Nanoparticle compositions for targeted delivery to cartilage and related methods

WO2026170199A2PCT designated stage Publication Date: 2026-08-13THE BRIGHAM & WOMEN S HOSPITAL INC +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2026-02-10
Publication Date
2026-08-13

Smart Images

  • Figure US2026014749_13082026_PF_FP_ABST
    Figure US2026014749_13082026_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure provides therapeutic matrix inverse targeting (MINT) nanoparticle including a MINT nanoparticle and a therapeutic material encapsulated in the MINT nanoparticle. The MINT nanoparticle includes a biocompatible polymer and an anionic coating. The disclosure further provides compositions including such a nanoparticle and methods of making such a nanoparticle or compositions. The disclosure further provides a method of treating an articular cartilage disease characterized by a decrease in glycosaminoglycan in extracellular matrix of articular cartilage using such a nanoparticle or composition.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] NANOPARTICLE COMPOSITIONS FOR TARGETED DELIVERY TO CARTILAGE AND RELATED METHODS

[0002] STATEMENT OF GOVERNMENT INTEREST

[0003] This invention was made with government support under contract 5R01AR077718-04 awarded by the National Institutes of Health. The government has certain rights in the inventions.

[0004] TECHNICAL FIELD

[0005] The present disclosure relates to compositions and methods for delivery of therapeutics to cartilage, such as articular cartilage, and related methods of manufacture and treatment.

[0006] BACKGROUND

[0007] Articular cartilage is located primarily at the end of bones, typically in joints, where bones interact with or touch one another. Degradation of or damage to articular cartilage can cause any a number of medical problems, often resulting in loss of joint mobility or pain. This is particularly true in the case of osteoarthritis, which occurs when articular cartilage at the ends of bones wears down, allowing the bones to contact one another in the affected joint. This contact between bones causes them to wear down over time, and also results in the pain, stiffness, and reduced mobility associated with osteoarthritis.

[0008] Despite being a very common medical condition, particularly in older individuals, there is no way to completely prevent osteoarthritis and, once it begins to develop, its progression is often controlled by only by rather untargeted interventions, such as weight loss or adopting low-impact exercise routines, or by administering general anti-inflammatory medications, such as steroids (e.g. cortisol) or non-steroidal anti-inflammatory drugs (e.g. ibuprofen, naproxen), that have limited benefits and, in the case of medications, often have unwanted side effects.

[0009] In many patients, osteoarthritis progresses to the point where quality of life is severely decreased, with the patient often unable to perform even basic activities, such as moving about their home, without facing serious pain. At this stage, the only option is replacement of the affected joint, such as a hip or kneejoint, which requires surgery, with all of its associated risks, and lengthy rehabilitation. For many patients, other medical conditions or the location of the affected joint prevents even surgical intervention, and the patient has no choice but to attempt to control their pain with medications and restricted movements.

[0010] Although less prevalent, other diseases affecting articular cartilage cause similar suffering for patients and have similarly risky or ineffective treatments.

[0011] Despite the clear need for better ways to prevent, better slow the progression of or, potentially, even remediate osteoarthritis and other articular cartilage diseases, effective treatments, other than surgical joint replacement, have not been developed.

[0012] SUMMARY

[0013] The disclosure provides the following embodiments, which may be combined with one another and with any other embodiments disclosed herein.

[0014] Embodiment 1 : A therapeutic matrix inverse targeting (MINT) nanoparticle comprising: a MINT nanoparticle comprising: a biocompatible polymer; and an anionic coating; and a therapeutic material encapsulated in the MINT nanoparticle.

[0015] Embodiment 2: The therapeutic MINT nanoparticle of embodiment 1, wherein the biocompatible polymer comprises poly(lactic-co-glycolic acid) (PLGA).

[0016] Embodiment 3 : The therapeutic MINT nanoparticle of embodiment 2, wherein the PLGA has a molecular weight in a range from 10 to 100 kDa.

[0017] Embodiment 4: The therapeutic MINT nanoparticle of embodiment 2 or embodiment 3, comprising PLGA in a concentration in a range from 2 to 50 mg / mL.

[0018] Embodiment 5: The therapeutic MINT nanoparticle of any one of embodiments 1-4, wherein the anionic coating comprises 1,2-dioleoyl-sn-gly cero-3 -phospho-L-serine (DOP S) .

[0019] Embodiment 6: The therapeutic MINT nanoparticle of embodiment 5, comprising DOPS in a concentration range from 50 to 500 pg / mL.

[0020] Embodiment 7: The therapeutic MINT nanoparticle of any one of embodiments 1 to 6, wherein the therapeutic MINT nanoparticle has a negative zeta potential in a range from -10 to -60 mV.Embodiment 8: The therapeutic MINT nanoparticle of any one of embodiments 1 to 7, wherein the MINT nanoparticle further comprises an ionizable liquid.

[0021] Embodiment 9: The therapeutic MINT nanoparticle of embodiment 8, wherein the ionizable liquid comprises one or more of: G0-C14, C12-200, DOTAP, SM102, DLinKC2DMA, DLinMC3DMA, ALC0315, cKK-E12, L319, FTT5, OF-C4-Deg-Lin, and any combinations thereof.

[0022] Embodiment 10: The therapeutic MINT nanoparticle of embodiment 8 or embodiment 9, wherein the therapeutic MINT nanoparticle comprises ionizable liquid and biocompatible polymer in a ratio range from 1 :3 to 1 : 12.

[0023] Embodiment 11 : The therapeutic MINT nanoparticle of any one of embodiments 1-10, wherein the therapeutic MINT nanoparticle further comprises a PEGylated lipid on an exterior surface.

[0024] Embodiment 12: The therapeutic MINT nanoparticle of embodiment 11, wherein the PEGylated lipid comprises l,2-distearoyl-sn-glycero-3-phosphoethanolamine-poly(ethylene glycol) (DSPE-PEG).

[0025] Embodiment 13: The therapeutic MINT nanoparticle of any one of embodiments 1-12, wherein the therapeutic material comprises a nucleic acid.

[0026] Embodiment 14: The therapeutic MINT nanoparticle of embodiment 13, wherein the nucleic acid comprises a small interfering ribonucleic acid (siRNA), messenger RNA (mRNA), self-amplifying RNA (saRNA), circular mRNA, microRNA (miRNA), or plasmid Deoxyribonucleic acid (pDNA).

[0027] Embodiment 15: The therapeutic MINT nanoparticle of embodiment 14, wherein the nucleic acid comprises mRNA in a concentration range from 0.1 to 10 pg / mL.

[0028] Embodiment 16: The therapeutic MINT nanoparticle of any one of embodiments 13-15, wherein the nucleic acid comprises a modified nucleotide.

[0029] Embodiment 17: The therapeutic MINT nanoparticle of any one of embodiments 13-16, wherein the modified nucleotide comprises N6-methyladenosine (m6A), 2'-O-methylation, pseudouridine, orNl-Methylpseudouridine.

[0030] Embodiment 18: The therapeutic MINT nanoparticle of any one of embodiments 13-17, wherein the nucleic acid encodes a protein comprising human ghrelin.Embodiment 19: The therapeutic MINT nanoparticle of any one of embodiments 13-18, wherein the nucleic acid encodes a protein having an amino acid sequence comprising SEQ ID NO: 1.

[0031] Embodiment 20: The therapeutic MINT nanoparticle of any one of embodiments 13-19, wherein the nucleic acid has a sequence comprising SEQ ID NO: 2.

[0032] Embodiment 21 : The composition comprising a therapeutic MINT nanoparticle of any one of embodiments 1-20 and a pharmaceutically acceptable carrier.

[0033] Embodiment 22: A method of treating an articular cartilage disease characterized by a decrease in glycosaminoglycan in extracellular matrix of articular cartilage, the method comprising administering to a patient having the articular cartilage disease a therapeutically effective amount of a therapeutic MINT nanoparticle of any one of embodiments 1-20 or a composition of embodiment 21.

[0034] Embodiment 23: The method of embodiment 22, further comprising administering the therapeutic MINT nanoparticle or the composition by injection into articular cartilage.

[0035] Embodiment 24: The method of embodiment 22 or embodiment 23, comprising administering the therapeutic MINT nanoparticle or composition once weekly.

[0036] Embodiment 25: The method of any one of embodiments 21-24, wherein the disease comprises an inflammatory or degenerative cartilage disease.

[0037] Embodiment 26: The method of any one of embodiments 21-25, wherein the disease comprises post-traumatic cartilage injury.

[0038] Embodiment 27: The method of any one of embodiments 21-25, wherein the disease comprises an arthritis disease.

[0039] Embodiment 28: The method of embodiment 27, wherein the disease comprises osteoarthritis.

[0040] Embodiment 29: The method of embodiment 27, wherein the disease comprises rheumatoid arthritis.

[0041] Embodiment 30: The use of a therapeutic MINT nanoparticle of any one of embodiments 1-20 or a composition of embodiment 21 in the formulation of a medicament for treatment of a disease characterized by decrease of glycosaminoglycan in extracellular matrix of articular cartilage.Embodiment 31 : The use according to embodiment 30, wherein the disease comprises osteoarthritis.

[0042] Embodiment 32: A kit comprising a therapeutic MINT nanoparticle according to any one of embodiments 1-20 or a composition of embodiment 21 and instructions for use according to any one of embodiments 22-30.

[0043] BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Some embodiments of the disclosure are described herein with reference to the accompanying figures. The description, together with the figures, makes apparent to a person having ordinary skill in the art how some embodiments of the disclosure may be practiced. The figures are for the purpose of illustrative discussion and details of embodiments that are not necessary for a fundamental understanding of the teachings of the disclosure may be omitted. The figures are not drawn to scale and where dimensions are provided, they are merely exemplary and do not limit the scope or spirit of the disclosed invention.

[0045] Fig- 1 shows a schematic diagram of MINT nanoparticle targeting and experiments to establish therapeutic effects of delivered mRNA encoding ghrelin (Ghr mRNA).

[0046] Fig. 2A shows representative images of porcine cartilage explants pretreated overnight with either PBS or chondroitinase (CDase), followed by toluidine blue staining and eosin red counterstaining.

[0047] Fig. 2B shows a graph of Zeta potential of poly(lactic-co-glycolic acid)(PLGA) nanoparticles coated with different concentrations of chitosan or l,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS). w = 4 sections, experiment performed at least twice.

[0048] Fig. 2C shows representative fluorescence microscopy images of sections from porcine cartilage pre-treated with either PBS (healthy control) or CDase (osteoarthritic-mimetic) for 6 hours, followed by 1 hour incubation with cationic or anionic nanoparticles encapsulating the fluorescent dye, Dil. n = 4-8 sections, experiment performed twice.

[0049] Fig. 2D shows a graph of quantification of Dil fluorescence intensity across cartilage sections. P values were determined using two-way ANOVA with Tukey’s post hoc analysis.

[0050] Fig. 2E shows representative fluorescence microscopy images of sections from porcine cartilage pre-treated with either PBS (healthy control) or trypsin(osteoarthritic-mimetic) for 6 hours, followed by 1 hour incubation with MINT nanoparticles encapsulating Dil.

[0051] Fig. 2F shows a graph of quantification of Dil fluorescence intensity across cartilage sections. Data are presented as Mean ± SD; n=4 sections, experiment performed at least twice. P value was determined using an unpaired Student’s t-test. **P<0.01.

[0052] Fig. 2G shows fluorescence intensity measured across sections of porcine cartilage pre-treated with PBS or CDase, followed by incubation with nanoparticles encapsulating Dil formulated with varying concentrations of DOPS. n = 7-8 explants, experiment performed twice. P values were determined using two-way ANOVA with Tukey’s post hoc analysis.

[0053] Fig. 2H shows representative fluorescence microscopy images of sections from porcine cartilage pre-treated with either PBS (healthy control) or chondroitinase (CDase, 1 U / mL) for 6 hours, followed by 1 hour incubation with MINT nanoparticles encapsulating DiL an formulated with varying concentration of DOPS (in pg / mL).

[0054] Fig. 21 shows representative in vivo imaging system (IVIS) images of whole porcine cartilage explants pre-treated with PBS or CDase, followed by incubation with cationic nanoparticles or MINT nanoparticles encapsulating 1’-dioctadecyl-3,3,3’,3’-tetramethylindotricarbocyanine iodide (DiR). n = 4 explants per treatment.

[0055] Fig. 2 J shows a graph of quantification of DiR fluorescence intensity over explants. P values were determined using two-way ANOVA with Tukey’s post hoc analysis.

[0056] Fig. 2K shows a graph of glycosaminoglycan content of porcine cartilage explants after 6 hours of treatment with PBS, with low concentrations of hyaluronidase (H, 0.1%) and CDase (C, 0.1 U mf1) (low), or high concentrations of H (0.3%) and C (1 U mb1) (high), n = 5-7 sections. P values were determined using one-way ANOVA.

[0057] Fig. 2L shows representative fluorescence microscopy images of sections obtained from porcine cartilage explants treated with MINT nanoparticles encapsulating Dil for 48 hours post-treatment with PBS or varying concentrations of hyaluronidase and CDase treatments. Arrows indicate the depth of penetration by nanoparticles. Scale bars, 100 pm. n = 5-7 sections.Fig. 2M shows a graph of quantification of the depth of Dil fluorescence signal. P values were determined using one-way ANOVA.

[0058] Fig. 2N shows optical and fluorescence microscopy images of representative sections from human osteoarthritic cartilage stained with Safranin O / Fast Green followed by incubation with MINT nanoparticles encapsulating Dil (Dil MINT NPs). Arrows point towards surface damage.

[0059] Fig. 20 shows representative images of sections from human healthy and osteoarthritic cartilage stained with Safranin O / Fast Green. Scale bars, 50 pm. Arrows point towards surface damage, n = 6-10 explants.

[0060] Fig. 2P shows a graph of Mankin scores indicating the extent of cartilage damage with max score = 14. P values were determined using an unpaired Student’s / -test.

[0061] Fig. 2Q shows fluorescence microscopy images of representative sections obtained from human healthy and osteoarthritic cartilage explants incubated with MINT nanoparticles encapsulating Dil for 48 hours. Arrows point to penetration depth of nanoparticles. Scale bars, 50 pm. n = 3 sections per NP.

[0062] Fig. 2R shows a graph of quantification of the depth of Dil fluorescence signal. P values were determined using two-way ANOVA with Tukey’s post hoc analysis.

[0063] Fig. 2S shows a schematic diagram of injection of cationic nanoparticles or MINT nanoparticles encapsulating Dil in the PIP joint of fingers obtained from a human osteoarthritic cadaveric donor (upper) along with a representative image of human finger joint cartilage sections stained with toluidine blue (lower). Scale bar, 100 pm.

[0064] Fig. 2T shows bright-field and fluorescence microscopy images of representative cartilage sections from human finger joints. Scale bars, 100 pm.

[0065] Fig. 2U shows a graph of quantification of the depth of Dil fluorescence signal. P values were determined using an unpaired Student’s / -test.

[0066] Fig. 2V shows MD simulation studies showing interaction of DOPS with cartilage extracellular matrix components: a) Collagen Type II b) Chondroitin sulfate c) Highly-N,0 sulfated glycosaminoglycan d) Lowly-N,O sulfated glycosaminoglycan e) Hyaluronic acid f) Keratan sulfate.

[0067] Fig. 3A shows a graph of luminescence signal in TC28a2 human chondrocyte cells 24 hours after treatment with medium alone or medium encapsulating MINT nanoparticles encapsulating Flue mRNA (Flue mRNANPs),formulated with varying ionizable lipids, n = 4 wells, experiment performed twice.

[0068] Fig. 3B shows a graph of in vitro luciferase expression 24 hours post treatment with MINT nanoparticles encapsulating Flue saRNA.

[0069] Fig. 3C shows a graph of luminescence signal in TC28a2 human chondrocyte cells24 hours after treatment with medium alone or medium encapsulating MINT nanoparticles encapsulating Flue mRNA (Flue mRNANPs), formulated with varying concentrations of DOPS. n = 4 wells, experiment performed twice.

[0070] Fig. 3D shows a graph of luminescence signal in TC28a2 human chondrocyte cells24 hours after treatment with medium alone or medium encapsulating MINT nanoparticles encapsulating Flue mRNA (Flue mRNANPs), formulated with varying weight ratios of ALC0315 to PLGA. n = 4 wells, experiment performed twice.

[0071] Fig. 3E shows a graph of percentage cell viability of TC28a2 cells treated for 24 hours, 48 hours or 72 hours with medium alone or medium containing MINT nanoparticles encapsulating Flue mRNA formulated with optimal DOPS concentration (150 pg mF1) and ALC0315 / PLGA weight ratio (1:6) and tested at varying mRNA concentrations, n = 6 wells, experiment performed twice.

[0072] Fig. 3F shows a graph of luminescence in TC28a2 cells treated with DSPE-PEG or DMG-PEG 2000 containing nanoparticles encapsulating different concentrations of Flue mRNA.

[0073] Fig. 3G shows a graph of luminescence in TC28a2 cells treated with PLGA-ester terminated or PLGA-Cholesterol terminated containing nanoparticles encapsulating different concentrations of Flue mRNA.

[0074] Fig. 3H shows a histogram of counts vs. B515 in TC28a2 cells treated with FITC-PLGA DOPS nanoparticles. DOPS was coated at three different concentration 25, 75, 150 pg / mL and uptake was quantified using flow cytometry. Media treated cells were used as control. Data shown as Mean±SEM. (n=3 per group).

[0075] Fig. 31 shows quantification showing % uptake of nanoparticles.

[0076] Fig. 3J shows histograms of count vs. GFP-A in cells 24 hours after treatment with MINT nanoparticles.

[0077] Fig. 3K shows a graph of cell viability. Media treated cells were used as positive control and PBS-treated as negative control.Fig. 3L shows a graph quantifying % GFP-high cells based on P2 gating. L2K stands for Lipofectamine 2000. Data shown as Mean±SEM (n=3 per group).

[0078] Fig. 3M shows representative confocal laser scanning microscopy images of TC28a2 cells treated for 3 hours with MINT nanoparticles encapsulating Cy5-tagged Scr mRNA and co-stained with Hoechst (nuclear stain) and LysoTracker Red DND-99 (endosomal marker). Scale bars, 20 pm.

[0079] Fig. 3N shows a graph of Eosin red intensity in porcine cartilage explants pre-treated with PBS or CDase. Cartilage explants were incubated for 6 hours with PBS or CDase (0.5-2 U / mL), then stained with toluidine blue, followed by eosin red. Eosin red intensity, indicative of glycosaminoglycan loss, was quantified using ImageJ software. Data represented as Mean ± SD; n=3 explants.

[0080] Fig. 30 shows IVIS images of representative whole porcine cartilage explants pre-treated for 6 hours with different concentrations of CDase, followed by 1 hour incubation with MINT nanoparticles encapsulating DiR / Scr mRNA. n = 9 sections from 3 mice per treatment.

[0081] Fig. 3P shows quantification of DiR fluorescence intensity over explants.

[0082] Fig. 3Q shows representative images of haematoxylin and eosin (H&E) (left) or Safranin O (right) -stained sections of mouse knee joints injected with MINT nanoparticles encapsulaing Flue mRNA or with PBS. Scale bars, 100 pm. n = 9 sections from 3 mice per treatment.

