Oligonucleotide forming novel g4 structure of oncogene NRAS and use thereof

WO2026181978A1PCT designated stage Publication Date: 2026-09-03NAT UNIV CORP TOKYO UNIV OF AGRI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2026/006547
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-02-25
Filing Date
2026-02-24
Publication Date
2026-09-03

Smart Images

  • Figure JPOXMLDOC01-APPB-C000001
    Figure JPOXMLDOC01-APPB-C000001
  • Figure JPOXMLDOC01-APPB-C000004
    Figure JPOXMLDOC01-APPB-C000004
  • Figure JPOXMLDOC01-APPB-M000002
    Figure JPOXMLDOC01-APPB-M000002
Patent Text Reader

Abstract

The present invention addresses the problem of establishing a screening system for a cancer therapeutic agent targeting a guanine quadruplex (G4) of oncogene NRAS. The present invention provides: an oligonucleotide including a base sequence represented by general formula (I) and forming a guanine quadruplex (G4) structure of mature mRNA generated from NRAS gene; and a method using the oligonucleotide to screen for a compound that inhibits transcription or translation of the NRAS gene. (I): X1-GG-X2-GG-X3-GG-X4-GG-X5 (In the formula, X1-X5 represent any sequence having 0-30 bases).
Need to check novelty before this filing date? Find Prior Art

Description

Oligonucleotides Forming a Novel G-quadruplex Structure of the Oncogene NRAS and Uses Thereof

[0001] The present invention relates to an oligonucleotide that forms a guanine quadruplex (G4) structure of the oncogene NRAS, and a method for screening a cancer therapeutic agent targeting said G4.

[0002] NRAS (neuroblastoma RAS viral oncogene homolog), together with KRAS and HRAS, constitutes the RAS oncogene gene family. When an amino acid substitution occurs due to a mutation in the RAS gene, a decrease in the GTPase function of RAS and a decreased response to GAP result in a constitutively activated state, which continues to transmit signals downstream, and this excessive signal is considered to be involved in carcinogenesis and cancer proliferation. Among RAS genes, KRAS gene mutations are found in the largest number of cancer types, but NRAS gene mutations are also confirmed with high probability in melanoma, thyroid cancer, ovarian cancer, and hematological malignancies.

[0003] Therefore, RAS is a promising molecular target for the development of cancer therapeutic drugs. However, due to the fact that RAS also functions in normal cells and the characteristics of the surface structure of RAS, drug discovery targeting RAS has been difficult. In recent years, with advances in drug discovery design technology, RAS inhibitors that selectively bind to KRAS G12C, in which the 12th amino acid of KRAS protein is mutated from glycine to cysteine, and irreversibly inhibit the structural change of KRAS to the active form have been reported. However, the administration is extremely limited to only patients in whom a KRAS G12C mutation positive has been confirmed.

[0004] On the other hand, guanine quadruplexes (G-quadruplexes: G4) are a type of higher-order structure of DNA and RNA, formed from guanine-rich base sequences. They are special higher-order structures in which two or more tetrameric faces (G-quartets) of four guanine molecules are stacked together through an interaction called π-π stacking. G4 is said to be abundant in the promoter regions and 5' untranslated regions of cancer-related genes. It is expected that stabilizing G4 in cancer cells with compounds that bind to G4, called G4 ligands, will inhibit the translation of cancer-related genes, thereby yielding an anti-cancer effect.

[0005] To date, a G4 structure of NRAS has been reported that has three layers of planes in which four guanines form a tetramer (G-quartet) (Non-Patent Literature 1), but the development of cancer drugs targeting this G4 has not been successful. Furthermore, the G4-forming sequence of NRAS reported above is a region that is deleted during mRNA splicing and is not directly involved in translational inhibition.

[0006] Kumari S, Bugaut A, Huppert JL, Balasubramanian S. An RNA G-quadruplex in the 5' UTR of the NRAS proto-oncogene modulates translation. Nat Chem Biol 2007; 3:218-21

[0007] The objective of this invention is to establish a screening system for cancer treatment agents that target the guanine quadruplex (G4) of the oncogene NRAS.

[0008] To solve the above problems, the inventors of the present invention conducted a thorough investigation and search of the guanine quadruplex (G4) in the oncogene NRAS. As a result, they discovered a gene region containing a sequence that forms a novel G4 structure in which two layers of guanine tetramer-forming planes (G-quartet) are superimposed, rather than the conventionally reported three layers. This gene region containing the novel G4-forming sequence is located in a region that persists in mature mRNA, and it was confirmed that a small molecule G4 ligand binds to the G4-forming sequence. Therefore, by screening compounds targeting this novel G4, it is possible to discover cancer therapeutic agents related to mutations in the NRAS gene. The present invention was completed based on these findings.

