Ultra-small metallic nanoparticles

WO2026181080A1PCT designated stage Publication Date: 2026-09-03RAMOT AT TEL AVIV UNIVERSITY LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/IL2026/050189
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-07-30
Filing Date
2026-02-26
Publication Date
2026-09-03

Smart Images

  • Figure IL2026050189_03092026_PF_FP_ABST
    Figure IL2026050189_03092026_PF_FP_ABST
Patent Text Reader

Abstract

Metal nanoparticles comprising at least one metal atom and a ligand associated with at least a portion of a surface of the metal atom, and uses thereof, are provided. The ligand is made of a first moiety (denoted as X) that is capable of associating with the surface of the metal atom; and an additional moiety (denoted as Y) which is a redox-reactive moiety and / or a second moiety that is capable of associating with the surface of the metal atoms, and optionally a linking moiety that links the first moiety and the additional moiety. The metal nanoparticles are ultra-small nanoparticles. The metal nanoparticles are usable in, for example, catalyzing redox reactions and as coatings for varying surfaces, and are capable of interacting with a myriad of substances, such as liposomes and oligonucleotides, rendering these nanoparticles usable in varying applications.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] ULTRA-SMALL METALLIC NANOPARTICLES

[0002] RELATED APPLICATION / S

[0003] This application claims the benefit of priority of U. S. Provisional Application Nos. 63 / 763,377, filed on February 26, 2025 and 63 / 853,999 filed on July 30, 2025. The contents of which are incorporated herein by reference in their entirety.

[0004] FIELD AND BACKGROUND OF THE INVENTION

[0005] The present invention, in some embodiments thereof, relates to material science and, more particularly, but not exclusively, to newly designed ultra-small metal nanoparticles, a process of preparing same, and to exemplary uses thereof.

[0006] Ultra-small gold nanoparticles are widely used in technological and biomedical applications. These particles have been employed in detection of biomolecules, in delivery of biomolecules into cancer and other pathological cells and in many other applications.

[0007] Heretofore, ultra-small gold nanoparticles have been synthesized using two main approaches (see, e.g., Background Art FIG. 1).

[0008] The first approach, introduced by Schmid et al. in 1981 [Schmid et al. Chem. Ber. 1981, 114, (11), 3634-3642], involves the reduction of gold ions with a strong diborane reducing agent in an apolar medium, stabilized by triphenylphosphine (PPh₃). This process produces uniform gold nanoparticles, approximately 1.4 nm in diameter, each consisting of 55 gold atoms (Au₅₅). These PPh₃-capped particles can undergo slow ligand exchange to incorporate hydrophilic phosphines or thiol-containing ligands, enabling water solubility [Warner et al. Chem. Mater. 2000, 12, 11, 3316— 3320: Schmid, G. Chem. Soc. Rev. 2008, Issue 9; Schmid, G. and Corain, B. European Journal of Inorganic Chemistry. 2003, 17, 3081-3098; Schmid et al. Polyhedron, 1988, 7(8), 1988, 605-608-]. Today, these nanoparticles are commercially available and are utilized in chemical and biological research.

[0009] The second approach, developed by Brust et al. [J. Chem. Soc. Chem. Commun. 1994, Issue 7], employs thiol-containing ligands to stabilize nanoparticles during synthesis and leads to highly uniform gold clusters with defined numbers of atoms and thiol ligands. Advanced characterization techniques have allowed researchers to study these particles at the atomic level [Azubel and Kornberg, Nano Lett. 2016, 16(5), 3348-3351; Levi-Kalisman et al. Nanoparticles. J. Am. Chem. Soc. 2011, 133(9), 2976-2982; Azubel et al. ACS Nano 2017, 11, 12, 11866-11871; Jadzinsky et al. Science (80) 2007, 318(5849), 430-433.; Azubel et al. Science (80) 2014, 345, 6199, 909-912],The thiol ligands on these nanoparticles can be exchanged for other thiol-containing molecules [Heinecke et al. J. Am. Chem. Soc. 2012, 134, 32, 13316-13322; Hong et al. Chem. Commun. 2006, Issue 22], making them versatile tools for interaction with biomolecules, including thiolated single- stranded DNA (ssDNA) oligonucleotides [Levi-Kalisman et al., Nanoparticles. J. Am. Chem. Soc. 2011, 133, 9, 2976-2982], and other thiol-functionalized compounds.

[0010] Briand [Dalton Trans., 2023, 52, 17666] describes the use of redox-active (non-innocent) ligands (e.g., O-amidophenolates, catecholates, ferrocenyl, and porphyrinates) that are capable of reversible electron transfer and can influence the redox properties of coordinated main group metal complexes, enabling transformations such as oxidative addition and reductive elimination despite the metals' limited intrinsic redox flexibility.

[0011] Xiong et al. [Green Chem., 2011, 13, 900] describes the preparation of nanosized copper particles via the reduction of Cu2+ions in the presence of high concentrations (0.4-1 M) of L-ascorbic acid at 80 °C. This process yields copper particles having a diameter of about 1.34 ± 0.14 nm, however, the process is relatively slow, as it requires about 16 hours to produce the particles.

[0012] Ciganda et al. [Chem. Commun., 2014, 50, 10126] describes gold nanoparticles capped with weakly coordinated triazole-based ligands that stabilize the particles and allow the gold core to participate in a catalytic proton reduction reaction via the formation of a gold hydride (Au-H) intermediate.

[0013] Jędrzejewski et al. [J. Phys. Chem. C, 2025, 129, 8902-8914] describes polyaniline-functionalized gold nanoparticles (“PANI@AuNPs”), in which the polyaniline forms a redox-active conductive shell around the gold core. The PANI@AuNPs are capable of undergoing reversible redox transitions, and were designed and used in a platform for electrochemical surface-enhanced Raman spectroscopy analysis (EC-SERS).

[0014] Savchenko et al. [J. Am. Chem. Soc. 2024, 146, 22208-22219] describes gold NPs stabilized by various capping agents, including aromatic and aliphatic thiols and citric acid, and studies the influence of these capping agents on the electrochemical oxidation peak potentials of the nanoparticles when adsorbed on electrode surfaces. The study shows that the nature of the capping ligand affects the redox behavior of the gold NPs, both thermodynamically and kinetically.

[0015] Katrivas et al. [Nanomaterials, 2023, 13, 3080] describes ultra-small GNPs coated by adenosine triphosphate (ATP) as a capping ligand, which are capable of binding non-hybridized regions in the DNA. The ultra-small ATP-coated GNPs are prepared under mildly alkaline conditions (2 mM KOH) and at low gold ion concentration (20 pM)), and feature an average particles size of 1.5 ± 0.5 nm or 2 ± 0.4 nm (according to AFM or HR-TEM measurements, respectively).Additional background art includes Noskov et al. arXiv, 2507.19001, 25 July 2025; WO 2024 / 216261; and Proshkina et al. Cancers (2021), 13, 5235.

[0016] SUMMARY OF THE INVENTION

[0017] According to an aspect of some of any of the embodiments of the invention, there is provided a metal nanoparticle comprising at least one metal atom and a ligand associated with at least a portion of a surface of the metal atom, wherein the ligand is represented by:

[0018] X-L-Y

[0019] wherein:

[0020] L is a linking moiety or is absent;

[0021] X is a first moiety that is capable of associating with the surface of the metal atoms; and Y is a redox-reactive moiety and / or a second moiety that is capable of associating with the surface of the metal atoms.

[0022] According to some embodiments of any of the embodiments described herein, the metal is selected from gold, copper, silver, manganese, cobalt, palladium, platinum, ruthenium, rhodium, and nickel.

[0023] According to some embodiments of any of the embodiments described herein, the metal is gold.

[0024] According to some embodiments of any of the embodiments described herein, X is or comprises at least one group that has a dissociation constant KD with the surface of the metal atom that is higher than 1 nano molar and lower than 100 micromolar.

[0025] According to some embodiments of any of the embodiments described herein, the dissociation constant KD ranges from 100 nanomolar to 100 micromolar, or from 1 micromolar to 100 micromolar, or from 10 micromolar to 100 micromolar.

[0026] According to some embodiments of any of the embodiments described herein, X is or comprises an amine group.

[0027] According to some embodiments of any of the embodiments described herein, X is or comprises a nitrogen-containing heterocyclic group.

[0028] According to some embodiments of any of the embodiments described herein, X is or comprises a nitrogen-containing heteroaryl.

[0029] According to some embodiments of any of the embodiments described herein, X is or comprises a purine or pyrimidine.According to some embodiments of any of the embodiments described herein, is or comprises a nucleobase.

[0030] According to some embodiments of any of the embodiments described herein,

[0031]

[0032] is or comprises a nucleoside or a nucleotide.

[0033] According to some embodiments of any of the embodiments described herein,

[0034]

[0035] is or comprises adenine.

[0036] According to some embodiments of any of the embodiments described herein,

[0037]

[0038] is or comprises at least one group that has a dissociation constant KD with the metal surface higher than 1 nanomolar and lower than 100 micromolar.

[0039] According to some embodiments of any of the embodiments described herein, the dissociation constant KD ranges from 100 nanomolar to 100 micromolar, or from 1 micromolar to 100 micromolar, or from 10 micromolar to 100 micromolar.

[0040] According to some embodiments of any of the embodiments described herein, the linking moiety, if present, is such that both X and Y are associated with the surface of the metal atoms, that is, is such that allows that both X and Y be associated with the surface of the metal atoms.

[0041] According to some embodiments of any of the embodiments described herein, Y is a redox-reactive moiety.

[0042] According to some embodiments of any of the embodiments described herein, Y is or comprises a nicotinamide moiety.

[0043] According to some embodiments of any of the embodiments described herein, the ligand is derived from a cofactor.

[0044] According to some embodiments of any of the embodiments described herein, the ligand is or comprises an oxidoreductase cofactor.

[0045] According to some embodiments of any of the embodiments described herein, the ligand is or comprises nicotinamide adenine dinucleotide (NAD), flavin adenine dinucleotide (FAD), nicotinamide adenine dinucleotide phosphate (NADP), folic acid, acetyl-CoA, cyanocobalamin and any combination thereof.

[0046] According to some embodiments of any of the embodiments described herein, the ligand is or comprises NAD.

[0047] According to some embodiments of any of the embodiments described herein, Y is or comprises a targeting moiety (e.g., a moiety that is capable of interacting with a cell-surface moiety that is overexpressed in diseased cells such as cancer cell; for example, the targeting moiety is or comprises a ligand of a receptor that is overexpressed in cancer cells).According to some embodiments of any of the embodiments described herein, the ligand is or comprises FAD.

[0048] According to some embodiments of any of the embodiments described herein, the metal nanoparticle as described herein in any of the respective embodiments has a mean diameter lower than 5 nm, or lower than 3 nm, or lower than 2 nm.

[0049] According to some embodiments of any of the embodiments described herein, the metal nanoparticle as described herein in any of the respective embodiments has an average relative size distribution (a ratio of a standard deviation to an average particle diameter) of up to 30 %.

[0050] According to some embodiments of any of the embodiments described herein, the metal nanoparticle as described herein in any of the respective embodiments comprises up to 200 metal atoms, e.g., in a range of from 10 to 200, or from 20 to 200, or from 30 to 200, or from 40 to 200, or from 50 to 200, or from 80 to 200, or from 90 to 200, or from 100 to 200, or from 10 to 150, or from 20 to 150, or from 30 to 150, or from 40 to 150, or from 50 to 150, or from 80 to 150, or from 100 to 150, or from 10 to 100, or from 20 to 100, or from 30 to 100, or from 40 to 100, or from 50 to 100, or from 80 to 120, metal atoms.

[0051] According to an aspect of some of any of the embodiments of the invention, there is provided a process of preparing the metal nanoparticle as described herein in any of the respective embodiments, the process comprising:

[0052] contacting the ligand with an ion of the metal to form an ionic metal complex, and contacting the ionic metal complex with a reducing agent to thereby form the metal nanoparticle.

[0053] According to some embodiments of any of the embodiments described herein, a molar (mol per liter) ratio between the ligand and the ion of the metal is from 1:1 and up to 50: 1, or up to 25: 1, or up to 10:1, or up to 5:1, for example, in a range of from 1:1 to 50:1, or from 1:1 to 25:1 or from 1:1 to 20:1, or from 1:1 to 10:1, or from 1:1 to 5:1, or is about 1:1.

[0054] According to some embodiments of any of the embodiments described herein, Y is a redox-reactive moiety, and the metal nanoparticle is for use as a catalyst in a redox reaction.

[0055] According to some embodiments of any of the embodiments described herein, X is or comprises a nucleobase, and the metal nanoparticle is capable of associating with a single-stranded oligonucleotide, to thereby form the oligonucleotide decorated by the metal nanoparticle.

[0056] According to some embodiments of any of the embodiments described herein, the metal nanoparticle as described herein in any of the respective embodiments is for use in labeling an oligonucleotide, and / or for detecting non-paired nucleotides in an oligonucleotide.According to some embodiments of any of the embodiments described herein, the metal nanoparticle as described herein in any of the respective embodiments is for use in a reaction in which displacement of the ligand (e.g., ligand exchange) is beneficial.

[0057] According to an aspect of some of any of the embodiments of the invention, there is provided a composition comprising a lipid bilayer associated with the metal nanoparticle as described herein in any of the respective embodiments.

[0058] According to an aspect of some of any of the embodiments of the invention, there is provided a cosmetic product comprising the composition as described herein in any of the respective embodiments.

[0059] According to an aspect of some of any of the embodiments of the invention, there is provided a composition-of-matter comprising a substrate and a plurality of metal nanoparticles associated with at least a portion of a surface of the substrate, wherein in at least a portion of the plurality of metal nanoparticles, each nanoparticle is the metal nanoparticle as described herein in any of the respective embodiments and any combination thereof.

[0060] According to some embodiments of any of the embodiments described herein, the plurality of metal nanoparticles forms together a film deposited on at least a portion of the surface of the substrate.

[0061] According to some embodiments of any of the embodiments described herein, a thickness of the film is lower than 5 nm, or lower than 2 nm, or is in a range of from 0.8 to 5 nm, or from 1 to 2 nm, such that the film is a thin film.

[0062] According to some embodiments of any of the embodiments described herein, the thin film is a monolayer formed of the plurality of metal nanoparticles.

[0063] According to some embodiments of any of the embodiments described herein, the plurality of metal nanoparticles covers at least 30 %, or at least 50 %, or at least 80 %, or at least 90 %, or at least 95 %, or all, of the surface of the substrate.

[0064] According to some embodiments of any of the embodiments described herein, the surface of the substrate is or comprises silicon.

[0065] According to some embodiments of any of the embodiments described herein, the surface of the substrate is or comprises HF-treated silicon.

[0066] According to some embodiments of any of the embodiments described herein, the surface of the substrate is or comprises a silicate mineral.

[0067] According to some embodiments of any of the embodiments described herein, the surface of the substrate is or comprises mica.

[0068] According to an aspect of some of any of the embodiments of the invention, there is provided a process for preparing the composition-of-matter as described herein in any of the respectiveembodiments, the process comprising contacting the substrate with a suspension that comprises a vehicle and the plurality of metal nanoparticles, to thereby obtain the composition-of-matter.

[0069] According to some embodiments of any of the embodiments described herein, the suspension further comprises a salt.

[0070] According to some embodiments of any of the embodiments described herein, the salt is a monovalent salt.

[0071] According to some embodiments of any of the embodiments described herein, the salt is or comprises KC1.

[0072] According to some embodiments of any of the embodiments described herein, the vehicle is or comprises water and the suspension is an aqueous suspension.

[0073] According to some embodiments of any of the embodiments described herein, the contacting comprises depositing the suspension onto the substrate.

[0074] According to some embodiments of any of the embodiments described herein, the contacting is for a period of at least 30 minutes, or at least 45 minutes, or at least 1 hour, or at least 3 hours (e.g., depending on the desired thickness of the deposited film).

[0075] According to some embodiments of any of the embodiments described herein, the salt is present in the suspension at a concentration of at least 10 mM, or at least 50 mM, or at least 70 mM, or at least 0.1 M, or is in a range of from 10 mM to 1 M (e.g., depending on the desired thickness of the deposited film and / or the average size of the plurality of the metal nanoparticles).

[0076] According to some embodiments of any of the embodiments described herein, the plurality of metal nanoparticles form a thin film on at least a portion of the surface of the substrate, and a thickness of the film and / or a surface coverage are determined by the time period of the contacting, an average size of the plurality of metal nanoparticles, a concentration and / or identity of the salt, a concentration of the plurality of metal nanoparticles in the suspension and / or a chemical composition of the substrate.

[0077] According to an aspect of some of any of the embodiments of the invention, there is provided an article-of-manufacturing comprising the composition-of-matter as described herein in any of the respective embodiments.

[0078] According to some embodiments of any of the embodiments described herein, the article-of-manufacturing is an optical article or device and / or a semiconductor article or device, or a part thereof.

[0079] According to an aspect of some of any of the embodiments of the invention, there is provided a composition-of-matter as described herein in any of the respective embodiments, for use in heterogeneous catalysis.Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and / or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

[0080] Implementation of the method and / or system of embodiments of the invention can involve performing or completing selected tasks manually, automatically, or a combination thereof. Moreover, according to actual instrumentation and equipment of embodiments of the method and / or system of the invention, several selected tasks could be implemented by hardware, by software or by firmware or by a combination thereof using an operating system.

[0081] For example, hardware for performing selected tasks according to embodiments of the invention could be implemented as a chip or a circuit. As software, selected tasks according to embodiments of the invention could be implemented as a plurality of software instructions being executed by a computer using any suitable operating system. In an exemplary embodiment of the invention, one or more tasks according to exemplary embodiments of method and / or system as described herein are performed by a data processor, such as a computing platform for executing a plurality of instructions. Optionally, the data processor includes a volatile memory for storing instructions and / or data and / or a non-volatile storage, for example, a magnetic hard-disk and / or removable media, for storing instructions and / or data. Optionally, a network connection is provided as well. A display and / or a user input device such as a keyboard or mouse are optionally provided as well.

[0082] BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S)

[0083] Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.

[0084] In the drawings:

[0085] FIG. 1 (Background Art) presents schematic illustrations of exemplary gold nanoparticles (GNP) featuring thiol-containing ligands, prepared by currently practiced methodologies for preparing GNPs.FIG. 2 presents a schematic illustration of an exemplary gold nanoparticle having exemplary NAD ligands associated therewith, and the 2D chemical structure of NAD.

[0086] FIG. 3 presents an exemplary synthetic scheme of preparing gold nanoparticles according to some embodiments of the present invention.

[0087] FIG. 4A presents HR-TEM image analysis of exemplary gold nanoparticles according to some embodiments of the present invention, NAD-GNPs.

[0088] FIG. 4B presents a diagram showing statistics of particle diameter distribution of exemplary gold nanoparticles according to some embodiments of the present invention, NAD-GNPs, measured by ImageJ software.

[0089] FIG. 4C presents atomic force microscopy (AFM) image of gold nanoparticles according to some embodiments of the present invention, NAD-GNPs. Scale bar is 0.2 micron.

[0090] FIG. 4D presents a diagram showing distribution of height analysis of the particles by Scanning Probe Image Processor (SPIP) software.

[0091] FIGs. 5A-E present Cryo-TEM images of L-a-phosphatidylcholine liposomes (Avanti Polar Lipids, Soy 40 %, 341602) (FIG. 5A) and exemplary metal NPs, NAD-GNPs, associated to the liposomes (FIG. 5B); a schematic illustration of a liposome having GNPs according to embodiments of the present invention associated with the bilayer membrane thereof nanoparticles (FIG. 5C); a photograph showing an exemplary separation process by size-exclusion chromatography (Sepharose CL-2B) for obtaining the exemplary NAD-GNPs-associated with liposomes from unassociated NAD-GNPs (FIG. 5D); and a photograph showing a separation process by size-exclusion chromatography (similar to the one described for FIG. 5D), performed after pursuing a similar procedure for the association of liposomes with NAD-BSPP-GNPs (NAD-GNPs that contain the strongly-coordinating ligand bis(p-sulfonatophenyl)phenylphosphine (BSPP)).

[0092] FIG. 6A presents comparative scatter plots showing the decrease in the concentration of NADH (in reactions comprising a buffer containing 10 mM potassium phosphate (pH 7.5), 150 mM NaCl, and 160 pM NADH), indicating oxidation of NADH by molecular oxygen catalyzed by exemplary metal NPs according to some embodiments of the present invention, NAD-GNPs or FAD-GNPs, or by commercially available GNPs (negatively-charged 1.4 nm GNPs), as indicated.

[0093] FIG. 6B is a schematic illustration of the oxidation process catalyzed by an exemplary metal NPs according to some embodiments of the present invention, NAD-GNPs, in which an electron generated by NADH is transferred through the metal nanoparticle to generate reduced oxygen radical.

[0094] FIGs. 6C-D present comparative plots showing the change in absorption following the addition of metal NPs according to some embodiments of the present invention, NAD-GNPs to a solution containing NADH and oxidized cytochrome c, indicating that the metal NPs catalyze the reduction ofcytochrome c by NADH (FIG. 6C), and a schematic illustration of a suggested mechanism for this redox process, showing that NADH donates electrons to the exemplary metal nanoparticles, which then transfer them either directly to cytochrome c, or to molecular oxygen, reducing it to radical species which then can transfer electrons to cytochrome c, resulting in the reduction of cytochrome c (FIG. 6D).

[0095] FIG. 7A is a schematic illustration exemplifying the displacement of an exemplary ligand, NAD, by DNA as an exemplary substance, on the nanoparticle’s surface.

[0096] FIG. 7B is a schematic illustration showing the preparation of pUC 19(3 AGA) following steps 1-3: The plasmid pUC19 was linearized using a pair of restriction endonucleases, EcoRI and HindIII (step 1). A double-stranded DNA fragment containing a central 3A-3A mismatch and sticky ends complementary to those of the cleaved plasmid was then annealed and inserted (step 2). Ligation of the construct (step 3) resulted in the formation of a circular plasmid harboring the 3A / 3A mismatched region.

[0097] FIGs. 7C-D present AFM characterization of an interaction of the plasmid formed by the process schematically illustrated in FIG. 7B, pUC 19(3 AGA), with the exemplary metal NPs, NAD-GNPs, before (FIG. 7C) and after (FIG. 7D) the addition of ascorbate and gold ions that resulted in the enlargement of the NPs, indicating binding of the exemplary NAD-GNPs to the 3A / 3A mismatched region of the DNA. Scale bars are 1 micron.

[0098] FIGs. 8A-B present an AFM image of copper nanoparticles according to some embodiments of the present invention, Cu-NAD-NPs (FIG. 8A); and a diagram showing the height analysis of the metal nanoparticles shown in FIG. 8A (FIG. 8B), as analyzed by Gwyddion (available online at gwyddion(dot)net). Scale bar in FIG. 8A is 1 micron.

[0099] FIGs. 9A-B present absorption spectra of metal nanoparticles according to some embodiments of the present invention, Cu-NAD-NPs, measured immediately after preparation (FIG. 9A) and following incubation under ambient conditions for 5 days (FIG. 9B).

[0100] FIGs. 10A-C present absorption spectra obtained at different times during (T=0 seconds) and following (from 15 to 240 seconds) the addition of metal nanoparticles according to some embodiments of the present invention, Cu-NAD-NPs (3 pM in 10 mM HEPES-K buffer (pH 7.5)), to ascorbate (ASC) in the presence of molecular oxygen (FIG. 10A); comparative scatter plot showing the time-dependent absorbance of ascorbate at 265 nm in the absence and presence of the exemplary metal nanoparticles, Cu-NAD-NPs, as indicated (FIG. 10B); and a schematic illustration of the mechanism of the oxidation process catalyzed by a redox-reactive metal NPs according to some embodiments of the present invention, Cu-NAD-NPs, in which the nanoparticle accepts an electronfrom ascorbate (“ASC”) and transfers it to molecular oxygen, completing the oxidation reaction (FIG.

[0101] 10C).

[0102] FIGs. 11A-C present AFM images (obtained in a semi-contact mode) of mica surfaces following 15 minutes (FIG. 11A), 1 hour (FIG. 11B), and 5 hours (FIG. 11C) incubation with 15-nm BSPP-GNPs in the presence of KC1 at a final concentration of 70 mM. Scale bars are 100 nm.

[0103] FIGs. 12A-C present AFM images (obtained in a semi-contact mode; FIGs. 12A-B) and SEM characterizations (FIG. 12C) of mica surfaces following 5 hours incubation with 15-nm BSPP-GNPs in the presence of KC1 at a final concentration of 70 mM. Scale bars are 100 nm (FIG. 12A), 10 nm (FIG. 12B) and 300 nm (FIG. 12C).

[0104] FIG. 13A presents absorption spectra of a solution of 15-nm BSPP-GNPs, of a bare mica surface, and of the mica surface following 5 hours incubation with the 15-nm BSPP-GNPs solution in the presence of KC1 at a final concentration of 70 mM, as indicated.

[0105] FIG. 13B presents a photograph of a mica surface following 5 hours incubation with 15-nm BSPP-GNPs in the presence of KC1 at a final concentration of 70 mM.

