Cells, methods, composition and immunotherapeutic target, and uses thereof in the treatment of a cancer

Abstract

The present invention relates to the scFv amino acid sequence capable of recognizing LILRB1 antigen. The present invention also relates to a T cell that expresses a chimeric antigen receptor (CAR) at the cell surface, the CAR comprising an antigen-binding domain; a hinge domain; a transmembrane domain; and an intracellular domain; wherein the CAR is directed against LILRB1 antigen, and to methods, composition and immunotherapeutic target for use in the cancer treatment, preferably for use in the treatment of hematological malignancies, or autoimmune diseases. Additionally, the present invention relates to BiTEs (bi-specific T-cell engagers), DARTs (dual affinity retargeting reagents) and other immunotherapeutic modalities utilizing the anti-LILRB1 binding domain.

Description

[0001] CELLS, METHODS, COMPOSITION AND IMMUNOTHERAPEUTIC TARGET, AND USES THEREOF IN THE TREATMENT OF A CANCER

[0002] FIELD OF THE INVENTION

[0003] The present invention relates generally to single-chain variable fragments capable of recognizing the LILRB1 antigen. Further disclosed herein are LILRB1 -targeting CAR-modified T cells, cells, methods, compositions and immunotherapeutic target, and uses thereof in the treatment of a cancer, preferably for use in the treatment of hematological malignancies, or autoimmune diseases including B-cell acute lymphoblastic leukemia (B-ALL), B-cell nonHodgkin lymphoma (B-NHL), acute myeloid leukemia (AML), and monocyte derived malignancies, as well as in the treatment where malignant cells had lost CD 19 expression postCD 19 CAR-T cell treatment. Additionally, the present invention relates to BiTEs (bi-specific T-cell engagers), DARTs (dual affinity retargeting reagents) and other immunotherapeutic modalities utilizing the anti-LILRBl binding domain.

[0004] BACKGROUND OF THE INVENTION

[0005] Immunotherapies based on antibodies, particularly monoclonal antibodies, or their fragments, have emerged in recent years as a safe and selective method for treating cancer and other diseases, especially hematological malignancies, including B-cell acute lymphoblastic leukemia (B-ALL), B-cell non-Hodgkin lymphoma (B-NHL), and acute myeloid leukemia (AML). This approach is crucial since said diseases represent 10% of cancers worldwide, and their frequency has increased over the past two decades. Combinatorial approaches, including chemotherapies and targeted therapies are still being developed. In addition to stem cell transplantation, new scFv antibody-based approaches including cell therapies with genetically modified T cells expressing chimeric antigen receptors (CAR) or Bi-specific T-cell engager (BiTE) have also emerged, initiating immune responses against cancer cells. However, despite recent therapeutic advances, the prognosis of patients with hematological malignancies remains unfavorable.

[0006] The CAR is a genetically modified fusion protein, a synthetic molecule that is created by combining the antigen-specific (murine or humanized) protein, for example, a single-chain variable fragment domain (scFv) of an immunoglobulin (Ig) that binds to the appropriate protein in the membrane of tumor cells, fused with a signaling and activating domain of the zeta subunit of the CD3 complex, in a single multidomain polypeptide. The transmembranedomain (TMD) is a component in the CAR structure that connects the antigen recognition moiety to the intracellular signaling domain. It is mainly derived from type-I single-spanning proteins, such as CD3^, CD4, CD8a, or CD28. Recognition of the target antigen present on tumor cells by CAR-containing T cells (CAR-T) leads to their activation independently of the major histocompatibility complex.

[0007] There are currently five generations of CARs. The first-generation is a fusion protein composed of an extracellular domain containing the scFv, which is followed by a hinge or spacer domain (frequently from the Ig constant heavy regions or the CD8 molecule), a transmembrane domain, and an intracellular signaling domain (endodomain) containing CD3^. The second-generation has an additional co-stimulatory molecule, i.e. CD28, CD137, CD134, 4-1BB or OX-40. In the third generation, the endodomain comprises two distinct co-stimulatory domains. The fourthgeneration CARs are based on second-generation constructs which are additionally modified with a constitutive or inducible expression cassette encoding protein such as a cytokine. These are called T cell redirected for universal cytokine-mediated killing (TRUCK) CAR-T. Moreover, the fifth-generation CARs even though similar in structure to the second-generation CARs, in addition to the co-stimulatory domain and CD3tj chain, consist of an IL-2RP receptor domain thus providing a binding site for STAT3.

[0008] BiTE therapy has a different approach, namely a BiTE construct comprises a single polypeptide chain molecule having two antigen binding domains, one of which binds to a T-cell antigen (e.g., CD3) and the other of which binds to an antigen present on the surface of a target cell. Key features of BiTE antibodies that, in their combination, distinguish them from other bispecific antibody constructs include a high potency of redirected lysis with EC50 values ranging from 0.1 to 50 pmol / 1 (2-1,000 pg ml), strict target cell-dependent activation of T cells, and support of serial lysis by activated T cells (activity at low E:T ratios). BiTE antibodies are typically produced as recombinant, glycosylated proteins secreted by higher eukaryotic cell lines.

[0009] A Dual-Affinity Re-Targeting (DART) refers to an immunoglobulin molecule that includes at least two polypeptide chains that associate (especially through a covalent interaction) to form at least two epitope binding sites, which may recognize the same epitope or different epitopes. Each of the polypeptide chains of a DART include an immunoglobulin light chain variable region and an immunoglobulin heavy chain variable region, but these regions do not interact to form an epitope binding site. Rather, the immunoglobulin heavy chain variable region of one(e.g., the first) of the DART polypeptide chains interacts with the immunoglobulin light chain variable region of a different (e.g., the second) DART polypeptide chain to form an epitope binding site. Similarly, the immunoglobulin light chain variable region of one (e.g., the first) of the DART polypeptide chains interacts with the immunoglobulin heavy chain variable region of a different (e.g., the second) DART polypeptide chain to form an epitope binding site. DARTs may be monospecific, bispecific or trispecific, for example, thus they are capable of simultaneously binding one, two or three (or more) different epitopes (which may be of the same or of different antigens). DARTs may additionally be monovalent, bivalent, trivalent, tetravalent, pentavalent or hexavalent, for example, thus are capable of simultaneously bind one, two, three, four, five, six or more molecules. These two features of DARTs (degree of specificity and valency) may be combined, for example to produce bispecific antibodies (capable of binding two epitopes) that are tetraval ent (capable of binding four sets of epitopes, for example).

[0010] In their basic construct, bispecific T-engaging antibodies (BiTEs) are connected by a linker molecule, which defines the flexibility of the construct and antigen-binding kinetics in conjunction with the specific antigens used. Dual-affinity re-targeting molecules (DARTs) have a similar basic structure but include a disulfide linker for additional stability.

[0011] CAR therapy relies on genetic modification of patient’s lymphocytes T to improve the response against e.g., hematological malignancies. An artificial receptor is introduced into the cells of the immune system by means of an appropriate vector. Effector cells modified in this way are given to the patient to actively eliminate cancer cells in the patient's body.

[0012] Chimeric antigen receptor-modified T cells (CAR-T cells) targeting CD19 have emerged as a breakthrough therapy for relapsed and refractory (r / r) B cell malignancies, establishing a new standard of care. However, tumor escape following CD 19 CAR-T cell therapy significantly contributes to relapse and treatment failure. CD 19 loss is a well-described mechanism that occurs in 30%-70% of relapsed B cell acute lymphoblastic leukemia (B-ALL), and in 20%-30% of B-cell non-Hodgkin lymphoma (B-NHL) cases. Alternative options are being developed for such patients and several B cell-specific antigens for novel CAR target selection are already under investigation in preclinical studies, including CD22 and CD20 emerging as the most advanced. Strategies addressing CD 19 antigen escape comprise CAR-T cell approaches simultaneously targeting CD 19 along with CD20 and CD22. However, they are effective only when targets are sufficiently expressed. Accordingly, in cases where CD22 andCD20 expression is low or downregulated / lost together with CD 19, these antigens may no longer be viable, underscoring the need for identification of novel targets and therapeutic strategies. Moreover, targeting B cell-specific antigens is not efficacious when the resistance to CD 19 CAR-T therapy is caused by a transition of tumor cells from a lymphoid to a myeloid phenotype. In that case, targeting antigens present on cells of myeloid origin becomes more attractive. Several of such targets have already been identified, including CD33, CD123, Lewis (Le)-Y, and FLT3, and CAR-T cells directed against these targets have been designed to recognize tumor cells of strictly myeloid origin. These CAR-T therapies demonstrated efficacy in eliminating acute myeloid leukemia (AML) cells in both in vitro and in vivo models, with some undergoing patient testing, however, none have yet received clinical approval. Most myeloid cell-specific CARs currently under development target pan-myeloid markers, also expressed in hematopoietic stem / progenitor cells (HSPC), leading to severe myelosuppression and significant toxicity. Consequently, the need for suitable myeloid targets remains unmet. Particularly pressing is the need for novel markers that can serve as alternatives following lineage switching and loss of the B cell phenotype.

[0013] Identifying new targets for CAR-T cell therapy presents a multifaceted challenge. Ideal target antigens for CAR-T cells should be homogenously expressed on malignant cells but not on normal tissues to avoid on-target off-tumor toxicity. However, such antigens are limited, and even clinically validated targets such as CD19 or BCMA do not meet these stringent criteria. Also, methodology is a limitation. Recent advances in proteomic methods combining mass spectrometry (MS) and bioinformatics tools led to the identification of some novel targets that were employed for the generation of novel CAR-T cell therapies in B-ALL, AML, and multiple myeloma and even solid tumors.

[0014] LILRB1, also known as CD85j, is an immunoreceptor tyrosine-based inhibitory motif (ITIM)-containing receptor. It is highly expressed in B cells, monocytes, and macrophages and moderately expressed in dendritic cells (DCs), as well as subsets of NK cells and T cells. LILRB1 interacts with a diverse range of MHC class I molecules through its binding with the invariant P2M subunit. The binding of LILRB1 with MHC class I molecules initiates a negative signal that downregulates the immune response. In monocytes, phosphorylation of LILRB1 leads to the binding of the tyrosine phosphatase SHP-1 and inhibition of tyrosine phosphorylation of the downstream Fc receptor gamma signaling molecules and results in down-modulating monocyte activation signals. Furthermore, LILRB1 signaling inhibits the phagocytosis of macrophages. LILRB1 plays also an inhibitory role in subpopulations of NKcells and T cells. The percentage of LILRB1+ NK cells is significantly higher in patients with advanced cancers. Blockade of LILRB1 signaling in immune cells has demonstrated the ability to activate NK cell activity against solid tumors and leukemia.

[0015] Proteins belonging to the LILRB protein family are known in the art to be expressed on cancer cells. Therefore, WO2016144728 discloses antibodies binding to LILRBs and methods of detecting and treating cancer. Likewise, WO2019144052 relates to anti-LILRB antibodies and their uses, more in particular to specific and pan antibodies that interact with one or more members of the LILRB receptor family and to pharmaceutical compositions and methods for modulating inflammatory macrophage activation, lymphocyte activation, and phagocytosis. WO2024041315 discloses antibodies or antigen-binding fragments thereof which bind to LILRB2 and uses thereof wherein the chains comprise specific amino acid sequences.

[0016] CAR-T cells, vectors for expressing chimeric antigen receptors, and their uses are also known in the art. In particular, WO2015 / 142675A2 relates to the treatment of cancer using chimeric antigen receptors being specific for a cancer-associated antigen, vectors encoding them, and recombinant T cells containing CAR. Similarly, WO2017 / 172981A2 discloses a composition that comprises a cell modified with nucleic acids encoding a CAR.

[0017] Conventional CARs provide a stimulatory signal to the engineered immune cell (e.g. a T cell or an NK cell), therefore in CAR-modified cells this results in killing activity towards the target cell identified by the antigen-binding domain of the CAR. On the other hand, inhibitory CARs (iCARs) have been developed as a means to control cell activity or restrict the activity of an activator CAR to specific cell types. The inhibitory CAR generally has the intracellular domain of an inhibitory signaling molecule (such as PD-I or CTLA-4) fused to an antigen-binding domain (e.g., a single-chain variable fragment, scFv) through a transmembrane region and optionally a hinge region. For example, WO2021119489 provides chimeric antigen receptors having the hinge, transmembrane region, and / or intracellular domain of LILRB1 or functional fragments, or variants thereof.

[0018] However, despite the increasing number and more advanced methods of cancer treatment, there is still a need to identify an attractive and a specific target antigen for cell-based immunotherapy to treat different hematological malignances, including challenging cases previously treated with other lines of immunotherapy and for elimination of tumor cells.

[0019] Furthermore, even though anti-CD19 chimeric antigen receptor-modified T cells have established a new standard of care for relapsed / refractory (r / r) B-cell malignancies, in aboutB-cell acute lymphoblastic leukemia (B-ALL), B-cell non-Hodgkin lymphoma (B-NHL), and acute myeloid leukemia (AML) remain incurable with relapses invariably occurring at different stages of treatment, there is an urgent need in the art for disclosing compositions and methods for treatment of cancer using a CAR-based therapy that can exhibit cancer - specific intended therapeutic attributes without the aforementioned shortcomings, and with improved immune system responses against hematological malignancies.

[0020] One of the significant challenges in the field of immunotherapy is that the antigen-binding domain of a CAR, BiTE or DART is typically based on an scFv (single chain variable fragment). However, not all scFvs generated from different mAbs binding the same antigen make effective, or equally effective, CAR, BiTE or DART therapy. The inventors of the present invention have successfully developed scFvs with improved on-target off-tumor toxicity characteristics compared to those described in prior art.SUMMMARY OF THE INVENTION

[0021] Therefore, the present invention addresses these needs by providing an scFv capable of recognizing a specific antigen, LILRB1, a CAR molecule comprising the scFv, as well as engineered T cells expressing the CAR combinations that are exquisitely specific for LILRB1-expressing cells. Thus, the present invention provides single-chain variable fragments sequence, CAR-modified T cells, methods, compositions, and uses thereof in the treatment of cancer.

[0022] According to the first aspect of the invention there is provided an isolated scFv capable of recognizing LILRB1 antigen, the amino acid sequence comprising:

[0023] (a) a heavy chain variable region (VH) comprising the complementarity determining regions (CDRs), wherein the CDR1, CDR2 and CDR3 of VH comprise the amino acid sequences of SEQ ID NO: 1, 2, 3 respectively, or a variant having at least 85% sequence identity therewith, and

[0024] (b) a light chain variable region (VL), wherein the CDR1, CDR2 and CDR3 of VL comprise the amino acid sequences of SEQ ID NO: 4, 5, 6 respectively, or a variant having at least 85% sequence identity therewith.

[0025] Accordingly, provided herein is an isolated scFv wherein the amino acids in the sequence are arranged in such a way that the fragment has binding affinity for a LILRB1 antigen, more in particular for a human LILRB1 antigen. In a specific embodiment, modifications in the amino acid sequence of the scFv are anticipated, as long as the fragment has binding affinity for the LILRB1 antigen. For example, it may be desirable to improve the binding affinity and / or other biological properties of the scFv.

[0026] In one specific embodiment, one or more of said CDR sequences are modified by substitution, addition or deletion of 1 to 3 amino acids.

[0027] In another embodiment,

[0028] (a) the heavy chain variable region (VH) has an amino acid sequence of SEQ ID NO: 11, or a variant having at least 85% sequence identity therewith, and

[0029] (b) the light chain variable region (VL) has an amino acid sequence of SEQ ID NO: 17, or a variant having at least 85% sequence identity therewith;In a further embodiment, the amino acid sequence of SEQ ID NO: 11 and 17 are joined by a linker sequence (i.e. having a VL-linker-VH orientation or VH-linker-VL orientation), wherein the linker sequence may comprise or consist of a polypeptide having a length of about and between 1 to about 100 AA, in particular about 2 to about 50 AA, more in particular about 2 to about 20 AA.

[0030] In a specific embodiment, the scFv comprises or consists of the amino acid sequence of SEQ ID NO: 18, 20, 55 or 56, or an amino acid sequence having at least 85%, such as at least 90%, at least 95%, at least 99% sequence identity thereto.

[0031] In yet another embodiment, the present invention provides a chimeric fusion protein comprising the scFv of the invention, wherein the chimeric fusion protein is selected from the group comprising: a chimeric antigen receptor (CAR), a bispecific T-cell engager (BiTE), a dual affinity retargeting proteins (DART) or an antibody-drug conjugates (ADC), in particular a CAR, BiTE or DART. In a specific embodiment, the CAR is comprised expressed in an immune cell, in particular a T cell, a B cell, a natural killer (NK) cell, a macrophage, a monocyte, more in particular a CAR T cell.

[0032] In one aspect of the invention there is provided a pharmaceutical composition comprising the isolated scFv, or scFv amino acid sequence, the chimeric fusion protein, the CAR T cell, BiTE, DART or ADC according to the invention, the nucleic acid encoding such constructs, the vectors or host cells according to the invention, and a pharmaceutically acceptable carrier. Accordingly, one will understand that the scFv, the chimeric fusion protein, the CAR T cell, BiTE, DART or ADC, the nucleic acids, vectors or host cells according to the invention can be administered directly as a separate compound, meaning without being present in a pharmaceutical composition.

[0033] In further aspect of the invention there is provided a nucleic acid sequence encoding the isolated scFv, or scFv amino acid sequence according to the invention.

[0034] In yet another aspect of the invention there is provided a vector comprising the nucleic acid. In another aspect of the invention there is provided a host cell comprising the vector. Preferably, the host cell is a mammalian cell.

[0035] In yet another aspect of the invention there is provided said scFv amino acid sequence according for use in the immunotherapy. Preferably, said immunotherapy is therapy selected from the group comprising: CAR T-cell, monoclonal antibodies (mAs), bispecific T-cell engager (BiTE),bispecific antibodies, antibody-drug conjugates (ADC), secretion of T-cell engager antibodies (StAb), preferably said immunotherapy is the CAR T-cell therapy.

[0036] In one embodiment, immunotherapy is a treatment of diseases where the elimination of cells expressing LILRB1 is desired, such as hematological malignancies, or autoimmune diseases. Preferably, hematological malignancies are selected from the group comprising B cell-derived malignancies, including B-ALL, B-NHL, monocyte derived malignancies, and malignancies resistant to prior lines of immunotherapy, including malignancies where malignant cells had lost CD 19 expression post-CD19-targeting treatment. Alternatively, autoimmune diseases are selected from the group comprising rheumatoid arthritis, systemic lupus erythematosus, inflammatory bowel disease, Sjogren's syndrome, systemic sclerosis.

[0037] In another aspect of the invention there is provided a method of treating, ameliorating the effect of, or preventing the recurrence of a cancer in a subject, the method comprising administering to said subject a therapeutically effective amount of the isolated scFv or scFv amino acid sequence or the pharmaceutical composition. Preferably, the scFv amino acid sequence or the pharmaceutical composition is administered intravenously, intra-arterially, intra-tumorally, or subcutaneously.

[0038] Accordingly in yet another aspect of the invention there is provided a T cell that expresses a chimeric antigen receptor (CAR) at the cell surface, the CAR comprising:

[0039] - an antigen-binding domain;

[0040] - a hinge domain;

[0041] - a linking / trans-membrane domain; and

[0042] - an intracellular domain;

[0043] wherein the CAR is directed against, or has binding affinity to LILRB1 antigen.

