Mirna site blocking antisense oligonucleotide regulators of MECP2 expression

WO2026183266A1PCT designated stage Publication Date: 2026-09-03LOYOLA UNIV OF CHICAGO
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2026/016727
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-02-27
Filing Date
2026-02-26
Publication Date
2026-09-03

Smart Images

  • Figure US2026016727_03092026_PF_FP_ABST
    Figure US2026016727_03092026_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure features useful compositions and methods to treat diseases or disorders associated with expression, including reduced expression, of methyl CpG binding protein 2 (MeCP2). In some embodiments, antisense oligonucleotides are provided that bind to certain portions of the 3'UTR of MeCP2 mRNA.
Need to check novelty before this filing date? Find Prior Art

Description

Docket No. 27013 / 70816 / PCmiRNA SITE BLOCKING ANTISENSE OLIGONUCLEOTIDE REGULATORS OF MeCP2 EXPRESSION INCORPORATION BY REFERENCE OF MATERIALS SUBMITTED ELECTRONICALLY

[0001] This application contains, as a separate part of the disclosure, a Sequence Listing in computer readable form (Filename: 70816_SeqListing.xml; Size: 16,818 bytes; Created: February 25, 2026), which is incorporated by reference in its entirety.BACKGROUND

[0002] Rett syndrome (RTT) is a debilitating neurodevelopmental disorder that affects approximately 1 in 10,000 female live births. In 1999, researchers identified de novo loss-of-function mutations in the methyl CpG binding protein 2 (MECP2) gene as the cause of RTT (Amir et al. 1999). It is now estimated that these mutations account for -95% of classic RTT cases. Over two decades of intensive research has led to an improved understanding of how MeCP2 functions in health and disease; however, therapeutic advancements have been minimal, with existing treatments primarily focused on alleviating symptoms and improving quality of life.

[0003] In rodent models, the absence of Mecp2 mimics the phenotypes of RTT in humans, including acquired microcephaly, apneas, seizures, impaired sociability, cognitive deficits, and hindlimb clasping, which parallel the hand stereotypies seen in humans. (Chen et al. 2001; Guy et al. 2001). Restoring Mecp2 levels in these models has been shown to reverse many of these symptoms, even in advanced disease stages (Guy et al. 2007;Luikenhuis et al. 2004; Garg et al. 2013). These findings support the widely accepted theory that, despite its myriad of challenges, RTT is reversible. As a result, normalizing MeCP2 expression in the brain has become the primary therapeutic goal.

[0004] Several strategies to restore MeCP2 expression are currently under development. These include genome editing, base editing, RNA editing, and MECP2 delivery platforms such as gene therapy, protein replacement, and mRNA therapy (Carrette et al. 2018; Sinnett et al. 2021, 2017; Grimm and Lee 2022; Flynn et al. 2024; Luoni et al. 2020; Gadalla et al. 2013; Bijlani et al. 2024). However, many of these approaches are complicated by the precise dosage requirements of MeCP2, as both insufficient and excessive levels can cause severe neurological phenotypes. For example, even a modest 1x overexpression can lead to MeCP2 duplication syndrome (MDS), which is characterized by intellectual disability, motor dysfunction, and autistic features (Collins and Neul 2022; Collins et al. 2004; D'Mello III 2021). This narrow therapeutic window requires innovative approaches to safely and effectively elevate levels of the protein. Additionally, while genome editing therapies hold promise for treating RTT by correcting MECP2 mutations, they are difficult to implement across the entire brain and carry the risk of permanent adverse effects associated with off-target indels. These challenges highlight the need for alternative strategies that allow for more controlled modulation of MeCP2 expression.

[0005] A critical discrepancy between preclinical and clinical RTT is the routine use of the Mecp2 knockout (KO) allele in mice. While informative for basic science research, this model presents significant challenges in translating findings to clinical applications. Many of the most common patient mutations either render key functional domains hypomorphic or are late-truncating, allowing for partial activity to be retained. Eight MeCP2Docket No. 27013 / 70816 / PCmutations account for 70% of all RTT cases, with five (R106W, R133C, T158M, R294X, R306C) believed to maintain partial functionality (Neul et al. 2008; Frullanti et al. 2019). The level of function retained by each mutant form of the protein is predictive of clinical outcomes. Missense or late truncating mutations such as R133C, T158M, R294X, and R306C are associated with milder phenotypes compared to early truncating mutations like R168X and R255X (Rodrigues et al. 2020; McGowan and Pang 2015). The preserved functionality of these mutations raises the possibility that increasing levels of the mutant protein could be exploited therapeutically. This potential was demonstrated in experiments showing that a Mecp2-T158M mutant transgene was able to rescue RTT-like phenotypes in Mecp2T158M / y knock-in mice (Lamonica et al. 2017).

