Riboswitches with superior switching performance

WO2026180727A1PCT designated stage Publication Date: 2026-09-03HARTIG JORG +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2026/055527
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-02-28
Filing Date
2026-02-27
Publication Date
2026-09-03

Smart Images

  • Figure EP2026055527_03092026_PF_FP_ABST
    Figure EP2026055527_03092026_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure relates to riboswitches for controlling target gene expression, wherein the riboswitches comprise an optimized aptamer that provides for improved expression control. The present disclosure also relates to the methods of using such riboswitches for controlling target gene expression in diagnostic and therapeutic applications.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] RIBOSWITCHES WITH SUPERIOR SWITCHING PERFORMANCE

[0002] FIELD

[0003] The present disclosure relates to riboswitches for controlling target gene expression, wherein the riboswitches comprise an optimized aptamer that provides for improved expression control. The present disclosure also relates to methods of using such riboswitches for controlling target gene expression in diagnostic and therapeutic applications.

[0004] BACKGROUND

[0005] Gene expression regulation tools play an important role in the development and application of gene therapies1. Artificial riboswitches are modular RNA-based regulators that function by binding specific ligands via an aptamer, which triggers a conformational (allosteric) change to control gene expression. Since riboswitches can be inserted into a shuttle vector with minimal coding space requirements and do not rely on the expression of potentially immunogenic proteins, they are considered particularly promising for advancing gene therapies1'2. Several synthetic riboswitches have been developed based on different expression platforms that can be linked via communication modules to aptamers binding a desired ligand3-9. To advance riboswitches into clinical applications, especially for therapeutic purposes, highly efficient variants that respond to clinically relevant drugs like tetracycline with excellent switching performances are essential.

[0006] Aptamers that bind to specific ligands can be produced in vitro via the systematic evolution of ligands by exponential enrichment (SELEX).10'n. The first engineered riboswitches designed for use in human cells included the theophylline-binding aptamer, developed by Jenison et al. in 1994, which has demonstrated functionality across various applications3'12'13. Another very widely used in vitro-generated aptamer is the tetracycline aptamer developed by Berens et al. Tetracycline aptamers have been extensively studied and used to create several synthetic riboswitches15. In 2015, the Suess group published a tetracycline-inducible aptazyme design based on the Type III Hammerhead ribozyme (HHR)4'16. This construct was demonstrated to function in eukaryotic organisms and was used for adeno-associated virus (AAV)-mediated transgene expression in mice4'17 19. One year later, the Farzan group developed an OFF switch by attaching the tetracycline aptamer to a type I HHR and also used these constructs to control the expression of AAV-vectored transgenes in mice20. These findings allowed for the application of tetracycline switches to regulate potential therapeutic genes, including VEGF-B for cardiovascular disease and prostaglandin F2α biosynthesis for glaucoma treatment21'22. Tetracycline riboswitches that control the accessibility of splice sites were shown to efficiently regulate reporter gene expression in mammalian cells and C. elegans with the advantage of a comparably low background expression23'24. These constructs regulate exon-skipping by ligand-dependent aptamer folding causing splice-site masking of an alternative exon with a premature stop codon. Switches based on alternative splicing were further used to study the function of CD20, a target for the treatment of B-cell associated diseases25.The variety of approaches taken by researchers to design artificial tetracycline switches has led to a wide range of expression platforms, offering to interfere with transgene expression at different stages of mRNA maturation or focusing on different regulatory mechanisms15. However, most of these platforms are not optimized to induce maximum fold-change and display significant background levels of gene expression in the off-state, which discourages the use of such systems for scientific or medical purposes. An example of the advanced optimization of tetracycline aptamer-based switches is the recently published PolyA regulator system26. In this case, Yen etal. were able to design an exceptionally efficient switch by placing a polyA-signal in a scaffold between three aptamers that additionally control a G-quadruplex-assisted splice site26.

[0007] More general approaches for improving riboswitch performance often involve enhancing the interaction between the aptamer and the expression platform. This can be achieved through various approaches, including rational design and NGS-based screenings. Additionally, reducing background expression can be accomplished by arranging small constructs, such as aptazymes, in tandem or by combining different regulatory mechanisms within the designs. However, most of these attempts have not led to the substantial improvements that would be desirable for the application of tetracycline riboswitches in a therapeutic context27'28.

[0008] Kelvin etal., 2025, Synthetic Dual-Input Hybrid Riboswitches - Optimized Genetic Regulators in Yeast, ACS Synth. Biol. 14:497-509, describe roadblock riboswitches, which function by blocking the ribosome in the 5'-UTR. Ribosome blocking becomes more likely upon ligand binding due to the formation of a more structured RNA conformation. A major drawback to the riboswitches described is that they are not functional in mammalian cells and that they only function as off-switches.

[0009] Thus, there remains a need for improved riboswitches with improved fold ranges, i.e., control of expression. Furthermore, screening approaches can be labor-intensive and require individual repetition for each riboswitch design. Currently, a simple and efficient optimization strategy that is easily transferable to another riboswitch design is lacking.

[0010] SUMMARY

[0011] Described herein are optimized aptamers comprising two fused aptamers each with its own ligandbinding domain, i.e., an optimized aptamer comprising two separate ligand-binding regions. An aptamer containing two stems that are stabilized upon ligand binding is opened at one of these stems and fused with a second aptamer, forming an optimized aptamer, referred to herein as an apdimer, with a proximal binding pocket (that is connected to the expression platform) and a distal binding pocket (that is connected to the proximal aptamer). The aptamers can be connected via a fusion region that allows cooperative ligand binding via both binding pockets, thereby optimizing the performance of the entire riboswitch construct. Apdimers can be placed on every riboswitch expression platform, such as aptazymes or splicing-based switches, in order to achieve optimal performances, i.e., a higher dynamic range of expression between "off" and "on", e.g., greater than 100-fold level of expression between "off" and "on".In an aspect of the present invention, disclosed herein is a nucleic acid molecule comprising at least one modified aptamer (apdimer), which apdimer comprises (i) at least a portion of a first aptamer comprising a first ligand-binding region and (ii) at least a portion of a second aptamer comprising a second ligand-binding region, wherein the first and second ligand binding regions are positioned relative to each other such that when one of the ligand-binding regions binds to its ligand, the other ligandbinding region binds to its ligand in a positive cooperative manner. In some embodiments, the cooperative manner means that binding of ligand to one ligand binding region facilitates or stabilizes the binding of ligand to the other ligand binding region.

[0012] As demonstrated herein, the apdimers of the invention have superior switching performance of up to a 1000-fold dynamic range with minimal background expression, e.g., a more rapid allosteric change in response to the change in the presence / absence of the binding ligand. The apdimers disclosed herein are characterized by a reduction in spontaneous / background allosteric change in the absence of the binding ligand and / or an increase in the responsiveness / sensitivity to the (change in the) presence / absence of the binding ligand (has a more pronounced response to the change in the presence / absence of the binding ligand). These characteristics allow for tighter regulation of the "on" or "off" state and allow for an increased sensitivity to the change in presence / absence of the binding ligand.

[0013] Without being limited to a particular mechanism of action, it is believed that these improved characteristics of the apdimers of the invention result from the positioning of the two separate ligand binding regions relative to each other, allowing for the ability of one ligand binding to its ligand binding region to influence the binding of the second ligand to the second ligand binding region. This influence results in positive cooperative binding of the binding ligands to their respective ligand binding regions. This cooperative binding can result in an increase of the measurable binding affinity of the binding ligands to the ligand binding region and / or can result in where ligand binding to one ligand-binding domain stabilizes ligand binding to the other ligand-binding domain. This effect based on the use of the apdimer cannot be explained by a more bulky RNA structure leading to ribosome blocking, as described in Kelvin etal. (citation above). Further, and in complete contrast to Kelvin etal. (citation above), the riboswitches according to the present invention are able to operate not only in mammalian cells but in different expression platforms which operate via completely different regulatory mechanisms in mammalian cells.

[0014] In an aspect of the present invention, disclosed herein is a riboswitch for the regulation of the expression of a target gene comprising: a nucleic acid comprising at least one modified aptamer (apdimer), which apdimer comprises: (i) at least a portion of a first aptamer comprising a first ligand-binding region, (ii) at least a portion of a second aptamer comprising a second ligand-binding region, wherein the first and second ligand binding regions are positioned relative to each other such that when one of the ligandbinding regions binds to its ligand, the other ligand-binding region binds to its ligand in a positive cooperative manner, and (iii) an effector region, which effector region, if not the entire apdimer,undergoes an allosteric change in response to ligand binding to at least one of the ligand-binding regions.

[0015] In an aspect of the present invention, disclosed herein is an expression cassette comprising a riboswitch of the invention as disclosed herein operably linked to a target gene comprising an open reading frame encoding a gene product, wherein the at least portion of the first aptamer of the riboswitch is proximal to the open reading frame and the at least portion of the second aptamer of the riboswitch is distal to the open reading frame. Distal and proximal refer to the position of the (first and second) ligand binding regions relative to the open reading frame / expression platform, e.g., as graphically demonstrated in Figure 19. As shown in the figure, the distal position is further away from the open reading frame / expression platform with the proximal position being located closer to the open reading frame / expression platform and between the distal position and the open reading frame / expression platform. It is apparent that this structure is wholly different from so-called "tandem riboswitches", as shown in, e.g., Mandal eta / ., 2004, A Glycine-Dependent Riboswitch That Uses Cooperative Binding to Control Gene Expression, Science 306:275-279 and Groher et al., 2019, Tuning the Performance of Synthetic Riboswitches using Machine Learning, ACS Synth. Biol. 8:34-44. In tandem riboswitches the independent aptamers are independent / separate from each other with a single-stranded linker of various length between each complete aptamer.

[0016] In other aspects of the present invention, disclosed herein is a vector comprising an expression cassette of the invention as disclosed herein, as well as a method of modulating the expression of a target gene in a cell comprising (i) introducing an expression cassette or vector of the invention as disclosed herein into a cell, and (ii) exposing the cell to a ligand that specifically binds at least one of the ligand-binding regions of the apdimer in an amount effective to modulate expression of the target gene. In an embodiment, the cell is a mammalian cell, such as a human cell. In an embodiment, the cell is not a yeast cell.SEQUENCES

[0017] The following table sets forth various sequences disclosed herein. Sequences with aptamer / apdimer sequences shown in bold letters. Important features of apdimer sequences are highlighted: Communication module or proximal stem (underlined). Fusion region (bold and underlined), distal aptamer {bold and itali ), closing stem of distal aptamer {italic, bold and underlined]

[0018] Table 1:

[0019] SEQ ID NO: 1 Tet_splice_l (Tet_9) GAAGGCACAUUACCUCUAAAACAUACCAGAUGAAAGUCUGGAGAGGUGAAGAAUACGACCACCU AGAGGUAAUGUGCGC SEQ ID NO: 2 Tet_splice_apdimer_l (VH366) GAAGGCAO\UUACCUCUAAAACAUACCAGAAMAOia4CC4G4£ / G44AGt / Ct / GGGGAGGt / GAAG A46MCG / 1CC4CCZAJCUGGGGAGGUGAAGAAUACGACCACCUAGAGGUAAUGUGC

[0020] SEQ ID NO: 3 Tet_splice_apdimer_w / o exon ^£A^}^C^Mdd^WK§ZAGAAAAACAUACCA^UGAAAGUCUGGGGAGGUGAAGAAUA CC4CCICC4AJCUGGGGAGGUGAAGAAUACGACCACCUAGAGGUAAUGUG

[0021] SEQ ID NO: 4 Tet_splice_apdimer_2 (EM 162) G^GGGKQA^KCQ\iGUAAM. CMiA. CCAGAAAAACAUACCAGAUGAAAGUCUGGGGAGGUGAAG > Wto1CGJCCflCaAJClJGGGGAGGUGAAGAUUACGACCACCUAGAGGUAAUGUGC

[0022] SEQ ID NO: 5 TetK19 (MaS159) GGCGCGUCCUGGAUUCGUGGUAAAACAUACCAGAUUUCGAUCUGGAGAGGUGAAGAAUACGACC ACCUACUACAUCCAGCUGAUGAGUCCCAAAUAGGACGAAACGCGC SEQ ID NO: 6 Tet_P2 (VH344) GGCGCGUCCUGGAUUCGUGGUGGAGAGGUGAAGAAUACGACCACCUAGGCUCGAAAGAGCCUAA AACAUACCACUACAUCCAGCUGAUGAGUCCCAAAUAGGACGAAACGCGC SEQ ID NO: 7 Tet_apdimer p2 / l_l (VH204) GGCGCGUCCUGGAUUCGUGGUGGAGAGGUGAAGAAUACGACCACCUACCAGAAAA4OI / Z4CdG AUGAAAGUCUGGAGAGGUGAAGAAUACGACCACClMG{iGGUM^^kGMkGGKG^KGMGCKG^ GAUGAGUCCCAAAUAGGACGAAACGCGC SEQ ID NO: 8 Tet_apdimer_P2 / l_2 (VH210) GGCGCGUCCUGGAUUCGUGGUGGAAGAGGUGAAGAAUACGACCACCUACCAGAAMJC^CCflg AUGAAAGUCUGGAGAGGUGAAGAAUACGACCACCWC{iGGUAAAKCMA{)CGKG{}KCK{}CCAGC UGAUGAGUCCCAAAUAGGACGAAACGCGC SEQ ID NO: 9 Tet_apdimer_P2 / l_3 (EM153) GGCGCGUCCUGGAUUCGUGGUGGAGGAGGUGAAGAUUACGACCACCUACCAGA^MA^CA& MCtM GAUGAAAGUCUGGGGAGGUGAAGAUUACGACCACClMC\)GG\3kAKACMJM3CCAGX)KCK\\C. C. K GCUGAUGAGUCCCAAAUAGGACGAAACGCGCU

[0023]

[0024] I u

[0025] 8 U3

[0026]

[0027] SEQ ID NO: 24 Tet_apdimer P2_2 (VH259, splicing GAAGGCACAUUACCUCAAGAGGUGAAGAAUACGACCACCUACCAGAAMACW^CCflgdggAM construct) GUCUGGAGAGGUGAAGAAUACGACCACCU{JC\JGGUM< M< CMK\)GKGG{}M<\}G\)GGGCA SEQ ID NO: 25 Tet_splice_2 GGCACAUUACCUCUAAAACAACCAGAUGAAAGUCUGGGGAGGUGAAGAAUACGACCACCUAGAG GUAAUGUGCGC SEQ ID NO: 26 Tet_apdimer_l splice control 1 GGCKCM\iKCCy)GXJAMACMi^CGAGrkAAAACAUUCCAGAUGAAAGUCUGGGGAGGUGAAGAA 6Mgg / ICOlCC£AJCUGGGGAGGUGAAGAAUACGACCACCUAGAGGUAAUGUGC

[0028] SEQ ID NO: 27 Tet_apdimer_l splice control 2 GGGKCM\JNZG^G\SKMA£W\JCCAGkAAAACAUACCAGAUGAAAGUCUGGGGAGGUGAAGAA £44Cg^CC4gg< MJCUGGGGAGGUGAAGAAUACGACCACCUAGAGGUAAUGUGC

[0029] SEQ ID NO: 28 Tet_apdimer_P2 / l_2 control 1 GGCGQGUCCUGGAUUCGUGGUGGAAGAGGUGAAGAAUACGACCACCUACCAGA> WMOl£ / £ / COI GAUGAAAGUCUGGAGAGGUGAAGAAUACGACCACCIAJCUGGUKM^CMJAGGGAG\}KGAGCCKG CUGAUGAGUCCCAAAUAGGACGAAACGCGC SEQ ID NO: 29 Tet_apdimer_P2 / l_2 control 2 GGCGCGUCCUGGAUUCGUGGUGGAAGAGGUGAAGAAUACGACCACCUACCAGAAAMdO4COIg AUGAAAGUCUGGAGAGGUGAAGAAUACGACCACClMCUGGUKAAACMJV)i)GGACdKGA\iCCKGC UGAUGAGUCCCAAAUAGGACGAAACGCGC SEQ ID NO: 30 Tet_apdimer_P2_2 (VH174) GGCGCGUCCUGGAUUCGUGGUGGAGAGGUGAAGAAUACGACCACCUAGGCUCGGAg4gggg4Ag

[0030] AAUACGACCACCUAGGCUCGAAAGAGCCUAAAACAUACCGKGCC\JKK^CMAGCKG!dKCMGG

[0031]

[0032] AGCUGAUGAGUCCCAAAUAGGACGAAACGCGDETAILED DESCRIPTION

[0033] The present disclosure provides nucleic acids, including expression cassettes and vectors, for the regulation of gene expression by apdimer-based modulation of riboswitches, such as small endonucleolytic ribozymes and / or alternative splicing riboswitches, and methods of using the nucleic acids to regulate target gene expression in response to the presence or absence of a ligand that binds the apdimer. The nucleic acid can comprise at least one riboswitch that contains at least one apdimer of the invention and an effector region, such as a ribozyme or a splice site. The manner in which the effector region is attached to the apdimer provides for riboswitches that activate the effector region in the presence of the apdimer ligand ("off riboswitches) or that inhibit the effector region in the presence of the apdimer ligand ("on" riboswitches). When incorporated into the DNA of a target gene, the riboswitch comprising an apdimer provides the ability to regulate expression of the target gene by apdimer / ligand mediated regulation of the effector region.

[0034] As used herein, the riboswitch in the context of the present invention contains an apdimer and an effector region that together are responsible for sensing the presence of a ligand that binds the ligandbinding regions of the apdimer and altering the conformation of effector region. In one embodiment, the expression of the target gene is increased when the ligand is present and decreased when the ligand is absent. In another embodiment, the expression of the target gene is decreased when the ligand is present and increased when the ligand is absent.

[0035] Although the present disclosure is further described in more detail below, it is to be understood that this disclosure is not limited to the particular methodologies, protocols and reagents described herein as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present disclosure which will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art. In the following, the elements of the present disclosure will be described in more detail. These elements are listed with specific embodiments; however, it should be understood that they may be combined in any manner and in any number to create additional embodiments. The variously described examples and preferred embodiments should not be construed to limit the present disclosure to only the explicitly described embodiments. This description should be understood to support and encompass embodiments which combine the explicitly described embodiments with any number of the disclosed and / or preferred elements. Furthermore, any permutations and combinations of all described elements in this application should be considered disclosed by the description of the present application unless the context indicates otherwise.

[0036] Preferably, the terms used herein are defined as described in " A multilingual glossary of biotechnological terms: (IUPAC Recommendations)", H. G. W. Leuenberger, B. Nagel, and H. Kölbl, Eds., Helvetica Chimica Acta, CH-4010 Basel, Switzerland, (1995).The practice of the present disclosure will employ, unless otherwise indicated, conventional chemistry, biochemistry, cell biology, immunology, and recombinant DNA techniques which are explained in the literature in the field {cf., e.g., Organikum, Deutscher Verlag der Wissenschaften, Berlin 1990; Streitwieser / Heathcook, " Organische Chemie", VCH, 1990; Beyer / Walter, " Lehrbuch der Organischen Chemie", S. Hirzel Verlag Stuttgart, 1988; Carey / Sundberg, " Organische Chemie", VCH, 1995; March, " Advanced Organic Chemistry", John Wiley & Sons, 1985; Rompp Chemie Lexikon, Falbe / Regitz (Hrsg.), Georg Thieme Verlag Stuttgart, New York, 1989; Molecular Cloning: A Laboratory Manual, 4thEdition, Green and Sambrook, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2012.

[0037] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by the context. The use of any and all examples, or exemplary language {e.g., "such as"), provided herein is intended merely to better illustrate the present disclosure and does not pose a limitation on the scope of the present disclosure otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the present disclosure.

[0038] Recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein.

[0039] Several documents are cited throughout the text of this specification. Each of the documents cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, are hereby incorporated by reference in their entirety. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.

[0040] Citation of documents and studies referenced herein is not intended as an admission that any of the foregoing is pertinent prior art. All statements as to the contents of these documents are based on the information available to the applicants and do not constitute any admission as to the correctness of the contents of these documents.

[0041] Definitions

[0042] In the following, definitions will be provided which apply to all aspects of the present disclosure. The following terms have the following meanings unless otherwise indicated. Any undefined terms have their art recognized meanings.

[0043] Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated member, integer or step or group of members, integers or steps but not the exclusion of any other member, integer or step or group of members, integers or steps. The term "consisting essentially of means excluding other members, integers or steps of any essential significance. The term "comprising" encompasses the term "consisting essentially of which, in turn,encompasses the term "consisting of". Thus, at each occurrence in the present application, the term "comprising" may be replaced with the term "consisting essentially of or "consisting of. Likewise, at each occurrence in the present application, the term "consisting essentially of may be replaced with the term "consisting of.

[0044] The terms "a", "an" and "the" and similar references used in the context of describing the present disclosure (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by the context.

[0045] Where used herein, "and / or" is to be taken as specific disclosure of each of the two specified features or components with or without the other. For example, " X and / or Y" is to be taken as specific disclosure of each of (i) X, (ii) Y, and (iii) X and Y, just as if each is set out individually herein.

[0046] As used herein, the terms "binding" or "capable of binding" in the context of the binding of an aptamer, e.g., an apdimer as disclosed herein, to a ligand typically is a binding with an affinity corresponding to a KD of about 10-7M or less, such as about 10-8M or less, such as about IO-9M or less, about 1010M or less, or about 1011M or even less, when determined, for instance, using Bio-Layer Interferometry (BLI) or using surface plasmon resonance (SPR) technology in a BIAcore 3000 instrument.

[0047] The term "kd" (sec-1), as used herein, refers to the dissociation rate constant of a particular ligandbinding region-ligand interaction. Said value is also referred to as the koffvalue.

[0048] The term " KD" (M), as used herein, refers to the dissociation equilibrium constant of a particular ligandbinding region-ligand interaction.

[0049] The term "riboswitch" refers to a cis-acting RNA element present in mRNA which binds a small molecule ligand as an effector molecule, resulting in change in expression of the proteins encoded by the mRNA, either at the level of transcription or at the level of translation. Riboswitches may be divided into two parts which include an aptamer, e.g., an apdimer as disclosed herein, and an expression platform. The aptamer is formed by the mRNA after transcription. The aptamer then binds the effector molecule which results in structural changes in the expression platform that modulates expression of the protein encoded by the mRNA, either at the level of transcription or at the level of translation. A riboswitch thus controls expression of the protein encoded by the mRNA in response to the effector molecule.