[0044] In a further embodiment, the CAR T cell as provided herein comprises the scFv according to the invention.

[0045] Preferably, the CAR further comprises a signal peptide domain, preferably the signal peptide domain is any one of a GM-CSF signal peptide, an IL-2 signal peptide, or a CD8a signal peptide.In one embodiment the antigen-binding domain of the CAR comprises the scFv amino acid sequence according to the invention.

[0046] In further embodiment, the CAR T cell comprises a scFv capable of recognizing LILRB1 wherein the scFv comprises

[0047] (a) a heavy chain variable region (VH) comprising the complementarity determining regions (CDRs), wherein the CDR1, CDR2 and CDR3 of VH comprise the amino acid sequences of SEQ ID NO: 1, 2, 3 respectively, or a variant having at least 85%, such as at least 90% or 95% sequence identity therewith, and

[0048] (b) a light chain variable region (VL), wherein the CDR1, CDR2 and CDR3 of VL comprise the amino acid sequences of SEQ ID NO: 4, 5, 6 respectively, or a variant having at least 85%, such as at least 90% or 95% sequence identity therewith.

[0049] Preferably, the scFv according to the invention, or the CAR T cell, BiTE, DART or ADC comprises

[0050] (a) the heavy chain variable region (VH) has an amino acid sequence of SEQ ID NO: 11, or a variant having at least 85% such as at least 90% or 95% sequence identity therewith, and (b) the light chain variable region (VL) has an amino acid sequence of SEQ ID NO: 17, or a variant having at least 85% such as at least 90% or 95% sequence identity therewith.

[0051] In a specific embodiment, provided herein is a CAR T cell, BiTE, DART or ADC comprising the scFv of the invention comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 18, 20, 55 or 56, or an amino acid sequence having at least 85%, such as at least 90%, at least 95%, at least 99% sequence identity thereto.

[0052] In yet further embodiment, the scFv has a VL-linker-VH orientation.

[0053] In even a further embodiment, a CAR or CAR construct is provided comprising the amino acid sequence as set forth in any one of SEQ ID NO: 60-63, or a variant having at least 85%, such as at least 90%, at least 95%, at least 99% sequence identity therewith.

[0054] In one embodiment, the transmembrane domain is a transmembrane domain derived from the alpha, beta or zeta chain of the T-cell receptor, CD28, CD27, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, preferably human CD8a, CD3, CD28, or CD4.In yet a further embodiment, the CAR further comprises one or more co-stimulatory signaling domains selected from a group comprising CD27, CD28, 4-1BB (CD137), 0X40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3.

[0055] In a very specific embodiment, the CAR comprises:

[0056] - the antigen-binding domain, comprising

[0057] (a) a heavy chain variable region (VH) comprising the complementarity determining regions (CDRs), wherein the CDR1, CDR2 and CDR3 of VH comprise the amino acid sequences of SEQ ID NO: 1, 2, 3 respectively, and

[0058] (b) a light chain variable region (VL), wherein the CDR1, CDR2 and CDR3 of VL comprise the amino acid sequences of SEQ ID NO: 4, 5, 6 respectively;

[0059] - the hinge domain comprising the amino acid sequence of SEQ ID NO: 22 or 58;

[0060] - the linking / transmembrane domain comprising the amino acid sequence set forth in SEQ ID NO: 21 or 57; and

[0061] - the intracellular domain comprising the amino acid sequence of SEQ ID NO: 23 or 59 and / or the amino acid sequence of SEQ ID NO: 24.

[0062] In a further aspect of the invention, there is provided a nucleic acid sequence encoding the CAR. Preferably, the CAR encoding sequence comprises a sequence set forth in any one of SEQ ID NO: 27, 65, 68-70, or a variant thereof having at least 80%, such as at least 85%, at least 90% or at least 95% sequence identity.

[0063] In one aspect of the invention there is provided a vector which comprises the nucleic acid sequence encoding the CAR. Preferably, said vector comprises the nucleic acid sequence comprising a sequence as set forth in any one of SEQ ID NO: 27, 65, 68-70or a variant thereof having at least 80%, such as at least 85%, at least 90% or at least 95% sequence identity. In another aspect of the invention there is provided a method for generating a T cell or CAR T cell, which comprises a step of introducing into a T cell ex vivo the nucleic acid sequences, or the vector. Preferably, the step of introducing the nucleic acid sequences into a T cell ex vivo is carried out via a process of viral transduction, preferably using retroviral particles and vector.In one embodiment, said method comprises additional steps of cell activation, specific interleukin stimulations, and / or cell expansion before the step as specified previously is carried out.

[0064] In one aspect of the invention there is provided a composition comprising a population of T cells comprising a plurality of the T cells.

[0065] In another aspect of the invention there is provided an immunotherapeutic composition comprising an antitumor effective amount of said composition.

[0066] In one aspect of the invention there is provided a composition for use in immunotherapy. Preferably, said immunotherapy is therapy selected from the group comprising CAR T-cell, monoclonal antibodies (MABs), bispecific T-cell engager (BiTE), antibody-drug conjugates (ADC), secretion of T-cell engager antibodies (StAb) therapy, preferably said immunotherapy is the CAR T-cell therapy or BiTE therapy.

[0067] In one embodiment, immunotherapy is a treatment of human diseases where the elimination of cells expressing LILRB1 is desired, such as hematological malignancies, autoimmune diseases. In yet another embodiment, hematological malignancies are selected from the group comprising B cell-derived malignancies, including B-ALL, B-NHL, monocyte derived malignancies, and malignancies resistant to prior lines of immunotherapy, including malignancies where malignant cells had lost CD 19 expression post-CD19 CAR-T cell treatment. Alternatively, autoimmune diseases are selected from the group comprising rheumatoid arthritis, systemic lupus erythematosus, inflammatory bowel disease, Sjogren's syndrome, systemic sclerosis. In other aspect of the invention, there is provided a method of performing an immunotherapy, the method comprising administering to a subject in which the elimination of cells expressing LILRB1 is desired, a population of T cells comprising a nucleic acid molecule encoding the chimeric receptor, wherein the chimeric receptor comprises:

[0068] - the antigen-binding domain;

[0069] - the hinge domain;

[0070] - the linking / trans -membrane domain; and

[0071] - the intracellular domain;

[0072] thereby treating the subject.Accordingly, in yet another aspect of the invention there is provided a BiTe comprising (a) said antigen-binding domain, and

[0073] (b) an antigen-binding domain that binds to a T-cell antigen.

[0074] In a specific embodiment, a BiTe is provided comprising the scFv according to the invention, in particular wherein the scFv comprises

[0075] (a) a heavy chain variable region (VH) comprising the complementarity determining regions (CDRs), wherein the CDR1, CDR2 and CDR3 of VH comprise the amino acid sequences of SEQ ID NO: 1, 2, 3 respectively, or a variant having at least 85% sequence identity therewith, and

[0076] (b) a light chain variable region (VL), wherein the CDR1, CDR2 and CDR3 of VL comprise the amino acid sequences of SEQ ID NO: 4, 5, 6 respectively, or a variant having at least 85% sequence identity therewith.

[0077] In a specific embodiment, provided herein is a BiTE comprising the scFv of the invention comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 18, 20, 55 or 56, or an amino acid sequence having at least 85%, such as at least 90%, at least 95%, at least 99% sequence identity thereto.

[0078] In a further embodiment, the BiTE comprises a linker, in particular having a VL-linker-VH orientation.

[0079] In even a further embodiment, a BiTE is provided comprising the amino acid sequence as set forth in SEQ ID NO: 64, or a variant having at least 85%, such as at least 90%, at least 95%, at least 99% sequence identity therewith. In a very specific embodiment, a BiTE is provided comprising the amino acid sequence as set forth in SEQ ID NO: 92.

[0080] Preferably, the antigen binding domain that binds to a T-cell antigen of the BiTe or DART comprises an antibody fragment that specifically binds CD3.

[0081] In one aspect of the invention there is provided a method of performing an immunotherapy, the method comprising administering to a subject in which the elimination of cells expressing LILRB1 is desired, a population of T cells comprising a nucleic acid molecule encoding the bispecific T-cell engager or DART, wherein the bi-specific T-cell engager or DART comprises:(a) said antigen-binding domain, in particular comprising the scFv according to the invention, and

[0082] (b) the antigen-binding domain that binds to a T-cell antigen;

[0083] thereby treating the subject.

[0084] In conclusion, the present invention demonstrates that the strategic selection of an antibody targeting LILRB1 for CAR construction is indispensable for the antitumor efficacy of LILRB1 CAR-T cells.

[0085] The above and other advantages and benefits of the present invention will become more apparent from the examples of embodiments of the invention provided below.

[0086] The invention is further described in the following non-limiting figures.

[0087] DESCRIPTION OF FIGURES

[0088] Fig. 1 shows LILRB1 expression in normal leukocytes. A. LILRB1 protein levels on various peripheral blood leukocytes isolated from two healthy donors were analyzed by flow cytometry using anti-LILRBl Ab. B. LILRB1 surface levels on primary macrophages differentiated from monocytes of three healthy donors were analyzed by flow cytometry using anti-LILRBl Ab.

[0089] C. Primary human T cells from two healthy donors were stimulated with anti-CD3 / CD28 Abs for 3 days. LILRB1 surface levels on unstimulated and stimulated CD4 and CD8 T cells were analyzed by flow cytometry using anti-LILRBl Ab. In A. - C. the cells were stained with clone HP-F1 of anti-LILRBl Ab.

[0090] Fig. 2 presents evaluation of LILRB1 expression on antigen-activated CAR-T cells. A. CD19 CAR-T cells were co-cultured with Raji target cells for 24, 48, and 72 hours. LILRB1 surface levels on CD4 and CD8 CAR-T cells were assessed by flow cytometry using anti-LILRBl Ab. B. Representative flow cytometry gating strategy for the detection of LILRB1 levels in various subsets of CD 19 CAR-T cells cultured alone (CD 19 CAR-T only) or exposed to CD19-positive Raji cells (+ targets) for 24, 48 and 72h at 1 : 1 E:T ratio. The subsets of T cells were determined based on the CD45RA and CCR7 levels and classified as TEMRA (terminally differentiated T cells), TN (naive T cells), TEM (effector memory T cells), and TCM (central memory T cells). For each sample the gating was adjusted to CD45RA and CCR7 fluorescence minus one (FMO) control. C. Representative dot plots showing the percentage of LILRB1-positive cells among various subsets of CD8-positive CD 19 CAR-T cells unexposed or exposedto target cells for the indicate time. In A. - C. the cells were stained with clone HP-F1 of anti-LILRBl Ab.

[0091] Fig. 3 presents LILRB1 expression in B cell malignancies. A. LILRB1 expression was evaluated by flow cytometry on B-ALL PDX samples (adult and pediatric) representing various leukemia subtypes (n=26). The cells were stained with anti-LILRBl Ab. Mean fluorescence intensity (MFI) for each sample is shown next to the corresponding histogram. B. LILRB1 expression was evaluated by flow cytometry on six lymphoma cell lines. In A. and B. the cells were stained with clone HP-F1 of anti-LILRBl Ab. Mean fluorescence intensity (MFI) for each sample is shown next to the corresponding histogram.

[0092] Fig.4 shows LILRB1 expression in malignant B cells that are resistant to prior lines of immunotherapy and in CD 19 KO cells. A. LILRB1 expression was evaluated by flow cytometry on lymphoma cell lines (Ramos, RL and Raji) with developed in vitro resistance to rituximab. The cells were stained with anti-LILRBl Ab. Mean fluorescence intensity (MFI) for each sample is shown next to the corresponding histogram. B. LILRB1 expression was evaluated by flow cytometry on Raji cells with developed in vitro resistance to CD 19 CAR-T cells (Raji CAR-4 IBB) and compared to parental Raji cells and the cells exposed to unmodified T cells (Raji control). The cells were stained with anti-LILRBl Ab. Mean fluorescence intensity (MFI) for each sample is shown next to the corresponding histogram. C. LILRB1 expression in RS4;11 and Ramos CD19 KO cells and control cells was evaluated by flow cytometry. The cells were stained with anti-CD19 Ab and either clone HP-F1 or clone #292305 of anti-LILRBl Ab. MFI in each sample is shown next to the corresponding histogram.

[0093] Fig. 5 presents comparison of LILRB1 surface levels using two different clones of anti-LILRBl mAbs. Cell lines with low (697), moderate (RS4;11) and high (SD-1) levels of LILRB1 expression were used to compare selected clones of mouse anti -human LILRB1 monoclonal antibodies. The cells were stained with unconjugated clone HP-F1 or clone #292305 of anti-LILRBl Ab and next with secondary donkey anti -mouse Ab conjugated with fluorochrome. LILRB1 expression was then evaluated by flow cytometry.

[0094] Fig. 6 presents generation ofLILRBl CAR-T cells and preliminary in vitro efficacy testing. A. The scheme representing the modular structure of generated LILRBl-CARs: the designed LILRB-1 -targeting scFv sequences were based on two different clones of LILRBl mAbs, HP -Fl (2115) and #292305 (2116), and were incorporated into a second-generation CAR backbone comprising a CD8 hinge, CD8 transmembrane domain, and a 4-lBB-CD3ijsignaling tail. B. Efficiency of primary T cells transduction with CAR constructs. The expression of LILRBl-CARs was evaluated by staining the cells with anti-CD34 Ab, CD 19 CAR presence was confirmed using anti-mFab Ab. Data shows means ± SD from n = 6 donors.

[0095] C. Cytotoxicity of LILRB1 CAR-T cells against leukemia (SD-1) and lymphoma (DHL-4) cells was assessed by flow cytometry-based killing assay. CAR-T cells and CTV-labeled target cells were co-cultured for 24h at 1 : 1 E:T ratio. The samples were then stained with propidium iodide (PI) and the percentage of dead CTV+PI+ target cells was determined. Data shows means ± SD from n = 3 donors, P values were calculated using ordinary one-way ANOVA with Tukey’s multiple comparisons test (MOCK vs. CAR-T and various CAR-T comparison). D.

[0096] Cytotoxicity of LILRB1 CAR-T cells against leukemia (SD-1, RS4;11) and lymphoma (DHL-4) cells was assessed using a luciferase-based killing assay. CAR-T cells and luciferaseexpressing target cells were co-cultured for 24 hours at a 1 : 1 E:T ratio. The percentage of dead target cells was determined by measuring the decrease in luminescence signal. Data represent means ± SD from n = 3 donors. P values were calculated using ordinary one-way ANOVA with Tukey’s multiple comparisons test (MOCK vs. CAR-T and various CAR-T comparison).

[0097] E. Cytotoxicity of LILRB1 CAR-T cells against MLLr B-ALL PDX cells was assessed by luciferase-based killing assay. CAR-T cells and luciferase-expressing target cells were co-cultured for 24h at 0.5:1 E:T ratio. The percentage of dead target cells was determined by measuring the decrease in luminescence signal. Data shows means ± SD from n = 3 donors, P values were calculated using ordinary one-way ANOVA with Tukey’s multiple comparisons test (MOCK vs. CAR-T and various CAR-T comparison).

[0098] Fig. 7 shows verification of LILRB1 CAR-T cells specificity by using target cells with various levels of LILRB1 expression. A. Cytotoxicity of LILRB1 CAR-T cells against lymphoma cells line Ly7 was assessed by flow cytometry-based killing assay. LILRB1 level in Ly7 cell line is shown in Fig. 3B. CAR-T cells and CTV-labeled target cells were co-cultured for 24h at 1:1 E:T ratio. The samples were then stained with propidium iodide (PI) and the percentage of dead CTV+PI+ target cells was determined. Data shows means ± SD from n = 2-3 donors, P values were calculated using ordinary one-way ANOVA with Tukey’s multiple comparisons test (MOCK vs. CAR-T). B. LILRB1 expression in breast cancer cell line (MDA-MB-231) and hepatoma cell line (HepG2) was evaluated by flow cytometry. The cells were stained with either clone HP-F1 or clone #292305 of anti-LILRBl Ab. MFI in each sample is shown next to the corresponding histogram. C. Cytotoxicity of LILRB1 CAR-T cells against MDA-MB-231 and HepG2 cancer cell lines was assessed using a luciferase-based killing assay.CAR-T cells and luciferase-expressing target cells were co-cultured for 24h at 2:1 E:T ratio. The percentage of viable target cells was determined by measuring luminescence signal. Data shows means ± SD from n = 2 donors. D. LILRB1 gene overexpression in 697 cells was validated by flow cytometry. MFI in each sample is shown next to the corresponding histogram.

[0099] E. Cytotoxicity of LILRB1 CAR-T cells against B-ALL cells (697) genetically modified to overexpress LILRB1 was assessed by flow cytometry-based killing assay. CAR-T cells and CTV -labeled target cells were co-cultured for 24h at 1:1 E:T ratio. The samples were then stained with propidium iodide (PI) and the percentage of dead CTV+PI+ target cells was determined. Data shows means ± SD from n = 3 donors, P values were calculated using two-way ANOVA with Tukey’s multiple comparisons test (MOCK vs. CAR-T cells in each group and CAR-T vs. control or modified cell line).

[0100] Fig. 8 presents LILRB1 CAR-T cells specific cytotoxicity towards B-ALL PDX cells. A. Left panel: LILRB1 expression on the MLLr B-ALL PDX was evaluated by flow cytometry using clone #292305 of anti-LILRBl Ab. Mean fluorescence intensity (MFI) for each sample is shown next to the corresponding histogram. Right panel: CD19 expression on the B-ALL PDX cells used for the MS analysis was evaluated by flow cytometry. Mean fluorescence intensity (MFI) for each sample is shown next to the corresponding histogram. B. Cytotoxicity of LILRB1 CAR-T cells against 6 MLLr B-ALL PDX cells was assessed by flow cytometry -based killing assay. CAR-T cells and CTV -labeled target cells were co-cultured for 24h at 0.5:1 E:T ratio. The samples were then stained with propidium iodide (PI) and the percentage of dead CTV+PI+ target cells was determined. Data shows means ± SD from n = 2-3 donors, P values were calculated using ordinary one-way ANOVA with Tukey’s multiple comparisons test (MOCK vs. CAR-T and various CAR-T comparisons).