[0006] One mechanism of increasing levels of the mutant MeCP2 protein is through post-transcriptional regulation. The 3' untranslated region (3'UTR) of MECP2 plays a well-defined role in regulating mRNA stability and translation (Rodrigues et al. 2020; McGowan and Pang 2015; Hong and Jeong 2023). MicroRNAs (miRNAs) and RNA binding proteins interact with complementary sequences within the 3'UTR, leading to mRNA degradation or translational inhibition (Shang et al. 2023). For proteins with high dosage sensitivity, these interactions are crucial for sustaining appropriate levels of expression. In RTT, this finely tuned regulatory mechanism maintains homeostatic balance of MeCP2, which is essential for normal neuronal function (Horvath et al. 2022; Cheng et al. 2014; Jauhari et al. 2022).

[0007] There are over 35 predicted miRNA binding sites in MECP2's 3'UTR, often targeted by multiple miRNAs (Rodrigues et al. 2020; McGowan and Pang 2015). Primary mutations in miRNA seed sequences have been reported in patients with RTT and MDS (Santos et al. 2008), underscoring the importance of post-transcriptional regulation. Research has shown that overexpression of miRNAs can reduce MeCP2 protein levels, while mutation in their predicted binding sites results in increased expression (Horvath et al. 2022; Khan et al. 2018; Urdinguio et al. 2010). Importantly, the regulatory effect of each miRNA is modest, creating a ceiling effect on their capacity to elevate MeCP2 levels when disrupted (Shang et al. 2023). There is a need in the art for methods and compositions for preventing miRNA-MECP2 interactions as a viable therapeutic approach to increase MeCP2 dosage while remaining within the narrow safety window of the protein.SUMMARY

[0008] The disclosure provides oligonucleotides, including antisense oligouncleotides, compositions and methods to increase expression of MeCP2. In some embodiments, the target RNA is a mRNA or pre-MRNA.

[0009] In one embodiment, an antisense oligonucleotide capable of binding to a miRNA binding site of a methyl CpG binding protein 2 (MeCP2) pre-mRNA is provided, wherein the miRNA binding site is a miR181 binding site and wherein said antisense oligonucleotide prevents miR181 from repressing expression of MeCP2. In one embodiment, the antisense oligonucleotide comprises the sequence 5' ACAGGTACATTCAGACAGGTTT 3’ (SEQ ID NO: 1).

[0010] In still other embodiments, an antisense oligonucleotide is provided comprising the sequence 5'-GAGCCAACAGCTGCCT-3' (SEQ ID NO: 2), 5'-AGTAACAGTCCTGGTG-3' (SEQ ID NO: 3), or 5'-Docket No. 27013 / 70816 / PCTGTAGACGGGGCACTG-3' (SEQ ID NO: 4). In still other embodiments, an antisense oligonucleotide is provided by the present disclosure comprising a sequence that is at least 80% identical to any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO:4, wherein said oligonucleotide is capable of binding to a miRNA binding site of a methyl CpG binding protein 2 (MeCP2) pre-mRNA, wherein the miRNA binding site is located in the 3' untranslated region (3’UTR) of the MeCP2 pre-mRNA.

[0011] The present disclosure also provides, in one embodiment, an antisense oligonucleotide comprising a sequence that is at least 80% identical to SEQ ID NO: 1, wherein said oligonucleotide is capable of binding to a miRNA181 binding site of a MeCP2 pre-mRNA and wherein said antisense oligonucleotide prevents miR181 from repressing expression of MeCP2.

[0012] In some embodiments, an aforementioned antisense oligonucleotide is at least 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In still other embodiments, the antisense oligonucleotide is sufficiently complementary to a region of a target RNA and is capable of forming a complex with the target RNA. In yet other embodiments, the antisense oligonucleotide is isolated or purified.