[0106] FIGs. 14A-D present AFM images (obtained in a semi-contact mode) of mica surfaces following 45 minutes incubation with 5-nm BSPP-GNPs in the presence of KC1 at a concentration of 0.2 M (FIG. 14A), 0.3 M (FIG. 14B), 0.5 M (FIG. 14C), and 1 M (FIG. 14D). Scale bars are 1 micron.

[0107] FIGs. 15A-B present AFM characterization of a mica surface (FIG. 15 A) and a 5 % HF-treated silicon surface (FIG. 15B) following incubation with 1.3 nm NAD-GNPs in the presence of KC1 at a concentration of 1 M, for 3 hours.

[0108] DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION

[0109] The present invention, in some embodiments thereof, relates to material science and, more particularly, but not exclusively, to newly designed ultra-small metal nanoparticles, a process of preparing same, and to exemplary uses thereof.

[0110] Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details of construction and the arrangement of the components and / or methods set forth in the following description and / or illustrated in the drawings and / or the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.

[0111] Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.Most of the currently practiced methods of preparing ultra-small metal nanoparticles yield particles coordinated to ligands that are non-removable or difficult to displace. This limits both the reactivity of the particles and the accessibility of their metal cores to components in the surrounding environment or medium.

[0112] The present inventors have designed a straightforward, rapid, and cost-effective methodology for preparing metal nanoparticles (e.g., gold nanoparticles, GNPs), which circumvents the limitations of associated with the currently practices metal nanoparticles.

[0113] The newly designed nanoparticles (NPs) (e.g., gold nanoparticles, GNPs) feature a ligand that comprises a first moiety that is capable of associating with a surface of the metal, optionally a linking moiety, and a redox-reactive moiety and / or a second moiety that is capable of associating with the surface of the metal, e.g., nicotinamide adenine dinucleotide (NAD) or flavin adenine dinucleotide (FAD), such that the ligand is associated with at least a portion of the surface of the metal atoms, and is optionally removable (i.e., exchangeable, displaceable) from the metal atom via a ligand-exchange mechanism.

[0114] This dynamic association enables the nanoparticles to interact with a wide variety of biological and chemical substrates, including single-stranded DNA (ssDNA), proteins, small organic molecules (e.g., organic dyes), and lipid bilayers (see, e.g., FIGs. 5A-D and 7A-D). The use of ligands such as NAD or FAD further allows the metal nanoparticles to catalyze redox reactions in a surrounding environment or medium, such as the oxidation of NADH or ascorbate by molecular oxygen (see, e.g., FIGs. 6A-B and 10A-B), and the reduction of cytochrome c by NADH in the presence of molecular oxygen (see, e.g., FIGs. 6C-D). These combined features render the nanoparticles highly versatile and reactive, suitable for diverse applications in catalysis, molecular detection, and beyond.

[0115] The novel methodology provides ultra-small nanoparticles, featuring an average or mean particles size as low as a few nanometers (nm).

[0116] Further, as demonstrated in Example 6 hereinbelow, the metal nanoparticles were shown to associate with solid substrates to form surface-bound metal nanoparticles (see, e.g., FIGs. 11A-C, 12A-C, 13A-B and 14A-D). In particular, ultra-small gold nanoparticles comprising ligands as described herein were shown, upon deposition on the surfaces, to adsorb onto silicon-based or silicate-based substrates and organize in the form of a nanometric thin film (see, FIGs. 15A-B).

[0117] Embodiments of the present invention therefore relate to newly designed nanoparticles, preferably ultra-small metal nanoparticles, featuring metal atoms and at least one ligand associated with a surface of the metal atoms.The term “nanoparticle”, as used herein throughout, describes (solid) particles in which at least one dimension thereof has a size of up to 100 nanometers (nm), preferably up to 50 nm, more preferably up to 10 nm, e.g., up to 2 nm.

[0118] According to an aspect of some of any of the embodiments of the invention, there is provided a metal nanoparticle comprising one or more metal atoms and a ligand associated with (e.g., at least a portion of) a surface of the one or more metal atoms (or a portion of a plurality, that is, two or more, of the metal atoms). According to some embodiments of any of the embodiments described herein, the metal nanoparticle is an ultra- small metal nanoparticle.

[0119] The term “ultra-small”, as used herein throughout, described particles having at least one dimension (e.g., a mean diameter for a spherical nanoparticle; e.g., height, length, and / or width for a non-spherical nanoparticle) smaller than 2 nm, e.g., ranging from 1 to 2 nm (e.g., from 1.1 to 1.9 nm, or from 1.1 to 1.8 nm, or from 1.1 to 1.7 nm, or from 1.1 to 1.6 nm, from 1.2 to 1.9 nm, or from 1.2 to 1.8 nm, or from 1.2 to 1.7 nm, or from 1.2 to 1.6 nm), including any intermediate values and subranges therebetween.

[0120] As used herein, the phrase “mean particle size” or “average particle size” describes the arithmetic average of the individual size parameter of a nanoparticle within a population of nanoparticles (a plurality of nanoparticles). This value is typically measured using software tools that process data obtained from analytical techniques such as transmission electron microscopy (TEM), atomic force microscopy (AFM), or dynamic light scattering (DLS); however, any other suitable method is also contemplated. In some embodiments, the nanoparticles are substantially spherical and the size parameter refers to the particle’s diameter, that is, is mean diameter or average diameter.

[0121] As used herein, the phrase “mean diameter” or “average diameter” describes the arithmetic average of the individual diameter of a nanoparticle within a population of nanoparticles (a plurality of nanoparticles). This value is typically measured using software tools that process data obtained from analytical techniques such as transmission electron microscopy (TEM), atomic force microscopy (AFM), or dynamic light scattering (DLS); however, any other suitable method is also contemplated.

[0122] According to some embodiments of any of the embodiments described herein, the metal nanoparticles have a mean or average diameter lower than 5 nm, or lower than 3 nm, or lower than 2 nm, for example, ranging from 1 to 2 nm (e.g., from 1.1 to 1.9 nm, or from 1.1 to 1.8 nm, or from 1.1 to 1.7 nm, or from 1.1 to 1.6 nm, from 1.2 to 1.9 nm, or from 1.2 to 1.8 nm, or from 1.2 to 1.7 nm, or from 1.2 to 1.6 nm), including any intermediate values and subranges therebetween.

[0123] According to some embodiments of any of the embodiments described herein, the metal nanoparticles are gold nanoparticles and have a mean or average diameter lower than 5 nm, or lower than 3 nm, or lower than 2 nm, for example, ranging from 1 to 2 nm (e.g., from 1.1 to 1.9 nm, or from1.1 to 1.8 nm, or from 1.1 to 1.7 nm, or from 1.1 to 1.6 nm, from 1.2 to 1.9 nm, or from 1.2 to 1.8 nm, or from 1.2 to 1.7 nm, or from 1.2 to 1.6 nm), including any intermediate values and subranges therebetween.

[0124] According to some embodiments of any of the embodiments described herein, the metal nanoparticles are copper nanoparticles and have a mean diameter lower than 5 nm, or lower than 3 nm, or lower than 2 nm, for example, ranging from 1 to 2 nm (e.g., from 1.1 to 1.9 nm, or from 1.1 to 1.8 nm, or from 1.1 to 1.7 nm, or from 1.1 to 1.6 nm, from 1.2 to 1.9 nm, or from 1.2 to 1.8 nm, or from 1.2 to 1.7 nm, or from 1.2 to 1.6 nm), including any intermediate values and subranges therebetween.

[0125] According to some embodiments of any of the embodiments described herein, a particle size distribution is characterized by a d50of from about 1 to about 3 nm, or from about 1 to about 2.5 nm, or from about 1 to about 2 nm, or from about 1 to about 1.75 nm, or from about 1 to about 1.6 nm, or from about 1 to about 1.5 nm, or from about 1.1 to about 1.5 nm, or from about 1.1 to about 1.4 nm, or from about 1.2 to about 1.5 nm, or from about 1.3 to about 1.5 nm, e.g., 1.4, or from about 1.1 to about 1.4 nm, e.g., 1.3, or from about 1 to about 5 nm, or from about 1 to about 4 nm, or from about 1 to about 3 nm, or from about 1 to about 2.8 nm, or from about 1.3 to about 2.5 nm, or from about 1.3 to about 2 nm, or from about 1.5 to about 2 nm, including any intermediate values and subranges therebetween, as determined by TEM; or by a d50of from about 1 to about 3 nm, or from about 1 to about 2.5 nm, or from about 1 to about 2 nm, or from about 1 to about 1.75 nm, or from about 1 to about 1.6 nm, or from about 1 to about 1.5 nm, or from about 1.1 to about 1.5 nm, or from about 1.1 to about 1.4 nm, or from about 1.2 to about 1.5 nm, or from about 1.3 to about 1.5 nm, e.g., 1.4, or from about 1.1 to about 1.4 nm, e.g., 1.3, or from about 1 to about 5 nm, or from about 1 to about 4 nm, or from about 1 to about 3 nm, or from about 1 to about 2.8 nm, or from about 1.3 to about 2.5 nm, or from about 1.3 to about 2 nm, or from about 1.5 to about 2 nm, including any intermediate values and subranges therebetween, as determined by AFM.

[0126] According to some embodiments of any of the embodiments described herein, the metal nanoparticles are gold nanoparticles and a particle size distribution is characterized by a d50of from about 1 to about 3 nm, or from about 1 to about 2.5 nm, or from about 1 to about 2 nm, or from about 1 to about 1.75 nm, or from about 1 to about 1.6 nm, or from about 1 to about 1.5 nm, or from about 1.1 to about 1.5 nm, or from about 1.1 to about 1.4 nm, or from about 1.2 to about 1.5 nm, or from about 1.3 to about 1.5 nm, e.g., 1.4, or from about 1.1 to about 1.4 nm, e.g., 1.3, including any intermediate values and subranges therebetween, as determined by TEM or by a d50of from about 1 to about 3 nm, or from about 1 to about 2.5 nm, or from about 1 to about 2 nm, or from about 1 to about 1.75 nm, or from about 1 to about 1.6 nm, or from about 1 to about 1.5 nm, or from about 1.1to about 1.5 nm, or from about 1.1 to about 1.4 nm, or from about 1.2 to about 1.5 nm, or from about 1.3 to about 1.5 nm, e.g., 1.4, or from about 1.1 to about 1.4 nm, e.g., 1.3, or from about 1 to about 5 nm, or from about 1 to about 4 nm, or from about 1 to about 3 nm, or from about 1 to about 2.8 nm, or from about 1.3 to about 2.5 nm, or from about 1.3 to about 2 nm, or from about 1.5 to about 2 nm, including any intermediate values and subranges therebetween, as determined by AFM.

[0127] According to some embodiments of any of the embodiments described herein, the metal nanoparticles are copper nanoparticles and a particle size distribution is characterized by a d50of from about 1.6 to about 2.3 nm, or from about 1 to about 3 nm, or from about 1 to about 2.8 nm, or from about 1 to about 2.5 nm, or from about 1.3 to about 2.5 nm, or from about 1.3 to about 2 nm, or from about 1.5 to about 2 nm, or from about 1.5 to about 2.3 nm, or from about 1.6 to about 2.5 nm, including any intermediate values and subranges therebetween, as determined by TEM; or by a d50of from about 1.4 to about 2.6 nm, or from about 1 to about 5 nm, or from about 1 to about 4 nm, or from about 1 to about 3 nm, or from about 1.1 to about 2.6 nm, or from about 1.1 to about 2.5 nm, or from about 1.1 to about 2 nm, or from about 1.2 to about 2.6 nm, or from about 1.2 to about 2.5 nm, or from about 1.3 to about 2.6 nm, or from about 1.3 to about 2.5 nm, or from about 1.4 to about 2.5 nm, or from about 1.5 to about 2.6 nm, or from about 1.6 to about 2.6 nm, including any intermediate values and subranges therebetween, as determined by AFM.

[0128] According to some embodiments of any of the embodiments described herein, a particle size distribution is characterized by a d90of from about 1 to about 1.8 nm, or from about 1 to about 1.75 nm, or from about 1 to about 1.7 nm, or from about 1 to about 1.6 nm, or from about 1 to about 1.5 nm, or from about 1.1 to about 1.6 nm, or from about 1.2 to about 1.6 nm, or from about 1.3 to about 1.6 nm, or from about 1.3 to about 1.75 nm, including any intermediate values and subranges therebetween, as determined by TEM; or by a d90of from about 1 to about 2 nm, or from about 1 to about 1.9 nm, or from about 1.1 to about 1.9 nm, or from about 1.2 to about 1.8 nm, or from about 1.3 to about 1.8 nm, or from about 1.4 to about 1.8 nm, or from about 1.4 to about 1.9 nm, or from about 1.5 to about 1.9 nm, or from about 1.6 to about 2 nm, including any intermediate values and subranges therebetween, as determined by AFM, including any intermediate values and subranges therebetween.

[0129] The value “dso” is the median particle size in a given distribution, representing the midpoint in a particles size distribution curve obtained in a certain measuring technique, at which 50 % of particles are smaller than this value, and 50 % are larger. The d50 is typically the diameter at which 50 % of the particles in a sample (by volume, number, or mass) are smaller, and 50 % are larger.

[0130] The value “dgo” is the median particle size in a given distribution, representing the midpoint in a particles size distribution curve obtained in a certain measuring technique, at which 90 % of particlesare smaller than this value, and 10 % are larger. The d90is typically the diameter at which 90 % of the particles in a sample (by volume, number, or mass) are smaller, and 10 % are larger.

[0131] According to some embodiments of any of the embodiments described herein, the metal nanoparticles have an average relative size distribution (a ratio of a standard deviation to an average particle diameter) of up to 50 %, or up to 40 %, or up to 30 %, or up to 25 %, or up to 20 %, or up to 15 %, or up to 10 %, including any intermediate values and subranges therebetween.

[0132] According to some embodiments of any of the embodiments described herein, the metal nanoparticle comprises up to 200 metal atoms, e.g., in a range of from 20 to 200, or in a range of from 20 to 170, or in a range of from 20 to 150, or up to 150, e.g., 100, or up to 100, or up to 75, e.g., from 20 to 100, or from 20 to 75, or from 40 to 75, e.g., 55, metal atoms, including any intermediate values and subranges therebetween.

[0133] According to some embodiments of any of the embodiments described herein, at least a portion, or all, of the nanoparticles are substantially spherical. As used herein, the term “spherical” refers to particles whose three spatial dimensions are substantially equal, allowing for minor deviations of up to 20 %, e.g., up to 15 %, or up to 10 %, or up to 7.5 %, or up to 5 %, or up to 2.5 %, or up to 1 %, or up to 0.5 %, including any intermediate values and subranges therebetween.

[0134] According to some embodiments of any of the embodiments described herein, at least a portion of the nanoparticles are substantially spherical and have a mean diameter lower than 5 nm, or lower than 3 nm, or lower than 2 nm, for example, ranging from 1 to 2 nm (e.g., from 1.1 to 1.9 nm, or from 1.1 to 1.8 nm, or from 1.1 to 1.7 nm, or from 1.1 to 1.6 nm, or from 1.2 to 1.9 nm, or from 1.2 to 1.8 nm, or from 1.2 to 1.7 nm, or from 1.2 to 1.6 nm), including any intermediate values and subranges therebetween.

[0135] Herein throughout, by “at least a portion” it is meant at least 10 %, or at least 20 %, or at least 50 %, or at least 60 %, or at least 80 %, or at least 99 %, or more (e.g., 100 %), of the indicated parameter (e.g., a total nanoparticle population, a total surface area, a total volume area, etc.), including any intermediate values and subranges therebetween.

[0136] According to some embodiments of any of the embodiments described herein, the nanoparticle as described herein in any of the respective embodiments and in any combination thereof is a metal nanoparticle, for example, a gold nanoparticle or a copper nanoparticle.

[0137] The phrase “metal nanoparticle”, as used herein throughout, describes a nanoparticle as defined herein comprising at least one (e.g., elemental) metal atom. The metal nanoparticle has associated therewith, for example, associated with at least a portion of a surface thereof, one or more ligand as described herein.Herein, whenever a metal nanoparticle is described, it is to be understood as encompassing also a plurality of nanoparticles in which at least a portion, or each, of the nanoparticles are metal nanoparticles as described herein in any of the respective embodiments.

[0138] A plurality of nanoparticles can comprise metal nanoparticles of the same type, that is, comprising the same metal and the same ligand, and featuring particles size distribution such as described herein, or two or more types of metal nanoparticles, which differ from one another by one or more of the metal atom(s), the ligand (presence or type), the mean particle size (e.g., diameter), etc.

[0139] In some embodiments of any of the embodiments described herein, the metal is a metal that can be readily obtained by reduction of its metal cation. According to some embodiments of any of the embodiments described herein, the metal is characterized by a standard reduction potential (E°) of at least 0.2 V, or at least 0.25 V, or at least 0.3 V, including any intermediate values and subranges therebetween, versus a standard hydrogen electrode (SHE), e.g., at 25 °C.

[0140] As used herein, the phrase “standard reduction potential (E°) versus a standard hydrogen electrode” describes the thermodynamic potential of a redox couple measured under standard conditions (25 °C, 1 atm, 1 M concentrations of all species) relative to the standard hydrogen electrode (SHE), which is assigned a potential of 0.00 volts. Standard reduction potentials provide a measure of the tendency of a species to be reduced (i.e., gain electrons).

[0141] The standard reduction potential may be determined using techniques known in the art, such as cyclic voltammetry, potentiometric titration, or open-circuit potential (OCP) measurements, in aqueous or non-aqueous media, using a three-electrode system with an appropriate reference electrode (e.g., SHE as described herein). Any other suitable method for determining the redox potential of a substance is also contemplated. Non-limiting examples of metals usable in the context of the present embodiments include gold, copper, silver, manganese, cobalt, palladium, platinum, ruthenium, rhodium, and nickel.

[0142] According to some embodiments of any of the embodiments described herein, the metal features an oxophilicity lower than 0.4, preferably lower than 0.3, or lower than 0.2, including any intermediate values and subranges therebetween, when calculated according to metal-oxygen bond enthalpy (e.g., as described in Kasper P. Kepp, Inorg. Chem., 2016, 55, 9461-9470). Non-limiting examples of such metal include ruthenium (Ru), cobalt (Co), copper (Cu), nickel (Ni), zinc (Zn), palladium (Pd), lead (Pb), silver (Ag), cadmium (Cd), platinum (Pt) and gold (Au).

[0143] As used herein and as known in the art, the term “oxophilicity” describes the thermodynamic tendency of a metal to form bonds with oxygen-containing ligands, and it may be quantitatively estimated using metal-oxygen bond dissociation enthalpies or related metrics. A lower oxophilicity value typically indicates a reduced affinity for oxygen, which can correlate with greater resistance tooxidation under ambient or physiological conditions (e.g., chemical stability). A higher oxophilicity value typically indicates enhanced affinity for oxygen, which can correlate with greater susceptibility to oxidation under ambient or physiological conditions, and can translate to higher activity in oxidation reactions.

[0144] According to some embodiments of any of the embodiments described herein, the metal nanoparticle comprises up to 500, or up to 300 or up to 200 metal atoms, e.g., in a range of from 10 to 200, or from 20 to 200, or from 30 to 200, or from 40 to 200, or from 50 to 200, or from 80 to 200, or from 90 to 200, or from 100 to 200, or from 10 to 150, or from 20 to 150, or from 30 to 150, or from 40 to 150, or from 50 to 150, or from 80 to 150, or from 100 to 150, or from 10 to 100, or from 20 to 100, or from 30 to 100, or from 40 to 100, or from 50 to 100, or from 80 to 120, metal atoms, including any intermediate values and subranges therebetween.

[0145] When the metal nanoparticle is a part of a plurality of metal nanoparticles, each nanoparticle can have the same or different number of metal atoms. In some embodiments, the variability in the number of metal atoms in each nanoparticle does not exceed 30 %, and can, for example, in a range of from 1 to 30, or 1 to 25, or 1 to 20, %, including any intermediate values and subranges therebetween.

[0146] According to some embodiments of any of the embodiments described herein, the metal is gold.

[0147] According to some embodiments of any of the embodiments described herein, the metal is copper.

[0148] According to some embodiments of any of the embodiments described herein, the metal nanoparticle is a gold nanoparticle comprising up to 200 metal atoms, e.g., in a range of from 10 to 200, or from 20 to 200, or from 30 to 200, or from 40 to 200, or from 50 to 200, or from 80 to 200, or from 90 to 200, or from 100 to 200, or from 10 to 150, or from 20 to 150, or from 30 to 150, or from 40 to 150, or from 50 to 150, or from 80 to 150, or from 100 to 150, or from 10 to 100, or from 20 to 100, or from 30 to 100, or from 40 to 100, or from 50 to 100, or from 80 to 120, metal atoms, including any intermediate values and subranges therebetween.

[0149] According to some embodiments of any of the embodiments described herein, the ligand is represented by: X-L-Y, wherein:

[0150] L is a linking moiety or is absent;

[0151] X is a first moiety that is capable of associating with the surface of the metal atom(s); and Y is a redox-reactive moiety and / or a second moiety that is capable of associating with the surface of the metal atoms.According to an aspect of some of any of the embodiments of the invention, there is provided a metal nanoparticle, or a plurality of metal nanoparticles in which each metal nanoparticle in at least a portion of the plurality of metal nanoparticles comprises one or more metal atoms as described herein and a ligand associated with at least a portion of a surface of the one or more metal atoms, wherein the ligand is represented by: X-L-Y, wherein:

[0152] L is a linking moiety or is absent;

[0153] X is a first moiety that is capable of associating with the surface of the metal atoms; and Y is a redox-reactive moiety and / or a second moiety that is capable of associating with the surface of the metal atoms.

[0154] According to some embodiments of any of the embodiments described herein, there is provided a gold nanoparticle, or a plurality of gold nanoparticles in which each gold nanoparticle in at least a portion of the plurality of the gold nanoparticles comprises one or more gold atoms as described herein and a ligand associated with at least a portion of a surface of the one or more gold atoms, wherein the ligand is represented by: X-L-Y, wherein X, L and Y are as described herein in any of the respective embodiments.

[0155] According to some embodiments of any of the embodiments described herein, there is provided a copper nanoparticle, or a plurality of copper nanoparticles in which each copper nanoparticle in at least a portion of the plurality of copper nanoparticles comprises one or more copper atoms as described herein and a ligand associated with at least a portion of a surface of the one or more copper atoms, wherein the ligand is represented by: X-L-Y, wherein X, L and Y are as described herein in any of the respective embodiments.

[0156] According to some embodiments of any of the embodiments described herein, when a metal (e.g., gold, or copper) nanoparticle comprises more than one metal atoms, the ligand can be associated with a surface or a portion thereof of each metal atom, or of a portion of the metal atoms.

[0157] According to some embodiments of any of the embodiments described herein, the ligand is associated with at least a portion of the surface of the one or more metal atoms. According to some embodiments, the ligand is associated with less than 100 % of the surface of the metal atoms, for example, at least 5 %, or at least 10 %, or at least 25 %, or at least 40 %, or at least 50 %, or at least 60 %, or at least 75 %, or at least 90 %, or 95 %, or more.

[0158] According to some embodiments, the ligand is associated with less than 100 % of the surface of the metal atoms, for example, with less than 95 %, or less than 90 %, or less than 80 %, or less than 75 %, or less than 70 %, or less than 60 %, or less than 50 %, or less than 40 %, or less than 30 %, or less than 355, or less than 20 %, or less than 15 %, or less than 10 %, or less than 5 %, of the surface of the metal atoms.According to some embodiments, the ligand is associated with from about 1 to about 95, or from about 1 to about 90, or from about 1 to about 85, or from about 1 to about 80, or from about 1 to about 75, or from about 1 to about 70, or from about 1 to about 60, or from about 1 to about 50, or from about 1 to about 40, or from about 1 to about 30, or from about 1 to about 25, or from about 1 to about 20, or from about 1 to about 15, or from about 1 to about 10, or from about 1 to about 5, % of the surface of the metal atoms, including any intermediate values and subranges therebetween.

[0159] According to some embodiments, the ligand is associated with from about 1 to about 95, or from about 5 to about 90, or from about 5 to about 85, or from about 5 to about 80, or from about 5 to about 75, or from about 5 to about 70, or from about 5 to about 60, or from about 5 to about 50, or from about 5 to about 40, or from about 5 to about 30, or from about 5 to about 25, or from about 5 to about 20, or from about 5 to about 15, or from about 5 to about 10, % of the surface of the metal atoms, including any intermediate values and subranges therebetween.

[0160] According to some embodiments, the ligand is associated with from about 1 to about 95, or from about 10 to about 90, or from about 10 to about 85, or from about 10 to about 80, or from about 10 to about 75, or from about 10 to about 70, or from about 10 to about 60, or from about 10 to about 50, or from about 10 to about 40, or from about 10 to about 30, or from about 10 to about 25, or from about 10 to about 20, or from about 10 to about 15, % of the surface of the metal atoms, including any intermediate values and subranges therebetween. According to some embodiments of any of the embodiments described herein, the metal atoms can comprise one or more ligands associated with a surface thereof (or a portion of the surface), which can be the same or different.