[0050] The term "oncolytic virus" as used herein refers to a virus capable of selectively replicating in and slowing the growth or inducing the death of a cancerous or hyperprol iterative cell, either in vitro or in vivo, while having no or minimal effect on normal cells. An oncolytic virus can comprise an expression cassette that may encode a target gene, such as a siRNA, shRNA, an oligonucleotide, antisense DNA or RNA, an antibody or a fragment thereof or a soluble immune checkpoint protein or fusion. The oncolytic virus preferably is replication competent, and the expression cassette is under the control of a viral promoter, e.g., synthetic early / late poxvirus promoter. Exemplary oncolytic viruses include vesicular stomatitis virus (VSV), rhabdoviruses {e.g., picornaviruses such as Seneca Valley virus; SVV-001), coxsackievirus, parvovirus, Newcastle disease virus (NDV), herpes simplex virus (HSV; OncoVEXGMCSF), retroviruses {e.g., influenza viruses), measles virus, reovirus, Sindbis virus, vaccinia virus, as exemplarily described in WO 2017 / 209053 (including Copenhagen, Western Reserve, Wyeth strains), and adenovirus e.g., Delta-24, Delta-24-RGD, ICOVIR-5, ICOVIR-7, Onyx-015, ColoAdl, H101, AD5 / 3-D24-GMCSF).

[0051] The terms "% identical" and "% identity" or similar terms are intended to refer, in particular, to the percentage of nucleotides or amino acids which are identical in an optimal alignment between the sequences to be compared. Said percentage is purely statistical, and the differences between the two sequences may be but are not necessarily randomly distributed over the entire length of the sequences to be compared. Comparisons of two sequences are usually carried out by comparing the sequences, after optimal alignment, with respect to a segment or "window of comparison", in order to identify local regions of corresponding sequences. The optimal alignment for a comparison may be carried out manually or with the aid of the local homology algorithm by Smith and Waterman, 1981, Ads App. Math.

[0052] 2, 482, with the aid of the local homology algorithm by Neddleman and Wunsch, 1970, J. Mol. Biol. 48, 443, with the aid of the similarity search algorithm by Pearson and Lipman, 1988, Proc. Natl Acad. Sci. USA 88, 2444, or with the aid of computer programs using said algorithms (GAP, BESTFIT, FASTA, BLAST P, BLAST N and TFASTA in Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis.). In some embodiments, percent identity of two sequences is determined using the BLASTN or BLASTP algorithm, as available on the United States National Center for Biotechnology Information (NCBI) website {e.g., at blast.ncbi.nlm.nih.gov / Blast.cgi). In some embodiments, the algorithm parameters used for BLASTN algorithm on the NCBI website include: (i) Expect Threshold set to 10; (ii) Word Size set to 28; (iii) Max matches in a query range set to 0; (iv) Match / Mismatch Scores set to 1, -2; (v) Gap Costs set to Linear; and (vi) the filter for low complexity regions being used. In some embodiments, the algorithm parameters used for BLASTP algorithm on the NCBI website include: (i) Expect Threshold set to 10; (ii) Word Size set to 3; (iii) Max matches in a query range set to 0; (iv) Matrix set to BLOSUM62; (v) Gap Costs set to Existence: 11 Extension: 1; and (vi) conditional compositional score matrix adjustment. Percentage identity is obtained by determining the number of identical positions at which the sequences to be compared correspond, dividing this number by the number of positions compared {e.g., the number of positions in the reference sequence) and multiplying this result by 100.

[0053] In some embodiments, the degree of similarity or identity is given for a region which is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or about 100% of the entire length of the reference sequence. For example, if the reference amino acid sequence consists of 200 amino acid residues, the degree of identity is given for at least about 100, at least about 120, at least about 140, at least about 160, at least about 180, or about 200 amino acid residues, in some embodiments continuous amino acid residues. In some embodiments, the degree of similarity or identity is given for the entire length of the reference sequence.

[0054] " Homology" and "homologous" as used herein refer to the percent identity between two polynucleotide sequences or between two polypeptide sequences. The correspondence between one sequence toanother can be determined by techniques known in the art. For example, homology can be determined by a direct comparison of two polypeptide molecules by aligning the sequence information and using readily available computer programs. Two polynucleotide or two polypeptide sequences are "substantially homologous" to each other when, after optimally aligned with appropriate insertions or deletions, at least about 80%, at least about 85%, at least about 90%, and at least about 95% of the nucleotides or amino acids, respectively, match over a defined length of the molecules, as determined using the methods above.

[0055] Nucleic acid sequences or amino acid sequences having a particular degree of similarity or identity to a given nucleic acid sequence or amino acid sequence, respectively, may have at least one functional property of said given sequence, e.g., and in some instances, are functionally equivalent to said given sequence.

[0056] Regarding polynucleotide sequences, "variant," "mutant," or "derivative" may be defined as a nucleic acid sequence having at least 50% sequence identity to the particular nucleic acid sequence over a certain length of one of the nucleic acid sequences using BLASTN with the " BLAST 2 Sequences" tool available at the National Center for Biotechnology Information's website. (See Tatiana A. Tatusova, Thomas L. Madden (1999), " Blast 2 sequences - a new tool for comparing protein and nucleotide sequences", FEMS Microbiol Lett. 174:247-250). Such a pair of nucleic acids may show, for example, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length.

[0057] A "recombinant nucleic acid" is a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two or more otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques known in the art. The term recombinant includes nucleic acids that have been altered solely by addition, substitution, or deletion of a portion of the nucleic acid. Frequently, a recombinant nucleic acid may include a nucleic acid sequence operably linked to a promoter sequence. Such a recombinant nucleic acid may be part of a vector that is used, for example, to transform a cell.

[0058] The nucleic acids disclosed herein may be "substantially isolated or purified." The term "substantially isolated or purified" refers to a nucleic acid that is removed from its natural environment, and is at least 60% free, preferably at least 75% free, and more preferably at least 90% free, even more preferably at least 95% free from other components with which it is naturally associated.

[0059] In the context of the present disclosure, the term "transcription" relates to a process, wherein the genetic code in a DNA sequence is transcribed into RNA (especially mRNA). Subsequently, the RNA (especially mRNA) may be translated into peptide or protein. According to the present disclosure, the term "transcription" comprises "in vitro transcription".The term "expression" as used herein is defined as the transcription and / or translation of a particular nucleotide sequence. With respect to RNA, the term "expression" or "translation" relates to the process in the ribosomes of a cell by which a strand of mRNA directs the assembly of a sequence of amino acids to make a peptide or protein.

[0060] The term "optional" or "optionally" as used herein means that the subsequently described event, circumstance or condition may or may not occur, and that the description includes instances where said event, circumstance, or condition occurs and instances in which it does not occur.

[0061] As used herein "endogenous" refers to any material from or produced inside an organism, cell, tissue or system.

[0062] As used herein, the terms "linked", "fused", or "fusion" are used interchangeably. These terms refer to the joining together of two or more elements or components or domains.

[0063] The term "nucleic acid" according to the disclosure also comprises a chemical derivatization of a nucleic acid on a nucleotide base, on the sugar or on the phosphate, and nucleic acids containing non-natural nucleotides and nucleotide analogs. In some embodiments, the nucleic acid is a deoxyribonucleic acid (DNA) or a ribonucleic acid (RNA). In general, a nucleic acid molecule or a nucleic acid sequence refers to a nucleic acid which is preferably deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). According to the disclosure, nucleic acids comprise genomic DNA, cDNA, mRNA, viral RNA, recombinantly prepared and chemically synthesized molecules. According to the disclosure, a nucleic acid may be in the form of a single-stranded or double-stranded and linear or covalently closed circular molecule.

[0064] According to the disclosure, "nucleic acid sequence" refers to the sequence of nucleotides in a nucleic acid, e.g., a ribonucleic acid (RNA) or a deoxyribonucleic acid (DNA). The term may refer to an entire nucleic acid molecule (such as to the single strand of an entire nucleic acid molecule) or to a part {e.g., a fragment) thereof.

[0065] According to the present disclosure, the term " RNA" or " RNA molecule" relates to a molecule which comprises ribonucleotide residues and which is preferably entirely or substantially composed of ribonucleotide residues. The term "ribonucleotide" relates to a nucleotide with a hydroxyl group at the 2'-position of a p-D-ribofuranosyl group. The term " RNA" comprises double-stranded RNA, single stranded RNA, isolated RNA such as partially or completely purified RNA, essentially pure RNA, synthetic RNA, and recombinantly generated RNA such as modified RNA which differs from naturally occurring RNA by addition, deletion, substitution and / or alteration of one or more nucleotides.

[0066] " Fragment", with reference to a nucleic acid sequence, relates to a part of a nucleic acid sequence, i.e., a sequence which represents the nucleic acid sequence shortened at the 5'- and / or 3'-end(s). Preferably, a fragment of a nucleic acid sequence comprises at least 80%, preferably at least 90%, 95%, 96%, 97%, 98%, or 99% of the nucleotide residues from said nucleic acid sequence.

[0067] As used herein, a percent complementarity indicates the percentage of contiguous residues in a nucleic acid molecule that can form hydrogen bonds e.g., Watson-Crick base pairing) with a second nucleicacid sequence e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary). " Perfectly complementary" or "fully complementary" means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. Preferably, the degree of complementarity according to the disclosure is at least 70%, preferably at least 75%, preferably at least 80%, more preferably at least 85%, even more preferably at least 90% or most preferably at least 95%, 96%, 97%, 98% or 99%. Most preferably, the degree of complementarity according to the disclosure is 100%.

[0068] The term "derivative" comprises any chemical derivatization of a nucleic acid on a nucleotide base, on the sugar or on the phosphate. The term "derivative" also comprises nucleic acids which contain nucleotides and nucleotide analogs not occurring naturally.

[0069] A "nucleic acid sequence which is derived from a nucleic acid sequence" refers to a nucleic acid which is a variant of the nucleic acid from which it is derived. Preferably, a sequence which is a variant with respect to a specific sequence, when it replaces the specific sequence in an RNA molecule retains RNA stability and / or translational efficiency.

[0070] "nt" is an abbreviation for nucleotide; or for nucleotides, preferably consecutive nucleotides in a nucleic acid molecule.

[0071] According to the disclosure, the term "codon" refers to a base triplet in a coding nucleic acid that specifies which amino acid will be added next during protein synthesis at the ribosome.

[0072] "3' end of a nucleic acid” refers according to the disclosure to that end which has a free hydroxy group. In a diagrammatic representation of double-stranded nucleic acids, in particular DNA, the 3' end is always on the right-hand side. "5' end of a nucleic acid” refers according to the disclosure to that end which has a free phosphate group. In a diagrammatic representation of double-strand nucleic acids, in particular DNA, the 5' end is always on the left-hand side.

[0073] " Upstream" describes the relative positioning of a first element of a nucleic acid molecule with respect to a second element of that nucleic acid molecule, wherein both elements are comprised in the same nucleic acid molecule, and wherein the first element is located nearer to the 5' end of the nucleic acid molecule than the second element of that nucleic acid molecule. The second element is then said to be "downstream" of the first element of that nucleic acid molecule. An element that is located "upstream" of a second element can be synonymously referred to as being located "5"' of that second element. For a double-stranded nucleic acid molecule, indications like "upstream" and "downstream" are given with respect to the (+) strand.

[0074] According to the disclosure, the term "gene" refers to a particular nucleic acid sequence which is responsible for producing one or more cellular products and / or for achieving one or more intercellular or intracellular functions. More specifically, said term relates to a nucleic acid section (typically DNA; but also, RNA) which comprises a nucleic acid coding for a specific protein or a functional or structural RNA molecule.As used herein, "heterologous" or "exogenous" means derived from a genotypically distinct entity from that of the rest of the entity to which it is compared or into which it is introduced or incorporated. For example, a polynucleotide introduced by genetic engineering techniques into a different cell type is a heterologous polynucleotide (and, when expressed, can encode a heterologous polypeptide). Similarly, a cellular sequence {e.g., a gene or portion thereof) that is incorporated into a viral vector is a heterologous nucleotide sequence with respect to the vector.

[0075] Apdimer for the regulation of gene expression

[0076] Aptamers are single-stranded nucleic acid molecules that non-covalently bind to specific ligands with high affinity and specificity by folding into three-dimensional structures. Aptamer ligands include ions, small molecules, nucleic acids, nucleotides, amino acids, proteins, viruses, and cells.

[0077] The term "aptamer" as used herein refers to an RNA polynucleotide (or DNA sequence encoding the RNA polynucleotide) that specifically binds to a class of ligands. The term "ligand” refers to a molecule that is specifically bound by an aptamer. Aptamers have binding regions that are capable of forming complexes with an intended target molecule (i.e., the ligand). An aptamer will typically be between about 15 and about 200 nucleotides in length. More commonly, an aptamer will be between about 30 and about 100 nucleotides in length, for example, 70 to 90 nucleotides in length. Aptamers typically comprise multiple paired (P) regions in which the aptamer forms a stem and unpaired regions where the aptamer forms a joining (J) region or a loop (L) region. The paired regions can be numbered sequentially starting at the 5' end (Pl) and numbering each stem sequentially (P2, P3, etc.). The loops (LI, L2, etc.) are numbered based on the adjacent paired region and the joining regions are numbered according to the paired regions that they link {e.g., Jl-2 joins paired region Pl to paired region P2). As used herein, the term "apdimer" refers to an optimized aptamer that comprises two (parental) aptamers, each with a ligand-binding region linked or fused to each other, thus forming the apdimer, which apdimer is capable of binding to two individual ligands and which maintains or has improved control of target gene production, either transcriptionally or translationally, e.g., decreased base-level expression. For example, disclosed herein is a nucleic acid molecule comprising at least one modified aptamer (apdimer), which apdimer comprises (i) at least a portion of a first aptamer comprising a first ligand-binding region and (ii) at least a portion of a second aptamer comprising a second ligand-binding region, wherein the first and second ligand binding regions are positioned relative to each other such that when one of the ligand-binding regions binds to its ligand, the other ligand-binding region binds to its ligand in a positive cooperative manner. The structures of exemplary apdimers of the invention are depicted in Figure 19.

[0078] In some embodiments, the first aptamer can be positioned to the second aptamer through a fusion region. In some embodiments, the fusion region can form a stem structure through base pairing. In some embodiments, the fusion region can comprise a nucleotide sequence of at least 4 nucleotides capable of forming a stem structure of at least 2 nucleotides through base pairing. In some embodiments, the fusion region comprises at least a portion of the nucleotide sequence of a stemstructure of either the first aptamer or the second aptamer. In some embodiments, the fusion region replaces a closing loop of the proximal aptamer and / or any portion thereof is not single-stranded and / or does not contain any nucleotides that are not base paired with another nucleotide, though one or two mismatches are allowed in the base paired region.

[0079] In some embodiments, the fusion region can comprise (i) at least a portion of the nucleotide sequence of the Pl stem of the first aptamer, or (ii) at least a portion of the nucleotide sequence of the P2 stem of the first aptamer, or (iii) at least a portion of the nucleotide sequence of the Pl stem of the second aptamer, or (iv) at least a portion of the nucleotide sequence of the P2 stem of the second aptamer. In some embodiments, the fusion region can comprise (i) at least a portion of the nucleotide sequence of the Pl stem of the first aptamer and at least a portion of the nucleotide sequence of the Pl stem of the second aptamer, or (ii) at least a portion of the nucleotide sequence of the Pl stem of the first aptamer and at least a portion of the nucleotide sequence of the P2 stem of the second aptamer, or (iii) at least a portion of the nucleotide sequence of the P2 stem of the first aptamer and at least a portion of the nucleotide sequence of the Pl stem of the second aptamer, or (iv) at least a portion of the nucleotide sequence of the P2 stem of the first aptamer and at least a portion of the nucleotide sequence of the P2 stem of the second aptamer.

[0080] In some embodiments, the fusion region can comprise a heterologous linker sequence located between the first aptamer and the second aptamer. In some embodiments, the heterologous linker sequence is capable of forming a stem structure through base pairing. In the context of the fusion region, the heterologous linker sequence can comprise a nucleotide sequence that is not derived from either of the aptamer sequences comprising the apdimer. In some embodiments, the fusion region can further comprise a heterologous linker sequence capable of forming a stem structure through base pairing. In this context, the heterologous linker sequence is in addition to the sequences that are derived from either of the aptamer sequences comprising the apdimer.

[0081] In some embodiments, the stem structure formed by the linker can be between about 2 and about 30 nucleotides in length representing a total number of about 4 to about 60 nucleotides comprised within the nucleic acid. In some embodiments, the stem structure formed by the linker can be 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,15, 16, 17, 18, 19, 20, 21,22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length, i.e., "rungs on a ladder". It is to be understood that stem structures encompassed within the apdimers of the invention can comprise mismatches in the stem, i.e., the stem structure does not comprise an even number of base pairings e.g., 11 nucleotides forming 5 sets of base pairings (5 ladder rungs) with an unmatched nucleotide).

[0082] In some embodiments, the linker can be 1 nucleotide in length. In some embodiments, the linker can be 2 nucleotides in length. In some embodiments, the linker can be 3 nucleotides in length. In some embodiments, the linker can be 4 nucleotides in length. In some embodiments, the linker can be 5 nucleotides in length. In some embodiments, the linker can be 6 nucleotides in length. In some embodiments, the linker can be 7 nucleotides in length. In some embodiments, the linker can be 8nucleotides in length. In some embodiments, the linker can be 9 nucleotides in length. In some embodiments, the linker can be 10 nucleotides in length. In some embodiments, the linker can be 11 nucleotides in length. In some embodiments, the linker can be 12 nucleotides in length. In some embodiments, the linker can be 13 nucleotides in length. In some embodiments, the linker can be 14 nucleotides in length. In some embodiments, the linker can be 15 nucleotides in length.

[0083] In some embodiments, the stem structure formed by the linker can be between about 1 and about 5 or between about 3 and about 7 or between nucleotides in length. In some embodiments, the linker can connect the respective stem sequences of the first aptamer and the second aptamer.

[0084] In some embodiments, the first ligand-binding region and the second ligand-binding region are in a cis-conformation or in a fra / 7S-conformation within the apdimer. This is graphically depicted, for example, in Figure 19, wherein the loops of the individual aptamers are located on different sides of the three-dimensional structure of the apdimer.

[0085] In some embodiments, the apdimer can further comprise an effector region, which effector region undergoes an allosteric change in response to ligand binding to at least one of the ligand-binding regions. As is well understood by the skilled person, aptamers have two three-dimensional structures (allosteric states), one where ligand is bound and one where the ligand is not bound, such that binding of a ligand or unbinding of the ligand results in a change of the three-dimensional structure into the other, i.e., results in the allosteric change. The effector region effects its function in only one of the two three-dimensional structures. In some embodiments, the effector region can comprise a 5' splice site. In some embodiments, the effector region can comprise a 3' splice site. In some embodiments, the effector region can comprise a ribozyme. In some embodiments, the effector region can comprise a ribonuclease recognition sequence. In some embodiments, the effector region can comprise a poly A sequence, a U1 snRNA binding site, an internal ribosome entry site, a viral translation reinitiation site, an miRNA, an miRNA target site, a ribosomal frameshift sequence, or an mRNA stabilizing structure. Each of these types of effector regions will be "active" only when the effector region / apdimer is in one of the two three-dimensional structures formed by binding / not binding of the ligand.

[0086] In some embodiments, the ligand can be an ion, amino acid, peptide, small molecule ligand, nucleotide, or nucleic acid. Any ligand that can specifically bind an aptamer / apdimer is encompassed herein. In some embodiments, the nucleotide sequence of the at least portion of the first aptamer and / or the nucleotide sequence of the at least portion of the second aptamer can comprise one or more nucleotide additions, deletions or substitutions. In some embodiments, the apdimers as disclosed herein can be modified by varying the sequences of the stems, varying stem length, varying the sequences of the ligand-binding regions while maintaining the function of the apdimer in terms of (cooperative) ligand binding and control of target gene expression. Many such variations are already known in the art and can be introduced into the apdimers as disclosed herein. As is understood by the skilled person, apart from the sequences that bind the ligand, the particular sequence of the stem and loops regions are not necessarily essential to the aptamer / apdimer, but what is essential is the formation of the loops andstems to provide for the functional structure of the aptamer / apdimer such that upon ligand binding an allosteric change occurs allowing for the activation or inhibition of the effector region.

[0087] In some embodiments, the first ligand-binding region and the second ligand-binding region can bind to the same ligand. In some embodiments, the first ligand-binding region and the second ligand-binding region can bind to different ligands.

[0088] In some embodiments, ligand binding to one ligand-binding domain can affect the binding affinity of ligand binding to the other ligand-binding domain, for example, the binding affinity can be increased. In some embodiments, ligand binding to one ligand-binding domain can facilitate or stabilize ligand binding to the other ligand-binding domain. Cooperative binding, not just in the context of the apdimers of the invention, is well understood in the art and methods are known in the art to measure such cooperativity, as are described in Peselis et al., 2015, Cooperativity, allostery and synergism in ligand binding to riboswitches, Biochemie 117:100-109, the contents of which are incorporated by reference in their entirety herein, Stefan and Le Novere, 2013, Cooperative Binding, PLOS Computational Biology 9:6 el003106, the contents of which are incorporated by reference in their entirety herein, and / or in Jose et al., 2001, Cooperative binding of effectors by an allosteric ribozyme, Nucleic acids research 29:1631-1637, the contents of which are incorporated by reference in their entirety herein. Exemplary methods for determining cooperativity include the Hill equation, the Adair equation, the Klotz equation, the Pauling equation, the KNF model, and the MWC model.

[0089] Exemplary apdimers encompassed herein are depicted in the attached Figures and can comprise or consist of an RNA sequence set out in any of SEQ ID NOs: 2, 3, 4, 7, 8, 9, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 and 24. In some embodiments, the apdimer comprises or consists of the RNA sequence depicted in SEQ ID NOs: 2, 3, 4, 7, 8, 9, 12, 13, 19, 20, 21, and 22.

[0090] Aptamers are widely known in the art, including those that are appropriate for the control of target gene expression in vivo, e.g., in a subject in which a nucleic acid encoding the target gene under the control of an apdimer as disclosed herein. Any aptamer can be used to produce an apdimer of the invention and the selection of a particular aptamer is usually dependent on the ligand to be used for controlling expression of a target gene. In some embodiments, the apdimer of the invention comprises a tetracycline-responsive aptamer. In some embodiments, the apdimer of the invention binds tetracycline. In some embodiments, the apdimer comprises the nucleotide sequence set out in SEQ ID NO: 2, 3, 4, 7, 8, 9, 12, 13, 19, 20, 21, or 22. In some embodiments, the apdimer of the invention does not comprise an oxypurinol-responsive aptamer. In some embodiments, the apdimer of the invention does not bind oxypurinol. In some embodiments, the apdimer does not comprise a competing stem that reduces background expression due to splice-site masking in the absence of binding ligand. In some embodiments, an intronic splicing enhancer sequence and / or a naturally occurring G-quadruplex sequence is not located downstream of the apdimer.