[0013] The present disclosure also provides, in other embodiment, an aforementioned antisense oligonucleotide wherein each nucleotide of the oligonucleotide comprises a nucleobase, a sugar, and an internucleotide linkage. In one embodiment, one or more sugars are selected from 2'-methoxy-ribose, 2'-MOE-ribose, 2'-deoxy-2' -fluororibose, 2'-fluoro-arabinose, 2-methoxy-arabinose, 2'deoxyribose and a locked nucleic acid (LNA). In another embodiment, all sugars are 2'-MOE-ribose. In some embodiments of the present disclosure, one or more internucleotide linkages of the oligonucleotide are phosphorothioate or phosphoramidate linkages. In still another embodiment, all internucleotide linkages are phosphorothioate linkages. The present disclosure also provides, in some embodiments, an aforementioned antisense oligonucleotide wherein one or more nucleobases are naturally occurring nucleobases. In some embodiments, one or more nucleobases are modified nucleobases selected from isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil, 5-thiazolo-uracil, 2-thio-uracil, pseudouracil, 1-methylpseudouracil, 5-methoxyuracil, 2'-thio-thymine, hypoxanthine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine. In still another embodiment, the antisense oligonucleotide has a GalNAc moiety at the 5' end. In another embodiment, the antisense oligonucleotide has a GalNAc moiety at the 3' end.

[0014] According to another embodiment of the present disclosure, an aforementioned antisense oligonucleotide is provided wherein all sugars are 2'-MOE-ribose and all internucleotide linkages are phosphorothioate linkages. In one embodiment, an antisense oligonucleotide is provided comprising the sequence 5' ACAGGTACATTCAGACAGGTTT 3' (SEQ ID NO: 1), wherein all sugars are 2'-MOE-ribose and all internucleotide linkages are phosphorothioate linkages. In still other embodiments, an antisense oligonucleotide is provided comprising the sequence set out in SEQ ID NO: 2, 3, or 4, wherein all nucleobases are locked nucleic acids (LNAs) and all internucleotide linkages are phosphorothioate linkages.Docket No. 27013 / 70816 / PC

[0015] In still other embodiments, an aforementioned antisense oligonucleotide is provided wherein the antisense oligonucleotide has a half-life of at least 6 months in a subject.

[0016] Compositions, including pharmaceutically acceptable compositions are also provided by the present disclosure. In one embodiment, a pharmaceutical composition is provided comprising an aforementioned antisense oligonucleotide, or 2 or more antisense oligonucleotide, and a pharmaceutically acceptable excipient, carrier and / or diluents. In one embodiment, a pharmaceutical composition is provided comprising an aforementioned antisense oligonucleotide, or 2 or more antisense oligonucleotide, comprising phosphate buffered saline (PBS) and / or an artificial cerebrospinal fluid (CSF) solution.

[0017] In still another embodiment, an aforementioned pharmaceutical composition is provided, wherein the antisense oligonucleotide is formulated in a liposome or a lipid nanoparticle (LNP).

[0018] A kit to treat or ameliorate the effects of a disease associated with reduced MeCP2 expression in a subject is also provided by the present disclosure, the kit comprising at least one aforementioned antisense oligonucleotide, packaged in a suitable container, together with instructions for its use. In another embodiment, a kit to treat or ameliorate the effects of a disease associated with reduced MeCP2 expression in a subject is provided, the kit comprising at least one aforementioned antisense oligonucleotide, packaged in a suitable container, together with instructions for its use, wherein the disease is selected from Rett syndrome (RTT), Pitt Hopkins Syndrome, CDKL5-deficiency disorder, Alzheimer's disease, Parkinson's disease, idiopathic autism, and cancer. In one embodiment, the disease is RTT.

[0019] Methods of treating a disease, or ameliorating one or more symptoms associated with a disease or disorder, are provided by the present disclosure. Methods of increasing expression of MeCP2 are also provided. In one embodiment, the present disclosure provides a method of increasing expression of MeCP2, said method comprising administering an aforementioned antisense oligonucleotide or an aforementioned composition to a subject in need thereof.

[0020] In one embodiment, MeCP2 (e.g., present in the subject receiving an aforementioned antisense oligonucleotide) is a wild-type MeCP2 or a mutant MeCP2. In some embodiments, the MeCP2 is a mutant MeCP2 and comprises one or more mutations elected from R106W, R111 G, R133C, R294X, T 158M, R168X, R270X, R255X, and / or R306C.