[0101] Fig.9 presents LILRB1 CAR-T cells cytotoxicity against CD 19 KO cells and CD 19 CAR-resistant cells. A. Cytotoxicity of LILRB1 CAR-T cells against RS4;11 and Ramos CD19 KO cells and control cells was assessed using a luciferase-based killing assay. CAR-T cells and luciferase-expressing target cells were co-cultured for 24h at 2:1 E:T ratio. The percentage of viable target cells was determined by measuring luminescence signal. Data shows means ± SD from n = 2 donors. B. Cytotoxicity of LILRB1 CAR-T cells against Raji cells resistant to CD19 CAR-T cells was assessed using a luciferase-based killing assay. CAR-T cells and luciferaseexpressing target cells were co-cultured for 24h at 5: 1 E:T ratio. The percentage of viable target cells was determined by measuring luminescence signal. Data shows means ± SD from n = 3donors, P values were calculated using two-way ANOVA with Tukey’s multiple comparisons test (MOCK vs. CAR-T cells in each group and CAR-T vs. control or resistant cell line). Fig. 10 presents degranulation and cytokines production by LILRB1 CAR-T cells after contact with tumor cells. A. Degranulation of LILRB1 CAR-T cells was assessed by flow cytometry. CAR-T cells and target cells (SD-1) were co-incubated for 18h at 1:2 E:T ratio, in the presence of anti-CD107a Ab. Next, the samples were stained with anti-CD3 Ab and the percentage of CD3+CD107a+ T cells was determined. Data shows means ± SD from n = 4 donors, P values were calculated using ordinary one-way ANOVA with Tukey’s multiple comparisons test (MOCK vs. CAR-T and CAR-T comparison). B. Cytokines release by LILRB1 CAR-T cells was evaluated using ELISA assay. CAR-T cells and target cells (SD-1) were co-incubated for 24h at 1:2 E:T ratio. The concentrations of IFNy and TNFa were then measured in the culture medium. Data shows means ± SEM from n = 3 donors, P values were calculated using ordinary one-way ANOVA with Dunnett’s multiple comparisons test (MOCK vs. CAR-T)

[0102] Fig. 11 shows evaluation of LILRB1 CAR-T cells cytotoxicity against PBMC subpopulations and hematopoietic progenitor cells. A. Cytotoxicity of LILRB1 CAR-T cells against normal PBMCs was assessed by flow cytometry. CFSE-labeled CAR-T cells were co-incubated with PBMCs for 24h at 1:2 E:T ratio. The samples were then stained with anti-CD19, anti-CD56, anti-CD3, and anti-CD14 antibodies to determine the approximate percentages of B cells (CD19+ cells), monocytes (CD14+ cells), T cells (CD3+ cells), and NK cells (CD56+ cells). Data shows means ± SD from n = 4 donors, P values were calculated using ordinary oneway ANOVA with Dunnett’s multiple comparisons test (MOCK vs. CAR-T). B. Colonyforming unit-erythroid (CFU-E), burst forming unit-erythroid (BFU-E), colony-forming unitgranulocyte, macrophage (CFU-GM), and colony-forming unit-granulocyte, erythrocyte, monocyte, megakaryocyte (CFU-GEMM) colonies were counted upon co-culture of 2.0 x 105BMNCs with 2.0 x 106CAR-T cells respectively (E:T ratio of 10:1) for 6 hours, followed by plating in methylcellulose and incubated for 14 days at 37°C (n=3; technical replicates).

[0103] Fig. 12 shows in vivo efficacy of LILRB1 CAR-T cells against LILRB 1-positive B-ALL. A. A scheme representing the design of the experiment evaluating in vivo efficacy of LILRB 1 CAR-T cells. NSG mice were injected iv with 3.0 x 106of luciferase-expressing RS4;11 cells. On day 3 and 6 after the injection of cancer cells the mice were treated with two doses, each of 5.0 x 106of CAR-T cells. The tumor development was monitored using IVIS imaging system.B. Representative images of the mice with developing tumor were obtained from the IVIS imaging system on days 3, 14, 24, 38, 46 and 53 following RS4;11 cells injection. The radiance scale demonstrates bioluminescence intensity. C. The quantification of tumor development was performed based on the measured bioluminescence from a region of interest (ROI) drawn over each animal and is presented individually for each mouse as total flux signal (n=5-7 / group) over time. P values were calculated for the results obtained up to day 38 using two-way repeated measures ANOVA with Dunnett’s multiple comparisons test (MOCK vs. CAR-T). The P values on day 38 are displayed on the graph. D. Event-free survival depicted on Kaplan-Meier survival plot. Curve comparison was done by log-rank (Mantel-Cox) test. E. The percentage of RS4;11 cells among all analyzed cells present in the spleens and bone marrow of the mice following the treatment was determined based on flow cytometry analysis at the day of sacrifice. Human cancer cells were defined as cells negative for murine CD45 (mCD45) antigen and human CD3 antigen. Data shows mean ± SEM from n = 4-7 mice, P values were calculated using ordinary one-way ANOVA with Tuckey’s multiple comparisons test. F. The percentage of human T cells residing in the spleens and bone marrow of the mice following CAR-T treatment was determined based on flow cytometry analysis. Human CD3+ cells were gated out from the cell population negative for mCD45 antigen. Data shows mean ± SEM from n = 4-7 mice, P values were calculated using ordinary one-way ANOVA with Tuckey’s multiple comparisons test. G. LILRB1 surface expression on the RS4;11 cells obtained from spleens and bone marrow of the mice following CAR-T treatment was assessed by flow cytometry.

[0104] Fig. 13 shows LILRB1 expression and LILRB1 CAR-T cells cytotoxicity against monocytic AML. A. LILRB1 expression was evaluated by flow cytometry on various AML cell lines. The cells were stained with anti-LILRBl Ab (clone HP-F1). Mean fluorescence intensity (MFI) for each cell line is shown next to the corresponding histogram. B. Cytotoxicity of LILRB1 CAR-T cells against AML cells (U937) was assessed using a flow cytometry-based killing assay. CAR-T cells and CTV -labeled target cells were co-cultured for 24h at 1:1 E:T ratio. The samples were then stained with propidium iodide (PI) and the percentage of dead CTV+PI+ target cells was determined. Data shows means ± SD from n = 3 donors, P values were calculated using ordinary one-way ANOVA with Dunnett’s multiple comparisons test (MOCK vs. CAR-T). C. IFNy and TNFa release by LILRB1 CAR-T cells was evaluated using ELISA assay. CAR-T cells and target AML cells (U937) were co-incubated for 24h at 1:2 E:T ratio. The concentration of IFNy and TNFa was then measured in the culture medium. Datashows means ± SEM from n = 3 donors, P values were calculated using ordinary one-way ANOVA with Dunnett’s multiple comparisons test (MOCK vs. CAR treatment).

[0105] Fig. 14 shows that LILRB1 CAR-T cells exhibit in vivo efficacy against LILRB 1-positive monocytic AML. A. A scheme representing the design of the experiment evaluating in vivo efficacy of LILRB 1 CAR-T cells. NSG mice were injected iv with 0.5 x 106of luciferaseexpressing U937 cells. At day 1 and 4 after the injection of cancer cells the mice were treated with two doses of 5 x 106of CAR-T cells. The tumor development was monitored using IVIS imaging system. B. The assessment of tumor development was performed based on the measured bioluminescence from a region of interest (ROI) drawn over each animal and is presented individually for each mouse as total flux signal (n=6-7 / group) over time. C.

[0106] Representative images of mice with developing tumor were obtained from the IVIS imaging system at days 5, 9, 12 and 16 following U937 cells injection. The radiance scale demonstrates bioluminescence intensity. D. Event-free survival depicted on Kaplan-Meier survival plot. Curve comparison was done by log-rank (Mantel-Cox) test. E. LILRB 1 expression (left panel) and CD33 expression (right panel) on U937 cells from cell culture (U937 only), as well as residing in the spleens of the mice following anti-LILRBl, anti-CD33 CAR-T or mock T cells treatment was evaluated by flow cytometry. Mean fluorescence intensity (MFI) for each sample is shown next to the corresponding histogram.

[0107] Fig. 15 presents generation of LILRB1 CAR constructs in addition to 2115 and 2116.

[0108] Schematic representation of the modular design of the extra generated LILRB 1 CARs. Variable heavy and variable light domains derived from two LILRB 1 monoclonal antibody clones (HPF1; clonel and #292305; clone 2) were joined using either a long or short linker to form scFvs. Construct 2499 is based on the same clone as 2115 (clone 1) except that the construct has a short linker whereas 2115 has a long linker. Construct 2500 is based on the same clone as 2116 (clone 2) except that the construct has a long linker whereas 2116 has a short linker. The resulting scFvs were incorporated into one of two second-generation CAR backbones: a construct containing a CD8 hinge, CD8 transmembrane domain, and 4-1 BB-CD3ij signaling domain (41BB), or a construct containing a CD28 hinge, CD28 transmembrane domain, and CD28-CD3ij signaling domain (CD28).

[0109] Fig. 16 shows cytotoxicity of LILRB1 CAR-T cells generated with different CAR formats (2116 or 2500) against LILRB 1-positive B-ALL and AML cell lines. Cytotoxicity of LILRB1 CAR-T cells against B-ALL cells (RS4;11; panel A&C) and AML cells (U937; panelB&D) was assessed using a luciferase-based killing assay. CAR-T cells and luciferaseexpressing target cells were co-cultured for 24h at 2: 1 E:T ratio (A, B) and 1 : 1 E:T ratio (C, D) The percentage of viable target cells was determined by measuring luminescence signal. Data shows means ± SD from n = 4 donors, P values were calculated using one-way ANOVA with Tukey’s multiple comparisons test (MOCK vs. CAR-T and various CAR-T comparisons). Fig.17 shows cytotoxicity and cytokine production of LILRB1 CAR-T cells generated with different CAR formats clone 1 (2115 or 2499) and clone 2 (2116 or 2500) against LILRB1-positive B-ALL cell line. A. Cytotoxicity of LILRB1 CAR-T cells against B-ALL cells (SD-1) was assessed using a luciferase-based killing assay. CAR-T cells and luciferase-expressing target cells were co-cultured for 24h at 1:1 E:T ratio. The percentage of viable target cells was determined by measuring luminescence signal. Data shows means ± SD from n = 4 donors, P values were calculated using one-way ANOVA with Tukey’s multiple comparisons test (MOCK vs. CAR-T and various CAR-T comparisons). B.-E. Cytokines release by LILRB1 CAR-T cells was evaluated using bioluminescent immunoassay. CAR-T cells and target cells (SD-1) were co-incubated for 24h at 1:2 E:T ratio. The concentrations of IFNy and IL-2 were then measured in the culture medium. Data shows means ± SD from n = 4 donors, P values were calculated using one-way ANOVA with Tukey’s multiple comparisons test (MOCK vs. CAR-T and various CAR-T comparisons).

[0110] Fig. 18 shows LILRB1 BiTEs generation and semi-quantitative evaluation. A. Variable heavy and variable light domains derived from two LILRB1 monoclonal antibody clones (HPF1 and #292305) are joined using a long linker to form LILRB1 -targeting single-chain variable fragments (scFvs), which are connected to an anti-CD3 scFv to form LILRB 1 -targeting BiTEs. B. CD 19-targeting and LILRB 1 -targeting BiTE proteins containing 6-His tags produced in HEK293T cells were detected in culture medium by Western blot analysis using anti-6-His tag antibodies

[0111] Fig.19 shows BiTE-mediated cytotoxicity of T cells against LILRB 1-positive B-ALL cells, or AML cells. A. Cytotoxicity of T cells against B-ALL cells (RS4;11) was assessed using a luciferase-based killing assay. T cells and luciferase-expressing target cells were co-cultured for 24h at 0.5:1 or 2:1 E:T ratio in the presence of varying amounts of BiTE protein. B.

[0112] Cytotoxicity of T cells against AML cells (U937) was assessed using a luciferase-based killing assay. T cells and luciferase-expressing target cells were co-cultured for 24h at 0.5:1 or 2: 1 E:T ratio in the presence of varying amounts of BiTE protein.DETAILED DESCRIPTION OF THE INVENTION

[0113] Current challenges in the more widespread and effective adaptation of CAR therapy for cancer relate, among others, to a paucity of compelling targets. Here, single chain variable fragments (scFvs) capable of recognizing LILRB1 were identified with the purpose for cancer immunotherapy, in particular for chimeric antigen receptor-modified T cell (CAR-T) and Bispecific T-cell engagers (BiTEs) immunotherapy based on binding affinity of the specific LILRB1 antibody.

[0114] In general, the inventors have found that an effective CAR or BiTE for use in adoptive cell transfer therapy against cells expressing LILRB1 may be based on the specific antibody, and more particularly on the variable region (VL and VH chains) of this antibody and specifically on the hypervariable regions or CDRs (complementarity determining regions) thereof.

[0115] As will be described in more detail below, in more particular embodiments, the CAR or BiTE comprises an antigen-binding domain based on, or comprising, the VL and VH chains of the particular LILRB1 antibody, optionally in combination with a signaling tail comprising specific combinations of hinge, transmembrane, co-stimulatory and intracellular signaling domains. LILRB1 belongs to a group of immune inhibitory receptors that transmit inhibitory signalling following binding with MHC class I molecules and was identified by the inventors as a novel target for immunotherapy. Extensive validation of LILRB1 expression revealed its specificity to B cell-derived malignancies including B-ALL, B-NHL, even in cases where malignant cells had lost CD 19 expression post-CD19 CAR-T cell treatment, and monocyte-derived malignancies such as AML. The inventors generated LILRB1 -targeted CAR-T cells and confirmed their antitumor efficacy both in vitro and in vivo.

[0116] Previous efforts to target AML-associated antigens such as CD 123 and CD33 have led to severe myelotoxicity because these antigens are also expressed on early stem and progenitor cells. Many novel antigens targeted by antibodies and CAR-T cells for treatment of AML are also coexpressed on normal HSPCs. In this context, LILRB1, unexpectedly, holds an advantage of not ablating normal human haematopoiesis when compared with other AML targets in development.

[0117] Although CARs are now a well-known and practiced technology and the use of immune cells expressing CARs represents an attractive and promising approach in cancer therapy, the design of an appropriate CAR is not always straightforward. Specifically, concerning the antigen-binding domain of the CAR, it cannot be assumed that a domain demonstrating antigen-binding capability in one situation will be effective in the CAR context, meaning it may not effectively trigger CAR-T cell activation. Moreover, the antigen-binding domain of a CAR is typically derived from a single-chain variable fragment (scFv), and not all antibodies are suitable for the generation of effective scFvs.

[0118] Considering the above, two different LILRB1 -specific CAR molecules, further defined herein as “2115” and “2116” were constructed, based on two clones of anti -LIL RBI mAbs, HP -Fl and 292305. Although both antibodies effectively bind the LILRB1 target, unexpectedly, obtained results demonstrated that T cells expressing the designed variant-based 2116 CAR construct are significantly more efficient in killing LILRB1 -expressing cells. Given the substantial differences in the CDR sequences of the heavy chains of these two antibody clones, inventors state, without being bound by any theory, that they bind different epitopes of LILRB 1 , which can affect the immune synapse structure and, consequently, CAR efficacy.

[0119] Following this, the inventors carried out thorough preclinical validation of the 2116 variantbased LILRB 1 CAR-T cells. These CAR-T cells showed specific targeting and elimination of LILRB 1 -expressing tumor cells while sparing cells that do not express the target. Notably, they also demonstrated antitumor activity in vivo. It was demonstrated herein for the first time that LILRB 1 is a viable target for immunotherapy. More particularly, it was shown that immunotherapy based on the binding affinity of the specific LILRB 1 antibody, namely LILRB 1 CAR-T cells, represents a novel therapeutic strategy, applicable across various hematologic indications.

[0120] Firstly, to address the applicability of LILRB 1 CAR-T cells as a salvage therapy, inventors employed cell lines resistant to previous lines of treatment. Since rituximab plus chemotherapy (R-CHOP) is applied as a first-line therapy for lymphoma, in the present study several RTX-resistant (RR) cell lines were used that have been previously established as surrogate models to study resistance to R-CHOP. In two tested RR cell lines upregulation of LILRB 1 was observed, as compared with control counterparts supporting the utility of LILRB 1 as a target for immunotherapy in rituximab-resistant patients. Furthermore, it was demonstrated that LILRB 1 CAR-T cells eliminate tumor cells resistant to CD 19 CAR-T cells. Given that CD 19 CAR-T cells are effective long-term only in about 50% of patients with B cell malignancies and resistance is often associated with CD 19 loss, there is an urgent need for identification of novel immunotherapy targets. In line with that, cell line resistant to CD 19 CAR-T cells was generatedby exposing the cells to CD19 CAR-T cells for subsequent several cycles. This model very well recapitulated the clinical data, when resistance is commonly caused by CD19 protein loss. CD 19 loss in the present resistant model was accompanied by disturbances in pathways involved in lymphocytes’ proliferation, activation, and adhesion, however, LILRB1 expression remained roughly unchanged. Importantly, in primary cells from a patient resistant to CD 19 CAR-T cells, LILRB1 expression was preserved even at a higher level at relapse after CD 19 CAR-T cells treatment than before the treatment. Moreover, retrospective analysis of patients previously treated with CD19-targeting immunotherapy revealed that in a substantial number of patients, CD22 is lost or downregulated along with CD 19, as has been already reported, while CD20 is typically expressed at very low levels. These observations suggest that targets under clinical investigation, such as CD22 and CD20, are not always optimal. Therefore, LILRB1 CAR-T cells are unexpectedly beneficial for groups of patients resistant to previous treatments and provide an alternative to other CAR-T tested in preclinical studies, targeting CD72, CD79a, and CD79b.

[0121] Another application of LILRB1 CAR-T cells is in B-ALL cases with a lymphoid-to-myeloid lineage switch. While lineage switching or the acquisition of myeloid features is rare in pediatric B-ALL cases treated with chemotherapy, its frequency increases to up to 10% under the pressure of CD19-directed immunotherapy. Despite B-ALL originating from committed pre-B cells or earlier progenitors, their inherent plasticity allows them to potentially reprogram into other hematopoietic lineages, often presenting a monocytic or myelomonocytic phenotype. Prolonged CD19-directed immunotherapy may trigger unique resistance mechanisms associated with the loss of B cell identity. Clinical and murine model studies have demonstrated that persistent CD 19 CAR-T cell therapy can induce lineage switching, characterized by the decreased or absent expression of B cell-specific markers (CD 19, CD22, B220) and the concurrent elevation of myeloid markers (CD33, Grl, CDllb). Instances of myeloid lineage switching at relapse have been documented following treatments with blinatumomab and CD19 CAR-T cells. In these scenarios, the use of LILRB1 CAR-T cells is particularly beneficial. An additional, unexpected use of immunotherapy based on a specific LILRB1 antibody, in particular the use of LILRB1 CAR-T cells, is in the treatment of monocytic and mixed-lineage AML. The present disclosure shows that LILRB1 is highly expressed in normal monocytes and monocytic AML primary cells and that LILRB1 CAR-T cells effectively kill monocytic AML cells in preclinical in vitro and in vivo models. Monocytic AML (M5 by FAB classification) is a difficult-to-treat, life-threatening malignancy, constituting about 10% of all AML cases. M5AML cells exhibit increased resistance to venetoclax therapy, with relapses showing a monocytic phenotype in approximately 30% of patients, leading to decreased overall survival compared to those with non-M5 AML. Therefore, targets for immunotherapy of monocytic AML are being intensively sought, and several candidates have been preliminarily evaluated in preclinical models, including CD64, LILRB4, and CLL1. LILRB1 CAR-T therapy represents another option for treating monocytic AML.

[0122] Targeting LILRB1 -mediated inhibitory signaling by blocking antibodies has been shown to increase antitumor functions of NK cells and to enhance tumor cell killing by bispecific antibodies. On the other hand, LILRB1 CAR-T cells can be employed to eliminate LILRB 1-expressing non-classical monocytes and tumor-associated macrophages (TAMs) to enhance other therapies. Non-classical monocytes and TAMs often accumulate in the tumor microenvironment (TME) in haematological malignancies and solid tumors and correlate with poor patient survival, reducing the efficacy of other therapies. Targeting LILRB 1 could improve outcomes by removing TAMs.