[0083] Fig. 3R shows representative images of TUNEL and DAPI co-stained sections of mouse knee joints. Scale bars, 100 pm.

[0084] Fig. 3S shows a graph quantifying percentage TUNEL-positive cells. P values were determined using an unpaired Student’s / -test. NS represents nonsignificant (P > 0.05).

[0085] Fig. 4A shows representative IVIS images showing luciferase expression as luminescence signals in the joints, captured at various time points.

[0086] Fig. 4B shows a graph of luminescence quantification in knee joints of mice at different time points, day 1 = 4 joints, days 2 and 3 = 6 joints.

[0087] Fig. 4C shows representative fluorescence images of MINT nanoparticles encapsulating Cy3 -tagged GFP mRNA 24 hours post-injection in 4 weeks post-ACLT knee joints. Representative images from cohort of 5 mice. Arrows show co-localization of Cy3 (red), GFP (green) and DAPI (blue) in vivo. Scale bars, 10 pm.Fig. 4D shows representative images of Safranin O-stained sections of mouse knee joints collected at week 2, 4 or 6 post-ACLT surgery. Two mice were used per time point for histological analysis. Scale bars, 200 pm.

[0088] Fig. 4E shows representative IVIS images showing luciferase expression as luminescence signals in healthy and ACLT joints of mice, captured at various time points post-surgery, week 2= 11 mice, week 4 = 9 mice, week 6 = 7 mice.

[0089] Fig. 4F shows a graph of luminescence flux ratio of the ACLT (right) knee to the healthy (left) knee (R / L ratio). P values were determined using oneway ANOVA followed by Tukey’s multiple comparison test.

[0090] Fig. 4G shows representative IVIS Images displaying luciferase expression in the knee joints across the experimental timeline (Days 1-18). The color scale indicates mean radiance intensity (arbitrary units, a.u.).

[0091] Fig. 4H shows a graph of quantitative analysis of total bioluminescence flux (Sum Intensity, a.u.) measured from the joint regions of interest (ROIs) over 18 days. Data points represent mean ± SEM (n=3 per time point).

[0092] Fig. 5A shows a graph of human ghrelin (Ghr) expression levels in the supernatant of TC28a2 human chondrocyte cells 24 hours after incubation with medium alone or medium containing MINT nanoparticles encapsulating human Ghr mRNA (Ghr mRNANPs). n = 3-4 wells, experiment repeated twice.

[0093] P values were determined using an unpaired Student’s Ltest.

[0094] Fig. 5B shows Ghr expression levels in mouse joints injected with PBS (left) or MIA (right), followed by injection of MINT nanoparticles encapsulating Ghr mRNA (2 pg mRNA per joint) on day 9. Ghr levels were measured at 1, 2 and 3 days post-NP injection, comparing both unmodified and Nl'P-modified versions of human Ghr mRNA. n = 5 mice per group P values were determined using two-way ANOVA with uncorrected Fisher’s least significant difference (LSD).

[0095] Fig. 5C shows representative immunofluorescence images of sections from healthy and ACLT joints of mice, showing mouse Ghr expression (red) with DAPI counterstaining (blue). Safranin O-stained sections are shown at the top to illustrate cartilage damage in the ACLT joint. Scale bars, 50 pm.

[0096] Fig. 5D shows a graph of ghrelin expression levels in kneww joints of mice subjected to ACLT surgery and injected with MINT nanoparticles encapsulating Ghr mRNA.Fig. 5E shows representative images of Safranin O / Fast Green-stained sections of ACLT joints from mice subjected to various treatments. The dashed box shows a closer view of cartilage damage (arrows). Scale bars, 100 pm.

[0097] Fig. 5F shows a graph of OARSI and ACS scores for cartilage from ACLT joints of mice subjected to different treatments. PBS = 9 mice, Scr mRNA NP = 10 mice, Ghr mRNANP = 15 mice. P values were determined using oneway ANOVA followed by Tukey’s multiple.

[0098] Fig. 5G shows representative images of Safranin O / Fast Green-stained sections of ACLT joints from mice subjected to various treatments, highlighting subchondral bone (SB) in the medial tibial plateau, indicated by larger dashed lines. Smaller dashed lines indicate the border of subchondral bone plate (SBP). Scale bars, 100 pm. PBS = 9 mice, Scr mRNANP = 10 mice, Ghr mRNA NP = 15 mice.

[0099] Fig. 5H shows a graph of the proportion of the area of the SBP to total area of SB. P values in g and h were determined using one-way ANOVA followed by Tukey’s multiple.

[0100] Fig. 51 shows representative immunofluorescence images of ACLT joint sections from mice treated with MINT nanoparticles enchapsulating Scr mRNA or Ghr mRNA, showing the expression of matrix metallopeptidase 13 (MMP13) (red), with DAPI counterstaining (blue). Scale bars, 50 pm.

[0101] Fig. 5 J shows representative immunofluorescence images of ACLT joint sections from mice treated with MINT nanoparticles enchapsulating Scr mRNA or Ghr mRNA, showing the expression of matrix metallopeptidase 3 (MMP3)(red), with DAPI counterstaining (blue). Scale bars, 50 pm.

[0102] Fig. 5K shows a graph quantifying MMP13 and MMP3 expression as integrated densities. MMP13, n = 9 sections obtained from 3 mice per group, MMP3, n = sections obtained from 3 mice in the Scr mRNANP group, n = 9 obtained from 3 mice in the Ghr mRNANP group. P values were determined using an unpaired Student’s / -test.

[0103] Fig. 6A shows a graph of withdrawal thresholds at weeks 5 and 6, reported in grams (g), for mice subjected to various treatments. P values were determined using one-way ANOVA followed by Tukey’s multiple comparison test.

[0104] Fig. 6B shows a graph of the ratio of withdrawal threshold of the ACLT (right) knee to the healthy unoperated (left) knee (R / L ratio) at weeks 5 and 6 formice subjected to various treatments. P values were determined using one-way ANOVA followed by Tukey’s multiple comparison test.

[0105] Fig. 6C shows representative immunofluorescence images of dorsal root ganglion (DRG) sections from mice treated with PBS or MINT nanoparticles encapsulating Ghr mRNA showing TRPV1 -positive neurons (red, indicated by white arrows) counterstained with NeuN (green). Scale bars, 50 pm.

[0106] Fig. 6D shows representative immunofluorescence images of dorsal root ganglion (DRG) sections from mice treated with PBS or MINT nanoparticles encapsulating Ghr mRNA showing CGRP -positive neurons (red, indicated by white arrows) counterstained with NeuN (green). Scale bars, 50 pm.

[0107] Fig. 6E shows a graph quantifying the percentage of TRPV1- or CGRP-positive neurons, n = 9 sections from 3 mice. P values i were determined using an unpaired Student’s / -test.

[0108] Fig. 7A shows a graph of Von Frey pain analysis results based on withdrawal threshold (g) of ZMPSTE24- / - mice injected with MINT nanoparticles encapsulating Ghr mRNA or MINT nanoparticles encapsulating Scr mRNA. n=5-7 mice / treatment.

[0109] Fig. 7B shows representative Safranin O images for each treatment. n=5-6 mice / treatment.

[0110] Fig. 7C shows graphs of histological scores of OARSI (left) and Synovial inflammation (right).

[0111] Fig. 7D shows representative immunofluorescence image for pl 6. n=9-l 1 sections from 3 mice / treatment.

[0112] Fig. 7E shows a graph quantifying results for p 16.

[0113] In all figures, P < 0.05 was considered statistically significant. All graphical data with + / - are presented as mean± s.e.m.

[0114] DETAILED DESCRIPTION

[0115] The present disclosure relates to therapeutic matrix inverse targeting (MINT) nanoparticles that include MINT nanoparticles encapsulating a therapeutic material, typically one or more nucleic acids or other therapeutically active materials. The therapeutic MINT nanoparticles, when administered to articular cartilage (sometimes referred to herein simply as cartilage), deliver the material encapsulated to cells in the articular cartilage. In some embodiments where the material includes a nucleic acid, this causes one or more protein to beexpressed from the nucleic acid in the cartilage. In embodiments where the material includes a different type of therapeutically active material, this allows the material to be released into an environment such that therapeutic activity can occur. This may include intracellular or extracellular environments.

[0116] The present disclosure also includes pharmaceutical compositions including therapeutic MINT nanoparticles, methods of making such therapeutic MINT nanoparticles or pharmaceutical compositions, methods of delivering nucleic acids or other materials to articular cartilage using the therapeutic MINT nanoparticles, and methods of treating osteoarthritis or other articular cartilage diseases using the therapeutic MINT nanoparticles or pharmaceutical compositions.

[0117] In some embodiments, the therapeutic MINT nanoparticles may deliver the nucleic acids or other materials preferentially to cartilage damaged by osteoarthritis, also often referred to as osteoarthritis lesions, with limited delivery to unaffected and healthy articular cartilage or other tissues. Furthermore, in some embodiments, the therapeutic MINT nanoparticles may deliver the nucleic acids or other materials in a disease-severity-responsive manner.

[0118] As osteoarthritis progresses, more damage to the articular cartilage results in greater glycosaminoglycan loss, which decreases the negative charge of the articular cartilage damaged articular cartilage, particularly the extracellular matrix of the damaged articular cartilage. This, in turn, causes reduced electrostatic repulsion between MINT nanoparticles and the damaged articular cartilage. Articular cartilage that has suffered greater damage and greater glycosaminoglycan loss will have a lower negative charge than less damaged articular cartilage and will, therefore attract and accumulate more of the therapeutic MINT nanoparticles. This may manifest as effectively increased dosing in joints and tissues with more advanced osteoarthritis and also in regions within a given joint or tissue with more osteoarthritis-related damage. In both instances, this damage-responsive property of the therapeutic MINT nanoparticles improves treatment efficacy by targeting delivery of the nucleic acid to areas most in need of treatment, and by ensuring that delivery is increased in more severe disease.

[0119] Although the present disclosure focuses on osteoarthritis as an example disease, the therapeutic MINT nanoparticles disclosed herein may also be used to treat other forms of arthritis, such as rheumatoid arthritis, and other diseasescharacterized by glycosaminoglycan loss in cartilage, such as post-traumatic cartilage injury or other inflammatory or degenerative cartilage conditions. In some embodiments, the nucleic acid in the MINT nanoparticle is delivered to a cell in or near the damaged articular cartilage or joint and is expressed in the cell to produce a therapeutic protein or polypeptide.

[0120] In some embodiments, the nucleic acid may encode an anabolic, anti-catabolic, anti-inflammatory, regenerative, or gene-modulating nucleic acid.

[0121] In some embodiments, the therapeutic protein or polypeptide includes ghrelin. Ghrelin is a 28 amino acid peptide hormone with diverse biological effects. Ghrelin is expressed in cartilage, where it exhibits anti-inflammatory effects, attenuates neuropathic pain resulting from damage to articular cartilage, and inhibits inflammation-induced cartilage damage by maintaining cartilage integrity. However, due to the small size of ghrelin, it is easily cleared.

[0122] Embodiments of the present disclosure allow extended and continuous production of ghrelin by the patient's own cells, avoiding the problems of rapid clearance after single injections of the protein.

[0123] Selected Definitions

[0124] Prior to setting forth this disclosure in more detail, it may be helpful to an understanding thereof to provide definitions of certain terms to be used herein. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which this invention belongs. Additional definitions are set forth throughout this disclosure.

[0125] In the present description, any concentration range, percentage range, ratio range, or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated. Also, any number range recited herein relating to any physical feature, such as dose, are to be understood to include any integer within the recited range, unless otherwise indicated. As used herein, the term "about" means ± 20% of the indicated range, value, or structure, unless otherwise indicated.

[0126] It should be understood that the terms "a" and "an" as used herein refer to "one or more" of the enumerated components. The use of the alternative (e.g., "or") should be understood to mean either one, both, or any combination thereof of the alternatives.As used herein, the terms "include," "have," and "comprise" are used synonymously, which terms and variants thereof are intended to be construed as non-limiting.

[0127] The term "consisting essentially of limits the scope of a claim to the specified materials or steps, or to those that do not materially affect the basic characteristics of a claimed invention. For example, a protein domain, region, or module (e.g., a binding domain, hinge region, linker module) or a protein (which may have one or more domains, regions, or modules) "consists essentially of a particular amino acid sequence when the amino acid sequence of a domain, region, or module or protein includes extensions, deletions, mutations, or any combination thereof (e.g., amino acids at the amino- or carboxy-terminus or between domains) that, in combination, contribute to at most 20% (e.g., at most 15%, 10%, 8%, 6%, 5%, 4%, 3%, 2%, or 1%) of the length of a domain, region, or module or protein and do not substantially affect (i.e., do not reduce the activity by more than 50%, such as no more than 40%, 30%, 25%, 20%, 15%, 10%, 5%, or 1%) the activity of the domain(s), region(s), module(s), or protein (e.g., the target binding affinity of a binding protein).

[0128] For a therapeutic nanoparticle, nucleic acid delivered via nanoparticle, composition containing a therapeutic nanoparticle, or protein expressed from a nucleic acid delivered via nanoparticle, a "therapeutically effective amount" or "effective amount" of refers to an amount of the composition sufficient to result in a "therapeutic effect," including improved clinical outcome; lessening or alleviating of symptoms associated with a disease; decreased occurrence of symptoms; improved quality of life; diminishment of extent of disease, stabilization of disease state; delay of disease progression; decreased or delayed cartilage degeneration; decreased or delayed subchondral bone thickening; decreased or delayed nociceptive pain; or decreased sensory neuron excitation in joint-innervating dorsal root ganglia in a statistically significant manner.

[0129] “Treat” or “treatment” refers to medical management of a disease, disorder, or condition of a patient e.g., a human or non-human mammal, such as a primate, horse, cat, dog, goat, mouse, or rat). In general, an appropriate dose or treatment regimen comprising a therapeutic nanoparticle is administered in an amount sufficient to elicit a therapeutic effect.

[0130] The term "nucleic acid" refers to any form of DNA or RNA, including double-stranded and single-stranded molecules, unless otherwise specified.Additionally, such molecules may have various structures, such as hairpin or doggybone conformations, unless otherwise specified. Furthermore, nucleic acids may include one or more modified nucleotides. A “modified nucleotide” refers to a nucleotides having a modification on the sugar (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or in the phosphate groups (e.g., phosphorothioates and 5'-N-phosphoramidite linkages); and / or in the nucleotide base. Examples of modified nucleotides include N6-methyl-adenosine (m6A), 1-methyl-adenosine (nriA), 5-methyl-cytidine (m5C), 5-hydroxymethyl-cytidine (hm5C), N4-acetyl-cytidine (ac4C), 5-methoxycytidine (mo5C), 4-thiouridine (S4U), 2-thiouridine (S2U), pseudouridine (y), ISf-methyl-pseudouridine (nriy), 5-methyluridine (m5U), and 5- methoxyuridine (mo5U).

[0131] As used herein, "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, y-carboxyglutamate, and O-phosphoserine. Amino acid analogs refer to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an a-carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refer to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.

[0132] As used herein, "mutation" refers to a change in the sequence of a nucleic acid molecule or polypeptide molecule as compared to a reference or wild-type nucleic acid molecule or polypeptide molecule, respectively. A mutation can result in several different types of change in sequence, including substitution, insertion or deletion of nucleotide(s) or amino acid(s).

[0133] A "conservative substitution" refers to amino acid substitutions that do not significantly affect or alter binding characteristics of a particular protein. Generally, conservative substitutions are ones in which a substituted amino acid residue is replaced with an amino acid residue having a similar side chain.

[0134] Conservative substitutions include a substitution found in one of the followinggroups: Group 1: Alanine (Ala or A), Glycine (Gly or G), Serine (Ser or S), Threonine (Thr or T); Group 2: Aspartic acid (Asp or D), Glutamic acid (Glu or Z); Group 3: Asparagine (Asn or N), Glutamine (Gin or Q); Group 4: Arginine (Arg or R), Lysine (Lys or K), Histidine (His or H); Group 5: Isoleucine (He or I), Leucine (Leu or L), Methionine (Met or M), Valine (Vai or V); and Group 6: Phenylalanine (Phe or F), Tyrosine (Tyr or Y), Tryptophan (Trp or W).

[0135] Additionally or alternatively, amino acids can be grouped into conservative substitution groups by similar function, chemical structure, or composition (e.g., acidic, basic, aliphatic, aromatic, or sulfur-containing). For example, an aliphatic grouping may include, for purposes of substitution, Gly, Ala, Vai, Leu, and He. Other conservative substitutions groups include: sulfur-containing: Met and Cysteine (Cys or C); acidic: Asp, Glu, Asn, and Gin; small aliphatic, nonpolar or slightly polar residues: Ala, Ser, Thr, Pro, and Gly; polar, negatively charged residues and their amides: Asp, Asn, Glu, and Gin; polar, positively charged residues: His, Arg, and Lys; large aliphatic, nonpolar residues: Met, Leu, He, Vai, and Cys; and large aromatic residues: Phe, Tyr, and Trp. Additional information can be found in Creighton (1984) Proteins, W.H. Freeman and Company.

[0136] As used herein, "protein" or "polypeptide" refers to a polymer of amino acid residues. Proteins apply to naturally occurring amino acid polymers, as well as to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, and non-naturally occurring amino acid polymers. Variants of proteins, peptides, and polypeptides of this disclosure are also contemplated. In certain embodiments, variant proteins, peptides, and polypeptides comprise or consist of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identical to an amino acid sequence of a defined or reference amino acid sequence as described herein.

[0137] "Percent sequence identity" refers to a relationship between two or more sequences, as determined by comparing the sequences. Preferred methods to determine sequence identity are designed to give the best match between the sequences being compared. For example, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment). Further, non-homologous sequences may be disregarded for comparison purposes. The percent sequence identity referenced herein is calculated over the length of thereference sequence, unless indicated otherwise. Methods to determine sequence identity and similarity can be found in publicly available computer programs. Sequence alignments and percent identity calculations may be performed using a BLAST program (e.g, BLAST 2.0, BLASTP, BLASTN, or BLASTX). The mathematical algorithm used in the BLAST programs can be found in Altschul et al., Nucleic Acids Res. 25:3389-3402, 1997. Within the context of this disclosure, it will be understood that where sequence analysis software is used for analysis, the results of the analysis are based on the "default values" of the program referenced. "Default values" mean any set of values or parameters which originally load with the software when first initialized, however, filtering may not be used in connection with low complexity regions.

[0138] A "functional variant" refers to a polypeptide that is structurally similar or substantially structurally similar to a parent or reference compound of this disclosure, but differs slightly in composition (e.g., one base, atom or functional group is different, added, or removed), such that the polypeptide is capable of performing at least one function of the parent polypeptide with at least 50% efficiency (i.e. level of activity of the parent polypeptide), preferably at least 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% efficiency. In other words, a functional variant of a polypeptide of this disclosure has "similar binding," "similar affinity" or "similar activity" when the functional variant displays no more than a 50% reduction in performance in a selected assay as compared to the parent or reference polypeptide, such as an assay for measuring binding affinity (e.g., Biacore™ (Cytiva) or tetramer staining measuring an association (Ka) or a dissociation (KD) constant).