[0091] In some embodiments, the apdimer disclosed herein is used for the regulation of gene expression, for example, as part of a riboswitch. Regulation of the expression of a target gene e.g., a therapeutictransgene) is advantageous in a variety of situations. In the context of the therapeutic expression of genes, for example, techniques that enable regulated expression of transgenes in response to the presence of a small molecule can enhance safety and efficacy by allowing for the regulation of the level of target gene expression and its timing. In a research setting, the regulation of gene expression allows a systematic investigation of different experimental conditions.

[0092] In some embodiments, the sequence encoding the riboswitch as described herein is part of a gene regulation cassette that provides the ability to regulate the expression level of a target gene in response to the presence or absence of the binding ligand of the apdimer. In embodiments, the gene regulation cassette further comprises a target gene. As used herein, "target gene" refers to a transgene that is expressed in response to the presence or absence of the ligand due to the ligand binding to the apdimer disclosed herein.

[0093] In some embodiments, the target gene comprises the coding sequence for a protein e.g., a therapeutic protein), a miRNA, or a siRNA. The target gene is heterologous to the apdimer used for the regulation of target gene expression, is heterologous to the polynucleotide cassette used for the regulation of target gene and / or is heterologous to a portion of the polynucleotide cassette used for the regulation of target gene.

[0094] The terms "gene regulation cassette", "regulatory cassette", "polynucleotide cassette" "expression cassette" or "expression platform" are used interchangeably herein.

[0095] In some embodiments, the presence of a small molecule ligand ("small molecule", "ligand" "binding ligand" and "small molecule ligand" are used interchangeably herein) that binds to an apdimer as disclosed herein leads to an increase in expression of a target gene as compared to the expression of the target gene in absence of the small molecule. In such an embodiment, the apdimer constitutes an "on" switch. In embodiments, the expression of the target gene is increased by at least 3-fold, by at least 5-fold, by at least 10-fold, by at least 15-fold, by at least 20-fold, by at least 25-fold, by at least 30-fold, by at least 40-fold, by at least 50-fold, by at least 100-fold, by at least 1000-fold, or by at least 10,000-fold in presence of the small molecule that binds to an apdimer as disclosed herein as compared to in absence of the small molecule. In embodiments, the expression of the target gene is increased by between 2-fold and 10-fold, between 5-fold and 10-fold, between 5-fold and 15-fold, between 5-fold and 20-fold, between 5-fold and 25-fold, between 5-fold and 30-fold, between 10-fold and 20-fold, between 10-fold and 30-fold, between 10-fold and 40-fold, between 10-fold and 50-fold, between 10-fold and 100-fold, between 10-fold and 500-fold, between 10-fold and 1,000-fold, between 50-fold and 100-fold, between 50-fold and 500-fold, between 50-fold and 100-fold, between 50-fold and 1,000-fold, between 100-fold and 1,000-fold, or between 100-fold and 10,000-fold in presence of the small molecule that binds to an apdimer as disclosed herein as compared to in absence of the small molecule.

[0096] In some embodiments, the presence of a small molecule that binds to an apdimer as disclosed herein leads to a decrease in expression of a target gene as compared to the expression of the target gene in the absence of the small molecule. In such embodiments, the apdimer constitutes an "off' switch. Inembodiments, the expression of the target gene is decreased by at least 3-fold, by at least 5-fold, by at least 10-fold, by at least 15-fold, by at least 20-fold, by at least 25-fold, by at least 30-fold, by at least 40-fold, by at least 50-fold, by at least 100-fold, by at least 1000-fold, or by at least 10,000-fold in presence of the small molecule that binds to an apdimer as disclosed herein as compared to in absence of the small molecule. In one embodiment, the expression of the target gene is decreased by between 2-fold and 10-fold, between 5-fold and 10-fold, between 5-fold and 15-fold, between 5-fold and 20-fold, between 5-fold and 25-fold, between 5-fold and 30-fold, between 10-fold and 20-fold, between 10-fold and 30-fold, between 10-fold and 40-fold, between 10-fold and 50-fold, between 10-fold and 100-fold, between 10-fold and 500-fold, between 10-fold and 1,000-fold, between 50-fold and 100-fold, between 50-fold and 500-fold, between 50-fold and 100-fold, between 50-fold and 1,000-fold, between 100-fold and 1,000-fold, or between 100-fold and 10,000-fold in presence of the small molecule that binds to an apdimer as disclosed herein as compared to in absence of the small molecule.

[0097] Apdimer (aptamer) ligands include ions, small molecules, nucleic acids, nucleotides, amino acids, proteins, viruses, and cells. Apdimer ligands can be, for example, an organic compound, amino acid, steroid, carbohydrate, or nucleotide. Non-limiting examples of small molecule apdimer ligands include antibiotics, therapeutics, dyes, cofactors, metabolites, molecular markers, neurotransmitters, pollutants, toxins, food adulterants, carcinogens, drugs of abuse. In some embodiments, the apdimer ligand is theophylline or tetracycline. In some embodiments, the ligand is suitable for administration to a subject. In some embodiments, an apdimer comprises (i) at least a portion of a first aptamer comprising a first ligand-binding region and (ii) at least a portion of a second aptamer comprising a second ligand-binding region, wherein the first and second ligand binding regions are positioned relative to each other such that when one of the ligand-binding regions binds to its ligand, the other ligand-binding region binds to its ligand in a positive cooperative manner, wherein the first aptamer is positioned to the second aptamer through a fusion region which forms a stem structure through base pairing and wherein the first and second binding regions bind to the same ligand.

[0098] Riboswitch

[0099] In some embodiments, an apdimer as disclosed herein is part of a riboswitch. Riboswitches are regulatory segments of an RNA polynucleotide that regulate the stability of the RNA polynucleotide and / or regulate the production of a protein from the RNA polynucleotide in response to the presence or absence of aptamer(apdimer)-specific ligands.

[0100] In some embodiments, a riboswitch of the invention for the regulation of the expression of a target gene can comprise a nucleic acid comprising at least one modified aptamer (apdimer), which apdimer comprises (i) at least a portion of a first aptamer comprising a first ligand-binding region, (ii) at least a portion of a second aptamer comprising a second ligand-binding region, wherein the first and second ligand binding regions are positioned relative to each other such that when one of the ligand-binding regions binds to its ligand, the other ligand-binding region binds to its ligand in a positive cooperative manner, and (iii) an effector region, which effector region undergoes an allosteric change in responseto ligand binding to at least one of the ligand-binding regions. The apdimer and the effector region comprised within a riboswitch together are responsible for sensing the presence of a ligand {e.g., a small molecule) and causing an effect that leads to increased or decreased expression of a target gene. The riboswitches described herein are recombinant, utilizing polynucleotides from two or more sources. The term "synthetic" as used herein in the context of a riboswitch refers to a riboswitch that is not naturally occurring. In some embodiments, the sensor e.g., apdimer) and effector region are joined by a polynucleotide linker. In some embodiments, the polynucleotide linker forms an RNA stem {i.e., a region of the RNA polynucleotide that is double-stranded).

[0101] In some embodiments of the riboswitch of the invention, the first aptamer can be positioned to the second aptamer through a fusion region. In some embodiments of the riboswitch of the invention, the fusion region can form a stem structure through base pairing. In some embodiments of the riboswitch of the invention, the fusion region can comprise a nucleotide sequence of at least 4 nucleotides capable of forming a stem structure of at least 2 nucleotides through base pairing. In some embodiments of the riboswitch of the invention, the fusion region comprises at least a portion of the nucleotide sequence of a stem structure of either the first aptamer or the second aptamer.

[0102] In some embodiments of the riboswitch of the invention, the fusion region can comprise (i) at least a portion of the nucleotide sequence of the Pl stem of the first aptamer, or (ii) at least a portion of the nucleotide sequence of the P2 stem of the first aptamer, or (iii) at least a portion of the nucleotide sequence of the Pl stem of the second aptamer, or (iv) at least a portion of the nucleotide sequence of the P2 stem of the second aptamer. In some embodiments of the riboswitch of the invention, the fusion region can comprise (i) at least a portion of the nucleotide sequence of the Pl stem of the first aptamer and at least a portion of the nucleotide sequence of the Pl stem of the second aptamer, or (ii) at least a portion of the nucleotide sequence of the Pl stem of the first aptamer and at least a portion of the nucleotide sequence of the P2 stem of the second aptamer, or (iii) at least a portion of the nucleotide sequence of the P2 stem of the first aptamer and at least a portion of the nucleotide sequence of the Pl stem of the second aptamer, or (iv) at least a portion of the nucleotide sequence of the P2 stem of the first aptamer and at least a portion of the nucleotide sequence of the P2 stem of the second aptamer. In some embodiments of the riboswitch of the invention, the fusion region can comprise a heterologous linker sequence located between the first aptamer and the second aptamer. In some embodiments of the riboswitch of the invention, the heterologous linker sequence is capable of forming a stem structure through base pairing. In the context of the fusion region, the heterologous linker sequence can comprise a nucleotide sequence that is not derived from either of the aptamer sequences comprising the apdimer. In some embodiments of the riboswitch of the invention, the fusion region can further comprise a heterologous linker sequence capable of forming a stem structure through base pairing. In this context, the heterologous linker sequence is in addition to the sequences that are derived from either of the aptamer sequences comprising the apdimer.In some embodiments of the riboswitch of the invention, the stem structure formed by the linker can be between about 2 and about 30 nucleotides in length representing a total number of about 4 to about 60 nucleotides comprised within the nucleic acid. In some embodiments, the stem structure formed by the linker can be 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,15, 16, 17, 18, 19, 20, 21,22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length, i.e., "rungs on a ladder". It is to be understood that stem structures encompassed within the apdimers of the invention can comprise mismatches in the stem, i.e., the stem structure does not comprise an even number of base pairings e.g., 11 nucleotides forming 5 sets of base pairings (5 ladder rungs) with an unmatched nucleotide).

[0103] In some embodiments of the riboswitch of the invention, the linker can be 1 nucleotide in length. In some embodiments of the riboswitch of the invention, the linker can be 2 nucleotides in length. In some embodiments of the riboswitch of the invention, the linker can be 3 nucleotides in length. In some embodiments of the riboswitch of the invention, the linker can be 4 nucleotides in length. In some embodiments of the riboswitch of the invention, the linker can be 5 nucleotides in length. In some embodiments of the riboswitch of the invention, the linker can be 6 nucleotides in length. In some embodiments of the riboswitch of the invention, the linker can be 7 nucleotides in length. In some embodiments of the riboswitch of the invention, the linker can be 8 nucleotides in length. In some embodiments of the riboswitch of the invention, the linker can be 9 nucleotides in length. In some embodiments of the riboswitch of the invention, the linker can be 10 nucleotides in length. In some embodiments of the riboswitch of the invention, the linker can be 11 nucleotides in length. In some embodiments of the riboswitch of the invention, the linker can be 12 nucleotides in length. In some embodiments of the riboswitch of the invention, the linker can be 13 nucleotides in length. In some embodiments of the riboswitch of the invention, the linker can be 14 nucleotides in length. In some embodiments of the riboswitch of the invention, the linker can be 15 nucleotides in length.

[0104] In some embodiments of the riboswitch of the invention, the stem structure formed by the linker can be between about 1 and about 5 or between about 3 and about 7 or between nucleotides in length. In some embodiments of the riboswitch of the invention, the linker can connect the respective stem sequences of the first aptamer and the second aptamer.

[0105] In some embodiments of the riboswitch of the invention, the first ligand-binding region and the second ligand-binding region are in a cis-conformation or in a trans-conformation within the apdimer. This is graphically depicted, for example, in Figure 19, wherein the loops of the individual aptamers are located on different sides of the three-dimensional structure of the apdimer.

[0106] In some embodiments of the riboswitch of the invention, the apdimer can further comprise an effector region, which effector region undergoes an allosteric change in response to ligand binding to at least one of the ligand-binding regions. As is well understood by the skilled person, aptamers have two three-dimensional structures (allosteric states), one where ligand is bound and one where the ligand is not bound, such that binding of a ligand or unbinding of the ligand results in a change of the three-dimensional structure into the other, i.e., results in the allosteric change. The effector region effects itsfunction in only one of the two three-dimensional structures. In some embodiments, the effector region can comprise a 5' splice site. In some embodiments of the riboswitch of the invention, the effector region can comprise a 3' splice site. In some embodiments of the riboswitch of the invention, the effector region can comprise a ribozyme. In some embodiments of the riboswitch of the invention, the effector region can comprise a ribonuclease recognition sequence. In some embodiments of the riboswitch of the invention, the effector region can comprise a poly A sequence, a U1 snRNA binding site, an internal ribosome entry site, a viral translation reinitiation site, an miRNA, an miRNA target site, a ribosomal frameshift sequence, or an mRNA stabilizing structure. Each of these types of effector regions will be "active" only when the effector region / apdimer is in one of the two three-dimensional structures formed by binding / not binding of the ligand.

[0107] In some embodiments of the riboswitch of the invention, the ligand can be an ion, amino acid, peptide, small molecule ligand, nucleotide, or nucleic acid. Any ligand that can specifically bind an aptamer / apdimer is encompassed herein.

[0108] In some embodiments of the riboswitch of the invention, the nucleotide sequence of the at least portion of the first aptamer and / or the nucleotide sequence of the at least portion of the second aptamer can comprise one or more nucleotide additions, deletions or substitutions. In some embodiments of the riboswitch of the invention, the apdimers as disclosed herein can be modified by varying the sequences of the stems, varying stem length, varying the sequences of the ligand-binding regions while maintaining the function of the apdimer in terms of (cooperative) ligand binding and control of target gene expression. Many such variations are already known in the art and can be introduced into the apdimers as disclosed herein. As is understood by the skilled person, apart from the sequences that bind the ligand, the particular sequence of the stem and loops regions are not necessarily essential to the aptamer / apdimer, but what is essential is the formation of the loops and stems to provide for the functional structure of the aptamer / apdimer such that upon ligand binding an allosteric change occurs allowing for the activation or inhibition of the effector region.

[0109] In some embodiments of the riboswitch of the invention, the first ligand-binding region and the second ligand-binding region can bind to the same ligand. In some embodiments, the first ligand-binding region and the second ligand-binding region can bind to different ligands.

[0110] In some embodiments of the riboswitch of the invention, ligand binding to one ligand-binding domain can affect the binding affinity of ligand binding to the other ligand-binding domain, for example, the binding affinity can be increased. In some embodiments of the riboswitch of the invention, ligand binding to one ligand-binding domain can facilitate or stabilize ligand binding to the other ligand-binding domain. Cooperative binding, not just in the context of the apdimers of the invention, is well understood in the art and methods are known in the art to measure such cooperativity, as are described in Peselis et al., 2015, Cooperativity, allostery and synergism in ligand binding to riboswitches, Biochemie 117:100-109, the contents of which are incorporated by reference in their entirety herein, Stefan and Le Novere, 2013, Cooperative Binding, PLOS Computational Biology 9:6 el003106, the contents of which areincorporated by reference in their entirety herein, and / or in Jose et al., 2001, Cooperative binding of effectors by an allosteric ribozyme, Nucleic acids research 29:1631-1637, the contents of which are incorporated by reference in their entirety herein. Exemplary methods for determining cooperativity include the Hill equation, the Adair equation, the Klotz equation, the Pauling equation, the KNF model, and the MWC model.

[0111] Exemplary apdimers encompassed herein are depicted in the attached Figures and can comprise or consist of an RNA sequence set out in any of SEQ ID NOs: 2, 3, 4, 7, 8, 9, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 and 24. In some embodiments of the riboswitch of the invention, the apdimer comprises or consists of the RNA sequence depicted in SEQ ID NOs: 2, 3, 4, 7, 8, 9, 12, 13, 19, 20, 21, and 22.

[0112] Aptamers are widely known in the art, including those that are appropriate for the control of target gene expression in vivo, e.g., in a subject in which a nucleic acid encoding the target gene under the control of an apdimer as disclosed herein. Any aptamer can be used to produce an apdimer of the invention and the selection of a particular aptamer is usually dependent on the ligand to be used for controlling expression of a target gene. In some embodiments of the riboswitch of the invention, the apdimer of the invention comprises a tetracycline-responsive aptamer. In some embodiments of the riboswitch of the invention, the apdimer of the invention binds tetracycline. In some embodiments of the riboswitch of the invention, the apdimer comprises the nucleotide sequence set out in SEQ ID NO: 2, 3, 4, 7, 8, 9, 12, 13, 19, 20, 21, or 22. In some embodiments of the riboswitch of the invention, the apdimer of the invention does not comprise an oxypurinol-responsive aptamer. In some embodiments of the riboswitch of the invention, the apdimer of the invention does not bind oxypurinol. In some embodiments of the riboswitch of the invention, the apdimer does not comprise a competing stem that reduces background expression due to splice-site masking in the absence of binding ligand. In some embodiments of the riboswitch of the invention, an intronic splicing enhancer sequence and / or a naturally occurring G-quadruplex sequence is not located downstream of the apdimer.

[0113] In some embodiments, the riboswitch of the invention comprises (A) an apdimer comprising (i) at least a portion of a first aptamer comprising a first ligand-binding region; (ii) at least a portion of a second aptamer comprising a second ligand-binding region, wherein the first and second ligand binding regions are positioned relative to each other such that when one of the ligand-binding regions binds to its ligand, the other ligand-binding region binds to its ligand in a positive cooperative manner, wherein the first aptamer is positioned to the second aptamer through a fusion region which forms a stem structure through base pairing and wherein the first and second binding regions bind to the same ligand; and (B) an effector region, which effector region undergoes an allosteric change in response to ligand binding to at least one or all of the binding regions.

[0114] In some embodiments, the sequence encoding the riboswitch as described herein is part of a gene regulation cassette that provides the ability to regulate the expression level of a target gene in response to the presence or absence of the binding ligand of the apdimer. In embodiments of the riboswitch ofthe invention, the gene regulation cassette further comprises a target gene. As used herein, "target gene" refers to a transgene that is expressed in response to the presence or absence of the ligand due to the ligand binding to the apdimer disclosed herein.

[0115] In some embodiments of the riboswitch of the invention, the target gene comprises the coding sequence for a protein e.g., a therapeutic protein), a miRNA, or a siRNA. The target gene is heterologous to the apdimer used for the regulation of target gene expression, is heterologous to the polynucleotide cassette used for the regulation of target gene and / or is heterologous to a portion of the polynucleotide cassette used for the regulation of target gene.

[0116] The terms "gene regulation cassette", "regulatory cassette", "polynucleotide cassette" "expression cassette" or "expression platform" are used interchangeably herein.

[0117] In some embodiments of the riboswitch of the invention, the presence of a small molecule ligand ("small molecule", "ligand" "binding ligand" and "small molecule ligand" are used interchangeably herein) that binds to an apdimer as disclosed herein leads to an increase in expression of a target gene as compared to the expression of the target gene in absence of the small molecule. In such an embodiment, the apdimer constitutes an "on" switch. In embodiments, the expression of the target gene is increased by at least 3-fold, by at least 5-fold, by at least 10-fold, by at least 15-fold, by at least 20-fold, by at least 25-fold, by at least 30-fold, by at least 40-fold, by at least 50-fold, by at least 100-fold, by at least 1000-fold, or by at least 10,000-fold in presence of the small molecule that binds to an apdimer as disclosed herein as compared to in absence of the small molecule. In some embodiments of the riboswitch of the invention, the expression of the target gene is increased by between 2-fold and 10-fold, between 5-fold and 10-fold, between 5-fold and 15-fold, between 5-fold and 20-fold, between 5-fold and 25-fold, between 5-fold and 30-fold, between 10-fold and 20-fold, between 10-fold and 30-fold, between 10-fold and 40-fold, between 10-fold and 50-fold, between 10-fold and 100-fold, between 10-fold and 500-fold, between 10-fold and 1,000-fold, between 50-fold and 100-fold, between 50-fold and 500-fold, between 50-fold and 100-fold, between 50-fold and 1,000-fold, between 100-fold and 1,000-fold, or between 100-fold and 10,000-fold in presence of the small molecule that binds to an apdimer as disclosed herein as compared to in absence of the small molecule.

[0118] In some embodiments of the riboswitch of the invention, the presence of a small molecule that binds to an apdimer as disclosed herein leads to a decrease in expression of a target gene as compared to the expression of the target gene in the absence of the small molecule. In such embodiments, the apdimer constitutes an "off' switch. In embodiments, the expression of the target gene is decreased by at least 3-fold, by at least 5-fold, by at least 10-fold, by at least 15-fold, by at least 20-fold, by at least 25-fold, by at least 30-fold, by at least 40-fold, by at least 50-fold, by at least 100-fold, by at least 1000-fold, or by at least 10,000-fold in presence of the small molecule that binds to an apdimer as disclosed herein as compared to in absence of the small molecule. In some embodiments of the riboswitch of the invention, the expression of the target gene is decreased by between 2-fold and 10-fold, between 5-fold and 10-fold, between 5-fold and 15-fold, between 5-fold and 20-fold, between 5-fold and 25-fold,between 5-fold and 30-fold, between 10-fold and 20-fold, between 10-fold and 30-fold, between 10-fold and 40-fold, between 10-fold and 50-fold, between 10-fold and 100-fold, between 10-fold and 500-fold, between 10-fold and 1,000-fold, between 50-fold and 100-fold, between 50-fold and 500-fold, between 50-fold and 100-fold, between 50-fold and 1,000-fold, between 100-fold and 1,000-fold, or between 100-fold and 10,000-fold in presence of the small molecule that binds to an apdimer as disclosed herein as compared to in absence of the small molecule.

[0119] Apdimer (aptamer) ligands include ions, small molecules, nucleic acids, nucleotides, amino acids, proteins, viruses, and cells. Apdimer ligands can be, for example, an organic compound, amino acid, steroid, carbohydrate, or nucleotide. Non-limiting examples of small molecule apdimer ligands include antibiotics, therapeutics, dyes, cofactors, metabolites, molecular markers, neurotransmitters, pollutants, toxins, food adulterants, carcinogens, drugs of abuse. In some embodiments, the apdimer ligand is theophylline or tetracycline. In some embodiments, the ligand is suitable for administration to a subject.