[0123] In conclusion, the present invention discloses isolated scFv capable of recognizing LILRB 1 as well as CAR-T cells or BiTEs that specifically target B-ALL, B-NHL, and monocytic AML blasts. The present findings highlight the potential of LILRB 1 CAR-T cells to address the limitations of current immunotherapies, particularly in cases where CD19-directed treatments fail or where there is a need to target monocytic AML, which currently lacks clinically-approved CAR-T therapy options.

[0124] CAR-encoding nucleic acids may be transferred to T cells using, for example, retroviral or lentiviral vectors, as well as by mRNA transfection. In this way, a large number of cancerspecific T cells can be generated for adoptive cell transfer. Upon CAR binding to the cognate antigen, it activates the T-cell, directing specificity and cytotoxicity towards tumor cells expressing the targeted antigen.

[0125] In some embodiments, the present disclosure relates to an immune cytotoxic cell that expresses the CAR at the cell surface such that an immune cytotoxic cell can recognize a desired surface molecule on target cells. The desired properties are provided by the CAR domain structure, including an extracellular antigen-binding domain, a hinge / trans-membrane domain and an endodomain / intracellular signaling domain.

[0126] The inventors have identified that an effective CAR for adoptive cell transfer therapy targeting LILRB 1 -expressing cells can be constructed based on a specific antibody, particularly itsvariable regions (VL and VH chains), more specifically on its hypervariable regions, or CDRs (complementarity-determining regions). As will be described in more detail below, in more particular embodiments the CAR comprises an antigen-binding domain of the VL and VH chains of the LILRB1 antibody (clone 292305), optionally in combination with a particular "signaling tail" comprising specific combinations of hinge, transmembrane, co-stimulatory and intracellular signaling domains. Therefore, the present invention relates to single-chain variable fragments capable of recognizing LILRB1 antigen and LILRB1 -targeting CAR-modified T cells, cells, methods, compositions and immunotherapeutic target, and uses thereof in the treatment of cancer.

[0127] According to a first aspect of the invention, provided herein is an isolated scFv capable of recognizing a LILRB1 antigen, the scFv comprising: (a) a heavy chain variable region (VH) comprising the complementarity determining regions (CDRs), wherein the CDR1, CDR2 and CDR3 of VH comprise the amino acid sequences of SEQ ID NO: 1, 2, 3 respectively, or a variant having at least 85%%, such as at least 90%, at least 95%, at least 99% or 100% sequence identity therewith, and (b) a light chain variable region (VL), wherein the CDR1, CDR2 and CDR3 of VL comprise the amino acid sequences of SEQ ID NO: 4, 5, 6 respectively, or a variant having at least 85%%, such as at least 90%, at least 95%, at least 99% or 100% sequence identity therewith.

[0128] In a specific embodiment, there is provided an scFv (SEQ ID NO: 20; also referred herein as clone2 “2116”) or an scFv (SEQ ID NO: 55; also referred herein as clone2 “2500”) amino acid sequence capable of recognizing LILRB1 antigen, comprising (a) a heavy chain variable region (VH) comprising the complementarity determining regions (CDRs), wherein the CDR1, CDR2 and CDR3 of VH, namely CDR-H1, CDR-H2, CDR-H3, comprise the amino acid sequences of SEQ ID NO: 1 , 2, 3 respectively, or a variant having at least 85% sequence identity therewith, and (b) a light chain variable region (VL), wherein the CDR1, CDR2 and CDR3 of VL, namely CDR-L1, CDR-L2, CDR-L3, comprise the amino acid sequences of SEQ ID NO: 4, 5, 6 respectively, or a variant having at least 85% sequence identity therewith.

[0129] The term "antibody”, as used herein, refers to a protein, or polypeptide sequence derived from an immunoglobulin molecule which specifically binds with an antigen. Antibodies can be polyclonal or monoclonal, multiple or single chain, or intact immunoglobulins, and may be derived from natural sources or from recombinant sources. Antibodies can be tetramers of immunoglobulin molecules.The term "scFv" or “isolated scFv” refers to a fusion protein comprising at least one antibody fragment comprising a variable region of a light chain and at least one antibody fragment comprising a variable region of a heavy chain, wherein the light and heavy chain variable regions are contiguously linked via a short flexible polypeptide linker, and capable of being expressed as a single chain polypeptide, and wherein the scFv retains the specificity of the intact antibody from which it is derived. Unless specified, as used herein an scFv may have the VL and VH variable regions in either order, e.g. , with respect to the N-terminal and C-terminal ends of the polypeptide, the scFv may comprise VL-linker-VH or may comprise VH-linker-VL. "Heavy chain variable region", “HV” or "VH" refers to the fragment of the heavy chain of an antibody that contains three CDRs (complementarity determining regions) interposed between flanking stretches known as framework regions, which are more highly conserved than the CDRs and form a scaffold to support the CDRs.

[0130] "Light chain variable region", “IN” or "VL" refers to the fragment of the light chain of an antibody that contains three CDRs interposed between framework regions.

[0131] In the context of the present invention, a “linker or "linker sequence" refers to an amino acid sequence that joins the VL and VH variable regions as provided herein. As used herein, a “short linker sequence” may consist of a polypeptide having a length of about and between 1 and 21 amino acids (AAs), whereas a “long linker sequence “ may consist of a polypeptide having a length of about and between 22 and 100 Aas, in particular between 22 and 55 AAs.

[0132] The term "Fv" refers to the smallest fragment of an antibody to bear the complete antigenbinding site. A Fv fragment consists of the variable region of a single light chain bound to the variable region of a single heavy chain.

[0133] The term "complementarity determining region" or "CDR," as used herein, refers to the sequences of amino acids within antibody variable regions which confer antigen specificity and binding affinity. For example, in general, there are three CDRs in each heavy chain variable region (e.g., HCDR1, HCDR2, and HCDR3) and three CDRs in each light chain variable region (LCDR1, LCDR2, and LCDR3). The precise amino acid sequence boundaries of a given CDR can be determined using any of a number of well-known schemes, including those described by Kabat et al. (1991) (38) or a combination thereof.

[0134] As used herein, the term "isolated" or "purified" in association with an antibody fragment means that the antibody fragment is not in its natural medium or in its natural form. Thus, the term"isolated" includes antibody fragments taken from the original environment, for example, if it is naturally occurring. For example, an isolated antibody fragment or scFv generally does not contain at least some proteins or other cellular components that it is usually bound to or usually mixed with or in solution. Isolated antibody fragments include the naturally produced polypeptides contained in cell lysates, the polypeptides in purified or partially purified form, recombinant polypeptides, the polypeptides expressed or secreted by cells, and in heterologous host cells or cultures of the polypeptide. In connection with nucleic acids, the term isolated or purified indicates that the nucleic acid is not in its natural genomic background (e.g., in a vector, as an expression cassette, linked to a promoter, or artificially introduced into a heterologous host cell).

[0135] In one embodiment, the isolated scFv amino acid sequence capable of recognizing LILRB1 antigen, described herein comprises heavy chain CDR sequences: a CDR1 sharing at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, or at least 95% identity with SEQ ID NO:1, a CDR2 sharing at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, or at least 95% identity with SEQ ID NO: 2, and a CDR3 sharing at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, or at least 95% identity with SEQ ID NO: 3; and / or the following light chain CDR sequences: a CDR1 sharing at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, or at least 95% identity with SEQ ID NO: 4, a CDR2 sharing at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, or at least 95% identity with SEQ ID NO: 5, and a CDR3 sharing at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, or at least 95% identity with SEQ ID NO: 6.

[0136] The term “percent (%) sequence identity” with respect to amino acid sequence (or nucleic acid sequence) is defined as the percentage of amino acid (or nucleic acid) residues in a candidate sequence that are identical to the amino acid (or nucleic acid) residues in a reference sequence, after aligning the sequences and, if necessary, introducing gaps, to achieve the maximum number of identical amino acids (or nucleic acids). In other words, percent (%) sequence identity of an amino acid sequence (or nucleic acid sequence) can be calculated by dividing the number of amino acid residues (or bases) that are identical relative to the reference sequence to which it is being compared by the total number of the amino acid residues (or bases) in the candidate sequence or in the reference sequence, whichever is shorter.

[0137] In one embodiment, one or more of said CDR sequences are modified by substitution, addition or deletion of 1 to 3 amino acids.In a specific embodiment, the isolated scFv capable of recognizing LILRB1 antigen described herein comprises (a) a heavy chain variable region (VH) comprising the complementarity determining regions (CDRs), wherein the CDR1, CDR2 and CDR3 of VH comprise the amino acid sequences of SEQ ID NO: 1, 2, 3 respectively, and (b) a light chain variable region (VL), wherein the CDR1, CDR2 and CDR3 of VL comprise the amino acid sequences of SEQ ID NO: 4, 5, 6 respectively. In a specific embodiment, said scFv is comprised in a CAR, CAR T cell or BiTE.

[0138] In yet other embodiment, (a) the heavy chain variable region (VH) of the isolated scFv according to the invention comprises or has an amino acid sequence of SEQ ID NO: 11, or a variant having at least 85% sequence identity therewith, and (b) the light chain variable region (VL) comprises or has an amino acid sequence of SEQ ID NO: 17, or a variant having at least 85% sequence identity therewith.

[0139] In one embodiment, the heavy chain variable region (VH), described herein, has an amino acid sequence sharing at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, or at least 95% identity with SEQ ID NO: 11; and / or the light chain variable region (VL) has an amino acid sequence sharing at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, or at least 95% identity with SEQ ID NO: 17. In a specific embodiment the heavy chain variable region (VH), described herein, has an amino acid sequence as set forth in SEQ ID NO: 11; and / or the light chain variable region (VL) has an amino acid sequence as set forth in SEQ ID NO: 17.

[0140] In another aspect of the invention there is provided the pharmaceutical composition comprising the isolated scFv according to the invention, the CAR, CAR T cell, or BiTE and a pharmaceutically acceptable carrier. The pharmaceutical composition may additionally comprise a pharmaceutically acceptable carrier, diluents, or excipient. Standard pharmaceutical carriers include a phosphate buffered saline solution, water, emulsions such as oil / water or water / oil emulsion, and various types of wetting agents. In some embodiments, the pharmaceutical composition is formulated for administration to a subject by multiple administration routes, including but not limited to, parenteral (e.g., intravenous, subcutaneous, intramuscular, intraarterial, intradermal, intraperitoneal, intravitreal, intracerebral, or intracerebroventricular), oral, intranasal, buccal, rectal, or transdermal administration routes. In some embodiments, the pharmaceutical compositions described herein are administered for therapeutic applications. In some embodiments, the pharmaceutical composition isadministered once per day, twice per day, three times per day or more. The pharmaceutical composition is administered daily, every day, every alternate day, five days a week, once a week, every other week, two weeks per month, three weeks per month, once a month, twice a month, three times per month, or more. The pharmaceutical composition is administered for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 2 years, 3 years, or more.

[0141] In further aspect of the invention there is provided a nucleic acid encoding the scFv according to the invention. In one embodiment, provided herein is a nucleic acid molecule that encodes said scFv, the nucleic acid molecule having a nucleotide sequence which is at least about 80% identical to SEQ ID NO: 25, 26 or 66-67. Preferably, the nucleic acid molecule has a nucleotide sequence with at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, or at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 25, 26 or 66-67.

[0142] Methods for preparing a nucleic acid molecule encoding the CAR are well known e.g. conventional polymerase chain reaction (PCR) cloning techniques can be used to construct the nucleic acid molecule. The nucleic acid molecule can be cloned into a general purpose cloning vector such as pENT (Gateway), pUC19, pBR322, pBluescript vectors (Stratagene Inc.) or pCR TOPO from Invitrogen Inc. The resultant nucleic acid construct (recombinant vector) carrying the nucleic acid molecule encoding the CAR can then be sub-cloned into expression vectors or viral vectors for protein expression, e.g. in mammalian cells. This may be for preparation of the CAR protein, or for expression in immune effector cells, e.g. in human T-cells or in NK cells or cell lines. Further, the nucleic acid may be introduced into mRNA expression vectors for production of mRNA encoding the CAR. The mRNA may then be transferred into immune effector cells.

[0143] Vectors or constructs (nucleic acid molecules) may be introduced into a cell by a variety of means, including chemical transfection agents (such as calcium phosphate, branched organic compounds, liposomes or cationic polymers), electroporation, cell squeezing, sonoporation, optical transfection, hydrodynamic delivery, or viral transduction.

[0144] Preferably, a vector or construct is introduced by viral transduction. This may allow for more persistent expression of the CAR. However, in some situations, e.g. in clinical trials, or in some clinical situations, it may be desirable to have a more transient period of expression of CAR protein. In such a situation it may be desirable to deliver the nucleic acid molecule to theimmune effector cell as mRNA. mRNA expression vectors for production of mRNA may be prepared according to methods known in the art (e.g. using Gateway Technology) and are known in the art).

[0145] The mRNA can be produced in vitro by e.g. in vitro transcription. The mRNA may then be introduced into the immune effector cells, e.g. as naked mRNA, e.g. by electroporation. Alternatively, mRNA may be introduced by other means such as by liposomes or cationic molecules etc. Heterologous nucleic acid molecules introduced into a cell may be expressed episomally, or may be integrated into the genome of the cell at a suitable locus.

[0146] Thus, in other aspect of the invention there is provided a vector comprising said nucleic acid. The term "vector" as used herein refers to a vehicle into which a polynucleotide encoding a protein may be operably inserted so as to bring about the expression of that protein. A vector may be used to transform, transduce, or transfect a host cell so as to bring about expression of the genetic element it carries within the host cell. Examples of vectors include plasmids, phagemids, cosmids, artificial chromosomes such as yeast artificial chromosome (YAC), bacterial artificial chromosome (BAC), or Pl -derived artificial chromosome (PAC), bacteriophages such as lambda phage or M13 phage, and animal viruses. Categories of animal viruses used as vectors include retrovirus (including lentivirus), adenovirus, adeno-associated virus, herpesvirus (e.g., herpes simplex virus), poxvirus, baculovirus, papillomavirus, and papovavirus (e.g., SV40). Avector may contain a variety of elements for controlling expression, including promoter sequences, transcription initiation sequences, enhancer sequences, selectable elements, and reporter genes. In addition, the vector may contain an origin of replication. A vector may also include materials to aid in its entry into the cell, including but not limited to a viral particle, a liposome, or a protein coating. A vector can be an expression vector or a cloning vector.

[0147] In one embodiment, the present disclosure provides vectors (e.g., expression vectors) containing the nucleic acid sequence provided herein encoding said scFv, at least one promoter (e.g., SV40, CMV, EF-la) operably linked to the nucleic acid sequence, and at least one selection marker. Promoters can also originate from viral elements, such as long terminal repeats (LTRs). Examples of viruses that serve as sources for these promoters include MPSV, MSGV, HTLV, and HIV. Examples of vectors include, but are not limited to, retrovirus (including lentivirus), adenovirus, adeno-associated virus, herpesvirus (e.g., herpes simplex virus), poxvirus, baculovirus, papillomawirus, papovavirus (e.g., SV40), lambda phage, and M13 phage, plasmidpcDNA3.3, pMD18-T, pOptivec, pCMV, pEGFP, pIRES, pQD-Hyg-GScu, pALTER, pBAD, pcDNA, pCal, pL, pET, pGEMEX, pGEX, pCI, pEGFT, pSV2, pFUSE, pVITRO, pVIVO, pMAL, pMONO, pSELECT, pUNO, pDUO, Psg5L, pBABE, pWPXL, pBI, pl5TV-L, pProll8, pTD, pRSlO, pLexA, pACT2.2, pCMV- SCRIPTRTM., pMP71, pCDM8, pCDNA 1.1 / amp, peDNA3.1, pRc / RSV, PCR 2.1, pEF-Il, pFB, pSGs, pXTl, pCDEF3, pSVSPORT, pEF-Bos etc.

[0148] In another aspect of the invention there is provided a host cell comprising said vector, preferably, the host cell is a mammalian cell. The phrase "host cell” as used herein refers to a cell into which an exogenous polynucleotide and / or a vector can be or has been introduced. In further aspect of the invention there is provided the scFv amino acid sequence for use in the immunotherapy.

[0149] The term “treating” or treatment” of a disease, disorder or condition as used herein includes preventing or alleviating a disease, disorder or condition, slowing the onset or rate of development of a disease, disorder or condition, reducing the risk of developing a disease, disorder or condition, preventing or delaying the development of symptoms associated with a disease, disorder or condition, reducing or ending symptoms associated with a disease, disorder or condition, generating a complete or partial regression of a disease, disorder or condition, curing a disease, disorder or condition, or some combination thereof.

[0150] In one embodiment, said immunotherapy is a therapy selected from the group comprising: CAR T-cell, monoclonal antibodies (mAbs), bispecific T-cell engagers (BiTEs), bispecific antibodies, antibody-drug conjugates (ADC), secretion of T-cell engager antibodies (StAb), preferably said immunotherapy is the CAR T-cell therapy or BiTE therapy.

[0151] The term "Chimeric Antigen Receptor" or alternatively a "CAR" refers to a recombinant polypeptide construct comprising at least an extracellular antigen binding domain, a transmembrane domain and a cytoplasmic signaling domain (also referred to herein as "an intracellular domain") comprising a functional signaling domain derived from a stimulatory molecule as defined below. In some embodiments, the domains in the CAR polypeptide construct are in the same polypeptide chain, e.g., comprise a chimeric fusion protein.

[0152] By "bi-specific T cell engagers,” "BiTE antibody constructs,” or BiTEs” is meant polypeptides that each include tandemly linked single-chain variable fragments (scFvs). Optionally, the scFvs are linked by a linker (e.g., a glycine-rich linker). One scFv of the BiTE binds to the Tcell receptor (TCR) (e.g., to the CD3e subunit) and the other binds to a target antigen (e.g., a tumor-associated antigen).

[0153] Accordingly, provided herein is a chimeric fusion protein comprising the scFv according to the invention. When reference is made to chimeric fusion protein, one will understand that this refers to fusion proteins other than natural proteins. Additionally, one will understand that these terms also refer to the term “recombinant protein” or “engineered protein”. Also used herein is the term T cell activator. For example, whereas both CAR, BiTE and DART platforms use single-chain variable fragments to recognize and target antigens expressed on tumor cells, the BiTE of DART platform also uses one scFv to recognize and bind T cells. As such, the terms defined herein can be used interchangeably. Thus, the chimeric fusion protein according to the invention results from the joining or fusion of the scFv domain capable of binding the LILBR1 antigen on the one hand, and on the other hand the respective parts of a CAR, BiTE, DART or ADC.

[0154] In one embodiment, immunotherapy is a treatment of diseases where the elimination of cells expressing LILRB1 is desired, such as hematological malignancies, hematological tumors, or autoimmune diseases.

[0155] In other embodiment, hematological malignancies are selected from the group comprising B cell-derived malignancies, including B-ALL, B-NHL, monocyte derived malignancies, and malignancies resistant to prior lines of immunotherapy, including malignancies where malignant cells had lost CD 19 expression post-CD19-targeting treatment. Accordingly, the scFv, or CAR, CAR T cell, BiTE comprising the scFv according to the invention are particularly suitable in the treatment or therapy of malignancies such as cancer (hematological malignancies, preferably B-cell acute lymphoblastic leukemia (B-ALL), B-cell non-Hodgkin lymphoma (B-NHL), and acute myeloid leukemia (AML) and all other cells exhibiting expression of LILRB1 and wherein cells have no, or have lost CD19 expression (e.g. in postCD 19 CAR-T cell treatment), or are particularly suitable in the treatment of therapy wherein resistance to CD 19 therapy is observed.