[0161] Herein throughout, by “association”, “associated with” and any grammatical diversion of these terms, it is meant that the indicated substances (e.g., a metal atom and a ligand) are linked to one another via one or more chemical and / or physical interactions. Non-limiting such interactions include physical interactions such as absorption, entanglement, encapsulation, and chemical interactions such as covalent bonding, electrostatic interactions, hydrogen bonding, van der Waals interactions, hydrophobic interactions, π-π stacking interactions, and coordinative interactions (e.g., coordinative bonds between a metal and one or more atoms or chemical groups in a ligand).

[0162] In some embodiments of any of the embodiments described herein, the ligand is non-covalently attached to the metal nanoparticle (i.e., the association therebetween is non-covalent). In alternative embodiments, the ligand is covalently attached to the metal nanoparticle (i.e., the association therebetween is covalent).

[0163] In some embodiments, the ligand forms a metal coordinative complex with the metal atom(s), for example, between the metal atom and one or more heteroatoms in the ligand (e.g., nitrogen atoms that form a part of an amine group or of a heterocyclic group such as heteroaryl).In some embodiments of any of the embodiments described herein, the ligand is associated with the metal atom at least via the moiety X, which is a moiety that is capable of associating with the surface of the metal atoms, that is, X is or comprises a chemical group or atom that has an affinity to the metal atoms, and can interact therewith as described herein (e.g., by forming coordinative bonds).

[0164] As known in the art, affinity between a substance (e.g., a ligand or moiety or a group) and a surface (e.g., a metal surface) is commonly evaluated by measuring the dissociation constant (KD), using techniques such as surface plasmon resonance (SPR), isothermal titration calorimetry (ITC), fluorescence quenching assays, nuclear magnetic resonance (NMR) spectroscopy, or computational binding models. Any other suitable analytical technique that can provide a reliable estimate of surface interaction strength is also contemplated. A preferred dissociation constant KD of the ligand and / or the moieties thereof (X, Y) is moderate - strong enough to stabilize the particles and prevent aggregation (e.g., in both solution and dry form, e.g., for months), and also low enough to allow for ligand exchange.

[0165] As used herein, the phrase “ligand exchange” describes a process by which a ligand that is associated with at least a portion of the surface of the metal atom(s) is replaced, displaced, or substituted by another ligand or chemical group, either partially or completely. The exchange may occur under equilibrium or dynamic conditions and may be driven by differences in affinity, concentration, or environmental conditions (e.g., pH, ionic strength, temperature). The ligand exchange may be reversible or irreversible and may involve displacement of either the entire ligand or a portion thereof (e.g., one of the moieties X or Y).

[0166] According to some embodiments of any of the embodiments described herein, X is or comprises at least one moiety (first moiety) having a dissociation constant KD with the surface of the metal atoms that is higher than 1 nanomolar and lower than 100 micromolar, including any intermediate values and subranges therebetween.

[0167] In contrast to strongly coordinating thiol-capped nanoparticles described in the Background Art, the ligands described herein may exhibit affinity and / or dissociation kinetics (e.g., koff=Kd / kon), enabling reversible ligand exchange while maintaining particle stability (e.g., chemical stability).

[0168] In some embodiments of any of the embodiments described herein, the dissociation constant KD as described herein ranges from about 1 nanomolar to about 100 micromolar, or from about 1 nanomolar to about 100 nanomolar, or from about 1 nanomolar to about 10 nanomolar, or from about 1 nanomolar to about 10 micromolar, or from about 1 nanomolar to about 1 micromolar, or from about 10 nanomolar to about 100 nanomolar, or from about 10 nanomolar to about 1 micromolar, or from about 100 nanomolar to about 1 micromolar, or from about 100 nanomolar to about 10 micromolar, or from about 100 nanomolar to about 50 micromolar, or from about 500 nanomolar to about 50micromolar, or from about 1 nanomolar to about 5 micromolar, or from about 1 nanomolar to about 10 micromolar, or from about 1 nanomolar to about 50 micromolar, or from about 1 micromolar to about 50 micromolar, or from about 10 micromolar to about 100 micromolar, or from about 100 nanomolar to about 100 micromolar, or from about 20 micromolar to about 100 micromolar, or from about 25 micromolar to about 75 micromolar, or from about 50 micromolar to about 100 micromolar, or from about 90 micromolar to about 100 micromolar, including any intermediate values and subranges therebetween.

[0169] In some embodiments of any of the embodiments described herein, the ligand is removable (i.e., exchangeable, displaceable, dissociable) from the metal atom, e.g., via a ligand-exchange mechanism, e.g., reversibly. According to some embodiments of any of the embodiments described herein, the ligand is removable under aqueous or physiological conditions, e.g., at pH 7.0 to 7.4.

[0170] Without being bound by any particular theory, it is assumed that the dissociation constant KD (which dictates the removability of the ligand) facilitates subsequent association of the metal nanoparticles with other chemical or biological entities, e.g., ssDNA, proteins, small molecules, lipid bilayers.

[0171] In some embodiments, the affinity of the ligand (e.g., X and / or Y) to the surface of the metal nanoparticle is alternatively, or in addition, determined by a ligand exchange rate (k_off), exchange half-life, competitive displacement concentration, and / or absorption free energy.

[0172] The ligand exchange rate constant koff describes the rate at which a bound ligand dissociates from the metal nanoparticle surface under defined conditions, typically in the presence of a competing ligand at a defined concentration. The exchange half-life t* is the time required for 50 % of the bound ligand to be displaced under those conditions:

[0173] t½ = ln(2) / koff

[0174] These parameters can be measured by UV-Vis Spectrophotometry (e.g., by determining absorbance at a characteristic wavelength (e.g., 400 nm) of either the displaced ligand or the incoming ligand as a function of time); and / or by CN Dissolution Kinetics (by treating a nanoparticle with a defined concentration of KCN and monitoring the rate of particle dissolution (e.g., by loss of LSPR absorbance), which reflects the accessibility of the gold surface that corresponds to the ligand binding strength.

[0175] According to some embodiments, the ligand is characterized by a ligand exchange half-life that is lower than that of thiols, yet higher than that of citrate, for example, by tl / 2 of at least 30 minutes, or at least one hour, or at least 90 minutes, or at least 2 hours, and no more than 48 hours, orno more than 24 hours, or no more than 12 hours. According to some embodiments, the ligand is characterized by k_off higher than 10’7 / second, or higher than 10’6 / second or higher than 10’5 / second, and lower than 10’2 / second, or lower than 10’3 / second, for example, in a range of from 10’3 / second to 10-5 / second, or 10-4 / second to 10-5 / second, including any intermediate values and subranges therebetween.

[0176] According to some embodiments, the ligand is displaceable from the metal nanoparticle surface by a competing phosphine ligand at a concentration of 10 mM within a period of from 1 hour to 48 hours at ambient temperature, as measured by UV-Vis spectrophotometry.

[0177] The competitive displacement concentration is defined as the molar concentration of a defined reference competing ligand required to displace 50 % of the bound ligand from the nanoparticle surface within a defined time period under defined conditions:

[0178] CDC50= [competing ligand] at which 50 % ligand displacement occurs within time t under conditions C

[0179] The competitive displacement concentration can be determined by incubating a concentrated solution of ligand-coated GNPs at defined optical density with serial concentrations of a competing ligand, for example, spanning from 0.01 mM to 100 mM, for a defined time period (e.g., 16 hours), and ambient temperature, filtering the nanoparticles, and quantifying the displaced ligand in the filtrate spectrophotometrically using the extinction coefficient of the ligand.

[0180] According to some embodiments, the competitive ligand is BSPP and the competitive displacement concentration lower than 100 mM, or lower than 50 mM, or lower than 20 mM, and is higher than 0.01, or higher than 0.05, or higher than 0.1, mM, for example, is a range of from 0.1 to 20, or 0.1 to 10, or from 1 to 20 or from 1 to 10, mM, including any intermediate values and subranges therebetween (at 25 °C, 16 hours incubation).

[0181] According to some embodiments, the ligand has a competitive displacement concentration (CDC50) of from 0.1 mM to 50 mM, or from 0.1 to 20, or from 0.1 to 10, or from 1 to 20, or from 1 to 10, mM, including any intermediate values and subranges therebetween, of bis(p-sulfonatophenyl)phenylphosphine (BSPP) as measured by UV-Vis spectrophotometry following 16 hours of incubation at 25 °C.

[0182] The adsorption free energy AGads is the Gibbs free energy change associated with transfer of one mole of ligand from solution to the bound state on the metal nanoparticle surface at equilibrium:

[0183] AGads = -RT ln(Ka) = RT ln(Kd)

[0184] wherein:

[0185] R = 8.314 J / mol K

[0186] T = KKa = association constant (L / mol)

[0187] Kd = dissociation constant (mol / L)

[0188] It can be determined, for example, by Isothermal Titration Calorimetry (ITC), or calculated from KD measurements, or by Temperature-Dependent Exchange Kinetics (van't Hoff Analysis) According to some embodiments, the ligand is characterized by AGads (kJ / mol) of no more than -30, or no more than -35, or no more than -40, and higher than -70, or higher than -65, or higher than -60, or higher than -55, kJ / mol, including any intermediate values and subranges therebetween.

[0189] According to some embodiments, the ligand is associated with the metal nanoparticle surface with an adsorption free energy (AGads) of from -35 kJ / mol to -70 kJ / mol as determined by isothermal titration calorimetry at 25 °C in aqueous solution at physiological ionic strength, including any intermediate values and subranges therebetween.

[0190] According to some embodiments, the oxophilicity of the metal and / or the standard reduction potential (E°) of the metal versus a standard hydrogen electrode (SHE) and a dissociation constant KD between the first moiety (X of the ligand and the metal) are such that provide chemical stability and / or reactivity to the metal nanoparticle.

[0191] According to some embodiments of any of the embodiments described herein, X is a moiety that is capable of associating with the metal atom(s) as described herein, and in some embodiments, the association is via a nitrogen-metal bond, for example, a coordinative bond.

[0192] The nitrogen atom can form a part of any nitrogen-containing group, for example, an amine group, an amide, a nitrogen-containing heterocyclic groups such as a nitrogen-containing heteroalicyclic or a nitrogen-containing heteroaryl.

[0193] According to some embodiments of any of the embodiments described herein, X is or comprises an amine group. The amine group can form a part of, for example, an alkyl that is substituted or terminated by an amine group, a cycloalkyl or a heteroalicyclic that is substituted by an amine group, an aryl or heteroaryl that is substituted by an amine group, or can form a part of the heterocyclic group, for example, of a heteroalicyclic or a heteroaryl.

[0194] According to some embodiments of any of the embodiments described herein, X is or comprises a nitrogen-containing heterocyclic group.

[0195] According to some embodiments of any of the embodiments described herein, X is or comprises a nitrogen-containing heteroalicyclic group. Examples include, without limitation, pyrrolidinyl, piperidinyl, azetidinyl, morpholinyl, piperazinyl, and azepanyl, each can be substituted or unsubstituted, e.g., as described herein, as long as the substituent(s) does / do not interfere with the association with the metal.According to some embodiments of any of the embodiments described herein, X is or comprises a nitrogen-containing heteroaryl. Examples include, without limitation, pyridyl, pyrimidinyl, pyrazinyl, triazolyl, imidazolyl, indolyl, quinolinyl, isoquinolinyl, purinyl, and benzimidazolyl, each can be substituted or unsubstituted, e.g., as described herein, as long as the substituent(s) does / do not interfere with the association with the metal.

[0196] According to some embodiments of any of the embodiments described herein, X is or comprises a purine (purinyl) or pyrimidine (pyrimidinyl).

[0197] As used herein and as known in the art, the term “purine” describes a bicyclic aromatic heterocycle comprising a fused six-membered and five-membered nitrogen-containing ring structure. Non-limiting examples of purines include adenine and guanine.

[0198] As used herein and as known in the art, the term “pyrimidine” describes a monocyclic aromatic heterocycle comprising a six-membered nitrogen-containing ring. Non-limiting examples of pyrimidines include cytosine, thymine, and uracil.

[0199] According to some embodiments of any of the embodiments described herein, the first moiety X is or comprises a nucleobase.

[0200] As used herein and as known in the art, the term “nucleobase” describes a nitrogen-containing heterocyclic compound that is a core structural element of nucleic acids. Non-limiting examples of nucleobases include adenine, guanine, cytosine, thymine, and uracil.

[0201] According to some embodiments of any of the embodiments described herein, X is or comprises a nucleoside or a nucleotide.

[0202] As used herein and as known in the art, the term “nucleoside” describes a molecule consisting of a nucleobase covalently linked to a sugar moiety (and do not contain a phosphate group), typically a pentose such as ribose or deoxyribose. Non-limiting examples of nucleosides include adenosine, guanosine, cytidine, thymidine, and uridine.

[0203] As used herein and as known in the art, the term “nucleotide” describes a molecule comprising a nucleoside (i.e., a nucleobase linked to a sugar) further bonded to one or more phosphate groups. Non-limiting examples of nucleotides include adenosine monophosphate (AMP), guanosine diphosphate (GDP), cytidine triphosphate (CTP), and uridine diphosphate (UDP). In some such embodiments, the linking moiety L is absent.

[0204] According to some embodiments of any of the embodiments described herein, X is or comprises adenine.

[0205] As used herein and as known in the art, the term “adenine” describes a purine nucleobase composed of a fused six-membered and five-membered nitrogen-containing ring system. Adenine is a key structural component of nucleic acids and cofactors and is capable of hydrogen bonding withthymine in DNA and uracil in RNA. Non-limiting examples of adenine-containing moieties include adenosine, ATP, NAD, and FAD.

[0206] According to some embodiments of any of the embodiments described herein, the ligand and / or X and / or Y is / are non-polymeric (i.e., is not or is not derived from a polymeric material). According to some embodiments of any of the embodiments described herein, the ligand is not or is not derived from poly aniline. In some embodiments, the ligand does not comprise an aniline.

[0207] According to some embodiments of any of the embodiments described herein, Y is a redox-reactive moiety.

[0208] The phrase “redox-reactive”, as used herein throughout, describes a property of a substance (herein, e.g., a ligand / moiety) that allows it to undergo (participate in) a redox reaction (electron transfer reactions) as defined herein (e.g., reversibly), such that it may be oxidized or reduced under physiologically relevant or synthetic conditions. The substance that is characterized by this property includes one or more atoms, moieties, or conjugated systems that is / are capable of undergoing a reversible change in oxidation state by accepting or donating one or more electrons. Redox-reactivity can be determined by electrochemical techniques, exposure to a chemical oxidant / reductant, or observable redox cycling behavior (e.g., using colorimetric or fluorometric redox indicators).

[0209] As used herein and as known in the art, phrase “redox reaction” describes oxidation and / or reduction, i.e., a chemical reaction involving the transfer of electrons between two species, wherein one species undergoes oxidation (loss of electrons) and the other undergoes reduction (gain of electrons).

[0210] According to some embodiments of any of the embodiments described herein, Y is a redox reactive moiety and the ligand is a redox-reactive ligand. According to some of these embodiments, the metal nanoparticle is a redox-reactive metal nanoparticle.

[0211] According to some embodiments of any of the embodiments described herein, the nanoparticles are redox-reactive metal nanoparticles.

[0212] In some embodiments of any of the embodiments described herein, the (e.g., redox-reactive) moiety and / or ligand is capable of participating in redox reactions under operational electrochemical potentials ranging from -1.5 V to +1.5 V vs. SHE. In some embodiments, the redox reaction of the redox-reactive moiety and / or ligand is compatible with (e.g., aqueous) physiological conditions. In some embodiments, the redox reaction of the redox-reactive moiety and / or ligand proceeds at a temperature of up to 50 °C, e.g., ranging from 20 °C to 45 °C. In some embodiments, the redox reaction of the redox-reactive ligand proceeds at a pH of up to 9.0, e.g., ranging from pH 6.0 to pH 8.0. According to some embodiments of any of the embodiments described herein, when Y is a redox reactive moiety, it can be present in a reduced form thereof, an oxidized form thereof, or in equilibriumof its reduced and oxidized form. The portion of the oxidized form of the redox reactive moiety depends on the environment surrounding the metal nanoparticles, for example, the oxygen content, the pH, the presence of reducing or oxidizing agents, etc.

[0213] According to some embodiments of any of the embodiments described herein, Y is a second moiety that is capable of associating with the surface of the metal atoms.

[0214] According to some embodiments of any of the embodiments described herein, Y is or comprises at least one group having a dissociation constant KD with the surface of the metal atoms that is higher than 1 nanomolar and lower than 100 micromolar, including any intermediate values and subranges therebetween.

[0215] According to some of these embodiments, Y is the same as X, or has a dissociation constant KD with the metal atom’s surface or a potion thereof which is as described herein for X.

[0216] Alternatively, according to some of these embodiments, Y is a moiety that features a dissociation constant KD with the surface of the metal atom which is higher than the KD of X, such that Y exhibits, for example, a partial association with the surface of the one or more metal atoms.

[0217] According to some embodiments of any of the embodiments described herein, for Y being a second groups that is capable of associating with the metal atom’s surface, the linking moiety, if present, is such that both the first moiety X and the second moiety Y are associated with the surface of the metal atoms. In some embodiments, the linking moiety is inert to the metal atom’s surface, such that it exhibits minimal association therewith (a high KD), and / or is of length that allows both X and Y to be in association with the metal atom’s surface.

[0218] According to some embodiments of any of the embodiments described herein, Y is a redox-reactive moiety that is capable of associating with the surface of the metal atoms, that is, the redox-reactive moiety as described herein also features a KD as described herein in any of the respective embodiments of Y.

[0219] According to some embodiments of any of the embodiments described herein, Y features an affinity to the nanoparticles surface which is determined as described herein for the affinity of X, in any of the respective embodiments and any combination thereof.

[0220] Examples of such moieties include redox reactive moieties as described herein, that feature a chemical group or atom that has an affinity to the metal, for example, is capable of forming a coordinative bond with the metal, as described herein, for example, via a nitrogen atom.

[0221] In some embodiments of any of the embodiments described herein, Y is a redox-reactive moiety that is capable of associating with the surface of the metal atoms, and the linking moiety, if present, is such that both the first moiety X and the second moiety Y are associated with the surface of the metal atoms.According to some embodiments of any of the embodiments described herein, Y is or comprises a nicotinamide moiety, as an exemplary redox reactive moiety that is also capable of associating with the surface of the metal atoms.

[0222] As used herein and as known in the art, the term “nicotinamide” describes a chemical compound consisting of a pyridine ring substituted with an amide group (-CONH2) at the 3-position. Non-limiting examples of nicotinamide-containing moieties include NAD, NADP, and their reduced counterparts NADH and NADPH. The amide group is the nicotinamide is capable of interacting with the metal surface to a lower extent (higher KD), compared to, for example, amine-containing groups or other nitrogen-containing groups as described herein.

[0223] According to some embodiments of any of the embodiments described herein, Y is or comprises a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal.

[0224] According to some embodiments of any of the embodiments described herein, the metal is gold and Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal.

[0225] According to some embodiments of any of the embodiments described herein, the metal is copper and Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal.

[0226] According to some embodiments of any of the embodiments described herein, X is or comprises an amine group, as described herein in any of the respective embodiments, and Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal.

[0227] According to some embodiments of any of the embodiments described herein, X is or comprises a nitrogen-containing heterocyclic group, as described herein in any of the respective embodiments, and Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal.

[0228] According to some embodiments of any of the embodiments described herein, X is or comprises a nitrogen-containing heteroaryl, as described herein in any of the respective embodiments, and Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal.

[0229] According to some embodiments of any of the embodiments described herein, X is or comprises a purine or pyrimidine, as described herein in any of the respective embodiments, and Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal.According to some embodiments of any of the embodiments described herein, X is or comprises a nucleobase, as described herein in any of the respective embodiments, and Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal.

[0230] According to some embodiments of any of the embodiments described herein, X is or comprises a nucleoside or a nucleotide, as described herein in any of the respective embodiments, and Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal.

[0231] According to some embodiments of any of the embodiments described herein, X is or comprises adenine, as described herein in any of the respective embodiments, and Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal.

[0232] According to some embodiments of any of the embodiments described herein, the linking moiety L is or comprises a phosphate group.

[0233] According to some embodiments of any of the embodiments described herein, X is or comprises an amine group, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a phosphate group.

[0234] According to some embodiments of any of the embodiments described herein, X is or comprises a nitrogen-containing heterocyclic group, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a phosphate group.

[0235] According to some embodiments of any of the embodiments described herein, X is or comprises a nitrogen-containing heteroaryl, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a phosphate group.

[0236] According to some embodiments of any of the embodiments described herein, X is or comprises a purine or pyrimidine, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a phosphate group.

[0237] According to some embodiments of any of the embodiments described herein, X is or comprises a nucleobase, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a phosphate group.According to some embodiments of any of the embodiments described herein, X is or comprises a nucleoside, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a phosphate group.

[0238] According to some embodiments of any of the embodiments described herein, X is or comprises adenine, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a phosphate group.

[0239] According to some embodiments of any of the embodiments described herein, the metal is gold, X is or comprises an amine group, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a phosphate group.

[0240] According to some embodiments of any of the embodiments described herein, the metal is gold, X is or comprises a nitrogen-containing heterocyclic group, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a phosphate group.

[0241] According to some embodiments of any of the embodiments described herein, the metal is gold, X is or comprises a nitrogen-containing heteroaryl, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a phosphate group.

[0242] According to some embodiments of any of the embodiments described herein, the metal is gold, X is or comprises a purine or pyrimidine, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a phosphate group.

[0243] According to some embodiments of any of the embodiments described herein, the metal is gold, X is or comprises a nucleobase, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a phosphate group.

[0244] According to some embodiments of any of the embodiments described herein, the metal is gold, X is or comprises a nucleoside, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a phosphate group.

[0245] According to some embodiments of any of the embodiments described herein, the metal is gold, X is or comprises adenine, Y is or comprises a nicotinamide moiety, or a redox reactive moietythat further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a phosphate group.

[0246] According to some embodiments of any of the embodiments described herein, the metal is copper, X is or comprises an amine group, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal and the linking moiety L is or comprises a phosphate group.

[0247] According to some embodiments of any of the embodiments described herein, the metal is copper, X is or comprises a nitrogen-containing heterocyclic group, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a phosphate group.

[0248] According to some embodiments of any of the embodiments described herein, the metal is copper, X is or comprises a nitrogen-containing heteroaryl, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a phosphate group.

[0249] According to some embodiments of any of the embodiments described herein, the metal is copper, X is or comprises a purine or pyrimidine, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a phosphate group.

[0250] According to some embodiments of any of the embodiments described herein, the metal is copper, X is or comprises a nucleobase, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a phosphate group.

[0251] According to some embodiments of any of the embodiments described herein, the metal is copper, X is or comprises a nucleoside, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a phosphate group.

[0252] According to some embodiments of any of the embodiments described herein, the metal is copper, X is or comprises adenine, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a phosphate group.

[0253] According to some embodiments of any of the embodiments described herein, the linking moiety L is or comprises a diphospho (pyrophosphate) group.As used herein and as known in the art, a diphospho group (also named pyrophosphate group) describes a chemical group consisting of two phosphate units joined by an anhydride bond, having the general chemical structure: “-O-P(=O)(OH)-O-P(=O)(OH)-O-“.

[0254] According to some embodiments of any of the embodiments described herein, X is or comprises an amine group, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a diphospho group. According to some of these embodiments, the metal is gold. According to some of these embodiments, the metal is copper.

[0255] According to some embodiments of any of the embodiments described herein, X is or comprises a nitrogen-containing heterocyclic group, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a diphospho group. According to some of these embodiments, the metal is gold. According to some of these embodiments, the metal is copper.

[0256] According to some embodiments of any of the embodiments described herein, X is or comprises a nitrogen-containing heteroaryl, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a diphospho group. According to some of these embodiments, the metal is gold. According to some of these embodiments, the metal is copper.

[0257] According to some embodiments of any of the embodiments described herein, X is or comprises a purine or pyrimidine, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a diphospho group. According to some of these embodiments, the metal is gold. According to some of these embodiments, the metal is copper.

[0258] According to some embodiments of any of the embodiments described herein, X is or comprises a nucleobase, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a diphospho group. According to some of these embodiments, the metal is gold. According to some of these embodiments, the metal is copper.

[0259] According to some embodiments of any of the embodiments described herein, X is or comprises a nucleoside, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a diphospho group. According to some of these embodiments, the metal is gold. According to some of these embodiments, the metal is copper.According to some embodiments of any of the embodiments described herein, X is or comprises adenine, Y is or comprises a nicotinamide moiety, or a redox reactive moiety that further features an amide group or any other group that is capable of associating with the metal, and the linking moiety L is or comprises a diphospho group. According to some of these embodiments, the metal is gold. According to some of these embodiments, the metal is copper.

[0260] According to some embodiments of any of the embodiments described herein, the ligand is derived from a cofactor.

[0261] As used herein and as known in the art, the term “cofactor” describes a non-protein chemical compound or metallic ion that is required for a protein's biological activity. Cofactors can be organic molecules (coenzymes) or inorganic ions. Non-limiting examples of cofactors include NAD, NADH, FAD, FMN, heme, biotin, thiamine pyrophosphate, iron-sulfur clusters, and magnesium ions.