[0120] Apdimer-mediated modulation of splicing

[0121] Provided herein are nucleic acids and methods for regulating the expression of a gene of interest by alternative splicing. The alternative splicing riboswitch comprises an alternatively-spliced exon, flanked by 5' and 3' introns, and a riboswitch comprising an apdimer as disclosed herein. The apdimers as disclosed herein can be encoded as part of a gene regulation cassette for the regulation of target gene expression by apdimer / ligand mediated alternative splicing of the resulting RNA (e.g., pre-mRNA). In this context, the gene regulation cassette comprises a riboswitch comprising at least one apdimer as disclosed herein and an effector region that together are responsible for sensing the presence of a small molecule ligand and altering splicing to an alternative exon. Splicing refers to the process by which an intronic sequence is removed from the nascent pre-messenger RNA (pre-mRNA) and the exons are joined together to form the mRNA. Splice sites are junctions between exons and introns and are defined by different consensus sequences at the 5' and 3' ends of the intron (i.e., the splice donor and splice acceptor sites, respectively). Splicing is carried out by a large multi-component structure called the spliceosome, which is a collection of small nuclear ribonucleoproteins (snRNPs) and a diverse array of auxiliary proteins. By recognizing various cis regulatory sequences, the spliceosome defines exon / intron boundaries, removes intronic sequences, and splices together the exons into a final message (e.g., the mRNA). In the case of alternative splicing, certain exons can be included or excluded to vary the final coding message thereby changing the resulting expressed protein.

[0122] In some embodiments, the polynucleotide cassette comprises (a) a riboswitch and (b) an alternatively-spliced exon, flanked by a 5' intron and a 3' intron, wherein the riboswitch comprises (i) an effector region comprising a stem forming sequence that includes the 5' splice site sequence of the 3' intron (and sequence complementary thereto), and (ii) an apdimer as disclosed herein. In embodiments, the effector region is a stem forming region that forms the Pl stem of the first ligand-binding region of an apdimer as disclosed herein. In other words, the effector stem comprises a first sequence that is linked to the 5' end of an apdimer as disclosed herein and a second sequence that is linked to the 3' end ofthe apdimer, wherein the first or second sequence includes the 5' splice site sequence of the 3' intron and the other includes sequence complementary to the 5' splice site sequence of the 3' intron. In embodiments, the effector region comprises the intronic 5' splice site ("5' ss") sequence of the intron that is immediately 3' of the alternative exon, as well as the sequence complementary to the 5' ss sequence of the 3' intron.

[0123] In one embodiment, the polynucleotide construct comprises a sequence encoding from 5' to 3':

[0124] (a) a first intron;

[0125] (b) an alternatively-spliced exon; and

[0126] (c) a second intron comprising a riboswitch disclosed herein, wherein the riboswitch comprises an effector region and an apdimer as disclosed herein, wherein the riboswitch comprises from 5' to 3': (i) a 5' splice site sequence of the second intron; (ii) the apdimer sequence; and (iii) a sequence that is complementary to the 5' splice site sequence of the second intron;

[0127] wherein the 5' splice site sequence of the second intron and the sequence that is complementary to the 5' splice site sequence of the second intron are capable of forming a stem;

[0128] wherein the alternatively-spliced exon comprises a stop codon that is in-frame with a target gene, when the alternatively-spliced exon is spliced into the target gene mRNA.

[0129] 5' splice site sequences (Ze., the splice site sequence located at the 5' end of an intron) are well known in the art. There is some variability among different 5' splice site sequences, and this variability is also well understood in the art. For example, Shapiro and Senapathy (Shapiro MB, Senapathy P. RNA splice junctions of different classes of eukaryotes: sequence statistics and functional implications in gene expression. Nucleic Acids Res. 1987 Sep ll;15(17):7155-74 or Zhang MQ. Statistical features of human exons and their flanking regions. Hum Mol Genet.1998 May; 7(5):919-32 describe for a variety of eukaryotes which positions of the splice site sequence have some variability, and which positions are fixed. Likewise, Zhang (Zhang MQ. Statistical features of human exons and their flanking regions. Hum Mol Genet. 1998 May;7(5):919-32 also shows which positions of the splice site sequence may have some variability, and which positions are fixed. As such, a person skilled in the art can easily recognize a splice site sequence based on the known consensus sequence and based on its location relative to the exon / intron boundary. Exemplary splice site sequences include, but are not limited to: A G G || G T G A G T; A A A || G T A A G C; G C A || G T A A G T; G A G || G T G T G G; A / C A G || G T A / G A G T; N A G || G T A / G A G T; N A G || G T A A G T; A / C A / T G || G T A N G T; and N A G / A || G T A A G T (where 11 denotes the exon / intron boundary and N represents A, G, C, or T).

[0130] When the apdimer binds its ligand(s), the effector region forms a stem and thus prevents splicing to the splice donor site at the 3' end of the alternative exon. Under certain conditions (for example, when the apdimer is not bound to its ligand), the effector region is in a context that provides access to the splice donor site at the 3' end of the alternative exon, leading to inclusion of the alternative exon in the target gene mRNA. In some embodiments, the polynucleotide cassette is placed in the target gene toregulate expression of the target gene in response to a ligand. In one embodiment, the alternatively-spliced exon comprises a stop codon that is in-frame with the target gene when the alternatively-spliced exon is spliced into the target gene mRNA.

[0131] In one embodiment, the gene regulation cassette comprises the sequence of SEQ ID NO: 2. In one embodiment, the gene regulation cassette comprises the sequence of SEQ ID NO: 3. In one embodiment, the gene regulation cassette comprises the sequence of SEQ ID NO: 4. In one embodiment, the gene regulation cassette comprises the sequence of SEQ ID NO: 7. In one embodiment, the gene regulation cassette comprises the sequence of SEQ ID NO: 8. In one embodiment, the gene regulation cassette comprises the sequence of SEQ ID NO: 9. In one embodiment, the gene regulation cassette comprises the sequence of SEQ ID NO: 12. In one embodiment, the gene regulation cassette comprises the sequence of SEQ ID NO: 13. In one embodiment, the gene regulation cassette comprises the sequence of SEQ ID NO: 19. In one embodiment, the gene regulation cassette comprises the sequence of SEQ ID NO: 20. In one embodiment, the gene regulation cassette comprises the sequence of SEQ ID NO: 21. In one embodiment, the gene regulation cassette comprises the sequence of SEQ ID NO: 22.

[0132] The alternative exon is flanked by 5' and 3' intronic sequences. The 5' and 3' intronic sequences that can be used in the gene regulation cassettes disclosed herein can be any sequence that can be spliced out of the target gene creating either the target gene mRNA or the target gene mRNA comprising the alternative exon mRNA, depending upon the presence or absence of a ligand(s) that binds the apdimer. The 5' and 3' intronic sequences each have the sequences necessary for splicing to occur, i.e., splice donor, splice acceptor and branch point sequences. In one embodiment, the 5' and 3' intronic sequences of the gene regulation cassette are derived from one or more naturally occurring introns or portions thereof. In one embodiment, the 5' and 3' intronic sequences are derived from a truncated human betaglobin intron 2 (IVS2A), from intron 2 of the human [3-globin gene, from the SV40 mRNA intron (used in pCMV-LacZ vector from Clontech Laboratories, Inc.), from intron 6 of human triose phosphate isomerase (TPI) gene (Nott Ajit, et al. RNA.2003, 9:6070617), from an intron from human factor IX (Sumiko Kurachi, et al. J. Bio. Chem.1995, 270(10), 5276), from the target gene's own endogenous intron, or from any genomic fragment or synthetic introns (Yi Lai, etal. Hum Gene Ther.2006: 17(10): 1036) that contain elements that are sufficient for regulated splicing (Thomas A. Cooper, Methods 2005 (37):331).

[0133] In one embodiment, the alternative exon and riboswitch are engineered to be in an endogenous intron of a target gene. That is, the intron (or a substantially similar intronic sequence) naturally occurs at that position of the target gene. In this case, the intronic sequence immediately upstream of the alternative exon is referred to as the 5' intron or 5' intronic sequence, and the intronic sequence immediately downstream of the alternative exon is referred to as the 3' intron or 3' intronic sequence. In this case, the endogenous intron is modified to contain a splice acceptor sequence and splice donor sequence flanking the 5' and 3' ends of the alternative exon. In one embodiment, the 5' and / or 3' introns are exogenous to the target gene.The splice donor and splice acceptor sites in the alternative splicing gene regulation cassette can be modified to be strengthened or weakened. That is, the splice sites can be modified to be closer to the consensus for a splice donor or acceptor by standard cloning methods, site directed mutagenesis, and the like. Splice sites that are more similar to the splice consensus tend to promote splicing and are thus strengthened. Splice sites that are less similar to the splice consensus tend to hinder splicing and are thus weakened. The consensus for the splice donor of the most common class of introns (U2) is A / C A G||G T A / G A G T (where || denotes the exon / intron boundary). The consensus for the splice acceptor is C A G||G (where || denotes the exon / intron boundary). The frequency of particular nucleotides at the splice donor and acceptor sites are described in the art (see, e.g., Zhang, M. Q., Hum Mol Genet. 1988, 7(5):919-932). The strength of 5' and 3' splice sites can be adjusted to modulate splicing of the alternative exon.

[0134] Additional modifications to 5' and 3' introns present in the alternative splicing gene regulation cassette that can be made to modulate splicing include modifying, deleting, and / or adding intronic splicing enhancer elements, intronic splicing suppressor elements and / or splice sites, and / or modifying the branch site sequence.

[0135] In some embodiments, the 5' intron has been modified to contain a stop codon that will be in frame with the target gene. The 5' and 3' intronic sequences can also be modified to remove cryptic slice sites, which can be identified with publicly available software (see, e.g., Kapustin, Y. etal. Nucl. Acids Res.2011.1-8).

[0136] The lengths of the 5' and 3' intronic sequences can be adjusted in order to, for example, meet the size requirements for viral expression constructs. In one embodiment, the 5' and / or 3' intronic sequences are about 50 to about 300 nucleotides in length. In one embodiment, the 5' and / or 3' intronic sequences are about 125 to about 240 nucleotides in length.

[0137] The relevant stem portion of the effector region should be of a sufficient length (and GC content) to substantially prevent alternative splicing of the alternative exon upon ligand binding the apdimer, while also allowing access to the splice site when the ligand is not present in sufficient quantities. In embodiments, the stem portion of the effector region comprises a stem sequence in addition to the 5' splice site sequence of the 3' intron and its complementary sequence of the 5' splice site sequence. In embodiments, this additional stem sequence comprises a sequence from the relevant stem. The length and sequence of the stem portion can be modified using known techniques in order to identify stems that allow acceptable background expression of the target gene when no ligand is present and acceptable expression levels of the target gene when the ligand is present.

[0138] In some embodiments, the effector region stem of the riboswitch is about 7 to about 20, about 7 to about 19, about 7 to about 18, about 7 to about 17, about 7 to about 16, about 7 to about 15, about 7 to about 14, about 7 to about 13, or about 7 to about 12 base pairs in length. In one embodiment, the effector region stem is 8 to 13 base pairs in length. In one embodiment, the effector region stem is 8 to 12 base pairs in length. In one embodiment, the effector region stem is 8 to 11 base pairs in length.In one embodiment, the stem has a length of about 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 base pairs. In addition to the length of the stem, the GC base pair content of the stem can be altered to modify the stability of the stem.

[0139] In some embodiments, the 5' splice site sequence of the second intron (Ze., the intron that is 3' of the alternative exon) and the sequence that is complementary to the 5' splice site sequence of the second intron may form a stem that may comprise additional stem forming sequence (together the (the effector region stem). In embodiments, this stem forming sequence is about 7 to about 20, about 7 to about 19, about 7 to about 18, about 7 to about 17, about 7 to about 16, about 7 to about 15, about 7 to about 14, about 7 to about 13, or about 7 to about 12 base pairs in length. In one embodiment, the region stem is 8 to 13 base pairs in length. In one embodiment, the stem is 8 to 12 base pairs in length. In one embodiment, the stem is 8 to 11 base pairs in length. In one embodiment, the stem has a length of about 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 base pairs. In addition to the length of the stem, the GC base pair content of the stem can be altered to modify the stability of the stem.

[0140] The alternative exon that is part of the alternative splicing gene regulation cassettes disclosed herein is any polynucleotide sequence capable of being transcribed to a pre-mRNA and alternatively spliced into the mRNA of the target gene. In one embodiment, the alternative exon contains at least one sequence that inhibits translation such that when the alternative exon is included in the target gene mRNA, expression of the target gene from that mRNA is prevented or reduced. In a preferred embodiment, the alternative exon contains a stop codon (TGA, TAA, TAG) that is in frame with the target gene when the alternative exon is included in the target gene mRNA by splicing. In embodiments, the alternative exon comprises, in addition to a stop codon, or as an alternative to a stop codon, another sequence that reduces or substantially prevents translation when the alternative exon is incorporated by splicing into the target gene mRNA including, e.g., a microRNA binding site, which leads to degradation of the mRNA. In one embodiment, the alternative exon comprises a miRNA binding sequence that results in degradation of the mRNA. In one embodiment, the alternative exon encodes a polypeptide sequence which reduces the stability of the protein containing this polypeptide sequence. In one embodiment, the alternative exon encodes a polypeptide sequence which directs the protein containing this polypeptide sequence for degradation.

[0141] The basal or background level of splicing of the alternative exon can be optimized by altering exon splice enhancer (ESE) sequences and exon splice suppressor (ESS) sequences and / or by introducing ESE or ESS sequences into the alternative exon. Such changes to the sequence of the alternative exon can be accomplished using methods known in the art, including, but not limited to site directed mutagenesis. Alternatively, oligonucleotides of a desired sequence {e.g., comprising all or part of the alternative exon) can be obtained from ESE sequences can be accomplished by methods known in the art, including, for example using ESEfinder 3.0 (Cartegni, L. et al. ESEfinder: a web resource to identify exonic splicing enhancers. Nucleic Acid Research, 2003, 31(13): 3568-3571) and / or other available resources.In some embodiments, the alternative exon is a naturally-occurring exon. In other embodiments, the alternative exon is derived from all or part of a known exon. In this context, "derived" refers to the alternative exon containing sequence that is substantially homologous to a naturally occurring exon, or a portion thereof, but may contain various mutations, such as mutations generated by altering exon splice enhancer (ESE) sequences and exon splice suppressor (ESS) sequences and / or by introducing ESE or ESS sequences into the alternative exon. " Homology" and "homologous" as used herein refer to the percent of identity between two polynucleotide sequences or between two polypeptide sequences. The correspondence between one sequence to another can be determined by techniques known in the art. For example, homology can be determined by a direct comparison of two polypeptide molecules by aligning their sequences and using readily available computer programs. Alternatively, homology can be determined by hybridization of polynucleotides under conditions which form stable duplexes between homologous regions, followed by digestion with single-stranded-specific nuclease(s), and size determination of the digested fragments. Two polynucleotide or two polypeptide sequences are "substantially homologous" to each other when, after optimally aligned with appropriate insertions or deletions, at least about 80%, at least about 85%, at least about 90%, and at least about 95% of the nucleotides or amino acids, respectively, match over a defined length of the molecules, as determined using the methods above.

[0142] In some embodiments, the alternative exon is exogenous to the target gene, although it may be derived from a sequence originating from the organism where the target gene will be expressed. As used herein, "exogenous" means derived from a genotypically distinct entity from that of the rest of the entity to which it is compared or into which it is introduced or incorporated. For example, a polynucleotide introduced by genetic engineering techniques into a different cell type is a heterologous polynucleotide (and, when expressed, can encode a heterologous polypeptide).

[0143] Apdimer modulation of polyadenylation

[0144] Provided herein are nucleic acids and methods for regulating the expression of a gene of interest by apdimer-modulated polyadenylation. The 3' end of almost all eukaryotic mRNAs comprises a poly(A) tail — a homopolymer of 20 to 250 adenosine residues. Because addition of the poly(A) tail to mRNA protects it from degradation, expression of a gene can be influenced by modulating the polyadenylation the corresponding mRNA.

[0145] In some embodiments, the expression of the target gene is regulated through apdimer-modulated accessibility of polyadenylation signals as described in and WO2018 / 156658. In such embodiments, the riboswitch comprises an effector stem-loop and an apdimer as disclosed herein, wherein the effector stem-loop comprises a polyadenylation signal, and wherein the apdimer and effector stem-loop are linked by an alternatively shared stem arm comprising a sequence that is complementary to the unshared arm of the apdimer stem and to the unshared arm of the effector stem loop (see, e.g., Figs, la, lb, 2a, and 5a of WO2018 / 156658 and the associated text, incorporated herein by reference). In some embodiments, the effector stem-loop is positioned 3' of the apdimer such that the alternativelyshared stem arm comprises all or a portion of the 3' apdimer stem arm and all or a portion of the 5' arm of the effector stem. In some embodiments, the effector stem -loop is positioned 5' of the apdimer such that the alternatively shared stem arm comprises all or a portion of the 5' apdimer stem arm and all or a portion of the 3' arm of the effector stem. In some embodiments, the polyadenylation signal is AATAAA or ATTAAA. In one embodiment, the polyadenylation signal is a downstream element (DSE). In some embodiments, the polyadenylation signal is an upstream sequence element (USE). In some embodiments, the polynucleotide cassette comprises two riboswitches, wherein the effector stem loop of the first riboswitch comprises all or part of the polyadenylation signal AATAAA or ATTAAA and the effector stem loop of the second riboswitch comprises all or part of the downstream element (DSE). In one embodiment, the two riboswitches each comprise apdimer as disclosed herein that bind the same ligand. In one embodiment, the two riboswitches comprise different apdimers that bind different ligands. In some embodiments, the riboswitch comprises an apdimer as described herein and an effector region comprising a binding site for the small nuclear ribonucleoprotein (snRNP) Ul, which is part of the spliceosome. WO2017 / 136591 describes riboswitches wherein the effector region comprises a Ul snRNP binding site, and is incorporated herein by reference in its entirety. When the apdimer binds its ligand, the effector region forms a stem and sequesters the Ul snRNP binding site from binding a Ul snRNP. Under certain conditions (for example, when the apdimer is not bound to its ligand), the effector region is in a context that provides access to the Ul snRNP binding site, allowing Ul snRNP to bind the mRNA and inhibit polyadenylation leading to degradation of the message. The Ul snRNP binding site can be any polynucleotide sequence that is capable of binding the Ul snRNP, thereby recruiting the Ul snRNP to the 3' UTR of a target gene and suppressing polyadenylation of the target gene message. In some embodiments, the Ul snRNP binding site is a variation of its known consensus sequence, including for example sequences that are shorter or have one or more nucleotides changed from the consensus sequence. The Ul snRNP binding site can be any 5' splice site from a gene.

[0146] Aptamer-mediated modulation of ribonuclease cleavage

[0147] Provided herein are nucleic acids and methods for regulating the expression of a gene of interest through apdimer-modulated ribonuclease cleavage. Ribonucleases (RNases) recognize and cleave specific ribonuclease substrate sequences. Provided herein are recombinant DNA constructs that, when incorporated into the DNA of a target gene, provide the ability to regulate expression of the target gene by apdimer / ligand mediated ribonuclease cleavage of the resulting RNA. In some embodiments, the apdimer encoding sequence as disclosed is part of a construct that contains or encodes a ribonuclease substrate sequence and a riboswitch comprising an effector region and the apdimer such that when the apdimer binds a ligand, target gene expression occurs (as described in W02018 / 161053, which is incorporated in its entirety by reference herein). In embodiments, an RNase P substrate sequence is linked to a riboswitch wherein the riboswitch comprises an effector region and an apdimer as disclosed herein, wherein the effector region comprises a sequence complementary to a portion of the RNase P substrate sequence. Binding of a suitable ligand to the apdimer induces structural changes in theapdimer and effector region, altering the accessibility of the ribonuclease substrate sequence for cleavage by the ribonuclease.

[0148] In some embodiments, the apdimer sequence is located 5' to the RNase P substrate sequence and the effector region comprises all or part of the leader sequence and all or part of the 5' acceptor stem sequence of the RNase P substrate sequence. See, e.g., Figs, la, 2b, and 3b of W02018 / 161053 and the associated text, incorporated herein by reference. In some embodiments, the acceptor stem of the RNase P substrate and the riboswitch effector region are separated by 0, 1, 2, 3, or 4 nucleotides. In some embodiments, the effector region stem includes, in addition to leader sequence (and its complement), one or more nucleotides of the acceptor stem of the RNase P substrate, and sequence complementary to the one or more nucleotides of the acceptor stem.

[0149] In some embodiments, the apdimer sequence of the polynucleotide cassette is located 3' to the RNase P substrate sequence and the effector region comprises sequence complementary to the all or part of the 3' acceptor stem of the RNase P substrate sequence. See, e.g., Fig. 3a of W02018 / 161053 and the associated text, incorporated herein by reference. In further embodiments, the effector region sequence complementary to the 3' acceptor stem of the RNase P substrate is 1 to 7 nucleotides. In other words, the effector region stem includes 1 to 7 nucleotides of the acceptor stem and includes sequence that is complementary to this 1 to 7 nucleotides of the acceptor stem. In embodiments, the riboswitch is located 3' of the RNase P substrate so the effector region stem and the acceptor stem of the RNase P substrate do not overlap. In embodiments, the effector region and the acceptor stem of the RNase P substrate are immediately adjacent (Ze., not overlapping). In other embodiments, the effector region and the acceptor stem of the RNase P substrate are separated by 1, 2, 3, 4, 5 or more nucleotides. Apdimer-mediated cleavage by self-cleaving ribozymes

[0150] Provided herein are nucleic acids and methods for regulating the expression of a gene of interest by apdimer-mediated modulation of small endonucleolytic ribozymes. A ribozyme is an RNA enzyme that catalyzes a chemical reaction. In the nucleic acids and methods disclosed herein, a ribozyme may be any small endonucleolytic ribozyme that will self-cleave in the target cell type including, but not limited to a hammerhead, hairpin, the hepatitis delta virus, the Varkud satellite, twister, twister sister, pistol or hatchet ribozyme. Accordingly, in one embodiment, provided is a riboswitch, and a gene expression cassette comprising the riboswitch that contains a ribozyme linked to an aptamer disclosed herein. WO2017 / 136608, which is incorporated in its entirety by reference herein, describes such riboswitches that activate ribozyme self-cleavage in the presence of aptamer ligand ("off' switch) or riboswitches that inhibit ribozyme self-cleavage in the presence of aptamer ("on" switch).