[0009] In other words, the present invention encompasses the following inventions: [1] An oligonucleotide that forms a guanine quadruplex (G4) structure of mature mRNA derived from the NRAS gene, comprising a base sequence represented by the following general formula (I): X1-GG-X2-GG-X3-GG-X4-GG-X5(I) (wherein X1 to X5 represent any sequence with 0 to 30 bases). [2] The oligonucleotide according to [1], wherein the oligonucleotide is one of the oligonucleotides shown in (a) to (e) below.(a) Oligonucleotides consisting of the nucleotide sequence shown in SEQ ID NO: 1, or a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in SEQ ID NO: 1 excluding the GG portion, and which form the guanine quadruplex (G4) structure of mature mRNA produced from the NRAS gene UCUUGCUGGUGUGAAAUGACUGAGUACAAACUGGUGGUGG (SEQ ID NO: 1) (b) Oligonucleotides consisting of the nucleotide sequence shown in SEQ ID NO: 2, or a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in SEQ ID NO: 2 excluding the GG portion, and which form the guanine quadruplex (G4) structure of mature mRNA produced from the NRAS gene UGGGACUCAGGGUUGUAUGGGAUUGCCAUGUGUGGUG (SEQ ID NO: 2) (c) Oligonucleotides consisting of the nucleotide sequence shown in SEQ ID NO: 3, or a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in SEQ ID NO: 3 excluding the GG portion, and which form the guanine quadruplex (G4) structure of mature mRNA produced from the NRAS gene GUGCCGCUCCUUGGUGGGGGCUGUUCAUGGCGGUUCCGGG (Sequence ID 3) (d) An oligonucleotide consisting of the nucleotide sequence shown in Sequence ID 4, or an oligonucleotide consisting of a nucleotide sequence having 90% or more sequence identity with respect to the nucleotide sequence of the nucleotide sequence shown in Sequence ID 4 excluding the GG portion, and which forms a guanine quadruplex (G4) structure of mature mRNA produced from the NRAS gene ACAAACUGGUGGUGGUUGGAGCAGGUGGUGUUGGGAAAA (Sequence ID 4) (e) An oligonucleotide consisting of the nucleotide sequence shown in Sequence ID 5, or an oligonucleotide consisting of a nucleotide sequence having 90% or more sequence identity with respect to the nucleotide sequence of the nucleotide sequence shown in Sequence ID 5 excluding the GG portion, and which forms a guanine quadruplex (G4) structure of mature mRNA produced from the NRAS gene GGUUGGAGCAGGUGGUGUUGGGAAAAGCGCACUGACAA (Sequence ID 5) [3] A method for screening compounds that inhibit transcription or translation of the NRAS gene, comprising the following steps.(1) A step of contacting a nucleic acid construct obtained by conjugating a reporter gene to an oligonucleotide described in [1] or [2] with a test compound; (2) A step of measuring the expression level of the reporter gene; and (3) A step of selecting a test compound that reduces the expression level of the reporter gene measured in (2) compared with a control measured in the absence of the test compound; (4) A compound that inhibits the transcription or translation of the NRAS gene obtained by the screening method described in [3]; (5) A cancer treatment agent containing the compound described in [4] as an active ingredient; (6) A method for treating cancer, comprising administering the compound described in [4] to a mammal having cancer in a therapeutically effective amount; (7) The compound described in [4] for use in the treatment of cancer; (8) The use of the compound described in [4] in the manufacture of a pharmaceutical product for the treatment of cancer. This application claims priority to Japanese Patent Application No. 2025-027721, filed on 25 February 2025, and incorporates the contents described in the specification of said patent application.

[0010] The present invention provides oligonucleotides that form a novel G4 structure of the oncogene NRAS. By using the oligonucleotides of the present invention, compounds that inhibit the transcription or translation of the NRAS gene can be screened simply and efficiently. Therefore, the oligonucleotides of the present invention are useful as a screening tool for molecularly targeted therapies for cancers associated with mutations in the NRAS gene.

[0011] Figure 1 shows the structure of G4 in the NRAS gene, 6OTD-Py (G4 ligand), and a schematic diagram of G4 in the NRAS gene bound to 6OTD-Py. Figure 2 shows the fluorescence intensity measurements when G4 ligand (6OTD-Py) was reacted with G4 candidate sequences (DNA) (NRAS_5, NRAS_10, NRAS_11, NRAS_117, NRAS_130, NRAS_142, NRAS_155, NRAS_659, NRAS_2363, NRAS_2377, NRAS_2398, NRAS_3064, NRAS_3074, NRAS_3809, NRAS_3819, NRAS_4037, NRAS_4064, NRAS_4067) at various oligoclode concentrations. Figure 3 shows the fluorescence intensity measurements when G4 ligand (6OTD-Py) was reacted with G4-forming sequences (RNA) (NRAS_117 and NRAS_659) at various oligoclode concentrations. Figure 4 shows the fluorescence spectrum measurements of the G4-forming sequences (RNA) (NRAS_117 and NRAS_659). Figure 5 shows the CD spectrum measurements of the G4-forming sequences (RNA) (NRAS_117 and NRAS_659) under conditions with and without L2H2-6OTD (G4-ligand). Figure 6 shows the construction diagram of plasmid DNA with an insertion sequence of a portion of the NRAS DNA base sequence. Figure 7 shows the results of in vitro translation using a DNA sequence containing GFPuv (NRAS_117_G4) under conditions with and without G4 ligand (PhenDC).