[0262] According to some embodiments of any of the embodiments described herein, the metal is gold and the ligand is derived from a cofactor.

[0263] According to some embodiments of any of the embodiments described herein, the metal is copper and the ligand is derived from a cofactor.

[0264] According to some embodiments of any of the embodiments described herein, the ligand is or comprises an oxidoreductase cofactor.

[0265] As used herein and as known in the art, the phrase “oxidoreductase cofactor” describes a cofactor that participates in oxidation-reduction (redox) reactions catalyzed by oxidoreductase enzymes. Non-limiting examples of oxidoreductase cofactors include nicotinamide adenine dinucleotide (NAD / NADH), flavin adenine dinucleotide (FAD / FADH2), flavin mononucleotide (FMN), and quinones.

[0266] According to some embodiments of any of the embodiments described herein, the ligand is or comprises nicotinamide adenine dinucleotide (NAD), flavin adenine dinucleotide (FAD), nicotinamide adenine dinucleotide phosphate (NADP), Folic acid, Acetyl-CoA, Cyanocobalamin, and any combination thereof.

[0267] According to some embodiments of any of the embodiments described herein, the ligand is or comprises nicotinamide adenine dinucleotide (NAD), flavin adenine dinucleotide (FAD), nicotinamide adenine dinucleotide phosphate (NADP), reduced nicotinamide adenine dinucleotide (NADH), reduced flavin adenine dinucleotide (FADH2), reduced nicotinamide adenine dinucleotide phosphate (NADPH), flavin mononucleotide (FMN), reduced FMN (FMNH2), quinone (e.g., benzoquinone, napthoquinone, ubiquinone (coenzyme Q), menadione), phenolic ligands (e.g., catechol, hydroquinone, gallic acid, tannic acid), folic acid, acetyl-CoA, cyanocobalamin and any combination thereof.According to some embodiments of any of the embodiments described herein, the ligand is or comprises NAD.

[0268] According to some embodiments of any of the embodiments described herein, the ligand is NAD.

[0269] According to some embodiments of any of the embodiments described herein, the metal is gold and the ligand is NAD.

[0270] According to some embodiments of any of the embodiments described herein, the ligand is NAD, and the metal nanoparticles are gold nanoparticles having a mean or average diameter as described herein in any of the respective embodiments, e.g., lower than 5 nm, or lower than 3 nm, or lower than 2 nm, for example, ranging from 1 to 2 nm (e.g., from 1.1 to 1.9 nm, or from 1.1 to 1.8 nm, or from 1.1 to 1.7 nm, or from 1.1 to 1.6 nm, from 1.2 to 1.9 nm, or from 1.2 to 1.8 nm, or from 1.2 to 1.7 nm, or from 1.2 to 1.6 nm, or from 1.2 to 1.5 nm, or from 1.2 to 1.4 nm, e.g., 1.35 nm), including any intermediate values and subranges therebetween.

[0271] According to some embodiments of any of the embodiments described herein, the ligand is NAD, the metal nanoparticles are gold nanoparticles and comprising up to 300, or up to 200 metal atoms, e.g., as described herein in any of the respective embodiments.

[0272] According to some embodiments of any of the embodiments described herein, the ligand is NAD, the metal nanoparticles are gold nanoparticles having a mean or average diameter as described herein in any of the respective embodiments, e.g., lower than 5 nm, or lower than 3 nm, or lower than 2 nm, for example, ranging from 1 to 2 nm (e.g., from 1.1 to 1.9 nm, or from 1.1 to 1.8 nm, or from 1.1 to 1.7 nm, or from 1.1 to 1.6 nm, from 1.2 to 1.9 nm, or from 1.2 to 1.8 nm, or from 1.2 to 1.7 nm, or from 1.2 to 1.6 nm, or from 1.2 to 1.5 nm, or from 1.2 to 1.4 nm, e.g., 1.35 nm), including any intermediate values and subranges therebetween, and the nanoparticles comprising up to 300 or up to 200 metal atoms, as described herein in any of the respective embodiments.

[0273] According to some embodiments of any of the embodiments described herein, the metal is copper and the ligand is NAD.

[0274] According to some embodiments of any of the embodiments described herein, the ligand is NAD, and the metal nanoparticles are copper nanoparticles having a mean or average diameter as described herein in any of the respective embodiments, or e.g., lower than 5 nm, or lower than 3 nm, or lower than 2 nm, for example, ranging from 1 to 3 nm (e.g., from 1.1 to 2.7 nm, or from 1.2 to 2.5 nm, or from 1.2 to 2.3 nm, or from 1.3 to 2 nm, from 1.2 to 2 nm, or from 1.2 to 1.9 nm, or from 1.3 to 1.9 nm, or from 1.4 to 1.9 nm, or from 1.5 to 1.9 nm, or from 1.5 to 1.8 nm, or from 1.6 to 1.9 nm, or from 1.6 to 1.8 nm, e.g., 1.7 nm), including any intermediate values and subranges therebetween.According to some embodiments of any of the embodiments described herein, Y is or comprises a targeting moiety, such that the redox-reactive moiety or the moieties capable of associating with the metal atoms’ surface, can also exhibit targeting to a desired substance other than the metal. A targeting moiety, for example, is a moiety that exhibits high and selective affinity to a desired target substance in a mixture of substances. For example, a targeting moiety may exhibit selective affinity to biological substances in a biological sample or in a physiological environment. Exemplary targeting moieties are capable of selectively interacting with cell-surface moieties (e.g., receptors) that are overexpressed in diseased cells such as cancer cell; for example, the targeting moiety is or comprises a ligand of a receptor that is overexpressed in cancer cells).

[0275] Flavin residues, including FAD (flavin adenine dinucleotide), can promote particle accumulation in tumors through interaction with riboflavin transporters, RFVT1 (SEC52A1), RFVT2 (SEC52A2), and RFVT3 (SEC52A3), which are known to be overexpressed in a variety of cancers, including breast cancer, prostate cancer, colorectal cancer, pancreatic cancer, glioblastoma and lung adenocarcinoma. These transporters mediate the cellular uptake of riboflavin and its derivatives (FMN and FAD), which are essential for redox metabolism and mitochondrial function.

[0276] In some embodiments of any of the embodiments described herein, the ligand is or comprises FAD, which features adenine as X, and an exemplary redox reactive moiety that functions also as a targeting moiety as Y.

[0277] According to some embodiments of any of the embodiments described herein, the ligand is FAD.

[0278] According to some embodiments of any of the embodiments described herein, the metal is gold and the ligand is FAD.

[0279] According to some embodiments of any of the embodiments described herein, the ligand is FAD and the metal nanoparticles are gold nanoparticles having a mean or average diameter as described herein in any of the respective embodiments, or lower than 5 nm, or lower than 3 nm, or lower than 2 nm, for example, ranging from 1 to 2 nm (e.g., from 1.1 to 1.9 nm, or from 1.1 to 1.8 nm, or from 1.1 to 1.7 nm, or from 1.1 to 1.6 nm, from 1.2 to 1.9 nm, or from 1.2 to 1.8 nm, or from 1.2 to 1.7 nm, or from 1.2 to 1.6 nm, e.g., about 1.4 nm), including any intermediate values and subranges therebetween.

[0280] According to some embodiments of any of the embodiments described herein, the metal is copper and the ligand is FAD.

[0281] According to some embodiments of any of the embodiments described herein, the ligand is FAD, and the metal nanoparticles are copper nanoparticles having a mean or average diameter as described herein in any of the respective embodiments, or lower than 5 nm, or lower than 3 nm, orlower than 2 nm, for example, ranging from 1 to 3 nm (e.g., from 1.1 to 2.7 nm, or from 1.2 to 2.5 nm, or from 1.2 to 2.3 nm, or from 1.3 to 2 nm, or from 1.2 to 2 nm, or from 1.2 to 1.8 nm, or from 1.3 to 2.7 nm, or from 1.4 to 2.4 nm, or from 1.5 to 2.5 nm, or from 1.5 to 2.3 nm, or from 1.6 to 2.4 nm, or from 1.7 to 2.2 nm, or from 1.4 to 2.2 nm, or from 1.5 to 2.1 nm, or from 1.1 to 2.2 nm, or from 1.2 to 2.2 nm, or from 1.3 to 2.2 nm, or from 1.3 to 2.5 nm), including any intermediate values and subranges therebetween.

[0282] According to some embodiments of any of the embodiments described herein, the nanoparticle comprises two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) ligands associated therewith. In some of these embodiments, the two or more ligands can be the same or different. In some embodiments of any of the embodiments described herein, each of the two or more ligands is independently a ligand as described herein in any of the respective embodiments and in any combination thereof.

[0283] When the metal nanoparticle is a part of a plurality of metal nanoparticles, each nanoparticle can have the same or different number of metal atoms. In some embodiments, the variability in the number of metal atoms in each nanoparticle does not exceed 30 %, and can, for example, in a range of from 1 to 30, or 1 to 25, or 1 to 20, %, including any intermediate values and subranges therebetween.

[0284] According to an aspect of some embodiments of the present invention there is provided a composition that comprises a plurality of metal nanoparticles as described herein. The metal nanoparticles can be the same or different. When different, metal nanoparticles can differ from one another by one or more of the metal type, the mean or average particle size or distribution, and the ligand (for example, by moiety X and / or moiety Y or linking moiety L in the ligand).

[0285] According to some embodiments of any of the embodiments described herein, the metal nanoparticles as described herein in any of the respective embodiments and in any combination thereof are usable, or are for use, in catalyzing a redox reaction. According to some embodiments of any of the embodiments described herein, the second moiety Y is a redox-reactive moiety, and the metal nanoparticles are for use as a catalyst in catalyzing a redox reaction as defined herein.

[0286] According an aspect of some embodiments of the present invention, there is provided a method of catalyzing a redox reaction, the method being effected by performing the redox reaction in the presence of a metal nanoparticle, or a plurality of metal particles, as described herein in any of the respective embodiments. According to of these embodiments, the redox reaction is performed in the presence of a catalytic amount of the metal nanoparticles.

[0287] As used herein and as known in the art, the term “catalyst” describes a substance that increases the rate of a chemical reaction without itself being consumed or undergoing permanent change in the process. Catalysts function by lowering the activation energy required for the reaction to proceed.In some embodiments of any of the embodiments described herein, the metal nanoparticles are for use as a catalyst in an oxidation of NADH. In some such embodiments, the oxidation of NADH is effected by contacting NADH and the metal nanoparticles as described herein in any of the respective embodiments and in any combination thereof, with molecular oxygen.

[0288] In some embodiments of any of the embodiments described herein, the metal nanoparticles are for use as a catalyst in a reduction of cytochrome c. In some such embodiments, the reduction of cytochrome c is effected by contacting cytochrome c and NADH with the metal nanoparticles as described herein in any of the respective embodiments and in any combination thereof.

[0289] In some embodiments of any of the embodiments described herein, the metal nanoparticles are gold nanoparticles, and are for use as a catalyst as described herein.

[0290] According to some embodiments of any of the embodiments described herein, the ligand is or comprises an oxidoreductase cofactor, the metal nanoparticles are gold nanoparticles and are for use as a catalyst as described herein.

[0291] According to some embodiments of any of the embodiments described herein, the ligand is or comprises nicotinamide adenine dinucleotide (NAD), the metal nanoparticles are gold nanoparticles and are for use as a catalyst as described herein.

[0292] According to some embodiments of any of the embodiments described herein, the ligand is or comprises flavin adenine dinucleotide (FAD), the metal nanoparticles are gold nanoparticles and are for use as a catalyst as described herein.

[0293] According to some embodiments of any of the embodiments described herein, X is or comprises a nucleobase, and the metal nanoparticles as described herein in any of the respective embodiments and in any combination thereof are gold nanoparticles and are for use as a catalyst as described herein.

[0294] According to some embodiments of any of the embodiments described herein, X is or comprises a nucleobase, Y is or comprises a nicotinamide moiety or similar, as described herein, and the metal nanoparticles as described herein in any of the respective embodiments and in any combination thereof are gold nanoparticles and are for use as a catalyst as described herein.

[0295] According to some embodiments of any of the embodiments described herein, X is or comprises a nucleobase, Y is or comprises a nicotinamide moiety or similar, the linking moiety L is a phosphate group, and the metal nanoparticles as described herein in any of the respective embodiments and in any combination thereof are gold nanoparticles and are for use as a catalyst as described herein.

[0296] According to some embodiments of any of the embodiments described herein, X is or comprises a nucleobase, Y is or comprises a nicotinamide moiety, the linking moiety L is a diphosphogroup, and the metal nanoparticles as described herein in any of the respective embodiments and in any combination thereof are gold nanoparticles and are for use as a catalyst as described herein.

[0297] In some embodiments of any of the embodiments described herein, the metal nanoparticles are copper nanoparticles, and are for use as a catalyst as described herein.

[0298] According to some embodiments of any of the embodiments described herein, the ligand is or comprises an oxidoreductase cofactor, the metal nanoparticles are copper nanoparticles and are for use as a catalyst as described herein.

[0299] According to some embodiments of any of the embodiments described herein, the ligand is or comprises nicotinamide adenine dinucleotide (NAD), the metal nanoparticles are copper nanoparticles and are for use as a catalyst as described herein.

[0300] According to some embodiments of any of the embodiments described herein, the ligand is or comprises flavin adenine dinucleotide (FAD), the metal nanoparticles are copper nanoparticles and are for use as a catalyst as described herein.

[0301] According to some embodiments of any of the embodiments described herein, X is or comprises a nucleobase, and the metal nanoparticles as described herein in any of the respective embodiments and in any combination thereof are copper nanoparticles and are for use as a catalyst as described herein.

[0302] According to some embodiments of any of the embodiments described herein, X is or comprises a nucleobase, Y is or comprises a nicotinamide moiety or similar, and the metal nanoparticles as described herein in any of the respective embodiments and in any combination thereof are copper nanoparticles and are for use as a catalyst as described herein.

[0303] According to some embodiments of any of the embodiments described herein, X is or comprises a nucleobase, Y is or comprises a nicotinamide moiety or similar, the linking moiety L is a phosphate group, and the metal nanoparticles as described herein in any of the respective embodiments and in any combination thereof are copper nanoparticles and are for use as a catalyst as described herein.

[0304] According to some embodiments of any of the embodiments described herein, X is or comprises a nucleobase, Y is or comprises a nicotinamide moiety or similar, the linking moiety L is a diphospho group, and the metal nanoparticles as described herein in any of the respective embodiments and in any combination thereof are copper nanoparticles and are for use as a catalyst as described herein.

[0305] According to some embodiments of any of the embodiments described herein, the metal nanoparticles as described herein in any of the respective embodiments and in any combination thereof are capable of associating to an oligonucleotide, by means of ligand exchange, as described herein, tothereby form the oligonucleotide decorated by nanoparticles of the metal, such that non-paired nucleobases of the oligonucleotide replace at least a portion of the ligands. In some such embodiments, the metal is gold.

[0306] According to some embodiments of any of the embodiments described herein, X is or comprises a nucleobase, and the metal nanoparticles are gold nanoparticles and are capable of associating to an oligonucleotide, to thereby form the oligonucleotide decorated by nanoparticles of the metal.

[0307] According to some embodiments of any of the embodiments described herein, X is or comprises a nucleobase, and the metal nanoparticles as described herein in any of the respective embodiments and in any combination thereof are capable of associating to an oligonucleotide, to thereby form the oligonucleotide decorated by nanoparticles of the metal.

[0308] In some embodiments of any of the embodiments described herein, the metal nanoparticles are for use in labeling an oligonucleotide, or for detecting non-paired nucleotides in an oligonucleotide (e.g., a nucleic acid).

[0309] Such metal nanoparticles are useful, e.g., for detecting sequence mismatches, structural irregularities, or point mutations within a nucleic acid strand; for probing hybridization events; for monitoring oligonucleotide folding or conformational changes; or for redox- or fluorescence-based signal reporting in molecular diagnostics, biosensing, or nucleic acid-targeted assays.

[0310] In some embodiments of any of the embodiments described herein, the metal nanoparticles are gold nanoparticles, and are for use in labeling an oligonucleotide, or for detecting non-paired nucleotides in an oligonucleotide (e.g., a nucleic acid).

[0311] In some embodiments of any of the embodiments described herein, the metal nanoparticles as described herein in any of the respective embodiments and in any combination thereof are for use in labeling an oligonucleotide, and for detecting non-paired nucleotides in an oligonucleotide (e.g., a nucleic acid).

[0312] The term “oligonucleotide” refers to a single stranded or double stranded oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof. This term includes oligonucleotides composed of naturally-occurring bases, sugars and covalent internucleoside linkages (e.g., backbone) as well as oligonucleotides having non-naturally-occurring portions which function similarly to respective naturally-occurring portions.

[0313] Oligonucleotides of some embodiments of the invention may also include base modifications or substitutions. As used herein, "unmodified" or "natural" bases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified bases include but are not limited to other synthetic and natural bases such as 5-methylcytosine (5-me-C), 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3 -deazaadenine. Further bases include those disclosed in U. S. Pat. No: 3,687,808, those disclosed in The Concise Encyclopedia of Polymer Science and Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993. Such bases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 °C [Sanghvi YS et al. (1993) Antisense Research and Applications, CRC Press, Boca Raton 276-278] and are presently preferred base substitutions, even more particularly when combined with 2'-O-methoxy ethyl sugar modifications.

[0314] In some embodiments of any of the embodiments described herein, the metal nanoparticles are for use in a reaction in which displacement (e.g., ligand exchange as defined herein in any of the respective embodiments) of the ligand is beneficial.

[0315] Such displacement may be beneficial, for example, for enabling the controlled release of the ligand under specific environmental or chemical conditions; for facilitating surface functionalization of the nanoparticle with alternative ligands, targeting moieties, or catalytically active groups; for exposing the metal surface to enhance catalytic, redox, or binding activity; for promoting interactions with biological molecules (e.g., proteins, nucleic acids, or lipids); or for allowing (e.g., reversible) association with substrates, membranes, or delivery carriers in biomedical, diagnostic, or synthetic applications.

[0316] Such displacement may be beneficial, for example, for providing substances decorated by nanoparticles of the metal, for example, polymeric substances, proteinaceous substances (e.g., antibodies, proteinaceous drugs, enzymes), which enables for detecting or imaging such substances.In some embodiments, the ligand displacement occurs under aqueous or physiological conditions (e.g., pH 6.5 to 7.4). In some embodiments, the ligand displacement is at least partially reversible.

[0317] In some embodiments, the ligand is replaced by a moiety or substance having a higher affinity for the surface of the metal atoms (e.g., thiol, phosphine, amines, and nitrogen-containing heterocyclic moieties).

[0318] According to an aspect of some of any of the embodiments of the invention, there is provided a process of preparing the metal nanoparticles as described herein in any of the respective embodiments and in any combination thereof.

[0319] According to some of these embodiments, the process is effected by contacting the ligand with an ion of the metal (as described herein in any of the respective embodiments and in any combination thereof) to form an ionic metal complex, and

[0320] contacting the ionic metal complex with a reducing agent to thereby form the metal nanoparticles.

[0321] As used herein and as known in the art, the phrase “reducing agent” describes a chemical species that donates one or more electrons to another chemical species, thereby reducing the oxidation state of the latter. Reducing agents are characterized by their ability to effect the conversion of metal ions (e.g., Au3+, Cu2+) into their corresponding elemental (zero-valent) metal form. Non-limiting examples include borohydrides (e.g., sodium borohydride, potassium borohydride), ascorbic acid, citrate, hydrazine, hydroxylamine, glucose, formate, carbon monoxide, alcohols (e.g., ethanol, methanol), phosphines, and gaseous hydrogen.

[0322] According to some embodiments, the metal atom is in its elemental (zero-valent) oxidation state following reduction of the (corresponding) ion of the metal, as described, e.g., in FIG. 3.

[0323] In some embodiments, the reducing agent is selected compatible with aqueous conditions and / or physiological pH. In some embodiments, the reduction is carried out under mild conditions, such as at a temperature of from about 4 °C to about 60 °C, or from about 15 °C to about 45 °C, e.g., 20 °C, including any intermediate values and subranges therebetween.

[0324] According to some embodiments of any of the embodiments described herein, a molar (mol per liter) ratio between the ligand and the ion of the metal is up to 50: 1, or up to 25: 1, or up to 10: 1, or up to 5:1, for example, is in a rage of for example, in a range of from 1:1 to 50:1, or from 1:1 to 25:1 or from 1:1 to 20:1, or from 1:1 to 10:1, or from 1:1 to 5:1, including any intermediate values and subranges therebetween, or is about 1:1.

[0325] According to an aspect of some of any of the embodiments of the invention, there is provided a composition comprising a lipid bilayer and the metal nanoparticles as described herein in anyembodiments and in any combination thereof. According to some embodiments of any of the embodiments described herein, the nanoparticles are associated with the lipid bilayer.

[0326] According to an aspect of some of any of the embodiments of the invention, there is provided a composition comprising a lipid bilayer having associated therewith the metal nanoparticle as described herein in any embodiments and in any combination thereof.

[0327] By “association”, “associated with” and any grammatical diversion of these terms as used herein, in the context of this aspect of embodiments of the invention, it is meant that that the nanoparticle and the lipid bilayer (the liposomes) are linked to one another via one or more chemical and / or physical interactions. Non-limiting examples of such interactions include electrostatic interactions, hydrogen bonding, van der Waals forces, hydrophobic interactions, π-π stacking interactions, and coordination interactions between functional groups of the ligand and headgroups or acyl chains of the lipid bilayer.

[0328] According to some embodiments of any of the embodiments described herein, the nanoparticle is associate with a lipid bilayer (e.g., a liposome) in a non-covalent manner or physically.

[0329] Without being bound by any particular theory, this association occurs at the interface of the nanoparticle and the external leaflet of the lipid bilayer, where the nanoparticle become associated with the membrane surface. In the context of NAD as an exemplary redox-reactive ligand, it is believed that the adenosine portion thereof (which includes a planar purine base and ribose sugar) may contribute hydrophobic surface area that facilitates membrane association via non-covalent (e.g., van der Waals, π-stacking) interactions with the lipid tails. This association may allow the nanoparticles to act as dynamic membrane-bound redox catalysts or delivery platforms, capable of reversible surface presentation on lipid bilayers without chemical modification of either the particle or the membrane.

[0330] The lipid bilayer can be in a form of a liposome that comprises at least one bilayer forming lipid.

[0331] Herein, the term "bilayer-forming lipid" encompasses any compound in which a bilayer may form from a pure aqueous solution of the compound. The formed bilayer comprises two parallel layers of lipid molecules.

[0332] In exemplary embodiment, the bilayer-forming lipid is a phospholipid, for example, a glycerophospholipid.

[0333] According to some embodiments, the liposome comprises one or more therapeutically active agent(s), or cosmetic agents or cosmeceutical active agents.

[0334] Herein, the term "bilayer-forming lipid" encompasses any compound in which a bilayer may form from a pure aqueous solution of the compound, the bilayer comprising two parallel layers of molecules of the compound (referred to as a "lipid").Typically, the bilayer comprises relatively polar moieties of the lipid at the two surfaces of the bilayer, which may optionally comprise an interface with the aqueous solution and / or an interface with a solid surface; and relatively hydrophobic moieties of the lipid at the interior of the bilayer, at an interface between the two layers of lipid molecules which form the bilayer.

[0335] In some embodiments, a bilayer-forming lipid is an amphiphilic lipid.

[0336] As used herein, the term “amphiphilic lipid” refers to compounds comprising at least one hydrophilic moiety and at least one lipophilic moiety. Examples of amphiphilic lipids include, without limitation, fatty acids (e.g., at least 6 carbon atoms in length) and derivatives thereof such as phospholipids and glycolipids; sterols (e.g., cholesterol) and steroid acids.

[0337] Herein, the term “phospholipid” refers to a compound comprising a substituted or nonsubstituted phosphate group and at least one alkyl chain (optionally at least two alkyl chains) which is optionally at least 5 carbon atoms in length, optionally at least 7 atoms in length and optionally at least 9 atoms in length, for example, of from 5 to 30, or from 7 to 30, or from 9 to 30, carbon atoms in length, including any intermediate values and subranges therebetween. The at least one alkyl chain is optionally a part of an acyl group (e.g., a fatty acid moiety), as described herein in any of the respective embodiments or an alkyl group per se (e.g., a fatty alcohol moiety). In some embodiments, the phosphate group and one or two (optionally two) alkyl chains (e.g., acyl or alkyl) are attached to a glycerol moiety via the oxygen atoms of glycerol, forming a glycerophospholipid.

[0338] In the context of the present embodiments, the term “phospholipid” encompasses lipids having a (phosphorylated) glycerol backbone (e.g., monoacylglyceride and / or diacylglyceride phospholipids), referred to as glycerophospholipids.

[0339] In some embodiments of any one of the embodiments described herein, the phospholipid is a glycerophospholipid. In some embodiments, the glycerophospholipid is a diacylglyceride, comprising two fatty acyl groups and one phosphate group attached to a glycerol backbone.

[0340] Examples of bilayer-forming lipids include glycerophospholipids (e.g., a glycerophospholipid according to any of the respective embodiments described herein). It is to be appreciated that the polymeric compound described herein may optionally be a bilayer-forming lipid which can form a bilayer per se or in combination with one or more additional bilayer-forming lipids.