[0151] In some embodiments, in an "off' switch scenario, apdimer / ligand binding increases the ribonuclease function of the ribozyme, leading to cleavage of the target gene RNA that contains the polynucleotide cassette, thereby reducing target gene expression. Examples of such an off switch include a polynucleotide cassette for the regulation of the expression of a target gene comprising a riboswitch that comprises a ribozyme linked by a stem to an apdimer as disclosed herein, wherein the stem linkingthe ribozyme to the apdimer attaches to the ribozyme at the location of the P3 stem of the ribozyme and wherein the target gene is linked to the Pl stem of the twister ribozyme (see, e.g. Figs, la, lb, or 3a of WO2017 / 136608 and the associated text, incorporated herein by reference).

[0152] In some embodiments, the stem linking the apdimer to the ribozyme does not contain sequence from either the P3 stem of the ribozyme or from the apdimer stem. In addition, the stem linking the ribozyme to the apdimer (including the P3 stem) may comprise one or more mismatches where a nucleotide is not complementary to its counterpart on the other stem arm.

[0153] The stem linking the apdimer to the ribozyme should be of a sufficient length (and GC content) to form a stem upon ligand binding the apdimer thereby promoting the ribozyme endonuclease activity, while also, when the ligand is not present in sufficient quantities, taking a conformation that inhibits ribozyme endonuclease activity. The length and sequence of the stem can be modified using known techniques in order to identify stems that allow acceptable background expression of the target gene when ligand is present and acceptable expression levels of the target gene when the ligand is not present. If the stem is, for example, too long it may provide an active ribozyme conformation in the presence or absence of ligand. If the stem is too short, it may not provide an active ribozyme even in the presence of ligand. In certain embodiments, the stem linking the ribozyme to the aptamer is about 3 to about 7 base pairs. In one embodiment, the stem linking the ribozyme to the aptamer is 3 to 7 base pairs. In one embodiment, the stem linking the ribozyme to the aptamer is 4 base pairs long. In one embodiment, the stem linking the ribozyme to the aptamer is 3 base pairs long.

[0154] In some embodiments, it is be understood that the stem linking the aptamer and ribozyme is not always in a double-stranded stem configuration. For example, when the apdimer is not bound to ligand, the structure of the stem can be disrupted inhibiting ribozyme endonucleolytic activity. When the apdimer binds its ligand the stem is stabilized promoting ribozyme endonucleolytic activity.

[0155] In some embodiments, in an "on" switch scenario, apdimer / ligand binding inhibits the ribonuclease function of the ribozyme, decreasing cleavage of the target gene RNA that contains the polynucleotide cassette, thereby increasing target gene expression in the presence of ligand. Examples of an on switch include a riboswitch that comprises a ribozyme linked to an apdimer, wherein the apdimer is linked to the 3' or 5' end of the ribozyme Pl stem, wherein when the apdimer is linked to the 3' end of the ribozyme Pl stem, a portion of the 3' arm of the twister ribozyme Pl stem is alternatively the 5' arm of the apdimer Pl stem, and wherein when the apdimer is linked to the 5' end of the ribozyme Pl stem, a portion of the 5' arm of the twister ribozyme Pl stem is alternatively the 3' arm of the apdimer Pl stem (see, e.g., Figs. 6a-6b of WO2017 / 136608 and the associated text, incorporated herein by reference). In this context, the riboswitch is an "on riboswitch" because apdimer / ligand binding inhibits the ribonuclease function of the twister ribozyme decreasing cleavage of the target gene RNA that contains the polynucleotide cassette and thereby increasing target gene expression in the presence of ligand. With regard to both on and off riboswitches, the ribozyme Pl stem and apdimer Pl stem may or may not comprise wild-type stem sequence. As such, the stem names are based on their location on theribozyme or apdimer and does not imply that the stems comprise any particular sequence. The Pl ribozyme stem and the Pl apdimer stem may each independently comprise stem sequence in addition to the shared stem sequence. This additional stem sequence may include sequence from the respective ribozyme Pl or apdimer Pl stem and / or additional sequence added to facilitate stem formation. In addition, ribozyme Pl and / or apdimer Pl stem may comprise one or more mismatches where a nucleotide is not complementary to its counterpart on the other stem arm.

[0156] The ribozyme Pl and aptamer Pl stem should be of a sufficient length (and GC content) such that the aptamer forms the Pl stem in the presence of aptamer ligand and the ribozyme forms the Pl stem when ligand is not present. The length and sequence of the stems can be modified using known techniques in order to identify stems that allow acceptable background expression of the target gene when ligand is not present and acceptable expression levels of the target gene when the ligand is present. In some embodiments, the Pl stem of the ribozyme is 4 to 9 base pairs, 5 to 8 base pairs, 6 base pairs, or 7 base pairs. In one embodiment, the PI stem of the aptamer is 6 to 11 base pairs, 7 to 10 base pairs, 8 base pairs, or 9 base pairs.

[0157] The polynucleotide cassette comprising the on or off riboswitch may be placed at one or more locations in the target gene, including, but not limited to the 5 ' and 3 ' UTR and downstream of the start codon.

[0158] Apdimer-mediated initiation of translation

[0159] Provided herein are nucleic acids and methods for regulating the expression of a gene of interest by apdimer-mediated modulation of the accessibility of an internal ribosome entry site or a viral translation reinitiation site.

[0160] In some embodiments, in an "off' switch scenario, apdimer / ligand binding decreases the ability of a ribosome translation complex to access the internal ribosome entry site or a viral translation reinitiation site, thereby reducing target gene expression. Examples of such an off switch include a polynucleotide cassette for the regulation of the expression of a target gene comprising a riboswitch that comprises an internal ribosome entry site or a viral translation reinitiation site linked to an apdimer as disclosed herein. In some embodiments, in an "on" switch scenario, apdimer / ligand binding increases the ability of a ribosome translation complex to access the internal ribosome entry site or a viral translation reinitiation site, thereby increasing target gene expression. Examples of such an off switch include a polynucleotide cassette for the regulation of the expression of a target gene comprising a riboswitch that comprises an internal ribosome entry site or a viral translation reinitiation site linked to an apdimer as disclosed herein. The polynucleotide cassette comprising the on or off riboswitch may be placed at one or more locations in the target gene, including, but not limited to the 5 ' and 3 ' UTR and downstream of the start codon.

[0161] Apdimer-mediated inhibition of translation

[0162] Provided herein are nucleic acids and methods for regulating the expression of a gene of interest by apdimer-mediated modulation of the accessibility of a miRNA target site.In some embodiments, in one scenario, apdimer / ligand binding increases the ability of a miRNA target site to be bound by its corresponding miRNA, thereby reducing target gene expression. In some embodiments, in another scenario, apdimer / ligand binding decreases the ability of a miRNA target site to be bound by its corresponding miRNA, thereby increasing target gene expression. Examples of such a switch include a polynucleotide cassette for the regulation of the expression of a target gene comprising a riboswitch that comprises an miRNA target site linked to an apdimer as disclosed herein. The polynucleotide cassette comprising the riboswitch may be placed at one or more locations in the target gene, including, but not limited to the 5 ' and 3 ' UTR and downstream of the start codon. Apdimer-mediated stabilization of translation

[0163] Provided herein are nucleic acids and methods for regulating the expression of a gene of interest by apdimer-mediated modulation of the accessibility of an mRNA stabilizing structure.

[0164] In some embodiments, in one scenario, apdimer / ligand binding increases the ability of an mRNA stabilizing structure to stabilize the mRNA, thereby increasing target gene expression. In some embodiments, in another scenario, apdimer / ligand binding decreases the ability of an mRNA stabilizing structure to stabilize the mRNA, thereby decreasing target gene expression. Examples of such a switch include a polynucleotide cassette for the regulation of the expression of a target gene comprising a riboswitch that comprises an mRNA stabilization sequence linked to an apdimer as disclosed herein. The polynucleotide cassette comprising the riboswitch may be placed at one or more locations in the target gene, including, but not limited to the 5 ' and 3 ' UTR and downstream of the start codon. Target genes

[0165] The expression of any target gene that can be expressed in a target cell, tissue or organism can be regulated using the apdimers as disclosed herein. The term "target gene" refers to a polynucleotide that is introduced into a cell and is capable of being transcribed into RNA and translated and / or expressed under appropriate conditions. Alternatively, the target gene is endogenous to the target cell and the apdimer is positioned into the target gene (for example into the 5' or 3' UTR of an endogenous target gene). An example of a target gene is a polynucleotide encoding a therapeutic polypeptide. In another embodiment, the target gene encodes an RNA such as a miRNA, rRNA, small or long noncoding RNAs, short hairpin RNA (shRNA) and any other regulatory RNAs. In some embodiments, the target gene is exogenous to the cell in which the recombinant DNA construct is to be transcribed. In some embodiments, the target gene is endogenous to the cell in which the recombinant DNA construct is to be transcribed.

[0166] In some embodiments, the target gene may be a gene encoding a protein, or a sequence encoding a non-protein coding RNA. The target gene may be, for example, a gene encoding a structural protein, an enzyme, a cell signaling protein, a mitochondrial protein, a zinc finger protein, a hormone, a transport protein, a growth factor, a cytokine, an intracellular protein, an extracellular protein, a transmembrane protein, a cytoplasmic protein, a nuclear protein, a receptor molecule, an RNA binding protein, a DNAbinding protein, a transcription factor, translational machinery, a channel protein, a motor protein, a cell adhesion molecule, a mitochondrial protein, a metabolic enzyme, a kinase, a phosphatase, exchange factors, a chaperone protein, and modulators of any of these. In embodiments, the target gene encodes erythropoietin (Epo), human growth hormone (hGH), transcription activator-like effector nucleases (TALEN), human insulin, CRISPR associated protein 9 (cas9), or an immunoglobulin (or portion thereof), including, e.g., a therapeutic antibody.

[0167] Expression Constructs

[0168] The present disclosure encompasses the use of a recombinant vector for introduction into target cells a polynucleotide encoding a target gene and containing the apdimer as disclosed herein, for example, an expression / transcriptional cassette comprising the encoding sequence of a target gene operably linked to a riboswitch of the invention that can control expression of the target gene depending on the presence or absence of a ligand that bind the apdimer.

[0169] In the context of an expression cassette of the invention comprising a riboswitch as disclosed herein operably linked to a target gene comprising an open reading frame encoding a gene product, the at least portion of the first aptamer of the riboswitch is proximal to the open reading frame and the at least portion of the second aptamer of the riboswitch is distal to the open reading frame. This is graphically demonstrated in Figure 19.

[0170] In some embodiments, the gene product is an RNA molecule or a peptide or protein. In some embodiments, the allosteric change results in the increased expression of the gene product. In some embodiments, the allosteric change results in the decreased expression of the gene product. In some embodiments, the effector region of the riboswitch is linked to the proximal aptamer of the apdimer. In some embodiments, the effector region is linked to the 5' terminus of the apdimer. In some embodiments, the effector region is linked to the 3' terminus of the apdimer. In some embodiments, the effector region is comprised within the proximal aptamer of the apdimer. In some embodiments, the riboswitch is inserted into the 5’ untranslated region of the target gene. In some embodiments, the riboswitch is inserted into the 3’ untranslated region of the target gene. In some embodiments, the riboswitch is inserted downstream of the translation start codon. In some embodiments, the riboswitch is inserted into an intron comprised within the target gene.

[0171] In many embodiments, the recombinant vector (DNA construct) disclosed herein comprising an expression cassette of the invention further comprises additional DNA elements including DNA segments that provide for the replication of the DNA in a host cell and expression of the target gene in that cell at appropriate levels. The skilled artisan appreciates that expression control sequences (promoters, enhancers, and the like) are selected based on their ability to promote expression of the target gene in the target cell. " Vector" means a recombinant plasmid, yeast artificial chromosome (YAC), mini chromosome, DNA mini-circle or virus (including virus derived sequences) that comprises a polynucleotide to be delivered into a host cell, either in vitro or in vivo. In some embodiments, therecombinant vector is a viral vector or a combination of multiple viral vectors. In some embodiments, the recombinant vector is comprised within an oncolytic virus.

[0172] Viral vectors for the apdimer-mediated expression of a target gene in a target cell, tissue, or organism are known in the art and include adenoviral (AV) vectors, adeno-associated virus (AAV) vectors, retroviral and lentiviral vectors, measles virus vectors, and Herpes simplex type 1 (HSV1) vectors. In some embodiments, the viral vector is an oncolytic measles virus vector or an attenuated oncolytic measles virus.

[0173] Adenoviral vectors include, for example, those based on human adenovirus type 2 and human adenovirus type 5 that have been made replication defective through deletions in the El and E3 regions. The transcriptional cassette can be inserted into the El region, yielding a recombinant El / E3-deleted AV vector. Adenoviral vectors also include helper-dependent high-capacity adenoviral vectors (also known as high-capacity, "gutless" or "gutted" vectors), which do not contain viral coding sequences. These vectors, contain the cis-acting elements needed for viral DNA replication and packaging, mainly the inverted terminal repeat sequences (ITR) and the packaging signal (Ψ). These helper-dependent AV vector genomes have the potential to carry from a few hundred base pairs up to approximately 36 kb of foreign DNA.

[0174] Recombinant adeno-associated virus "rAAV" vectors include any vector derived from any adeno-associated virus serotype, including, without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-7 and AAV-8, AAV-9, AAV-10, and the like. rAAV vectors can have one or more of the AAV wild-type genes deleted in whole or in part, preferably the Rep and / or Cap genes, but retain functional flanking ITR sequences. Functional ITR sequences are retained for the rescue, replication, packaging and potential chromosomal integration of the AAV genome. The ITRs need not be the wild-type nucleotide sequences, and may be altered {e.g., by the insertion, deletion or substitution of nucleotides) so long as the sequences provide for functional rescue, replication and packaging.

[0175] Alternatively, other systems such as lentiviral vectors can be used in embodiments of the invention. Lenti viral-based systems can transduce non-dividing as well as dividing cells making them useful for applications targeting, for example, the non-dividing cells of the CNS. Lentiviral vectors are derived from the human immunodeficiency virus and, like that virus, integrate into the host genome providing the potential for long-term gene expression.

[0176] Polynucleotides, including plasmids, YACs, minichromosomes and minicircles, carrying the target gene containing the gene regulation cassette can also be introduced into a cell or organism by nonviral vector systems using, for example, cationic lipids, polymers, or both as carriers. Conjugated poly-L-lysine (PLL) polymer and polyethylenimine (PEI) polymer systems can also be used to deliver the vector to cells. Other methods for delivering the vector to cells include hydrodynamic injection and electroporation and use of ultrasound, both for cell culture and for organisms. For a review of viral and non-viral delivery systems for gene delivery see Nayerossadat eta / ., (Adv Biomed Res. 2012; 1:27) incorporated herein by reference.In some embodiments, an expression construct of the invention comprises a riboswitch operably linked to a target gene comprising an open reading frame encoding a gene product, wherein the riboswitch comprises (A) an apdimer comprising (i) at least a portion of a first aptamer comprising a first ligandbinding region; (ii) at least a portion of a second aptamer comprising a second ligand-binding region, wherein the first and second ligand binding regions are positioned relative to each other such that when one of the ligand-binding regions binds to its ligand, the other ligand-binding region binds to its ligand in a positive cooperative manner, wherein the first aptamer is positioned to the second aptamer through a fusion region which forms a stem structure through base pairing and wherein the first and second binding regions bind to the same ligand; and (B) an effector region, which effector region undergoes an allosteric change in response to ligand binding to at least one or all of the binding regions, wherein the allosteric change results in the increased expression of the gene product, and wherein the at least portion of a first aptamer of the riboswitch is proximal to the open reading frame and the at least a portion of a second aptamer of the riboswitch is distal to the open reading frame.

[0177] Methods of Modulating Expression of a Target Gene

[0178] In an aspect, the present disclosure provides a method of modulating expression of a target gene in a mammalian cell e.g., a therapeutic gene), comprising (i) introducing an expression cassette / vector of the invention as disclosed herein into a mammalian cell, and (ii) exposing the cell to a ligand that specifically binds at least one of the ligand-binding regions of the apdimer in an amount effective to modulate expression of the target gene. The mammalian cell is preferably a human cell.

[0179] In some embodiments, the cassette / vector can comprise additional nucleotide sequences flanking the apdimer either 5', 3' or both, which provides for the insertion of the apdimer into the target gene without modifying the nucleotide sequence of the apdimer or affecting its functional control of expression of the target gene. In some embodiments, the cassette / vector comprises an off riboswitch and exposure to the binding ligand reduces target gene expression. In some embodiments, where the cassette / vector comprises an on riboswitch and exposure to the binding ligand increases target gene expression. In some embodiments, the ligand is a small molecule. In some embodiments, expression of the target gene in target cells confers a desired property to a cell into which it was introduced or otherwise leads to a desired therapeutic outcome.

[0180] Methods of Treatment and Pharmaceutical Compositions

[0181] An aspect of the present disclosure provides a method of regulating the level of a therapeutic protein delivered by gene therapy. In this embodiment, the "target gene" may encode the therapeutic protein. The "target gene" may encode a protein that is endogenous or exogenous to the cell. In some embodiments, the cell is a mammalian cell, preferably a human cell. In some embodiments, the mammalian cell is comprised within a subject, preferably a human.The therapeutic gene sequence containing the riboswitch of the invention is delivered to target cells in vitro or ex vivo, e.g., by a vector. The cell specificity of the "target gene" may be controlled by promoter or other elements within the vector.

[0182] Due to the presence of the riboswitch within the target gene sequence, the target gene is not expressed at significant levels, preferably measurable levels. In some embodiments, the target gene is in the "off state" in the absence of the specific ligand that binds to the apdimer contained within in the regulatory cassette riboswitch. Only when the apdimer specific ligand is administered (or otherwise present in sufficient quantities) is the target gene expression activated. In other embodiments, the target gene is in the "off state" in the presence of the specific ligand that binds to the apdimer contained within the regulatory cassette riboswitch. When administration stops (or the ligand is otherwise present at sufficiently low levels), target gene expression will occur.

[0183] The delivery of the vector construct containing the target gene and the delivery of the activating ligand generally are separated in time. The delivery of the activating ligand will control when the target gene is expressed, as well as the level of protein expression. The ligand may be delivered by a number of routes including, but not limited to, intravitreal, intraocular, inhalation, subcutaneous, intramuscular, intradermal, intra-lesion, topical, intraperitoneal, intravenous (IV), intra-arterial, perivascular, intracerebral, intracerebroventricular, oral, sublingual, sublabial, buccal, nasal, intrathoracic, intracardiac, intrathecal, epidural, intraosseous, or intraarticular.

[0184] The timing of delivery of the ligand will depend on the requirement for activation of the target gene. For example, if the therapeutic protein encoded by the target gene is required constantly, in the case of the "on" riboswitches, an oral small molecule ligand may be delivered daily, or multiple times a day, to ensure continual activation of the target gene, and thus continual expression of the therapeutic protein. If the target gene has a long-acting effect, the inducing ligand may be dosed less frequently. This allows the expression of the therapeutic transgene to be controlled temporally, in a manner determined by the temporal dosing of the ligand specific to the apdimer within the riboswitch of the regulatory polynucleotide cassette. The increased expression of the therapeutic transgene only on ligand administration (in the case of the "on" riboswitches), increases the safety of a gene therapy treatment by allowing the target gene to be off in the absence of the ligand.

[0185] Different aptamers comprised within the apdimer, optionally in combination with other aptamers, can be used to allow different ligands to activate target genes or repress target genes. In some embodiments, each therapeutic gene containing a regulatory cassette will have a specific apdimer within the cassette that will be activated by a specific small molecule. This means that each therapeutic gene can be activated only by the ligand specific to the apdimer comprised within it. In these embodiments, each ligand will only activate one therapeutic gene. This allows for the possibility that several different "target genes" may be delivered to one individual and each will be activated on delivery of the specific ligand for the apdimer contained within the riboswitch comprised in each target gene.Moreover, this allows any therapeutic protein whose gene can be delivered to the body (such as erythropoietin (EPO) or a therapeutic antibody) to be produced by the body when the activating ligand is delivered. This method of therapeutic protein delivery may replace the manufacture of such therapeutic proteins outside of the body which are then injected or infused, e.g., antibodies used in cancer or to block inflammatory or autoimmune disease. The body containing the regulated target gene becomes the biologic manufacturing factory, which is switched on when the gene- specific ligand is administered.

[0186] In some embodiments, the target gene may encode a nuclease that can target and edit a particular DNA sequence. Such nucleases include Cas9, zinc finger containing nucleases, or TALENs. In the case of these nucleases, the nuclease protein may be required for only a short period of time that is sufficient to edit the target endogenous genes.

[0187] However, if an unregulated nuclease gene is delivered to the body, this protein may be present for the rest of the life of the cell. In the case of nucleases, there is an increasing risk of off-target editing the longer the nuclease is present. Regulation of expression of such proteins has a significant safety advantage. In this case, a vector containing the nuclease target gene containing a regulatory cassette could be delivered to the appropriate cells in the body. The target gene is in the "off state" in the absence of the cassette-specific ligand, so no nuclease is produced. Only when the activating ligand is administered, is the nuclease produced. When sufficient time has elapsed allowing sufficient editing to occur, the ligand will be withdrawn and not administered again. Thus, the nuclease gene is thereafter in the "off state" and no further nuclease is produced and editing stops. This approach may be used to correct genetic conditions, including a number of inherited retinopathies such as LCA10 caused by mutations in CEP290 and Stargardt's Disease caused by mutations in ABCA4.

[0188] Administration of a regulated target gene encoding a therapeutic protein which is activated only on specific ligand administration may be used to regulate therapeutic genes to treat many different types of diseases, e.g., cancer with therapeutic antibodies, immune disorders with immune modulatory proteins or antibodies, metabolic diseases, rare diseases such as PNH with anti-C5 antibodies or antibody fragments as the regulated gene, or ocular angiogenesis with therapeutic antibodies, and dry AMD with immune modulatory proteins.

[0189] A wide variety of specific target genes, allowing for the treatment of a wide variety of specific diseases and conditions, are suitable for use in accordance with the present disclosure. For example, insulin or an insulin analog (preferably human insulin or an analog of human insulin) may be used as the target gene to treat type I diabetes, type II diabetes, or metabolic syndrome; human growth hormone may be used as the target gene to treat children with growth disorders or growth hormone-deficient adults; erythropoietin (preferably human erythropoietin) may be used as the target gene to treat anemia due to chronic kidney disease, anemia due to myelodysplasia, or anemia due to cancer chemotherapy. The nucleic acids and methods disclosed herein may be especially suitable for treating diseases caused by single gene defects such as cystic fibrosis, hemophilia, muscular dystrophy, thalassemia, or sicklecell anemia. Thus, human β-, γ-, δ-, or ζ-globin may be used as the target gene to treat β-thalassemia or sickle cell anemia; human Factor VIII or Factor IX may be used as the target gene to treat hemophilia A or hemophilia B.