[0139] As used herein, a "functional portion" or "functional fragment" refers to a polypeptide or polynucleotide that comprises only a domain, portion or fragment of a parent or reference compound, and the polypeptide or encoded polypeptide retains at least 50% efficiency (i.e. level of activity of the parent polypeptide) associated with the domain, portion or fragment of the parent or reference compound, preferably at least 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% efficiency of the parent polypeptide, or provides a biological benefit (e.g., effector function).

[0140] A protein or polypeptide "encoded" by a nucleic acid includes the polypeptide as initially translated, as well as post-translationally -modified versions, such as shortened versions with a leader sequence.As used herein a "therapeutic MINT nanoparticle" may comprise, consist essentially of, or consist of a MINT nanoparticle encapsulating a nucleic acid. According to some embodiments, the therapeutic MINT nanoparticle may further have a negative surface charge under physiological conditions. In more specific embodiments, the therapeutic MINT nanoparticle may have a negative surface charge in physiological conditions present in damaged cartilage, particularly cartilage in which glycosaminoglycan has been depleted.

[0141] As used herein, "delivery" or "deliver" refers to the movement of a nucleic acid or other material out of a MINT nanoparticle and into an area where it can exert a therapeutic effect. In some embodiments, delivery may include release of the nucleic acid or other material into an extracellular area. In some embodiments, particularly this in which the therapeutic MINT nanoparticle encapsulates a nucleic acid, during delivery, the nucleic acid or material may move from the MINT nanoparticle into a cell, such as a cell able to express a protein or polypeptide from the nucleic acid, to transfect the cell. In some embodiments in which the MINT nanoparticle encapsulates multiple copies of the nucleic acid or other material, delivery may not require this movement of all copies of the nucleic acid or other material. Movement of enough copies to exert a therapeutic effect is sufficient to constitute delivery.

[0142] Therapeutic Compositions

[0143] According to some embodiments, the disclosure provides therapeutic MINT nanoparticles comprising, consisting essentially of, or consisting of a MINT nanoparticle encapsulating a nucleic acid or other material. In more specific embodiments, the material encapsulated is a nucleic acid, particularly a RNA.

[0144] In some embodiments, the therapeutic MINT nanoparticle has an exterior charge that increases its affinity for articular cartilage lesions, particularly osteoarthritic lesions, as compared to healthy or non-osteoarthritic cartilage. In particular, the therapeutic MINT nanoparticle may have an exterior charge that increases its affinity for articular cartilage with decreased negative charge due to glycosaminoglycan loss, which increases as osteoarthritis progresses.

[0145] In some embodiments, the therapeutic MINT nanoparticle comprises one or more biocompatible polymers selected from: Poly(lactic-co-glycolic acid) (PLGA), Ester-terminated PLGA, Acid-terminated PLGA, poly(lactic acid)(PLA), poly(glycolic acid) (PGA), polycaprolactone (PCL), poly(s-caprolactone-co-lactide), poly(s-caprolactone-co-glycolide), polyethylene glycol) (PEG), poly(ethylene oxide) (PEO), polyethylenimine (PEI) and polypropylenimine (PPI), polypropylene glycol) (PPG), polyvinyl alcohol (PVA), poloxamers (Pluronic®, Poloxamine), poly(ortho esters), poly(hydroxybutyrate) (PHB), poly(hydroxyvalerate) (PHV), poly(hydroxybutyrate-co-hydroxyvalerate) (PHBV), poly(glycerol sebacate) (PGS), poly(sebacic acid), poly(D,L-lactide-co-trimethylene carbonate), poly(malic acid), poly(dioxanone), poly(trimethylene carbonate) (PTMC), chitosan, hyaluronic acid (HA), alginate, dextran, gelatin, collagen, starch, pectin, pullulan, cellulose and its derivatives such as hydroxypropyl methylcellulose (HPMC), xanthan gum, carboxymethylcellulose (CMC), poly(ethyleneimine) (PEI), poly(L-lysine) (PLL), poly(amidoamine) (PAMAM) dendrimers, poly(beta-amino esters) (PBAE), poly(vinyl pyrrolidone) (PVP), poly(methacrylic acid) (PMAA), poly(acrylic acid) (PAA), poly(2-hydroxyethyl methacrylate) (PHEMA), poly(4-vinylbenzoic acid), poly(N-isopropyl acrylamide) (PNIPAM), poly(methyl methacrylate) (PMMA), poly(N-vinylcaprolactam) (PNVCL), poly(2-oxazoline), poly(carbonates), poly(phosphazenes), poly(urethane), poly(siloxane), poly(D,L-lactide-co-glycolide)-poly(ethylene glycol) (PLGA-PEG), DMG-PEG (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-PEG), DSPE-PEG (l,2-distearoyl-sn-glycero-3-phosphoethanolamine-PEG), Cholesterol PEG, PEG-Ceramide, methoxyterminated PEG, Hydroxy -terminated PEG, PEGylated chitosan, PEGylated poly(P-amino esters), PEGylated poly(lysine), PEGylated dendrimers, PEGylated polyphosphazenes, PEGylated poly(carbonates), and any combinations thereof.

[0146] In some embodiments, the therapeutic MINT nanoparticle comprises of poly(lactic-co-glycolic acid) (PLGA). In some embodiments the PLGA may have a molecular weight in range from any two of 10, 20, 50, and 100 kDa.

[0147] In some embodiments, the PLGA concentration in the therapeutic MINT nanoparticle or in the MINT nanoparticle is at least 2 mg / mL, or in a range from 2 mg / mL to 5, 10, 20, or 50 mg / mL.

[0148] In some embodiments, in addition to a polymer, the therapeutic MINT nanoparticle comprises one or more anionic coatings selected from:

[0149] phospholipids and lipid derivatives such as l,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS), l,2-distearoyl-sn-glycero-3-phospho-L-serine (DSPS), l,2-dioleoyl-sn-glycero-3 -phosphoethanolamine (DOPE), 1,2-dioleoyl-sn-glycero-3 -phosphate (DOPA), l,2-dipalmitoyl-sn-glycero-3 -phosphate (DPP A), l,2-dioleoyl-sn-glycero-3 -phosphoglycerol (DOPG), 1,2-dimyristoyl-sn-glycero-3 -phosphoglycerol (DMPG), 1 ,2-dipalmitoyl-sn-glycero-3 -phosphoglycerol (DPPG), l,2-dioleoyl-sn-glycero-3 -sulfate (DOPSul), 1,2-dioleoyl-sn-glycero-3 -citrate (DO-Citrate), phosphatidic acid (PA), phosphatidyl serine (PS);

[0150] polysaccharides and natural anionic biopolymers such as hyaluronic acid (HA), alginate, pectin, dextran sulfate, chondroitin sulfate, carrageenan, heparin, xanthan gum, carboxymethyl cellulose (CMC), polyuronic acid, fucoidan;

[0151] synthetic anionic polymers such as poly(acrylic acid) (PAA), poly (methacrylic acid) (PMAA), poly (styrene sulfonate) (PSS), poly (vinyl sulfate), poly(glutamic acid) (PGA), poly(aspartic acid) (PAAsp), poly(itaconic acid), poly(maleic acid), poly(sulfonic acid);

[0152] anionic surfactants and amphiphilic molecules such as sodium dodecyl sulfate (SDS), dioctyl sulfosuccinate sodium salt (AOT), sodium cholate, sodium deoxycholate, and sodium lauryl sulfate (SLS);

[0153] inorganic anionic coatings such as silica, silicate nanoparticles, phosphate-coated nanoparticles, polyoxometalates, graphene oxide derivatives;

[0154] and any combinations thereof.

[0155] In some embodiments, the anionic coating comprises, consists essentially of, or consists of a polymer, lipid, or surfactant.

[0156] In some embodiments, the anionic coating comprises, consists essentially of, or consists of DOPS. In some embodiments, the DOPS is present at a concentration in a range from any two of 50, 75, 200, 300, and 500 pg / mL.

[0157] In some embodiments, the anionic coating is present at a concentration sufficient to impart a net negative zeta potential to the therapeutic MINT nanoparticles in a range from any two of -10 mV, - 20m V, -30 mV, -40 mV, -50 mV and -60 mV, more particularly in a range from -20 mV to -60 mV, in physiological medium.

[0158] In some embodiments, the therapeutic MINT nanoparticle includes a MINT nanoparticle that comprises, consists essentially of, or consists of one or more polymers and one or more anionic coatings. In some embodiments, the MINT nanoparticle comprises, consists essentially of, or consists of PLGA and DOPS.In some embodiments, the MINT nanoparticle may comprise, consist essentially of, or consist of a MINT nanoparticle as described in the Examples. In some embodiments, the MINT nanoparticle may comprise, consist essentially of, or consist of a nanoparticle having the same materials as a MINT nanoparticle as described in the Examples, in an amount in a range from any two of + or - 1%, 2%, 5%, or 10% of the amount described in the Examples.

[0159] In some embodiments, the therapeutic MINT nanoparticle may lack moieties, other than an anionic coating, that target the nanoparticles to articular cartilage lesions. For example, the therapeutic MINT nanoparticle may lack antibodies that bind to antigens in articular cartilage lesions or ligands for receptors expressed in articular cartilage lesions.

[0160] In some embodiments, the therapeutic MINT nanoparticle may comprise one or more ionizable lipids selected from: DLin-MC3-DMA, SM-102, ALC-0315, C12-200, DODAP, DLin-KC2-DMA, DOTAP, DODMA, G0-C14, DLinDMA, C14-4, 0-DMA, DLin-DMA, OF-02, Lipid 5, PEGylated DOPE, PEGylated DODMA, PEGylated SM-102, PEGylated ALC-0315, PEGylated DLin-KC2-DMA, BHEM-Chol, BC14, iPhos lipids, SS-02, TT3, CL4H6, C16-4, DODAG, GQ-16, cKK-E12, L319, FTT5, OF-C4-Deg-Lin, zwitterionic ionizable lipids, Heptatriaconta-6,9,28,31-tetraen- 19-yl 4-(dimethylamino)butanoate, [(4-hydroxybutyl)azanediyl]bis(hexane-6, 1 -diyl)bis(2-hexyldecanoate), l,l'-[[2-[4-[2-[2-[bis(2-hydroxydodecyl)amino]ethylamino]ethyl]-l-piperazinyl]ethyl]imino]bis-2-dodecanol, 2-[2,2-bis[(9Z,12Z)-octadeca-9,12-dienyl]-l,3-dioxolan-4-yl]-N,N-dimethylethanamine, 2,2-dilinoleyl-4-dimethylaminoethyl-[l,3]-dioxolane, 1,2-dioleoyl-3-trimethylammonium-propane, l,2-dioleoyl-3 -dimethylammonium propane, hydroxy-terminated ionizable lipid, N,N-Di(2-hexyldecyl)aminobutyric acid, biodegradable cationic lipid with C14 chains, disulfide-encapsulating ionizable lipid, biodegradable lipid with tunable charge properties, custom lipids optimized for RNA delivery, ionizable lipids with 16-carbon tails, 1,2-Dioleoyl-3 -dimethylammonium propane-glycine, lipids with optimized branching for RNA delivery, other emerging ionizable lipids designed to reduce immunogenicity and enhance nucleic acid encapsulation efficiency, and any combinations thereof.

[0161] In some embodiments, the ionizable lipid may be one or more ionizable lipids selected from G0-C14, C12-200, DOTAP, SM102, DLinKC2DMA,DLinMC3DMA, ALC0315, cKK-E12, L319, FTT5, 0F-C4-Deg-Lin, or any combinations thereof.

[0162] In some embodiments, the ionizable lipid (or total ionizable lipids, if two or more are present) is present in a ratio of ionizable lipid:biocompatible polymer in a range from 1 :3 tol : 12.

[0163] In some embodiments, an ionizable lipid may facilitate complexing of the MINT nanoparticle with the encapsulated nucleic acid, allowing for more efficient manufacturing of the therapeutic MINT nanoparticle.

[0164] In some embodiments, the ionizable lipid may reduce immunogenicity of the therapeutic MINT nanoparticle.

[0165] In some embodiments, the therapeutic MINT nanoparticle may comprise an ionizable lipid as described in the Examples. In some embodiments, the therapeutic anionic nanoparticle may comprise an ionizable lipid as described in the exampled, in an amount in a range from any two of + or - 1%, 2%, 5%, or 10% of the amount described in the Examples.

[0166] In some embodiments, the therapeutic MINT nanoparticle may comprise a PEGylated lipid on their surface, such as l,2-distearoyl-sn-glycero-3-phosphoethanolamine-poly(ethylene glycol) (DSPE-PEG).

[0167] In some embodiments, particularly embodiments in which the therapeutic material encapsulated by the MINT nanoparticle is not a nucleic acid, the therapeutic MINT nanoparticle may lack an ionizable lipid.

[0168] In some embodiments, the material encapsulated by the MINT nanoparticle may comprise, consist essentially of, or consist of a therapeutic material that has exhibits an anabolic, anti-catabolic, anti-inflammatory, regenerative, or gene-modulating effect, particularly in cartilage.

[0169] In some embodiments, the therapeutic material encapsulated by the MINT nanoparticle may comprise, consist essentially of, or consist of therapeutic a nucleic acid.

[0170] In some embodiments, the nucleic acid may comprise, consist essentially of, or consist of a single-stranded RNA (ssRNA). In some embodiments, the nucleic acid may comprise, consist essentially of, or consist of messenger RNA (mRNA), which may be circular mRNA. In some embodiments, the RNA may comprise, consist essentially of, or consist of self-amplifying RNA (saRNA). saRNA may comprise, in addition to a sequence encoding the protein to be expressed, sequences for RNA replication or amplification proteins, allowing theRNA to be self-amplifying. In some embodiments, the RNA may comprise, consist essentially of, or consist of small interfering RNA (siRNA). In some embodiments, the RNA may comprise, consist essentially of, or consist of microRNA (miRNA).

[0171] In some embodiments, the therapeutic MINT nanoparticle may comprise mRNA in a concentration range from any two of 0.05, 0.1, 1, 2, 5, 10, 20, 25, 50, 75, and 100 pg / mL, particularly in a concentration range from 0.1 to 100, 1-100, 25-100, 25-75, 25-50, or 50-75 pg / mL. In some embodiments, the MINT nanoparticle may comprise mRNA in a concentration range sufficient to provide a human-appropriate dose in a volume sufficiently small to allow injection into a joint, particularly into articular cartilage.

[0172] In some embodiments, the RNA may comprise one or more modified nucleotides. In some embodiments, the one or more modified nucleotides may be selected from: N6-methyladenosine (m6A), 2'-O-methylation, pseudouridine, N1 -Methylpseudouridine, and any combinations thereof.

[0173] In some embodiments, the RNA may comprise one or more antidegradation features, such as a cap.

[0174] In some embodiments, the nucleic acid comprises DNA, which may be double-stranded (dsDNA), single-stranded (ssDNA, of which cDNA is an example). In some embodiments, the DNA may comprise, consist essentially of, or consist of plasmid DNA (pDNA).

[0175] In some embodiments, the therapeutic MINT nanoparticle may comprise a plurality of copies of the nucleic acid. This number of copies may be in a range from any of 1, 5, 10, 20, 50, 100, and 200.

[0176] In some embodiments, the therapeutic MINT nanoparticle may comprise two or more different nucleic acids having different sequences. For example, the MINT nanoparticle may encapsulate a first nucleic acid that encodes a therapeutic protein and a second nucleic acid that facilitates the therapeutic effect of the therapeutic protein. The second nucleic acid may, for example, assist with amplification of the first nucleic acid, or perform a gene editing function.

[0177] In some embodiments, the therapeutic MINT nanoparticle comprises a nucleic acid, particularly an RNA that encodes ghrelin protein, particularly human ghrelin, or a functional fragment thereof. In some embodiments, the nucleic acid may encode a protein having an amino acid sequence comprising, consisting essentially of, or consisting of:GSSFLSPEHQRVQQRKESKKPPAKLQPR (SEQ ID NO: 1).

[0178] In some embodiments, the nucleic acid may encode a protein having an amino acid sequence comprising, consisting essentially of, or consisting of a sequence having at least 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 1. In some embodiments, such protein may have one or more conservative substitutions with respect to SEQ ID NO: 1.

[0179] In some embodiments, the nucleic acid may have a sequence comprising, consisting essentially of, or consisting of:

[0180] AGTTCCCCAAAGATAACACAGCTTTGCACAGTGGATGTTTACTTGCTG GTGGTCTTATCTAAGATCAACATTGGCAGCTGTGCCCGGAGAGGCCTC CAGGGTCCAGGGCCATGCCCACTTGGGGCACCCCGCCACCGTGTTCC AGGGACAGCTGGAGCACATGCTTCTTCCCTCGCCAACCCAGCAATTCC GCAGGGCATCTGACCTCCACTGTTGACTTCTACCCAGAGGACAAGAA CATTTTTAGTTCCCAAGGAATGTACATCAGCCCCACGGAAGCTAGGCC ACCTCTGGGATGGGGTTGCTGGTTTAGAACAAACGCCAGTCATCCTAT ATAAGGACCTGACAGCCACCAGGCACCACCTCCGCCAGGAACTGCAG GCCCACCTGTCTGCAACCCAGCTGAGGCCATGCCCTCCCCAGGGACC GTCTGCAGCCTCCTGCTCCTCGGCATGCTCTGGCTGGACTTGGCCATG GCAGGCTCCAGCTTCCTGAGCCCTGAACACCAGAGAGTCCAGAGAAA GGAGTCGAAGAAGCCACCAGCCAAGCTGCAGCCCCGAGCTCTAGCAG GCTGGCTCCGCCCGGAAGATGGAGGTCAAGCAGAAGGGGCAGAGGA TGAACTGGAAGTCCGGTTCAACGCCCCCTTTGATGTTGGAATCAAGCT GTCAGGGGTTCAGTACCAGCAGCACAGCCAGGCCCTGGGGAAGTTTC TTCAGGACATCCTCTGGGAAGAGGCCAAAGAGGCCCCAGCCGACAAG TGATCGCCCACAAGCCTTACTCACCTCTCTCTAAGTTTAGAAGCGCTC ATCTGGCTTTTCGCTTGCTTCTGCAGCAACTCCCACGACTGTTGTACA AGCTCAGGAGGCGAATAAATGTTCAAACTGTATGCTGATGTTCCAAA TGGGAATTTATTTCAAAGAGGAAAAGTTAATATTTTACTTTAAAAAAA TCAAAATAATACAAATAAAAA (SEQ ID NO: 2).

[0181] In some embodiments, the nucleic acid may have a sequence comprising, consisting essentially of, or consisting of a sequence having at least 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 2. In some embodiments, such sequence may encode a protein having SEQ ID NO: 1 or one or more conservative substitutions with respect to SEQ ID NO: 1.In some embodiments, the therapeutic MINT nanoparticle may comprise a different nucleic acid encoding another protein useful in the treatment of osteoarthritis. In some embodiments, the nucleic acid may encode one or more proteins, particularly human proteins, selected from: hyaluronic acid, glucosamine, chondroitin sulfate, methyl sulfonylmethane (MSM), diacerein, curcumin, resveratrol, celecoxib, ibuprofen, naproxen, indomethacin, dexamethasone, betamethasone, triamcinolone acetonide, rapamycin, tacrolimus, sirolimus, everolimus, methotrexate, tofacitinib, baricitinib, ruxolitinib, adalimumab, infliximab, etanercept, golimumab, certolizumab pegol, secukinumab, ixekizumab, brodalumab, ustekinumab, guselkumab, risankizumab, anakinra, canakinumab, tocilizumab, sarilumab, abatacept, filgotinib, upadacitinib, hydroxychloroquine, sulfasalazine, leflunomide, cyclosporine, apremilast, pentosan polysulfate, doxycycline, minocycline, strontium ranelate, parathyroid hormone analogs, bone morphogenetic proteins (BMP-2, BMP-7), fibroblast growth factor-18 (FGF-18), transforming growth factor-beta (TGF-P), platelet-derived growth factor (PDGF), vascular endothelial growth factor (VEGF), insulin-like growth factor- 1 (IGF-1), nerve growth factor (NGF) inhibitors such as tanezumab and fasinumab, and any combinations thereof.