[0341] The lipid bilayer according to some of the present embodiments may optionally be closed upon itself (e.g., such that the bilayer has no edges), thereby forming an inner volume separated by the bilayer from the surrounding environment, which is referred to herein and in the art as a "liposome". Alternatively, or additionally, the bilayer may be open-faced and / or with edges.

[0342] As used herein and in the art, the term “liposome” refers to an artificially prepared vesicle comprising a bilayer composed of molecules of an amphiphilic lipid. In an aqueous medium, thebilayer is typically configured such that hydrophilic moieties of the amphiphilic lipid are exposed to the medium at both surfaces of the bilayer, whereas lipophilic moieties of the lipid are located in the internal portion of the bilayer, and therefore less exposed to the medium. Examples of liposomes which may be used in any one of the embodiments described herein include, without limitation, small unilamellar vesicles (SUV), large unilamellar vesicles (LUV) and large multilamellar vesicles (MLV).

[0343] As described herein, the liposome according to the present embodiments comprises, inter alia, at least one bilayer-forming lipid.

[0344] A liposome may optionally comprise a single bilayer (e.g., a unilamellar vesicle) or a plurality of bilayers (e.g., a multilamellar vesicle) - wherein each bilayer optionally independently forms a closed vesicle - comprising, for example, concentric bilayer vesicles and / or a plurality of separate bilayer vesicles encompassed by the same bilayer vesicle.

[0345] As used herein, the term “unilamellar” refers to liposomes characterized by a single lipid bilayer, whereas the term “multilamellar” refers to liposomes characterized by multiple lipid bilayers, for example, concentric bilayers.

[0346] As used herein, the phrase “small unilamellar vesicle” refers to unilamellar liposomes of less than 100 nm in diameter, whereas the phrase “large unilamellar vesicle” refers to unilamellar liposomes at least 100 nm in diameter.

[0347] As used herein, the phrase “small multilamellar vesicle” refers to multilamellar liposomes of less than 100 nm in diameter, whereas the phrase “large multilamellar vesicle”, MLV, refers to multilamellar liposomes at least 100 nm in diameter.

[0348] In some embodiments of any one of the embodiments described herein, the liposomes comprise multilamellar vesicles. In some embodiments, the liposomes are primarily (more than 50 weight percent) multilamellar vesicles, preferably large multilamellar vesicles (MLV).

[0349] In some embodiments of any one of the embodiments described herein, the liposomes comprise small unilamellar vesicles. In some embodiments, the liposomes are primarily (more than 50 weight percent) small unilamellar vesicles.

[0350] In some embodiments of any one of the embodiments described herein, the liposomes comprise large unilamellar vesicles. In some embodiments, the liposomes are primarily (more than 50 weight percent) large unilamellar vesicles.

[0351] A liposome according to any of the respective embodiments described herein may be approximately spherical in shape or may have any alternative shape, such as an elongated tube and / or a flattened (e.g., sheet-like) shape.A liposome according to any of the respective embodiments described herein can be used as carrier for delivering agents encapsulated or otherwise associated therewith, in addition to the metal nanoparticles. Such agents can be, for example, therapeutically active agents, and the metal nanoparticles can serve for detecting the liposomes, for example, in a physiological environment.

[0352] According to an aspect of some of any of the embodiments of the invention, there is provided a product comprising the composition as described herein in any of the respective embodiments and in any combination thereof. According to some embodiments of any of the embodiments described herein, the product is a cosmetic or cosmeceutical product.

[0353] As used herein, the phrase "cosmetic product" describes a formulation or preparation that is intended to be applied to an external surface of the body, such as skin, lips, hair, nails, or mucous membranes, for the purpose of cleansing, beautifying, promoting attractiveness, protecting, or altering the appearance without exerting a therapeutic effect. Cosmetic products in which the compositions described herein can be beneficially utilized include, for example, moisturizers, serums, lotions, emulsions, toners, cleansers, masks, sunscreens, anti-aging formulations, skin brightening agents, eye creams, or formulations for topical delivery of antioxidants or other beneficial agents.

[0354] As used herein, the phrase “cosmeceutical product” describes a product that combines cosmetic and pharmaceutical properties, that is, a topically applied product that has both a cosmetic (e.g., an aesthetic or beautifying) effect as described herein and a biologically active effect on the external surface of the body to which it is applied.

[0355] In some embodiments, the metal nanoparticles function as redox-modulating or antioxidant agent in a topical cosmetic or cosmeceutical formulation.

[0356] According to some embodiments of any of the embodiments described herein, the composition is formulated as a topical cosmetic or cosmeceutical formulation comprising the lipid bilayer-associated nanoparticles as described herein in any embodiment and in any combination thereof.

[0357] According to some embodiments of any of the embodiments described herein, the metal nanoparticles as described herein in any of the respective embodiments and in any combination thereof are arranged on a substrate, such that a plurality of the metal nanoparticles are associated with at least a portion of a surface of the substrate.

[0358] Embodiments of the present invention also relate to compositions-of-matter comprising a substrate and a plurality of metal nanoparticles associated with at least a portion of a surface of the substrate.

[0359] According to an aspect of some of any of the embodiments of the invention, there is provided a composition-of-matter comprising a substrate and a plurality of metal nanoparticles associated with at least a portion of a surface of the substrate.According to these embodiments, in at least a portion of the plurality of metal nanoparticles, each nanoparticle is a metal nanoparticle as described herein in any of the respective embodiments and in any combination thereof.

[0360] As used herein, the term “substrate” describes a solid material having at least one exposed surface. The substrate as described herein may be planar or curved, rigid or flexible, particulate, porous, crystalline, or amorphous.

[0361] In some embodiments of any of the embodiments described herein, the substrate is selected capable of supporting, interacting with, and / or being coated by the metal nanoparticles of any of the respective embodiments and / or is such that associating with its surface the nanoparticles as described herein is beneficial.

[0362] In some embodiments of any of the embodiments described herein, the substrate comprises a solid material in at least a portion of its surface that is capable of adsorbing metal nanoparticles from an aqueous suspension under conditions of defined ionic strength. The substrate serves as a solid support onto which the metal nanoparticles are deposited. The substrate is not limited to any particular chemical composition, provided that its surface supports association with the nanoparticles as described herein.

[0363] According to some embodiments of any of the embodiments described herein, the substrate comprises an inorganic solid material. Inorganic solid materials suitable for use as substrates include, without limitation, semiconductor materials, mineral materials, and oxide materials, and any combination thereof.

[0364] According to some embodiments, the substrate comprises or consists of silicon.

[0365] According to some embodiments, the surface of the substrate is or comprises or consists of silicon.

[0366] Th silicon can be, for example, crystalline silicon, poly crystalline silicon, and / or amorphous silicon. Suitable silicon substrates include, without limitation, silicon wafers of any crystallographic orientation, doping level, and thickness known in the art.

[0367] According to some embodiments, the surface of the substrate is or comprises HF-treated silicon. As used herein, the phrase “HF-treated silicon” describes silicon that has been treated with, or exposed to or contacted with, hydrofluoric acid (HF) so as to remove at least a portion of a native oxide layer (e.g., silicon dioxide) on the surface of the silicon, thereby generating a hydrogen-terminated silicon surface and / or a surface having modified surface chemistry relative to untreated silicon. The hydrogen-terminated silicon surface obtained by hydrofluoric acid treatment is chemically distinct from both native silicon and silicon dioxide.In some embodiment, hydrofluoric acid treatment is carried out by immersing the silicon substrate in an aqueous hydrofluoric acid solution, followed by rinsing with water and drying.

[0368] According to some embodiments of any of the embodiments described herein, the substrate comprises in at least a portion of its surface a semiconductor material. The semiconductor material can be silicon, as described herein, and / or semiconductor materials such as, but not limited to, germanium, gallium arsenide, indium phosphide, and other Group IV, III-V, and II- VI semiconductor materials known in the art.

[0369] According to some embodiments of any of the embodiments described herein, the substrate comprises in at least a portion of its surface a negatively charged inorganic material, for example, a silicate-containing material.

[0370] According to some embodiments of any of the embodiments described herein, the substrate comprises in at least a portion of its surface a silicate mineral, for example, a phyllosilicate mineral. Phyllosilicate minerals are characterized by a layered sheet structure of silicon-oxygen tetrahedra and include, without limitation, mica, talc, pyrophyllite, quartz, feldspar, clay minerals, and layered aluminosilicates and related minerals. In some embodiments, the silicate mineral is or comprises mica.

[0371] According to some embodiments of any of the embodiments described herein, the surface of the substrate is or comprises mica.

[0372] The term “mica” describes a group of sheet silicate (phyllosilicate) minerals characterized by a layered structure and atomically flat cleavage planes. Mica surfaces may present negatively charged sites under aqueous conditions, which can facilitate adsorption of charged or polar ligands associated with the metal nanoparticles.

[0373] The mica can be, for example, muscovite mica, having the chemical formula KAl2(AlSi3O10)(OH)2. Mica substrates are prepared for nanoparticle deposition by cleaving with adhesive tape or a blade immediately prior to use, thereby exposing a clean, atomically flat surface.

[0374] According to some embodiments of any of the embodiments described herein, the substrate comprises in at least a portion of its surface an oxide material. In some embodiments, the oxide material is or comprises silicon dioxide, including thermally grown silicon dioxide on silicon wafers, native oxide layers, and fused silica. The substrate may also comprise glass, including borosilicate glass, soda-lime glass, and quartz glass. Glass and silicon dioxide substrates present hydroxylterminated surfaces under ambient conditions, which are negatively charged and thereby promote association of the nanoparticles.

[0375] The substrate, or a portion thereof, may take any physical form suitable for the intended application, including without limitation a wafer, a flat plate, a slide, a chip, a film, a fiber, a bead, a particle, a membrane, or a porous matrix. The substrate may be rigid or flexible. The substrate maybe optically transparent, optically opaque, or reflective, depending on the requirements of the intended application. The substrate may be electrically conductive, semiconducting, or insulating.

[0376] According to some embodiments of any of the embodiments described herein, the substrate and / or the surface thereof is not a silicon substrate as described in WO 2024 / 216261.

[0377] According to some embodiments of any of the embodiments described herein, the plurality of metal nanoparticles is associated with at least 10 %, or at least 20 %, or at least 30 %, or at least 50 %, or at least 80 %, or at least 95 %, or about 100 %, of a surface of the substrate, including any intermediate values and subranges therebetween.

[0378] In the context of the present aspect, association between the plurality of metal nanoparticles and the substrate surface may occur via physical and / or chemical interactions, as described herein, between the nanoparticles (including ligands associated therewith) and the substrate surface.

[0379] In some embodiments of any of the embodiments described herein, the plurality of metal nanoparticles forms together a film on at least a portion of the surface of the substrate.

[0380] According to some embodiments, the film is a thin film.

[0381] As used herein and as known in the art, the phrase “thin film” describes a layer of material having a thickness in the nanometer scale, for example, lower than 5 nm, or lower than 3 nm, or lower than 2 nm, or ranging from 0.5 to 5, or from 0.8 to 5, or from 0.8 to 3, or from 0.8 to 2, or from 1 to 5, or from 1 to 3, or from 1 to 2, nm, including any intermediate values and subranges therebetween.

[0382] According to some embodiments of any of the embodiments described herein, the thin film is a monolayer formed of the plurality of metal nanoparticles.

[0383] As used herein, the term “monolayer” describes, in the context of the present invention, an arrangement in which the metal nanoparticles form a substantially single layer on the surface of the substrate, such that the metal nanoparticles are arranged laterally across the surface of the substrate without substantial vertical stacking.

[0384] According to some embodiments of any of the embodiments described herein, the film comprises more than one layer of metal nanoparticles.

[0385] According to some embodiments, the film comprises two or more layers (e.g., bilayer, multilayer), optionally formed by partial stacking or aggregation of nanoparticles on previously deposited nanoparticles.

[0386] According to some embodiments of any of the embodiments described herein, the plurality of metal nanoparticles forming the film are ultra-small metal nanoparticles as described herein in any of the respective embodiments, for example, metal nanoparticles having a mean diameter lower than 5 nm, or lower than 3 nm, or lower than 2 nm, including any intermediate values and subranges therebetween.According to some embodiments of any of the embodiments described herein, the nanoparticles average size, the substrate, and the thickness of the formed layer or film, are selected or configured to provide a composition-of-matter that is suitable or usable in a certain application. According to some embodiments of any of the embodiments described herein, the composition-of-matter is obtainable by a process as described herein in any of the respective embodiments, that is, by a wet chemistry, solution / suspension-based process.

[0387] The arrangement of the plurality of metal nanoparticles on the surface of the substrate, optionally in the form of a monolayer or thin film as described herein, may provide a surface architecture characterized by nanoscale dimensions, high surface-to-volume ratio, and accessible metal sites and / or ligands. Such surface architecture may modify one or more physicochemical properties of the substrate, including electronic conductivity, surface charge distribution, work function, optical absorbance, reflectance, catalytic activity, redox behavior, wettability, surface energy, and / or interfacial reactivity, as compared to the uncoated substrate, thereby rendering the substrate, when associated with the nanoparticles, usable in a myriad of applications.

[0388] According to some embodiments of any of the embodiments described herein, the composition-of-matter is usable in (configured for integration into, incorporation into, or implementation in) electronic, bioelectronic, optical, catalytic, sensing, and / or surface-modifying applications.

[0389] In some such embodiments, the plurality of metal nanoparticles deposited on the substrate provides an interface that is usable (actively participates) in electron transfer, charge transport modulation, light-matter interaction, heterogeneous catalytic processes (heterogeneous catalysis), molecular recognition, adsorption phenomena, or controlled surface functionalization.

[0390] As known in the art, the phrase “heterogeneous catalysis” describes a catalytic process in which a catalyst is in a different phase from at least one reactant participating in the reaction. In the context of the present embodiments, heterogeneous catalysis refers to a catalytic process in which the plurality of metal nanoparticles associated with at least a portion of a surface of a substrate function as a surface-bound catalyst, such that reactant molecules in a surrounding liquid or gaseous medium interact with at least some of the metal nanoparticles to undergo a redox and / or other catalytic transformation.

[0391] According to some embodiments, the heterogeneous catalytic process comprises an oxidation reaction, a reduction reaction, or a coupled redox reaction.

[0392] In some embodiments, the plurality of metal nanoparticles deposited on the substrate define a functional surface layer capable of modifying one or more electrical, optical, catalytic, or redox properties of the substrate.For example, the composition-of-matter is characterized by a red shift in localized surface plasmon resonance (LSPR), relative to a solution or suspension (e.g., aqueous) that comprises the nanoparticles.

[0393] The composition-of-matter can be integrated with an article-of-manufacturing in which the functionality is beneficial.

[0394] According to an aspect of some embodiments of the present invention, there is provided an article-of-manufacturing comprising the composition-of-matter as described herein in any of the respective embodiments and in any combination thereof.

[0395] According to some embodiments, the article-of-manufacturing is an optical article or device, and / or a semiconductor article or device, or a part thereof.

[0396] The following describes exemplary, non-limiting, articles-of-manufacturing.

[0397] A biosensor device: the localized surface plasmon resonance properties of the nanoparticle film provide an optical signal that changes measurably upon binding of a target analyte to the coated surface, enabling label-free detection of biomolecules such as nucleic acids.

[0398] An electrochemical sensor: the nanoparticle film can function as a modified electrode surface capable of mediating electron transfer between solution-phase analytes and the underlying substrate.

[0399] A surface-enhanced Raman scattering substrate: the nanoparticle film can provide electromagnetic field enhancement sufficient to amplify the Raman scattering signal of molecules adsorbed on or proximate to the surface having associated therewith the nanoparticles.

[0400] A microfluidic analytical device: an internal surface associated with the nanoparticles can provide optical or electrochemical detection capability within the microfluidic channel or chamber.

[0401] A lateral flow assay device: the nanoparticles can provide a visually or instrumentally detectable signal upon contact with a target analyte.

[0402] A laboratory substrate for atomic force microscopy: the nanoparticles layer can provide a dimensional reference standard for calibration of atomic force microscopy instrumentation.

[0403] A medical device having an external surface or an internal surface onto which a thin film of the metal nanoparticles is deposited, and can provide antimicrobial activity by inhibiting the adhesion and proliferation of bacteria and other microorganisms on the device surface. Non-limiting examples of such medical devices include catheters, implants, surgical instruments, wound dressings, and prosthetic components.

[0404] A cell culture substrate: the nanoparticles layer can provide a defined chemical and topographical interface for the adhesion, growth, and study of cells in vitro.

[0405] A drug delivery research tool: the replaceable ligand can provide a model system for the quantitative study of ligand adsorption, desorption, and exchange kinetics under defined conditions.A photodetector device: the nanoparticles layer can modify the optical absorption properties of the semiconductor surface and thereby affects the photoresponse of the device.

[0406] A solar energy conversion device: the nanoparticles layer can modify the optical absorption characteristics of the semiconductor surface layer.

[0407] A nano-heating element: irradiation of the nanoparticles layer with light of an appropriate wavelength can generate localized heat at the substrate surface, enabling applications in thermally activated surface chemistry, polymerase chain reaction support surfaces, and related thermal processing applications.

[0408] A water treatment device, a food packaging material, a textile or wearable article and any other articles, in which the nanoparticles layer can contribute to the inactivation of microorganisms or the degradation of chemical contaminants.

[0409] The composition-of-matter of the present embodiments can be tailored to feature properties suitable for its intended use, for example for an intended article-of-manufacturing comprising same, by selecting a suitable substrate, a suitable size of the nanoparticles, and by controlling the process parameters while preparing the composition-of-matter.

[0410] According to an aspect of some of any of the embodiments of the invention, there is provided a process for preparing the composition-of-matter as described herein in any of the respective embodiments and in any combination thereof.

[0411] According to some embodiments of any of the embodiments described herein, the process comprises contacting a substrate (e.g., the substrate as described herein in any of the respective embodiments) with a suspension that comprises a vehicle (a carrier, a solvent) and a plurality of metal nanoparticles as described herein, to thereby obtain the composition-of-matter. In some embodiments of any of the embodiments described herein, in at least a portion of the plurality of metal nanoparticles, each nanoparticle is the metal nanoparticle as described herein in any of the respective embodiments and in any combination thereof.

[0412] As used herein, the term “vehicle” describes a liquid medium suitable for dispersing or suspending the plurality of metal nanoparticles and enabling their contact with the surface of the substrate.

[0413] According to some embodiments of any of the embodiments described herein, the vehicle is or comprises water. In some embodiments of any of the embodiments described herein, the suspension is an aqueous suspension.

[0414] The vehicle may comprise a mixture of water and a water-miscible organic solvent, provided that the organic solvent does not cause aggregation of the nanoparticles or damage to the substratesurface. Non-limiting examples of water-miscible organic solvents that may be considered in this context include ethanol and dimethyl sulfoxide at low volume fractions.

[0415] In some embodiments of any of the embodiments described herein, the contacting comprises depositing the suspension onto the substrate. Such depositing may be effected by drop-casting, spincoating, dip-coating, immersion, spraying, and / or any other liquid-phase deposition technique known in the art or any combination of techniques.

[0416] According to some embodiments of any of the embodiments described herein, the contacting is effected for a period of at least 5 minutes, or at least 10 minutes, or at least 15 minutes, or at least 20 minutes, or at least 30 minutes, or at least 45 minutes, or at least 1 hour, or at least 3 hours, or at least 6 hours, or at least 10 hours, or at least 12 hours, or at least 16 hours, including any intermediate values and subranges therebetween. The contacting period determines the thickness of the deposited nanoparticles layer or film.

[0417] Depending on the desired application, when an increased surface coverage and / or formation of multilayer arrangements of the plurality of metal nanoparticles on the surface of the substrate is / are desired, prolonged contacting (e.g., longer than 3 hours, longer than 5 hours, longer than 6 hours, longer than 10 hours, longer than 12 hours, or longer than 16 hours) and / or the use of a salt that increases an ionic strength of the suspension (e.g., a divalent salt) and / or a high concentration of the salt, may be preferred.

[0418] According to some embodiments of any of the embodiments described herein, the suspension further comprises a salt. Any water-soluble inorganic or organic salt that is compatible with the nanoparticle suspension and does not cause irreversible aggregation of the nanoparticles at the concentration required for deposition may be used. Suitable monovalent cation chloride salts include, without limitation, potassium chloride, sodium chloride, lithium chloride, ammonium chloride, and cesium chloride. Suitable monovalent cation salts with anions other than chloride include, without limitation, sodium acetate, potassium acetate, sodium nitrate, potassium nitrate, sodium phosphate monobasic, and potassium phosphate monobasic. Divalent cation salts include, without limitation, magnesium acetate, magnesium chloride, calcium chloride, and zinc acetate.

[0419] Buffer salts may also be used, either alone or in combination with additional salts, provided that the total ionic strength of the deposition suspension falls within the range required to produce the desired surface coverage. Suitable buffer systems include, without limitation, HEPES-potassium, HEPES-sodium, Tris-HCl, phosphate-buffered saline, citrate -potassium, and citrate-sodium buffers.

[0420] According to some embodiments, the salt is a water-soluble salt.

[0421] According to some embodiments, the salt is a monovalent salt.

[0422] According to some embodiments, the salt is a water-soluble monovalent salt.According to some embodiments, the salt comprises an alkali metal halide.

[0423] According to some embodiments, the salt is KC1.

[0424] According to some embodiments of any of the embodiments described herein, the salt is present at a concentration of at least 10 mM, or at least 50 mM, or at least 70 mM, or at least 0.1 M, or at least 0.2 M, or at least 0.3 M, or at least 0.5 M, or at least 0.7 M, or at least 0.8 M, or at least 1 M, or is in a range of from 1 mM to 10 M, or from 10 mM to 10 M, or from 0.1 M to 10 M, or from 10 mM to 1 M, or from 50 mM to 1 M, or from 70 mM to 1 M, or from 0.1 M to 1 M, or from 0.2 M to 1 M, or from 0.5 M to 1 M, including any intermediate values and subranges therebetween.

[0425] The concentration of the salt and / or the prolonged contacting may enable formation of nonmonolayer films and / or multilayer nanoparticle arrangements.

[0426] Without being bound by any particularly theory, the presence of divalent cations increases ionic strength and may reduce electrostatic repulsion between nanoparticles and / or between nanoparticles and the substrate surface, thereby affecting adsorption behavior. At relatively high concentrations of divalent salts, partial aggregation of the plurality of metal nanoparticles may occur prior to or during deposition.

[0427] According to some embodiments of any of the embodiments described herein, the salt is a divalent salt. Non-limiting examples include MgCl2, CaCl2, and ZnCl2. The concentration of the divalent salt may be selected so as to balance the stability of the metal nanoparticle in suspension with promotion of surface adsorption.

[0428] According to some embodiments of any of the embodiments described herein, the plurality of metal nanoparticles forms a thin film on at least a portion of the surface of the substrate.

[0429] According to some embodiments of any of the embodiments described herein, the contacting time, a concentration and / or average size of the plurality of metal nanoparticles in the suspension, a concentration of the salt, an identity of the salt, and substrate (identity / optional modifications of the surface of the substrate) are selected such that a monolayer of the plurality of metal nanoparticles is formed upon the contacting.

[0430] As used herein the term “about” refers to ± 10 % or ± 5 %.

[0431] The terms "comprises", "comprising", "includes", "including", “having” and their conjugates mean "including but not limited to".

[0432] The term “consisting of’ means “including and limited to”.

[0433] The term "consisting essentially of" means that the composition, method or structure may include additional ingredients, steps and / or parts, but only if the additional ingredients, steps and / or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof.

[0434] Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

[0435] Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases “ranging / ranges between” a first indicate number and a second indicate number and “ranging / ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.

[0436] As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.

[0437] As used herein throughout, the term “alkyl” refers to any saturated aliphatic hydrocarbon including straight chain and branched chain groups. Preferably, the alkyl group has 1 to 20 carbon atoms. Whenever a numerical range; e.g., “1 to 20”, is stated herein, it implies that the group, in this case the hydrocarbon, may contain 1 carbon atom, 2 carbon atoms, 3 carbon atoms, etc., up to and including 20 carbon atoms. More preferably, the alkyl is a medium size alkyl having 1 to 10 carbon atoms. Most preferably, unless otherwise indicated, the alkyl is a lower alkyl having 1 to 4 carbon atoms. The alkyl group may be substituted or non-substituted. When substituted, the substituent group can be, for example, cycloalkyl, aryl, heteroaryl, heteroalicyclic, halo, hydroxy, alkoxy, aryloxy, thiohydroxy, thioalkoxy, thioaryloxy, sulfinyl, sulfonyl, sulfonate, sulfate, cyano, nitro, azide, phosphonyl, phosphinyl, oxo, imine, oxime, hydrazone, carbonyl, thiocarbonyl, a urea group, a thiourea group, O-carbamyl, N-carbamyl, O-thiocarbamyl, N-thiocarbamyl, S -thiocarbamyl, C-amido, N-amido, C-carboxy, O-carboxy, sulfonamide, guanyl, guanidinyl, hydrazine, hydrazide, thiohydrazide, and amino, as these terms are defined herein.