[0190] The ligands used in the present invention are generally combined with one or more pharmaceutically acceptable carriers to form pharmaceutical compositions suitable for administration to a patient. Pharmaceutically acceptable carriers include solvents, binders, diluents, disinteg rants, lubricants, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, generally used in the pharmaceutical arts. Pharmaceutical compositions may be in the form of tablets, pills, capsules, troches, and the like, and are formulated to be compatible with their intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, intranasal, subcutaneous, oral, inhalation, transdermal (topical), transmucosal, and rectal. The pharmaceutical compositions comprising ligands are administered to a patient in a dosing schedule such that an amount of ligand sufficient to desirably regulate the target gene is delivered to the patient. When the ligand is a small molecule and the dosage form is a tablet, capsule, or the like, preferably the pharmaceutical composition comprises from 0.1 mg to 10 g of ligand; from 0.5 mg to 5 g of ligand; from 1 mg to 1 g of ligand; from 2 mg to 750 mg of ligand; from 5 mg to 500 mg of ligand; or from 10 mg to 250 mg of ligand.

[0191] The pharmaceutical compositions may be dosed once per day or multiple times per day {e.g., 2, 3, 4, 5, or more times per day). Alternatively, pharmaceutical compositions may be dosed less often than once per day, e.g., once every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days, or once a month or once every few months. In some embodiments of the invention, the pharmaceutical compositions may be administered to a patient only a small number of times, e.g., once, twice, three times, etc.

[0192] The present disclosure provides a method of treating a patient in need of increased expression of a therapeutic protein encoded by a target gene, the method comprising administering to the patient a pharmaceutical composition comprising a ligand for an apdimer comprised within a riboswitch as disclosed herein, where the patient previously had been administered a recombinant DNA comprising the target gene, where the target gene contains or is operably linked to a riboswitch of the present invention that provides the ability to regulate expression of the target gene by the ligand of the apdimer by, e.g., alternative splicing of pre-mRNA of the target gene, thereby increasing expression of the therapeutic protein.

[0193] Apdimers for detection and / or diagnostic uses

[0194] A wide range of detection and diagnostic agents can be linked to apdimers through chimerical or physical conjugation. Further, apdimers as disclosed herein can be incorporated in biosensors, microfluidic devices and other detection platforms. In some embodiments, the apdimer is conjugated to a polyalkylene glycol moiety, including, but not limited to, polyethylene glycol (PEG), polypropylene glycol(PPG), polyoxyethylated glycerol (POG) and other polyoxyethylated polyols, polyvinyl alcohol (PVA) and other polyalkylene oxides, polyoxyethylated sorbitol, or polyoxyethylated glucose.

[0195] In some embodiments, the apdimer is conjugated to a detectable moiety, including, but not limited to, fluorescent moieties or labels, imaging agents, radioisotopic moieties, radiopaque moieties, and the like, e.g. detectable labels such as biotin, fluorophores, chromophores, spin resonance probes, nanoparticles (including, but not limited to gold, magnetic, and superpara magnetic nanoparticles), quantum dots, radiolabels. Exemplary fluorophores include fluorescent dyes e.g. fluorescein, rhodamine, and the like) and other luminescent molecules {e.g. luminal). A fluorophore may be environmentally-sensitive such that its fluorescence changes if it is located close to one or more residues in the modified protein that undergo structural changes upon binding a substrate {e.g. dansyl probes).

[0196] Exemplary radiolabels include small molecules containing atoms with one or more low sensitivity nuclei (13C,15N,2H,125I,123I,99Tc,43K,52Fe,67Ga,68Ga, and the like). Other useful moieties are known in the art.

[0197] Reporter proteins encoded by the reporter genes used in the methods disclosed herein are proteins that can be assayed by detecting characteristics of the reporter protein, such as enzymatic activity or spectrophotometric characteristics, or indirectly, such as with antibody-based assays. Examples of reporter gene products that are readily detectable include, but are not limited to, puromycin resistance marker (pac), 3-galactosidase, luciferase, orotidine 5'-phosphate decarboxylase (URA3), arginine permease CAN1, galactokinase (GALI), beta-galactosidase (LacZ), or chloramphenicol acetyl transferase (CAT). Other examples of detectable signals include cell surface markers, including, but not limited to CD4. Reporter genes suitable for the use in the methods for identifying aptamers disclosed herein also include fluorescent proteins {e.g., green fluorescent protein (GFP) and its derivatives), or proteins fused to a fluorescent tag.

[0198] Articles of Manufacture and Kits

[0199] Also provided herein are kits or articles of manufacture comprising the nucleic acids comprising apdimer sequences as disclosed herein and for their use in the methods described herein. In aspects, the kits comprise the compositions described herein {e.g., for compositions for delivery of a vector comprising the target gene containing the gene regulation cassette) in suitable packaging. Suitable packaging for compositions (such as ocular compositions for injection) described herein are known in the art, and include, for example, vials (such as sealed vials), vessels, ampules, bottles, jars, flexible packaging {e.g., sealed Mylar or plastic bags), and the like. These articles of manufacture may further be sterilized and / or sealed.

[0200] The kits comprising compositions described herein may further comprise instruction(s) on methods of using the composition, such as uses described herein. The kits described herein may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for performing the administration,including e.g., any methods described herein. For example, in some embodiments, the kit comprises rAAV for expression of the target gene comprising the gene regulation cassette as disclosed herein, a pharmaceutically acceptable carrier suitable for injection, and one or more of: a buffer, a diluent, a filter, a needle, a syringe, and a package insert with instructions for performing the injections. In some embodiments, the kit is suitable for intraocular injection, intramuscular injection, intravenous injection and the like.

[0201] BRIEF DESCRIPTION OF THE FIGURES

[0202] Figures 1A to 1C: Compared switching performance of Tet_splice, Tet_splice_2 and Tet_splice_apdimers in HeLa cells. Dual luciferase assay showing the performance of tet-apdimer containing splice-switches in HeLa cells compared to constructs with the conventional tetracycline aptamer 24 h after transfection and induction with 50·μM tetracycline (light grey). Values show the luciferase activity normalized to a psiCheck control without riboswitch. Shown is the mean ± s.d. of four biological replicates. **p< 0.01, ***p< 0.001.

[0203] Tet_splice_l = SEQ ID NO: 1, Tet_splice_2 = SEQ ID NO: 25, Tet_splice_apdimer_l = SEQ ID NO: 2, Tet_splice_apdimer_2 = SEQ ID NO: 4

[0204] Figures 2Ato 2B: Comparison of Tetapdimerand controls with individually mutated binding pockets. Hela cells were transfected with a psiCheck vector and psiCheck vectors containing the splicing cassette with tetracycline switches in the firefly coding sequence. Shown is the mean of three biological replicates in presence (light grey) or absence (dark grey) of 50 µM tetracycline. The gene expression was normalized to a psiCheck control without regulatory element. **p< 0.01.

[0205] Tet_splice apdimer = SEQ ID NO: 2, splice control 1 = SEQ ID NO: 26, splice control 2 = SEQ ID NO: 27

[0206] Figures 3A to 3D: Evaluation of a Tet apdimer that is connected to a HHR ribozyme via its P2 stem. Hela cells were transfected with a psiCheck vector and psiCheck vectors containing the tetracycline switches with a single tetracycline aptamer connected to the HHR ribozyme via P2 (TetP2) and tetracycline apdimer aptamer versions (Tet_apdimer, Tet_apdimer P2 / l_2, Tet_apdimer P2 / l_2, Tet_apdimer P2 / l_3) in the Renilla luciferase coding sequence. Comparison of the TetK19 construct with the optimized Tet_apdimer construct and controls of Tet_apdimer containing mutations in binding pocket of the distal (Tet_control_l) or the proximal("bridging") aptamer (Tet_control_2). Shown is the mean of three biological replicates in presence (light grey) or absence (dark grey) of 50 µM tetracycline. The gene expression was normalized to a psiCheck control without a regulatory element. **p< 0.01, ***<0.001.

[0207] TetP2 = SEQ ID NO: 6, Tet_apdimer P2 / l_l = SEQ ID NO: 7, Tet_apdimer P2 / l_2 = SEQ ID NO: 8, Tet_apdimer P2 / l_3 = SEQ ID NO: 9, TetK19 = SEQ ID NO: 5, Tet_apdimer P2 / l_2 control 1 = SEQ ID NO: 28, Tet_apdimer P2 / l_2 control 2 = SEQ ID NO: 29Figures 4Ato 4B: Compared switching performance of Theo_splice and Tet_apdimer_splice versions in HeLa cells. Dual luciferase assay showing the performance of theo-apdimer containing splice-switches in HeLa cells compared to constructs with the conventional theophylline aptamer 24 h after transfection and induction with 2 mM theophylline (light grey). Values show the luciferase activity normalized to a psiCheck control without riboswitch. Shown is the mean ± s.d. of three biological replicates. **p< 0.01, ***p< 0.001.

[0208] Theo_splice = SEQ ID NO: 10, theo_splice apdimer 1 = SEQ ID NO: 11, theo splice_apdimer 2 = SEQ ID NO: 12, theo_splice_apdimer 3 = SEQ ID NO: 13, theo splice apdimer_4 = SEQ ID NO: 14, theo_splice apdimer_5 = SEQ ID NO: 15

[0209] Figures 5A to 5D: Compared performance of the original Tet_splice switch and the combined construct containing the Tet_apdimer_splice construct and Tet_apdimer HHR constructs in the 3'-UTR. (A) Hela cells were transfected with psiCheck vector and psiCheck vectors containing the tetracycline switches and incubation with or without 50 µM tetracycline. (B) Dose response curve of the Tet_apdimer comi switch. (C) Concentration-dependent response of the Tet_apdimer combi riboswitch to tetraclyine (blue points) and epi-tetracycline (red triangles). Shown is the mean of three biological replicates in presence (light grey) or absence (dark grey) of 50 µM tetracycline. The gene expression was normalized to a psiCheck control without regulatory element. ***<0.001, ****p< 0.0001.

[0210] Tet_splice = SEQ ID NO: 1, combi 1 = combination of SEQ ID NO: 2 and SEQ ID NO: 8, combi 2 = combination of SEQ ID NO: 4 and SEQ ID NO: 9

[0211] Figures 6Ato 6B: Controlling Interleukin-2 expression using thetet_apdimer_combi_l. (A) Design of the IL-2 construct under the control of the tet_apdimer containing riboswitch constructs with the splice-switch inserted at different positions (splice site 2 and 1). The sequences were inserted into a psiCheck control, replacing the firefly sequence (B) Relative IL-2 expression evaluated via ELISA. Shown is the mean of three biological replicates in presence of 50 pM (light grey), 10 pM (dark grey) or absence (black) of tetracycline. Values below the detected background were set to 0. The gene expression was normalized to a psiCheck control, containing the IL-2 gene sequence instead of the firefly sequence without regulatory element. Bar plots show the mean (±SD) of three independent replicates, each measured in triplicates *p< 0.05.

[0212] Combi splice 1 and 2 = combinations of SEQ ID NO: 2 and SEQ ID NO: 8 (with SEQ ID NO: 2 inserted at different positions of the IL_2 exon sequence)

[0213] Figures 7A to 7B: Concentration-dependent induction of luciferase expression. (A) Concentration-dependent fold change of of Tet_splice and (B) Tet_splice_2. The concentration of tetracycline for half-maximal response is indicated as EC50. Data points represent the mean (±SD) of three independent experiments, performed in triplicates.

[0214] Tet_splice_l = SEQ ID 1, Tet_splice_2 = SEQ ID NO: 25Figure 8: Concentration-dependent induction of luciferase expression. (A) Concentrationdependent fold change of Tet_splice_apdimer_l. The concentration of tetracycline for half maximal response is indicated as EC50. Data points represent the mean (±SD) of three independent experiments, performed in triplicates.

[0215] Tet_splice_apdimer_l = SEQ ID NO: 2

[0216] Figures 9A to 9B: Comparison of switching performance of Tet_splice_apdimer_l and Tet_apdimer_w / o exon. (A) Schematic depiction of the constructs. Both contain the same apdimer version. In Tet_apdimer_w / o exon, Stop codons in the aptamer sequence are placed in frame with the first exon. (B) Relative luciferase activity in absence (dark grey) and presence (light grey) of 50 µM tetracycline. Shown is the mean of three biological replicates. The gene expression was normalized to a psiCheck control without regulatory element. ***<0.001, ****p< 0.0001.

[0217] Tet_apdimer_l = SEQ ID NO: 2, Tet_apdimer_w / o exon = SEQ ID NO: 3

[0218] Figures 10A to 10B: Evaluation of a Tet aptazyme containing an aptamer that is connected to a HHR ribozyme via its Pl or P2 stem. (A) Aptazyme constructs containing a HHR type III ribozyme connected to a tetracycline aptamer via Pl or P2 stem. The Pl construct was published as TetK19 construct by Beilstein etal and the P2 construct is based on designs from Zhong eta / 0(B) Hela cells were transfected with a psiCheck vector and psiCheck vectors containing the tetracycline switches with a single tetracycline aptamer connected to the HHR ribozyme via Pl (TetK19) or P2 (Tet_P2). Shown is the mean of three biological replicates in presence (light grey) or absence (dark grey) of 50 µM tetracycline. The gene expression was normalized to a psiCheck control without regulatory element. **p< 0.01.

[0219] TetK19 = SEQ ID NO: 5, Tet_P2 = SEQ ID NO: 6

[0220] Figures 11A to 11B: Evaluation of a Tet apdimer HHR constructs containing different connection stems. (A) Depiction of the predicted secondary structure of the P2-connected apdimer aptamer. The connection stem is highlighted with a red square. (B) Comparison of the switching performance of Tet_apdimer aptazymes containing three different connection stems in Hela cells: the initial construct (Tet_apdimer_HHR type III), a stabilized connection stem (Tet_con_stab) and a destabilized connection stem (Tet_con_destab). ). Shown is the mean of three technical replicates in presence (light grey) or absence (dark grey) of 50 µM tetracycline. The gene expression was normalized to a psiCheck control without regulatory element.

[0221] Tet_apdimer_P2 / l_2 = SEQ ID NO: 8, Tet_con_stab = SEQ ID NO: 17, Tet_con_destab = SEQ ID NO: 16

[0222] Figure 12A to 12B: Evaluation of a Tet apdimer HHR constructs containing different communication modules. (A) Depiction of the predicted secondary structure of the P2-connected apdimer aptamer. The communication module is highlighted in a red square. (B) Comparison of the switching performance of three constructs containing different communication modules in HeLa cells(Tet_apdimer_comm_l, Tet_apdimer_comm_2, Tet_apdimer_comm_3). Shown is the mean of three technical replicates in presence (light grey) or absence (dark grey) of 50 µM tetracycline. The gene expression was normalized to a psiCheck control without regulatory element.

[0223] Tet_apdimer p2 / l_l (Tet_apdimer_comm_l) = SEQ ID NO: 7, Tet_apdimer_P2 / l_2 (Tet_apdimer_comm_2) = SEQ ID NO: 8, Tet_apdimer_comm_3 = SEQ ID NO: 18

[0224] Figures 13A to 13B: Evaluation of a Tet apdimer aptazmes containing different closing stems. (A) Depiction of the predicted secondary structure of the P2-connected apdimer aptamer. The closing stem is highlighted in a red square. (B) Comparison of the switching performance of three constructs containing different closing stems and stabilities. Shown is the mean of three technical replicates in presence (light grey) or absence (dark grey) of 50 µM tetracycline. The gene expression was normalized to a psiCheck control without regulatory element.

[0225] Tet_apdimer p2 / l_l (Tet_apdimer_stem_l) = SEQ ID NO: 7, Tet_apdimer_stem_2 = SEQ ID NO: 19, Tet_apdimer_stem_3 = SEQ ID NO: 21

[0226] Figures 14A to 14B: Evaluation of a Tet apdimer HHR constructs containing different communication modules and closing stem P2_2. (A) Depiction of the predicted secondary structure of the P2-connected apdimer aptamer with closing stem P2. The communication module and closing stem are highlighted in a red square. (B) Comparison of the switching performance of two constructs with different communication modules in HeLa cells. Shown is the mean of three technical replicates in presence (light grey) or absence (dark grey) of 50 µM tetracycline. The gene expression was normalized to a psiCheck control without regulatory element.

[0227] Tet_apdimer_stem_2_2 = SEQ ID NO: 20, Tet_apdimer_stem_2 = SEQ ID NO: 19

[0228] Figures 15Ato 15B: Evaluation of a Tet apdimer HHR constructs containing different closing stems modulesand communication module_2. (A) Depiction of the predicted secondary structure of the P2-connected apdimer with closing stem 1. The communication module and closing stem are highlighted in a red square. (B) Comparison of the switching performance of both constructs in HeLa cells, Shown is the mean of three technical replicates in presence (light grey) or absence (dark grey) of 50 µM tetracycline. The gene expression was normalized to a psiCheck control without regulatory element.

[0229] Tet_apdimer_P2 / l_2 (VH210) (Tet_apdimer_comm_2_2)= SEQ ID NO: 8, Tet_apdimer_stem_2_2 (Tet_apdimer_comm_l_2) = SEQ ID NO: 20

[0230] Figures 16A to 16B: Connection of the second aptamer via stem P2. Predicted secondary structure of the P2-connected Tet-HHR construct (Tet_P2) and an apdimer construct that contains a second aptamer connected via its P2 stem (Tet_apdimer P2 / P2). Comparison of the switching performance of both constructs in HeLa cells. Shown is the mean of three technical replicates in presence (light grey) or absence (dark grey) of 50 µM tetracycline. The gene expression was normalized to a psiCheck control without regulatory element.Tet_p_2 = SEQ ID NO: 6, Tet_apdimer_P2_2 (VH174) = SEQ ID NO: 30

[0231] Figures 17A to 17B: Comparison of Tet_apdimer P2 / P1 and an AG-mutated Tet_apdimer Pl / Pl connected construct. (A) Predicted secondary structure of two different apdimer versions connected to a HHR type III ribozyme. (B) Compared switching performance of both construct in absence of tetracycline (black), with 1 pM tetracycline (very dark grey), 10 µM tetracycline (dark grey) and 50 µM tetracycline (light grey). Shown is the mean of three technical replicates. The gene expression was normalized to a psiCheck control without regulatory element.

[0232] Tet_apdimer_P2 / l_2 = SEQ ID NO: 8, Tet_apdimer_Pl AG Mut = SEQ ID NO: 22

[0233] Figures 18A to 18B: Comparison of different tet-apdimer versions in a splicing-based expression platform. (A) predicted secondary structures of three apdimer constructs connected to a splcing-based expression platform. (B) Comparison of the switching performance of the constructs in HeLa cells. Shown is the mean of three technical replicates in presence (light grey) or absence (dark grey) of 50 µM tetracycline. The gene expression was normalized to a psiCheck control without regulatory element.

[0234] Tet_splice_l = SEQ ID NO: 1, Tet_splice_apdimer_P2_l = SEQ ID NO: 23, Tet_splice_apdimer_P2_2 = SEQ ID NO: 24, Tet_splice_apdimer_l = SEQ ID NO: 2

[0235] Figure 19: Structural depictions. Schematic depiction showing the design and concept of apdimers. An aptamer containing two stems that are stabilized upon ligand binding is opened at one of these stems and fused with a second aptamer, forming an apdimer with a proximal binding pocket (that is connected to the expression platform) and a distal binding pocket (that is connected to the proximal aptamer). The aptamers are connected via a fusion region that allows cooperative ligand binding via both binding pockets, thereby optimizing the performance of the entire riboswitch construct. Apdimers can be placed on every riboswitch expression platform in order to achieve optimal performance. Since two stems can be used for aptamer fusion, the apdimers that contain aptamers of different orientations, which gives room for the adaption to each specific context, depending on which stem was used initially for connection of the aptamer to the expression platform.

[0236] The description (including the following examples) is presented to enable a person of ordinary skill in the art to make and use the various embodiments. Descriptions of specific devices, techniques, and applications are provided only as examples. Various modifications to the examples described herein will be readily apparent to those of ordinary skill in the art, and the general principles defined herein may be applied to other examples and applications without departing from the spirit and scope of the various embodiments. Thus, the various embodiments are not intended to be limited to the examples described herein and shown but are to be accorded the scope consistent with the claims.EXAMPLES

[0237] Riboswitches are compact RNA-based regulatory elements capable of modulating gene expression in response to small molecules, without the need for additional proteins. Various synthetic riboswitches have been engineered using in / o-generated tetracycline and theophylline aptamers. However, many of these constructs exhibit suboptimal switching efficiency and background expression. Moreover, efforts to enhance their performance often involve time-consuming and costly screening processes. The experimental results presented herein show that artificial riboswitches can be efficiently optimized by engineering fusion aptamers that contain two binding pockets (apdimer). Following this rational approach, the performance of splicing-based and ribozyme-based synthetic riboswitches were unexpectedly improved, yielding switches that exceed 1000-fold dynamic ranges with virtually no detectable background expression in the off-state. The results show a straightforward and effective approach for the optimization of existing synthetic riboswitches.

[0238] Material and Methods

[0239] Plasmid construction: Each riboswitch was introduced via PCR in a psiCHECK-2 vector, encoding Renilla luciferase (hRIuc) and firefly luciferase (hluc+). Splicing-based riboswitches were inserted in a spicing cassette as previously described23to modulate hluc-i- expression, while hRIuc expression served for transfection control. Aptazymes were inserted into the 3'-UTR of hRIuc and hluc-i- served as internal control. For combined constructs the splicing-cassette and aptazyme were both regulating hluc+ expression. All oligonucleotides were purchased from Sigma-Aldrich. Plasmids were purified using a Zyppy Plasmid Miniprep kit (Zymo Research).

[0240] Cell culture experiments: Hela cells were grown in Dulbecco's Modified Eagle's Medium (Gibco DMEM, Fisher Scientific) supplemented with 10% (v / v) fetal calf serum and 1% (v / v) penicillin / streptomycin (Fisher Scientific) at 37 °C in 5% CO2 humidified atmosphere. 24 h prior to plasmid transfection, 8000 cells were seeded in 96-well plates.

[0241] Lipofectamine3000 (Thermo Fisher Scientific) was used for transient transfection of HeLa cells. After incubation of 4 h at 37°C, the medium was replaced by Dulbecco's Modified Eagle's Medium (Gibco DMEM, Fisher Scientific) with tetracycline (dissolved in DMSO) or theophylline dissolved in 1 M NaOH and the same volume of 1 M HCI to restore the pH. Controls were treated with Dulbecco's Modified Eagle's Medium, controls for theophylline supplemented with 1 M NaOH and 1 M HCI. Twenty-four hours after transfection, luciferase expression was measured using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer's protocol. The luminescence was quantified with a Spark multimode microplate reader (Tecan), applying a settle time of 0 ms and an integration time of 2000 ms.