[0182] In some embodiments, the nucleic acid may include one or more of microRNAs (miRNAs) such as miR-140, miR-146a, miR-21, siRNAs targeting inflammatory mediators, mRNAs encoding cartilage-regenerating factors like SOX9, RUNX2, C0L2A1, lubricin (PRG4), ghrelin mRNA, interleukin- 1 receptor antagonist (IL-IRa) mRNA, CRISPR / Cas9 gene-editing tools targeting catabolic enzymes like MMP-13 and ADAMTS-5, peptides such as kartogenin, thymosin beta-4, calcitonin, synthetic peptides mimicking extracellular matrix proteins, and any combinations thereof.

[0183] In some embodiments, the therapeutic material encapsulated in the MINT nanoparticle may comprise, consist essentially of, or consist of one or more of mesenchymal stem cells (MSCs), exosomes derived from MSCs, autologous or allogeneic growth factors, anti-senescence agents such as fisetin and quercetin, anti-fibrotic drugs like pirfenidone, mitochondrial-targeting antioxidants such as mitoQ, N-acetylcysteine, edaravone, vitamin D analogs, bisphosphonates like zoledronic acid and alendronate, omega-3 fatty acids, cannabidiol (CBD),synthetic cannabinoid receptor agonists, and any combinations thereof encapsulated in the MINT nanoparticle.

[0184] In some embodiments, the therapeutic material encapsulated in the MINT nanoparticle comprises, consists essentially of, or consists of Hyaluronic acid, glucosamine, chondroitin sulfate, methyl sulfonylmethane (MSM), diacerein, curcumin, resveratrol, celecoxib, ibuprofen, naproxen, indomethacin, dexamethasone, betamethasone, triamcinolone acetonide, rapamycin, tacrolimus, sirolimus, everolimus, methotrexate, tofacitinib, baricitinib, ruxolitinib, adalimumab, infliximab, etanercept, golimumab, certolizumab pegol, secukinumab, ixekizumab, brodalumab, ustekinumab, guselkumab, risankizumab, anakinra, canakinumab, tocilizumab, sarilumab, abatacept, filgotinib, upadacitinib, hydroxychloroquine, sulfasalazine, leflunomide, cyclosporine, apremilast, pentosan polysulfate, doxycycline, minocycline, strontium ranelate, parathyroid hormone analogs, bone morphogenetic proteins (BMP-2, BMP-7), fibroblast growth factor-18 (FGF-18), transforming growth factor-beta (TGF-P), platelet-derived growth factor (PDGF), vascular endothelial growth factor (VEGF), insulin-like growth factor- 1 (IGF-1), nerve growth factor (NGF) inhibitors such as tanezumab and fasinumab, mesenchymal stem cells (MSCs), exosomes derived from MSCs, microRNAs (miRNAs) such as miR-140, miR-146a, miR-21, siRNAs targeting inflammatory mediators, mRNAs encoding cartilage-regenerating factors like SOX9, RUNX2, COL2A1, lubricin (PRG4), ghrelin mRNA, interleukin-1 receptor antagonist (IL-IRa) mRNA, CRISPR / Cas9 gene-editing tools targeting catabolic enzymes like MMP-13 and ADAMTS-5, peptides such as kartogenin, thymosin beta-4, calcitonin, synthetic peptides mimicking extracellular matrix proteins, any nucleic acids complementary to or able to hybridize in stringent conditions to any nucleic acids in the preceding, any nucleic acids encoding any protein in the preceding, and any combinations thereof.

[0185] In some embodiments, the therapeutic material may comprise, consist essentially of, or consist of autologous or allogeneic growth factors, antisenescence agents such as fisetin and quercetin, anti-fibrotic drugs like pirfenidone, mitochondrial-targeting antioxidants such as mitoQ, N-acetylcysteine, edaravone, vitamin D analogs, bisphosphonates such as zoledronic acid and alendronate, omega-3 fatty acids, cannabidiol (CBD), synthetic cannabinoid receptor agonists, and any combinations thereof.In some embodiments, the therapeutic material may comprise, consist of, or consist essentially of a combination of two or more therapeutic materials provided above or otherwise in this specification. In some embodiments, the nanoparticle may further encapsulate one or more additional materials in addition to one or more therapeutic materials. In some embodiments, the one or more additional materials may be other than or in further addition to an ionizable lipid.

[0186] In some embodiments, a therapeutic agent may comprise a means to encapsulate a material means and deliver such material means to a joint, articular cartilage tissue, articular cartilage extracellular matrix, or an articular cartilage cell. Such a means may include a means to electrostatically attract the therapeutic agent to damaged articular cartilage, or to decrease electrostatic repulsion in damaged articular cartilage, in either case as compared to healthy articular cartilage. In some embodiments, the therapeutic agent may comprise a material means to cause a therapeutic effect, particularly a therapeutic effect with respect to osteoarthritis. In some embodiments, the therapeutic agent may further comprise a means to facilitate encapsulation of the material means to cause a therapeutic effect in the means to deliver such material means.

[0187] Pharmaceutical Compositions

[0188] The present disclosure also provides pharmaceutical compositions comprising therapeutic MINT nanoparticles.

[0189] In some embodiments, the composition includes only one therapeutic, the therapeutic MINT nanoparticle. In other embodiments, the composition further comprises a second therapeutic. In some embodiments, the composition comprises two different MINT nanoparticles that together produce a therapeutic effect, such as a first MINT nanoparticle comprising a first nucleic acid and a second MINT nanoparticle comprising a second nucleic acid.

[0190] In some embodiments, the pharmaceutical compositions further comprise one or more pharmaceutically acceptable carrier, diluent, or excipient, suitable for administration by injection, particularly intra-articular injection.

[0191] Pharmaceutically acceptable carriers for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington’s Pharmaceutical Sciences, Mack Publishing Co. (A.R. Gennaro (Ed.), 18th Edition, 1990) and in CRC Handbook of Food, Drug, and Cosmetic Excipients, CRC Press LLC (S.C. Smolinski, ed., 1992). Exemplary pharmaceuticallyacceptable carriers include any carrier, excipient, glidant, diluent, preservative, dye / colorant, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonic agent, solvent, emulsifier, or any combination thereof. For example, sterile saline and phosphate buffered saline (PBS) at physiological pH can be suitable pharmaceutically acceptable carriers. Preservatives, stabilizers, dyes or the like may also be provided in the pharmaceutical composition. In addition, antioxidants and suspending agents may also be used. Pharmaceutical compositions may also contain diluents such as water, buffers, antioxidants such as ascorbic acid, low molecular weight polypeptides (less than about 10 residues), proteins, amino acids, carbohydrates (e.g., glucose, sucrose, dextrins), chelating agents (e.g., EDTA), glutathione, and other stabilizers and excipients. Neutral buffered saline or saline mixed with nonspecific serum albumin are exemplary diluents.

[0192] A pharmaceutical composition may be formulated in the form of a solid, semi-solid or liquid composition. Solid compositions may include powders. In some embodiments, the pharmaceutical compositions described here are lyophilized or in powder form for re-constitution with a suitable vehicle, e.g., sterile water, before use. In some embodiments, the pharmaceutical compositions described herein is a suspension, solution, or emulsion. The pharmaceutical compositions and formulations can be sterilized. Sterilization can be accomplished by filtration through sterile filtration.

[0193] The pharmaceutical compositions described herein can be formulated for injection, particularly intra-articular injection. Examples of formulations for injection can include a sterile suspension, solution or emulsion in oily or aqueous vehicles. Suitable oily vehicles can include those used for other nanoparticles. Aqueous injection suspensions can contain substances which increase the viscosity of the suspension. The suspension can also contain suitable stabilizers. Alternatively, the pharmaceutical compositions described herein can be lyophilized or in powder form for reconstitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.

[0194] The therapeutic MINT nanoparticles can be formulated for administration in a unit dosage form in association with a pharmaceutically acceptable vehicle. Such vehicles can be inherently nontoxic, and non-therapeutic. A vehicle can be water, saline, Ringer’s solution, dextrose solution, and 5% human serum albumin. Non-aqueous vehicles such as fixed oils and ethyl oleate can also beused. The vehicle can contain minor amounts of additives such as substances that enhance isotonicity and chemical stability (e.g., buffers and preservatives).

[0195] In some embodiments, an aqueous formulation of a therapeutic MINT nanoparticle has a pH in a range of 4-5.7, 4-8, 5-7.5, or 6-7.4. The aqueous formulation may comprise one or more excipients, such as, for example, one or more buffering agents, one or more lyoprotectants, and the like. In some embodiments, the formulation comprises at least one buffer. In various embodiments, the buffer may be selected from histidine, citrate, aspartate, acetate, phosphate, lactate, tromethamine, gluconate, glutamate, tartrate, succinate, malic acid, fumarate, a-ketoglutarate, and combinations thereof. In some embodiments, the buffer is at least one buffer selected from histidine, citrate, aspartate, acetate, and combinations thereof. In some embodiments, the buffer is a combination of histidine and aspartate. In some embodiments, the total concentration of the buffer in the aqueous formulation is lOmM to 40mM, such as 15mM-30mM, 15mM-25mM, or 20 mM.

[0196] In some embodiments, the aqueous formulation comprises at least one lyoprotectant. In some such embodiments, the at least one lyoprotectant is selected from sucrose, arginine, glycine, sorbitol, glycerol, trehalose, dextrose, alpha-cyclodextrin, hydroxypropyl beta-cyclodextrin, hydroxypropyl gammacyclodextrin, proline, methionine, albumin, mannitol, maltose, dextran, and combinations thereof. In some embodiments, the lyoprotectant is sucrose. In some embodiments, the total concentration of lyoprotectant in the aqueous formulation is 3-12%, such as 5-12%, 6-10%, 5-9%, 7-9%, or 8%.

[0197] In some embodiments, the aqueous formulation comprises at least one surfactant. Exemplary surfactants include polysorbate 80, polysorbate 20, poloxamer 88, and combinations thereof. In some embodiments, the aqueous formulation comprises polysorbate 80. In some embodiments, the total concentration of the at least one surfactant is 0.01%-0.1%, such as 0.01%-0.05%, 0.01%-0.08%, or 0.01%-0.06%, 0.01%-0.04%, 0.01%-0.03%, or 0.02%.

[0198] In some embodiments, pharmaceutical compositions of the present invention are formulated in a single dose unit. In some embodiments, pharmaceutical compositions are formulated in a form comprising a plurality of dosage units. Methods of preparing such dosage forms are known, or will be apparent, to those skilled in this art; for example, see Remington: The Scienceand Practice of Pharmacy, 20th Edition (Philadelphia College of Pharmacy and Science, 2000).

[0199] In some embodiments, the concentration of the therapeutic MINT nanoparticle in the aqueous formulation is 1 mg / mL-250 mg / mL, such as 10 mg / mL-220 mg / mL, 10 mg / mL-200 mg / mL 10 mg / mL- 175 mg / mL, 10 mg / mL- 150 mg / mL, 10 mg / mL-100 mg / mL, 20 mg / mL-200 mg / mL, 20 mg / mL-175 mg / mL, 20 mg / mL-150 mg / mL, 20 mg / mL-125 mg / mL, 20 mg / mL-100 mg / mL, 30 mg / mL-200 mg / mL, 30 mg / mL-175 mg / mL, 30 mg / mL-150 mg / mL, 30 mg / mL-125 mg / mL, 30 mg / mL-100 mg / mL, 40 mg / mL-200 mg / mL 40 mg / mL- 175 mg / mL, 40 mg / mL-150 mg / mL, 40 mg / mL-125 mg / mL, 40 mg / mL-100 mg / mL, 50 mg / mL-200 mg / mL 50 mg / mL-175 mg / mL, 50 mg / mL-150 mg / mL, 50 mg / mL-125 mg / mL, 50 mg / mL-100 mg / mL, 60 mg / mL-200 mg / mL, 60 mg / mL-175 mg / mL, 60 mg / mL-150 mg / mL, 60 mg / mL-125 mg / mL, 60 mg / mL- 100 mg / mL, 70 mg / mL-200 mg / mL, 70 mg / mL-175 mg / mL, 70 mg / mL-150 mg / mL, 70 mg / mL-125 mg / mL, 80 mg / mL-200 mg / mL, 80 mg / mL-175 mg / mL, 80 mg / mL-150 mg / mL, 80 mg / mL-125 mg / mL, 100 mg / mL-200 mg / mL, 125 mg / mL-200 mg / mL, 150 mg / mL-200 mg / mL, or 160 mg / mL- 190 mg / mL, 170 mg / mL- 180 mg / mL, or 175 mg / mL.

[0200] Methods of Treatment

[0201] Electrostatic interactions between cationic nanoparticles and negatively charged glycosaminoglycans have been previously explored for targeting healthy cartilage and early-stage osteoarthritis. In moderate and severe osteoarthritis, however, the extracellular matrix associated with articular cartilage undergoes drastic changes. Studies have revealed that as osteoarthritis progresses, the pH at the surface of the cartilage shifts from neutral to acidic, indicating a reduction in the overall negative charge of the cartilage due to progressive glycosaminoglycan loss. Thus, while cationic nanoparticles are effective in targeting healthy cartilage, the reduction in negative charge in osteoarthritic lesions limits the usefulness of cationic nanoparticles in this setting, especially in moderate to severe osteoarthritis or in areas of an arthritic lesion with damage equivalent to that in moderate to severe osteoarthritis, even if the lesion overall is more characteristic of an earlier stage of disease.

[0202] In some embodiments, the cartilage disease may also result in increased porosity of the cartilage. This increased porosity might result from or beexacerbated by any of a number of factors, but in many diseases, including forms of arthritis, the increased porosity is at least partially due to glycosaminoglycan loss. Regardless of the cause, increased cartilage porosity is typically associated with more advanced disease states, particularly in degenerative cartilage diseases.

[0203] In embodiments of the present disclosure, increased porosity may facilitate penetration into and dispersion of the therapeutic MINT nanoparticles in cartilage. Furthermore, due to the increased porosity, larger numbers of therapeutic MINT nanoparticles may reach more diseased areas of cartilage. This may also result in a disease-state-responsive effect. The same dose of therapeutic MINT nanoparticles may result in more nanoparticles actually delivering the therapeutic material in a patient with a more advanced cartilage disease than in a patient with less advanced disease because more therapeutic MINT nanoparticles will move to locations where cartilage charge allows effective delivery of the therapeutic agent, and fewer MINT nanoparticles will be cleared from the joint or retained in joint locations where therapeutic effect is minimal in the patient with more advanced disease. Similarly, the concentration of therapeutic MINT nanoparticles and delivery of the therapeutic material will be higher in joint or tissue regions with more damage than in joint or tissue regions in the same patient or joint with less damage because the relatively higher porosity of the more damaged tissue facilitates nanoparticle movement into the tissue.

[0204] The present disclosure, in some embodiments, provides methods of treating articular cartilage diseases that result in lesions in articular cartilage characterized by glycosaminoglycan loss, such as osteoarthritis, rheumatoid arthritis, post-traumatic cartilage injury and other inflammatory or degenerative cartilage diseases.

[0205] In some methods, therapeutic MINT nanoparticles are introduced to an affected joint or otherwise in an area of damaged articular cartilage. The therapeutic MINT nanoparticles then selectively diffuse and accumulate into articular cartilage extracellular matrix (ECM) with lower amounts of glycosaminoglycan because such regions have a decreased negative charge. This translates into reduced repulsion of the MINT nanoparticles. MINT involves “inverse-targeting” because it relies on selective anionic nanoparticle accumulation in regions in a manner inversely correlated with glycosaminoglycan content in the extracellular matrix.In some embodiments, the therapeutic MINT nanoparticle may deliver a nucleic acid to an articular cartilage cell. In some embodiments, the therapeutic MINT nanoparticle may deliver a nucleic acid to a cell in the extracellular martix of cartilage.

[0206] In some embodiments, the treatment methods rely solely on the MINT nanoparticle charge and electrostatic attraction or reduced electrostatic repulsion (as compared to cationic nanoparticles or other non-anionic nanoparticles) to target delivery of the nucleic acid to articular cartilage lesions, particularly osteoarthritic lesions. Other moieties that target articular cartilage lesions may be unnecessary and not included in the therapeutic MINT nanoparticle

[0207] In some embodiments, the treatment methods may including delivering higher amounts of nucleic acid to lesions exhibiting more damage than to lesions exhibiting less damage. This disease-severity-responsive delivery may increase therapeutic benefit while minimizing the chances of unwanted side-effects.

[0208] In some embodiments, the treatment methods may include delivering higher amounts of nucleic acid to areas of a lesion exhibiting more damage than other areas of a lesion. This disease-severity-responsive delivery may increase therapeutic benefit my providing increased amounts of therapeutic nucleic acid and, in some embodiments, as a result, increased expression of therapeutic protein in areas of the lesion where they are most needed and may have the most dramatic and beneficial effects.

[0209] In some embodiments, administration of the therapeutic MINT nanoparticle may result in endogenous expression of a therapeutically effective amount of a protein or polypeptide encoded by the nucleic acid, such as ghrelin, in the osteoarthritic lesion, for a time period of at least 1 month, at least 2 month, at least 3 months, or at least 4 months after administration. In some embodiments, a short delay of one day, two days, or three days or less after administration may occur before protein or polypeptide, such as ghrelin, expression reaches a therapeutically effective amount. This is particularly true if the patient, or the affected joint or lesion, has not previously received the therapeutic MINT nanoparticle.

[0210] In some embodiments, the therapeutic MINT nanoparticle may be administered weekly via injection at the affected joint or tissue (sometimes referred to as intra-articular administration). In some embodiments, the therapeutic MINT nanoparticle may be administered less frequently, such asevery two weeks, every three weeks, every four weeks, every six weeks, every eight weeks, or every twelve weeks. Embodiments in which therapeutic MINT nanoparticle includes therapeutic saRNA may be administered less frequently than embodiments in which the therapeutic includes non-self-replicating RNAs. The self-replicating nature of saRNA may allow expression of the nucleic acid in the affected joint for a longer period of time.

[0211] In some embodiments in which the therapeutic MINT nanoparticle delivers a nucleic acid to a cell, the nucleic acid may avoid endosomal degradation in the cell.

[0212] In some embodiments, the therapeutic MINT nanoparticle is administered to a human patient. In some embodiments, the therapeutic MINT nanoparticle is administered to a non-human mammalian patient, such as a dog, cat, horse, donkey, pig, cow, sheep, goat, llama, alpaca, or rabbit.