[0156] In yet other embodiment, autoimmune diseases are selected from the group comprising rheumatoid arthritis, systemic lupus erythematosus, inflammatory bowel disease, Sjogren's syndrome, systemic sclerosis.

[0157] In another aspect of the invention there is provided a method of treating or ameliorating the effect of a cancer in a subject comprising administering to said subject a therapeuticallyeffective amount of said scFv amino acid sequence, CAR, CAR T cell, BiTE comprising the scFv according to the invention, preferably by intravenously, intra-arterially, intra-tumorally, or subcutaneously injection.

[0158] The term “subject” includes human and non-human animals. Non-human animals include all vertebrates, e.g., mammals and non-mammals, such as non-human primates, mice, rats, cats, rabbits, sheep, dogs, cows, chickens, amphibians, and reptiles. Except when noted, the terms "patient", “subject” or individual” are used herein interchangeably.

[0159] The term "effective amount" of an agent, e.g., a pharmaceutical formulation, cells, or composition, in the context of administration, refers to an amount effective, at dosages / amounts and for periods of time necessary, to achieve a desired result, such as a therapeutic or prophylactic result. In particular, the “effective amount" of an agent, e.g., a pharmaceutical formulation or engineered cells, refers to an amount effective, at dosages and for periods of time necessary, to achieve a desired therapeutic result, such as for treatment of a disease, condition, or disorder, and / or pharmacokinetic or pharmacodynamic effect of the treatment. The effective amount may vary according to factors such as the disease state, age, sex, and weight of the subject, and the immunomodulatory polypeptides or engineered cells administered. In some embodiments, the provided methods involve administering the immunomodulatory polypeptides, engineered cells, or compositions at effective amounts, e.g., therapeutically effective amounts.

[0160] According to another aspect of the invention there is provided an immune cell wherein the immune cell expresses a chimeric antigen receptor (CAR) comprising the scFv of the invention, in particular the scFv having the amino acid sequence as set forth in SEQ ID NO: 18, 20, 55, or 56 or a sequence having at least 95% amino acid sequence identity thereto. In a further embodiment, the immune cell can be selected from a T-cell, a B-cell, a natural killer (NK) cell, a macrophage, a monocyte, in particular a T-cell.

[0161] According to another aspect of the invention there is provided the T cell that expresses a chimeric antigen receptor (CAR) at the cell surface, the CAR comprising:

[0162] - an antigen-binding domain;

[0163] - a hinge domain;

[0164] - a linking / trans -membrane domain; and

[0165] - an intracellular domain;wherein the CAR is directed against LILRB1 antigen.

[0166] In a specific embodiment, the CAR T cell has binding affinity to a LILRB1 antigen and the antigen-binding domain of said CAR T cell comprises the scFv according to the invention. A CAR that comprises an antigen binding domain (e.g., a scFv, or TCR) that targets, e.g., binds to, a specific antigen X, such as those described herein, is also referred to as XCAR, X-CAR or X-targeting CAR. For example, a CAR that comprises an antigen binding domain that targets LILRB1 is referred to as LILRB1 CAR.

[0167] As used herein, the term "binding domain" or "antibody molecule" (also referred to herein as "anti-target (e.g., LILRB1) binding domain") refers to a protein, e.g., an immunoglobulin chain or fragment thereof, comprising at least one immunoglobulin variable domain sequence. The term "binding domain" or "antibody molecule" or “anti-binding domain” encompasses antibodies and antibody fragments. In an embodiment, an antibody molecule is a multispecific antibody molecule, e.g., it comprises a plurality of immunoglobulin variable domain sequences, wherein a first immunoglobulin variable domain sequence of the plurality has binding specificity for a first epitope and a second immunoglobulin variable domain sequence of the plurality has binding specificity for a second epitope. In an embodiment, a multispecific antibody molecule is a bispecific antibody molecule. A bispecific antibody has specificity for no more than two antigens. A bispecific antibody molecule is characterized by a first immunoglobulin variable domain sequence which has binding specificity for a first epitope and a second immunoglobulin variable domain sequence that has binding specificity for a second epitope.

[0168] The portion of the CAR of the invention comprising an antigen-binding domain may exist in a variety of forms where the antigen binding domain is expressed as part of a contiguous polypeptide chain including, for example, scFv antibody fragments, linear antibodies, single domain antibodies such as sdAb (either VL or VH), camelid VHH domains, a humanized antibody, a bispecific antibody, an antibody conjugate. In one aspect, the antigen binding domain of a CAR of the invention comprises an antibody fragment. In a further aspect, the CAR comprises an antibody fragment that comprises a scFv, in particular a scFv according to the invention.

[0169] In one embodiment, the CAR further comprises a signal peptide domain. In one preferred embodiment, the signal peptide domain is any one of a GM-CSF signal peptide, an IL-2 signal peptide, or a CD8a signal peptide. In one non-limiting embodiment, the signal peptidecomprises the amino acid sequence as set forth in any one of SEQ ID NO: 19 or 46. In another non-limiting embodiment, the scFv according to the invention may comprise a signal peptide (e.g. as set forth in SEQ ID NO: 18 or 56) or may not comprise a signal peptide (e.g. as set forth in SEQ ID NO: 20 or 55).

[0170] In yet another embodiment, the antigen-binding domain comprises the scFv amino acid sequence according to the invention.

[0171] In one embodiment, the CAR, CAR T cell, or BiTE comprises a scFv amino acid sequence capable of recognizing LILRB1 comprising (a) a heavy chain variable region (VH) comprising the complementarity determining regions (CDRs), wherein the CDR1, CDR2 and CDR3 of VH, namely CDR-H1, CDR-H2, CDR-H3, comprise the amino acid sequences of SEQ ID NO: 1, 2, 3 respectively, or a variant having at least 85%, such as at least 90%, at least 95%, at least 99% or 100% sequence identity therewith, and (b) a light chain variable region (VL), wherein the CDR1, CDR2 and CDR3 ofVL, namely CDR-L1, CDR-L2, CDR-L3, comprise the amino acid sequences of SEQ ID NO: 4, 5, 6 respectively, or a variant having at least 85%, such as at least 90%, at least 95%, at least 99% or 100% sequence identity therewith.

[0172] In one embodiment, the scFv comprises (a) the heavy chain variable region (VH) has an amino acid sequence of SEQ ID NO: 11, or a variant having at least 85%, such as at least 90%, at least 95%, at least 99% or 100% sequence identity therewith, and (b) the light chain variable region (VL) has an amino acid sequence of SEQ ID NO: 17, or a variant having at least 85%, such as at least 90%, at least 95%, at least 99% or 100% sequence identity therewith.

[0173] In other embodiment, scFv antibody has a variable heavy (VH) chain domain sharing at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, or at least 95%, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO: 11 ; and / or a variable light (VL) chain domain sharing at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, or at least 95%, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO: 17.

[0174] Preferably, the VL sequence is linked to VH by a linker sequence. The linker sequence may be between 1-30, more preferably 1-28, 1-25 or 1-22, amino acids long. The linker may be a flexible linker. As used herein, a “short linker sequence” may consist of a polypeptide having a length of about and between 1 and 21 amino acids (AAs) more in particular about and between 2 AAs and 20 AAs, whereas a “long linker sequence “ may consist of a polypeptide having a length of about and between 22 and 100 AAs, more in particular about and between 22 and 50AAs. A non-liming example of a short linker is set forth in SEQ ID NO: 16 while a non-liming example of a long linker is set forth in SEQ ID NO: 43.

[0175] In one embodiment, scFv has a VL-linker-VH orientation. In other embodiment, scFv has VH-linker-VL orientation.

[0176] In yet another embodiment, the scFv comprises or consists of the amino acid sequence of SEQ ID NO: 18, 20 55 or 56, or an amino acid sequence having at least 85%, such as at least 90%, at least 95%, at least 99% sequence identity thereto.

[0177] In some embodiments, the recombinant receptor such as the CAR, further includes at least a fragment of an immunoglobulin constant region, such as a hinge region, e.g., an IgG4 hinge region, and / or a CHI CL and / or Fc region. In some embodiments, the recombinant receptor such as the CAR, further includes a spacer, which may be or include at least a fragment of an immunoglobulin constant region or variant or modified version thereof, such as a hinge region, e.g., an IgG4 hinge region, and / or a CRI CL and / or Fc region. In some embodiments, the recombinant receptor further comprises a spacer and / or a hinge region. In some embodiments, the constant region or portion is of a human IgG, such as IgG4 or IgGl. In some embodiments, the portion of the constant region serves as a spacer region between the antigen-recognition component, e.g., scFv, and transmembrane domain. The spacer can be of a length that provides for increased responsiveness of the cell following antigen binding, as compared to the absence of the spacer. In some examples, the spacer is or is about 12 amino acids in length or is no more than 12 amino acids in length. Exemplary spacers include those having at least about 10 to 229 amino acids, about 10 to 200 amino acids, about 10 to 175 amino acids, about 10 to 150 amino acids, about 10 to 125 amino acids, about 10 to 100 amino acids, about 10 to 75 amino acids, about 10 to 50 amino acids, about 10 to 40 amino acids, about 10 to 30 amino acids, about 10 to 20 amino acids, or about 10 to 15 amino acids, and including any integer between the endpoints of any of the listed ranges. In some embodiments, a spacer region has about 12 amino acids or less, about 119 amino acids or less, or about 229 amino acids or less. Exemplary spacers include IgG4 hinge alone, IgG4 hinge linked to CH2 and CH3 domains, or IgG4 hinge linked to the CH3 domain. In a non-limiting embodiment, the CAR may comprise a hinge as set forth in any one of SEQ ID NO: 22, 58.

[0178] The antigen recognition domain generally is linked to one or more intracellular signaling components, such as signaling components that mimic activation through an antigen receptor complex, such as a TCR complex, in the case of a CAR, and / or signal via another cell surfacereceptor. Thus, in some embodiments, the antigen-binding component (e.g., antibody) is linked to one or more transmembrane and intracellular signaling domains or regions. In some embodiments, the transmembrane domain is fused to the extracellular domain. In one embodiment, a transmembrane domain that naturally is associated with one of the domains in the receptor, e.g., CAR, is used. In some instances, the transmembrane domain is selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins to minimize interactions with other members of the receptor complex. The transmembrane domain in some embodiments is derived either from a natural or from a synthetic source. Where the source is natural, the domain in some aspects is derived from any membrane-bound or transmembrane protein. Transmembrane regions include those derived from (i.e. comprise at least the transmembrane region(s) of) the alpha, beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154. Alternatively, the transmembrane domain in some embodiments is synthetic. In some embodiments, the synthetic transmembrane domain comprises predominantly hydrophobic residues such as leucine and valine. In some embodiments, a triplet of phenylalanine, tryptophan and valine will be found at each end of a synthetic transmembrane domain. In some embodiments, the linkage is by linkers, spacers, and / or transmembrane domain(s).

[0179] In one preferred embodiment, the transmembrane domain is a transmembrane domain derived from the alpha, beta or zeta chain of the T-cell receptor, CD28, CD27, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, preferably human CD8a, CD3, CD28, or CD4.

[0180] The term "signaling domain" refers to the functional portion of a protein which acts by transmitting information within the cell to regulate cellular activity via defined signaling pathways by generating second messengers or functioning as effectors by responding to such messengers. In some aspects, the signaling domain of the CAR described herein is derived from a stimulatory molecule or co-stimulatory molecule described herein, or is a synthesized or engineered signaling domain.

[0181] In one embodiment, the stimulatory molecule is the CD3^ chain associated with the T cell receptor complex. In one embodiment, the cytoplasmic signaling domain comprises a primary signaling domain (e.g., a primary signaling domain of CD3 . In yet one embodiment, the cytoplasmic signaling domain further comprises one or more functional signaling domainsderived from at least one co-stimulatory molecule as defined below. In one embodiment, the co-stimulatory molecule is chosen from 4-1BB (i.e., CD137), CD27, ICOS, and / or CD28. In one preferred embodiment, one or more co-stimulatory signaling domains are selected from a group comprising CD27, CD28, 4-1BB (CD137), 0X40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3. In one embodiment, the CAR comprises a chimeric fusion protein comprising an extracellular antigen binding domain, a transmembrane domain and an intracellular signaling domain comprising a functional signaling domain derived from a stimulatory molecule. In one embodiment, the CAR comprises a chimeric fusion protein comprising an extracellular antigen binding domain, a transmembrane domain and an intracellular signaling domain comprising a functional signaling domain derived from a co-stimulatory molecule and a functional signaling domain derived from a stimulatory molecule. In one embodiment, the CAR comprises a chimeric fusion protein comprising an extracellular antigen binding domain, a transmembrane domain and an intracellular signaling domain comprising two functional signaling domains derived from one or more co-stimulatory molecule(s) and a functional signaling domain derived from a stimulatory molecule. In one embodiment, the CAR comprises a chimeric fusion protein comprising an extracellular antigen binding domain, a transmembrane domain and an intracellular signaling domain comprising at least two functional signaling domains derived from one or more co-stimulatory molecule(s) and a functional signaling domain derived from a stimulatory molecule. In one aspect the CAR comprises an optional leader sequence at the amino-terminus (N-ter) of the CAR fusion protein. In one embodiment, the CAR further comprises a leader sequence at the N-terminus of the extracellular antigen binding domain, wherein the leader sequence is optionally cleaved from the antigen recognition domain (e.g., a scFv) during cellular processing and localization of the CAR to the cellular membrane.

[0182] Important within the context of CARs is that the hinge domain, transmembrane domain and intracellular domain are not limited to those amino acid sequences defined herein. In other words, these amino acid sequences can vary meaning that the CAR comprising the scFv according to the invention is generalizable types of hinge domains, transmembrane domains or intracellular domains, as long as the CAR is functionally active.

[0183] For example, the transmembrane domain and an intracellular signaling domain of LILRB1 construct 2115 and construct 2116 as described in the Examples had the same transmembrane and intracellular domains, and only the scFv extracellular antigen binding domain was different(Figure 6A). As evident from the results (Figure 6C-E; and Figure 17A), construct 2116 outperforms construct 2115 with respect to killing activities in all investigated cell lines. It is acknowledged that for construct 2115, the variable heavy and variable light domains were joined via a long flexible linker to form the scFv, and for construct 2116, a short flexible linker was used. However, for construct 2116 (short linker) and construct 2500 (2500 is construct 2116 with a long linker), similar results were observed with respect to percentage of dead target cells in at least two cell lines (Figure 16A-D; Construct 211641BB vs. 250041BB and 2116 CD28 vs. 2500 CD28).

[0184] On a similar notice, exchanging the costimulatory signaling domains (e.g. 4 IBB by CD28) has a some (non-significant) impact on the killing efficiency of construct 2116 (or 2500) in some cell lines (RD4;11 vs. U937, Figure 16A-D), yet it is known that CD28 provides rapid, high-intensity signaling for immediate, potent antitumor efficacy, while 4- IBB offers prolonged persistence and sustained T-cell proliferation. This is especially apparent when comparing with construct 2115 (or 2499). It was expected that the costimulatory signaling domain CD28 performed better compared to 41BB but still, the construct 2116 with CD28 outperformed all other constructs (Figure 17A-E).

[0185] Thus, in one preferred embodiment, the T cell expresses a chimeric antigen receptor (CAR) at the cell surface, the CAR comprising: the antigen-binding domain, comprising (a) a heavy chain variable region (VH) comprising the complementarity determining regions (CDRs), wherein the CDR1, CDR2 and CDR3 of VH, namely CDR-H1, CDR-H2, CDR-H3, comprise the amino acid sequences of SEQ ID NO: 1, 2, 3 respectively, and (b) a light chain variable region (VL), wherein the CDR1, CDR2 and CDR3 of VL, namely CDR-L1, CDR-L2, CDR-L3, comprise the amino acid sequences of SEQ ID NO: 4, 5, 6 respectively; the hinge domain comprising the amino acid sequence of SEQ ID NO: 22 or 58; the transmembrane domain comprising the amino acid sequence set forth in SEQ ID NO: 21 or 57; and the intracellular domain comprising the amino acid sequence of SEQ ID NO: 23 or 59 and / or the amino acid sequence of SEQ ID NO: 24.

[0186] In even a further embodiment, a CAR or CAR construct or CAR T cell is provided comprising the amino acid sequence as set forth in any one of SEQ ID NO: 60-63, or a variant having at least 85%, such as at least 90%, at least 95%, at least 99% sequence identity therewith.

[0187] In further aspect of the invention there is provided a nucleic acid sequence encoding said CAR. In one preferred embodiment, the CAR encoding nucleic acid sequence comprises a sequenceset forth in any one of SEQ ID NO: 27, 65, 67-70, or a variant thereof having at least 80%, such as at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity.

[0188] In yet further aspect of the invention there is provided a vector which comprises a nucleic acid sequence encoding said CAR.

[0189] In one preferred embodiment, said vector comprises the nucleic acid sequence comprising a sequence as set forth in any one of SEQ ID NO: 27, 65, 67-70 or a variant thereof having at least 80%, such as at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity.

[0190] In one embodiment, the vector has the following structure anti-LILRBl scFv / CD8 H / CD8 TM / 4-lBB / CD3^, in which: anti-LILRBl scFv is the nucleic acid sequence encoding the antigen binding domain; CD8 is the nucleic acid sequence encoding the transmembrane domain; and 4- 1 BB-CD3^ is the nucleic acid sequence encoding the endodomain.

[0191] In other embodiment, the CAR has configuration selected from the group comprising: CD28H / CD28TM / 41BB / CD3z; CD28H / CD28TM / CD28 / CD3z; CD8H / CD8TM / CD28 / CD3z; CD8H-CD8 TM-CD28 ICD -4-1BB ICD -CD3z (3rd generation); HCH2CH3-CD28 ICD -0X40 ICD -CD3z (3d generation); or antibody hinge-CD8TM-4-1BB ICD.

[0192] Moreover, the present invention relates to immunological cells, namely T cell or NK cell, which expresses said CAR at the cell surface. T cells or T lymphocytes are a type of lymphocyte that play a central role in cell-mediated immunity. They can be distinguished from other lymphocytes, such as B cells and natural killer cells (NK cells), by the presence of a T-cell receptor (TCR) on the cell surface.

[0193] In certain embodiments, the CAR cells of the invention may be any of the cell types mentioned above. CAR- expressing cells, such as CAR-expressing T or NK cells, may either be created ex vivo either from a patient’s own peripheral blood, or in the setting of a hematopoietic stem cell transplant from donor peripheral blood, or peripheral blood from an unrelated donor.

[0194] In certain embodiments, the present invention also provides a cell composition comprising CAR expressing T cells and / or CAR expressing NK cells according to the present invention. The cell composition may be made by transducing or transfecting a blood-sample ex vivo with a nucleic acid according to the present invention. Alternatively, CAR-expressing cells may be derived from ex vivo differentiation of inducible progenitor cells or embryonic progenitor cells to therelevant cell type, such as T cells. Alternatively, an immortalized cell line such as a T-cell line which retains its lytic function and could act as a therapeutic may be used.