[0242] ELISA: Secreted IL-2 was quantified using a Mouse IL-2 ELISA Kit (Invitrogen) according to the manufacture's protocol. Cells were seeded, transfected and treated as described above. 24 h after transfection, the supernatant was collected and secreted IL-2 was quantified using the Mouse IL-2 ELISA Kit (Invitrogen) according to the manufacture's protocol. Briefly, a 96 microwell plate was coated withbiotin-conjugated anti-mouse IL-2 antibody. The supernatant of transfected cells was diluted in PBS (uninduced samples and controls 1:1, induced samples 1:50) and were incubated on one plate with two IL-2 standard dilution series. The next day, plates were treated with Streptavidin-HRP and Substrate Solution (tetramethyl-benzidine) and the color reaction was stopped with 2N H2SO4. The absorbance was determined at a Spark multimode microplate reader (Tecan), applying 450 nm as primary wave length.

[0243] Statistical analysis: Statistical analysis was performed in Python using the scipy.stats package. P values were determined by one-side ANOVA.

[0244] Results

[0245] Design of an optimized Pl-connected tandem tetracycline aptdimer for splicing-based riboswitches

[0246] We aimed for an optimized version of the tetracycline aptamer which would improve the dynamic range of splicing-based tetracycline switches published in 201923. Recent results suggested that the fusion of two stem-loop aptamers improved the switching performance of riboswitchs. In order to assess whether this principle is transferable and can be applied in a general manner, we set out to improve synthetic tetracycline riboswitches. We opened stem P2 of the tet minimer and connected it to a second tetracycline riboswitch. In addition, we introduced point mutations in the aptamer, that were reported to increase the switching efficiency or the on state. The mutation of A42 to G was reported to improve the performance of tetracycline switches in human cells by Yen etal.26. In 2003 Suess etal. proposed that a G in this position influences aptamer stability29. To differentiate between the effect of this mutation we further introduced it in the tet 9 (herein called Tet_splice and Tet_splice_2, respectively) construct from Finke etal. containing only one aptamer and compared the switching of the constructs in transfected HeLa cells (Fig 1, Suppl. Fig 1). The A42G mutation indeed seems to improve the switching performance of the splicing-based construct, resulting in an increase in the dynamic range from 28-fold to 40-fold. Moreover, Tet_splice_2 displays higher sensitivity with an EC50 of 21.4 pM, compared to the original construct Tet_spl ice (EC50 = 50.5 pM) (Fig. 7). The construct Tet_splice_apdimer_l containing the engineered apdimer switches at a similar level as Tet_splice, but with a notable decrease in background expression. This background reduction causes a significantly higher dynamic range of over 200-fold (Fig 1C). We also placed the apdimer in a construct that does not contain the alternative exon and uses the aptamer with two UAA stop codons in frame as described in Finke etal. Thereby a slight increase in induction and dynamic range of ~ 150-fold was achieved (Fig. 9). As a second approach, we introduced a second A to U point mutation (Fig IB). This A53 to U mutation was reported to increase the regulatory property of tetracycline-aptamer controlled translation in yeast by Hanson et al.30. For Tet_splice_apdimer_2 the dynamic range reaches up to 300-fold induction ratio (Fig 1C).

[0247] We speculated that the apdimer aptamers bind their ligands in a cooperative manner, thereby causing the improved switching performance. However, since the sensitivity of Tet_splice_apdimer_l (EC50 =22.5 µM) compared to Tet_splice_2 (EC50= 21.4 µM) was not increased (Figure 7 and 8) we considered also the possibility that the enhancement could be the effect of P2 stabilization.

[0248] To investigate whether both aptamers contribute to the optimized performance or if it is caused by higher stability of stem P2, we created binding-deficient controls. We introduced a mutation that abrogates tetracycline binding (A6U, see Figure 2 A) into each tetracycline binding pocket of Tet_splice_apdimer_l23. While mutating the distal aptamer reduced the switching effect to 39-fold, mutation of the proximal aptamer abolished switching completely. We thus concluded that the improved switching efficiency is a result of both aptamers binding tetracycline and stabilizing each other. In addition, the structural flexibility of the longer sequence might cause the formation of alternative structures in absence of tetracycline and thereby reduce splice site masking, causing lower background expression.

[0249] Design of a P2-connected tetracycline-apdimer for aptazyme optimization

[0250] Since fusing aptamers resulted in the most effective optimization of splicing-based tetracycline switches, we investigated whether we could use the same strategy to improve the fold-change of a tetracyclineresponsive aptazyme. Many research groups have utilized tetracycline aptamers linked to HHR ribozymes as synthetic riboswitches.4, 16,20'31. If connected to stem I or stem II of the ribozyme, the communication module between aptamer and ribozyme allows tetracycline-dependent inhibition of the ribozyme. Binding the ligand initiates structural changes and compacts the aptamer, which then stabilizes the Pl and P2 stem. This, in turn, disrupts base pairing between the ribozyme loops necessary for its catalytically active conformation.

[0251] The TetK19 construct designed by Beilstein etal. contains the tetracycline aptamer connected via the Pl stem to the ribozyme's stem I4. In a similar design, Zhong et al. connected the aptamer via the aptamer's P2 stem to stem III of a HHR type I ribozyme20. We introduced TetK19 and a P2-connected aptazyme version (Tet_P2) in the 3'-UTR of a reporter gene and compared the switching performance in HeLa cells (Figure 10). TetK19 shows the highest fold change, however, the construct displays a rather high background gene expression, which is undesirable for most applications. With the aim of designing a more efficient aptazyme with lower background expression, we choose to optimize a P2-connected construct.

[0252] We opened the tetracycline aptamer at the Pl stem and attached a second aptamer via its Pl stem (Tet_ apdimer P2 / l_l), resulting in an aptazyme design containing two aptamers with different orientations. In a second design, we added an AU basepair to stem P2 of the ribozyme-connected aptamer to stabilize the communication module (Tet_apdimer P2 / l_2). Thirdly, we again introduced the aptamer stabilizing mutations A42G and A53U (Tet_apdimer P2 / l_3). To compare the apdimer versions with TetP2, we transfected HeLa cells with all three constructs and measured the luminescence after induction with tetracycline (Figure 3).Both apdimer constructs display a higher dynamic range compared to the original Tet_P2 switch. In this context, the addition of the second aptamer seems to stabilize the Pl stem formation, thereby decreasing cleavage by the ribozyme. The highest fold change was achieved by the mutated and stabilized version containing an additional AU basepair (Tet_apdimer P2 / l_3). However, this construct also shows the highest background gene expression with ~8 %. The non-mutated construct Tet_apdimer_P2 / l_2 exhibits reduced background expression of ~5 % and a similar fold change. We directly compared the Tet_apdimer P2 / l_2 construct with TetK19 to evaluate if the apdimer strategy led to an overall improved HHR type Ill-based aptazyme. When measured in the same experiment, TetK19 and Tet_apdimer P2 / l_2switch to a similar gene expression level of ~40 %. However, the background of Tet_apdimer P2 / l_2 is reduced by almost ~40 % compared to TetK19, resulting in an increased fold-change. Although the improvement of the switching performance is only moderate, the apdimer-HHR construct might represent a valuable alternative in a context, where lower background expression is preferred.

[0253] To also examine the contribution of each aptamer to the switching performance in the ribozyme-based design, we again mutated both binding pockets of Tet_apdimer P2 / l_2 individually. Mutation of the second aptamer decreased the dynamic range to 4-fold, which is comparable to the performance of the parental TetK19 riboswitch. In contrast, mutation of the aptamer that is connected to the HHR type III ribozyme results in almost complete depletion of the switching performance. This led us to the conclusion that the connection of a second, distal aptamer adds a ligand-dependent stabilization of the proximal aptamer, allowing for the generation of more efficient ribozyme-based riboswitch platforms.

[0254] Design of Pl-connected theophylline-apdimer for splicing-based riboswitches

[0255] To investigate the transferability of the apdimer concept to other systems we additionally designed a theophylline apdimer. In a theophylline-responsive splice on-switch (theo_splice) we opened the P3 stem and connected a second aptamer via the Pl stem32. By adjusting the length of the connecting stem, we could generate constructs with suitable stability. A P3 / 1 connection stem of four basepairs seems to be too unstable, as it results in a non-switching construct (theo_splice_ apdimer_l). However, three constructs with a more stable connection stem increased the switching performance of the theo_splice riboswitch (Figure 4). Addition of a GC basepair to the P3 / 1 connection stem resulted in the most efficient construct that reaches an induction ratio of >90 fold (theo_splice_apdimer_2, Figure 4B). In summary, we could observe an optimized performance when replacing the single-aptamer version with a apdimer construct. We therefore believe this strategy could be considered for optimizing other riboswitches with different aptamers in the future.

[0256] Combination of tet-splice and tet-aptazyme constructs and 4-epitetracycline as effector Finally, we combined both optimized tetracycline-responsive constructs by placing the Tet_apdimer_P2 / l_2 construct in the 3'-UTR of a firefly luciferase that contains the splicing construct Tet_splice_apdimer_l (Tet_apdimer_combi_l). Previous studies have shown that combining aptazymes and splicing-based switches can improve the overall switching performance24'33. We evaluated theswitching performance of the construct in HeLa cells (Figure 5). The dynamic range of this combined construct is increased to more than 1000-fold due to a reduction of the background gene expression in the off-state that amounts to 0.01 % expression compared to the parental psiCheck vector. When combining the mutated versions Tet_splice_apdimer_2 and Tet_apdimer_P2 / l_3 (Tet_apdimer_combi_2), the background expression increases slightly but also higher induction levels are reached, leading to a similar induction ratio.

[0257] For Tet_apdimer_combi_l we further measured the concentration-dependent increase in gene expression upon addition of tetracycline. With this switch combination, 200-fold induction is already achieved at a concentration of 12.5 µM tetracycline.

[0258] One of the most prevalent degradation products of tetracycline is 4-epitetracycline (4-ET). This less antibiotic degradation product is formed upon epimerization under mildly acidic aqueous conditions (pH 4-6) and makes up ~5 % of excreted tetracyclines in patients34'35. Since the tumor microenvironment is characterized by a lower pH compared to the physiological pH, formation of 4-ET might play a role for applications in cancer medicine36'37. To investigate whether the optimized switches respond to 4-ET with the same efficiency, we additionally measured a concentration-dependency using this ligand (Figure 5). We observed no deficit in the switching performance with 4-ET and even improved fold-changes at lower ligand concentrations. Thus, we conclude that the performance of these improved switches is not hampered by the formation of 4-ET under physiological conditions.

[0259] Controlling Interleukin 2 expression with tet-apdimer constructs

[0260] The herein developed fusion constructs achieve a high dynamic range and display very low background expression, which is an advantage for potential therapeutic applications. Especially gene therapies that involve the expression of toxic genes or trigger the immune system require tools for precise dosing that could be realized with riboswitches. Hence, we aimed to investigate the transferability of the results from the luciferase reporter to a therapeutic gene. Interleukin-2 (IL-2) exhibits dose-dependent effects on the immune system, stimulating regulatory T-cells at low doses, while high doses activate a broader immune response. The latter is utilized clinically as an anti-tumor therapy (Aldesleukin)38-40. Despite its therapeutic potential, IL-2's short half-life necessitates frequent administration, which can lead to side effects. As a result, alternative delivery methods, such as viral vectors, are under investigation41. Given its dual role in immune modulation, precise control over IL-2 expression could significantly enhance its therapeutic efficacy and safety in both autoimmune and cancer treatments. We therefore introduced the optimized switches in the sequence of a murine interleukin-2 gene (mIL-2) and quantified mIL-2 expression in HeLa cells in presence or absence of tetracycline via ELISA (Figure 6).

[0261] Upon addition of 50 µM tet, we observed induction of ~400-500 fold with the splice-aptazyme combination using two different insertion sites for the splicing-based construct. The experiment was additionally carried out at a concentration of 10 µM tet which reflects a concentration that is more likely to be achievable in the targeted tissues in in mammals34'42. Also at this concentration, induction of ~50-70 fold could be reached when testing the splice-aptazyme combination. Importantly, we observed thatinserting the splicing construct at a second splice site resulted in overall reduced expression levels. Consequently, the leakiness in the absence of tetracycline was further minimized and, in most cases, became undetectable. Therefore, we consider the dynamic range in such experiments not very meaningful. However, we have included this value to indicate that stable induction is achieved with this system.

[0262] Influence of connection stem between both aptamers

[0263] Referring to Figure 11, both aptamers of the P2-connected apdimer construct were connected by stems that vary in length and stability. Stabilization of the connection stem resulted in a slightly reduced expression levels with lower background but similar switching efficiency. Destabilization of the connection stem abrogated the switching effect completely, which led us to the conclusion that a minimal stability of the connecting stem is necessary to maintain switching. Slight variations of the connection stem might allow fine-tuning of the expression levels.

[0264] Influence of communication module in HHR type III constructs

[0265] Referring to Figure 12, the Tet_apdimer aptazyme was connected to the HHR type III ribozyme via its P2 stem. Three different communication modules were tested, to evaluate the optimal stability of the in this construct. A slight stabilization of the communication module by one AU base pair results in elevation of the expression levels by ~3x and an improved switching efficiency. Further stabilization of the communication module was causing a higher background and lowering the switching efficiency. Effect of the closing stem on the Tet_apdimer aptazyme

[0266] Referring to Figure 13, three different closing stems (in this case P2 of the original Tetracycline aptamer) were inserted in the tet-apdimer aptazyme construct. Stabilization of the closing stem by an additional GC base pair (Tet_apdimer_stem_2) results in slightly lower expression levels and a similar fold change when compared with the original construct. The same effect was observed when using a stem of slightly lower stability (the P2 stem of the cb28 minimer14). It was concluded that the closing stem can be varied in order to fine-tune expression levels. However, the stability of the closing stem is no indicator for the overall switching levels.

[0267] Effect of the communication modules on the Tet_apdimer HHR construct containing closing stem P2_2

[0268] Referring to Figure 14, two constructs containing closing stem P2_2 and different communication modules (communication module 1 and 2) were tested to compare both effects when combining two aptamers with different communication modules or closing stems. As expected, the shorter communication module (Tet_apdimer_comm_l_2) results in lower gene expression levels and a reduced off-state. However, compared to the communication module that is stabilized by an additional AU base pair, the switching efficiency is lower.Effect of the closing stems on the Tet_apdimer constructs containing communication module 2

[0269] Referring to Figure 15, the best-performing constructs contain an additional AU base pair (communication module 2) and were compared in one measurement. As observed when comparing the effect of closing stem stabilization in constructs containing communication module 1, a slight stabilization of the closing stem causes reduced gene expression levels but similar switching efficiency. In general, it can be concluded that the exact sequence of the closing stem can be varied and has a rather minor effect on the switching performance.

[0270] Connection of the second aptamer via stem P2

[0271] Referring to Figure 16, the second aptamer Tet-HHR construct could be connected via the P2 or Pl stem. In the initial apdimer-construct, the second aptamer was attached via its Pl stem. To test if apdimer constructs can be generated by attaching the aptamer with another stem, a P2-connected construct was designed (Tet_apdimerP2 / P2). In comparison with the one-aptamer version, this constructs switches on a higher level and causes lightly higher background gene expression in absence of the ligand. Nevertheless, a switching effect can still be observed. We concluded that connection via both stems (Pl and P2) is possible, although improving the witching performance might require fine-tuning by modulating the connection stem as performed for the Pl connected second aptamer (see Figure 11).

[0272] Connection of an apdimer via stem Pl

[0273] Referring to Figure 17, the first aptamer of the apdimer can be connected via stem Pl (TetK194). To test if such a construct can be used for the construction of an apdimer, we again connected a second aptamer via its Pl stem (Tet_apdimer Pl / 1) and compared the switching efficiency with the Tet_apdimer_P2 / Pl construct. Please note that the Pl / Pl construct contains two point mutations (G42A) that were observed to increase efficiency and sensitivity of tetracycline switches. Both constructs showed similar switching efficiency of 6-8 fold when applying a concentration of 50 µM tetracycline. We concluded that addition of an second Pl-connected aptamer to the Pl-connected aptamer does not increase the switching efficiency. However, it might be possible to improve the performance by fine-tuning the connection stem as performed for the P2 / P1 connected second aptamer (see Figure 11) or connection of the second aptamer via its P2-stem (see Figure 16).

[0274] Connection of different Tet-apdimer variants in a splicing-based riboswitch construct Referring to Figure 18, three different apdimer constructs were tested in the splicing-based construct to evaluate the best-performing apdimer for this context. Since a P2-connected version with a single aptamer was not available, we tested two different communication modules. Both constructs seemed to have a destabilizing effect. The first version (apdimer_P2_l) was almost completely off, while the more stable construct (apdimer_P2_2) was switching with reduced off-and on-state. In contrast, a Pl-connected construct was available (Tet_splice). Please note that the Pl / Pl construct contains two pointmutations (G42A) that were observed to increase efficiency and sensitivity of tetracycline switches. The Pl-connected apdimer version caused a lower off state and higher on-state, which resulted in a strong improvement of the switching efficiency. It was concluded that this apdimer version shows the highest functionality in the splicing construct. However, varying the stem-stabilities of the P2 / P1 construct has a strong effect on the switching performance and optimization might be possible. Alternative, connection of a P2 / P2 or P1 / P2 apdimer construct might be an alternative.

[0275] Discussion

[0276] RNA-based induction of gene expression is a promising tool for the development of controllable gene therapies. In the past years, many synthetic riboswitches with response to tetracycline and theophylline were developed based on the SELEX-derived aptamers from Jenison etal. and Berens et al.12, 14. Here, we show that riboswitches can be optimized by fusing two aptamer structures on splicing-based riboswitches but also aptazymes. Combination of the improved constructs results in an even higher foldchange and lower background gene expression. We further show that the optimized switches are suitable to control the expression of IL-2, which is used for therapeutic applications.

[0277] Up to now, riboswitch optimization was focused on changing length and composition of communication modules. An exception is the pA-regulator system, which was optimized by adding additional expression platform elements. Also, a fused aptamer structure was integrated to add space for the polyA signal. However, the author optimized the switch by adding a scaffold and integrated a third aptamer instead of optimizing the two-aptamer structure. Since this structure contains a part of the expression platform it might be challenging to integrate it into another riboswitch construct.

[0278] The versatility of the tetracycline aptamer, demonstrated by its applicability in various contexts such as aptazymes, Ul-snRNP-based or splicing-based switches, as well as in more complex systems like the pA regulator, highlights its suitability for integration into diverse environments4-8'15'43'44. This also underlines the robustness of the tetracycline-induced structural changes even when positioned at different locations within the mRNA and surrounded by different sequences. However, we want to point out that some applications could necessitate specific features of the riboswitch platform mechanism, for example independency of transcriptional processes upon application in RNA viruses45'46. To leverage the various designs effectively, an easily implementable optimization strategy could catalyze the emergence of numerous efficient riboswitches based on the preferred mechanism.

[0279] The tetracycline aptamer is a rare example of an in-vitro generated aptamer that is functional in riboswitch designs. Often SELEX-derived aptamers do not transfer a sufficient structural rearrangement upon ligand-binding47. However, the recently developed approach of capture-SELEX holds promise to facilitate the selection of ligand-specific aptamers that undergo structural rearrangement while bound to the ligand48'49. With the development of riboswitch-suitable aptamers capable of binding additional therapeutically applicable ligands with favorable pharmacological properties, riboswitches will become more attractive for therapeutic applications. Since we were also able to optimize theophylline switchesapplying the same strategy of aptamer fusion, we are optimistic that the approach will further advance the development of more efficient riboswitches containing different aptamers.References

[0280] 1. Kallunki, T.; Barisic, M.; Jaattela, M.; Liu, B., How to choose the right inducible gene expression system for mammalian studies? Ce / / s2019, <9 (8), 796.

[0281] 2. Tickner, Z. J.; Farzan, M., Riboswitches for controlled expression of therapeutic transgenes delivered by adeno-associated viral vectors. Pharmaceuticals 2021, 14 (06), 554.

[0282] 3. Tang, J.; Breaker, R. R., Rational design of allosteric ribozymes. Chemistry & biology 1997, 4 (6), 453-459.

[0283] 4. Beilstein, K.; Wittmann, A.; Grez, M.; Suess, B., Conditional control of mammalian gene expression by tetracycline-dependent hammerhead ribozymes. ACS synthetic biology 2015, 4 (5), 526-534.

[0284] 5. Mou, H.; Zhong, G.; Gardner, M. R.; Wang, H.; Wang, Y.-W.; Cheng, D.; Farzan, M., Conditional Regulation of Gene Expression by Ligand-Induced Occlusion of a MicroRN A Target Sequence. Molecular Therapy 2018, 25(5), 1277-1286.

[0285] 6. Spöring, M.; Boneberg, R.; Hartig, J. S., Aptamer-Mediated Control of Polyadenylation for Gene Expression Regulation in Mammalian Cells. ACS Synthetic Biology 2020, 9(11), 3008-3018.

[0286] 7. Finke, M., Splicing-based RNA switches with high dynamic ranges for tetracycline-inducible gene expression in human cell culture and C. elegans. Nucleic Acids Research, submitted, 2019.

[0287] 8. Luo, L.; Jea, J. D.-Y.; Wang, Y.; Chao, P.-W.; Yen, L., Control of mammalian gene expression by modulation of polyA signal cleavage at 5' UTR. Nature Biotechnology 2024, 1-13.

[0288] 9. Mustafina, K.; Fukunaga, K.; Yokobayashi, Y., Design of Mammalian ON-Riboswitches Based on Tandemly Fused Aptamer and Ribozyme. ACS Synthetic Biology 2020, 9(1), 19-25.

[0289] 10. Ellington, A. D.; Szostak, J. W., In vitro selection of RNA molecules that bind specific ligands. nature 1990, 545(6287), 818-822.

[0290] 11. Tuerk, C.; Gold, L., Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase, science 1990, 249(4968), 505-510.

[0291] 12. Jenison, R. D.; Gill, S. C.; Pardi, A.; Polisky, B., High-resolution molecular discrimination by RNA. Science 1994, 263 (5152), 1425-1429.

[0292] 13. Wrist, A.; Sun, W.; Summers, R. M., The theophylline aptamer: 25 years as an important tool in cellular engineering research. ACS Synthetic Biology 2020, 9(4), 682-697.