[0213] In some embodiments, the treatment dose may be expressed in terms of units of mRNA per dose, such as pg, mg, or g of mRNA delivered. The dose may be expressed in a per joint amount. In some embodiments, the units of mRNA administered may be the equivalent of 2 pg mRNA / mouse knee joint. This equivalent may be calculated, in some embodiments, using standard pharmacological dosage conversions between organisms. In some embodiments, the dosage may be the same amount per joint based solely on organism type or other whole-organism feature, such as age. Due to the localized nature of the injection and therapeutic effect, many whole-organism dosage factors considered for other therapeutics, such as patient weight, may be excluded from consideration when determining an appropriate dosage.

[0214] In some embodiments, the dosage may differ, even within the same type of organism or within a given patient, depending on the joint to which the treatment is administered, with larger joints, for example, receiving higher dosages.

[0215] However, given the ability of some therapeutic MINT nanoparticles of the present disclosure to automatically adjust to the amount of diseased tissue present and the degree of damage or disease, fine-tuned dosages may not be necessary. For example, one dosage amount may be appropriate for all adult humans, or all geriatric humans, regardless of which joint serves as the injection site or the degree of the disease.This feature may render therapeutic MINT nanoparticles of the present disclosure more easily used because the administering medical profession need not determine a specific dose and ensure that the correct dose is administered. In some embodiments, the therapeutic MINT nanoparticle may be provided in single-doses to further reduce complications in administering the composition. With such embodiments, the administering medical professional need only confirm that the correct therapeutic has been selected (typically by reading the label) and which joint is to be treated, prior to administering the treatment. This uncomplicated dosage and administration may help prevent medical errors.

[0216] Furthermore , the disease-severity -response features of some therapeutic MINT nanoparticles of the present disclosure may also allow for more streamlined diagnosis of osteoarthritis. Rather than requiring complex assessments of osteoarthritis, for example to determine the disease progression, a medical professional may, in some embodiments, only need to determine that the patient likely has osteoarthritis. This diagnosis can often occur during a simple clinical setting, such as an office visit, without the need for medical imaging. Provided that the patient has osteoarthritis, the therapeutic MINT nanoparticle will adjust the treatment provided automatically to a therapeutically effective amount. This streamlined diagnosis process may allow patients to obtain relief from their osteoarthritis symptoms. Similarly streamlined diagnoses may be possible for other diseases as well.

[0217] Methods of Forming Therapeutic MINT Nanoparticles

[0218] Therapeutic MINT nanoparticles of the present disclosure may be formed using any methods suitable for use with the nanoparticle and encapsulated nucleic acid or other material.

[0219] In some embodiments, a MINT nanoparticle formed from a polymer and anionic coating may be contacted with a nucleic acid under conditions in which the nucleic acid is encapsulate by the nanoparticle. Presence of an ionizable lipid may facilitate interaction of the nucleic acid and the nanoparticle such that the nucleic acid is encapsulated. In embodiments in which the MINT nanoparticle encapsulates a therapeutic material that does not include a nucleic acid, the therapeutic material may be encapsulatable without the presence of an ionizable lipid. In such cases, an ionizable lipid may be absent from the method of forming a therapeutic MINT nanoparticle.In some embodiments, the MINT nanoparticle may be pre-formed prior to contacting with the nucleic acid and, if present, ionizable lipid. In other embodiments, MINT nanoparticle precursors may be contacted with one another and the nucleic acid and, if present, the ionizable lipid such that the nanoparticle forms with the nucleic acid encapsulated.

[0220] EXAMPLES

[0221] Example 1: MINT nanoparticles for ghrelin delivery

[0222] MINT nanoparticles encapsulating mRNA encoding human ghrelin where administered to osteoarthritic lesions. MINT was observed, along with therapeutic effects. In particular, the therapy exploited the progressive loss of negatively charged glycosaminoglycan in the extracellular matrix of osteoarthritic articular cartilage. Glycosaminoglycan (GAG) loss leads to reduced negative charge of the extracellular matrix, resulting in lesion areas that are electrostatically distinct from healthy areas. Clinically, this phenomenon is used to detect osteoarthritic lesions in delayed gadolinium-enhanced magnetic resonance imaging of cartilage (dGEMRIC). The partitioning of anionic gadolinium into the extracellular matrix inversely correlates with glycosaminoglycan content, allowing for a quantitative assessment of cartilage health to detect various stages of osteoarthritis, including its early onset.

[0223] Engineered poly(lactic-co-glycolic acid) (PLGA) MINT nanoparticles were developed in the present disclosure to harness these electrostatic changes in osteoarthritic lesions to precisely target delivery of ghrelin mRNA (Ghr mRNA) and to cause disease-severity-responsive delivery and expression of Ghr mRNA. This targeting, as well as experiments to establish the therapeutic effects of MINT nanoparticles encapsulating Ghr mRNA as opposed to scrambled mRNA are illustrated in Fig. 1.

[0224] Data provided in these Examples establish that the MINT nanoparticles tested preferentially targeted glycosaminoglycan-depleted porcine cartilage, showing progressively higher accumulation as glycosaminoglycan loss increased. Moreover, MINT nanoparticles penetrated human osteoarthritic cadaveric finger joints more effectively than cationic nanoparticles, demonstrating that electrostatic effects cause delivery differences in vivo. This validated the targeting and penetration capabilities of MINT nanoparticles using cartilagesamples from both porcine and human sources, ensuring cross-species relevance. Beyond demonstrating targeting in cartilage explants, the results confirmed the cartilage-penetration ability of MINT nanoparticles in an intact human joint, a key translationally relevant finding. Additionally, these examples demonstrate a rigorous screening process to determine formulations with better efficacy. The process included evaluating NPs with varying DOPS concentrations and charges to identify the combination that demonstrated the best lesion targeting among options tested. The choice of ionizable lipid and mRNA chemistry were also assayed to determine which achieved the highest protein expression among those tested. In addition to providing useful guidance regarding therapeutic MINT nanoparticles, these tests provide guidance for the evaluation of other nanoparticles and nucleic acids or materials to be delivered for treatment of osteoarthritis or other articular cartilage diseases.

[0225] In a mouse model of anterior cruciate ligament transection (ACLT)-induced osteoarthritis, MINT nanoparticles injected into articular cartilage delivered luciferase mRNA with expression proportional to disease severity, while MINT nanoparticles encapsulating ghrelin mRNA reduced cartilage degeneration, subchondral bone thickening, nociceptive pain, and sensory neuron excitation in knee-innervating dorsal root ganglia (DRG. This conformed therapeutic efficacy of MINT nanoparticles encapsulating ghrelin mRNA through multiple endpoints.

[0226] Further, the data indicated that MINT nanoparticles could be applied before the onset of late-stage osteoarthritis. In the efficacy study, treatment initiated at 1-week post-ACLT (early osteoarthritic) resulted in remarkable therapeutic effect. These findings indicated that MINT nanoparticles can deliver mRNA in a targeted manner to damaged cartilage regions prior to widespread degradation, potentially slowing disease progression.

[0227] Data showing that MINT nanoparticles could effectively deliver siRNA expands their potential beyond mRNA-based therapies, while data relating to saRNA established potential uses for MINT nanoparticles for evolving mRNA-based therapies.

[0228] Example 2: MINT nanoparticles target osteoarthritis-mimetic porcine cartilage To mimic glycosaminoglycan loss during osteoarthritic, porcine cartilage explants were treated with either PBS or chondroitinase (CDase), whichenzymatically depletes glycosaminoglycan from the extracellular matrix. The explants were first stained with toluidine blue, a positively charged dye that binds to the negatively charged glycosaminoglycan in the extracellular matrix. The explants were then counter-stained with eosin, an anionic dye that is repelled by the negatively charged glycosaminoglycan. PBS-treated explants exhibited strong toluidine blue staining and minimal eosin staining while CDase-treated explants showed prominent eosin staining (Fig. 2A). This indicated a reduction in negative charge due to glycosaminoglycan depletion.

[0229] To determine the optimal surface charge of nanoparticles for electrostatic targeting of osteoarthritic lesions, PLGA nanoparticles were fabricated with surface modifications using either an anionic lipid (l,2-dioleoyl-sn-glycero-3-phospho-L-serine, DOPS) or a cationic polymer (chitosan). The concentration of each surface-modifying coating material was systematically adjusted to generate a range of surface charges from -50 to +50 mV (Table 1).

[0230] Table 1: Size, charge and polydispersity index (PDI) of PLGA nanoparticles (NPs) with different coatings

[0231] Coating type (jig / mL) No. size (nm) PDI Zeta (mV) PLGA NPs 85.9 0.13 -20.5 PLGA-Chitosan 50 87.9 0.13 +28.6 PLGA-Chitosan 100 104 0.15 +43.3 PLGA-Chitosan 200 88.1 0.20 +41.2 PLGA-Chitosan 400 112.1 0.19 +47.2 PLGA-DSPE-PEG 100 80.7 0.11 -7.6 PLGA-DOPS 25 91.1 0.12 -29.6 PLGA-DOPS 50 97.4 0.09 -35.5 PLGA-DOPS 75 97.4 0.09 -43.4 PLGA-DOPS 100 111.4 0.13 -45.8 PLGA-DOPS 125 120 0.09 -48.8 PLGA-DOPS 150 94.2 0.12 -49.1

[0232] Chitosan-coated nanoparticles (cationic nanoparticles) exhibited a progressive shift toward positive charges, with the magnitude of the charge increasing in proportion to higher chitosan concentrations. Similarly, DOPS-coated nanoparticles (MINT nanoparticles) showed an increase in the negativesurface charges, reaching saturation at approximately -50 mV as DOPS concentration increased (Fig. 2B).

[0233] To confirm that MINT nanoparticles preferentially target osteoarthritismimetic porcine cartilage, two nanoparticles with opposite surface charges were tested. Cationic nanoparticles were coated with 400 pg / mL of chitosan (+47 mV). MINT nanoparticles were coated with 150 pg / mL of DOPS (-49 mV). PBS-pre-treated cartilage sections exhibited higher fluorescence signals upon treatment with cationic nanoparticles compared to CDase-pre-treated sections, confirming that cationic nanoparticles preferentially targeted the negatively charged extracellular matrix (Fig. 2C and Fig. 2D). Conversely, MINT nanoparticles showed preferential targeting of CDase-treated cartilage sections (Fig. 2C and Fig. 2D). Similar trends were observed when PBS- or trypsin-treated cartilage sections were incubated with MINT nanoparticles (Fig. 2E and Fig. 2F). Higher concentrations of DOPS in the nanoparticles resulted in increased targeting of CDase-treated cartilage sections, as evidenced by increasing fluorescence intensity (Fig. 2G). A minimum of 100 pg / mL DOPS (surface charge of at least -40 mV) was required to achieve significantly higher targeting of CDase-treated cartilage sections compared to PBS-treated ones (Fig.

[0234] 2G and Fig.2H). Optimal targeting was achieved at a DOPS concentration of 125-150 pg / mL. For subsequent studies, nanoparticles with the highest DOPS concentration (150 pg / mL) were selected as MINT nanoparticles, while nanoparticles encapsulating 400 pg / mL chitosan were used as the cationic control due to their comparable but opposite charge.

[0235] The ability of MINT nanoparticles to target osteoarthritis-mimetic cartilage was further confirmed using whole explants. MINT nanoparticles exhibited significantly higher fluorescence signal in CDase-treated cartilage, while cationic nanoparticles showed stronger signal in PBS-treated cartilage (Fig. 21 and Fig. 2 J). These results highlighted the ability of MINT nanoparticles and cationic nanoparticles to selectively target osteoarthritis-mimetic or healthy cartilage, respectively.

[0236] Cartilage damage during osteoarthritis can extend into deeper layers, so evaluations were conducted to determine if MINT nanoparticles could effectively penetrate osteoarthritis-mimetic porcine cartilage and to examine how reduced glycosaminoglycan concentration influenced penetration of nanoparticles.

[0237] Glycosaminoglycan concentration in the explants decreased with increasingconcentrations of CDase and hyaluronidase (Fig. 2K). Hyaluronidase was added to digest the hyaluronic acid, a component of the extracellular matrix that is also degraded in osteoarthritis. As glycosaminoglycan depletion increased, MINT nanoparticle penetration in the porcine cartilage correspondingly increased, further highlighting the ability of MINT nanoparticles to penetrate glycosaminoglycan-depleted cartilage (Fig. 2L and Fig. 2M).

[0238] Example 3: MINT nanoparticles preferentially target osteoarthritic lesions in human cartilage

[0239] Osteoarthritic lesions were identified by the loss of Safranin O / fast green staining in human cartilage sections (Fig. 2N). Upon incubation of these sections with MINT nanoparticles encapsulating Dil (Dil MINT NPs), Dil fluorescence was predominantly localized to areas with Safranin O loss, rather than Safranin O-stained zones (Fig. 2N). This result confirmed the selective targeting of osteoarthritic lesions by MINT nanoparticles.

[0240] Whether MINT nanoparticles could effectively penetrate human osteoarthritic cartilage was assessed using cartilage with significant structural damage in the surface zone, as indicated by a higher Mankin score, (Fig. 20 and Fig. 2P), while relatively healthy cartilage with a very low Mankin score served as the control. MINT nanoparticles demonstrated a four-fold greater penetration in osteoarthritic cartilage compared to healthy cartilage. Furthermore, MINT nanoparticles penetrated osteoarthritic cartilage significantly deeper than cationic nanoparticles, highlighting their superior targeting capability (Fig. 2Q and Fig.

[0241] 2R). In contrast, cationic nanoparticles showed a similar extent of penetration for both healthy and osteoarthritic cartilage (Fig. 2Q and Fig. 2R). This was likely due to the loss of glycosaminoglycan on the surface cartilage in aging individuals. Donors for these cartilage specimens were aged individuals. The surface layer of articular cartilage tends to be devoid of glycosaminoglycan even for healthy aging individuals.

[0242] MINT nanoparticles effectively localized and penetrated cartilage in an intact human finger joint, supporting their potential for clinically relevant delivery into articular cartilage. MINT nanoparticles encapsulating Dil were injected into the proximal interphalangeal (PIP) joint of fingers obtained from a human osteoarthritic cadaveric donor (Fig. 2S). Osteoarthritic-related cartilage damage was confirmed by the loss of toluidine blue staining. MINTnanoparticles exhibited six-fold greater penetration in the PIP joint cartilage compared to cationic nanoparticles (Fig. 2T and Fig. 2U).

[0243] Molecular docking studies using DOPS, the anionic lipid responsible for charge-based nanoparticle selectivity, were performed to elucidate the interactions of MINT nanoparticles with key cartilage extracellular matrix components. Binding affinities (Table 2) and interaction types (Fig. 2V) were determined.

[0244] Table 2: Binding affinity and interactions analysis ofDOPS with cartilage matrix components.

[0245]

[0246] Keratan sulfate

[0247]

[0248] DOPS showed strong binding to collagen type II (-7.0 kcal / mol) through hydrogen bonding and hydrophobic interactions, consistent with the neutral to slightly positive charge of this protein. In contrast, chondroitin sulfate (-5.4 kcal / mol) and N,O-highly sulfated glycosaminoglycans (-4.2 kcal / mol) displayed weaker binding, with multiple unfavourable negative-negative electrostatic interactions, reflecting the strong repulsion encountered in healthy cartilage rich in sulfated glycosaminoglycans. Binding affinity increased substantially for lowly sulfated glycosaminoglycans (-7.1 kcal / mol), hyaluronic acid (-7.0 kcal / mol), and keratan sulfate (-6.7 kcal / mol), all of which have reduced fixed negative charges compared to highly sulfated glycosaminoglycans. These results indicated a mechanism whereby the loss and desulfation of glycosaminoglycans in osteoarthritis diminish electrostatic repulsion, enabling greater MINT nanoparticle binding and diffusion into cartilage lesions.

[0249] Example 4: MINT nanoparticles transfect, target by disease-severity, and are safe

[0250] MINT nanoparticles encapsulating mRNA / saRNA were used to determine efficiency of in vitro transfection. Firefly luciferase (FLuc) mRNA / saRNA was encapsulated by MINT nanoparticles (FLuc mRNA / saRNA NPs) by complexing with varying ionizable lipids, achieving -50% encapsulation efficiency across formulations. Three ionizable lipids (DLinKC2DMA, DLinMC3DMA, and ALC0315) produced measurable luciferase expression, which increased with mRNA dose (Fig. 3A). ALC0315 yielded the highest expression. MINT nanoparticles encapsulating Flue saRNA also demonstrated dose-responsive luciferase expression in vitro (Fig. 3B).

[0251] MINT nanoparticles incorporated DOPS (150 pg / mL) for enchanced lesion targeting, but as an anionic lipid, it was possible that DOPS could reduce cellular uptake of the RNA and transfection of cartilage cells. The effect of DOPS concentration on luciferase expression was assessed to determine if such reduction occurred. Results showed that increasing DOPS enhanced FLucexpression at all mRNA doses, with maximal transfection at 125-150 pg / mL (Fig. 3C). Transfection was also influenced by the ALC0315:PLGA ratio, with 1:6 producing the highest signal (Fig. 3D). 150 pg / mL DOPS and a 1:6 ALC0315:PLGA ratio were used in subsequent experiments. Under these conditions, MINT nanoparticles encapsulating FLuc showed excellent biocompatibility, maintaining >80% viability in TC28a2 cells at mRNA doses up to 2 pg / mL for 24-72 h (Fig. 3E).

[0252] The effects of PEG type and PLGA types on transfection were also tested. DSPE-PEG 2000 and DMG-PEG 2000 were both tested for in vitro transfection capabilities. Results demonstrated significantly higher luciferase expression with DMG-PEG compared to DSPE-PEG 2000 (Fig.3F). Similarly, PLGA-cholesterol demonstrated significantly higher luciferase expression compared to ester-terminated PLGA used in previous studies (Fig. 3G).

[0253] Cellular uptake of nanoparticles coated with varying amounts of DOPS was evaluated to explore the mechanism underlying the unexpected increase in luciferase expression with higher DOPS concentrations. Flow cytometry analysis revealed a concentration-dependent increase in uptake, with the highest DOPS concentration yielding the greatest cellular internalization (Fig. 3H and Fig. 31).

[0254] These findings indicated that DOPS coating enhances membrane fusion and cellular uptake, increasing transfection efficiency at higher DOPS concentration.

[0255] To assess the versatility of MINT nanoparticles for delivery of different types of RNA therapeutics, a proof-of-concept GFP siRNA was encapsulated and its silencing efficiency on GFP expressing TC28a2 cells was evaluated. Cell viability assays confirmed no cytotoxicity up to 100 nM siRNA concentration (Fig. 3J, Fig. 3K and Fig. 3L). Flow cytometry analysis demonstrated 45% reduction in GFP-high cells at 100 nM concentration 24-hours post-treatment (Fig. 3J, Fig. 3K and Fig. 3L), indicating effective siRNA delivery. These findings confirmed the capability of MINT nanoparticles to deliver diverse RNA therapeutics to cartilage cells.