[0012] The present invention will be described in detail below. 1. Oligonucleotides that form the guanine quadruplex (G4) structure of mature mRNA derived from the NRAS gene The oligonucleotides that form the guanine quadruplex (G4) structure of mature mRNA derived from the NRAS gene according to the present invention include a base sequence represented by the following general formula (I).

[0013] X1-GG-X2-GG-X3-GG-X4-GG-X5(I) (wherein X1 to X5 represent any sequence with 0 to 30 base pairs).

[0014] The oligonucleotide that forms the guanine quadruplex (G4) structure of mature mRNA derived from the NRAS gene in this invention is a parallel-type structure in which two layers of tetrameric planes (G-quartets) of four guanines are stacked. A G-ligand that recognizes and specifically binds to G4 of the NRAS gene can inhibit the translation of the NRAS gene, a cancer-related gene, by stabilizing G4. Therefore, substances that strongly bind to G4 of the NRAS gene are useful as cancer treatment agents. Figure 1 shows 6OTD-Py as an example of a G4-ligand, the structure of G4 of the NRAS gene, and a schematic diagram of G4 bound to 6OTD-Py.

[0015] The oligonucleotides that form the guanine quadruplex (G4) structure of mature mRNA derived from the NRAS gene of the present invention only need to contain at least the base sequence represented by the above general formula (I), that is, the GG sequence should appear at least four times. Furthermore, the total length of the oligonucleotide is preferably 30 to 60 bases, more preferably 30 to 50 bases, and even more preferably 35 to 45 bases.

[0016] In the above general formula (I), X1 to X5 are any sequence with 0 to 30 base pairs, and may contain G. The number of base pairs may be 30 or less, but preferably 25 or less, and more preferably 20 or less.

[0017] Oligonucleotides that form a guanine quadruplex (G4) structure in mature mRNA derived from the NRAS gene of the present invention include NRAS_117, NRAS_659, NRAS_11, NRAS_142, and NRAS_155, but NRAS_117 and NRAS_659 are preferred.

[0018] NRAS_117: UCUUGCUGGUGUGAAAUGACUGAGUACAAACUGGUGGUGG (Sequence ID 1) NRAS_659: UGGGACUCAGGGUUGUAUGGGAUUGCCAUGUGUGGUG (Sequence ID 2) NRAS_11: GUGCCGCUCCUUGGUGGGGGCUGUUCAUGGCGGUUCCGGG (Sequence ID 3) NRAS_142: ACAAACUGGUGGUGGUUGGAGCAGGUGGUGUUGGGAAAA (Sequence ID 4) NRAS_155: GGUUGGAGCAGGUGGUGUUGGGAAAAGCGCACUGACAA (Sequence ID 5)

[0019] Furthermore, each of the above oligonucleotides may be an oligonucleotide that has 90% or more sequence identity with the base sequence excluding the GG portion of the base sequence shown in each sequence number, as long as it forms the guanine quadruplex (G4) structure of the mature mRNA derived from the NRAS gene.

[0020] The above-mentioned "base sequence having 90% or more sequence identity" means that the base sequence has at least 90% sequence identity, preferably 95% or more, more preferably 97% or more, and most preferably 98% or more. The sequence identity of a base sequence can be determined using methods well known to those skilled in the art, sequence analysis software, etc. Examples include the blastn program of the BLAST algorithm and the fasta program of the FASTA algorithm. Here, the sequence identity of a base sequence is a value expressed as a percentage of the frequency at which the same base appears in the same location when the base sequence to be evaluated is compared with the base sequence described in each sequence number.

[0021] The above-mentioned oligonucleotides can be synthesized using commonly used automated DNA synthesizers (e.g., Model 394 from Applied Biosystems) by methods known in the art for the synthesis of oligonucleotides, such as the phosphotriethyl method and the phosphodiester method.

[0022] 2. Screening method for compounds that inhibit transcription or translation of the NRAS gene The screening method for compounds that inhibit transcription or translation of the NRAS gene according to the present invention is preferably carried out using a reporter gene system (reporter assay).

[0023] The screening method of the present invention includes the steps of (1) contacting a nucleic acid construct obtained by conjugating a reporter gene to the oligonucleotide described in 1. above with a test compound, (2) measuring the expression level of the reporter gene, and (3) selecting a test compound that reduces the expression level of the reporter gene measured in (2) by comparing it with a control measured in the absence of the test compound.