[0438] Herein, the term “alkenyl” describes an unsaturated aliphatic hydrocarbon comprise at least one carbon-carbon double bond, including straight chain and branched chain groups. Preferably, the alkenyl group has 2 to 20 carbon atoms. More preferably, the alkenyl is a medium size alkenyl having 2 to 10 carbon atoms. Most preferably, unless otherwise indicated, the alkenyl is a lower alkenyl having 2 to 4 carbon atoms. The alkenyl group may be substituted or non-substituted. Substituted alkenyl may have one or more substituents, whereby each substituent group can independently be, for example, alkynyl, cycloalkyl, alkynyl, aryl, heteroaryl, heteroalicyclic, halo, hydroxy, alkoxy, aryloxy, thiohydroxy, thioalkoxy, thioaryloxy, sulfinyl, sulfonyl, sulfonate, sulfate, cyano, nitro, azide, phosphonyl, phosphinyl, oxo, imine, oxime, hydrazone, carbonyl, thiocarbonyl, a urea group, a thiourea group, O-carbamyl, N-carbamyl, O-thiocarbamyl, N-thiocarbamyl, S -thiocarbamyl, C-amido, N-amido, C-carboxy, O-carboxy, sulfonamide, guanyl, guanidinyl, hydrazine, hydrazide, thiohydrazide, and amino.

[0439] Herein, the term “alkynyl” describes an unsaturated aliphatic hydrocarbon comprise at least one carbon-carbon triple bond, including straight chain and branched chain groups. Preferably, the alkynyl group has 2 to 20 carbon atoms. More preferably, the alkynyl is a medium size alkynyl having 2 to 10 carbon atoms. Most preferably, unless otherwise indicated, the alkynyl is a lower alkynyl having 2 to 4 carbon atoms. The alkynyl group may be substituted or non-substituted. Substituted alkynyl may have one or more substituents, whereby each substituent group can independently be, for example, cycloalkyl, alkenyl, aryl, heteroaryl, heteroalicyclic, halo, hydroxy, alkoxy, aryloxy, thiohydroxy, thioalkoxy, thioaryloxy, sulfinyl, sulfonyl, sulfonate, sulfate, cyano, nitro, azide, phosphonyl, phosphinyl, oxo, imine, oxime, hydrazone, carbonyl, thiocarbonyl, a urea group, a thiourea group, O-carbamyl, N-carbamyl, O-thiocarbamyl, N-thiocarbamyl, S -thiocarbamyl, C-amido, N-amido, C-carboxy, O-carboxy, sulfonamide, guanyl, guanidinyl, hydrazine, hydrazide, thiohydrazide, and amino.

[0440] A “cycloalkyl” group refers to a saturated on unsaturated all-carbon monocyclic or fused ring (z.e., rings which share an adjacent pair of carbon atoms) group wherein one of more of the rings does not have a completely conjugated pi-electron system. Examples, without limitation, of cycloalkyl groups are cyclopropane, cyclobutane, cyclopentane, cyclopentene, cyclohexane, cyclohexadiene, cycloheptane, cycloheptatriene, and adamantane. A cycloalkyl group may be substituted or nonsubstituted. When substituted, the substituent group can be, for example, alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heteroalicyclic, halo, hydroxy, alkoxy, aryloxy, thiohydroxy, thioalkoxy, thioaryloxy, sulfinyl, sulfonyl, sulfonate, sulfate, cyano, nitro, azide, phosphonyl, phosphinyl, oxo,imine, oxime, hydrazone, carbonyl, thiocarbonyl, a urea group, a thiourea group, O-carbamyl, N-carbamyl, O-thiocarbamyl, N-thiocarbamyl, S -thiocarbamyl, C-amido, N-amido, C-carboxy, O-carboxy, sulfonamide, guanyl, guanidinyl, hydrazine, hydrazide, thiohydrazide, and amino, as these terms are defined herein. When a cycloalkyl group is unsaturated, it may comprise at least one carboncarbon double bond and / or at least one carbon-carbon triple bond.

[0441] An “aryl” group refers to an all-carbon monocyclic or fused-ring polycyclic (z.e., rings which share adjacent pairs of carbon atoms) having a completely conjugated pi-electron system. Examples, without limitation, of aryl groups are phenyl, naphthalenyl and anthracenyl. The aryl group may be substituted or non-substituted. When substituted, the substituent group can be, for example, alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heteroalicyclic, halo, hydroxy, alkoxy, aryloxy, thiohydroxy, thioalkoxy, thioaryloxy, sulfinyl, sulfonyl, sulfonate, sulfate, cyano, nitro, azide, phosphonyl, phosphinyl, oxo, imine, oxime, hydrazone, carbonyl, thiocarbonyl, a urea group, a thiourea group, O-carbamyl, N-carbamyl, O-thiocarbamyl, N-thiocarbamyl, S -thiocarbamyl, C-amido, N-amido, C-carboxy, O-carboxy, sulfonamide, guanyl, guanidinyl, hydrazine, hydrazide, thiohydrazide, and amino, as these terms are defined herein.

[0442] A “heteroaryl” group refers to a monocyclic or fused ring (z.e., rings which share an adjacent pair of atoms) having in the ring(s) one or more atoms, such as, for example, nitrogen, oxygen and sulfur and, in addition, having a completely conjugated pi-electron system. Examples, without limitation, of heteroaryl groups include pyrrole, furan, thiophene, imidazole, oxazole, thiazole, pyrazole, pyridine, pyrimidine, quinoline, isoquinoline, pyrazine, pyridazine, indole, benzofuran, benzothiophene, benzoxazole, benzimidazole, benzothiazole, quinoxaline, and carbazole and purine. The heteroaryl group may be substituted or non-substituted. When substituted, the substituent group can be, for example, alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heteroalicyclic, halo, hydroxy, alkoxy, aryloxy, thiohydroxy, thioalkoxy, thioaryloxy, sulfinyl, sulfonyl, sulfonate, sulfate, cyano, nitro, azide, phosphonyl, phosphinyl, oxo, imine, oxime, hydrazone, carbonyl, thiocarbonyl, a urea group, a thiourea group, O-carbamyl, N-carbamyl, O-thiocarbamyl, N-thiocarbamyl, S-thiocarbamyl, C-amido, N-amido, C-carboxy, O-carboxy, sulfonamide, guanyl, guanidinyl, hydrazine, hydrazide, thiohydrazide, and amino, as these terms are defined herein.

[0443] A “heteroalicyclic” group refers to a monocyclic or fused ring group having in the ring(s) one or more atoms such as nitrogen, oxygen and sulfur. The rings may also have one or more double bonds. However, the rings do not have a completely conjugated pi-electron system. The heteroalicyclic may be substituted or non-substituted. When substituted, the substituted group can be, for example, alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heteroalicyclic, halo, hydroxy, alkoxy, aryloxy, thiohydroxy, thioalkoxy, thioaryloxy, sulfinyl, sulfonyl, sulfonate, sulfate, cyano,nitro, azide, phosphonyl, phosphinyl, oxo, imine, oxime, hydrazone, carbonyl, thiocarbonyl, a urea group, a thiourea group, O-carbamyl, N-carbamyl, O-thiocarbamyl, N-thiocarbamyl, S-thiocarbamyl, C-amido, N-amido, C-carboxy, O-carboxy, sulfonamide, guanyl, guanidinyl, hydrazine, hydrazide, thiohydrazide, and amino, as these terms are defined herein. Representative examples are piperidine, piperazine, tetrahydrofuran, tetrahydropyran, morpholine, pyrrolidine, phthalimide, 1,4-dioxane, azepine, thiazolidine, and the like.

[0444] Herein, the terms “amine” and “amino” each refer to either a -NR’R’ ’ group or a -N+R’R’ ’R’ ’ ’ group, wherein R’, R” and R”’ are each hydrogen or a substituted or non-substituted alkyl, alkenyl, alkynyl, cycloalkyl, heteroalicyclic (linked to amine nitrogen via a ring carbon thereof), aryl, or heteroaryl (linked to amine nitrogen via a ring carbon thereof), as defined herein. Optionally, R’, R” and R”’ are hydrogen or alkyl comprising 1 to 4 carbon atoms. Optionally, R’ and R” (and R’”, if present) are hydrogen. When substituted, the carbon atom of an R’, R” or R”’ hydrocarbon moiety which is bound to the nitrogen atom of the amine is not substituted by oxo (unless explicitly indicated otherwise), such that R’, R” and R’” are not (for example) carbonyl, C-carboxy or amide, as these groups are defined herein.

[0445] An “azide” group refers to a -N=N+=N“ group.

[0446] An “alkoxy” group refers to any of an -O-alkyl, -O-alkenyl, -O-alkynyl, -O-cycloalkyl, and -O-heteroalicyclic group, as defined herein.

[0447] An “aryloxy” group refers to both an -O-aryl and an -O-heteroaryl group, as defined herein. A “hydroxy” group refers to a -OH group.

[0448] A “thiohydroxy” or “thiol” group refers to a -SH group.

[0449] A “thioalkoxy” group refers to any of an -S-alkyl, -S-alkenyl, -S-alkynyl, -S-cycloalkyl, and -S -heteroalicyclic group, as defined herein.

[0450] A “thioaryloxy” group refers to both an -S-aryl and an -S-heteroaryl group, as defined herein. A “carbonyl” or “acyl” group refers to a -C(=O)-R’ group, where R’ is defined as hereinabove. A “thiocarbonyl” group refers to a -C(=S)-R’ group, where R’ is as defined herein.

[0451] A “C-carboxy” group refers to a -C(=O)-O-R’ group, where R’ is as defined herein.

[0452] An “O-carboxy” group refers to an R’C(=O)-O- group, where R’ is as defined herein.

[0453] A “carboxylic acid” group refers to a -C(=O)OH group.

[0454] An “oxo” group refers to a =0 group.

[0455] An “imine” group refers to a =N-R’ group, where R’ is as defined herein.

[0456] An “oxime” group refers to a =N-0H group.

[0457] A “hydrazone” group refers to a =N-NR’R” group, where each of R’ and R” is as defined herein.A “methyleneamine” group refers to an -NR’-CH2-CH=CR”R”’ end group or a -NR’-CH2-CH=CR”- linking group, as these phrases are defined hereinabove, where R’, R” and R’” are as defined herein.

[0458] A “halo” group refers to fluorine, chlorine, bromine or iodine.

[0459] A “sulfinyl” group refers to an -S(=O)-R’ group, where R’ is as defined herein.

[0460] A “sulfonyl” group refers to an -S(=O)2-R’ group, where R’ is as defined herein.

[0461] A “sulfonate” group refers to an -S(=O)2-O-R’ group, where R’ is as defined herein.

[0462] A “sulfate” group refers to an -O-S(=O)2-O-R’ group, where R’ is as defined as herein. A “sulfonamide” or “sulfonamide” group encompasses both S-sulfonamido and N-sulfonamido groups, as defined herein.

[0463] An “S-sulfonamido” group refers to a -S(=O)2-NR’R” group, with each of R’ and R” as defined herein.

[0464] An “N-sulfonamido” group refers to an R’S(=O)2-NR”- group, where each of R’ and R” is as defined herein.

[0465] An “O-carbamyl” group refers to an -OC(=O)-NR’R” group, where each of R’ and R” is as defined herein.

[0466] An “N-carbamyl” group refers to an R’OC(=O)-NR”- group, where each of R’ and R” is as defined herein.

[0467] An “O-thiocarbamyl” group refers to an -OC(=S)-NR’R” group, where each of R’ and R” is as defined herein.

[0468] An “N-thiocarbamyl” group refers to an R’OC(=S)NR”- group, where each of R’ and R” is as defined herein.

[0469] An “S-thiocarbamyl” group refers to an -SC(=O)-NR’R” group, where each of R’ and R” is as defined herein.

[0470] An “amide” or “amido” group encompasses C-amido and N-amido groups, as defined herein. A “C-amido” group refers to a -C(=O)-NR’R” group, where each of R’ and R” is as defined herein.

[0471] An “N-amido” group refers to an R’C(=O)-NR”- group, where each of R’ and R’ ’ is as defined herein.

[0472] A “urea group” refers to an -N(R’)-C(=O)-NR”R”’ group, where each of R’, R” and R” is as defined herein.

[0473] A “thiourea group” refers to a -N(R’)-C(=S)-NR”R”’ group, where each of R’, R” and R” is as defined herein.

[0474] A “nitro” group refers to an -NO2group.A “cyano” group refers to a -C=N group.

[0475] A “isocyanate” group refers to a -N=C=O group.

[0476] The term “phosphonyl” or “phosphonate” describes a -P(=O)(OR’)(OR”) group, with R’ and R’ ’ as defined hereinabove.

[0477] The term “phosphate” describes an -O-P(=O)(OR’)(OR”) group, with each of R’ and R” as defined hereinabove.

[0478] The term “phosphinyl” describes a -PR’R” group, with each of R’ and R” as defined hereinabove.

[0479] The term “hydrazine” describes a -NR’ -NR”R’ ’ ’ group, with R’, R”, and R’” as defined herein. As used herein, the term “hydrazide” describes a -C(=O)-NR’-NR”R”’ group, where R’, R” and R’” are as defined herein.

[0480] As used herein, the term “thiohydrazide” describes a -C(=S)-NR’-NR”R”’ group, where R’, R” and R’” are as defined herein.

[0481] A "azo" or “diazo” group refers to an -N=NR’ end group or an -N=N- linking group, as these phrases are defined hereinabove, with R’ as defined hereinabove.

[0482] A “guanidinyl” group refers to an -RaNC(=NRd)-NRbRc group, where each of Ra, Rb, Rc and Rd can be as defined herein for R’ and R”.

[0483] A “guanyl” or “guanine” group refers to an RaRbNC(=NRd)- group, where Ra, Rb and Rd are as defined herein.

[0484] For any of the embodiments described herein, a compound, moiety, ligand, reagent or substance as described herein (collectively referred to herein as “compound”) may be in a form of a salt, for example, a pharmaceutically acceptable salt.

[0485] As used herein, the phrase “pharmaceutically acceptable salt” refers to a charged species of the parent compound and its counter-ion, which is typically used to modify the solubility characteristics of the parent compound and / or to reduce any significant irritation to an organism by the parent compound, while not abrogating the biological activity and properties of the administered compound. A pharmaceutically acceptable salt of a compound as described herein can alternatively be formed during the synthesis of the compound, e.g., in the course of isolating the compound from a reaction mixture or re-crystallizing the compound.

[0486] In the context of some of the present embodiments, a pharmaceutically acceptable salt of the compounds described herein may optionally be an acid addition salt and / or a base addition salt.

[0487] An acid addition salt comprises at least one basic (e.g., amine and / or guanidinyl) group of the compound which is in a positively charged form (e.g., wherein the basic group is protonated), in combination with at least one counter-ion, derived from the selected acid, that forms apharmaceutically acceptable salt. The acid addition salts of the compounds described herein may therefore be complexes formed between one or more basic groups of the compound and one or more equivalents of an acid.

[0488] A base addition salt comprises at least one acidic (e.g., carboxylic acid) group of the compound which is in a negatively charged form (e.g., wherein the acidic group is deprotonated), in combination with at least one counter-ion, derived from the selected base, that forms a pharmaceutically acceptable salt. The base addition salts of the compounds described herein may therefore be complexes formed between one or more acidic groups of the compound and one or more equivalents of a base.

[0489] Depending on the stoichiometric proportions between the charged group(s) in the compound and the counter-ion in the salt, the acid additions salts and / or base addition salts can be either monoaddition salts or poly-addition salts.

[0490] The phrase “mono-addition salt”, as used herein, refers to a salt in which the stoichiometric ratio between the counter-ion and charged form of the compound is 1:1, such that the addition salt includes one molar equivalent of the counter-ion per one molar equivalent of the compound.

[0491] The phrase “poly-addition salt”, as used herein, refers to a salt in which the stoichiometric ratio between the counter-ion and the charged form of the compound is greater than 1:1 and is, for example, 2: 1, 3: 1, 4: 1 and so on, such that the addition salt includes two or more molar equivalents of the counter-ion per one molar equivalent of the compound.

[0492] An example, without limitation, of a pharmaceutically acceptable salt would be an ammonium cation or guanidinium cation and an acid addition salt thereof, and / or a carboxylate anion and a base addition salt thereof.

[0493] The base addition salts may include a cation counter-ion such as sodium, potassium, ammonium, calcium, magnesium and the like, that forms a pharmaceutically acceptable salt.

[0494] The acid addition salts may include a variety of organic and inorganic acids, such as, but not limited to, hydrochloric acid which affords a hydrochloric acid addition salt, hydrobromic acid which affords a hydrobromic acid addition salt, acetic acid which affords an acetic acid addition salt, ascorbic acid which affords an ascorbic acid addition salt, benzenesulfonic acid which affords a besylate addition salt, camphorsulfonic acid which affords a camphorsulfonic acid addition salt, citric acid which affords a citric acid addition salt, maleic acid which affords a maleic acid addition salt, malic acid which affords a malic acid addition salt, methanesulfonic acid which affords a methanesulfonic acid (mesylate) addition salt, naphthalenesulfonic acid which affords a naphthalenesulfonic acid addition salt, oxalic acid which affords an oxalic acid addition salt, phosphoric acid which affords a phosphoric acid addition salt, toluenesulfonic acid which affords a p-toluenesulfonic acid addition salt, succinic acid which affords a succinic acid addition salt, sulfuric acid which affords a sulfuricacid addition salt, tartaric acid which affords a tartaric acid addition salt and trifluoroacetic acid which affords a trifluoroacetic acid addition salt. Each of these acid addition salts can be either a monoaddition salt or a poly-addition salt, as these terms are defined herein.

[0495] Further, each of the compounds described herein, including the salts thereof, can be in a form of a solvate or a hydrate thereof.

[0496] The term “solvate” refers to a complex of variable stoichiometry (e.g., di-, tri-, tetra-, penta-, hexa-, and so on), which is formed by a solute (the heterocyclic compounds described herein) and a solvent, whereby the solvent does not interfere with the biological activity of the solute.

[0497] The term “hydrate” refers to a solvate, as defined hereinabove, where the solvent is water. The compounds described herein can be used as polymorphs and the present embodiments further encompass any isomorph of the compounds and any combination thereof.

[0498] The compounds and structures described herein encompass any stereoisomer, including enantiomers and diastereomers, of the compounds described herein, unless a particular stereoisomer is specifically indicated.

[0499] As used herein, the term “enantiomer” refers to a stereoisomer of a compound that is superposable with respect to its counterpart only by a complete inversion / reflection (mirror image) of each other. Enantiomers are said to have “handedness” since they refer to each other like the right and left hand. Enantiomers have identical chemical and physical properties except when present in an environment which by itself has handedness, such as all living systems. In the context of the present embodiments, a compound may exhibit one or more chiral centers, each of which exhibiting an (R) or an (S) configuration and any combination, and compounds according to some embodiments of the present invention, can have any their chiral centers exhibit an (R) or an (S) configuration.

[0500] The term “diastereomers”, as used herein, refers to stereoisomers that are not enantiomers to one another. Diastereomerism occurs when two or more stereoisomers of a compound have different configurations at one or more, but not all of the equivalent (related) stereocenters and are not mirror images of each other. When two diastereoisomers differ from each other at only one stereocenter they are epimers. Each stereo-center (chiral center) gives rise to two different configurations and thus to two different stereoisomers. In the context of the present invention, embodiments of the present invention encompass compounds with multiple chiral centers that occur in any combination of stereoconfiguration, namely any diastereomer.

[0501] The term “peptide” encompasses native peptide (e.g., degradation products, synthetically synthesized peptide and / or recombinant peptide), including, without limitation, native proteins, fragments of native proteins and homologs of native proteins and / or fragments thereof; as well as peptidomimetics (typically, synthetically synthesized peptide) and peptoids and semipeptoids whichare peptide analogs, which may have, for example, modifications rendering the peptide more stable while in a body or more capable of penetrating into cells. Such modifications include, but are not limited to N-terminus modification, C-terminus modification, peptide bond modification, backbone modifications, and residue modification. Methods for preparing peptidomimetic compounds are well known in the art and are specified, for example, in Quantitative Drug Design, C. A. Ramsden Gd., Chapter 17.2, F. Choplin Pergamon Press (1992), which is incorporated by reference as if fully set forth herein. Further details in this respect are provided herein below.

[0502] Peptide bonds (-CO-NH-) within the peptide may be substituted, for example, by N-methylated amide bonds (-N(CH3)-CO-), ester bonds (-C(=O)-O-), ketomethylene bonds (-CO-CH2-), sulfinylmethylene bonds (-S(=O)-CH2-), a-aza bonds (-NH-N(R)-CO-), wherein R is any alkyl (e.g., methyl), amine bonds (-CH2-NH-), sulfide bonds (-CH2-S-), ethylene bonds (-CH2-CH2-), hydroxyethylene bonds (-CH(OH)-CH2-), thioamide bonds (-CS-NH-), olefinic double bonds (-CH=CH-), fluorinated olefinic double bonds (-CF=CH-), retro amide bonds (-NH-CO-), peptide derivatives (-N(R)-CH2-CO-), wherein R is the "normal" side chain, naturally present on the carbon atom.

[0503] These modifications can occur at any of the bonds along the peptide chain and even at several (2-3) bonds at the same time.

[0504] Natural aromatic amino acids, Trp, Tyr and Phe, may be substituted by non-natural aromatic amino acids such as 1,2, 3, 4-tetrahydroisoquinoline-3 -carboxy lie acid (Tic), naphthylalanine, ring-methylated derivatives of Phe, halogenated derivatives of Phe or O-methyl-Tyr.

[0505] The peptide of some embodiments of the invention may also include one or more modified amino acids or one or more non-amino acid monomers (e.g., fatty acids, complex carbohydrates etc.).

[0506] The term “amino acid” or “amino acids” is understood to include the 20 naturally occurring amino acids; those amino acids often modified post-translationally in vivo, including, for example, hydroxyproline, phosphoserine and phospho threonine; and other unusual amino acids including, but not limited to, 2-aminoadipic acid, hydroxy lysine, isodesmosine, nor-valine, nor-leucine and ornithine. Furthermore, the term "amino acid" includes both D- and L- amino acids.