[0256] Efficient transfection suggested that MINT nanoparticles could successfully escape endosomes within cells. To confirm this, chondrocytes were incubated with MINT nanoparticles encapsulating Cy5-tagged Scrambled (Scr) mRNA. The separation of green (mRNA) and red (endosome) fluorescence signals within the cytoplasm indicated successful escape of mRNA from the endosomes into the cytoplasm (Fig.3M).MINT nanoparticles adjusted for increased mRNA delivery were reassayed for retained lesion-targeting ability. Nanoparticle targeting intensified with greater glycosaminoglycan depletion, which created less repulsion for the anionic MINT nanoparticles. Glycosaminoglycan depletion, as confirmed by reduced eosin red intensity (Fig. 3N), increased with higher CDase concentration. In separate explants, MINT nanoparticles encapsulating DiR or scrambled mRNA showed progressively stronger DiR signal with higher CDase concentrations (Fig. 30 and Fig. 3P), indicating enhanced targeting of cartilage explants with greater glycosaminoglycan depletion. Thus, MINT nanoparticles encapsulating mRNA maintained lesion targeting that scaled with glycosaminoglycan loss, supporting disease-severity-responsive targeting.

[0257] Biocompatibility of MINT nanoparticles was also assessed in vivo. MINT nanoparticles encapsulating Flue mRNA (2 pg mRNA per joint) or a PBS control was injected into knee joints of healthy mice. After one week, the joints were collected and stained. No evidence of immune cell infiltration, cartilage damage, or synovitis was observed in mouse joints injected with PBS or with MINT nanoparticles encapsulating Flue mRNA (Figu. 3Q). Additionally, terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining revealed no significant difference between mice injected with MINT nanoparticles encapsulating Flue mRNA and PBS controls (Fig. 3R and Fig. 3S). These findings confirmed the in vivo biocompatibility of MINT nanoparticles.

[0258] Example 5: MINT nanoparticles exhibited disease-severity-responsive mRNA expression

[0259] The ability of MINT nanoparticles to deliver and express mRNA in vivo was assessed by injecting MINT nanoparticles encapsulating Flue mRNA (2 pg RNA / joint) in both knee joints of healthy mice. One, two, or three days after injection of the MINT nanoparticles, D-Luc was injected and IVIS imaging was conducted. MINT nanoparticles encapsulating Flue mRNA produced sustained intra-articular luciferase expression for >3 days in healthy mice (Fig. 4A and Fig.

[0260] 4B) To verify chondrocyte transfection, MINT nanoparticles encapsulating Cy3-tagged GFP mRNA were injected into knees of mice with ACLT-induced osteoarthritis, with the contralateral knees as healthy controls. MINT nanoparticles were administered 4 weeks post-surgery and joints were analyzed 24 h later. Cy3 fluorescence co-localized with GFP protein in the superficialcartilage zone (Fig. 4C), demonstrating mRNA delivery to cartilage and translation within chondrocytes.

[0261] Consistent with the ex vivo findings that MINT nanoparticles preferentially targeted glycosaminoglycan-depleted regions, in vivo the nanoparticles facilitated disease-severity-responsive mRNA expression, with more advanced osteoarthritic yielding higher expression due to enhanced targeting. MINT nanoparticles encapsulating Flue mRNA were injected at 2, 4, or 6 weeks post-ACLT, time points representing increasing cartilage degeneration confirmed by Safranin-0 staining (Fig. 4D). At week 2, luciferase expression was similar between ACLT and control joints (luminescence flux ratio ~1), but by weeks 4 and 6 the ACLT joints showed progressively higher expression (flux ratio >1), with a significant increase from week 2 to week 6 (Fig. 4E and Fig. 4F). These results demonstrated disease-severity-responsive mRNA expression in vivo.

[0262] MINT nanoparticles encapsulating Flue saRNA were evaluated to determine if saRNA could further extend the protein expression compared to Flue mRNA due to the self-amplifying ability of the RNA. MINT nanoparticles encapsulating FLuc saRNA were injected at 2 pg saRNA / joint into knee joints of C57BL / 6 mice (40 weeks age). Longitudinal IVIS imaging after IP Cyclucl (5 mg / ml) administration was conducted on days 1, 3, 5, 7, 10, 14, 18, and 26 post-nanoparticle administration Flue saRNA extended the protein expression from 3 days to 3 weeks in healthy mice (Fig. 4G and Fig. 4H).

[0263] Example 6: MINT nanoparticles encapsulating ghrelin mRNA attenuate osteoarthritis progression

[0264] The therapeutic potential of MINT nanoparticles was further evaluated using human ghrelin mRNA, which has been reported to exhibit chondroprotective effects in mouse osteoarthritis. MINT nanoparticles encapsulating human ghrelin mRNA (Ghr mRNA NPs) efficiently transfected TC28a2 chondrocytes and induced robust ghrelin expression in vitro (Fig.5A). A monosodium iodoacetate (MIA) osteoarthritic model was used to assess in vivo expression in glycosaminoglycan-depleted joints. Because the modified nucleotide N1 -methylpseudouridine (NIT) enhances mRNA stability and translation, both unmodified and N l -modified ghrelin mRNA were tested. MINT nanoparticles encapsulating Ghr mRNA were injected into both knees ofmice, and human ghrelin levels were measured 24 hours later using a humanspecific enzyme-linked immunosorbent assay (ELISA) (cross-reactivity with mouse ghrelin was evaluated and determined to not occur). MINT nanoparticles encapsulating modified or unmodified Ghr mRNA both yielded higher ghrelin expression in MIA joints than did PBS controls, demonstrating disease-severity-responsive expression. NlT-modified mRNA produced significantly higher expression than unmodified mRNA (Fig. 5B).

[0265] Immunofluorescence staining of ghrelin in mouse ACLT osteoarthritis confirmed that ghrelin levels were reduced specifically in lesion areas with cartilage loss, as identified by Safranin O staining of adjacent sections (Fig. 5C).To determine whether MINT nanoparticles could induce ghrelin expression in ACLT mice, MINT nanoparticles encapsulating Ghr mRNA (2 pg mRNA / joint) were administered into joints 2 weeks post- ACLT. Sustained ghrelin expression was observed for at least three days (Fig. 5D).

[0266] Having confirmed robust ghrelin expression from MINT nanoparticles encapsulating Ghr mRNA, therapeutic efficacy in the ACLT mouse model was tested. At one, two, three, four, and five weeks post- ACLT, mouse knee joints were injected with MINT nanoparticles encapsulating Ghr mRNA, MINT nanoparticles encapsulating scrambled mRNA (Scr mRNA), or PBS. Joints were collected at week six. The weekly dosing regimen was employed to avoid or reduce injection-related inflammation. MINT nanoparticles encapsulating Ghr mRNA markedly reduced cartilage damage relative to PBS and MINT nanoparticles encapsulating scrambled mRNA, as shown by Safranin-0 staining (Fig. 5E), with -50% lower OARSI and ACS scores (Fig. 5F). MINT nanoparticles encapsulating Scr mRNA showed no benefit. MINT nanoparticles encapsulating Ghr mRNA also significantly reduced subchondral bone plate thickening (Fig, 5G and Fig. 5H). Mechanistically, MINT nanoparticles encapsulating Ghr mRNA lowered MMP3 and MMP13 expression compared to MINT nanoparticles encapsulating scrambled mRNA. (Fig. 51, Fig. 5J, Fig. 5K).

[0267] Example 7: MINT nanoparticles encapsulating ghrelin mRNA attenuate osteoarthritis pain

[0268] The Von Frey assay was used to determine the effect or MINT nanoparticles encapsulating ghrelin mRNA on nociception. Beginning one week post-ACLT, mice were administered MINT nanoparticles encapsulating GhrmRNA, MINT nanoparticles encapsulating scrambled mRNA, or PBS weekly through five weeks post-ACLT. Pain sensitivity was analysed at week five and again at week six. L3-L5 lumbar vertebrae were collected at week 6 for immunofluorescence analysis. Administration of MINT nanoparticles encapsulating Ghr mRNA did not change withdrawal thresholds at week 5 as compared to PBS or MINT nanoparticle encapsulating scrambled mRNA controls, but did significantly increased thresholds by week 6, indicating reduced pain sensitivity (Fig. 6A). To account for individual variability, the ACLT knee was normalized to the contralateral knee in each mouse. This ratio revealed significantly improved pain thresholds in mice administered MINT nanoparticles encapsulating Ghr mRNA at both weeks 5 and 6, whereas MINT nanoparticles encapsulating scrambled mRNA had no effect (Fig. 6B). These findings demonstrated that MINT nanoparticles encapsulating Ghr mRNA reduced osteoarthritis-associated nociceptive pain.

[0269] To investigate if the anti -nociceptive effects observed by the Von Frey analysis was reflected by dorsal root ganglion (DRG) neuronal activation, transient receptor potential vanilloid 1 (TRPV1) and calcitonin gene-related peptide (CGRP), which are established markers of pain and neuronal activation in the DRG, were assessed. Immunofluorescence staining revealed that MINT nanoparticles encapsulating Ghr mRNA significantly reduced TRPV1 and CGRP in DRG neurons, which were marked by NeuN staining (Fig. 6C, Fig. 6D, and Fig. 6E). These findings demonstrated that MINT nanoparticles encapsulating Ghr mRNA delivered into the joint via injection effectively alleviated osteoarthritis-associated nociceptive pain, as evidenced by increased pain thresholds and reduced neuronal activation.

[0270] Example 8: MINT nanoparticles encapsulating ghrelin mRNA ameloriated ZMPSTE24 - / - early-aging osteoarthritis

[0271] Osteoarthritis progression was studied in the ZMPSTE24 (ZMPSTE24 -I- ) knockout mouse model, which mimics Hutchinson-Gilford Progeria Syndrome (HGPS) and has an early aging phenotype. This allowed evaluation of the effectiveness of MINT nanoparticles encapsulating ghrelin mRNA in promoting cartilage repair and reducing pain in this early-aging phenotype by assessing cartilage regeneration, inflammatory modulation, and pain relief.MINT nanoparticles encapsulating ghrelin mRNA (Ghr mRNA) or Scrambled mRNA loaded NPs (Scr mRNA) were injected in the right joints of 13 week old ZMPSTE24- / - mice at Week 0 ((g) of ZMPSTE24- / - mice injected with MINT nanoparticles encapsulating Ghr mRNA or MINT nanoparticles encapsulating Scr mRNA (2pg of mRNA / joint). Left joints were left as unoperated control (NOC). Withdrawal threshold for pain tolerance was analyzed using a Von Frey assay at Week 0 prior to injections and at Week 2. Mice were injected with a second round of MINT nanoparticles encapsulating the relevant mRNA at Week 2, and joints were harvested at Week 4 for histological analysis. At Week 2, mice administered with MINT nanoparticles encapsulating Ghr mRNA exhibited a trend of higher pain tolerance than that administered MINT nanoparticles encapsulating Scrambled mRNA as observed with higher withdrawal threshold values (Fig. 7A).

[0272] At Week 4, mice administered with MINT nanoparticles encapsulating Ghr mRNA also exhibited a trend of lower OARSI score and synovial inflammation, indicating that Ghr mRNA has a chondroprotective effect on the ZMPSTE24- / - joints (Fig.

[0273] 7B and Fig. 7C). Immunofluorescence staining of senescent marker pl6 showed that Ghr mRNA can lead to a reduction in senescence as indicated by the decrease in percent positive pl6 in cartilage (Fig. 7D and Fig. 7E).

[0274] Example 9: Methods

[0275] The following methods were used in Examples 1-7.

[0276] Toluidine blue and eosin red staining of porcine cartilage

[0277] Biopsy punches were made to porcine cartilage procured from a local abattoir in Boston, resulting in 6*1 mm explants, which were incubated overnight or for 6 hours with PBS or varying concentrations of chondroitinase (CDase) (Sigma Aldrich) (0.5-2 U / mL) and stained with 0.04% (w / v) toluidine blue solution (Sigma Aldrich) for 30 minutes. Subsequently, the explants were incubated with 0.25% (w / v) eosin (Sigma Aldrich) for 10 minutes. Extent of glycosaminoglycan loss was assessed by quantifying eosin red intensity using ImageJ software.

[0278] Synthesis of dye-loaded nanoparticles

[0279] Nanoparticles (NPs) were prepared by the nanoprecipitation method as reported previously with some modifications53. To prepare Dil or DiR-loaded NPs, the following stock solutions were used. Ester terminated PLGA, 10-15 kDa, L:G85:15 (PolySciTech, Akina Inc) was dissolved at 5 mg / mL concentration in dimethyl formamide (DMF) (Sigma Aldrich), DiR or Dil (Sigma Aldrich) were dissolved in DMF at 5 mg / mL, DOPS (Avanti Polar Lipids) was dissolved at 1 mg / mL in ethanol, low molecular weight chitosan (Sigma Aldrich) was dissolved at 2 mg / mL in 2% v / v acetic acid, and poly vinyl alcohol (PVA) (Sigma Aldrich) was dissolved at 5 mg / mL in water. The aqueous phase was prepared by adding varying volumes of DOPS or chitosan stocks into a 4% v / v ethanol or 1% v / v PVA solution, respectively. The organic phase was prepared by mixing 50 pL of DiR or Dil solution with 500 pL of PLGA stock. Blank NPs were prepared with only PLGA stock. The organic phase was added dropwise to the aqueous phase under continuous stirring at 1500 g, and the resulting NP solution was stirred for 90 minutes to stabilize. The solution was then centrifuged using an Amicon filter (EMD Millipore) (100 kDa molecular weight cut-off) at 5000 g and 4°C for 15 minutes. The NPs were washed with PBS, and the centrifugation and washing process was repeated three times. The NPs were characterized for size, charge, and polydisersity index using dynamic light scattering (Anton Paar, USA). The encapsulated amount of Dil or DiR within the NPs was quantified by dissolving the NPs in a 50:50 DMSO-water mixture and measuring the fluorescence intensity at excitation / emission wavelengths of 540 / 563 nm using a fluorescence plate reader (Tecan). Encapsulation efficiency was calculated using a standard formula:

[0280]

[0281] Synthesis of MINT nanoparticles encapsulating mR A

[0282] MINT nanoparticles encapsulating mRNA (also referred to as mRNA-loaded MINT NPs) were prepared as reported previously with extensive optimization. PLGA (5 mg / mL) and ionizable lipids (2.5 mg / mL) were dissolved in DMF, while l,2-distearoyl-sn-glycero-3-phosphoethanolamine- polyethylene glycol- 2000 (DSPE-PEG-2000) (Avanti Polar Lipids) (1 mg / mL) was prepared in nuclease-free water. Ionizable lipids, including 2-[2,2-bis[(9Z,12Z)-octadeca-9,12-dienyl]-l,3-dioxolan-4-yl]-N,N-dimethylethanamine (DLin-KC2-DMA), (6Z,9Z,28Z,3 lZ)-Heptatriaconta-6,9,28,31-tetraen- 19-yl 4- (dimethylamino)butanoate (DLin-MC3-DMA), 8-[(2-hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino]-octanoic acid, 1-octylnonyl ester (SM-102), l,l'-[[2-[4-[2-[[2-[bis(2-hydroxydodecyl)amino]ethyl](2-hydroxydodecyl)amino]ethyl]-1- piperazinyl]ethyl]imino]bis-2-dodecanol (C12-200) were purchased from Medchem Express. Ionizable lipid, l,2-Dioleoyl-3 -trimethylammonium propane (DOTAP) was purchased from Avanti Polar Lipids, while G0-C14, was synthesized as reported previously, using ring-opening polymerization reaction between the ethylene diamine core-poly(amidoamine) PAMAM dendrimer (Gen 0) and 1, 2 epoxy tetradecane purchased from Sigma Aldrich. Flue mRNA was purchased from TriLink Biotechnologies, while human Ghr mRNA and Scr mRNA were purchased from Synbio Technologies. The aqueous phase encapsulated DSPE-PEG (0.1 mg / mL) and DOPS (150 pg / mL) in nuclease-free water. For the organic phase, citrate buffer (10 mM, pH 3) was mixed with ionizable lipid (60 pL) and incubated for 5 minutes, followed by the addition of mRNA (10 pL, at a 1:15 mRNA-to-ionizable lipid weight ratio) and further incubation for 15 minutes. This mixture was combined with PLGA at varying lipid-to-polymer ratios to complete the organic phase, which was then added dropwise to the aqueous phase under continuous stirring at 1500g. The resulting mRNA-MINT NP solution was stirred for 30 minutes to stabilize, followed by three rounds of centrifugation at 5000g for 15 minutes using an Amicon filter (100 kDa), with the filtrate washed with ultra-pure water after each run. Same method was applied to encapsulate self-amplifying (saRNA). mRNA / saRNA encapsulation was assessed by dissolving the NPs in a 50:50 DMSO-water solution and quantifying the mRNA content using the Quant-iT™ RNA assay kit (Thermo Fisher Scientific), following the manufacturer’s protocol. Encapsulation efficiency was calculated using a standard formula:

[0283] mRNA amount encapsulated

[0284] %EE = * 100

[0285] mRNA amount added initally

[0286] siRNA NPs were also prepared by nanoprecipitation. The organic phase consisted of 10 uL siRNA (200 pM stock), 100 uL ionizable lipid and 500 uL PLGA. Aqueous phase consisted of 100 pg / mL DSPE-PEG and DOPS (150 pg / mL) in nuclease-free water. Organic phase was added dropwise to the aqueous phase under continuous stirring at 1500 g. The resulting siRNA-MINT NP solution was stirred for 30 minutes to stabilize, followed by three rounds of centrifugation at 5000g for 15 minutes using an Amicon filter (100 kDa), with the filtrate washed with ultra-pure water after each run. siRNA encapsulation was assessed by dissolving the NPs in a 50:50 DMSO-water solution and quantifying the siRNAcontent using the Quant-iT™ RNA assay kit (Thermo Fisher Scientific), following the manufacturer’s protocol.

[0287] Ex vivo targeting and penetration of glycosaminoglycan-depleted porcine cartilage

[0288] Porcine cartilage explants (6x1 mm) were incubated for 6 hours with PBS or varying concentrations of CDase (0.5-2 U / mL), or low concentration of combination of hyaluronidase (0.1%) and chondroitinase (O.lU / mL), or high concentration of combination of hyaluronidase (0.3%) and chondroitinase (lU / mL). NP targeting was assessed using either whole explants or explant sections. For section-based analysis, explants were paraffin sectioned and mounted on glass slides. Deparaffinized sections were incubated with Dil-loaded cationic or anionic NPs (5 pg / mL dye) for 1 hour at 37°C, washed with PBS and imaged with Leica DMi8 Widefield microscope. Fluorescence intensity was quantified using the ImageJ software. For whole explant analysis, DiR-loaded cationic / MINT NPs or DiR / Scr mRNA-loaded MINT NPs were incubated with explants for 1 hour at 37°C, washed with PBS, and imaged with an IVIS instrument (Bruker Xtreme). To assess NP penetration, explants were incubated with Dil-loaded MINT NPs for 48 hours at 37°C, washed with PBS, fixed in formalin, cryosectioned at 10pm thickness, and imaged using a fluorescence microscope (DP75 Olympus). The depth of NP penetration was measured using the Fiji software at 5-6 locations within each section. Twelve sections per treatment were analyzed.

[0289] Ex vivo assessment of glycosaminoglycan concentration in porcine cartilage

[0290] Porcine cartilage explants (6x1 mm) were incubated for 6 hours with PBS, low concentration of hyaluronidase (0.1%) and chondroitinase (0. lU / mL), or high concentration of hyaluronidase (0.3%) and chondroitinase (lU / mL). Postincubation, explants were digested overnight using Papain, and supernatants were then used to quantify glycosaminoglycan using a glycosaminoglycan assay kit (Chondrex).

