Recombinant vector and use thereof for treating hereditary skin disease
Patent Information
- Application Number
- PCT/CN2026/079950
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-02-25
- Filing Date
- 2026-02-25
- Publication Date
- 2026-09-03
Smart Images

Figure PCTCN2026079950-FTAPPB-I100001 
Figure PCTCN2026079950-FTAPPB-I100002 
Figure PCTCN2026079950-FTAPPB-I100003
Abstract
Description
A recombinant vector and its application in treating genetic skin diseases Technical Field
[0001] This invention relates to the field of biotechnology, specifically to a replication-defective recombinant viral vector and its applications. Background Technology
[0002] Dominant-negative effects occur in alleles; when one gene is mutated, the function of the other normal allele is also affected. Some genes encoding skin-related keratin and connective proteins exhibit dominant-negative effects. These mutations not only cause the mutant protein to lose function but also interfere with the function of normal proteins, leading to more severe phenotypes. Dominant and negative genes that cause skin genetic diseases include the pathogenic mutated genes selected from one or more of the following groups: KRT1, KRT2, KRT3, KRT4, KRT5, KRT6, KRT7, KRT9, KRT10, KRT14, KRT16, KRT17, PLEC, KLHL24, CD151, DST, EXPH5, TGM5, JUP, PKP1, DSP, GJB2, LOR, EDAR, EDARR, and WNT10A, etc., which can cause a variety of skin genetic diseases, including simple bullous epidermolysis, congenital bullous ichthyosis-like erythroderma, epidermolytic hyperkeratosis, palmoplantar keratosis, skin fragility syndrome, keratotic dermatitis, and ichthyosis, etc.
[0003] Epidermolysis bullosa (EB), also known as hemidesmomeric epidermolysis bullosa or hereditary epidermolysis bullosa, comprises a group of rare, clinically and genetically heterogeneous inherited skin disorders, with an estimated 500,000 cases worldwide. It is characterized by moderate to extreme fragility of the epithelial tissue, resulting in skin blisters or erosions (mechanical bullous dermatopathy) after minor trauma or friction. The pathogenic mechanism is a change in skin structure caused by genetic defects in epidermal keratin or dermal-epidermal intercellular anchoring proteins. Epidermolysis bullosa simplex (EBS) is the most common subtype of EB, characterized by fragile skin (and in some cases, mucosal epithelial cells), leading to non-scarring blisters and erosions from minor mechanical injury. EBS differs from other types of EB or non-EB skin fragility syndromes in the location of the blisters relative to the dermal-epidermal junction. In EBS, the blisters occur within basal keratinocytes. The severity of the blisters ranges from limited to the hands and feet to widespread involvement. Other features may include hyperkeratosis of the palms and soles (cutaneous keratosis), nail dystrophy, miliaria, and hyperpigmentation and / or hypopigmentation. Rare subtypes of EBS are associated with other clinical features, including pyloric atresia, muscular dystrophy, cardiomyopathy, and / or nephropathy.
[0004] EBS-causing genes include KRT5, KRT14, PLEC, EXPH5, TGM5, JUP, PKP1, DST, CD151, KLHL24, and DSP. Most cases of EBS are inherited in an autosomal dominant pattern, with a smaller proportion inherited in an autosomal recessive pattern. Autosomal dominant EBS is associated with heterozygous dominant-negative variants in KRT5, KRT14, or PLEC, or heterozygous pathogenic variants in KLHL24. Autosomal recessive EBS is associated with biallelic loss-of-function variants in KRT5, KRT14, or PLEC, or biallelic pathogenic variants in CD151, DST, or EXPH5. Over 75% of EBS cases are caused by mutations in the KRT5 and KRT14 genes, the vast majority of which are heterozygous dominant-negative variants, with a minority being biallelic recessive variants. In extremely rare cases, EBS is caused by heterozygous pathogenic variants in KRT5 and KRT14, and is inherited in a bigenic pattern. The KRT5 and KRT14 genes encode basal epidermal keratin 5 and 14, respectively. Both keratin 5 and keratin 14 possess a central rod-shaped α-helix structure and lateral non-helix structures (head and tail). At the beginning and end of the central rod-shaped region, there are two highly conserved amino acid sequences called the helix initiation peptide (HIP) and helix termination peptide (HTP). Mutations in the KRT5 and KRT14 genes affect HIP and HTP, inhibiting tail-to-tail polymerization of keratin fibers and leading to severe cytoskeleton disruption, resulting in epidermal fragility to frictional stress and the development of clinical phenotypes. Mutations in the PLEC1 gene, which encodes reticulin, can lead to muscular dystrophy and pyloric atresia-related EBS. In most cases, the location of the mutation determines the severity of the clinical phenotype. For example, HIP and HTP mutations affecting keratin filament assembly result in the most severe Dowling-Meara type EBS (EBS-DM); mutations typically lead to localized EBS in non-helix junction regions; while mutations in Koebner type EBS (EBS-K) are more widely distributed across keratin 5 and keratin 14 peptides. To date, more than 150 different pathogenic mutations associated with these genes have been recorded, most of which are associated with more severe EBS-DM.
[0005] In dominant-negative mutations, a mutation in one allele leads to the loss of function in the other normal allele. Therefore, for gene therapy of dominant-negative mutant genes, simply supplementing the normal gene is insufficient. Gene editing methods such as CRISPR homologous recombination, single-base editing, prime editing, and RNA editing can transform mutated sites into normal gene sites, making them feasible approaches for treating dominant-negative mutant genes. However, a single gene-edited product can only target one mutation. For mutant genes without mutation hotspots, gene editing to cover all mutations is impractical. Furthermore, the efficiency of gene editing and the safety risks associated with off-target effects have not been fully resolved, resulting in a higher risk of drug development.
[0006] Herpes simplex virus (HSV) belongs to the Herpesviridae family and is an enveloped double-stranded DNA virus, including two subtypes: type I (HSV-1) and type II (HSV-2). Currently, HSV-1 viral vectors have been used for gene therapy of major diseases such as cancer, neurodegenerative diseases, genetic diseases, and immune system diseases. Compared with other gene therapy viral vectors, HSV-1 viral vectors have many advantages. The HSV-1 genome is relatively large (Figure 1), and can carry large or multiple exogenous genes. The HSV-1 genome is 152 kb long, while the commonly used gene therapy viral vector—AAV—is only about 4.7 kb. Of the more than 80 known genes in the HSV-1 genome, about half are non-essential genes in in vitro culture and can be replaced by multiple exogenous therapeutic genes. Its maximum exogenous gene insertion can reach 30-40 kb. This is particularly important for treating many diseases, especially those involving multiple genes. HSV-1 does not integrate with cellular DNA, replication is controllable, and it has high safety. HSV-1 rarely causes life-threatening diseases in immunocompetent adults [Shen Y, Nemunaitis J. Herpes simplex virus 1 (HSV-1) for cancer treatment [J]. Cancer Gene Therapy, 2006, 13(11): 975-992]. Herpes simplex virus type 1 (HSV-1) is considered a very promising viral vector for gene therapy due to its broad host cell range and high safety profile. Summary of the Invention
[0007] This invention provides a recombinant vector, specifically, a replication-defective recombinant herpes simplex virus vector and its applications. Specifically, this application modifies a specific region of the HSV-1 genome (as shown in Figure 2) to obtain an HSV-1 replication-defective viral vector. Using the viral vector obtained in this application to deliver exogenous genes can effectively treat dominant-negative mutant gene diseases such as epidermolysis bullosa.
[0008] Specifically, this application relates to the following technical solutions:
[0009] Item 1. A short hairpin RNA (shRNA) for knocking down the KRT5 gene and / or the KRT14 gene, comprising a nucleotide sequence as shown in any one of SEQ ID NO:1-41 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with it.
[0010] Item 2. The short hairpin RNA according to Item 1, comprising a nucleotide sequence as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:19, SEQ ID NO:20, or SEQ ID NO:21, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with it.