[0195] In one embodiment, a CAR T cell of the invention may be an ex vivo T cell from a subject. The T cell may be isolated from a peripheral blood mononuclear cell (PBMC) sample. T cells may be activated and / or expanded prior to being transduced with CAR-encoding nucleic acid, for example by treatment with the colloidal, polymeric nanomatrix, conjugated to recombinant humanized CD3 and CD28 agonists. In other embodiment, T cells may be activated by interleukins.

[0196] A CAR T cell of the invention may be generated by isolation of a T cell-containing sample from a subject or other sources listed above; and transduction of the T cells with one or more nucleic acid sequences encoding said CAR. Then, after expansion, cells are immunophenotyped and sorted, for example, selected on the basis of expression of said CAR.

[0197] In one aspect of the invention there is provided a method for generating said T cell, which comprises a step of introducing into a T cell ex vivo said nucleic acid sequences. Preferably, said step of introducing the nucleic acid sequences into a T cell ex vivo is carried out via a process of viral transduction, preferably using lentivirus particles and a system of vectors or mRNA electroporation.

[0198] The present invention also includes manufacturing protocol for both parts i.e., production of infectious virus after being packaged with the vectors described above and preparation of the CAR-T product.

[0199] The present invention also relates to a pharmaceutical composition containing a plurality of CAR-expressing cells of the invention. The pharmaceutical composition may additionally comprise a pharmaceutically acceptable carrier, diluent or excipient. The pharmaceutical composition may optionally comprise one or more further pharmaceutically active polypeptides and / or compounds. Such a formulation may, for example, be in a form suitable for intravenous infusion.

[0200] Furthermore, the CAR T cells of the present invention present anti-tumor activity and may be capable of killing target cells, such as cancer cells (hematological malignancies, preferably B-cell acute lymphoblastic leukemia (B-ALL), B-cell non-Hodgkin lymphoma (B-NHL), and acute myeloid leukemia (AML) and all other cells exhibiting expression of LILRB1. The target cell is recognizable by a defined pattern of antigen expression.In one aspect of the invention there is provided an immunotherapeutic composition comprising an anti-tumor effective amount of said composition.

[0201] In further aspect of the invention there is provided said composition or immunotherapeutic composition for use in the immunotherapy.

[0202] In the context of the present invention, the term “immunotherapy” is to be understood as a type of medical treatment that harnesses the body’s own immune system to recognize, target, and combat diseases, particularly cancer. The goal of immunotherapy is to boost or modify the immune response, enabling it to more effectively identify and destroy abnormal or infected cells. In the context of cancer treatment, cancer cells can sometimes evade detection by the immune system. Immunotherapy seeks to overcome these evasive mechanisms and enhance the body’s natural ability to fight cancer. The term also encompasses adoptive immunotherapy. In another embodiment, the scFv according to the invention, or composition thereof is for use in targeted radiotherapy.

[0203] In one aspect of the invention there is provided a method of performing an immunotherapy, the method comprising administering to a subject in which the elimination of cells expressing LILRB1 is desired, a population of T cells comprising a nucleic acid molecule encoding the chimeric receptor, wherein the chimeric receptor comprises: the antigen-binding domain, in particular comprising the scFv according to the invention, more in particular the scFv comprising the amino acid sequence as set forth in SEQ ID NO: 18, 20, 55 or 56 ; the hinge domain; the / trans-membrane domain; and the intracellular domain; thereby treating the subject. In further aspect of the invention there is provided a bi-specific T-cell engager (BiTE) comprising (a) said antigen-binding domain, in particular comprising the scFv according to the invention, more in particular the scFv comprising the amino acid sequence as set forth in SEQ ID NO: 18, 20, 55 or 56, and (b) an antigen-binding domain that binds to a T-cell antigen. In a specific embodiment, a BiTE is provided comprising 3 linkers, in particular one linker connecting (a) and (b), as well as a one linker connecting the VL and VH of LILBR1 scFv antigen, and one linker connecting the VL and VH of the scFv that binds to a T-cell antigen (Figure 18A). In a specific embodiment, the BiTE comprises a LILRB1 -specific scFv, in which the VL and VH domains are connected by a long linker, and this scFv is linked to an T-cell antigen, in particular an anti-CD3 scFv (clone OKT3), via a short linker, in particular wherein the anti-CD3 scFv comprises or consists of VH and VL domains connected by a different shortlinker (EGGSGGSGGSGGSGGV (SEQ ID NO: 91). Suitable linkers in the context of BiTE include repeating motifs comprising glycine and serine residues, including but not limited to (GGGGS)n, (GGGS)n, (GGS)n, (GS)n, (G4S)n, (G3S)n, and (G2S)n, wherein n is independently selected from 1 to 10. Such linkers are commonly used in BiTE formats to minimize steric hindrance and maintain the functional activity of linked binding domains.

[0204] In a further embodiment, the variable heavy and variable light domains of each antibody of the BiTE may be connected via a long flexible linker, in particular a linked as set forth in SEQ ID NO: 43 to form the scFv.

[0205] In another embodiment, the BiTE of the invention may further comprise other elements such as but not limited to a His tag, P2A protein and / or EGFP.

[0206] Accordingly, in even a further embodiment, a BiTE is provided comprising the amino acid sequence as set forth in SEQ ID NO: 64 or 92, or a variant having at least 85%, such as at least 90%, at least 95%, at least 99% sequence identity therewith. In further aspect of the invention there is provided a nucleic acid sequence encoding said BiTE or DART. In one preferred embodiment, the BiTE encoding nucleic acid sequence comprises a sequence set forth in SEQ ID NO: 71, or a variant thereof having at least 80%, such as at least 85%, at least 90%, at least 95%, at least 99% or 100% sequence identity.

[0207] In a preferred embodiment, said antigen binding domain of the BiTE that binds to a T-cell antigen comprises an antibody fragment that specifically binds CD3. One skilled person in the art will understand that the antigen-binding domain in the context of BiTE is not limited to CD3 and can include- but not limited to - CD2, CD4, CD5, CD6, CD7, CD8, CD27, CD28, CD45, CD45RA, CD45RO, CD52, CD69, CD90, CD95 (Fas), CD122 (IL-2 receptor P), CD127 (IL-7 receptor a), CD 132 (common y chain), T-cell receptor (TCR) a / p, TCR y / 8, TRBC1, TRBC2, ICOS (CD278), 0X40 (CD134), 4-1BB (CD137), GITR (CD357), DNAM-1 (CD226), NKG2D, and SLAMF6.

[0208] Such BiTE molecules can targ et T cells (e.g., by binding CD3) as well as a tumor antigen (e.g., EGFR, EGFRvIII, or CD 19), and can be used to augment the T cell response in, e.g., the tumor microenvironment. The two components of a BiTE can optionally be separated from one another by a linker (e.g., a glycine-based linker, rigid linker or a minimal linker or no linker with cysteins to create disulfide bonds (FV)).

[0209] In yet further aspect of the invention there is provided a method of performing an immunotherapy, the method comprising administering to a subject in which the elimination ofcells expressing LILRB1 is desired, a population of T cells comprising said nucleic acid molecule encoding the bi-specific T-cell engager, in particular the BiTE comprising the scFv according to the invention, more in particular the scFv comprising the amino acid sequence as set forth in SEQ ID NO: 18, 20, 55 or 56, wherein the bi-specific T-cell engager comprises: (a) said antigen-binding domain, and (b) an antigen-binding domain that binds to a T-cell antigen; thereby treating the subject.

[0210] In one embodiment, the present invention relates to a mammalian cell comprising any of the CAR polypeptides described herein (optionally together with another therapeutic molecule, e.g., an antibody reagent (e.g., ascFv, a camelid antibody, or a BiTE) or a cytokine); or a nucleic acid encoding any of the CAR polypeptides described herein (optionally together with another therapeutic molecule, e.g., an antibody reagent (e.g., a scFv, a camelid antibody, or a cytokine). In another embodiment, the mammalian cell comprises an antibody, antibody reagent, antigenbinding portion thereof, any of the CARs described herein, or a cytokine, or a nucleic acid encoding such an antibody, antibody reagent, antigen-binding portion thereof, any of the CARs described herein, or a cytokine. The mammalian cell or tissue can be of human, primate, hamster, rabbit, rodent, cow, pig, sheep, horse, goat, dog or cat origin, but any other mammalian cell may be used. In a preferred embodiment, the mammalian cell is human.

[0211] The invention will now be further described by way of Examples, which are meant to serve to assist one of ordinary skill in the art in carrying out the invention and are not intended in any way to limit the scope of the invention.EXAMPLES

[0212] HUMAN CELL LINES

[0213] The human B-ALL (SD-1, RS4;11, BV-173, NALM-16, SEM, SUP-B15, 697), B-NHL (DHL-4, Ramos, RL, Jeko-1, BL-41, Ly-7), and AML (U937, MV4;11, OCI-AML3, THP-1, Kasumi-1, HL-60) cell lines were obtained from DSMZ or ATCC. B-ALL and B-NHL cells were maintained in RPMI-1640 (Gibco) supplemented with 10% fetal bovine serum (FBS; HyClone) and 1% penicillin / streptomycin (pen / strep) (complete RPMI medium). MV4;11 cells were cultured in Modified Dulbecco’s Medium + 20% FBS, OCI-AML3 in alpha-MEM + 20% FBS, and HL-60 in the Iscove's Modified Dulbecco’s Medium + 20% FBS (all supplemented with pen / strep). The remaining AML cell lines were maintained in complete RPMI medium. All cells were cultured in a humidified atmosphere at 37°C, 5% CO2.

[0214] FLOW CYTOMETRY ANALYSIS OF CELL LINES, PRIMARY CELLS, AND PDX Detection of surface protein levels in cell lines and B-ALL PDX samples

[0215] For cell surface markers detection, 0,5 x 106cells were stained with BD Horizon™ Fixable Viability Stain 510 (BD Biosciences, catalog no. 564406; dilution 1:200) for 15 minutes in PBS, washed with Easy Sep buffer (PBS with 2% FBS and ImM EDTA) and incubated with BD Pharmingen™ Human BD Fc Block™ (BD Biosciences, catalog no. 564220) for another 15 minutes. Next, the cells were stained with either fluorochrome-conjugated or unconjugated antihuman LILRB1 antibodies (HP-F1 or #292305 clones); cat. numbers: 46-5129-42 - Thermo Fisher Scientific, FAB20171P-100 - Bio-techne R&D, 16-5129-82 - Thermo Fisher Scientific, MAB20171 - Bio-techne R&D). Fluorochrome-conjugated antibodies were added in 50 pl total volume of PBS, incubated for 25 minutes at room temperature and then washed in PBS. Alternatively, cells were incubated with unconjugated antibodies for 30 minutes on ice, washed twice with PBS and then incubated with donkey anti-mouse IgG (H+L) secondary antibody (Thermo Fisher Scientific, cat. no. #A10037) for 20 minutes on ice. Following the final wash in PBS, the samples were analysed using BD LSRFortessa™ Cell Analyzer (BD Biosciences). Detection ofLILRBl levels in blood of healthy donors

[0216] Peripheral blood of healthy donors was obtained from Regional Blood and Hemotherapy Center in Warsaw. From each donor, 5 ml of a whole blood was added to falcon tube containing 40 ml of Gibco™ ACK Lysing Buffer (Thermo Fisher Scientific, catalog no. A1049201) and incubated for 5 minutes at room temperature. Next, the samples were centrifuged at 300 x g for5 min and washed with 20 ml of cold PBS. The lysis was repeated once more and followed by three washing steps in PBS. Either 2,0 * 106(for T cells and monocytes detection) or 4,0 x 106cells (for B cells and NK cells detection) were then transferred to facs tubes and stained with BD Horizon™ Fixable Viability Stain 510 (BD Biosciences, catalog no. 564406; dilution 1:200) for 15 minutes in PBS, washed with EasySep buffer (PBS with 2% FBS and ImM EDTA) and incubated with BD Pharmingen™ Human BD Fc Block™ (BD Biosciences, catalog no. 564220) for another 15 minutes (in 100 pl of PBS). Next, anti-LILRBl functional grade antibody (HP-F1 clone; eBioscience™, Thermo Fisher Scientific, catalog no. #16-5129-82) was added in 100 pl total volume of PBS and incubated for 30 minutes on ice. The cells were then washed twice in PBS and incubated with donkey anti-mouse IgG (H+L) secondary antibody (Thermo Fisher Scientific, catalog no. # Al 0037; Alexa Fluor™ 568) for 20 minutes on ice. Following that time, the cells were washed in PBS and stained with following fhiorochrome-conjugated antibodies: anti-CD19, (BD Biosciences, cat. no. 555415), -CD56 (BioLegend, cat. no. 318328), -CD3 (BD Biosciences, cat. no. 562427), -CD14 (eBioscience, Thermo Fisher Scientific, cat. no. 67-0149-42), and CDllb (BD Biosciences, cat. no. 557754). Finally, the samples were washed once in PBS and subjected to FACS analysis with BD LSRFortessa™ Cell Analyzer. (BD Biosciences). The data was visualized using FlowJo™ Software. (BD Life Sciences).

[0217] Detection of LILRB1 levels in PBMC-derived macrophages

[0218] Peripheral blood mononuclear cells (PBMCs) were isolated from buffy coats of healthy donors through density-gradient centrifugation following a standard protocol. Next, CD 14+ monocytes were isolated using CliniMACS CD14 microbeads, human and LS separation magnetic columns (MiltenyiBiotec, cat. no. 130-019-101). 6,0 x 106of isolated monocytes were then seeded onto non-adherent dish culture in full RPMI-1640 medium, 20% FBS, antibiotics (100 U / mL penicillin, 100 pg / mL streptomycin) and 25 ng / ml human macrophage colony -stimulating factor (M-CSF). The cells were maintained in a humidified atmosphere at 37°C and 5% CO2. Following 3 days, the new portion of full RPMI with 25 ng / ml M-CSF was added. After additional 4 days, the cells were detached using Cellstripper™ (Coming) and stained as described in the “Detection of surface protein levels in cell lines and B-ALL PDX samples”. Detection of LILRB1 levels in activated primary T cells

[0219] PBMCs were isolated from buffy coats of healthy donors through density-gradient centrifugation following a standard protocol. Next, primary T cells were isolated usingEasySep™ Human T Cell Enrichment Kit (STEMCELL Technologies, cat. no. 19051) through negative selection. Isolated T cells were then stimulated with Dynabeads™ Human T- Activator CD3 / CD28 for T Cell Expansion and Activation (Thermo Fisher Scientific, cat. no. 1113 ID) at 1:2 bead-to-cell ratio for 48 hours. The cells were maintained in complete RPMI medium with addition of recombinant human IL-2 (Peprotech, cat. no. 200-02) at the final concentration of 100 U / ml. Following the indicated time, the unstimulated T cells (controls) and stimulated T cells were stained with Fixable Viability Stain 510 (BD Biosciences, cat. no. 564406) for 15 minutes and then washed once in the EasySep buffer (PBS with 2% FBS and ImM EDTA). Next, the cells were incubated with BD Pharmingen™ Human BD Fc Block™ (BD Biosciences, cat. no. 564220) for 15 minutes and then stained for 25 minutes with the following antibodies: anti-LILRBl (HP-F1 clone, eBioscience, Thermo Fisher Scientific, cat. no. 46-5129-42), -CD4 (BD Biosciences, cat. no. 557852), and -CD8 (BD Biosciences, cat. no.

[0220] 564526). The samples were analyzed using BD LSRFortessa™ Cell Analyzer (BD Biosciences) and the results were visualized using FlowJo™ Software (BD Life Sciences).

[0221] Detection ofLILRBl levels in the subsets of CD 19 CAR-T cells

[0222] To determine the level of LILRBl in CD19 CAR-T cells (pSEW-CARCD19-41BB; lentiviral system) upon target engagement, 4,0 * 106CAR-T cells were seeded onto 24-well plate and cultured alone, or co-cultured with CD19-positive target cells (Raji) at 1:1 E:T ratio for 24, 48 or 72h. Following the indicated time, the cells were stained with Fixable Viability Stain 510 (BD Biosciences, cat. no. 564406) for 15 minutes and then washed once in the EasySep buffer (PBS with 2% FBS and ImM EDTA). Next, the cells were incubated with BD Pharmingen™ Human BD Fc Block™ (BD Biosciences, cat. no. 564220) for 15 minutes and then stained for 25 minutes with the following antibodies: anti-LILRBl (HP-F1 clone, eBioscience, Thermo Fisher Scientific, cat. no. 46-5129-42), anti-CD69 (BioLegend, cat. no. 310914), -CD4 (BD Biosciences, cat. no. 557852), -CD8 (BD Biosciences, cat. no. 561953), -CCR7 (BD Biosciences, cat. no. 566602), -CD45RA (eBioscience, Thermo Fisher Scientific, cat. no. 11-0458-42). Samples were then washed in PBS and the surface levels of selected proteins were evaluated using BD LSRFortessa™ Cell Analyzer (BD Biosciences). The gating strategy is presented on Figure 2B. The data was visualized using FlowJo™ Software (BD Life Sciences). CAR CONSTRUCTS

[0223] Sequencing of two mouse anti-LILRBl antibodies (clone 1, HP-F1 and clone 2, 292305. respectively) was performed by Rapid Novor (Kitchener, Ontario, Canada). Based onthe sequencing results, two anti-LILRBl scFvs (single-chain variable fragments) were generated after backtranslation of the variable domains of the heavy and light chains joined by a DNA sequence coding flexible linker (SEQ ID NO: 53 and SEQ ID NO: 26, respectively). The resultant cDNA was cloned in the CAR construct using Golden Gate method. Anti-LILRBl-scFv was introduced before CD8 hinge, CD8 transmembrane, 41BB co-signaling, and CD3ij signaling domains, linked by a 2A skipping peptide to a truncated CD34 protein to enable transduction efficiency. LILRBl-CARs were expressed from a pMP71. Anti-CD19 (fmc63-based) and anti-CD33 scFv-containing CAR constructs design was already described but overall, they hold the same structure as LILRB1 CAR with CD8 hinge, CD8 transmembrane, 4 IBB co-signaling, and CD3ij signaling domains.

[0224] To generate additional CAR variants, variable heavy and variable light domains derived from two LILRB1 monoclonal antibody clones (clone 1 HPF1 and clone 2 #292305) were combined using either a long or short linker to form alternative scFvs.

[0225] 2115 - clone 1, long linker (SEQ ID NO: 53)

[0226] 2499 - clone 1, short linker (SEQ ID NO: 84)

[0227] 2500 - clone 2, long linker (SEQ ID NO: 67)

[0228] 2116 - clone 2, short linker (SEQ ID NO: 26)

[0229] The resulting cDNAs were cloned using the Golden Gate method into one of two second-generation CAR backbones: a construct containing a CD8 hinge, CD8 transmembrane domain, and 4-lBB-CD3ij signaling domain (named 41BB), or a construct containing a CD28 hinge, CD28 transmembrane domain, and CD28-CD3ij signaling domain (named CD28). Both backbones contained a truncated CD34 marker to assess transduction efficiency and were expressed from the pMP71 vector.