[0291] Ex vivo lesion targeting and penetration of human osteoarthritic cartilage Healthy and osteoarthritic human cartilage samples were obtained from patients undergoing total knee replacement surgery at Tufts Medical Centre(age / sex: 60 / M, 67 / F), and from cadaveric joints (National Disease Research Interchange, age / sex: 74 / F). Articular cartilage slices of normal and osteoarthritic specimens were excised from the tibial plateau as previously described57. To evaluate lesion targeting, deparaffinized sections were incubated with Dil MINT NPs (Dil 5 pg / mL) for 1 hour at 37°C, washed with PBS, and imaged using a fluorescence microscope (Leica DMi8 Widefield Microscope). The amount of NP targeted to the tissues were quantified based on fluorescence intensity.

[0292] To assess cartilage penetration, cartilage explants (diameters 3-6 mm) were biopsy punched and cultured in chondrogenic growth medium (Lonza). Healthy and osteoarthritic human cartilage explants were incubated with DiL loaded MINT NPs or cationic NPs (Dil 10 pg / mL) for 48 hours at 37°C. Following incubation, the explants were fixed in formalin, cryosectioned at 10 pm thickness, and imaged using a fluorescence microscope (DP75 Olympus). The depth of NP penetration was measured using the Fiji software at 5-6 locations within each sections. Twelve sections per treatment were analyzed.

[0293] Ex vivo cartilage penetration in intact human finger joints

[0294] Human cadaveric finger joints were obtained from National Disease Research Interchange (age / sex: 68 / F). 30 pL of either Dil-loaded cationic NPs or Dil MINT NPs at a final Dil concentration of 1 pg / mL were injected into each PIP joint and incubated at 37°C and 5% CO2 for 24 hours. Three joints were used per particle. Joints were cryo-embedded and sectioned at 10pm using cryo-tape method58. These sections were mounted on glycerol-based mounting media and imaged using a fluorescence microscope (DP75 Olympus). Remaining tissue was destroyed post-experiment.

[0295] In vitro cell viability and transfection in TC28a2 human chondrocyte line Flue mRNA NPs were evaluated for their in vitro transfection efficiency using TC28a2 human articular chondrocyte cell line. TC28a2 cells were cultured in Dulbecco’s Eagle Modified medium (DMEM) (Gift from Dr. Mary Goldring) supplemented with 10% Fetal Bovine Serum (FBS) (Sigma Aldrich) and 1% penicillin-streptomycin (Thermo Fisher Scientific) at 37°C in 5% CO2 conditions. Upon reaching 80% confluency, cells were seeded at a density of 20,000 cells / well and then treated with Flue mRNA NPs at varying final mRNA concentration (0.125-2 pg / mL) for 24 hours. Post-24 hours, cell viability was tested usingCellTiter-Glo® luminescent cell viability assay (Promega) and luciferase expression was measured using Steady-Gio luciferase assay system (Promega) using a luminometer (Tecan). Cells treated with media alone were used as a control.

[0296] In vitro cellular uptake

[0297] To test the effect of DOPS on cellular uptake, TC28a2 cells were seeded at a seeding density of 0.3 M cells / well in a 6 well plate, followed by overnight incubation. Cells were treated with FITC-labelled PLGA DOPS NPs at 10 pg / mL PLGA concentration for 2 hours. Post 2 hours incubation, cells were washed with PBS twice, trypsinized and the pellet was resuspended in FACS buffer (PBS + 5% FBS). DAPI was used for live-dead staining. Media treated cells were used as control. Cells were collected in flow tubes and analysed using BD FACS Symphony A5.

[0298] Endosomal escape analysis

[0299] TC28a2 cells were seeded a seeding density of 20,000 cells / well and incubated with Cy5-tagged Scr mRNA-loaded MINT NPs at a final mRNA concentration of 1 pg / mL for 3 hours at 37°C. After the treatment period, NP-encapsulating medium was replaced with medium encapsulating LysoTracker Red DND-99 (75 nM) (Thermo Fisher Scientific) and cells were incubated for 1 hour. Hoechst staining was performed 30 minutes after LysoTracker staining. Cells were imaged using a confocal microscope (Zeiss LSM880 + FAST AiryScan Confocal).

[0300] In vitro transfection of ghrelin mRNA NP into TC28a2 cells

[0301] Cells were plated at a density of 105cells / well in a 24 well plate and treated with Ghr mRNA NPs (final concentration^ pg / mL) for 24 hours and supernatants were collected to quantify ghrelin levels using human ghrelin ELISA kit (Abeam), following manufacturer’s protocol. Cells treated with media alone were used as control.

[0302] In vitro silencing study

[0303] The silencing ability of MINT NPs was tested using GFP siRNA-loaded MINT NPs. GFP siRNA was loaded using DLinKC2DMA ionizable lipid. GFP expressing TC28a2 cells were seeded at a seeding density of 3 *105 cells / well in a 6 well plate. Cells were allowed to adhere overnight followed by treatment withmedia control or GFP siRNA-loaded MINT NP at a siRNA concentration of 100 nM for 24 hours. Chondrocyte cells with no GFP expression were used as control. Cells were then washed with PBS, trypsinized and centrifuged at 300 g for 5 mins. The pellet was resuspended in FACS buffer followed by flow cytometry using BD FACS Symphony A5. 20,000 events were recorded per sample.

[0304] Animals

[0305] All animal care and experimental procedures were approved by the Institutional Animal Care and Use Committees at Tufts University (Protocol #B2022-131). Mice were purchased from Charles River Laboratories or from Jackson Laboratory. Mice were caged in groups under the standard conditions with a 12-hour light / dark cycle and fed with a standard chow diet. Mice were euthanized by carbon dioxide overdose followed by cervical dislocation.

[0306] In vivo biocompatibility test of mRNA-loaded MINT NPs

[0307] Four microliters of Flue mRNA NPs (2pg mRNA per joint) were injected into both knee joints of 11-week-old CD1 mice. Seven days post-injection, the mice were euthanized, and their joints were harvested, fixed in formalin, decalcified, embedded in paraffin (Paraplast plus), and sectioned for histological analysis.

[0308] In vivo assessment of the duration of MINT NP-mediated luciferase mRNA / saRNA delivery in healthy mice

[0309] Five microliters of FLuc mRNA NPs (2 pg mRNA per joint) were injected into both knee joints of healthy 10-13-weeks-old CD-I mice. At one, two, or three days post-NP injection, D-Luciferin (4pL, 30pg / pL; Sigma Aldrich) was administered into the joints, followed by luminescence imaging using IVIS to determine luciferase expression. Similarly, five microliters of FLuc saRNA NPs (2 pg saRNA per joint) were injected into both knee joints of healthy C57BL6 mice. At 1, 3, 5, 7, 10, 14, 18, 21 days post-NP injection, Cyclic-Luciferin (200pL, 5 pg / pL; Sigma Aldrich) was administered into the joints intraperitoneally, followed by luminescence imaging using IVIS to determine luciferase expression.

[0310] Mouse osteoarthritis models

[0311] For ACLT osteoarthritis models, 10 to 13-weeks-old CD1 mice were anesthetized using isoflurane / Ch inhalation. Buprenorphine Extended Release (0.5mg / kg) was pre-operatively administered subcutaneously. The right knee of the mouse as sterilized, and the medial skin of the knee was incised. The patella was displaced laterally to expose the knee joint and the ACL was transected as described previously. Left knees served as the non-operated control. For monosodium iodoacetate (MIA)-induced osteoarthritic models, 10 to 43-weeks-old C57B / 6 mice were injected with 5pL of MIA (Sigma-Aldrich, of 0.2 mg / mL) intra-articularly into the right knee and used 9 days later for MINT NP assessment. The left knee was injected with PBS as a sham joint. Allocation of mice into treatment groups were randomized by randomly distributing treatments within each cage. Each mouse was thereafter numbered to be identified for the treatments given.

[0312] In vivo assessment of disease-responsiveness of MINT NP mediated mRNA delivery

[0313] Five microliters of Flue mRNA NPs (2 pg mRNA per joint) were injected into ACLT and non-operated knee joints of mice at two, four, or six weeks postsurgery. Twenty -four hours after NP injection, D-Luciferin (4pL, 30 pg / pL; Sigma Aldrich) was administered into the joints, and luminescence was imaged and quantified using IVIS.

[0314] In vivo chondrocyte targeting and mRNA expression in osteoarthritic mice Five microliters of Cy3 tagged GFP mRNA NPs (2 pg mRNA per joint) were injected into 4weeks post- ACLT knee joints. Twenty-four hours after NP injection knee joints were harvested and processed for cryo-tape sectioning. Fluorescent microscopy was used to identify chondrocytes with Cy3 signal and GFP signal.

[0315] In vivo assessment of MINT NP mediated human ghrelin mRNA delivery in osteoarthritic mice

[0316] To assess MINT NP delivery of ghrelin mRNA in vivo, 5pL of Ghr mRNA NPs (2pg of unmodified or modified mRNA per joint) were injected into MIA-treated mouse joints at 9 days post-MIA injection. Joints were harvested 24 hours after mRNA NP injections for ELISA analysis of Ghr protein expression. To assess the duration of Ghr mRNA delivery, 5 pL of modified Ghr mRNA NPs (2pg / joint) was injected into the knee joints two weeks post- ACLT surgery, and mice were euthanized on days 1, 2, and 3 post-injections. Harvested joints from both MIAand ACLT models were flash-frozen, homogenized using a Bullet Blender tissue homogenizer (Next Advances) with 1.5 mL Navy Bead Lysis kits (Next Advances), and centrifuged at 12,000g for 10 minutes. Supernatants were collected and analyzed using a human Ghr ELISA kit (Abeam) to confirm human Ghr protein expression.

[0317] In vivo assessment of biological efficacy of human ghrelin mRNA delivery in osteoarthritic mice

[0318] One-week post- ACLT surgery, mice were inj ected with 5 pL of either PB S, Ghr mRNA NP (2 pg mRNA per joint) or Scr mRNA NP (2 pg mRNA per joint), followed by repeated injections once a week. Mice were euthanized at week 6 and joints were harvested and paraffin sectioned for histological assessment. For analysis of neuronal pain activation, lumbar dorsal root ganglion (DRG) (L3-L5) were isolated from spinal columns of mice injected with PBS or ghrelin mRNA loaded NPs, as previously described60. DRGs were fixed with 4% paraformaldehyde for 3 hours, then cryosectioned.

[0319] Von Frey analysis for mechanical allodynia

[0320] For pain assessment in ACLT mice injected with control or Ghrelin mRNA loaded NPs, mice were subjected to Von Frey analysis at 5- and 6-weeks post-surgery. The testing was done by applying a Von Frey filaments of varying forces (0.08-78.4 mN) at the paw of the mice using the 50% withdrawal threshold method61, 62. The threshold at which the mice withdraw its paw was noted and plotted to assess the pain levels. Left paws served as a healthy control and the data was plotted as withdrawal threshold (g) or withdrawal threshold ratio of the ACLT (right) knee to the healthy unoperated (left) knee.

[0321] Histological Analysis

[0322] For cryosection analysis, samples were fixed in 10% formalin for 24 hours, then equilibrated with sucrose gradient (25%, 50%, 75%). For isolated cartilage explants or DRG, samples were equilibrated with OCT overnight and cryoembedded in OCT and cryo-sectioned (Leica) at 10pm. For intact human PIP joints, samples were embedded in SCEM embedding media without decalcification and cryo-sectioned (Leica) at 10pm using the cryo-tape method. For paraffin sections on mouse joints, samples were fixed in 10% formalin for 24 hours, and then decalcified in 0.33M EDTA for 10 days. Samples weresubsequently embedded in paraffin (Paraplast plus) and sectioned at 5pm thickness.

[0323] Sections were stained with 0.1% Safranin O and counter stained with 0.02% Fast Green and 50% Harris Hematoxylin64. Cartilage integrity for mouse knee joints was evaluated by an OARSI scoring and ACS scoring based on the loss of Safranin O and the structure of the articular cartilage surface64. Subchondral bone sclerosis was determined using previously described methods of determining the ratio of subchondral bone plate area to total subchondral bone area, as measured using Fiji imaging software57. Cartilage integrity for human cartilage explants was evaluated by the established MANKIN scoring method based on the structure of the surface, cellular morphology, Safranin O staining and tidemark integrity26. To determine synovial inflammation, sections were stained with 1% Eosin Y in 70% Ethanol and 100% Harris Hematoxylin. Severity of synovitis was then scored based on cellularity, immune cell infiltration and stromal thickness, using the established method65. For cell death assessment, the TUNEL in situ detection kit (Roche) was used following manufacturer’s instruction. Images were captured with fluorescence microscopy (DP74 Olympus). Targeting and binding were quantified using ImageJ. Cell death rates were determined as the percentage of TUNEL-positive cells among DAPI positive cells. All histological scoring and quantification were performed blind to the conditions of the experiment.

[0324] Immunohistochemistry

[0325] For formalin fixed paraffin embedded (FFPE) sectioned and cryosectioned dorsal root ganglion (DRG) immunofluorescence staining, heat-induced nuclear antigens retrieval in lOmM citrate buffer at pH 6.0 was performed by steaming the sections for 10 minutes. Sections were incubated overnight at 4°C with primary antibody overnight: Ghrelin (Abeam), MMP13 (Proteintech), MMP3 (Proteintech), CGRP (Cell Signaling Technology), TRPV1 (Abeam), NeuN (Proteintech); and the following secondary antibody for two hours: Goat antiRabbit IgG (H + L) conjugated to AlexaFluor 594 (Invitrogen) and Goat antiMouse IgG (H+L) conjugated to AlexaFluor 488 (Invitrogen). Fluorescent sections were counterstained with DAPI. MMP3 and MMP13 integrated density was quantified using FIJI. Double positive staining of TRPV1 and NeuN or CGRP and NeuN were quantified using FIJI. All quantification were performed blind to the conditions of the experiment.Molecular Docking Simulation for DOPS with cartilage matrix components

[0326] To evaluate the binding interactions between DOPS and key components of the cartilage matrix — Collagen type II and GAGs — a solvated lipid bilayer model was generated using CHARMM-GUI Membrane Builder to represent our coating formulation. The bilayer consisted of 100% DOPS lipids, with each leaflet comprising 100 DOPS lipids, yielding a membrane surface area of 84.62 x 84.62 A2 in the x-y plane. Molecular docking (MD) simulations were performed using Biovia Discovery Studio 2021 Client and PyRx (version 0.8) software to assess binding affinities and characterize molecular interactions. The 3D structures of the cartilage components — Collagen Type II fragment (residues 245-270, CID: 131848175), chondroitin sulfate disaccharide (CID: 146037056), highly N, O-sulfated glycosaminoglycan (CID: 3726152), lowly N, O-Sulfated glycosaminoglycan (CID: 3726151), hyaluronic acid (CID: 155925852), and keratan sulfate (CID: 446715) — were downloaded in .sdf format from the PubChem database. Prior to docking, all ligand structures were imported into PyRx, where they underwent energy minimization and geometry optimization with the OpenBabel toolkit, and subsequently converted to the .pdbqt format. MD simulations were performed using AutoDock Vina within the PyRx framework, with the prepared cartilage components treated as flexible ligands and the DOPS bilayer as a macromolecule. The simulations were confined to a grid box with the dimensions of 70x70x25 A3, centered at (0, 0, 20) A to encompass the upper leaflet of the 1 membrane. Following the docking simulations, the binding free energy (kcal / mol) for the topscoring conformation of each DOPS-ligand complex was recorded. These docked conformations were then visualized and analyzed in Biovia Discovery Studio to characterize the specific intermolecular interactions.

[0327] Statistical analysis

[0328] Statistical analysis and graph preparations were done using GraphPad Prism. All experiments were repeated at least 3 times, and the values are reported as mean ± standard error of mean (SEM). For functional analysis, we determined that N=8 mice and N=5 human primary cells and tissues of the same treatment will yield a power of 0.8 to identify a 50% difference at a significance level a of 0.05. Considering unexpected mortality, the number may be adjusted as experiments progress. The two-tailed Student’s t-test was used to compare two experimentalgroups, p<0.05 was considered significant. Outliers were identified and removed using ROUT Test (Q=10%) in Prism. One-way ANOVA with Tukey’s post hoc analysis was conducted to compare more than two groups. Two-way ANOVA with either Tukey’s post hoc analysis or uncorrected Fisher’s test was conducted to compare more than two groups. * denotes p<0.05, ** denotes p<0.01, *** denotes p<0.001 and **** denotes pO.OOOl. NS: not significant. Data distribution was assumed to be normal, but this was not formally tested.

[0329] The following methods were used for Example 8. Unless otherwise specified, applicable methods above were also used for Example 8.

[0330] Animals

[0331] All animal care and experimental procedures were approved by the Institutional Animal Care and Use Committees at Tufts University (Protocol #B2022-131). ZMPSTE24- / - mice were a gift from Dr. Alexander Poltorak at Tufts University School of Medicine. Mice were caged in groups under the standard conditions with a 12-hour light / dark cycle and fed with a standard chow diet. Mice were euthanized by carbon dioxide overdose followed by cervical dislocation.

[0332] MINT NP injection

[0333] 13 week old ZMPSTE24- / - mice were injected with either Ghrelin mRNA or Scrambled mRNA loaded MINT NPs (2pg mRNA / joint) in the right joint at week 0 and week 2. Left joints were kept as non-operative control. Joints were harvested at 17 weeks of age, or at Week 4 of the experiment.

[0334] Von Frey analysis for mechanical allodynia

[0335] For pain assessment in ZMPSTE24- / - mice injected with Scrambled or Ghrelin mRNA-loaded NPs mice were subjected to Von Frey analysis at Week 0 and Week 2. The testing was done by applying Von Frey filaments of varying forces (0.08-78.4 mN) to the paw of the mice using the 50% withdrawal threshold method. The threshold at which the mice withdrew their paw was noted and plotted to assess the pain levels. Left paws served as a healthy control, and the data were plotted as withdrawal threshold (g) or withdrawal threshold ratio of the NP inj ected (right) knee to the healthy unoperated (left) knee.Tissue processing and sectioning

[0336] Knee joints from euthanized mice were fixed in 4% formalin and decalcified in 300 mM EDTA for 10 days. Following decalcification, joints were gradually dehydrated through a graded ethanol series (70%, 80%, 95%, and two times 100%), followed by two changes of 100% xylene. Joints were subsequently immersed in melted paraffin overnight. Joints were embedded in paraffin and sectioned at a thickness of 5pm using a LEICA RM2255 microtome.

[0337] Histological Analysis

[0338] Sections were stained with 0.1% Safranin O and counterstained with 0.02% Fast Green and 50% Harris Hematoxylin. Cartilage integrity for mouse knee joints was evaluated by an OARSI scoring and ACS scoring based on the loss of Safranin O and the structure of the articular cartilage surface. Synovial inflammation was evaluated on the same Safranin O / Fast Green and Harris Hematoxylin-stained knee joint sections using a scoring system adapted from Krenn et al. Synovial lining thickness, stromal cellularity, and inflammatory cell infiltration were each scored from 0 to 3 (0 = absent, 1 = mild, 2 = moderate, 3 = severe), and summed to generate a total synovitis score (0-9). Total scores were categorized as no synovitis (0-1), low-grade synovitis (2-4), or high-grade synovitis (5-9).