[0024] In step (1), a nucleic acid construct, in which a reporter gene is attached to the oligonucleotide of the present invention, is introduced into a gene transcription / translation system, brought into contact with the test compound, and gene transcription and translation are carried out in the presence of the test substance. The transcription / translation system may be a cell-based transcription / translation system or a cell-free transcription / translation system, but a cell-free transcription / translation system is preferred.

[0025] In the case of cell-based transcription / translation systems, the cells include bacteria belonging to the genera Escherichia (such as Escherichia coli), Bacillus (such as Bacillus subtilis), Pseudomonas (such as Pseudomonas putida), and Rhizobium (such as Rhizobium meliloti); Saccharomyces cerevisiae, Schizosaccharomyces pombe Any of the following may be used: yeast such as pombe; or animal cells such as CHO cells, HeLa cells, COS-1 cells, COS-7 cells, HEK293 cells, etc.

[0026] For cell-free transcription / translation systems, cell-free transcription / translation systems derived from prokaryotes, insect cells, non-human animal cells, human cells, wheat germ, etc., can be used. Cell-free transcription / translation systems can be commercially available as kits.

[0027] Furthermore, it is more preferable to use a reconstituted cell-free transcription / translation system, and a reconstituted E. coli translation system (the so-called PURE system) can be used. The PURE system is a reconstituted E. coli translation system in vitro. The PURE system includes initiation factors (IF1, IF2, IF3), elongation factors (EF-Tu, EF-Ts, EF-G), termination (dissociation) factors (RF1, RF2, RF3), ribosomal regeneration factors (RRF), aminoacyl-tRNA synthetase (ARS), methionyl-tRNA formyltransferase, ribosomes, T7 RNA polymerase, amino acids, NTPs, tRNA, etc. When using a reconstituted cell-free translation system, the reaction temperature and reaction time can be set as appropriate; for example, a reaction temperature of 20-50°C and a reaction time of 1-24 hours can be exemplified.

[0028] The nucleic acid construct described above is in the form of a plasmid containing a promoter, a ribosome binding site (RBS), and other regions necessary for gene transcription and expression, operably linked upstream of an oligonucleotide to which a reporter gene is attached, and is introduced into the transcription / translation system described above. The plasmid may optionally include enhancers, splicing signals, poly-A addition signals, selection markers (such as drug resistance genes or genes that complement nutrient requirement mutations), and origins of replication. The promoter can be appropriately selected depending on the expression system used, but for example, in the case of a transcription / translation system using E. coli cells or an E. coli-derived cell-free transcription / translation system, promoters that function in E. coli, such as the T7 promoter, T3 promoter, and SP6 promoter, are examples. When using animal cells, examples include the SV40 promoter, CMV promoter, SRα promoter, LTR promoter, or MoMuLV (Molony mouse leukemia virus) LTR promoter.

[0029] The reporter genes mentioned above are not particularly limited as long as their expression can be detected, and examples include the GFP gene, CAT gene, lacZ gene, luciferase gene, and β-glucuronidase gene (GUS).

[0030] In step (2), the expression level of the reporter gene in the transcription / translation system is measured. The expression level of the reporter gene can be measured by a method known to those skilled in the art, depending on the type of reporter gene used. For example, if the reporter gene is a GFP gene, the expression level of the reporter gene can be measured by detecting fluorescence produced by the GFP protein. If the reporter gene is a CAT gene, the expression level of the reporter gene can be measured by detecting the acetylation of chloramphenicol by the gene product; if the reporter gene is a lacZ gene, the expression level of the reporter gene can be measured by detecting the color development of a dye compound due to the catalytic action of the gene expression product; if the reporter gene is a luciferase gene, the expression level of a fluorescent compound due to the catalytic action of the gene expression product can be measured by detecting fluorescence; and if the reporter gene is a β-glucuronidase gene (GUS), the expression level of the reporter gene can be measured by detecting the emission of Glucuron (ICN) or the color development of 5-bromo-4-chloro-3-indolyl-β-glucuronide (X-Gluc) due to the catalytic action of the gene expression product.

[0031] In step (3), a compound is selected that reduces the expression level of the reporter gene compared to a control measured in the absence of the test compound. The comparison of expression levels is preferably based on whether or not there is a statistically significant difference. For example, if the expression level measured in the presence of the test compound is 20%, 30%, 50%, 70%, or 90% lower than the expression level of the control, it can be determined that there has been a statistically significant reduction.

[0032] The test compounds used for screening are mainly components that can be used in pharmaceuticals and / or food and beverages, and include, for example, mixtures containing multiple compounds such as extracts of animal or plant tissues or microbial cultures, and purified standards therefrom; naturally occurring molecules (e.g., amino acids, peptides, oligopeptides, polypeptides, proteins, nucleic acids, lipids, steroids, glycoproteins, proteoglycans, etc.); synthetic analogs or derivatives of naturally occurring molecules (e.g., peptide mimetic substances, etc.); and molecules that do not occur naturally (e.g., low-molecular-weight organic compounds produced using combinatorial chemistry technology, etc.); and mixtures thereof. Furthermore, a single test compound may be tested independently, or a mixture of several candidate test compounds (including libraries, etc.) may be tested. Examples of libraries containing multiple test compounds include synthetic compound libraries and peptide libraries, but medium-molecular-weight compound libraries or low-molecular-weight compound libraries are preferred.