[0011] Item 3. A nucleic acid construct comprising short hairpin RNA as described in Item 1 or 2.
[0012] Item 4. The nucleic acid construct according to Item 3, wherein the nucleic acid construct is a nucleic acid construct composed of a short hairpin RNA and a miRNA backbone as described in Item 1 or 2, wherein the short hairpin RNA replaces the targeting region in the miRNA backbone.
[0013] Item 5. The nucleic acid construct according to Item 4, wherein the miRNA is selected from one or more of miR30, miR155 and miR17-92.
[0014] Item 6. The nucleic acid construct according to Item 4 or 5, wherein the nucleic acid construct comprises a nucleotide sequence as shown in SEQ ID NO: 45 or 46 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with it.
[0015] Item 7. A vector comprising a short hairpin RNA as described in Item 1 or 2, or a nucleic acid construct as described in any one of Items 3-6.
[0016] Item 8. The vector according to Item 7, comprising plasmids, lipid nanoparticles (LNPs), transposons, granules, bacterial artificial chromosomes, virus-like particles (VLPs), and viral vectors; optionally, the viral vector comprises a retroviral vector, a lentiviral vector, an adenovirus vector, an adeno-associated virus vector, or a herpes simplex virus vector.
[0017] Item 9. A cell comprising a carrier as described in Item 8, optionally, said cell being a prokaryotic cell or a eukaryotic cell.
[0018] Item 10. A vector system for treating epidermolysis bullosa (EB), comprising one or more vectors, the one or more vectors comprising:
[0019] 1) A nucleotide sequence targeting the EB-causing mutant gene, used to knock out or knock down the EB-causing mutant gene; and
[0020] 2) The nucleotide sequence of the normal gene corresponding to the EB-causing mutant gene.
[0021] The components 1) and 2) are located on the same or different carriers in the system.
[0022] Item 11. The vector system according to Item 10, wherein the EB-causing mutant gene comprises one or more genes selected from the group consisting of: KRT5, KRT14, PLEC, KLHL24, CD151, DST, EXPH5, TGM5, JUP, PKP1, and DSP.
[0023] Item 12. The vector system according to Item 10 or 11, wherein the vector comprises plasmids, lipid nanoparticles (LNPs), transposons, granules, bacterial artificial chromosomes, virus-like particles (VLPs), and viral vectors; optionally, the viral vector comprises a retroviral vector, a lentiviral vector, an adenovirus vector, an adeno-associated virus vector, or a herpes simplex virus vector.
[0024] Item 13. The vector system according to any one of items 10-12, wherein the EB-causing mutant gene is knocked out or knocked down by one or more methods selected from: CRISPR homologous recombination, single-base editing, prime editing, RNA interference, and RNA editing.
[0025] Item 14. The vector system according to any one of items 10-13, wherein the nucleotide sequence of the EB-targeting mutant gene comprises siRNA, shRNA, microRNA (miRNA), nucleic acid constructs composed of shRNA and microRNA, or sgRNA for knocking out or knocking down the EB-targeting mutant gene.
[0026] Item 15. The vector system according to any one of items 10-14, wherein the EB-induced mutant gene comprises the KRT5 gene and / or the KRT14 gene.
[0027] Item 16. The vector system according to any one of items 10-15, wherein the vector is a herpes simplex virus vector, optionally a type I herpes simplex virus vector, preferably, one or more of the ICP0 gene, ICP4 gene, ICP27 gene, ICP34.5 gene, ICP47 gene, ICP22 gene, ICP6 gene, UL41 gene, UL55 gene, UL56 gene and IRL / IRS region in the genome of the herpes simplex virus vector are disrupted or knocked out.
[0028] Item 17. The vector system according to Item 16, wherein the components 1) and 2) are located on the same or different herpes simplex virus vectors, optionally, the components 1) and 2) are located at the same or different sites on the same herpes simplex virus vector, the sites being selected from one or more disrupted or knocked-out gene sites: ICP0 gene, ICP4 gene, ICP27 gene, ICP34.5 gene, ICP47 gene, ICP22 gene, ICP6 gene, UL41 gene, UL55 gene, UL56 gene and IRL / IRS region.
[0029] Item 18. The vector system according to any one of items 15-17, wherein the nucleotide sequence targeting the EB-induced mutant gene comprises a nucleotide sequence targeting the KRT5 gene and / or the KRT14 gene, the nucleotide sequence being an shRNA for knocking down the KRT5 gene and / or the KRT14 gene, optionally, the shRNA comprising a nucleotide sequence as shown in any one of SEQ ID NO:1-41 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with it.
[0030] Item 19. The vector system according to any one of items 10-17, wherein the nucleotide sequence of the EB-targeting mutant gene is a nucleic acid construct comprising a shRNA and miRNA backbone of the EB-targeting mutant gene.
[0031] Item 20. The vector system according to Item 19, wherein the shRNA targeting the EB-induced mutant gene is an shRNA targeting the KRT5 gene and / or the KRT14 gene.
[0032] Item 21. The vector system according to Item 20, wherein the shRNA targeting the KRT5 gene and / or KRT14 gene comprises the short hairpin RNA described in Item 1 or 2.
[0033] Item 22. The vector system according to Item 19, wherein the miRNA is selected from one or more of miR30, miR155 and miR17-92.
[0034] Item 23. The vector system according to Item 21 or 22, comprising the nucleotide sequence shown in SEQ ID NO:45 or 46 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with it.
[0035] Item 24. The vector system according to any one of items 10-23, wherein the nucleotide sequence encoding keratin comprises a nucleotide sequence as shown in SEQ ID NO:43 or 44 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with it.
[0036] Item 25. The vector system according to any one of items 16-24, further wherein the ICP34.5 gene and / or the IRL / IRS region in the genome is disrupted or knocked out.
[0037] Item 26. A composition comprising a carrier system as described in any one of items 10-25.
[0038] Item 27. The composition according to Item 26, wherein the composition is a pharmaceutical composition, further comprising a pharmaceutically acceptable excipient.
[0039] Item 28. Use of the short hairpin RNA (shRNA) as described in Item 1 or 2, the nucleic acid construct as described in any one of Items 3-6, the vector as described in Item 7 or 8, the vector system as described in any one of Items 10-25, or the composition as described in Item 26 or 27 in the preparation of a medicament for treating epidermolysis bullosa.
[0040] Item 29. The use according to Item 28, wherein the bullous epidermolysis is simple bullous epidermolysis.
[0041] Item 30. A method of treating bullous epidermolysis, comprising administering to a subject in need an effective amount of the composition as described in Item 26 or 27.
[0042] Item 31. The method according to Item 30, wherein the bullous epidermolysis is simple bullous epidermolysis.
[0043] Item 32. A vector system for treating a skin genetic disease caused by a dominant-negative gene mutation, comprising one or more vectors, the one or more vectors comprising:
[0044] 1) nucleotide sequences targeting the pathogenic dominant-negative mutant gene, used to knock out or knock down the pathogenic mutant gene; and
[0045] 2) The nucleotide sequence encoding the normal gene corresponding to the pathogenic mutated gene,
[0046] The components 1) and 2) are located on the same or different carriers in the system.
[0047] Item 33. The vector system according to Item 32, wherein the pathogenic mutant gene comprises one or more genes selected from the group consisting of: KRT1, KRT2, KRT3, KRT4, KRT5, KRT6, KRT7, KRT9, KRT10, KRT14, KRT16, KRT17, PLEC, KLHL24, CD151, DST, EXPH5, TGM5, JUP, PKP1, DSP, GJB2, LOR, EDAR, EDARR, and WNT10A.
[0048] Item 34. The vector system according to Item 32 or 33, wherein the vector comprises plasmids, lipid nanoparticles (LNPs), transposons, granules, bacterial artificial chromosomes, virus-like particles (VLPs), and viral vectors; optionally, the viral vector comprises a retroviral vector, a lentiviral vector, an adenovirus vector, an adeno-associated virus vector, or a herpes simplex virus vector.