[0507] Tables A and B below list naturally occurring amino acids (Table A), and non-conventional or modified amino acids (e.g., synthetic, Table B) which can be used with some embodiments of the invention.Table A

[0508] Amino Acid Three-Letter Abbreviation One-letter Symbol Alanine Ala A

[0509] Arginine Arg R Asparagine Asn N

[0510] Aspartic acid Asp D

[0511] Cysteine Cys C

[0512] Glutamine Gin Q

[0513] Glutamic Acid Glu E

[0514] Glycine Gly G

[0515] Histidine His H

[0516] Isoleucine Ile I

[0517] Leucine Leu L

[0518] Lysine Lys K Methionine Met M Phenylalanine Phe F

[0519] Proline Pro P

[0520] Serine Ser S

[0521] Threonine Thr T Tryptophan Trp W

[0522] Tyrosine Tyr Y

[0523] Valine Val V

[0524] Any amino acid as above Xaa X

[0525]

[0526] Table B

[0527] N on-conventional amino Code N on-conventional amino acid Code acid

[0528] ornithine Orn hydroxyproline Hyp a-aminobutyric acid Abu aminonorbornylNorb carboxylate

[0529] D-alanine Dala aminocyclopropaneCpro carboxylate

[0530] D-arginine Darg N-(3 -guanidinopropyl)glycine Narg

[0531]

[0532] N on-conventional amino Code N on-conventional amino acid Code acid

[0533] D-asparagine Dasn N-(carbamylmethyl)glycine Nasn D-aspartic acid Dasp N-(carboxymethyl)glycine Nasp D-cysteine Deys N-(thiomethyl)glycine Ncys D-glutamine Dgln N-(2-carbamylethyl)glycine Ngln D-glutamic acid Dglu N-(2-carboxyethyl)glycine Nglu D-histidine Dhis N-(imidazolylethyl)glycine Nhis D-isoleucine Dile N-( 1 -methylpropyl)glycine Nile D-leucine Dleu N-(2-methylpropyl)glycine Nleu D-lysine Dlys N-(4-aminobutyl)glycine Nlys D-methionine Dmet N-(2-methylthioethyl)glycine Nmet D-omithine Dorn N-(3 -aminopropyl)glycine Norn D-phenylalanine Dphe N-benzylglycine Nphe D-proline Dpro N-(hydroxymethyl)glycine Nser D- serine Dser N-( 1 -hydroxy ethyl)glycine Nthr D-threonine Dthr N-(3-indolylethyl) glycine Nhtrp D-tryptophan Dtrp N-(p-hydroxyphenyl)glycine Ntyr D-tyrosine Dtyr N-( 1 -methylethyl)glycine Nval D-valine Dval N -methylglycine Nmgly D-N-methylalanine Dnmala L-N-methylalanine Nmala D-N-methylarginine Dnmarg L-N-methylarginine Nmarg D-N-methylasparagine Dnmasn L-N-methylasparagine Nmasn D-N-methylasparatate Dnmasp L-N-methylaspartic acid Nmasp D-N-methylcysteine Dnmcys L-N-methylcysteine Nmcys D-N-methylglutamine Dnmgln L-N-methylglutamine Nmgln D-N-methylglutamate Dnmglu L-N-methylglutamic acid Nmglu D-N-methylhistidine Dnmhis L-N-methylhistidine Nmhis D-N-methylisoleucine Dnmile L-N-methylisolleucine Nmile D-N-methylleucine Dnmleu L-N-methylleucine Nmleu D-N-methyllysine Dnmlys L-N-methyllysine Nmlys D-N-methylmethionine Dnmmet L-N-methylmethionine Nmmet D-N-methylornithine Dnmorn L-N-methylornithine Nmorn

[0534]

[0535] N on-conventional amino Code N on-conventional amino acid Code acid

[0536] D-N-methylphenylalanine Dnmphe L-N-methylphenylalanine Nmphe D-N-methylproline Dnmpro L-N-methylproline Nmpro D-N-methylserine Dnmser L-N-methylserine Nmser D-N-methylthreonine Dnmthr L-N-methylthreonine Nmthr D-N-methyltryptophan Dnmtrp L-N-methyltryptophan Nmtrp D-N-methyltyrosine Dnmtyr L-N-methy Ityro sine Nmtyr D-N-methylv aline Dnmval L-N-methylv aline Nmval L-norleucine Nle L-N-methy Inorleucine Nmnle L-norv aline Nva L-N-methy Inorv aline Nmnva L-ethylglycine Etg L-N-methyl-ethylglycine Nmetg L-t-butylglycine Tbug L-N-methyl-t-butylglycine Nmtbug L-homophenylalanine Hphe L-N-methyl-homophenylalanine Nmhphe a-naphthylalanine Anap N-methyl-a-naphthylalanine Nmanap penicillamine Pen N -methylpenicillamine Nmpen y-aminobutyric acid Gabu N -methyLy- aminobutyrate Nmgabu cyclohexylalanine Chexa N -methyl-cyclohexylalanine Nmchexa cyclopentylalanine Cpen N -methyl-cyclopentylalanine Nmcpen a-amino-a-methylbutyrate Aabu N-methyl-a-amino-a- Nmaabu methylbutyrate

[0537] a-aminoisobutyric acid Aib N-methyl-a-aminoisobutyrate Nmaib D-a-methylarginine Dmarg L-a-methylarginine Marg D-a-methylasparagine Dmasn L-a-methylasparagine Masn D-a-methylaspartate Dmasp L-a-methylaspartate Masp D-a-methylcysteine Dmcys L-a-methylcysteine Mcys D-a-methylglutamine Dmgln L-a-methylglutamine Mgln D-a-methyl glutamic acid Dmglu L-a-methylglutamate Mglu D-a-methylhistidine Dmhis L-a-methylhistidine Mhis D-a-methylisoleucine Dmile L-a-methylisoleucine Mile D-a-methylleucine Dmleu L-a-methylleucine Mleu D-a-methyllysine Dmlys L-a-methyllysine Mlys

[0538]

[0539] N on-conventional amino Code N on-conventional amino acid Code

[0540] acid

[0541] D-a-methylmethionine Dmmet L-a-methylmethionine Mmet

[0542] D-a-methylornithine Dmorn L-a-methylomithine Morn

[0543] D-a-methylphenylalanine Dmphe L-a-methylphenylalanine Mphe

[0544] D-a-methylproline Dmpro L-a-methylproline Mpro

[0545] D-a-methylserine Dmser L-a-methylserine Mser

[0546] D-a-methylthreonine Dmthr L-a-methylthreonine Mthr

[0547] D-a-methyltryptophan Dmtrp L-a-methyltryptophan Mtrp

[0548] D-a-methyltyrosine Dmtyr L-a-methyltyrosine Mtyr

[0549] D-a-methylvaline Dmval L-a-methylvaline Mval

[0550] N-cyclobutylglycine Ncbut L-a-methylnorv aline Mnva

[0551] N-cycloheptylglycine Nchep L-a-methylethylglycine Metg

[0552] N-cyclohexylglycine Nchex L-a-methyl-Z-butylglycine Mtbug

[0553] N-cyclodecylglycine Ncdec L-a-methyl-homophenylalanine Mhphe

[0554] N-cyclododecylglycine Ncdod a-methyl-a-naphthylalanine Manap

[0555] N-cyclooctylglycine Ncoct a-methylpenicillamine Mpen

[0556] N-cyclopropylglycine Ncpro a-methyl-y-aminobutyrate Mgabu

[0557] N-cycloundecylglycine Ncund a-methyl-cyclohexylalanine Mchexa

[0558] N-(2-aminoethyl)glycine Naeg a-methyl-cyclopentylalanine Mcpen

[0559] N-(2,2- Nbhm N-(N-(2,2-diphenylethyl) Nnbhm diphenylethyl)glycine carbamylmethyl-glycine

[0560] N-(3,3- Nbhe N-(N- (3, 3 -diphenylpropyl) Nnbhe diphenylpropyl)glycine carbamylmethyl-glycine

[0561] 1 -carboxy- 1 -(2, 2-diphenyl Nmbc 1,2,3,4-tetrahydroisoquinoline- Tic ethylamino)cyclopropane 3 -carboxylic acid

[0562] phospho serine pSer pho spho threonine pThr phosphotyrosine pTyr O-methyl-tyrosine

[0563] 2-aminoadipic acid hydroxylysine

[0564]

[0565] The peptide of some embodiments of the invention are preferably utilized in a linear form, although it will be appreciated that in cases where cyclization does not severely interfere with peptide characteristics, cyclic forms of the peptide can also be utilized.Since the present peptide are preferably utilized in therapeutics or diagnostics which require the peptide to be in soluble form, the peptide of some embodiments of the invention preferably include one or more non-natural or natural polar amino acids, including but not limited to serine and threonine which are capable of increasing peptide solubility due to their hydroxyl-containing side chain.

[0566] The peptide of some embodiments of the invention may be synthesized by any techniques that are known to those skilled in the art of peptide synthesis. For solid phase peptide synthesis, a summary of the many techniques may be found in J. M. Stewart and J. D. Young, Solid Phase Peptide Synthesis, W. H. Freeman Co. (San Francisco), 1963 and J. Meienhofer, Hormonal Proteins and Peptides, vol.

[0567] 2, p. 46, Academic Press (New York), 1973. For classical solution synthesis see G. Schroder and K. Lupke, The Peptides, vol. 1, Academic Press (New York), 1965.

[0568] In general, these methods comprise the sequential addition of one or more amino acids or suitably protected amino acids to a growing peptide chain. Normally, either the amino or carboxyl group of the first amino acid is protected by a suitable protecting group. The protected or derivatized amino acid can then either be attached to an inert solid support or utilized in solution by adding the next amino acid in the sequence having the complimentary (amino or carboxyl) group suitably protected, under conditions suitable for forming the amide linkage. The protecting group is then removed from this newly added amino acid residue and the next amino acid (suitably protected) is then added, and so forth. After all the desired amino acids have been linked in the proper sequence, any remaining protecting groups (and any solid support) are removed sequentially or concurrently, to afford the final peptide compound. By simple modification of this general procedure, it is possible to add more than one amino acid at a time to a growing chain, for example, by coupling (under conditions which do not racemize chiral centers) a protected tripeptide with a properly protected dipeptide to form, after deprotection, a pentapeptide and so forth. Further description of peptide synthesis is disclosed in U. S. Pat. No. 6,472,505.

[0569] A preferred method of preparing the peptide compounds of some embodiments of the invention involves solid phase peptide synthesis.

[0570] Large scale peptide synthesis is described by Andersson (2000) Biopolymers, 55(3), 227-250. It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.

[0571] EXAMPLES

[0572] Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non-limiting fashion.

[0573] Experimental Methods

[0574] Atomic Force Microscopy (AFM )mapping: Atomic Force Microscopy mapping was performed on a Solver PRO AFM system (NT-MDT Ltd.) in a semi-contact (tapping) mode using High Accuracy Non-Contact AFM probes from the PHA-NC series (ScanSens, Berlin, Germany). The images were “flattened” (each line of the image was fitted to a second-order polynomial, and the polynomial was then subtracted from the image line) with Nova image processing software (NT-MDT Ltd.).

[0575] The images were analyzed using the following imaging software programs: WSxM Nanotec Electronica S. L (WSxM v4.0 Beta 10.0, Nanotec Electronica Ltd., Madrid, Spain) and SPIP software (MountainsSPIP®8, Image Metrology A / S, Hprsholm Denmark).

[0576] EXAMPLE 1

[0577] Metal Nanoparticles

[0578] The preparation of NAD-NPs is a quick, straightforward, and cost-effective process, and an exemplary procedure for the preparation of NAD-GNPs as exemplary metal NPs is depicted in FIG. 3.

[0579] The following describes an exemplary procedure.

[0580] 0.1 M NAD was mixed with 0.08 M AuHCl4 in 0.3 mL of deionized water (DDW) and the mixture was incubated for 15 minutes under ambient conditions. The mixture was then added to a 100-fold volume (30 mL) of 8 mM KOH solution (pre-filtered through a 3 kDa Amicon Ultra centrifugal filter) containing 1.5 mM NaBH4 while stirring continuously. This resulted in the immediate formation of a distinctive dark brown solution. The reaction mixture was stirred for an additional 5 minutes and then centrifuged for 5 minutes at 20 °C using a 15-mL 50 kDa Amicon Ultra centrifugal filter units at 4000 rpm. Larger particles retained by the filter were discarded. The filtrate, containing smaller nanoparticles, was further centrifuged for 15 minutes at 20 °C using a 15-mL 10 kDa Amicon Ultra centrifugal filter. The retained fraction was diluted with 15 mL of DDW, and the centrifugation-dilution cycle was repeated thrice to completely remove unassociated NAD.Typically, the final volume of the particles was about 0.3 mL, and the optical density (OD) of the particles at 420 nm (OD420) is about 100. The resulting NAD-NPs were shown to be stable and capable of retaining their properties for several months (data not shown).

[0581] TEM characterization of the exemplary NAD-GNPs was performed by HR-TEM image analysis conducted using Thermo Fisher Scientific Talos F200i TEM. Samples for the analysis shown in FIG. 4B were prepared by depositing 1.5 pL of the NAD-GNPs solution (OD420 of about 2) onto ultrathin (3-4 nm thickness) carbon-coated copper grids (LC200-CU-CC obtained from Electron Microscopy Sciences, Hatfield, USA), which had been pretreated with a 25 % O2 / 75 % Ar plasma. After a 2-minute incubation, excess solution was removed by gently touching the edge of the grid with filter paper. The grids were then dried under low vacuum for 15 minutes. Following drying, the samples were briefly (10 seconds) exposed to an O2 / Ar plasma to remove residual organic material.

[0582] The results are shown in FIG. 4A, and the distribution of particles diameter measured by ImageJ software (version 1.53; National Institutes of Health, USA) is presented in FIG. 4B. As can be seen, based on TEM analyses, NAD-GNPs have an average diameter of 1.3 ± 0.4 nm (when measured using ImageJ software; FIG. 4B). The particles were highly uniform, spherical in shape, and exhibited a narrow size distribution.

[0583] Atomic force microscopy (AFM) characterization of the exemplary NAD-GNPs was also conducted. To this, the NAD-GNPs were diluted in 0.1 M KC1 (OD420 of about 10 mAU). A 20-pL drop of the particles was poured on a freshly cleaved mica and let sit on the substrate under ambient for 1 minute. The surface was then rinsed with 1 mL of ice-cold DDW and quickly dried by a stream of nitrogen gas. AFM imaging was performed on a Solver PRO AFM system (NTEGRA SPECTRA II, NT-MDT Ltd., Moscow, Russia) in a semi-contact (tapping) mode using High Accuracy Non-Contact AFM probes from the PHA-NC series (ScanSens, Berlin, Germany). The images were “flattened” (each line of the image was fitted to a second-order polynomial, and the polynomial was then subtracted from the image line) with Nova image processing software (NT-MDT Ltd. Moscow, Russia) and analyzed using SPIP software (MountainsSPIP®8, Image Metrology A / S, Hprsholm Denmark).

[0584] The results are shown in FIG. 4C and the distribution of particle height as analyzed using the SPIP software is presented in FIG. 4D. As can be seen, based on AFM analysis, NAD-GNPs were spherical in shape and have an average diameter of 1.4 ± 0.3 nm.

[0585] An exemplary procedure for the preparation of FAD-GNPs as exemplary metal NPs is as follows: A solution of flavin adenine dinucleotide (FAD) (0.1 M) and HAuCL (0.08 M) in 0.3 mL of deionized water (DDW) was prepared and incubated at room temperature for 15 minutes underambient conditions. The resulting mixture was then added to 30 mL of 6 mM KOH (pre-filtered through a 3 kDa Amicon Ultra centrifugal filter) containing 1.5 mM NaBH4 while stirring vigorously. This resulted in the immediate formation of a dark brown solution, indicating the generation of the exemplary FAD-GNPs. The reaction mixture was stirred for an additional 5 minutes and then centrifuged at 20 °C for 5 minutes using a 15-mL 50 kDa Amicon Ultra centrifugal filter units at 4000 rpm. Larger particles retained by the filter were discarded. The filtrate, containing smaller nanoparticles, was subjected to a second centrifugation for 15 minutes at 20 °C using a 15-mL 10 kDa Amicon Ultra centrifugal filter. The retained fraction was diluted with 15 mL DDW, and the centrifugation-dilution cycle was repeated three times in order to completely remove unassociated FAD.

[0586] Typically, the final yield of the particles was about 0.3 mL, with an OD420 of about 100. The particles were stable under ambient for at least one month without noticeable change in the absorption spectrum and properties.

[0587] The FAD-GNPs were analyzed using AFM as described herein for the exemplary NAD-GNPs, and the average size of the particles was determined to be 1.43 nm.

[0588] Ultra-small gold nanoparticles (about 1.4 nm in diameter; about 55 gold atoms) with various surface functionalities (positively or negatively charged, or functionalized for interaction with amino and sulfhydryl protein groups) are commercially available from various companies including Nanoprobes at a cost of about 400$ per 30 nmol (corresponding to about 30 pg, based on a molecular mass of about 1,000 Da), while the cost of preparing 5 mg of the exemplary NAD-GNPs is approximately 14 NIS (based on the price of NAD and HAuCl4·3H2O used), and that of FAD-GNPs is about 50 NIS. Additional expenses, including use of centrifuges and Amicon Ultra centrifugal filter units (reusable for the preparation of hundreds of milligrams), as well as labor, do not exceed 300 NIS (about 90$). The preparation procedure is rapid (completed within one hour) and can be easily scaled up by at least 10-fold without a significant increase in preparation time and cost. Thus, the total cost of preparing the exemplary NAD-GNPs and FAD-GNPs is approximately 1000-fold lower than that of comparable commercial nanoparticles.

[0589] EXAMPLE 2

[0590] Association of Metal Nanoparticles with Small Unilamellar Vesicles In an exemplary procedure, L-a-phosphatidylcholine liposomes as exemplary small unilamellar vesicles were prepared as follows: A phospholipid suspension was prepared by hydrating L-a-phosphatidylcholine (PC) granules (0.2 grams; Avanti Polar Lipids, soy-derived 40 % PC, #341602) in 10 mL of distilled water and allowing it to swell for 16-20 hours at ambient temperature.The resulting suspension was filtered through a 0.8 pm syringe filter, subjected to five freeze-thaw cycles, and then extruded 19 times through a 100 nm pore-size polycarbonate membrane using an Avanti Mini Extruder at room temperature. This procedure yielded unilamellar liposomes (SUVs) having an average diameter of 80-90 nm.

[0591] In an exemplary procedure of preparing NAD-GNPs-associated liposomes, 50 pL of NAD-GNPs (prepared one day prior according to the exemplary procedure described herein) were mixed with 50 pL of liposomes (4mg / mL) in a buffer containing 150 mM KC1 and 2mM potassium phosphate (K-Pi), pH 7.5. The mixture was incubated overnight at ambient temperature. The mixture was then loaded onto a size-exclusion Sepharose CL-2B column equilibrated with 150 mM KC1 and 2 mM K-Pi (pH 7.5). The void volume fraction, corresponding to liposomes and NAD-GNP-associated liposomes, was collected between 2.0 and 2.5 mL. Unassociated NAD-GNPs were eluted over the full Sepharose CL-2B column volume, and a photograph is presented in FIG. 5D. The bottom, faster-moving band in the column corresponds to the NPs-associated liposomes, while the upper, slower-moving darker band corresponds to free NAD-GNPs, unassociated with the liposomes.

[0592] Centrifugation of the nanoparticle-associated liposomes was then performed. A 5-minute centrifugation of the nanoparticle-associated liposomes at 10,000 rpm on an Eppendorf table centrifuge resulted in nearly complete precipitation of the nanoparticle-associated liposomes, whereas bare (not nanoparticles-associated) liposomes remained in the supernatant even after prolonged centrifugation at higher spinning rates.

[0593] Cryo-TEM images of vesicles were performed on the liposomes and following association of the liposomes with the exemplary metal NPs, NAD-GNPs. To this, a 3.5 pL aliquot of either the liposome suspension (FIG. 5A) or the NAD-GNP-associated liposome suspension (FIG. 5B) was applied to a glow-discharged 300-mesh copper TEM grid coated with a holey carbon film (Lacey substrate, Ted Pella, Ltd.). Excess liquid was blotted, and the sample was vitrified by rapid plunging into liquid ethane pre-cooled with liquid nitrogen, using a Vitrobot Mark IV (FEI). The vitrified grids were transferred to a cryo-holder (Gatan Model 626) and imaged at -177 °C using a FEI Tecnai 12 G2 Spirit TWIN transmission electron microscope operated at 120 kV in low-dose mode. Images were acquired using a 4K × 4K FEI Eagle CCD camera and processed with Tecnai Imaging & Analysis (TIA) software.

[0594] The results are presented in FIGs. 5A-B. Bare liposomes, as shown in FIG. 5A, appear smooth, whereas the surface of the NPs-associated liposomes is densely coated with small dark granules, as shown in FIG. 5B. The high-contrast dots correspond to the exemplary metal NPs, NAD-GNPs, which appear more electron-dense than the surrounding phospholipid bilayer. FIG. 5Cpresents a schematic illustration of a nanoparticle-associate liposome. These data indicate that the exemplary metal NPs, NAD-GNPs, exhibited strong binding to the vesicles.

[0595] Considering the hydrophilic nature of the metal nanoparticles which prevents them from penetrating the bilayer, they are likely to bind tightly to the outer surface of the liposome. Without being bound by any particular theory, it is plausible that phospholipid head groups in the liposome interact directly with the metal surface of the nanoparticles, anchoring them to the vesicle.

[0596] The exemplary metal NPs, NAD-GNPs, remained stably bound to the vesicles for weeks when stored at 4 °C.

[0597] In contrast, ultra-small commercial GNPs or NAD-GNPs additionally coated with strongly-coordinating ligands which do not dissociate from the metal core (bis(p-sulfonatophenyl)phenylphosphine (BSPP)) do not associate with SUVs.

[0598] In order to assess the effect of strongly-coordinating ligands which do not dissociate from the metal core (bis(p-sulfonatophenyl)phenylphosphine (BSPP)) on the association with liposomes, NAD-NPs were pre-treated with BSPP (incubated with 1 mM BSPP for 1 hour at room temperature before mixing with the liposomes), and were then mixed with liposomes, as described hereinabove for NAD-GNPs, and further analyzed by the same chromatography. As can be seen in FIG. 5E, in contrast to the observed particles shown in FIG. 5D, no association of the metal nanoparticles was observed. These results suggest that strongly-coordinating ligands, such as BSPP, prevent the binding of the metal nanoparticles to liposomes.

[0599] This exclusive interaction profile of the exemplary metal NPs, NAD-NPs, highlights their unique ability to associate with various compounds, substances, matrices and structures.

[0600] EXAMPLE 3

[0601] Catalytic Activity of NAD-GNPs

[0602] The ability of the exemplary metal NPs, NAD-GNPs, to catalyze the oxidation of various compounds in aqueous media by molecular oxygen, was assessed.

[0603] Tested substances included NADH, ascorbate, and cytochrome c.

[0604] The relative catalytic efficiency of NAD-GNPs, FAD-GNPs and of commercially available ultra-small GNPs (1.4 nm gold nanoparticles containing multiple carboxylic acid groups; 1.4 nm Nanogold obtained from Nanoprobes, USA) was tested. Reactions were carried out in a buffer containing 10 mM potassium phosphate (pH 7.5), 150 mM NaCl, and 160 pM NADH.

[0605] Kinetics of the reactions were monitored by calculating the concentration of NADH in solution based on its absorbance at λ=340 nm (considering ε₃₄₀ = 6.22).The results are presented in FIG. 6A, and show that the addition of exemplary metal NPs (NAD-GNPs or FAD-GNPs) to an aqueous solution of NADH resulted in the gradual oxidation of NADH by molecular oxygen. While the rate of NADH oxidation catalyzed by FAD-GNPs is approximately 1.5 times slower than that observed with an equal concentration of NAD-GNPs (FIG.

[0606] 6A, blue and red curves, respectively), commercially available GNPs - which also carry a negative surface charge - did not catalyze NADH oxidation (FIG. 6A, black curve).

[0607] FIG. 6B is a schematic illustration of the mechanism of the oxidation process, and depicts that the metal nanoparticles facilitate the reaction by accepting an electron from NADH (NADH originating from a surrounding environment) and transferring it, potentially via the ligands (e.g., NAD), to molecular oxygen, completing the oxidation reaction.

[0608] In contrast, neither ultra-small commercial gold nanoparticles (Au55) nor NAD-GNPs additionally coated with tightly coordinated BSPP ligands (data not shown) exhibited the catalytic activity observed for the exemplary, unmodified, NAD-GNPs. This lack of activity is likely due to the inaccessibility by either NADH or oxygen to the gold surface.

[0609] To conclude, unlike ATP-GNPs and commercially available ultra-small gold nanoparticles, NAD-GNPs and FAD-GNPs exhibit pronounced catalytic activity. They efficiently catalyze the oxidation of substrates (e.g., NADH) by molecular oxygen in aqueous solution.

[0610] Without being bound by any particular theory, this unique catalytic behavior likely arises from the redox-reactive nature of ligands such as NAD and FAD, which can reversibly cycle between oxidized and reduced forms. These ligands may mediate electron transfer from the substrate (e.g., NADH) through the metal atom(s), to molecular oxygen, generating reactive oxygen species (FIG.

[0611] 6B). An alternative explanation is that the surface of the metal NPs (e.g., NAD-GNPs and FAD-GNPs) remains accessible to both substrate and oxygen, enabling direct interaction at the metal interface. In contrast, commercial ultra-small GNPs are typically passivated by tightly bound ligands that shield the gold core and hinder such interactions, thereby suppressing catalytic activity.

[0612] Another tested redox reaction catalysis by the exemplary metal nanoparticles was reduction of cytochrome c by NADH.

[0613] In living cells, cytochrome c is electrostatically bound to the outer surface of the inner mitochondrial membrane and is physiologically reduced by Complex III as part of the mitochondrial respiratory chain, a process coupled to mitochondrial NADH or succinate oxidation. Reduction of cytochrome c by cytoplasmic (intermembrane space) NADH is normally not possible. It was assessed that the exemplary NAD-GNPs or FAD-GNPs could mediate electron transfer between cytoplasmic NADH and cytochrome c, bypassing the natural respiratory pathway. Such aberrant reduction ofcytochrome c within the mitochondria could severely impair the electron transport chain, disrupt ATP production, and lead to cell death.

[0614] To this, a reaction mixture contained 10 mM potassium phosphate buffer (pH 7.5), 150 mM NaCl, 10 pM oxidized cytochrome c, and 160 pM NADH. The initial absorption spectrum was recorded before the addition of NAD-GNPs, and following the addition of about 10 pM of the exemplary NPs, spectra were recorded after 10 seconds and 1 minute. The results before the addition, after 10 seconds and after 1 minute are presented in FIG. 6C (blue, black and red curves, respective).

[0615] As can be seen, upon the addition of NAD-GNPs to a solution containing NADH and oxidized cytochrome c (FIG. 6C, blue curve), a sharp absorption band around 550 nm appeared, characteristic of the reduced form of cytochrome c, indicating a rapid reduction of the protein. The reaction is essentially complete within one minute (FIG. 6C, red curve), with 15-20 % of the protein reduced within just 10 seconds after the addition of the exemplary metal NPs (FIG. 6C, black curve).

[0616] Without being bound by any particular theory, it is assumed that NADH first transfers its electrons to the GNP, which then acts as electron shuttle. The particles subsequently donate electrons either to molecular oxygen, producing reactive oxygen species (ROS), or to cytochrome c, reducing it as schematically illustrated in FIG. 6D.

[0617] EXAMPLE 4

[0618] Interaction of Metal Nanoparticles with Non-Paired Nucleotides

[0619] In contrast to commercially available ultra-small GNPs (e.g., Au55), NAD and FAD as exemplary ligands of gold as the exemplary metal NPs enable facile ligand exchange (displacement). This allows association (e.g., attachment) of the metal nanoparticles (upon removal of the ligand) with various functional moieties.