[0033] The compounds selected by the screening method of the present invention may be compounds that act at any stage of the NRAS gene, including the transcription level, post-transcriptional regulation level, translation level to NRAS protein level, and post-translational modification level. Therefore, the compounds that inhibit the transcription or translation of the NRAS gene according to the present invention include compounds that inhibit the transcription of the NRAS gene, compounds that inhibit the processing of the initial transcript to mRNA, compounds that inhibit the transport of mRNA to the cytoplasm, compounds that inhibit the translation of mRNA to NRAS protein or compounds that degrade mRNA, and compounds that inhibit the post-translational modification of the initial translation product. Although any compound that acts at any of the above stages can be used for the pharmaceutical applications targeted by the present invention, compounds that bind to oligonucleotides (RNA) and inhibit translation to NRAS protein according to the present invention are preferred.

[0034] 3. Cancer Therapeutic Agents Compounds that inhibit the transcription or translation of the NRAS gene obtained by the screening method of the present invention can be used as pharmaceuticals for the treatment of diseases related to mutations in the NRAS gene, in particular as cancer therapies. Cancers related to mutations in the NRAS gene include, but are not limited to, melanoma, gastric cancer, breast cancer, lung cancer, esophageal cancer, prostate cancer, liver cancer, colorectal cancer, rectal cancer, gallbladder and bile duct cancer, kidney cancer, bladder cancer, uterine cancer, ovarian cancer, thyroid cancer, brain tumors, osteosarcoma, and lymphoma.

[0035] When using the cancer treatment agent of the present invention for the treatment of the above-mentioned cancer, it should be administered to the mammal with cancer in a therapeutically effective amount. Examples of mammals include humans, dogs, cats, sheep, goats, cattle, horses, and pigs. A "therapeutally effective amount for cancer" refers to the amount of this agent administered to proliferating cancer cells that causes the cessation of cancer cell proliferation, reduction of tumor size, or disappearance. The specific dosage should be appropriately increased or decreased depending on the route of administration, the patient's age and weight, the type and malignancy of the cancer, and whether or not there is metastasis or recurrence.

[0036] The methods of administration include intravenous, intra-arterial, intramuscular, intraperitoneal, subcutaneous, local, intratumoral, oral, perdermal, rectal, vaginal, nasal, and sublingual administration. Specifically, for example, solid tumors in various organs that can be easily accessed by surgery can be administered by local injection into or near the tumor using a stereotactic needle. Non-solid tumors such as leukemia, cancers in areas that are difficult to access by surgery such as brain tumors, and metastatic cancers can be administered by intravenous injection. In addition, the above administration methods can be appropriately selected and used depending on the type and location of the cancer.

[0037] When formulating the cancer treatment agent of the present invention, the above compound can be mixed with pharmacologically and pharmaceutically acceptable additives and formulated into various formulations such as tablets, powders, granules, fine granules, capsules, oral solutions (suspensions, syrups, emulsions, etc.), topical solutions (injections, sprays / aerosols, inhalants, ointments, etc.), injections, drips, and suppositories using methods known in the art. Pharmacologically and pharmaceutically acceptable additives may include, depending on the dosage form and application, appropriately selected formulation bases or carriers, excipients, diluents, binders, lubricants, coatings, disintegrants or disintegration aids, stabilizers, preservatives, antiseptics, bulking agents, dispersants, wetting agents, buffers, solubilizers or solubilizers, isotonic agents, pH adjusters, colorants, etc., and prepared into various formulations that can be administered orally or parenterally systemically or locally using various known methods. The cancer treatment agent of the present invention, prepared in various formulation forms, can be administered orally or parenterally, systemically or locally. When the cancer treatment agent of the present invention is administered orally, it may be formulated as tablets, capsules, granules, powders, pills, oral solutions, suspensions, emulsions, syrups, etc., or as a dried product that is redissolved at the time of use. When the cancer treatment agent of the present invention is administered parenterally, it may be formulated as an intravenous injection (including infusion), intramuscular injection, intraperitoneal injection, intrathecal injection, subcutaneous injection, suppositories, etc., and in the case of an injectable formulation, it is provided in the form of a unit dose ampoule or a multi-dose container.

[0038] The present invention will be described in more detail below with reference to examples. However, the present invention is not limited to these examples. (Example 1) Searching for and verifying G4-forming sequences of NRAS Using a guanine quadruplex (G4) formation prediction device (Japanese Patent Application Publication No. 2023-174616), novel G4-forming sequences were predicted on the DNA base sequence of NRAS, and 18 candidate G4 sequences were selected. These 18 candidate G4 sequences were verified to determine whether they were G4-forming sequences.