[0049] Item 35. The vector system according to Item 33 or 34, wherein the pathogenic dominant-negative mutant gene is knocked out or knocked down by one or more methods selected from: CRISPR homologous recombination, single-base editing, prime editing, RNA interference, and RNA editing.
[0050] Item 36. The vector system according to any one of items 32-35, wherein the nucleotide sequence of the targeted pathogenic mutant gene comprises siRNA, shRNA, microRNA (miRNA), nucleic acid construct composed of shRNA and microRNA, or sgRNA for knocking out or knocking down the pathogenic dominant or negative mutant gene.
[0051] Item 37. The vector system according to any one of items 32-36, wherein the pathogenic dominant-negative mutant gene comprises the KRT5 gene and / or the KRT14 gene.
[0052] Item 38. The vector system according to any one of items 32-37, wherein the vector is a herpes simplex virus vector, optionally a type I herpes simplex virus vector, preferably, one or more of the regions selected from the ICP0 gene, ICP4 gene, ICP27 gene, ICP34.5 gene, ICP47 gene, ICP22 gene, ICP6 gene, UL41 gene, UL55 gene, UL56 gene and IRL / IRS region in the genome of the herpes simplex virus vector are disrupted or knocked out.
[0053] Item 39. The vector system according to Item 38, wherein the components 1) and 2) are located on the same or different herpes simplex virus vectors, optionally, the components 1) and 2) are located at the same or different sites on the same herpes simplex virus vector, the sites being selected from one or more gene sites that have been disrupted or knocked out: ICP0 gene, ICP4 gene, ICP27 gene, ICP34.5 gene, ICP47 gene, ICP22 gene, ICP6 gene, UL41 gene, UL55 gene, UL56 gene and IRL / IRS region.
[0054] Item 40. The vector system according to any one of items 37-39, wherein the nucleotide sequence targeting the pathogenic mutant gene comprises a nucleotide sequence targeting the KRT5 gene and / or the KRT14 gene, the nucleotide sequence being an shRNA for knocking down the KRT5 gene and / or the KRT14 gene, optionally, the shRNA comprising a nucleotide sequence as shown in any one of SEQ ID NO:1-41 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with it.
[0055] Item 41. The vector system according to any one of items 32-39, wherein the nucleotide sequence of the pathogenic dominant-negative mutant gene is a nucleic acid construct comprising the shRNA and miRNA backbone of the pathogenic dominant-negative mutant gene.
[0056] Item 42. The vector system according to Item 41, wherein the shRNA targeting the pathogenic dominant-negative mutant gene is an shRNA targeting the KRT5 gene and / or the KRT14 gene.
[0057] Item 43. The vector system according to Item 42, wherein the shRNA targeting the KRT5 gene and / or KRT14 gene comprises the short hairpin RNA described in Item 1 or 2.
[0058] Item 44. The vector system according to Item 41, wherein the miRNA is selected from one or more of miR30, miR155 and miR17-92.
[0059] Item 45. The vector system according to Item 43 or 44, comprising the nucleotide sequence shown in SEQ ID NO:45 or 46 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with it.
[0060] Item 46. The vector system according to any one of items 40-45, wherein the nucleotide sequence encoding keratin comprises the nucleotide sequence shown in SEQ ID NO:43 or 44 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with it.
[0061] Item 47. The vector system according to any one of items 40-46, further wherein the ICP34.5 gene and / or the IRL / IRS region in the genome is disrupted or knocked out.
[0062] Item 48. A composition comprising a carrier system as described in any one of items 32-47.
[0063] Item 49. The composition according to Item 48, which is a pharmaceutical composition, further comprising a pharmaceutically acceptable excipient.
[0064] Item 50. Use of the short hairpin RNA (shRNA) as described in Item 1 or 2, the nucleic acid construct as described in any one of Items 3-6, the vector as described in Item 7 or 8, the vector system as described in any one of Items 10-25, the vector as described in Item 26 or 27, the vector system as described in any one of Items 32-47, or the composition as described in Item 48 or 49 in the preparation of a medicament for treating a skin genetic disease caused by a dominant-negative mutant gene.
[0065] Item 51. According to the use described in Item 50, the skin genetic diseases caused by the dominant-negative mutant gene are simple bullous epidermolysis, congenital bullous ichthyosis-like erythroderma, epidermolytic hyperkeratosis, palmoplantar keratosis, skin fragility syndrome, keratotic dermatitis, and ichthyosis, etc.
[0066] Item 52. A method for treating a skin genetic disease caused by a dominant-negative gene mutation, comprising administering to a subject in need an effective amount of the composition as described in Item 48 or 49.
[0067] Item 53. According to the method of Item 52, the genetic skin disease caused by the dominant-negative mutation gene is simple bullous epidermolysis, congenital bullous ichthyosis-like erythroderma, epidermolytic hyperkeratosis, palmoplantar keratosis, skin fragility syndrome, keratotic dermatitis, and ichthyosis, etc.
[0068] Item 54. Use of the short hairpin RNA (shRNA) as described in Item 1 or 2, the nucleic acid construct as described in any one of Items 3-6, the vector as described in Item 7 or 8, the vector system as described in any one of Items 10-25, the vector as described in Item 26 or 27, the vector system as described in any one of Items 32-47, or the composition as described in Item 48 or 49 in the treatment of skin genetic diseases caused by dominant-negative mutant genes.
[0069] Item 55. Use of the short hairpin RNA (shRNA) as described in Item 1 or 2, the nucleic acid construct as described in any one of Items 3-6, the vector as described in Item 7 or 8, the vector system as described in any one of Items 10-25, the vector as described in Item 26 or 27, the vector system as described in any one of Items 32-47, or the composition as described in Item 48 or 49 in the treatment of epidermolysis bullosa.
[0070] It should be understood that, within the scope of this application, the above-described technical features of the present invention and the technical features specifically described below can be combined with each other to form new or preferred technical solutions. Further details are omitted due to space limitations.
[0071] Since most cases of EBS are caused by dominant-negative gene mutations, the mutated gene expression products lead to the loss of functional activity of normal gene expression products. Therefore, simply supplementing normal genes cannot achieve a therapeutic effect. This invention provides a method for treating EBS. Specifically, by simultaneously inserting 1) a sequence for knocking out a mutated keratin gene and 2) an exogenous normal keratin gene sequence into an HSV-1 replication-defective viral vector, after delivery to skin cells, on the one hand, knocking out the mutated gene prevents its expression product from inhibiting the function of normal proteins; on the other hand, it supplements normal gene expression functional proteins, thereby restoring skin function. The supplemented exogenous normal gene has undergone sequence optimization, differing from the wild-type gene sequence to avoid the knockout gene sequence from cutting the supplemented exogenous normal gene. Attached Figure Description
[0072] Figure 1 is a schematic diagram of the HSV-1 genome.
[0073] Figure 2 shows a schematic diagram of the ICP4 and ICP27 genes of HSV-1.
[0074] Figure 3 is a schematic diagram of the recombinant viral vector A2.
[0075] Figure 4 shows the effect of shRNA knockdown of KRT5 gene expression.
[0076] Figure 5 shows the effect of shRNA knockdown of KRT14 gene expression.
[0077] Figure 6 is a schematic diagram of the recombinant viral vectors H and I.
[0078] Figure 7 is a schematic diagram of recombinant viral vectors J and K. Detailed Implementation
[0079] The specific embodiments of the present invention are described in detail below, but it should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods not specifying specific experimental conditions in the following examples are generally performed under conventional conditions or as recommended by the manufacturer.
[0080] Unless otherwise expressly stated, throughout the specification and claims, the term "comprising" or its variations such as "including" or "comprises" shall be understood to include the stated ingredients or components without excluding other ingredients or other components.