[0230] HUMAN T CELLS ACTIVATION

[0231] Peripheral blood mononuclear cells (PBMCs) were isolated from huffy coats of healthy donors through density-gradient centrifugation following a standard protocol. To activate human T cells, the total of 6 * 106isolated PBMCs were seeded onto 6-well plate per well, and incubated with Ipg / ml anti-CD3 (functional grade OKT3, eBioscience, catalog no. 16-0037-85), and Ipg / ml anti-CD28 (functional grade CD28.6, eBioscience, catalog no. 16-0289-85) antibodies at 37°C 5% CO2. Following 2-3 days, the cells were counted and prepared for further processing.TRANSDUCTION AND EXPANSION OF HUMAN T CELLS

[0232] Until stated otherwise in particular methods descriptions, all experiments involving CAR-T cells were performed with effector cells produced using retroviral platform for cells modification. For retroviral particle preparation, 1 x 10sHEK-P cells were seeded onto 6 cm plates. Transfection was performed using X-tremeGENE™ 9 DNA Transfection Reagent (Roche, catalog no. XTG9-RO) and a DNA mixture containing the retroviral packaging vectors and the expression vector at an equimolar ratio. After 24 h, the culture medium was replaced with Dulbecco’s Modified Eagle Medium (Thermo Fisher Scientific, catalog no. 11965092) supplemented with 1% FBS, and the cells were incubated at 32 °C. Virus -containing supernatants were harvested after 24 and 48 h of incubation. For the transduction, 0,3 x 106of activated T cells in 0,5 ml of complete medium were added to a 24-well plate coated with 50 pg / ml RetroNectin (Takara Bio, catalog no. T100B) and mixed with 0,5 ml of retroviral supernatant. The cells were spinoculated at 750 x g for 60 minutes at 32°C and then incubated at 37°C 5% CO2 for 24h. On the next day, the spinoculation was repeated using another 0,5 ml of retroviral supernatant. On the following day, the medium was replaced and Dynabeads™ Human T- Activator CD3 / CD28 for T Cell Expansion and Activation (Thermo Fisher Scientific, catalog no. 1113 ID) was added to the T cells at 1:1 bead-to-cell ratio for 5-7 days. The modification efficiency was determined following 5-7 days post transduction by evaluating the human CD34 (eBioscience, Thermo Fisher Scientific, catalog no. 17-0349-42), or murine Fab surface expression (anti-F(ab')2 fragment Alexa Fluor® 647, Jackson Immunoresearch, catalog no. 115-606-072, dilution 1:50).

[0233] GENERATION OF LILRB1 -OVEREXPRESSING 697 CELL LINE

[0234] LILRB1 was amplified using a commercial vector (OHu23369D, Gene script) as a template and the following primers: CACCATGACCCCCATCCTCACGGTCC (SEQ ID NO: 89) and TATCAATTGGTGGATGGCCAGAGTGGCGTAG (SEQ ID NO: 90) to generate a compatible fragment for pENTR / TOPO (invitrogene) where the STOP was replaced by a Muni site. After sequence checking, the modified insert was extracted and subcloned into a plasmid containing the sequence fused to truncated CD34 tag. This construct was finally recombined into a Gateway compatible pMP71 retroviral vector. 697 cells overexpressing LILRB1 were generated by retroviral transduction. The population of LILRB1 -positive cells was purified using FACS Aria III cell sorter (BD Biosciences).DEGRANULATION ASSAY

[0235] Target cells were seeded onto a 96-well plate at density 0,2 x 106of cells per well. Effector cells were added to target cells at E:T ratio 1:2. A mix of anti-human CD107a antibody (BD Biosciences, catalog no. 555801), GolgiStop™ (BD Biosciences, catalog no. 554724;) and GolgiPlug™ Protein Transport Inhibitor (BD Biosciences, catalog no. 555029;) reagents was added to each well and the cultures were incubated overnight at 37°C 5% CO2. Upon incubation time, the cells were spun down, washed with PBS and stained first with BD Horizon™ Fixable Viability Stain 510 (BD Biosciences, catalog no. 564406,), and next for T cell markers: CD3 (clone UCHT1, BV421, BD Biosciences, catalog no. 562427) and CD8 (clone RPA-T8, APC, BD Biosciences, catalog no. 555369). The degranulation of effector cells was then assessed using BD LSRFortessa™ Cell Analyzer.

[0236] ANALYSIS OF CYTOKINES SECRETION

[0237] Cytokine release by CAR-T cells was evaluated following co-incubation with target cells for 24 h at 37°C 5% CO2 at 1:2 E:T ratio. After incubation, cytokine concentrations were measured in the collected culture medium. Cytokine levels shown in Figures 10B and 13C were quantified using the Human IFN-y ELISA Kit and Human TNF-a ELISA Kit (Thermo Fisher Scientific, catalog nos. KHC4021 and KHC3011, respectively), according to the manufacturer’s protocols. Samples were analyzed using the PerkinElmer EnVision multimode plate reader. For results presented in Figure 17B-E, cytokines were measured using the Lumit® IFN-y (Human) Immunoassay and Lumit® IL-2 (Human) Immunoassay (Promega, catalog nos. W6040 and W6020, respectively). Luminescence signal was measured using the Tecan Group Infinite® M Plex multimode microplate reader.

[0238] FLOW CYTOMETRY-BASED KILLING ASSAY

[0239] Target cells were stained with CellTrace™ Violet dye (Thermo Fisher Scientific, catalog no. C34557) according to manufacturer’s protocol and seeded onto 96-well plate at density 0,1 x 106of cells per well. Effector cells were added to target cells at various E:T ratios (0.5:1, 1:1, 2.5:1) and the cells were incubated for 24h at 37°C 5% CO2. To determine the percentage of dead target cells, propidium iodide (PI, Sigma-Aldrich, catalog no. P4864) was added upon incubation time at final concentration of 1 pg / ml. Cytotoxicity of effector cells was evaluated using BD LSRFortessa™ Cell Analyzer.LUCIFERASE-BASED KILLING ASSAY

[0240] Suspension target cell lines with luciferase expression were seeded onto 96-well plate at density 2,5 x 104of cells per well. Adherent target cells were seeded at the same density onto 96-well black plates with a clear bottom (PerkinElmer, catalog no. 6005182). Effector cells were added to target cells at E:T ratio 0.5:1 or 1 : 1 and the cells were incubated at 37°C 5% CO2. After 24h, 100 pl of suspension cultures was transferred onto white 96-well plate and 100 pl of the mix of Bright-GloTM Luciferase Assay (Promega, catalog no. E2620) was added. For the cultures with adherent target cells, 100 pl of medium was removed from black plates and replaced with 100 pl of the mix of Bright-GloTM Luciferase Assay. After 5 minutes incubation, the bioluminescence signal was detected using Victor Plate Reader (PerkinElmer).

[0241] CAR-T CYTOTOXICITY ASSAY AGAINST HEALTHY DONOR-DERIVED PBMC Effector untransduced (MOCK) T cells as well as CD19, CD33, and LILRB1 CAR-T cells were pre-labeled with CFSE CellTrace™ (Thermo Fisher Scientific, catalog no. C34554). Next, 1,0 x 106effector cells were plated onto 24-well plate and co-cultured with PBMC (E:T - 1:2) isolated from 4 healthy donors. Following 24h, the cells were collected and washed twice in PBS. Then the cells were stained with Fixable Viability Stain 510 (BD Biosciences, catalog no.

[0242] 564406) for 15 minutes and washed once in the Easy Sep buffer (PBS with 2% FBS and ImM EDTA). Next, the cells were incubated on ice with BD Pharmingen™ Human BD Fc Block™ (BD Biosciences, catalog no. 564220) for 15 minutes and then stained for 25 minutes with the following mix of antibodies: anti-CD 19 (eBioscience, Thermo Fisher Scientific, cat. no. 25-0199-42, -CD56 (BD Biosciences, cat. no. 555518), -CD3 (BD Biosciences, cat. no. 562427), -CD14 (eBioscience, Thermo Fisher Scientific, cat. no. 67-0149-42). Samples were then washed in PBS and analyzed using BD LSRFortessa™ Cell Analyzer. The data was visualized using FlowJo™ Software.

[0243] CFU ASSAY

[0244] Effector T cells were co-cultured with non-autologous Bone Marrow Mononuclear Cells (BMNCs) for 6 hours in complete RPMI medium at an E:T ratio of 10: 1. After culture, the cells were washed and resuspended in 400 pL of PBS 10% Human Serum Albumin (HSA). The solution was then mixed with 4 mL of complete methylcellulose media (MethoCult medium; STEMCELL), and 1,1 mL was transferred to each well of a 6-well plate (in triplicate). After 15 days, colony-forming unit-erythroid (CFU-E), burst-forming unit- erythroid (BFU-E), colonyforming unit-granulocyte, macrophage (CFU-GM), and colony-forming unit-granulocyte,erythrocyte, monocyte, megakaryocyte (CFU-GEMM) colonies were counted under a microscope.

[0245] ANIMAL STUDIES TESTING CAR-T-CELLS ACTIVITY

[0246] Approval for the in vivo experiments was given by the 2nd Local Ethical Committee for Experiments on Animals in Warsaw (WAW2 / 042 / 2023).

[0247] In-house bred, specific-pathogen free NOD.Cg-Prkdcscid I12rgtmlWjl / SzJ (NSG) mice were maintained in a controlled pathogen-free facility. The experiments were performed using female 8-12 weeks old mice. For the evaluation of CAR-T cells efficacy against B-ALL, each mouse was injected via tail vein with 3 * 106RS4;11 cells stably expressing luciferase (RS4;ll-luc). In vivo bioluminescence was evaluated three days after cancer cells engraftment and the mice were randomly allocated to control and treatment groups (5-7 mice per group). On the same day the mice were injected via tail vein with 5.0 x 106unmodified T cells (MOCK), CD19 CAR-T cells, or LILRB1 CAR-T cells depending on the group. The second dose of MOCK or CAR-T cells was administered on day 6 post engraftment. The in vivo imaging was performed twice a week. For the evaluation of CAR-T cells efficacy against AML, the mice were injected via tail vein with 0,5 x 106U937 cells stably expressing luciferase (U937-luc). In vivo bioluminescence was evaluated one day after cancer cells engraftment and the mice were randomly allocated to control and treatment groups (6-7 mice per group). On the same day, depending on the group, the mice were injected with 5,0 x 106MOCK T cells, CD 19 CAR-T cells, or LILRB1 CAR-T cells via tail vein. The second dose of MOCK or CAR-T cells was administered on day 4 post engraftment. The in vivo imaging was performed three times per week. In both experiments, in addition to bioluminescence detection, the mice were controlled for other signs of illness, including body weight loss, ruffled fur, hind paw reflex loss, reduced movement, lethargy. The mice were sacrificed when they reached predefined human endpoint criteria. The organs (spleens and bone marrow) were collected and analyzed on the same day. Spleens were smashed through the Falcon® 100 pm Cell Strainer (Coming, catalog no. 352360) using a syringe plunger. Bone marrow was extracted from femur and tibia of the mice by flushing it with PBS using a syringe with a needle. Isolated cells were washed with ice-cold PBS. Next, red blood cells were removed from the cell suspension using ACK Lysing Buffer (Thermo Fisher Scientific, catalog no. A1049201). The suspensions of single cells were then incubated with BD Pharmingen™ Human BD Fc Block™ (BD Biosciences, catalog no.

[0248] 564220) for 15 minutes prior to the addition of antibodies. The cells from spleens and bonemarrow of the mice injected with B-ALL cells (RS4; 11) were stained for 25 minutes with antimouse CD45 (eBioscience, Thermo Fisher Scientific, catalog no. 17-0451-82), anti-human CD3 (BioLegend, catalog no. 300448), anti-human CD19 (eBioscience, Thermo Fisher Scientific, catalog no. 47-0199-42) and anti -human LILRB1 (HP-F1 clone, eBioscience, Thermo Fisher Scientific, catalog no. 62-5129-42). The samples were analysed using BD FACSCanto™ II Flow Cytometer (BD Life Sciences). The cells from spleens of the mice injected with AML cells (U937) were stained for 25 minutes with anti-mouse CD45 (eBioscience, Thermo Fisher Scientific, catalog no. 17-0451-82), anti-human CD45 (eBioscience, Thermo Fisher Scientific, catalog no. 12-0459-42), anti-human CD33 (eBioscience, Thermo Fisher Scientific, catalog no. 61-0338-42) and anti-human LILRB1 (HP-F1 clone, eBioscience, Thermo Fisher Scientific, catalog no. 62-5129-42). The samples were analysed using BD LSRFortessa™ Cell Analyzer (BD Biosciences). The data from both experiments was visualized using FlowJo™ Software (BD Life Sciences).

[0249] BITE CONSTRUCTS

[0250] Two LILRB1 -targeting BiTE constructs were generated. For the 2115 BiTE, the anti-LILRBl single-chain variable fragment (scFv) was derived from the mouse anti-LILRBl antibody clone HP-F1, whereas for the 2500 BiTE, the scFv originated from antibody clone 292305. The variable heavy and variable light domains of each antibody were joined via a long flexible linker (SEQ ID NO: 43) to form the scFv. The coding sequence for the LILRB 1 scFv was subsequently cloned into the BiTE backbone using the Golden Gate method and expressed in combination with an anti-CD3 scFv fragment from a pMP71 plasmid.

[0251] BITE PRODUCTION

[0252] BiTEs were produced by transfection of HEK-P cells. One day prior to transfection, 1 x 10sHEK-P cells were seeded onto 6 cm plates. Transfection was performed using X-tremeGENE™ 9 DNA Transfection Reagent (Roche, catalog no. XTG9-RO) and plasmid DNA encoding the respective BiTE construct. After 24 h, the culture medium was replaced with Iscove’s Modified Dulbecco’s Medium (Thermo Fisher Scientific, catalog no. 12440053) supplemented with 1% FBS, and cells were incubated at 32 °C for 48 h. BiTE protein levels in the culture medium were assessed by Western blotting using His Tag Antibody (R&D Systems, catalog no. MAB050). The BiTE-containing culture medium was stored at 4 °C until use.EXAMPLE 1

[0253] VALIDATION OF LILRB1 AS A CAR-T TARGET

[0254] To validate LILRB1 as an immunotherapy target, inventors first addressed the possibility of on-target off-tumor effects mediated by LILRB1 -directed CAR-T cells. Inventors analyzed LILRB1 expression across multiple organs using publicly available databases (the Human Protein Atlas (HPA), the Genotype-Tissue Expression database (GTEx), and a single-cell human cell atlas from the Tabula Sapiens Consortium. LILRB1 expression was detected predominantly in lymphoid tissues such as bone marrow, spleen, blood, and additionally in lungs and liver (data not shown). However, the LILRB1 expression in the lungs and liver exclusively stemmed from tissue-resident macrophages and monocytes (data not shown). Inventors subsequently confirmed LILRB1 protein presence on normal peripheral blood leukocytes from healthy donors, demonstrating the highest expression levels in monocytes and B cells, with much lower expression in NK cells and T cells (Figure 1A) similarly to already available data. Primary macrophages differentiated in vitro from human peripheral blood monocytes displayed high LILRB1 surface levels (Figure IB). Given LILRB1 surface expression in T cells potentially poses a risk of fratricide killing in CAR-T cell manufacturing, LILRB1 levels were evaluated in human T cells activated by CD3 / CD28 stimulation. LILRB1 expression was higher in CD8 than in CD4 T cells, decreasing upon stimulation (Figure 1C).

[0255] Furthermore, LILRB1 expression remained roughly unchanged in CD 19 CAR-T cells upon their contact with CD 19-positive target cells (Figure 2A). The pattern of LILRB1 expression was consistent across various CD8+ CAR-T cell subsets (naive, central memory, effector memory, and terminally differentiated T cells (Figure 2B, C). In summary, these analyses indicate that targeting LILRB1 with CAR-T cells is likely to eliminate B cell and monocyte compartments only and suggest the feasibility of LILRB1 CAR-T manufacturing.

[0256] EXAMPLE 2

[0257] ANALYSIS OF LILRB1 EXPRESSION IN B CELL-DERIVED MALIGNANCIES

[0258] To explore the utility of LILRB1 for elimination of tumor cells, inventors further analyzed its expression in various malignancies originating from B cells. LILRB1 was expressed in 24 out of 26 tested PDX samples representing high-risk B-ALL subtypes including BCR-ABL1, BCR-ABLl-like, hypodiploid, and B-other, with typically moderate but uniform expression levels across cell population (Figure 3A). Notably, LILRB1 was expressed also in PDX samples with KMT2A rearrangements as driver translocations (KMT2A-r PDX) (Figure 3A). This subgroupof B-ALL has the highest rate of relapses, often manifesting as a lineage switch or CD 19 loss. Additionally, LILRB1 was expressed in 4 out of 6 B-NHL cell lines (Figure 3B). These findings underscore the substantial expression of LILRB1 across various B-cell malignancies, emphasizing its potential as a viable target for immunotherapy.

[0259] EXAMPLE 3

[0260] ANALYSIS OF LILRB 1 EXPRESSION IN MALIGNANT B CELLS RESISTANT TO PREVIOUS LINES OF IMMUNOTHERAPY AND THE CELLS WITH CD 19 KONCKOUT Antigen escape or downregulation stands as one of the mechanisms contributing to resistance against various immunotherapies. Therefore, inventors utilized models resistant to previous lines of immunotherapy (IT) in B-NHL cell lines that were LILRB 1 -positive. In RL and Ramos cell lines resistant to rituximab, an anti-CD20 antibody, the levels of CD20 decreased in all cell lines (Figure 4A). Remarkably, in the majority of cell lines, the expression of other B cellspecific markers, such as CD22 and CD19, was also slightly decreased, while conversely, the levels of LILRB 1 surprisingly tended to increase (Figure 4A). In addition to anti-CD20 antibodies, immunotherapeutics targeting CD 19 are also integrated into management of r / r B-ALL and r / r B-NHL. Accordingly, the level of selected markers was assessed in in vitro-generated B-NHL Raji cells resistant to CD 19 CAR-T cells that mimic the situations observed in clinical practice. In this model, a loss of CD 19 expression was accompanied by only partial downregulation of CD22, CD20, and LILRB 1 (Figure 4B). Furthermore, LILRB 1 was stably expressed also in B-ALL and B-NHL cell lines with generated CD 19 genomic knockouts (KO) (Figure 4C). Altogether, these findings substantiate the potential of LILRB 1 as a promising immunotherapy target in B cell malignancies following prior lines of immunotherapy support LILRB 1 as a valid alternative to CD 19 CAR or for a next-line treatment.

[0261] EXAMPLE 4

[0262] DEVELOPMENT OF LILRB 1 -DIRECTED CAR-T CELLS

[0263] To select LILRB 1 -specific single-chain variable fragments (scFv) for incorporation into CAR vectors, various clones of murine anti -LILRB 1 monoclonal antibodies (mAbs) were screened, ultimately choosing two clones: HP-F1 and #292305 (Figure 5). Inventors utilized de novo antibody sequencing via LC-MS / MS to derive antibodies variable domains sequences (SEQ ID NO: 47 and SEQ ID NO: 20, respectively) necessary for CAR design. The amino acid sequences (according to Kabat numbering scheme) and the corresponding nucleotide sequence, are shown in Table 1 and Table 2.Table 1

[0264]

[0265] Table 1, continuation

[0266]

[0267] Table 2

[0268]

[0269] Table 2, continuation

[0270]

[0271] The inventors also compared the antigen-binding sequences of both antibodies, clone 1 - HP-Fl, and clone 2 - 292305 - both targeting LILRB1 with comparable binding efficacies against various cancer cell lines. The alignments of heavy chain variable regions (VH, SEQ ID NO: 38 and SEQ ID NO: 11, respectively) exhibited substantial differences (only 33% sequence identity), whereas the alignments of light chain variable regions (VL, SEQ ID NO: 44 and SEQ ID NO: 17, respectively) showed greater similarity (94% sequence identity).