[0339] Immunofluorescence (IF) staining

[0340] To evaluate senescence markers, IF staining was performed on paraffin section knee joints. Sections were deparaffinized and rehydrated as mentioned in 2.3, followed by antigen retrieval, quench autofluorescence, and block with 10% goat serum (Fisher Scientific) before incubation. Incubation with primary pl6 antibody (Invitrogen, 1:100,) at 4 °C overnight, followed by secondary antibody incubation with Alexa Fluor 594-conjugated goat anti-rabbit (1:500, Invitrogen) and diaminophenylindole (DAPI, 1:1000) to stain the nucleus.

[0341] All patents, patent application publications, and patent applications, as well as any other publications, including those in the "References" below, that are referred to in this specification and / or listed in the Application Data Sheet, including U.S. Provisional Patent Application No. 63 / 756,779, filed February 10, 2025, are incorporated herein by reference, in their entirety. Aspects of the embodiments can be modified, if necessary to employ concepts of the variouspatents and applications to provide yet further embodiments. The various embodiments described above can be combined to provide further embodiments.

[0342] While specific embodiments of the invention have been illustrated and described, it will be readily appreciated that the various embodiments described above can be combined to provide further embodiments, and that various changes can be made therein without departing from the spirit and scope of the invention. These and other changes can be made to the embodiments in light of the abovedetailed description.

[0343] In general, in the following claims, the terms used should not be construed to limit the claims to the specific embodiments disclosed in the specification and the claims, but should be construed to include all possible embodiments along with the full scope of equivalents to which such claims are entitled. Accordingly, the claims are not limited by the disclosure.

[0344] References

[0345] Katz, J.N., Arant, K.R. & Loeser, R.F. Diagnosis and Treatment of Hip and Knee Osteoarthritis: A Review. JAMA 325, 568-578 (2021); Jiang, P., Hu, K., Jin, L. & Luo, Z. A brief review of current treatment options for osteoarthritis including disease-modifying osteoarthritis drugs (DMOADs) and novel therapeutics. Ann Med Surg (Lond) 86, 4042-4048 (2024); Li, X., Shen, L., Deng, Z. & Huang, Z. New treatment for osteoarthritis: Gene therapy. Precis Clin Med 6, pbad014 (2023); Evans, C.H., Ghivizzani, S.C. & Robbins, P.D. Osteoarthritis gene therapy in 2022. Curr Opin Rheumatol 35, 37-43 (2023); Bedingfield, S.K. et al. Amelioration of post-traumatic osteoarthritis via nanoparticle depots delivering small interfering RNA to damaged cartilage. Nat Biomed Eng 5, 1069-1083 (2021); Nap, R.J. & Szleifer, I. Structure and interactions of aggrecans: statistical thermodynamic approach. Biophys J 95, 4570-4583 (2008); Bittersohl, B. et al. Delayed gadolinium-enhanced magnetic resonance imaging of hip joint cartilage: pearls and pitfalls. Orthop Rev (Pavia) 3, ell (2011); Tiderius, C.J., Olsson, L.E., Leander, P., Ekberg, O. & Dahlberg, L. Delayed gadolinium-enhanced MRI of cartilage (dGEMRIC) in early knee osteoarthritis. Magn Reson Med 49, 488-492 (2003); Xiao, S., Tang, Y., Lin, Y., Lv, Z. & Chen, L. Tracking Osteoarthritis Progress through Cationic Nanoprobe-Enhanced Photoacoustic Imaging ofCartilage. Acta Biomater 109, 153-162 (2020); Chen, L. et al. Cationic poly-1-lysine-encapsulated melanin nanoparticles as efficient photoacoustic agents targeting to glycosaminoglycans for the early diagnosis of articular cartilage degeneration in osteoarthritis. Nanoscale 10, 13471-13484 (2018); Lu, R. et al. Gadolinium-hyaluronic acid nanoparticles as an efficient and safe magnetic resonance imaging contrast agent for articular cartilage injury detection. Bioact Mater 5, 758-767 (2020); Fazeli, P.K. et al. Treatment With a Ghrelin Agonist in Outpatient Women With Anorexia Nervosa: A Randomized Clinical Trial. J Clin Psychiatry 79 (2018); Tschop, M., Smiley, D.L. & Heiman, M.L. Ghrelin induces adiposity in rodent s. Nature 407, 908-913 (2000); Guillory, B. et al. Deletion of ghrelin prevents aging-associated obesity and muscle dysfunction without affecting longevity. Aging Cell 16, 859-869 (2017); Baatar, D., Patel, K. & Taub, D.D. The effects of ghrelin on inflammation and the immune system. Mol Cell Endocrinol 340, 44-58 (2011); Andrews, Z.B. et al. UCP2 mediates ghrelin's action on NPY / AgRP neurons by lowering free radicals. Nature 454, 846-851 (2008); Stoyanova, II Ghrelin: a link between ageing, metabolism and neurodegenerative disorders. Neurobiol Dis 72 Pt A, 72-83 (2014); Sibilia, V. et al. Pharmacological characterization of the ghrelin receptor mediating its inhibitory action on inflammatory pain in rats. Amino Acids 43, 1751-1759 (2012); Sun, J. et al. Role and molecular mechanism of ghrelin in degenerative musculoskeletal disorders. J Cell Mol Med 27, 3681-3691 (2023); Liu, J. et al. Ghrelin prevents articular cartilage matrix destruction in human chondrocytes. Biomed Pharmacother 98, 651-655 (2018); Qu, R. et al. Ghrelin protects against osteoarthritis through interplay with Akt and NF-kappaB signaling pathways. FASEB J 32, 1044-1058 (2018); Bautista, C.A., Park, H.J., Mazur, C.M., Aaron, R.K. & Bilgen, B. Effects of Chondroitinase ABC-Mediated Proteoglycan Digestion on Decellularization and Recellularization of Articular Cartilage. PLoS One 11, e0158976 (2016); Bergholt, N.L., Lysdahl, H., Lind, M. & Foldager, C.B. A Standardized Method of Applying Toluidine Blue Metachromatic Staining for Assessment of Chondrogenesis. Cartilage 10, 370-374 (2019); Bajpayee, A.G. & Grodzinsky, A. J. Cartilage-targeting drug delivery: can electrostatic interactions help? Nat Rev Rheumatol 13, 183-193 (2017); Gao, T. et al. Non-Destructive Spatial Mapping of Glycosaminoglycan Loss in Native and Degraded Articular Cartilage Using Confocal Raman Microspectroscopy. Front Bioeng Biotechnol 9, 744197 (2021); Pauli, C. et al. Comparison of cartilage histopathology assessmentsystems on human knee joints at all stages of osteoarthritis development. Osteoarthritis Cartilage 20, 476-485 (2012); Kleuskens, M.W.A., van Donkelaar, C.C., Kock, L.M., Janssen, R.P.A. & Ito, K. An ex vivo human osteochondral culture model. J Orthop Res 39, 871-879 (2021); Wei, Y. et al. Phospholipase A(2) inhibitor-loaded micellar nanoparticles attenuate inflammation and mitigate osteoarthritis progression. Sci Adv 7 (2021); Abumanhal-Masarweh, H. et al. Tailoring the lipid composition of nanoparticles modulates their cellular uptake and affects the viability of triple negative breast cancer cells. J Control Release 307, 331-341 (2019); Uchimura, T. et al. Erythromycin acts through the ghrelin receptor to attenuate inflammatory responses in chondrocytes and maintain joint integrity. Biochem Pharmacol 165, 79-90 (2019); Drevet, S., Favier, B., Brun, E., Gavazzi, G. & Lardy, B. Mouse Models of Osteoarthritis: A Summary of Models and Outcomes Assessment. Comp Med 72, 3-13 (2022); Yu, L. et al. The role of TRPV1 in different subtypes of dorsal root ganglion neurons in rat chronic inflammatory nociception induced by complete Freund's adjuvant. Mol Pain 4, 61 (2008); DeJulius, C.R. et al. Engineering approaches for RNA-based and cellbased osteoarthritis therapies. Nat Rev Rheumatol 20, 81-100 (2024); Gao, J. et al. Gene therapy for CNS disorders: modalities, delivery and translational challenges. Nat Rev Neurosci (2024); Chen, H. et al. Urchin-like ceria nanoparticles for enhanced gene therapy of osteoarthritis. Sci Adv 9, eadf0988 (2023); Shin, H. J. et al. p47phox siRNA-Loaded PLGA Nanoparticles Suppress ROS / Oxidative Stress-Induced Chondrocyte Damage in Osteoarthritis. Polymers (Basel) 12 (2020); Aini, H. et al. Messenger RNA delivery of a cartilage-anabolic transcription factor as a disease-modifying strategy for osteoarthritis treatment. Sci Rep 6, 18743 (2016); Yan, H. et al. Induction of WNT16 via Peptide-mRNA Nanoparticle-Based Delivery Maintains Cartilage Homeostasis. Pharmaceutics 12 (2020); 39.

[0346] Geiger, B.C., Wang, S., Padera, R.F., Jr., Grodzinsky, A. J. & Hammond, P.T. Cartilage-penetrating nanocarriers improve delivery and efficacy of growth factor treatment of osteoarthritis. Sci Transl Med 10 (2018); Vedadghavami, A. et al. Cartilage penetrating cationic peptide carriers for applications in drug delivery to avascular negatively charged tissues. Acta Biomater 93, 258-269 (2019); Konttinen, Y.T. et al. Acidic cysteine endoproteinase cathepsin K in the degeneration of the superficial articular hyaline cartilage in osteoarthritis. Arthritis Rheum 46, 953-960 (2002); Paulini, F. et al. In Vivo Evaluation of DMSA-Coated Magnetic Nanoparticle Toxicity and Biodistribution in Rats: A Long-TermFollow-Up. Nanomaterials (Basel) 12 (2022); Dantas, G.P.F., Ferraz, F.S., Andrade, L.M. & Costa, G.M.J. Male reproductive toxicity of inorganic nanoparticles in rodent models: A systematic review. Chem Biol Interact 363, 110023 (2022); Li, Y., Vulpe, C., Lammers, T. & Pallares, R.M. Assessing inorganic nanoparticle toxicity through omics approaches. Nanoscale 16, 15928-15945 (2024); Akalu, Y., Molla, M.D., Dessie, G. & Ayelign, B. Physiological Effect of Ghrelin on Body Systems. Int J Endocrinol 2020, 1385138 (2020); Wakabayashi, H., Arai, H. & Inui, A. The regulatory approval of anamorelin for treatment of cachexia in patients with non-small cell lung cancer, gastric cancer, pancreatic cancer, and colorectal cancer in Japan: facts and numbers. J Cachexia Sarcopenia Muscle 12, 14-16 (2021); Yasar, H. et al. Kinetics of mRNA delivery and protein translation in dendritic cells using lipid-coated PLGA nanoparticles. J Nanobiotechnology 16, 72 (2018); Lutz, J. et al. Unmodified mRNA in LNPs constitutes a competitive technology for prophylactic vaccines. NPJ Vaccines 2, 29 (2017); Pardi, N. et al. Expression kinetics of nucleoside-modified mRNA delivered in lipid nanoparticles to mice by various routes. J Control Release 217, 345-351 (2015); Qin, S. et al. mRNA-based therapeutics: powerful and versatile tools to combat diseases. Signal Transduct Target Ther 7, 166 (2022); Unti, M.J. & Jaffrey, S.R. Highly efficient cellular expression of circular mRNA enables prolonged protein expression. Cell Chem Biol 31, 163-176 el65 (2024); Musumeci, G. et al. Histochemistry as a unique approach for investigating normal and osteoarthritic cartilage. Eur J Histochem 58, 2371 (2014); Zhang, L. et al. Selfassembled lipid— polymer hybrid nanoparticles: a robust drug delivery platform. ACS Nano 2, 1696-1702 (2008); Xiao, Y. et al. Combining p53 mRNA nanotherapy with immune checkpoint blockade reprograms the immune microenvironment for effective cancer therapy. Nat Commun 13, 758 (2022); Kong, N. et al. Synthetic mRNA nanoparticle-mediated restoration of p53 tumor suppressor sensitizes p53-deficient cancers to mTOR inhibition. Sci Transl Med 11 (2019); Huang, X. et al. Synthesis of siRNA nanoparticles to silence plaquedestabilizing gene in atherosclerotic lesional macrophages. Nat Protoc 17, 748-780 (2022); Uchimura, T., Foote, A.T., Smith, E.L., Matzkin, E.G. & Zeng, L. Insulin-Like Growth Factor II (IGF-II) Inhibits IL- 1 beta-induced Cartilage Matrix Loss and Promotes Cartilage Integrity in Experimental Osteoarthritis. J Cell Biochem 116, 2858-2869 (2015); Kawamoto, T. & Kawamoto, K. Preparation of Thin Frozen Sections from Nonfixed and Undecalcified Hard Tissues UsingKawamoto's Film Method (2020). Methods Mol Biol 2230, 259-281 (2021); Glasson, S.S., Blanchet, T.J. & Morris, E.A. The surgical destabilization of the medial meniscus (DMM) model of osteoarthritis in the 129 / SvEv mouse. Osteoarthritis Cartilage 15, 1061-1069 (2007); Sleigh, J.N., Weir, G.A. & Schiavo, G. A simple, step-by-step dissection protocol for the rapid isolation of mouse dorsal root ganglia. BMC Res Notes 9, 82 (2016); Chaplan, S.R., Bach, F.W., Pogrel, J.W., Chung, J.M. & Yaksh, T.L. Quantitative assessment of tactile allodynia in the rat paw. J Neurosci Methods 53, 55-63 (1994); Kameda, T., Kaneuchi, Y., Sekiguchi, M. & Konno, S.I. Measurement of mechanical withdrawal thresholds and gait analysis using the CatWalk method in a nucleus pulposus-applied rodent model. J Exp Orthop 4, 31 (2017); Kawamoto, T. & Kawamoto, K. Preparation of thin frozen sections from nonfixed and undecalcified hard tissues using Kawamot's film method (2012). Methods Mol Biol 1130, 149-164 (2014); McNulty, M.A. et al. A Comprehensive Histological Assessment of Osteoarthritis Lesions in Mice. Cartilage 2, 354-363 (2011); Krenn, V. et al. Synovitis score: discrimination between chronic low-grade and high-grade synovitis. Histopathology 49, 358-364 (2006).

Claims

CLAIMS1. A therapeutic matrix inverse targeting (MINT) nanoparticle comprising:a MINT nanoparticle comprising:a biocompatible polymer; andan anionic coating; anda therapeutic material encapsulated in the MINT nanoparticle.

2. The therapeutic MINT nanoparticle of claim 1, wherein the biocompatible polymer comprises poly(lactic-co-glycolic acid) (PLGA).

3. The therapeutic MINT nanoparticle of claim 2, wherein the PLGA has a molecular weight in a range from 10 to 100 kDa.

4. The therapeutic MINT nanoparticle of claim 2 or claim 3, comprising PLGA in a concentration in a range from 2 to 50 mg / mL.

5. The therapeutic MINT nanoparticle of any one of claims 1-4, wherein the anionic coating comprises l,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS).

6. The therapeutic MINT nanoparticle of claim 5, comprising DOPS in a concentration range from 50 to 500 pg / mL.

7. The therapeutic MINT nanoparticle of any one of claims 1 to 6, wherein the therapeutic MINT nanoparticle has a negative zeta potential in a range from -10 to -60 mV.

8. The therapeutic MINT nanoparticle of any one of claims 1 to 7, wherein the MINT nanoparticle further comprises an ionizable liquid.

9. The therapeutic MINT nanoparticle of claim 8, wherein the ionizable liquid comprises one or more of: G0-C14, C12-200, DOTAP, SM102, DLinKC2DMA, DLinMC3DMA, ALC0315, cKK-E12, L319, FTT5, OF-C4-Deg-Lin, and any combinations thereof.

10. The therapeutic MINT nanoparticle of claim 8 or claim 9, wherein the therapeutic MINT nanoparticle comprises ionizable liquid and biocompatible polymer in a ratio range from 1:3 to 1:12.

11. The therapeutic MINT nanoparticle of any one of claims 1-10, wherein the therapeutic MINT nanoparticle further comprises a PEGylated lipid on an exterior surface.

12. The therapeutic MINT nanoparticle of claim 11, wherein the PEGylated lipid comprises l,2-distearoyl-sn-glycero-3-phosphoethanolamine-poly(ethylene glycol) (DSPE-PEG).

13. The therapeutic MINT nanoparticle of any one of claims 1-12, wherein the therapeutic material comprises a nucleic acid.

14. The therapeutic MINT nanoparticle of claim 13, wherein the nucleic acid comprises a small interfering ribonucleic acid (siRNA), messenger RNA (mRNA), selfamplifying RNA (saRNA), circular mRNA, microRNA (miRNA), or plasmid Deoxyribonucleic acid (pDNA).

15. The therapeutic MINT nanoparticle of claim 14, wherein the nucleic acid comprises mRNA in a concentration range from 0.1 to 10 pg / mL.

16. The therapeutic MINT nanoparticle of any one of claims 13-15, wherein the nucleic acid comprises a modified nucleotide.

17. The therapeutic MINT nanoparticle of any one of claims 13-16, wherein the modified nucleotide comprises N6-methyladenosine (m6A), 2'-O-methylation, pseudouridine, or N 1 -Methylpseudouridine.

18. The therapeutic MINT nanoparticle of any one of claims 13-17, wherein the nucleic acid encodes a protein comprising human ghrelin.

19. The therapeutic MINT nanoparticle of any one of claims 13-18, wherein the nucleic acid encodes a protein having an amino acid sequence comprising SEQ ID NO: 1.

20. The therapeutic MINT nanoparticle of any one of claims 13-19, wherein the nucleic acid has a sequence comprising SEQ ID NO: 2.

21. The composition comprising a therapeutic MINT nanoparticle of any one of claims 1-20 and a pharmaceutically acceptable carrier.

22. A method of treating an articular cartilage disease characterized by a decrease in glycosaminoglycan in extracellular matrix of articular cartilage, the method comprising administering to a patient having the articular cartilage disease a therapeutically effective amount of a therapeutic MINT nanoparticle of any one of claims 1-20 or a composition of claim 21.

23. The method of claim 22, further comprising administering the therapeutic MINT nanoparticle or the composition by injection into articular cartilage.

24. The method of claim 22 or claim 23, comprising administering the therapeutic MINT nanoparticle or composition once weekly.

25. The method of any one of claims 21-24, wherein the disease comprises an inflammatory or degenerative cartilage disease.

26. The method of any one of claims 21-25, wherein the disease comprises post-traumatic cartilage injury.

27. The method of any one of claims 21-25, wherein the disease comprises an arthritis disease.

28. The method of claim 27, wherein the disease comprises osteoarthritis.

29. The method of claim 27, wherein the disease comprises rheumatoid arthritis.

30. The use of a therapeutic MINT nanoparticle of any one of claims 1-20 or a composition of claim 21 in the formulation of a medicament for treatment of a disease characterized by decrease of glycosaminoglycan in extracellular matrix of articular cartilage.

31. The use according to claim 30, wherein the disease comprises osteoarthritis.

32. A kit comprising a therapeutic MINT nanoparticle according to any one of claims 1-20 or a composition of claim 21 and instructions for use according to any one of claims 22-30.