[0081] As used in this article, the term "epidermolysis bullosa (EB)" is a group of serious hereditary skin diseases characterized by the formation of vesicles, blood blisters, or bullae on the skin and mucous membranes after minor friction or trauma. It is divided into two types: hereditary (congenital) and acquired (epidermolysis bullosa acquisita, EBA). Its etiology is still unclear, but it may be related to genetic factors, autoimmune abnormalities, environmental factors, skin damage, endocrine disorders, etc.
[0082] Hereditary epidermolysis bullosa (EB) can be classified into three types based on the location of the lesions: ① simple bullous EB (EBS), where the bullae are located within the epidermis; ② junctional bullous EB (JEB), where the bullae occur in the stratum lucidum; and ③ dystrophic bullous EB (DEB), where the bullae occur in the subdensate layer. EBS is mainly associated with gene mutations encoding keratin 5 (KRT5) and keratin 14 (KRT14); JEB is associated with gene mutations encoding laminin 5 and type XVII collagen (BPAG2); and DEB is associated with mutations in the gene encoding type VII collagen (COL7A1). Mutations in genes encoding structural proteins of the epidermis and basement membrane lead to impaired synthesis or structural abnormalities in these proteins, resulting in bullae formation in different anatomical locations.
[0083] As used herein, the term “construction” refers to a recombinant molecule, such as a recombinant nucleic acid or polypeptide, comprising one or more isolated nucleic acid sequences or amino acid sequences from a heterologous source. For example, a polypeptide construct may be a chimeric polypeptide molecule in which two or more amino acid sequences of different origins are operatively linked together in a single polypeptide construct. Similarly, a “nucleic acid construct” may be a chimeric nucleic acid molecule in which two or more nucleic acid sequences of different origins are assembled into a single nucleic acid molecule. Thus, representative nucleic acid constructs include any construct containing: (1) a nucleic acid sequence, including regulatory and coding sequences that are not found adjacent to each other in nature (e.g., at least one of the nucleotide sequences is heterologous relative to at least one of its other nucleotide sequences); or (2) a sequence encoding a portion of a non-naturally adjacent functional RNA molecule or protein; or (3) a portion of a non-naturally adjacent promoter. Representative nucleic acid constructs may contain any recombinant nucleic acid molecule (linear or circular single- or double-stranded DNA or RNA molecule) derived from any source capable of genome integration or autonomous replication (such as plasmids, granules, viruses, autonomously replicating polynucleotide molecules, bacteriophages), including nucleic acid molecules in which one or more nucleic acid sequences have been operatively linked. Nucleic acid constructs of this disclosure may contain elements necessary to guide the expression of a target nucleic acid sequence also contained in the construct. Such elements may include control elements (such as promoters operatively linked to the target nucleic acid sequence (in order to guide its transcription)) and optionally include polyadenylation sequences.
[0084] In some embodiments of this disclosure, one or more nucleic acid constructs may be incorporated (e.g., inserted) into a single nucleic acid molecule (such as a single vector), or may be incorporated (e.g., inserted) into two or more separate nucleic acid molecules (such as two or more separate vectors).
[0085] The term "vector" is used herein to refer to a nucleic acid molecule or sequence capable of transferring or transporting another nucleic acid molecule. Therefore, the term "vector" encompasses both DNA-based vectors and RNA-based vectors. The term "vector" includes cloning vectors and expression vectors, as well as viral vectors and integration vectors. An "expression vector" is a vector containing a regulatory region that enables the expression of DNA sequences and fragments in vitro, ex vivo, and / or in vivo. In some embodiments, the vector may contain a sequence that guides autonomous replication in the cell, such as plasmids (DNA-based vectors) or self-replicating RNA vectors. In some embodiments, the vector may contain a sequence sufficient to allow integration into the host cell's DNA. Useful vectors include, for example, plasmids (e.g., DNA plasmids or RNA plasmids), transposons, granules, bacterial artificial chromosomes, and viral vectors. In some embodiments, the vectors of this disclosure may be single-stranded vectors (e.g., ssDNA or ssRNA). In some embodiments, the vectors of this disclosure may be double-stranded vectors (e.g., dsDNA or dsRNA). In some embodiments, the vector is a gene delivery vector. In some embodiments, the vector is used as a gene delivery medium to transfer a gene into a cell. In some implementations, the vector of this disclosure is a self-replicating RNA (srRNA) vector.
[0086] "Expression vectors" typically contain at least a control sequence operatively linked to a target nucleotide sequence. In this way, for example, a promoter operatively linked to the nucleotide sequence to be expressed is provided in the expression vector for expression in cells. For the practice of this disclosure, compositions and methods for preparing and using vectors (e.g., expression vectors) and cells are known to those skilled in the art.
[0087] As used herein, the term "replication-deficient" refers to a viral vector that cannot replicate completely and efficiently. A replication-deficient virus is a mutant or defective variant of one or more functions essential for viral genome replication or viral particle synthesis and assembly. Replication-deficient viruses can multiply in complementary cell lines expressing the missing gene product. However, in normal target cells, replication-deficient viruses can express the viral gene product but do not replicate to form infectious progeny viral particles. In some embodiments, a replication-deficient virus or viral vector is a mutant or defective virus or vector that functions one or more functions essential for viral genome replication. In some embodiments, a replication-deficient virus or viral vector is a mutant or defective virus or vector that functions one or more functions essential for viral particle synthesis and assembly. In some embodiments of the invention, the replication-deficient viral vector is an HSV-1 viral vector.
[0088] The term "siRNA (small interfering RNA)" refers to a double-stranded RNA molecule approximately 21-25 nucleotides in length. siRNA inhibits the expression of a specific gene by binding to its target gene's mRNA, leading to mRNA degradation. siRNA is typically produced by the cleavage of long double-stranded RNA (dsRNA) by the Dicer enzyme, which then binds to the RISC (RNA-induced silencing complex) to form an activated RISC complex, which subsequently recognizes and degrades the target mRNA.
[0089] The term "sgRNA (single guide RNA)" refers to a single-stranded RNA molecule, approximately 100-200 nucleotides in length. sgRNA is a key component of the CRISPR-Cas9 gene editing system, guiding the Cas9 protein to recognize and cleave specific DNA sequences. sgRNA binds to the Cas9 protein, forming a Cas9-sgRNA complex, which then recognizes and binds to the target DNA sequence, causing a double-strand break and thus enabling gene editing.
[0090] The term "shRNA (short hairpin RNA)" refers to a special type of RNA molecule with a circular structure and two complementary arms. shRNA is engineered to form a hairpin structure. Once inside the cell, shRNA is cleaved into siRNA by the Dicer enzyme, which then binds to RISC to further recognize and degrade target mRNA, thereby inhibiting the expression of specific genes.
[0091] As used herein, the term "pharmaceutical-grade excipient" means an excipient that is pharmacologically and / or physiologically compatible with the subject and the active ingredient, which is well known in the art and includes, but is not limited to: pH adjusters, surfactants, adjuvants, ionic strength enhancers, diluents, agents for maintaining osmotic pressure, agents for delaying absorption, and preservatives.