[0293] 14. Berens, C.; Thain, A.; Schroeder, R., A tetracycline-binding RNA aptamer. Bioorganic & medicinal chemistry 2001, 9(10), 2549-2556.15. Kelvin, D.; Suess, B., Tapping the potential of synthetic riboswitches: reviewing the versatility of the tetracycline aptamer. RNA biology 2023, 20(1), 457-468.

[0294] 16. Wittmann, A.; Suess, B., Selection of tetracycline inducible self-cleaving ribozymes as synthetic devices for gene regulation in yeast. Molecular BioSystems 2011, 7(8), 2419-2427.

[0295] 17. Strobel, B.; Duchs, M. J.; Blazevic, D.; Rechtsteiner, P.; Braun, C.; Baum-Kroker, K. S.; Schmid, B.; Ciossek, T.; Gottschling, D.; Hartig, J. S.; Kreuz, S., A Small-Molecule-Responsive Riboswitch Enables Conditional Induction of Viral Vector-Mediated Gene Expression in Mice. ACS Synthetic Biology 2020, 9 (6), 1292-1305.

[0296] 18. Wurmthaler, L. A.; Sack, M.; Gense, K.; Hartig, J. S.; Gamerdinger, M., A tetracycline-dependent ribozyme switch allows conditional induction of gene expression in Caenorhabditis elegans. Nature communications 2019, 10 (1), 491.

[0297] 19. Duchs, M. J.; Kratzer, R. F.; Vieyra-Garcia, P.; Strobel, B.; Schönberger, T.; GroB, P.; Aljayyoussi, G.; Gupta, A.; Lang, I.; Klein, H., Riboswitch-controlled IL-12 gene therapy reduces hepatocellular cancer in mice. Frontiers in Immunology 2024, 15, 1360063.

[0298] 20. Zhong, G.; Wang, H.; Bailey, C. C.; Gao, G.; Farzan, M. J. E., Rational design of aptazyme riboswitches for efficient control of gene expression in mammalian cells. 2016, 5, el8858.

[0299] 21. Eriksson, R. A. E.; Nieminen, T.; Galibert, L.; Peltola, S. K.; Tikkanen, P.; Kayhty, P.; Leinonen, H. M.; Oruetxebarria, I.; Lepola, S.; Valkama, A. J., Optimized riboswitch-regulated AAV vector for VEGF-B gene therapy. Frontiers in Medicine 2022, 9, 1052318.

[0300] 22. Chern, K. J.; Nettesheim, E. R.; Reid, C. A.; Li, N. W.; Marcoe, G. J.; Lipinski, D. M., Prostaglandin-based rAAV-mediated glaucoma gene therapy in Brown Norway rats. Communications Biology 2022, 5(1), 1169.

[0301] 23. Finke, M.; Brecht, D.; Stifel, J.; Gense, K.; Gamerdinger, M.; Hartig, J. S., Efficient splicingbased RNA regulators for tetracycline-inducible gene expression in human cell culture and C. elegans. Nucleic Acids Research 2021, 49 (12), e71-e71.

[0302] 24. Vogel, M.; Weigand, J. E.; Kluge, B.; Grez, M.; Suess, B., A small, portable RNA device for the control of exon skipping in mammalian cells. Nucleic acids research 2018, 46 (8), e48-e48.

[0303] 25. Kläsener, K.; Jellusova, J.; Andrieux, G.; Salzer, U.; Böhler, C.; Steiner, S. N.; Albinus, J. B.; Cavallari, M.; Süß, B.; Voll, R. E., CD20 as a gatekeeper of the resting state of human B cells. Proceedings of the National Academy of Sciences 2021, 118 (7), e2021342118.

[0304] 26. Luo, L.; Jea, J. D.-Y.; Wang, Y.; Chao, P.-W.; Yen, L., pA regulator: a system for controlling mammalian gene expression via the modulation of polyA signal cleavage. bioRxiv 2023, 2023-01.27. Strobel, B.; Spöring, M.; Klein, H.; Blazevic, D.; Rust, W.; Sayols, S.; Hartig, J. S.; Kreuz, S. J. N. c., High-throughput identification of synthetic riboswitches by barcode-free amplicon-sequencing in human cells. 2020, 11 (1), 1-12.

[0305] 28. Kobori, S.; Nomura, Y.; Miu, A.; Yokobayashi, Y., High-throughput assay and engineering of self-cleaving ribozymes by sequencing. Nucleic acids research 2015, 43 (13), e85-e85.

[0306] 29. Suess, B.; Hanson, S.; Berens, C.; Fink, B.; Schroeder, R.; Hillen, W., Conditional gene expression by controlling translation with tetracycline-binding aptamers. Nucleic acids research 2003, 31 (7), 1853-1858.

[0307] 30. Hanson, S.; Bauer, G.; Fink, B.; Suess, B., Molecular analysis of a synthetic tetracycline-binding riboswitch. RNA 2005, 11 (4), 503-511.

[0308] 31. Win, M. N.; Smolke, C. D., A modular and extensible RNA-based gene-regulatory platform for engineering cellular function. Proceedings of the National Academy of Sciences 2007, 104 (36), 14283-14288.

[0309] 32. Boyne, A. R.; Danos, O. F.; Voiles, M. J.; Guo, X., Regulation of gene expression by aptamer-mediated modulation of alternative splicing. Google Patents: 2019.

[0310] 33. Fukunaga, K.; Dhamodharan, V.; Miyahira, N.; Nomura, Y.; Mustafina, K.; Oosumi, Y.; Takayama, K.; Kanai, A.; Yokobayashi, Y., Small-Molecule Aptamer for Regulating RNA Functions in Mammalian Cells and Animals. Journal of the American Chemical Society 2023, 145 (14), 7820-7828.

[0311] 34. Agwuh, K. N.; MacGowan, A., Pharmacokinetics and pharmacodynamics of the tetracyclines including glycylcyclines. Journal of Antimicrobial Chemotherapy 2006, 58 (2), 256-265.

[0312] 35. Halling-Sørensen, B.; Sengeløv, G.; Tjørnelund, J., Toxicity of tetracyclines and tetracycline degradation products to environmentally relevant bacteria, including selected tetracycline-resistant bacteria. Archives of environmental contamination and toxicology 2002, 42, 263-271.

[0313] 36. Boedtkjer, E.; Pedersen, S. F., The acidic tumor microenvironment as a driver of cancer. Annual review of physiology 2020, 82(1), 103-126.

[0314] 37. Justus, C. R.; Dong, L.; Yang, L. V., Acidic tumor microenvironment and pH-sensing G protein-coupled receptors. Frontiers in physiology 2013, 4, 354.

[0315] 38. Klatzmann, D.; Abbas, A. K., The promise of low-dose interleukin-2 therapy for autoimmune and inflammatory diseases. Nature Reviews Immunology 2015, 15(5), 283-294.

[0316] 39. Noble, S.; Goa, K. L., Aldesleukin (Recombinant Interleukin-2) A Review of its Pharmacological Properties, Clinical Efficacy and Tolerability in Patients with Metastatic Melanoma. BioDrugs 1997, 7, 394-422.40. Pol, J. G.; Caudana, P.; Paillet, J.; Piaggio, E.; Kroemer, G., Effects of interleukin-2 in immunostimulation and immunosuppression. Journal of Experimental Medicine 2020, 217(1).

[0317] 41. Wang, H.; Borlongan, M.; Hemminki, A.; Basnet, S.; Sah, N.; Kaufman, H. L.; Rabkin, S. D.; Saha, D., Viral vectors expressing interleukin 2 for cancer immunotherapy. Human Gene Therapy 2023, 34 (17-18), 878-895.

[0318] 42. Strobel, B.; Duchs, M. J.; Blazevic, D.; Rechtsteiner, P.; Braun, C.; Baum-Kroker, K. S.; Schmid, B.; Ciossek, T.; Gottschling, D.; Hartig, J. r. S., A Small-Molecule-Responsive Riboswitch Enables Conditional Induction of Viral Vector-Mediated Gene Expression in Mice. ACS Synthetic Biology 2020, 9 (6), 1292-1305.

[0319] 43. Rovira, E.; Moreno, B.; Razquin, N.; Blazquez, L.; Hernandez-Alcoceba, R.; Fortes, P.; Pastor, F., Engineering Ul-Based Tetracycline-Inducible Riboswitches to Control Gene Expression in Mammals. ACS nano 2023, 17(23), 23331-23346.

[0320] 44. Mustafina, K.; Nomura, Y.; Rotrattanadumrong, R.; Yokobayashi, Y., Circularly-permuted pistol ribozyme: a synthetic ribozyme scaffold for mammalian riboswitches. ACS Synthetic Biology 2021, 10 (8), 2040-2048.

[0321] 45. Ketzer, P.; Kaufmann, J. K.; Engelhardt, S.; Bossow, S.; Von Kalle, C.; Hartig, J. S.; Ungerechts, G.; Nettelbeck, D. M., Artificial riboswitches for gene expression and replication control of DNA and RNA viruses. Proceedings of the National Academy of Sciences 2014, 111 (5), E554-E562.

[0322] 46. Takahashi, K.; Yokobayashi, Y., Reversible Gene Regulation in Mammalian Cells Using Riboswitch-Engineered Vesicular Stomatitis Virus Vector. ACS Synthetic Biology 2019, 8(9), 1976-1982.

[0323] 47. Hotzel, J.; Suess, B., Structural changes in aptamers are essential for synthetic riboswitch engineering. Journal of Molecular Biology 2022, 167631.

[0324] 48. Spöring, M.; Finke, M.; Hartig, J. S., Aptamers in RNA-based switches of gene expression. Current opinion in biotechnology 2020, 63, 34-40.

[0325] 49. Boussebayle, A.; Groher, F.; Suess, B. J. M., RNA-based capture-SELEX for the selection of small molecule-binding aptamers. 2019, 161, 10-15.

[0326] 50. Zhong, G.; Wang, H.; Bailey, C. C.; Gao, G.; Farzan, M., Rational design of aptazyme riboswitches for efficient control of gene expression in mammalian cells. Elife 2016, 5, e18858.

Claims

1. CLAIMS:

1. A nucleic acid molecule comprising at least one modified aptamer (apdimer), which apdimer comprises (i) at least a portion of a first aptamer comprising a first ligand-binding region and (ii) at least a portion of a second aptamer comprising a second ligand-binding region, wherein the first and second ligand binding regions are positioned relative to each other such that when one of the ligand-binding regions binds to its ligand, the other ligand-binding region binds to its ligand in a positive cooperative manner.

2. The nucleic acid of claim 1, wherein the first aptamer is positioned to the second aptamer through a fusion region.

3. The nucleic acid of claim 2, wherein the fusion region forms a stem structure through base pairing.

4. The nucleic acid of claim 2 or 3, wherein the fusion region comprises a nucleotide sequence of at least 4 nucleotides capable of forming a stem structure of at least 2 nucleotides through base pairing.

5. The nucleic acid of any one of claims 2 to 4, wherein the fusion region comprises at least a portion of the nucleotide sequence of a stem structure of either the first aptamer or the second aptamer.

6. The nucleic acid of any one of claims 2 to 5, wherein the fusion region comprises:(i) at least a portion of the nucleotide sequence of the Pl stem of the first aptamer, or(ii) at least a portion of the nucleotide sequence of the P2 stem of the first aptamer, or(iii) at least a portion of the nucleotide sequence of the Pl stem of the second aptamer, or(iv) at least a portion of the nucleotide sequence of the P2 stem of the second aptamer.

7. The nucleic acid of any one of claims 2 to 6, wherein the fusion region comprises:(i) at least a portion of the nucleotide sequence of the Pl stem of the first aptamer and at least a portion of the nucleotide sequence of the Pl stem of the second aptamer, or(ii) at least a portion of the nucleotide sequence of the Pl stem of the first aptamer and at least a portion of the nucleotide sequence of the P2 stem of the second aptamer, or(iii) at least a portion of the nucleotide sequence of the P2 stem of the first aptamer and at least a portion of the nucleotide sequence of the Pl stem of the second aptamer, or(iv) at least a portion of the nucleotide sequence of the P2 stem of the first aptamer and at least a portion of the nucleotide sequence of the P2 stem of the second aptamer.

8. The nucleic acid of any one of claims 2 to 4, wherein the fusion region comprises a heterologous linker sequence capable of forming a stem structure through base pairing located between the first aptamer and the second aptamer.

9. The nucleic acid of any one of claims 2 to 7, wherein the fusion region further comprises a heterologous linker sequence capable of forming a stem structure through base pairing.

10. The nucleic acid of claim 8 or 9, wherein the stem structure formed by the linker is between about 2 and about 30 nucleotides in length representing a total number of about 4 to about 60 nucleotides comprised within the nucleic acid.

11. The nucleic acid of any one of claims 8 to 10, wherein the stem structure formed by the linker is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,15, 16, 17, 18, 19, 20, 21,22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.

12. The nucleic acid of any one of claims 8 to 11, wherein the stem structure formed by the linker is between about 1 and about 5 or between about 3 and about 7 or between nucleotides in length.

13. The nucleic acid of any one of claims 8 to 12, wherein the linker connects the respective stem sequences of the first aptamer and the second aptamer.

14. The nucleic acid of any one of claims 1 to 13, wherein the first ligand-binding region and the second ligand-binding region are in a cis-conformation or in a trans-conformation within the apdimer.

15. The nucleic acid of any one of claims 1 to 14, which apdimer further comprises an effector region, which effector region undergoes an allosteric change in response to ligand binding to at least one of the ligand-binding regions.

16. The nucleic acid of claim 15, wherein the effector region comprises a 5' splice site.

17. The nucleic acid of claim 15, wherein the effector region comprises a 3' splice site.

18. The nucleic acid of claim 15, wherein the effector region comprises a ribozyme.

19. The nucleic acid of claim 15, wherein the effector region comprises a ribonuclease recognition sequence.

20. The nucleic acid of claim 15, wherein the effector region comprises a poly A sequence, a U1 snRNA binding site, an internal ribosome entry site, a viral translation reinitiation site, an miRNA, an miRNA target site, a ribosomal frameshift sequence or an mRNA stabilizing structure.

21. The nucleic acid of any one of claims 1 to 20, wherein the nucleotide sequence of the at least portion of the first aptamer and / or the nucleotide sequence of the at least portion of the second aptamer comprise one or more nucleotide additions, deletions or substitutions.

22. The nucleic acid of any one of claims 1 to 21, wherein the ligand is an ion, amino acid, peptide, small molecule ligand or nucleic acid.

23. The nucleic acid of any one of claims 1 to 22, wherein the first ligand-binding region and the second ligand-binding region bind to the same ligand.

24. The nucleic acid of any one of claims 1 to 22, wherein the first ligand-binding region and the second ligand-binding region bind to different ligands.

25. The nucleic acid of any one of claims 1 to 24, wherein ligand binding to one ligand-binding domain affects the binding affinity of ligand binding to the other ligand-binding domain.

26. The nucleic acid of claim 25, wherein the binding affinity is increased.

27. The nucleic acid of any one of claims 1 to 26, wherein ligand binding to one ligand-binding domain stabilizes ligand binding to the other ligand-binding domain.

28. The nucleic acid of any one of claims 1 to 27, wherein the apdimer comprises the nucleotide sequence set out in any one of SEQ ID NOs: 2, 3, 4, 7, 8, 9, 12, 13, 19, 20, 21, or 22.

29. A riboswitch for the regulation of the expression of a target gene in mammalian cells comprising:a nucleic acid comprising at least one modified aptamer (apdimer), which apdimer comprises:(i) at least a portion of a first aptamer comprising a first ligand-binding region, (ii) at least a portion of a second aptamer comprising a second ligand-binding region, wherein the first and second ligand binding regions are positioned relative to each other such that when one of the ligand-binding regions binds to its ligand, the other ligand-binding region binds to its ligand in a positive cooperative manner, and(iii) an effector region, which effector region undergoes an allosteric change in response to ligand binding to at least one or all of the ligand-binding regions.

30. The nucleic acid of claim 29, wherein the first aptamer is positioned to the second aptamer through a fusion region.

31. The nucleic acid of claim 30, wherein the fusion region forms a stem structure through base pairing.

32. The nucleic acid of claim 30 or 31, wherein the fusion region comprises a nucleotide sequence of at least 4 nucleotides capable of forming a stem structure of at least 2 nucleotides through base pairing.

33. The nucleic acid of any one of claims 30 to 32, wherein the fusion region comprises at least a portion of the nucleotide sequence of a stem structure of either the first aptamer or the second aptamer.

34. The nucleic acid of any one of claims 30 to 33, wherein the fusion region comprises:(i) at least a portion of the nucleotide sequence of the Pl stem of the first aptamer, or(ii) at least a portion of the nucleotide sequence of the P2 stem of the first aptamer, or(iii) at least a portion of the nucleotide sequence of the Pl stem of the second aptamer, or(iv) at least a portion of the nucleotide sequence of the P2 stem of the second aptamer.

35. The nucleic acid of any one of claims 30 to 34, wherein the fusion region comprises:(i) at least a portion of the nucleotide sequence of the Pl stem of the first aptamer and at least a portion of the nucleotide sequence of the Pl stem of the second aptamer, or(ii) at least a portion of the nucleotide sequence of the Pl stem of the first aptamer and at least a portion of the nucleotide sequence of the P2 stem of the second aptamer, or(iii) at least a portion of the nucleotide sequence of the P2 stem of the first aptamer and at least a portion of the nucleotide sequence of the Pl stem of the second aptamer, or(iv) at least a portion of the nucleotide sequence of the P2 stem of the first aptamer and at least a portion of the nucleotide sequence of the P2 stem of the second aptamer.

36. The nucleic acid of any one of claims 30 to 32, wherein the fusion region comprises a heterologous linker sequence capable of forming a stem structure through base pairing located between the first aptamer and the second aptamer.

37. The nucleic acid of any one of claims 30 to 35, wherein the fusion region further comprises a heterologous linker sequence capable of forming a stem structure through base pairing.

38. The nucleic acid of claim 36 or 37 wherein the stem structure formed by the linker is between about 2 and about 30 nucleotides in length representing a total number of about 4 to about 60 nucleotides comprised within the nucleic acid.

39. The nucleic acid of any one of claims 35 to 38, wherein the stem structure formed by the linker is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,15, 16, 17, 18, 19, 20, 21,22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.

40. The nucleic acid of any one of claims 35 to 39, wherein the stem structure formed by the linker is between about 1 and about 5 or between about 3 and about 7 or between nucleotides in length.

41. The nucleic acid of any one of claims 35 to 40, wherein the linker connects the respective stem sequences of the first aptamer and the second aptamer.

42. The nucleic acid of any one of claims 29 to 41, wherein the first ligand-binding region and the second ligand-binding region are in a cis-conformation or in a trans-conformation within the apdimer.

43. The nucleic acid of any one of claims 29 to 42, wherein the effector region comprises a 5' splice site.

44. The nucleic acid of any one of claims 29 to 42, wherein the effector region comprises a 3' splice site.

45. The nucleic acid of any one of claims 29 to 42, wherein the effector region comprises a ribozyme.

46. The nucleic acid of any one of claims 29 to 42, wherein the effector region comprises a ribonuclease recognition sequence.

47. The nucleic acid of any one of claims 29 to 42, wherein the effector region comprises a poly A sequence, a U1 snRNA binding site, an internal ribosome entry site, a viral translation reinitiation site, an miRNA, an miRNA target site, a ribosomal frameshift sequence or an mRNA stabilizing structure.

48. The nucleic acid of any one of claims 29 to 47, wherein the nucleotide sequence of the at least portion of the first aptamer and / or the nucleotide sequence of the at least portion of the second aptamer comprise one or more nucleotide additions, deletions or substitutions.

49. The nucleic acid of any one of claims 29 to 48, wherein the ligand is an ion, amino acid, peptide, small molecule ligand, or nucleic acid.

50. The nucleic acid of any one of claims 29 to 49, wherein the first ligand-binding region and the second ligand-binding region bind to the same ligand.

51. The nucleic acid of any one of claims 29 to 49, wherein the first ligand-binding region and the second ligand-binding region bind to different ligands.

52. The nucleic acid of any one of claims 29 to 51, wherein ligand binding to one ligand-binding domain affects the binding affinity of ligand binding to the other ligand-binding domain.

53. The nucleic acid of claim 52, wherein the binding affinity is increased.

54. The nucleic acid of any one of claims 29 to 53, wherein ligand binding to one ligand-binding domain facilitates and / or stabilizes ligand binding to the other ligand-binding domain.

55. The nucleic acid of any one of claims 29 to 54, wherein the apdimer comprises the nucleotide sequence set out in any one of SEQ ID NOs: 2, 3, 4, 7, 8, 9, 12, 13, 19, 20, 21, or 22.

56. An expression cassette comprising a riboswitch of any one of claims 28 to 55 operably linked to a target gene comprising an open reading frame encoding a gene product, wherein the at least portion of the first aptamer of the riboswitch is proximal to the open reading frame and the at least portion of the second aptamer of the riboswitch is distal to the open reading frame.

57. The expression cassette of claim 56, wherein the gene product is an RNA molecule or a peptide or protein.

58. The expression cassette of claim 56 or 57, wherein the allosteric change results in the increased expression of the gene product.

59. The expression cassette of claim 56 or 57, wherein the allosteric change results in the decreased expression of the gene product.

60. The expression cassette of any one of claims 56 to 59, wherein the effector region of the riboswitch is linked to the proximal aptamer of the apdimer.

61. The expression cassette of claim 60, wherein the effector region is linked to the 5' terminus of the apdimer.

62. The expression cassette of claim 60, wherein the effector region is linked to the 3' terminus of the apdimer.

63. The expression cassette of claim 60, wherein the effector region is comprised within the proximal aptamer of the apdimer.

64. The expression cassete of any one of claims 56 to 63, wherein the riboswitch is inserted into the 5’ untranslated region of the target gene.

65. The expression cassete of any one of claims 56 to 63, wherein the riboswitch is inserted into the 3’ untranslated region of the target gene.

66. The expression cassette of any one of claims 56 to 63, wherein the riboswitch is inserted downstream of the translation start codon.

67. The expression cassette of any one of claims 56 to 63, wherein the riboswitch is inserted into an intron comprised within the target gene.

68. A vector comprising the expression cassette of any one of claims 56 to 67.

69. The vector of claim 68, wherein the vector is a viral vector.

70. The vector of claim 69, wherein the viral vector is an oncolytic viral vector.

71. The vector of claim 70, wherein the oncolytic viral vector is a measles virus.

72. A method of modulating the expression of a target gene in a mammalian comprising (i) introducing the expression cassette of any one of claims 56 to 67 into a mammalian cell, and (ii) exposing the cell to a ligand that specifically binds at least one of the ligand-binding regions of the apdimer in an amount effective to modulate expression of the target gene.