[0620] Exemplary such moieties include single- stranded oligonucleotides such as single- stranded DNA (ssDNA), including those labeled with fluorescent dyes, biotin, and others, which can readily interact with the exemplary particles NAD-GNP by ligand exchange. Non-paired nucleobases in the oligonucleotides can replace the NAD ligand and interact directly with the particle surface, anchoring the metal particles to the strand. These metal-labeled ssDNA-GNPs can be used, for example, in intracellular and in vivo imaging.

[0621] In contrast, the exemplary NAD-GNPs exhibit weak binding to double stranded (ds) DNA backbones (data not shown) and do not associate strongly to fully double- stranded DNA. However, NAD-GNPs efficiently interact with non-hybridized (non-paired) regions such as sticky ends or mismatched bases as described above, providing a specific strategy for DNA-directed assembly and targeting mismatched regions in the nucleic acid.Without being bound by any particular theory, it is believed that the adenosine in the oligonucleotide or non-hybridized DNA regions replaces the ligand / s (e.g., NAD or FAD) and attaches to the metal (e.g., gold) of the nanoparticles, e.g., as schematically illustrated in FIG. 7A.

[0622] In order to assess the ability of the ligands of the metal NPs to displace and allow interaction of the metal NPs with biologically active substances, the exemplary metal NPs, NAD-GNPs, were shown to interact with a circular plasmid construct containing a 3A-3A mismatched insert, pUC 19(3 AGA).

[0623] To this, pUC 19(3 AGA) was first prepared as schematically illustrated in FIG. 7B, and as follows:

[0624] The plasmid pUC19 was linearized using EcoRI and HindIII (New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s protocol (FIG. 7B; step 1). The linearized plasmid was purified from enzymes and other components using size-exclusion chromatography on a Sepharose CL-2B column (GE Healthcare, Chicago, IL, USA; 5 x 0.9 cm) equilibrated with 50 mM HEPES-K buffer (pH 7.5). The void volume fraction, containing the linearized plasmid, was collected and subsequently ligated with a short double-stranded DNA insert comprising a 3A / 3A mismatch (FIG.

[0625] 7B).

[0626] The insert, bearing sticky ends complementary to those of the linearized plasmid and containing a 3A mismatch, was prepared by annealing the following phosphorylated oligonucleotides:

[0627] 5 '-P-AATTC AAGCAATTAAGAACAAAACGC AAGGATCGCG-3 ' and

[0628] 5 '-P-AGCTCGCGATCCTTGCGTTTTGTTCTTAATTGCTTG-3

[0629] The oligonucleotides were mixed at equimolar concentrations in 0.1 M LiOH and dialyzed overnight (16 hours) at ambient temperature against 1 liter (L) of 100 mM NaCl, 20 mM Tris-HCl (pH 7.5).

[0630] The annealed insert (FIG. 7B; step 2) was combined with the linearized plasmid at a 2: 1 molar ratio in a ligation buffer containing 20 mM Tris-HCl (pH 7.5), 100 mM NaCl, 10 mM MgCh, 10 mM DTT, 0.5 mM ATP, and 0.02 U / pL T4 DNA ligase (Thermo Scientific, Waltham, MA, USA). The ligation reaction (FIG. 7B; step 3) was incubated for 20 hours at 4 °C.

[0631] Following ligation, the plasmid construct was separated from the enzyme and ATP using a 1 mL HiTrap Q HP ion-exchange column (Cytiva, USA). The eluate was further desalted on a NAP-5 column (Cytiva, Marlborough, MA, USA) equilibrated with 50 mM KC1 and 10 mM HEPES-K (pH 7.5). The resulting plasmid construct, pUC19(3AGA), contains a defined 3 A mismatch region.

[0632] Interaction of pUC19(3AGA) with the exemplary metal NPs, NAD-GNPs, was performed as follows:The pUC19(3A / 3A) plasmid was mixed with a 1000-fold molar excess of NAD-NPs in 50 mM KC1 and 10 mM HEPES-K (pH 7.5) and incubated for 16 hours at 25 °C. The plasmid-NPs was separated from excess NAD-NPs via size-exclusion chromatography on a Sepharose CL-2B column (5 x 0.9 cm) equilibrated with 10 mM KC1 and 5 mM HEPES-K (pH 7.5). The void volume fraction, containing the plasmid-NP, was collected.

[0633] Due to their ultra-small size, the plasmid-NPs could not be directly visualized within DNA by AFM. Therefore, for imaging, the particle was enlarged. To this, the plasmid-NPs were deposited for 5 minutes onto freshly cleaved mica. The mica surface was first rinsed with about 1 mL of ice-cold 20 mM magnesium acetate, and excess liquid was removed using a piece of filter paper. Next, 100 pL of a freshly prepared gold-deposition mixture, comprising 25 µL of 10 µM HAuCl4with 1 mM KBr, 74 pL of DDW, and 1 pL of neutralized (pH 6-7) 0.1 M ascorbate-K solution was added to the mica surface and left for 30 seconds. The preferential reduction of gold ions by ascorbate on the surface of the particles leads to their extension. The surface was then rinsed with 1 mL of ice-cold water and dried with a gentle stream of nitrogen gas. AFM scanning was subsequently performed.

[0634] The resulting AFM analysis of the plasmid-NPs before and after particle enlargement are presented in FIGs. 7C-D, respectively. As can be seen, before enlargement (FIG. 7C), no particles are visible along the DNA. Following enlargement with gold ions and ascorbate (FIG. 7D), the exemplary NAD-GNPs are observed as bright spots, typically one particle per plasmid, indicating site-specific binding of the NPs to the 3A / 3A mismatch region.

[0635] These data indicate that metal nanoparticles as described herein are capable of (e.g., selectively) interact with non-paired nucleotides, which is useful in labeling an oligonucleotide, and / or for detecting non-paired nucleotides in DNA. This further supports the assessment that nucleic bases in non-paired nucleotides replaces the ligand (e.g., NAD or FAD) and attaches to the metal (e.g., gold) of the nanoparticles.

[0636] EXAMPLE 5

[0637] Copper-Based Metal NPs

[0638] Metal NPs according to some embodiments of the present invention, copper-based NAD-NPs (Cu-NAD-NPs), were prepared similarly to the exemplary method for the preparation of the gold nanoparticles (NAD-GNPs).

[0639] In an exemplary procedure, 0.1 M NAD was mixed with 0.06 M CuSO4 and the mixture was incubated for 30 minutes under ambient conditions. The mixture was then added to a 50-fold volume of 10 mM KOH solution containing 1.75 mM NaBH4while continuously stirring the mixture, resulting in immediate formation of a distinctive cognac-colored solution.The Cu-NAD-NPs were filtered using a 50 kDa Centricon ultrafiltration unit during 2-minute centrifugation at 4,000 rpm. The retentate, which contained larger (2-5 nm) particles, was discarded, while the filtrate, containing smaller (1.5-2 nm) particles, was further concentrated using a 10 kDa Centricon ultrafiltration unit during 15-minute centrifugation at 4,000 rpm.

[0640] The concentrated particles were then purified using a NAP- 10 column (obtained from Cytiva) equilibrated with 5 mM HEPES-K buffer to enable Cu-NAD-NPs separation from excess NAD and transferring them to a neutral buffer solution.

[0641] Unlike the reported nanoparticles by Xiong et al (2011, supra), which require 16 hours of synthesis at 80 °C with continuous heating and intensive stirring, ultra-small copper NPs according to some embodiments of the present invention are rapidly produced (30 minutes) under mild conditions.

[0642] AFM image analysis of the Cu-NAD-NPs was performed as described herein above for the NAD-GNPs. The results are shown in FIG. 8A and the height analysis of the particles as analyzed by Gwyddion software (available online at gwyddion(dot)net) is presented in FIG. 8B. It shows that the Cu-NAD-NPs have an average diameter of 1.7 ± 0.3 nm.

[0643] Cu-NAD-NPs underwent slow oxidation (over days) by molecular oxygen dissolved in water. To maintain their reduced state, the particle solution is purged with argon and / or stored under reduced temperature (e.g., -80 °C).

[0644] FIGs. 9A-B present the absorption spectra of the exemplary metal nanoparticles, Cu-NAD-GNPs, recorded immediately after preparation (FIG. 9A) and after storage for 5 days under ambient conditions (FIG. 9B).

[0645] As shown in FIG. 9A, the freshly prepared, fully reduced nanoparticles exhibit a strong absorbance in the 420-550 nm range and relatively low absorbance beyond 550 nm. In contrast, FIG.

[0646] 9B demonstrates that following storage under ambient conditions, the particles undergo at least partial oxidation, as evidenced by a marked decrease in absorbance within the 420-550 nm region and a corresponding increase in the 600-850 nm region. This spectral shift indicates a significant alteration in the electronic structure of the particles due to oxidation.

[0647] Notably, purging the particle dispersion with argon during storage effectively prevented oxidation. The absorption spectrum of samples stored under an argon atmosphere for 5 days closely matches that of freshly prepared particles, as shown in FIG. 9A, thereby confirming the stability of the reduced form under inert conditions.

[0648] The ability of the exemplary copper NPs, Cu-NAD-NPs, to catalyze the oxidation of various substances in aqueous media by molecular oxygen, was then assessed in the presence of ascorbate as a model substance.It is well established that the reduction of Cu2+by ascorbic acid generates reactive oxygen species (ROS). The mechanism of oxygen reduction by ascorbic acid in the presence of Cu2+involves a redox cycle in which copper ions catalyze the transfer of electrons from ascorbate to molecular oxygen (O2), leading to the formation of ROS such as superoxide (O2•−) and hydrogen peroxide (H2O2).

[0649] Accordingly, the ability of the exemplary Cu-NAD-NPs to catalyze the oxidation of ascorbate to ascorbic acid by molecular oxygen was assessed. To this, the absorption of a buffer containing 10 mM HEPES-K (pH 7.5) and 75 pM ascorbate was monitored immediately after the addition of 3 pM of the exemplary metal nanoparticles, Cu-NAD-NPs (in copper atoms). The results are presented in FIG. 10A, and FIG. 10B presents the change in absorbance at 265 nm in the presence and absence of the exemplary metal nanoparticles Cu-NAD-NPs, as indicated.

[0650] A time-dependent decrease in ascorbate’ s maximal absorbance peak (at 265 nm) was observed (FIG. 10A), indicating the consumption of ascorbate in the presence of the exemplary metal NPs, Cu-NAD-NPs. These data demonstrate that Cu-NAD-NPs rapidly and effectively catalyze the oxidation of ascorbate by molecular oxygen. In comparison, no such reduction was monitored in the absence of the metal NPs (FIG. 10B, brown curve).

[0651] FIG. 10C is a schematic illustration showing the suggested oxidation mechanism, according to which the nanoparticles promote the oxidation reaction by accepting an electron from ascorbate and transferring it to oxygen.

[0652] The exemplary Cu-NAD-NPs exhibit significantly higher reactivity than the nanoparticles taught in Xiong et al.; they completely dissolve in 10 mM potassium cyanide (KCN) within less than a minute, while nanoparticles taught in Xiong et al. remain undissolved even after 24 hours. Due to their high reactivity, the exemplary Cu-NAD-NPs undergo oxidation by molecular oxygen, as detected by the change in their absorption spectrum over time. In contrast, the nanoparticles taught in Xiong et al. resist oxidation and maintain spectral stability during months of storage under oxygen.

[0653] EXAMPLE 6

[0654] Coating of Solid Substrates

[0655] Preliminary tests were performed using Bis(p-sulfonatophenyl)phenylphosphine (BSPP) as a ligand of gold nanoparticles (GNPs).

[0656] 15-nm GNPs were prepared following the standard Turkevich method, as described in Turkevich et al. [Discuss. Faraday Soc., 1951, 11, 55-75]. The resulting nanoparticles suspension was concentrated by ultrafiltration using a 30 kDa molecular weight cutoff (MWCO) membrane toan optical density (OD) at 520 nm of about 10. Bis(p-sulfonatophenyl)phenylphosphine (BSPP) was added to the nanoparticle suspension to a final concentration of 1 mM.

[0657] Potassium chloride (KC1) from a 1 M stock solution then added at a final concentration of 70 mM, and a 50-pL drop of the obtained suspension was placed onto a 1 cm2freshly cleaved mica surface and incubated for 15 minutes, 1 hour, or 5 hours. After incubation, the surface was briefly rinsed with cold double-distilled water (DDW), dried under a gentle nitrogen stream, and imaged by AFM in semi-contact mode.

[0658] AFM images of the resulting NP-coated mica surfaces following incubation for 15 minutes, 1 hour, and 5 hours are presented in FIGs. 11A-C, respectively.

[0659] These data show the formation of a nanoparticles’ monolayer on mica. Within this monolayer, the nanoparticles are arranged in hexagonal symmetry.

[0660] As can be further seen in FIGs. 11 A-C, increasing the deposition time leads to a higher coating density: for 15-nm GNPs, a 15-minutes deposition yields nanoparticle clusters composed of several particles (FIG. 11 A). Prolonged deposition increases cluster size and results in progressively larger surface areas covered by nanoparticles (FIG. 11B). After 5 hours or longer, the surface becomes almost completely coated (FIG. 11C).

[0661] In order to further examine the effect of particles size and salt concentration on monolayer formation, similar experiments were performed using smaller, 5-nm GNPs, deposited on mica in the presence of varying KC1 concentrations.

[0662] To this end, the gold nanoparticles were prepared as described hereinabove and then concentrated by ultrafiltration using a 30 kDa molecular weight cutoff (MWCO) membrane to an optical density (OD) at 520 nm of about 5. BSPP was added to the nanoparticle suspension to a final concentration of 1 mM, followed by the addition of KC1 from a 3 M stock solution to a final concentration of 0.2 M, 0.3 M, 0.5 M, or 1 M. A 50-pL drop of each nanoparticle suspension was placed onto a 1 cm2freshly cleaved mica surface and incubated for 45 minutes. After incubation, the surface was briefly rinsed with cold double-distilled water (DDW), dried under a gentle nitrogen stream, and imaged by AFM in semi-contact mode.

[0663] To further characterize the NP-coated mica surfaces obtained following 5 hours incubation with 15-nm BSPP-GNPs-coated (FIG. 11C), AFM, as shown in FIGs. 12A-B, and SEM images were taken, as shown in FIG. 12C.

[0664] As shown in FIGs. 12A-C, the resulting layer is a true monolayer, with a thickness corresponding to the particles’ height, and the particles exhibit clear hexagonal packing (FIG. 12B). The SEM image (FIG. 12C) further confirms the formation of a densely packed nanoparticles layer on the mica surface.In order to study the optical properties of the NP-coated mica surfaces shown in FIGs. 12A-C, their absorption spectrum was measured and is presented in FIG. 13 A. A photograph of the same surface is presented in FIG. 13B.

[0665] FIG. 13 A presents the absorption spectrum of a mica surface prepared as described hereinabove after 5 hours incubation with 15-nm GNPs, the absorption spectrum of the same 15-nm GNPs in solution, and to the absorption spectrum of a bare mica surface.

[0666] The nanoparticles-coated mica surface is intensely colored and displays a strong absorption band at 610-620 nm, which is significantly red-shifted relative to the plasmon resonance maximum of individual particles in a colloidal solution (about 520 nm). Without being bound by any particular theory, this red shift is consistent with plasmonic coupling between closely spaced particles within the monolayer formed on the surface.

[0667] AFM images of the resulting NP-coated mica surfaces are presented in FIGs. 14A-D for final KC1 concentrations of 0.2 M (FIG. 14A), 0.3 M (FIG. 14B), 0.5 M (FIG. 14C), and 1 M (FIG. 14D).

[0668] As shown in FIGs. 14A-D, surface coverage depends strongly on KC1 concentration. At 0.2 M KC1, surface coverage is below 50 %, whereas under otherwise identical conditions at 1 M KC1, the surface becomes almost completely coated (FIG. 14D).

[0669] It can therefore be concluded that the surface coverage can be tuned by adjusting the deposition conditions, such as deposition time (FIGs. 11A-C) and the salt concentration (FIGs. 14A-D), and that nanoparticle size may further influence monolayer formation and packing density.

[0670] Without being bound by any particular theory, based on the data obtained in these preliminary studies, it is assumed that the type of coating and the extent of surface coverage depend on nanoparticle size and surface ligand, on salt concentration during deposition, and on incubation time, and can be controlled by manipulating one or more of these parameters. The optimal conditions for monolayer formation can therefore be adjusted accordingly.

[0671] Based on the above preliminary data, coating of surfaces with the ultra-small (1.3 nm) NAD-GNPs described in Example 1 hereinabove was practiced at 3 hours incubation time, and 1 M KC1 concentration. The deposition parameters were selected in order to obtain substantially complete surface coverage while maintaining formation of a single nanoparticle layer. A relatively high KC1 concentration (1 M) was employed to promote adsorption of the nanoparticles onto the surface and to reduce or avoid particles aggregation.

[0672] KC1 from a 3 M stock solution was added to an aqueous suspension of NAD-GNPs (OD of about 100 at 420 nm), to a final concentration of 1 M KC1. A 50-pL drop of the NAD-GNPs suspension was placed onto a 1 cm2freshly cleaved mica or 5 % HF-treated silicon surfaces andincubated for 3 hours. After incubation, each surface was briefly rinsed with cold double-distilled water (DDW), dried under a gentle nitrogen stream, and imaged by AFM in semi-contact mode.

[0673] AFM images of the resulting NP-coated surfaces are presented in FIGs. 15A-B for the mica (FIG. 15A) and 5 % HF-treated silicon (a crystalline silicon wafer (<100>, undoped, 280 pm thickness) treated with 5 % HF for 5 minutes) (FIG. 15B) surfaces. As shown, deposition of the 1.3 nm NAD-GNPs produced nearly complete monolayer coverage on both mica and silicon substrates under these conditions.

[0674] The ultra-small (1.3 nm) NAD-GNPs were found to remain stable under these high ionic strength conditions (I M KC1). An incubation period of about 3 hours was sufficient to obtain substantially complete monolayer coverage. Prolonged incubation (e.g., about 16 hours) resulted in formation of an additional nanoparticle layer atop the first layer (data not shown).

[0675] Additional compositions are prepared by varying the time period of said contacting, an average size of the plurality of metal nanoparticles, a concentration and / or identity of said salt, a concentration of said plurality of metal nanoparticles in said suspension and / or a chemical composition of said substrate.

[0676] The resulting compositions described herein are further characterized with respect to their structural, optical, and electronic properties using methods as known in the art.

[0677] The compositions described herein may be used in optical, optoelectronic, catalytic, and sensing applications. The percentage surface coverage of the plurality of metal nanoparticles is selected according to the intended use, for example: relatively low surface coverage (5-30 %) can provide discrete nanoparticle domains suitable for sensing and / or catalytic applications; intermediate surface coverage (30-80 %) provides tunable optical absorption and / or reflection properties; and high or substantially complete monolayer coverage (80-100 %) enhances near-field coupling between adjacent nanoparticles and modifies light-matter interactions at the substrate surface, thereby rendering the nanoparticle-coated substrate suitable for use in photodetectors, photovoltaic devices, optical filters, or other semiconductor-based devices.

[0678] Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.

[0679] It is the intent of the applicant(s) that all publications, patents and patent applications referred to in this specification are to be incorporated in their entirety by reference into the specification, as if each individual publication, patent or patent application was specifically and individually noted when referenced that it is to be incorporated herein by reference. In addition, citation or identification ofany reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting. In addition, any priority document(s) of this application is / are hereby incorporated herein by reference in its / their entirety.

Claims

WHAT IS CLAIMED IS:

1. A metal nanoparticle comprising at least one metal atom and a ligand associated with at least a portion of a surface of said metal atom, wherein said ligand is represented by:X-L-Ywherein:L is a linking moiety or is absent;X is a first moiety that is capable of associating with said surface of said metal atoms; and Y is a redox-reactive moiety and / or a second moiety that is capable of associating with said surface of said metal atoms.

2. The metal nanoparticle of claim 1, wherein the metal is selected from gold, copper, silver, manganese, cobalt, palladium, platinum, ruthenium, rhodium, and nickel.

3. The metal nanoparticle of claim 1 or 2, wherein the metal is gold.

4. The metal nanoparticle of any one of claims 1 to 3, wherein X is or comprises at least one group that has a dissociation constant KD with said surface of said metal atom that is higher than 1 nanomolar and lower than 100 micromolar.

5. The metal nanoparticle of claim 4, wherein said dissociation constant KD ranges from 100 nanomolar to 100 micromolar, or from 1 micromolar to 100 micromolar, or from 10 micromolar to 100 micromolar.

6. The metal nanoparticle of any one of claims 1 to 5, wherein X is or comprises an amine group.

7. The metal nanoparticle of any one of claims 1 to 6, wherein X is or comprises a nitrogen-containing heterocyclic group.

8. The metal nanoparticle of any one of claims 1 to 7, wherein X is or comprises a purine or pyrimidine.

9. The metal nanoparticle of any one of claims 1 to 8, wherein X is or comprises a nucleobase, a nucleoside or a nucleotide.

10. The metal nanoparticle of any one of claims 1 to 9, wherein X is or comprises adenine.

11. The metal nanoparticle of any one of claims 1 to 10, wherein Y is or comprises at least one group that has a dissociation constant KD with the metal surface higher than 1 nanomolar and lower than 100 micromolar.

12. The metal nanoparticle of claim 11, wherein said dissociation constant KD ranges from 100 nanomolar to 100 micromolar, or from 1 micromolar to 100 micromolar, or from 10 micromolar to 100 micromolar.

13. The metal nanoparticle of any one of claims 1 to 12, wherein said linking moiety, if present, is such that allows association of both X and Y with said surface of said metal atoms.

14. The metal nanoparticle of any one of claims 1 to 13, wherein Y is a redox-reactive moiety.

15. The metal nanoparticle of any one of claims 1 to 14, wherein Y is or comprises a nicotinamide moiety.

16. The metal nanoparticle of any one of claims 1 to 15, wherein the ligand is derived from a cofactor.

17. The metal nanoparticle of any one of claims 1 to 16, wherein the ligand is or comprises an oxidoreductase cofactor.

18. The metal nanoparticle of any one of claims 1 to 17, wherein said ligand is or comprises nicotinamide adenine dinucleotide (NAD), flavin adenine dinucleotide (FAD), nicotinamide adenine dinucleotide phosphate (NADP), folic acid, acetyl-CoA, cyanocobalamin and any combination thereof.

19. The metal nanoparticle of any one of claims 1 to 18, wherein the ligand is or comprises NAD.

20. The metal nanoparticle of any one of claims 1 to 18, wherein Y is or comprises a targeting moiety.

21. The metal nanoparticle of any one of claims 1 to 18 and 20, wherein the ligand is or comprises FAD.

22. The metal nanoparticle of any one of claims 1 to 21, having a mean diameter lower than 5 nm, or lower than 3 nm, or lower than 2 nm.

23. The metal nanoparticle of any one of claims 1 to 22, having an average relative size distribution of up to 30 %.

24. The metal nanoparticle of any one of claims 1 to 23, comprising up to 200 metal atoms.

25. A process of preparing the metal nanoparticle of any one of claims 1 to 24, the process comprising:contacting said ligand with an ion of said metal to form an ionic metal complex, and contacting said ionic metal complex with a reducing agent to thereby form the metal nanoparticle.

26. The metal nanoparticle of any one of claims 1 to 24, wherein Y is a redox-reactive moiety, the metal nanoparticle being for use as a catalyst in a redox reaction.

27. The metal nanoparticle of any one of claims 1 to 26, wherein X is or comprises a nucleobase, the metal nanoparticle being capable of associating with a single-stranded oligonucleotide, to thereby form said oligonucleotide decorated by said nanoparticle of said metal.

28. The metal nanoparticle of claim 27, for use in labeling an oligonucleotide, and / or for detecting non-paired nucleotides in an oligonucleotide.

29. The metal nanoparticle of any one of claims 1 to 24, for use in a reaction in which displacement of said ligand is beneficial.

30. A composition comprising a lipid bilayer associated with the metal nanoparticle of any one of claims 1 to 24.

31. A cosmetic product comprising the composition of claim 30.

32. A composition-of-matter comprising a substrate and a plurality of metal nanoparticles associated with at least a portion of a surface of the substrate, wherein in at least a portion of the plurality of metal nanoparticles, each nanoparticle is the metal nanoparticle of any one of claims 1 to 24.

33. The composition-of-matter of claim 32, wherein the plurality of metal nanoparticles forms together a film deposited on said at least a portion of said surface of the substrate.

34. The composition-of-matter of claim 32 or 33, wherein the surface of the substrate is or comprises silicon.

35. The composition-of-matter of any one of claims 32 to 34, wherein the surface of the substrate is or comprises a silicate mineral.

36. The composition-of-matter of any one of claims 32 to 34, wherein the surface of the substrate is or comprises mica.

37. A process for preparing the composition-of-matter of any one of claims 32 to 36, the process comprising contacting the substrate with a suspension that comprises a vehicle and the plurality of metal nanoparticles, to thereby obtain the composition-of-matter.

38. The process of claim 37, wherein the suspension further comprises a salt.

39. The process of claim 37 or 38, wherein the vehicle is or comprises water and the suspension is an aqueous suspension.

40. An article-of-manufacturing comprising the composition-of-matter of any one of claims 32 to 36.