[0092] As used in this article, the term miRNA (microRNA) refers to a class of small, non-coding RNA molecules approximately 20-24 nucleotides in length. They play a crucial role in gene expression regulation, primarily by binding to target mRNAs, inhibiting their translation, or promoting their degradation, thereby regulating gene expression. miRNAs play important roles in various biological processes, including cell differentiation, proliferation, apoptosis, development, and tumorigenesis. While miRNAs do not encode proteins, they exert significant regulatory roles within cells, particularly at the post-transcriptional level (i.e., mRNA stability and translation). They typically inhibit gene expression by binding to the 3' untranslated region (3'UTR) of target gene mRNAs. The synthesis of miRNAs involves the following main steps: 1. Gene transcription: The precursor gene of the miRNA (pri-miRNA) is synthesized by RNA polymerase II during transcription. pri-miRNA is a long primary transcript containing a hairpin-like structure, which is the mature precursor structure of the miRNA. 2. Post-transcriptional processing: In the nucleus, pri-miRNA is processed by the Drosha enzyme and its cofactor DGCR8 into a short precursor miRNA (pre-miRNA). The pre-miRNA is approximately 70 nucleotides long and forms a hairpin structure. 3. Transport to the cytoplasm: The pre-miRNA is transported from the nucleus to the cytoplasm with the help of Exportin-5 and RanGTP. 4. Further processing: In the cytoplasm, the Dicer enzyme further processes the pre-miRNA into a double-stranded mature miRNA. This double-stranded structure contains two strands: one is the functional strand (called miRNA), and the other strand (called the miRNA*(star) strand) is usually degraded. 5. RNA-induced silencing complex (RISC) loading: The generated single-stranded miRNA binds to the RISC complex, forming a mature miRNA-RISC complex. The miRNA inhibits the translation of the target gene or accelerates its degradation by pairing with the 3'UTR region of its target mRNA. The functional strand of the miRNA is the region that targets and binds to the target mRNA, referred to in this application as the "target region". In some embodiments of this application, the short hairpin RNA replaces the "targeting region" in the precursor miRNA (pre-miRNA), i.e., the region that later becomes the functional strand of the mature miRNA, constituting a nucleic acid construct comprising the short hairpin RNA of this application and a "miRNA backbone" (i.e., the portion of the pre-miRNA with the "targeting region" removed). The "miRNA backbone" of this application covers the backbones of various miRNAs. Various miRNA backbones known in the art can be used to hybridize with the short hairpin RNA of this application to form hybrid nucleic acid constructs.Those skilled in the art can obtain the nucleotide sequences of various miRNA backbones through databases such as miRBase (http: / / www.mirbase.org / ), miRDB, miRanda, TargetScan, and miRTarBase.
[0093] As is known in the art, a "genomic segment" refers to a specific nucleotide position within the genome. The nucleotide positions of the specific genomic segments of the HSV-1 genome in this application were determined with reference to the HSV-1 laboratory virus strain 17 genome (NC_001806.2). Those skilled in the art will understand that the specific nucleotide positions may differ in the genomes of different herpesvirus strains, but they can determine the nucleotide positions corresponding to the specific genomic segments disclosed in this application using conventional techniques. Specifically, when describing the locations of mutations, knockouts, insertions, etc., performed on the viral genome in this application, the corresponding base positions of the HSV-1 laboratory virus strain 17 genome are listed, obtained by aligning any other herpesvirus strain genome sequence with the laboratory virus strain 17 genome sequence using sequence alignment tools such as BLAST. Therefore, this application covers the specific genomic segments determined with reference to the HSV-1 laboratory virus strain 17 genome (NC_001806.2), and also covers the genomic segments corresponding to this genomic segment in different herpesvirus strains.
[0094] In some embodiments, the genome is selected from ICP34.5 gene, ICP6 gene, ICP0 gene, ICP47 gene, ICP22 gene, ICP27 gene, and U. S 3 genes, U L 56 genes, functional VP16 gene, VHS gene, UNG gene, IR L / IR S One or more of the following genes are disrupted or knocked out: region, glycoprotein H gene, thymidine kinase gene.
[0095] In some implementations, ICP0 and / or ICP22 in the genome are disrupted or knocked out.
[0096] Example
[0097] Preparation Example 1: Preparation of HSV-1 Replication-Defective Recombinant Viral Vector
[0098] The HSV-1 viral genome consists of long terminal repeat (TR) sequences. L ), long unique segment (U L ), long internal repeat (IR) sequencesL ), short internal repeat (IR) sequences S ), short unique segment (U S ) and short terminal repeat (TR) sequences S The composition is shown in Figure 1. By modifying specific regions of the HSV-1 genome (as shown in Figure 2), HSV-1 replication-defective viral vectors can be obtained.
[0099] Refer to the method described in patent application publication number CN113046331A for knocking out HSV-1 genomic IR S and TR S The regions 126785-131176bp and 147025-151439bp involve the HSV-1 virus ICP4 gene region, and the GFP gene is inserted at this position to obtain the viral vector A2 (Figure 3).
[0100] Viral vectors containing deletions of the essential HSV-1 replication genes ICP4 and ICP27 need to be prepared and grown on compensatory cell lines capable of compensating for the deletions of ICP4 and ICP27 genes. The ICP4 gene (Gene ID: 2703392) and the ICP27 gene (Gene ID: 24271474) were simultaneously cloned into a plasmid (Takara, 3244) carrying a puromycin selection gene, and grown according to Lipofectamine... TM Following the instructions of Thermo (L3000015), the plasmid was stably transfected into Vero cells using liposomes to obtain the ZH02 compensatory cell line that supports the replication of replication-defective viral vectors.
[0101] In all embodiments and preparation examples of this application, the pA used for the recombinant viral vector is TK pA.
[0102] Example 1: shRNA design to knock down human KRT5 and KRT14 genes
[0103] Knockdown shRNAs targeting the human KRT5 gene (NM_000424.4) and KRT14 gene (NM_000526.5) were designed. The shRNAs were designed and optimized using VectorBuilder shRNA Target design software (https: / / en.vectorbuilder.com / tool / shrna-target-design.html), resulting in 18 shRNAs knocking down the KRT5 gene (as shown in SEQ ID NO:1-18 in the sequence listing) and 23 shRNAs knocking down the KRT14 gene (as shown in SEQ ID NO:19-41 in the sequence listing).
[0104] Example 2: Screening for shRNAs that knock down the human KRT5 gene
[0105] The shRNA sequence of the human KRT5 gene knocked down using SEQ ID NO:1-3 was synthesized and cloned into the multiple cloning site of the pGMLV-Puro vector (Jiman Biotechnology). After transformation into competent cells, single colonies were picked and cultured in small quantities using a liquid culture method. Recombinant plasmids were extracted using a plasmid extraction kit (DP120-01, TIANGEN). The target plasmid was transfected into HaCaT cells (Jiman Biotechnology) using an electroporator (Celetrix) for verification. HaCaT cells were cultured in DMEM medium containing 10% fetal bovine serum at 37°C and 5% CO2. The HaCaT cell pellet was collected by digestion and centrifugation, and 1×10⁶ cells were collected. 6Cells were mixed with 20 μl of electroporation buffer and 2 μg of plasmid, then transferred to electroporation tubes for electroporation. The cells were then transferred to six-well plates, with 2 ml of culture medium added to each well. The plates were incubated at 37°C with 5% CO2 for 3 days before harvesting. Total RNA was extracted from the cells using a total RNA extraction kit (19221ES50, Yisheng), following the kit's instructions. The extracted RNA was reverse transcribed using a cDNA synthesis kit (EG15133S, Bristol-Myers Squibb), following the kit's instructions. Real-time quantitative PCR was used to quantify KRT5 gene expression in the obtained cDNA. In PCR analysis, the primer sequences used for KRT5 gene detection were KRT5-F: TGTCTCGCCAGTCAAGTGTG (SEQ ID NO:47) and KRT5-R: CCACCCACTCCACAAGCAC (SEQ ID NO:48), with GAPDH as an internal control. The primer sequences used for detection were GAPDH-F: GTCTCCTCTGACTTCAACAGCG (SEQ ID NO:49) and GAPDH-R: ACCACCCTGTTGCTGTAGCCAA (SEQ ID NO:50). Data analysis was performed using the ΔΔCt method, with the relative expression level of the KRT5 gene calculated in normal HaCaT cells using GAPDH as an internal control.
[0106] ΔCt = (average Ct of KRT5 gene in test sample - average Ct of internal reference gene in test sample) - (average Ct of KRT5 gene in control sample - average Ct of internal reference gene in control sample)
[0107] The relative expression level of the gene F = 2 -ΔΔCt .
[0108] The Ct values obtained from real-time quantitative PCR are shown in Table 1 below:
[0109] Table 1
[0110] The effects of shRNA knockdown on KRT5 gene expression are shown in Table 2 and Figure 4 below:
[0111] Table 2
[0112] The results show that KRT5 shRNA1, shRNA2 and shRNA3 can all significantly knock down the expression of the KRT5 gene.