[0039] Oligonucleotides (DNA) of 18 G-quadruplex candidate sequences were dissolved in a buffer solution containing 10 mM lithium cacodylate (pH 7.4) and 100 mM KCl, to prepare an oligonucleotide solution adjusted to a final concentration of 25 μM. After denaturing this oligonucleotide solution at 95°C for 5 minutes, it was gradually cooled to 25°C to perform annealing (G4 formation). Thereafter, an oligonucleotide solution adjusted to an oligonucleotide concentration of 0.012 to 25 μM was prepared using the same buffer as above.

[0040] Next, a G4 ligand and an oligonucleotide having a G4 candidate sequence were reacted by the following method. As the G4 ligand, 6OTD-Py represented by the following structural formula was used.

[0041]

[0042] To a solution obtained by dissolving 6OTD-Py (0.2 μM) in a buffer solution containing 10 mM lithium cacodylate (pH 7.4), 100 mM KCl and 0.01% Tween-20, the above oligonucleotide solution was added such that the oligonucleotide concentration became 0.006 to 12.5 μM, followed by incubation for 24 hours, thereby reacting the G4 ligand with each oligonucleotide of the G4 candidate sequences.

[0043] A reaction solution of the above G4 ligand and the oligonucleotide having a G4 candidate sequence was used as a sample, which was subjected to fluorescence intensity measurement. Fluorescence intensity was measured by placing 40 μL of the sample in a 384-well plate (Greiner, 781900), and using a microplate reader (TECAN, Spark) at room temperature at an excitation wavelength of 406 nm and an emission wavelength of 510 nm.

[0044] The results are shown in Figure 2. Since an increase in fluorescence intensity was observed in all 18 G4 candidate sequences after reaction with the G4 ligand, it was considered that all the candidate sequences form G4 structures.

[0045] Next, for each of the 18 oligonucleotides of G4 candidate sequences, a regression curve represented by the following Formula 1 fitted to the relationship between fluorescence intensity and sample concentration was obtained from the fluorescence intensities measured for samples of various concentrations, thereby obtaining the dissociation constant K of 6OTD-Py d [μM] was determined.

[0046]

[0047] F: Fluorescence intensity m0: [OLG] (twice the concentration [μM] of oligonucleotide) m1: [6OTD-Py] (concentration [μM] of 6OTD-Py) m2: Kd (dissociation constant [μM]) A: Maximum fluorescence intensity of the complex of 6OTD-Py and G4

[0048] The dissociation constants of each oligonucleotide are shown in Table 1 below.

[0049]

[0050] Among the 18 oligonucleotides of the above G4 candidate sequences, NRAS_117, NRAS_659, NRAS_11, NRAS_142, and NRAS_155, which have strong binding to the ligand (small dissociation constant), were considered promising as G4-forming sequences of NRAS. The base sequences (RNA) of these five NRAS G4-forming sequences are shown below.

[0051] NRAS_117: UCUUGCUGGUGUGAAAUGACUGAGUACAAACUGGUGGUGG (SEQ ID NO: 1) NRAS_659: UGGGACUCAGGGUUGUAUGGGAUUGCCAUGUGUGGUG (SEQ ID NO: 2) NRAS_11: GUGCCGCUCCUUGGUGGGGGCUGUUCAUGGCGGUUCCGGG (SEQ ID NO: 3) NRAS_142: ACAAACUGGUGGUGGUUGGAGCAGGUGGUGUUGGGAAAA (SEQ ID NO: 4) NRAS_155: GGUUGGAGCAGGUGGUGUUGGGAAAAGCGCACUGACAA (SEQ ID NO: 5)

[0052] (Example 2) Verification of the G4-forming base sequence (RNA) of NRAS (1) Measurement of fluorescence intensity Of the oligonucleotides that were considered promising as G4-forming sequences of NRAS in Example 1, the oligonucleotides (RNA) NRAS_117 and NRAS_659 were reacted with a G4 ligand in the same manner as in Example 1 and the fluorescence intensity was measured.

[0053] Oligonucleotide (RNA) solutions of NRAS_117 and NRAS_659 were dissolved in a buffer containing 10 mM lithium cacodylate (pH 7.4) and 100 mM KCl, and adjusted to a final concentration of 25 μM. These oligonucleotide solutions were denatured at 95°C for 5 minutes, then slowly cooled to 25°C for annealing (G4 formation). Subsequently, oligonucleotide solutions were prepared using the same buffer to adjust the oligonucleotide concentration to 0.012–25 μM.

[0054] Next, 6OTD-Py (0.2 μM) was dissolved in a buffer containing 10 mM lithium cacodylate (pH 7.4), 100 mM KCl, and 0.01% Tween-20 to obtain a solution. To this solution, the oligoclode solution was added to achieve an oligoclode concentration of 0.006 to 12.5 μM, and the mixture was incubated for 24 hours to react the G4 ligand with the oligonucleotides (RNAs) of NRAS_117 and NRAS_659.