[0272] Using the antibodies variable domains, the scFvs (SEQ ID NO: 47 and SEQ ID NO: 20, respectively, and corresponding nucleotide sequences, namely SEQ ID NO: 53 and SEQ ID NO: 26, respectively) were designed and integrated into a second-generation CAR backbonecomprising a CD 8 hinge, CD8 transmembrane domain, and a 4-lBB-CD3^ signaling tail, linked by a 2A skipping peptide to a truncated CD34 protein, to enable transduced cells detection. The resulting CARs derived from HP-F1 and #292305 (SEQ ID NO: 54 and SEQ ID NO: 27, respectively) were designated as constructs 2115 CAR (Ab clone HP-F1) and 2116 CAR (Ab clone #292305), respectively (Figure 6A). Primary T cells from healthy donors were transduced with these CAR constructs, and the CD34 signal was observed in 70-90% of T cells, indicating robust transduction efficiency (Figure 6B, left panel). Similarly, sufficient transduction efficiency and CAR expression were detected in CD 19 CAR-T cells, as proved by high murine Fragment antigen binding region (mFab) levels (Figure 6B, right panel).

[0273] EXAMPLE 5

[0274] ANALYSIS OF LILRB1 CAR-T CELLS ACTIVITY AGAINST ALL TESTED LEUKEMIA AND LYMPHOMA CELLS

[0275] Inventors evaluated the killing efficacy of LILRB1 CAR-T cells generated using both 2115 and 2116 constructs in a flow cytometry-based killing assay. As target cells, representative B-ALL (SD-1) and B-NHL (DHL-4) cell lines with the highest expression of LILRB1 among tested cells were selected. In both cell lines, 2116 LILRB1 CAR-T cells exhibited potent killing efficacy comparable to gold standard CD19 CAR-T cells (Figure 6C). Surprisingly, 2115 LILRB1 CAR-T cells were inefficient in the elimination of SD-1 and DHL-4 cells (Figure 6C).

[0276] Similar results were observed in a bioluminescence-based killing assay using LILRBl-high, luciferase-modified target cells (Figure 6D). Importantly, 2116 LILRB1 CAR-T effectively killed RS4;11 B-ALL cells with moderate LILRB1 levels (Figure 6D). Subsequently, CAR-T cells were tested in a bioluminescence-based killing assay against B-ALL PDX cells expressing luciferase. Both 2116 LILRB1 and CD 19 CAR-T cells killed the target cells with similar efficacy, while 2115 LIL RBI CAR-T cells did not exhibit any advantage over mock T cells (Figure 6E). Based on the presented comparative studies, inventors conclude that the 2116 LILRB1 CAR construct surpasses the 2115 LILRB1 construct since, as already mentioned, it is hereby demonstrated that not all antibodies, or scFv fragments are suitable for generation of effective CAR constructs. Hereafter, the 2116 LILRB1 CAR will be referred to as LILRB1 CAR,EXAMPLE 6

[0277] VERIFICATION OF THE LILRB1 CAR-T CELL KILLING SPECIFICITY

[0278] Next, inventors verified the specificity of LILRB1 CAR-T cell killing. LILRB1 CAR-T cells exhibited no cytotoxic effects against LILRB1 -negative Ly-7 lymphoma cells (Figure 7A) as well as non-hematologic cells, such as breast and hepatocellular carcinoma cell lines lacking LILRB1 expression (Figure 7B, C). Next, inventors overexpressed LILRB1 in 697 cells that were originally LILRB1 -negative (Figure 7D). Killing assays conducted with 697 parental cells and those overexpressing LILRB1 revealed that LILRB1 CAR-T cell activity was exclusively detected in cells expressing LILRB1 (Figure 7E). Subsequently, inventors evaluated the cytotoxic effects of LILRB1 CAR-T cells against MLLr B-ALL PDX samples with varying LILRB1 expression levels (Figure 8A) and compared them with CD 19 CAR-T cell cytotoxicity. LILRB1 CAR-T cells exhibited the highest cytotoxicity levels in four PDX samples (PDX#1-PDX#4), which was comparable to the cytotoxicity of CD 19 CAR-T cells (Figure 8B), consistent with their high LILRB1 and CD 19 expression levels (Figure 8A).

[0279] Conversely, significantly lower cytotoxicity of LILRB1 CAR as compared to CD19-CAR was observed in samples PDX#5 and PDX#6 (Figure 8B), which expressed low levels of LILRB1 (Figure 8A). Furthermore, LILRB1 CAR-T cells potently killed CD 19 KO cells that exhibited complete resistance to CD19-CAR T cells (Figure 9A) as well as Raji cells resistant to CD19 CAR-T-cells (Figure 9B) that aligned with the preserved LILRB1 expression (Figure 4).

[0280] Altogether, our findings confirm the specificity of LILRB1 CAR-T cells and demonstrate that their cytotoxicity corresponds with LILRB1 levels on target cells.

[0281] To validate the functionality of generated LILRB1 CAR-T cells, their degranulation was tested following 24 h of co-culture with cells expressing high levels of LILRB1 (SD-1). CD3+ LILRB1 CAR-T cells exhibited pronounced degranulation, comparable to CD3+ CD 19 CAR-T cells (Figure 10A). Both, LILRB1 and CD 19 CAR-T cells also released significant amounts of IFNy and TNFa after 24 h of co-culture with SD-1 cells, consistent with the expression of CD 19 and LILRB1 targets (Figure 10B). These findings collectively demonstrate targetspecific degranulation and cytokine release by LILRB1 CAR-T cells.EXAMPLE 7

[0282] ASSESSMENT OF POTENTIAL LILRB1 CAR-T CELLS OFF-TUMOR TOXICITY To assess potential off-tumor toxicity across normal leukocytes, inventors conducted co-culture experiments with LILRB1 CAR-T cells and healthy donor PBMCs. Following 24 h of coculture, flow cytometry analysis of PBMC subtypes revealed specific depletion of monocytes by LILRB1 CAR-T cells, with no discernible effects on B cells, T cells or NK cells (Figure IIA). The effect of depletion of monocytes was also observed for CD33 CAR-T cells, a therapy currently tested in clinical trials in AML patients. In contrast, CD19 CAR-T cells selectively eliminated CD19-expressing B cells (Figure 11A). These findings suggest that targeting LILRB1 is likely to only eliminate target positive tumor cells and monocytes.

[0283] Next, the toxicity of LILRB1 -CAR-T cells was assessed on normal hematopoiesis in comparison to CD33-CAR-T cells. CD33 CAR T cells significantly reduced the number of colonies derived from erythroid and myeloid progenitors, whereas bone marrow treated with LILRB1 -CAR-T cells produced a similar number of colonies as the mock-treated group (Figure IIB). These findings suggest that targeting LILRB1 is likely to spare normal leukocytes, except for monocytes, and that LILRB1 -CAR-T cells are less myelotoxic than CD33-CAR-T cells, which remains in accordance with LILRB1 expression profile.

[0284] EXAMPLE 8

[0285] LILRB1 CAR-T CELLS DEMONSTRATE ANTI-B-ALL ACTIVITY IN VIVO

[0286] To assess the in vivo efficacy of the LILRB1 CAR, NOD scid gamma (NSG) mice implanted with RS4;11 B-ALL cells expressing GFP-luciferase+ (GFP-luc+) were utilized (Figure 12A).

[0287] Mice treated with two doses of either LILRB1 CAR-T cells or CD 19 CAR-T cells exhibited a significant reduction in tumor burden, as measured by bioluminescent imaging (Figure 12B, C), and had markedly prolonged survival compared to those receiving MOCK T cells (Figure 12D). At the time of sacrifice, organ analysis showed that mice treated with LILRB1 CAR-T cells had significantly lower tumor burden in the spleens compared to the groups after MOCK and CD 19 CAR-T cells, and significantly lower tumor burden in the bone marrow compared to the group treated with MOCK T cells (Figure 12E). Additionally, a significant number of human CD3+ cells were detected among human cells in the spleens and bone marrow of the LILRB1 CAR-T cell-treated group (Figure 12F). Importantly, RS4;11 tumor cells that relapsed following CD 19 CAR-T treatment continued to express LILRB1 (Figure 12G). These findingsindicate that LILRB1 CAR-T cells are effective against B-ALL in vivo and their antitumor efficacy is comparable to that of CD 19 CAR-T cells.

[0288] EXAMPLE 9

[0289] ANALYSIS OF LILRB1 EXPRESSION IN MONOCYTIC AML AND ELIMINATION OF MONOCYTIC AML BY LILRB1 CAR-T CELLS IN VITRO AND IN VIVO

[0290] Considering the abundant expression of LILRB1 in monocytes, inventors next checked the levels of LILRB 1 in various types of AML cell lines. The highest levels of LILRB 1 protein were found in monocytic (U937) and bi-phenotypic B-myelomonocytic (MV4;11) cell lines (Figure 13A). Accordingly, potent in vitro killing efficacy of LILRB 1 CAR-T cells against LILRB 1 -expressing AML cell line (U937) (Figure 13B) was observed. Moreover, prominent cytokines release was observed following LILRB1 CAR-T cell co-incubation with U937 cells (Figure 13C).

[0291] Finally, the in vivo efficacy of LILRB 1 CAR-T cells against AML cells was investigated using an aggressive model of U937 cells in NSG mice. Each group of 6-7 mice received either LILRB 1 CAR-T cells or CD33 CAR-T cells in two doses, or mock T cells, as presented in Figure 14A. Mice treated with LILRB 1 CAR-T cells and CD33 CAR-T cells exhibited a robust response, as evidenced by reduced leukemic burden observed through bioluminescent imaging (Figure 14B, C) and significantly prolonged survival compared to mock T cells (Figure 14D).

[0292] To assess LILRB 1 levels post-CAR treatment, spleens from relapsed mice were isolated. Although LILRB 1 levels in vivo on U937 cells were much lower than in vitro, they were stable across treatment groups (Figure 14E). Collectively, these results show that LILRB 1 CAR-T cells effectively reduce leukemic burden and prolong survival in this aggressive AML model.

[0293] EXAMPLE 10

[0294] IMPACT OF LINKER TYPE AND COSTIMULATORY DOMAIN SELECTION

[0295] The impact of linker type and costimulatory domain selection on the function of LILRB 1-targeting CAR constructs was investigated, as well as to compare the efficacy of distinct scFv amino acid sequences. As illustrated in Figure 15, new LILRB 1 CAR formats were generated by combining variable domains from two monoclonal antibody clones (HPF1 and #292305) with either a long or short linker, and incorporating these scFvs into second-generation CAR backbones containing either 4-1BB or CD28 costimulatory domains. The resulting CARs derived from clone 1 HP-F1 (SEQ ID NO: 78, 79, 80) were designated as constructs “2499 41BB”; “2499 CD28”; and “2115 CD28” respectively. The resulting CARs derived from clone2 #292305 (SEQ ID NO: 61, 62, 63) were designated as constructs “2500 41BB”; “2500 CD28 and “2116 CD28” respectively.

[0296] Functional analyses comparing the efficacy of different variants of CARs built on clone 2 scFv (2116 41BB, 2116 CD28, 2500 41BB, 2500 CD28), including cytotoxicity assays against LILRB1 -positive B-ALL (RS4;11,) and AML (U937) cell lines (Figure 16), demonstrated that the LILRB1 CAR construct comprising the scFv of the invention maintains comparable cytotoxic activity regardless of these structural modifications.

[0297] Unexpectedly, comparative evaluation of CAR constructs based on the specific scFv amino acid sequences showed that the construct designated 2116 markedly outperformed the 2115 and 2499 constructs in terms of cytotoxicity (Figure 17A) and cytokine production (Figure 17B-E). The superior activity of 2116 was consistent across various CAR backbone formats and target cell types, suggesting that the amino acid composition of the scFv is a critical determinant of CAR efficacy.

[0298] In addition, further formats of LILRB1 -targeting chimeric fusion proteins, namely BiTE proteins were generated and characterized (Figures 18-19). These BiTE constructs, comprising scFvs derived fromHPFl (2115) or #292305 (2500) linked to an anti-CD3 scFv (clone OKT3), were successfully expressed in HEK293T cells and demonstrated potent BiTE-mediated cytotoxicity against LILRB1 -positive ALL and AML cell lines in vitro. Likewise in CAR formats, also in BiTE format the scFv based on the antibody clone 2 (2500) outperformed the scFv based on the antibody clone 1 (2115), further corroborating that the amino acid composition of the scFv is a critical determinant of LILRB1 -targeting BiTE efficacy.

[0299] Collectively, these results provide important insights into the design of LILRB1 -targeting CARs and BiTEs. Specifically, they highlight that linker type and costimulatory domains do not substantially alter functional outcomes, whereas the scFv amino acid sequence, notably that of constructs 2116 and 2500, are unexpectedly decisive in achieving enhanced therapeutic activity.

Claims

CLAIMS1. An isolated scFv capable of recognizing a LILRB1 antigen, the scFv comprising:(a) a heavy chain variable region (VH) comprising the complementarity determining regions (CDRs), wherein the CDR1, CDR2 and CDR3 of VH comprise the amino acid sequences of SEQ ID NO: 1, 2, 3 respectively, or a variant having at least 95% sequence identity therewith, and(b) a light chain variable region (VL), wherein the CDR1, CDR2 and CDR3 of VL comprise the amino acid sequences of SEQ ID NO: 4, 5, 6 respectively, or a variant having at least 95% sequence identity therewith.

2. The scFv according to claim 1, wherein(a) the heavy chain variable region (VH) has an amino acid sequence of SEQ ID NO: 11, or a variant having at least 95% sequence identity therewith, and(b) the light chain variable region (VL) has an amino acid sequence of SEQ ID NO: 17, or a variant having at least 95% sequence identity therewith.

3. The scFv according to claim 1 or 2, wherein the scFv comprises the amino acid sequence of SEQ ID NO: 18, 20, 55 or 56, or an amino acid sequence having at least 905% sequence identity thereto.

4. A chimeric fusion protein comprising the scFv according to any one of claims 1 to 3, wherein the chimeric fusion protein is selected from the group comprising: a chimeric antigen receptor (CAR), bispecific T-cell engager (BiTE), a dual affinity retargeting proteins (DART), or an antibody-drug conjugates (ADC), in particular a CAR or a BiTE.

5. The chimeric fusion protein of claim 4, wherein the chimeric fusion protein is a CAR comprising the amino acid sequence as set forth in any one of SEQ ID NO: 60-63, or a variant having at least 95% sequence identity therewith.

6. A CAR T cell comprising the scFv according to any one of claims 1 to 3, or the CAR according to claim 5, in particular wherein the scFv comprises:(a) a heavy chain variable region (VH) comprising the complementarity determining regions (CDRs), wherein the CDR1, CDR2 and CDR3 of VH comprise the amino acid sequences of SEQ ID NO: 1, 2, 3 respectively, and67(b) a light chain variable region (VL), wherein the CDR1, CDR2 and CDR3 of VL comprise the amino acid sequences of SEQ ID NO: 4, 5, 6 respectively.

7. The CAR of claim 5, or the CAR T cell of claim 6, wherein the CAR further comprises:- a hinge domain, in particular comprising the amino acid sequence of SEQ ID NO: 22 or 58;- a transmembrane domain, in particular comprising the amino acid sequence set forth in SEQ ID NO: 21 or 57; and- an intracellular domain, in particular comprising the amino acid sequence of SEQ ID NO: 23 or 59 and / or the amino acid sequence of SEQ ID NO: 24.

8. The CAR T cell of claim 6 or 7, wherein said CAR further comprises a signal peptide domain, preferably the signal peptide domain is any one of a GM-CSF signal peptide, an IL-2 signal peptide, or a CD8a signal peptide.

9. The CAR T cell according to any one of claims 6-8, wherein said CAR further comprises one or and more co-stimulatory signaling domains selected from a group comprising CD28 or 4-1BB.

10. The CAR of claim 5, or the CAR T cell according to any one of claims 6-8, wherein said CAR further comprises a transmembrane domain derived from human CD8a, CD3, CD28, or CD4, in particular CD8a and CD28.

11. A bi-specific T-cell engager (BiTE) comprising:(a) the scFv according to any one of claims 1-3, and(b) an antigen-binding domain having binding affinity to a T-cell antigen, in particular an anti-CD3.

12. The BiTE of claim 11, comprising the amino acid sequence as set forth in SEQ ID NO: 64 or 92, or a variant having at least 95% sequence identity therewith.

13. An isolated nucleic acid encoding the scFv according to any one of claims 3-12, in particular wherein the nucleic acid comprises the nucleic acid sequence as set forth in any one of SEQ ID NO: 25-26, 66-67, or a sequence having at least 80% sequence identity thereto.

14. An isolated nucleic acid encoding the CAR according to any one of claims 5-10, or the BiTE according to claim 11 or 12, in particular wherein the nucleic acid comprises a sequence as setforth in any one of SEQ ID NO: 27 or 65, 68-71, or a sequence having at least 80% sequence identity thereto.

15. A vector comprising the nucleic acid of claim 13 or 14.

16. A host cell comprising the nucleic acid of claim 13 or 14 or the vector of claim 15, in particular wherein the host cell is a mammalian cell.

17. A pharmaceutical composition comprising the scFv of claim 1 to 3, the chimeric fusion protein of claim 4, the CAR of claim 5, the CAR T cell of any one of claim 6-10, the BiTE of claim 11 or 12, the nucleic acid of claim 13 or 14, the vector of claim 15 or the host cell of claim 16, and a pharmaceutically acceptable carrier.

18. The pharmaceutical composition of claim 17 for use in immunotherapy, in particular for use in adoptive immunotherapy, more in particular wherein said immunotherapy is therapy selected from the group comprising: CAR T-cell, monoclonal antibodies (mAbs), bispecific T-cell engager (BiTE), bispecific antibodies, dual affinity retargeting proteins (DART); antibodydrug conjugates (ADC), secretion of T-cell engager antibodies (StAb), preferably said immunotherapy is the CAR T-cell therapy or BiTE therapy.

19. The pharmaceutical composition for use according to claim 17 or 18, wherein immunotherapy is a treatment of diseases where the elimination or reduction of cells expressing LILRB1 is desired selected from hematological malignancies, or autoimmune diseases, in particular wherein said hematological malignancies are selected from the group comprising: B cell-derived malignancies, including B-ALL, B-NHL, monocyte-derived malignancies, and malignancies resistant to prior lines of immunotherapy, including malignancies where malignant cells had lost CD 19 expression post-CD19-targeting treatment, or where malignancies become resistant to CD19-targeting treatment.

20. The pharmaceutical composition for use according to any one of claims 17 to 19, in the treatment of diseases wherein cells have no, or have lost CD 19 expression, in particular for use in post-CD19 CAR-T cell treatment.

21. A method of treating or ameliorating the effect of cancer in a subject, the method comprising administering to said subject a therapeutically effective amount of the scFv according to any one of claims 1-3, the chimeric fusion protein of claim 4, the CAR of claim 5, the CAR T cell of any one of claim 6-10, the BiTE of claim 11 or 12, the nucleic acid of claim 13 or 14, the vector of claim 15, the host cell of claim 16, or the pharmaceutical composition according to claim 17.

Images