[0113] Example 3: Screening for shRNAs that knock down the human KRT14 gene
[0114] The shRNA sequence of the human KRT14 gene was knocked down using the synthesized sequence SEQ ID NO:19-21. Following the method in Example 2, the shRNA sequence was cloned into the pGMLV-Puro vector, and recombinant plasmids were prepared by culturing and extraction. After electroporation into HaCaT cells, total RNA was extracted, reverse transcribed into cDNA, and then KRT14 gene expression was quantitatively analyzed using real-time quantitative PCR. The primer sequences used for KRT14 gene detection in the PCR analysis were KRT14-F: GAGCAGAACCAGGAGTACA (SEQ ID NO:51) and KRT14-R: AGGAGGTCACATCTCTGGATGA (SEQ ID NO:52). GAPDH was used as an internal control. The primer sequences used for detection were GAPDH-F: GTCTCCTCTGACTTCAACAGCG (SEQ ID NO:49) and GAPDH-R: ACCACCCTGTTGCTGTAGCCAA (SEQ ID NO:50). Data analysis was performed using the ΔΔCt method, with GAPDH as an internal reference to calculate the relative expression level of the KRT14 gene in normal HaCaT cells.
[0115] ΔCt = (average Ct of KRT14 gene in test sample - average Ct of internal reference gene in test sample) - (average Ct of KRT14 gene in control sample - average Ct of internal reference gene in control sample)
[0116] The relative expression level of the gene F = 2 -ΔΔCt .
[0117] The Ct values obtained from real-time quantitative PCR are shown in Table 3 below:
[0118] Table 3
[0119] The effects of shRNA knockdown on KRT14 gene expression are shown in Table 4 and Figure 5 below:
[0120] Table 4
[0121] The results show that KRT14 shRNA 19, shRNA 20 and shRNA 21 can all significantly knock down the expression of the KRT14 gene.
[0122] Preparation Example 2: Construction of HSV-1 vector for EBS gene therapy
[0123] To target the KRT5 gene, the ICP34.5 gene was further knocked out based on the recombinant viral vector A2, and the GFP gene was replaced at the knockout position of the ICP4 gene. The EF1 promoter, the optimized KRT5 sequence (opKRT5) (SEQ ID NO:43), the polyadenylate sequence, the U6 promoter, and the KRT5 shRNA 1 sequence (SEQ ID NO:1) were then inserted sequentially to obtain the recombinant viral vector H (Figure 6).
[0124] The maturation of miRNAs and shRNAs shares similar cellular mechanisms. Using precursor miRNA secondary structures as a backbone for interfering RNA (RNA-interference) production results in more natural processing and splicing of the interfering RNA, minimizing side effects. Furthermore, the longer miRNA backbone sequence inserted into the shRNA sequence allows for the use of pol II promoters, including various tissue-specific promoters, to achieve gene silencing in specific tissues. Among the miRNA backbones currently used for gene interference research (such as miR30, miR155, and miR17-92), miR30 is the most commonly used structure.
[0125] In this preparation example, the target region in the miR30 backbone was replaced with KRT5 shRNA 1 to obtain a miRNA-based KRT5 mirshRNA (SEQ ID NO:45). Next, the ICP34.5 gene was knocked out based on the recombinant viral vector A2, and the GFP gene was replaced at the ICP4 gene knockout position. The EF1 promoter, the optimized KRT5 sequence (opKRT5) (SEQ ID NO:43), the KRT5 mirshRNA (SEQ ID NO:45), and the polyadenylate sequence were then inserted sequentially to obtain recombinant viral vector I (Figure 6). Since the opKRT5 sequence is different from the wild-type KRT5 sequence, shRNA or miRNA sequences were avoided from cleaving it.
[0126] The HSV-1 vector designed for the KRT14 gene was constructed using the same strategy as the HSV-1 vector designed for the KRT5 gene. Based on the recombinant viral vector A2, the ICP34.5 gene was further knocked out, and the GFP gene was replaced at the ICP4 gene knockout position. The EF1 promoter, the optimized KRT14 sequence (opKRT14) (SEQ ID NO:44), the polyadenylated nucleotide sequence, the U6 promoter, and the KRT14 shRNA 1 sequence (SEQ ID NO:19) were then sequentially inserted to obtain the recombinant viral vector J (Figure 7).
[0127] The target region in the miR30 backbone was further replaced with KRT14 shRNA 1 to obtain KRT14 mirshRNA (SEQ ID NO:46) based on the miRNA backbone. Next, the ICP34.5 gene was knocked out based on the recombinant viral vector A2, and the GFP gene was replaced at the ICP4 gene knockout position. Then, the EF1 promoter, the optimized KRT14 sequence (opKRT14) (SEQ ID NO:44), KRT14 mirshRNA (SEQ ID NO:46), and the polyadenylate sequence were inserted sequentially to obtain the recombinant viral vector K (Figure 7).
[0128] Example 4: Validation of the efficacy of the HSV-1 vector designed targeting the KRT5 gene.
[0129] HaCaT cells were used at a rate of 2 × 10 6 Cells were seeded at a density of cells / well in six-well plates and cultured overnight at 37°C and 5% CO2. Recombinant viral vector H was transfected into HaCaT cells at an MOI of 1, with a blank control group (without viral vector). Two wells were set up for each group of cells, and the cells were incubated statically at 37°C and 5% CO2 for 2 days. Total RNA was extracted from each well according to the method in Example 2 and reverse transcribed into cDNA. Real-time quantitative PCR was used to quantify the expression of wild-type KRT5 and optimized KRT5 genes in the obtained cDNA. GAPDH was used as an internal control. The primer sequences for GAPDH detection and wild-type KRT5 detection were the same as in Example 2. The optimized KRT5 detection primer sequences were: opKRT5-F1: AGCAATGCATTCTGCAAGTT (SEQ ID NO: 53) and opKRT5-R1: GAAGCCGAGTCCTGGTACCA (SEQ ID NO: 54). Data analysis was performed using the ΔΔCt method, with GAPDH as an internal reference to calculate the relative expression level of the KRT5 gene in normal HaCaT cells.
[0130] The Ct values obtained from real-time quantitative PCR are shown in Table 5 below:
[0131] Table 5
[0132] The effects of shRNA knockdown of KRT5 gene expression are shown in Table 6 below:
[0133] Table 6
[0134] Experimental data showed that, compared to normal cells, the HSV-1 vector designed targeting the KRT5 gene significantly knocked down the expression of the wild-type KRT5 gene in cells, while simultaneously overexpressing the optimized KRT5 gene. These results indicate that this vector shows great promise for EBS treatment.
[0135] Example 5: Validation of the efficacy of the HSV-1 vector designed targeting the KRT14 gene.
[0136] HaCaT cells were used at a rate of 2 × 10 6 Cells were seeded at a density of cells / well in six-well plates and cultured overnight at 37°C and 5% CO2. Recombinant viral vector J was transfected into HaCaT cells at an MOI of 1, with a blank control group (without viral vector). Two wells were set up for each cell group, and the cells were incubated statically at 37°C and 5% CO2 for 2 days. Total RNA was extracted from each well according to the method in Example 3 and reverse transcribed into cDNA. Real-time quantitative PCR was used to quantify the expression of wild-type KRT14 and optimized KRT14 genes. GAPDH was used as an internal control. The primer sequences for GAPDH detection and wild-type KRT14 detection were the same as in Example 3. The optimized KRT14 detection primer sequences were: opKRT14-F1: TTGAGCCTCAGGTGGGCATCT (SEQ ID NO: 55) and opKRT14-R1: AGTTAGCCCAAATCCAGGAAATG (SEQ ID NO: 56). Data analysis was performed using the ΔΔCt method, with GAP DH as an internal reference to calculate the relative expression level of the KRT14 gene in normal HaCaT cells.