[0055] The reaction mixture of the above G4 ligand and the oligonucleotides (RNAs) NRAS_117 and NRAS_659 was used as a sample, and its fluorescence intensity was measured. Fluorescence intensity was measured at room temperature using a microplate reader (TECAN, Spark) with an excitation wavelength of 406 nm and an emission wavelength of 510 nm, using 40 μL of the sample in a 384-well plate (Greiner, 781900). The dissociation constant Kd (μM) was determined from the measured fluorescence intensity and sample concentration according to Equation 1.

[0056] The fluorescence intensity measurement results are shown in Figure 3. In all samples, the fluorescence intensity increased in a concentration-dependent manner with the oligonucleotide, and it was confirmed that NRAS_117 and NRAS_659 also form G4 in RNA sequences.

[0057] (2) Measurement of UV Spectra Oligonucleotides (RNAs) of NRAS_117 and NRAS_659 were dissolved in a buffer containing 10 mM lithium cacodylate (pH 7.4) and 100 mM KCl to prepare oligonucleotide solutions adjusted to a final concentration of 10 μM. These oligonucleotide solutions were denatured at 95°C for 5 minutes, then slowly cooled to 25°C for annealing (G4 formation). The UV spectra were recorded using a JASCO V-730 spectropolarimeter (Tokyo, Japan) with a quartz cell with a path length of 10 mm (scan speed: 100 nm / min, wavelength range: 280-330 nm, measurement temperature: 25°C, 95°C). The Δabsorbance was obtained by subtracting the UV spectrum at 25°C from the UV spectrum at 95°C.

[0058] The UV spectral measurement results are shown in Figure 4. Since UV absorption was observed around 295 nm, it was confirmed that both NRAS_117 and NRAS_659 are G4-forming sequences.

[0059] (3) Measurement of CD Spectrum Analysis of the G4 structure formed by the CD spectrum was performed. Oligonucleotides (RNAs) of NRAS_117 and NRAS_659 were dissolved in a buffer containing 10 mM lithium cacodylate (pH 7.4) and 100 mM KCl to prepare an oligonucleotide solution adjusted to a final concentration of 5 μM. This oligonucleotide solution was denatured at 95°C for 5 minutes, then slowly cooled to 25°C for annealing (G4 formation). Subsequently, the oligonucleotide was mixed to a final concentration of 2 μM and the G4 ligand, L2H2-6OTD, represented by the following structural formula, to a final concentration of 10 μM (1% DMSO), and injected into a quartz cell.

[0060]

[0061] CD spectra were recorded using a JASCO-810 circular dichroism spectrometer (Jasco, Easton, MD) with a quartz cell having a path length of 1 mm. The measurement conditions were a scan speed of 100 nm / min, a response time of 1 second, and a wavelength range of 230–320 nm. The CD spectrum was representative of five scans averaged at 37°C.

[0062] The results of the CD spectrum measurement are shown in Figure 5. A peak originating from the positive Cotton effect is observed at 260–265 nm, and a peak originating from the negative Cotton effect is observed at 240–245 nm, suggesting that the oligonucleotides (RNAs) of NRAS_117 and NRAS_659 adopt a parallel G4 structure.

[0063] (Example 3) Verification of NRAS gene translation inhibition by NRAS_117 (1) Resuspension and storage of plasmid DNA Plasmid DNA (Figure 6) in which a portion of the NRAS DNA base sequence (Insert sequence: Sequence ID 6) was inserted was resuspended using ultrapure water. Specifically, 40 μL of ultrapure water was added to a tube containing approximately 4 μg of plasmid DNA to adjust the concentration to 100 ng / μL.

[0064] (2) PCR amplification The DNA sequence containing GFPuv (NRAS_117_G4) (Sequence ID 7) was amplified by PCR. Specifically, PCR was performed on the plasmid DNA solution from (1) using the following primer set and a Thermal Cycle Dice® Real Time System III (Shiga, Japan) manufactured by Takara Bio Inc. (step 1: 94°C, 120 sec, 1 cycle; step 2: 98°C, 10 sec / 55°C, 30 sec / 68°C, 60 sec, 30 cycles).

[0065] Forward primer: CCAAGCTGGCTAGCGAAA (SEQ ID NO: 8) Reverse primer: CCACACTGGACTAGTGGAT (SEQ ID NO: 9)

[0066] (3) Purification of PCR products 1 μL of DpnI was added to the solution after the PCR reaction and allowed to react (step 1: 37°C, 60 min, 1 cycle; step 2: 75°C, 15 min, 1 cycle) to cleave the remaining plasmid DNA. Subsequently, the PCR products were purified using the QIAquick PCR Purification Kit (QIAGEN). The procedure followed the kit protocol, and the elution volume in ultrapure water was 30 μL.