[0137] The Ct values obtained from real-time quantitative PCR are shown in Table 7 below:
[0138] Table 7
[0139] The effects of shRNA knockdown of KRT14 gene expression are shown in Table 8 below:
[0140] Table 8
[0141] Experimental data showed that, compared to normal cells, the HSV-1 vector designed targeting the KRT14 gene significantly knocked down the expression of the wild-type KRT14 gene in cells, while simultaneously overexpressing the optimized KRT14 gene. These results indicate that this vector shows great promise for EBS treatment.
[0142] Example 6: Validation of the efficacy of the HSV-1 vector carrying miRNA designed targeting the KRT5 gene.
[0143] HaCaT cells were used at a rate of 2 × 106 Cells were seeded at a density of cells / well in six-well plates and cultured overnight at 37°C and 5% CO2. Recombinant viral vector I and HSV1-GFP (with the same backbone as recombinant viral vector I) control viral vectors were transfected into HaCaT cells at MOI=1 and MOI=0.1, respectively. A blank control group (without viral vector) was also included. Two wells were set up for each group of cells, and the cells were incubated statically at 37°C and 5% CO2 for 2 days. Total RNA was extracted from each well according to the method in Example 4 and reverse transcribed into cDNA. Real-time quantitative PCR was used to quantify the expression of wild-type KRT5 and optimized KRT5 genes in the obtained cDNA. GAPDH was used as an internal control, and the primer sequences for GAPDH detection, wild-type KRT5 detection, and optimized KRT5 detection were the same as in Example 4. Data analysis was performed using the ΔΔCt method, with GAPDH as an internal control to calculate the relative expression level of the KRT5 gene in normal HaCaT cells.
[0144] The Ct values of wild-type KRT5 detected by real-time quantitative PCR are shown in Table 9 below:
[0145] Table 9
[0146] The knockdown of KRT5 gene expression by recombinant viral vector I is shown in Table 10 below:
[0147] Table 10
[0148] The Ct values of the optimized KRT5 for real-time quantitative PCR detection are shown in Table 11 below:
[0149] Table 11
[0150] The effect of recombinant viral vector I on improving the expression of the optimized KRT5 gene is shown in Table 12 below:
[0151] Table 12
[0152] The experimental data above show that the HSV-1 vector carrying miRNA designed for the KRT5 gene can significantly knock down the expression of the wild-type KRT5 gene in cells under the condition of MOI=1, while simultaneously overexpressing the optimized KRT5 gene. The experimental results indicate that this vector has great potential for application in EBS treatment.
[0153] Sequence List:
[0154] The above description is merely a preferred embodiment of this application and is not intended to limit the application in any way. Any person skilled in the art may make changes or modifications to the disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of this application, without departing from the scope of the technical solution of this application, shall still fall within the protection scope of this application.
Claims
1. A vector system for treating epidermolysis bullosa (EB), comprising one or more vectors, said one or more vectors comprising: 1) A nucleotide sequence targeting the EB-causing mutant gene, used to knock out or knock down the EB-causing mutant gene; and 2) The nucleotide sequence of the normal gene corresponding to the EB-causing mutant gene. The components 1) and 2) are located on the same or different carriers in the system.
2. The vector system according to claim 1, wherein the EB-inducing mutant gene comprises one or more genes selected from the group consisting of: KRT5, KRT14, PLEC, KLHL24, CD151, DST, EXPH5, TGM5, JUP, PKP1, and DSP.
3. The vector system according to claim 1 or 2, wherein the vector comprises plasmids, lipid nanoparticles (LNPs), transposons, granules, bacterial artificial chromosomes, virus-like particles (VLPs), and viral vectors; optionally, the viral vector comprises retroviral vectors, lentiviral vectors, adenovirus vectors, adeno-associated virus vectors, or herpes simplex virus vectors.
4. The vector system according to any one of claims 1-3, wherein the EB-causing mutant gene is knocked out or knocked down by one or more methods selected from: CRISPR homologous recombination, single-base editing, prime editing, RNA interference, and RNA editing.
5. The vector system according to any one of claims 1-4, wherein the nucleotide sequence of the EB-targeting mutant gene comprises siRNA, shRNA, microRNA (miRNA), a nucleic acid construct composed of shRNA and microRNA, or sgRNA for knocking out or knocking down the EB-targeting mutant gene.
6. The vector system according to any one of claims 1-5, wherein the EB-inducing mutant gene comprises the KRT5 gene and / or the KRT14 gene.
7. The vector system according to any one of claims 1-6, wherein the vector is a herpes simplex virus vector, optionally a type I herpes simplex virus vector, preferably, the herpes simplex virus vector genome is selected from ICP0 gene, ICP4 gene, ICP27 gene, ICP34.5 gene, ICP47 gene, ICP22 gene, ICP6 gene, U L 41 genes, U L 55 genes, U L 56 genes and IR L / IR S One or more areas in the region have been destroyed or knocked out.
8. The vector system of claim 7, wherein components 1) and 2) are located on the same or different herpes simplex virus vectors, optionally, components 1) and 2) are located at the same or different sites on the same herpes simplex virus vector, the sites being selected from one or more gene sites that have been disrupted or knocked out: ICP0 gene, ICP4 gene, ICP27 gene, ICP34.5 gene, ICP47 gene, ICP22 gene, ICP6 gene, U L 41 genes, U L 55 genes, U L 56 genes and IR L / IR S area.
9. The vector system according to any one of claims 6-8, wherein the nucleotide sequence of the EB-targeting mutant gene comprises a nucleotide sequence targeting the KRT5 gene and / or the KRT14 gene, the nucleotide sequence being an shRNA for knocking down the KRT5 gene and / or the KRT14 gene, optionally, the shRNA comprising a nucleotide sequence as shown in any one of SEQ ID NO:1-41 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with it.
10. The vector system according to any one of claims 1-8, wherein the nucleotide sequence of the EB-targeting mutant gene is a nucleic acid construct comprising a shRNA and miRNA backbone of the EB-targeting mutant gene.
11. The vector system according to claim 10, wherein the shRNA targeting the EB-induced mutant gene is an shRNA targeting the KRT5 gene and / or the KRT14 gene.
12. The vector system of claim 11, wherein the shRNA targeting the KRT5 gene and / or the KRT14 gene comprises short hairpin RNA (shRNA) for knocking down the KRT5 gene and / or the KRT14 gene. The short hairpin RNA (shRNA) comprises a nucleotide sequence as shown in any one of SEQ ID NO:1-41 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with it.
13. The vector system of claim 12, wherein the short hairpin RNA comprises a nucleotide sequence as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:19, SEQ ID NO:20, or SEQ ID NO:21, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with it.
14. The vector system of claim 10, wherein the miRNA is selected from one or more of miR30, miR155 and miR17-92.
15. The vector system according to any one of claims 12-14, comprising the nucleotide sequence shown in SEQ ID NO:45 or 46 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with it.
16. The vector system according to any one of claims 1-15, wherein the nucleotide sequence encoding keratin comprises the nucleotide sequence shown in SEQ ID NO:43 or 44 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with it.
17. The vector system according to any one of claims 7-17, further comprising the ICP34.5 gene and / or IR gene in the genome. L / IR S The area was destroyed or knocked out.
18. A composition comprising the carrier system as described in any one of claims 1-17.
19. The composition of claim 18, wherein the composition is a pharmaceutical composition and further comprises a pharmaceutically acceptable excipient.
20. A method of treating bullous epidermolysis, comprising administering to a subject in need an effective amount of the composition as described in claim 18 or 19.
21. The method of claim 20, wherein the bullous epidermolysis is simple bullous epidermolysis.
22. A vector system for treating a skin genetic disease caused by a dominant-negative gene mutation, comprising one or more vectors, said one or more vectors comprising: 1) nucleotide sequences targeting the pathogenic dominant or negative mutant gene, used to knock out or knock down the pathogenic mutant gene; and 2) The nucleotide sequence encoding the normal gene corresponding to the pathogenic mutated gene, The components 1) and 2) are located on the same or different carriers in the system.