[0067] (4) Protein synthesis was carried out using In vitro transfer PUREflex® 1.0 (GeneFrontier: https: / / www.genefrontier.com / solutions / pureflex / lineup / pureflex-1-0 / ) according to the kit protocol. First, a test solution for in vitro transfer was prepared.

[0068] PCR products were added to the test solution so that the DNA concentration of the PCR product was 1 ng / μL. The DNA concentration of the PCR product was measured using a nanodrop spectrophotometer. PhenDC (a commercially available G4 stabilizing reagent), a G4 ligand, was diluted with DMSO, and the same amount of DMSO was added to the negative control (PCR product only) and the group without PhenDC (PhenDC(-)). The concentration of DMSO in the test solution was adjusted to 3 / 1000 vol. After preparing the test solutions for the PhenDC-added group (PhenDC(+)), the group without PhenDC (PhenDC(-)), and the negative control, the solutions were thoroughly mixed and reacted at 37°C for 4 hours using a thermal cycler to synthesize proteins.

[0069] Ten μL of the synthesized translation product was transferred to a 96-well black half plate, diluted five-fold with 40 μL of ultrapure water, and the fluorescence intensity was measured using a plate reader (Spark). (Upward measurement, excitation wavelength: 380 nm, fluorescence wavelength: 510 nm). The fluorescence intensity of each group was corrected by subtracting the fluorescence intensity of the negative control.

[0070] The results are shown in Figure 7. A dramatic decrease in fluorescence intensity was observed in the PhenDC-added group compared to the group without PhenDC. Therefore, it is suggested that the G4 structure formed by NRAS_117 is stabilized by PhenDC, inhibiting the translation of the oncogene NRAS and thus suppressing cancer. These results suggest that the NRAS G4-forming oligonucleotide of the present invention can serve as an anti-cancer site for G4 ligands and can be used in cancer drug discovery using G4 as an indicator.

[0071] This can be used in the development of molecularly targeted drugs that target the G4 structure of the NRAS gene. All publications, patents, and patent applications cited herein are incorporated herein by reference in their entirety.

Claims

1. Oligonucleotides that form the guanine quadruplex (G4) structure of mature mRNA derived from the NRAS gene, containing the base sequence represented by the following general formula (I): X1-GG-X2-GG-X3-GG-X4-GG-X5(I) (wherein X1 to X5 represent any sequence with 0 to 30 bases).

2. The oligonucleotide according to claim 1, wherein the oligonucleotide is one of the oligonucleotides shown in (a) to (e) below. (a) Oligonucleotides consisting of the nucleotide sequence shown in SEQ ID NO: 1, or a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in SEQ ID NO: 1 excluding the GG portion, and which form the guanine quadruplex (G4) structure of mature mRNA produced from the NRAS gene UCUUGCUGGUGUGAAAUGACUGAGUACAAACUGGUGGUGG (SEQ ID NO: 1) (b) Oligonucleotides consisting of the nucleotide sequence shown in SEQ ID NO: 2, or a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in SEQ ID NO: 2 excluding the GG portion, and which form the guanine quadruplex (G4) structure of mature mRNA produced from the NRAS gene UGGGACUCAGGGUUGUAUGGGAUUGCCAUGUGUGGUG (SEQ ID NO: 2) (c) Oligonucleotides consisting of the nucleotide sequence shown in SEQ ID NO: 3, or a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in SEQ ID NO: 3 excluding the GG portion, and which form the guanine quadruplex (G4) structure of mature mRNA produced from the NRAS gene (Sequence ID 3) (d) Oligonucleotides consisting of the nucleotide sequence shown in Sequence ID 4, or a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in Sequence ID 4 excluding the GG portion, and which form the guanine quadruplex (G4) structure of mature mRNA produced from the NRAS gene ACAAACUGGUGGUGGUUGGAGCAGGUGGUGUUGGGAAAA (Sequence ID 4) (e) Oligonucleotides consisting of the nucleotide sequence shown in Sequence ID 5, or a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence shown in Sequence ID 5 excluding the GG portion, and which form the guanine quadruplex (G4) structure of mature mRNA produced from the NRAS gene GGUUGGAGCAGGUGGUGUUGGGAAAAGCGCACUGACAA (Sequence ID 5) 3. A method for screening compounds that inhibit the transcription or translation of an NRAS gene, comprising the following steps: (1) Contacting a nucleic acid construct obtained by conjugating a reporter gene to an oligonucleotide according to claim 1 or 2 with a test compound; (2) Measuring the expression level of the reporter gene; and (3) Selecting a test compound that reduces the expression level of the reporter gene measured in (2) compared with a control measured in the absence of the test compound.

4. A compound that inhibits the transcription or translation of the NRAS gene obtained by the screening method described in claim 3.

5. A cancer treatment agent containing the compound described in claim 4 as an active ingredient.