23. The vector system of claim 22, wherein the pathogenic mutant gene comprises one or more genes selected from the group consisting of: KRT1, KRT2, KRT3, KRT4, KRT5, KRT6, KRT7, KRT9, KRT10, KRT14, KRT16, KRT17, PLEC, KLHL24, CD151, DST, EXPH5, TGM5, JUP, PKP1, DSP, GJB2, LOR, EDAR, EDARR, and WNT10A.
24. The vector system according to claim 22 or 23, wherein the vector comprises plasmids, lipid nanoparticles (LNPs), transposons, granules, bacterial artificial chromosomes, virus-like particles (VLPs), and viral vectors; optionally, the viral vector comprises a retroviral vector, a lentiviral vector, an adenovirus vector, an adeno-associated virus vector, or a herpes simplex virus vector.
25. The vector system according to claim 23 or 24, wherein the pathogenic dominant-negative mutant gene is knocked out or knocked down by one or more methods selected from: CRISPR homologous recombination, single-base editing, prime editing, RNA interference, and RNA editing.
26. The vector system according to any one of claims 22-25, wherein the nucleotide sequence of the targeted pathogenic mutant gene comprises siRNA, shRNA, microRNA (miRNA), a nucleic acid construct composed of shRNA and microRNA, or sgRNA for knocking out or knocking down the pathogenic dominant or negative mutant gene.
27. The vector system according to any one of claims 22-26, wherein the pathogenic dominant-negative mutant gene comprises the KRT5 gene and / or the KRT14 gene.
28. The vector system according to any one of claims 22-27, wherein the vector is a herpes simplex virus vector, optionally a type I herpes simplex virus vector, preferably, the genome of the herpes simplex virus vector is selected from ICP0 gene, ICP4 gene, ICP27 gene, ICP34.5 gene, ICP47 gene, ICP22 gene, ICP6 gene, U L 41 genes, U L 55 genes, U L 56 genes and IR L / IR S One or more areas in the region have been destroyed or knocked out.
29. The vector system of claim 28, wherein components 1) and 2) are located on the same or different herpes simplex virus vectors, optionally, components 1) and 2) are located at the same or different sites on the same herpes simplex virus vector, the sites being selected from one or more disrupted or knocked-out gene sites: ICP0 gene, ICP4 gene, ICP27 gene, ICP34.5 gene, ICP47 gene, ICP22 gene, ICP6 gene, U L 41 genes, U L 55 genes, U L 56 genes and IR L / IR S area.
30. The vector system according to any one of claims 27-29, wherein the nucleotide sequence targeting the pathogenic mutant gene comprises a nucleotide sequence targeting the KRT5 gene and / or the KRT14 gene, the nucleotide sequence being an shRNA for knocking down the KRT5 gene and / or the KRT14 gene, optionally, the shRNA comprising a nucleotide sequence as shown in any one of SEQ ID NO:1-41 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with it.
31. The vector system according to any one of claims 22-29, wherein the nucleotide sequence of the dominant-negative mutant gene targeting pathogenicity is a nucleic acid construct comprising the shRNA and miRNA backbone of the dominant-negative mutant gene targeting pathogenicity.
32. The vector system according to claim 31, wherein the shRNA targeting the pathogenic dominant-negative mutant gene is an shRNA targeting the KRT5 gene and / or the KRT14 gene.
33. The vector system of claim 32, wherein the shRNA targeting the KRT5 gene and / or KRT14 gene comprises short hairpin RNA (shRNA) for knocking down the KRT5 gene and / or KRT14 gene. The short hairpin RNA (shRNA) comprises a nucleotide sequence as shown in any one of SEQ ID NO:1-41 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with it.
34. The vector system of claim 33, wherein the short hairpin RNA comprises a nucleotide sequence as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:19, SEQ ID NO:20, or SEQ ID NO:21, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with it.
35. The vector system of claim 31, wherein the miRNA is selected from one or more of miR30, miR155 and miR17-92.
36. The vector system of any one of claims 33-35, comprising the nucleotide sequence shown in SEQ ID NO:45 or 46 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with it.
37. The vector system of any one of claims 30-36, wherein the nucleotide sequence encoding keratin comprises the nucleotide sequence shown in SEQ ID NO:43 or 44 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with it.
38. The vector system according to any one of claims 30-37, further comprising the ICP34.5 gene and / or IR gene in the genome. L / IR S The area was destroyed or knocked out.
39. A composition comprising the carrier system as described in any one of claims 22-38.
40. The composition of claim 39, wherein the composition is a pharmaceutical composition and further comprises a pharmaceutically acceptable excipient.
41. A method of treating a skin genetic disease caused by a dominant-negative gene mutation, comprising administering to a subject in need an effective amount of the composition as described in claim 39 or 40.
42. The method according to claim 41, wherein the dominant-negative mutated gene causes the hereditary skin disease, such as simple bullous epidermolysis, congenital bullous ichthyosis-like erythroderma, epidermolytic hyperkeratosis, palmoplantar keratosis, skin fragility syndrome, keratotic dermatitis, and ichthyosis.
43. A short hairpin RNA (shRNA) for knocking down the KRT5 gene and / or the KRT14 gene, comprising a nucleotide sequence as shown in any one of SEQ ID NO:1-41 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with it.
44. The short hairpin RNA of claim 43, wherein the short hairpin RNA comprises a nucleotide sequence as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:19, SEQ ID NO:20, or SEQ ID NO:21, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with it.
45. A nucleic acid construct comprising the short hairpin RNA as described in claim 43 or 44.
46. The nucleic acid construct according to claim 45, wherein the nucleic acid construct is a nucleic acid construct composed of a short hairpin RNA and a miRNA backbone as described in claim 43 or 44, wherein the short hairpin RNA replaces the targeting region in the miRNA backbone.
47. The nucleic acid construct according to claim 46, wherein the miRNA is selected from one or more of miR30, miR155 and miR17-92.
48. The nucleic acid construct according to claim 46 or 47, wherein the nucleic acid construct comprises a nucleotide sequence as shown in SEQ ID NO:45 or 46 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with it.
49. A vector comprising the short hairpin RNA as described in claim 43 or 44 or the nucleic acid construct as described in any one of claims 45-48.
50. The vector of claim 49, wherein the vector comprises plasmids, lipid nanoparticles (LNPs), transposons, granules, bacterial artificial chromosomes, virus-like particles (VLPs), and viral vectors; optionally, the viral vector comprises retroviral vectors, lentiviral vectors, adenovirus vectors, adeno-associated virus vectors, or herpes simplex virus vectors.
51. A cell comprising the carrier as described in claim 50, wherein optionally, the cell is a prokaryotic cell or a eukaryotic cell.
52. Use of the short hairpin RNA (shRNA) of claim 43 or 44, the nucleic acid construct of any one of claims 45-48, the vector of claim 49 or 50, the vector system of any one of claims 1-17, or the composition of claim 18 or 19 in the preparation of a medicament for treating epidermolysis bullosa.
53. The use according to claim 52, wherein the bullous epidermolysis is simple bullous epidermolysis.
54. Use of the short hairpin RNA (shRNA) of claim 43 or 44, the nucleic acid construct of any one of claims 45-48, the vector of claim 49 or 50, the vector system of any one of claims 1-17, the composition of claim 18 or 19, the vector system of any one of claims 22-38, or the composition of claim 39 or 40 in the preparation of a medicament for treating a skin genetic disease caused by a dominant-negative mutant gene.
55. The use according to claim 54, wherein the dominant-negative mutation of the gene causes the hereditary skin disease, such as epidermolysis bullosa, congenital bullous ichthyosis-like erythroderma, epidermolysis bullosa hyperkeratosis, palmoplantar keratosis, skin fragility syndrome, keratotic dermatitis, and ichthyosis.