[0021] A method of treating a disease or disorder associated with reduced expression of MeCP2 is provided by the present disclosure, in one embodiment, the method comprising administering an aforementioned antisense oligonucleotide or an aforementioned composition to a subject in need thereof. In various embodiments, the disease or disorder is selected from Rett syndrome (RTT), Pitt Hopkins Syndrome, CDKL5-deficiency disorder, Alzheimer's disease, Parkinson's disease, idiopathic autism, and cancer. In one embodiment, the disease or disorder is RTT.Docket No. 27013 / 70816 / PC

[0022] Combination therapies are also contemplated by the present disclosure. In some embodiments, an aforementioned method is provided wherein the subject is additionally administered an insulin-like growth factor 1 (IGF-1 ) mimetic, a gene therapy, a protein replacement therapy, a mRNA therapy, or a gene editing therapy. In one embodiment, the subject is administered Trofinetide. In some embodiments, the subject is administered 2 or more antisense oligonucleotides capable of binding to a miRNA binding site of a methyl CpG binding protein 2 (MeCP2) pre-mRNA, wherein the miRNA binding site is located in the 3' untranslated region (3'UTR) of the MeCP2 pre-mRNA. In some embodiments, the miRNA binding site is selected from a miR22, miR132 and a miR483 binding site. In one embodiment, the subject is administered an antisense oligonucleotide comprising the sequence set out in SEQ ID NON, and at least one additional antisense oligonucleotide comprising a sequence set out in SE ID NO: 2, 3 and / or 4.

[0023] In one embodiment of the present disclosure, a method of interfering with miRNAI 81 -associated repression of MeCP2 is provided, said method comprising administering an aforementioned antisense oligonucleotide or an aforementioned composition to a subject in need thereof.BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1: Magnitude of Upregulated DEMs in T158M and R255X.

[0025] Figure 2: Schematic Representation of sbASO-Mediated Disinhibition Approach on MECP23'UTR. Figure 2C includes human and mouse sequences corresponding to sbASO.miR-22 (human - SEQ ID NO: 5, and mouse - SEQ ID NO: 17), sbASO.miR-483 (human - SEQ ID NO: 6 and mouse- SEQ ID NO: 7), sbASO.miR-132 (human - SEQ ID NO: 8, and mouse - SEQ ID NO: 18), target sequences.

[0026] Figure 3: Dose-Dependent Increase of MeCP2 Expression in SH-SY5Y Cells.

[0027] Figure 4: sbASOs Increase Mecp2 Protein Expression and Induce MDS-like Phenotypes in Wild-Type Mice.

[0028] Figure 5: Mutation-Specific sbASO Efficacy in RTT Patient-Derived Human Fibroblast Cells.

[0029] Figure 6: sbASOs Show Efficacy in MECP2-T158M Neural Stem Cells.

[0030] Figure 7: sbASOs Increase Total BDNF Levels in MECP2-T158M Neural Stem Cells.

[0031] Figure 8: Dose response of sb181 in RTT Patient Derived Fibroblast LinesDETAILED DESCRIPTION

[0032] Provided herein are antisense oligonucleotides that can be used to modify the expression of MeCP2. More specifically, the present disclosure provides, in various embodiments, methods and compositions for preventing these miRNA-MECP2 interactions as a viable therapeutic approach to increase MeCP2 dosage while remaining within the narrow safety window of the protein.

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Methods and materialsDocket No. 27013 / 70816 / PCare described herein for use in the present disclosure; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.Definitions

[0034] For convenience, the meaning of some terms and phrases used in the specification, examples, and appended claims are provided below. Unless stated otherwise, or implicit from context, the following terms and phrases include the meanings provided below. The definitions are provided to aid in describing particular embodiments, and are not intended to limit the claimed technology, because the scope of the technology is limited only by the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this technology belongs. If there is an apparent discrepancy between the usage of a term in the art and its definition provided herein, the definition provided within the specification shall prevail.

[0035] In this application, unless otherwise clear from context, (I) the term "a” may be understood to mean "at least one”; (II) the term "or” may be understood to mean "and / or”; and (ill) the terms "including” and "comprising” may be understood to encompass itemized components or steps whether presented by themselves or together with one or more additional components or steps.

[0036] As used herein, the terms "about” and "approximately” refer to a value that is within 10% above or below the value being described.

[0037] The term "at least” prior to a number or series of numbers is understood to include the number adjacent to the term "at least", and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 18 nucleotides of a 21 -nucleotide nucleic acid molecule" means that 18, 19, 20, or 21 nucleotides have the indicated property. When at least is present before a series of numbers or a range, it is understood that "at least" can modify each of the numbers in the series or range.

[0038] As used herein, "no more than” or "less than” is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. For example, an oligonucleotide with "no more than 5 unmodified nucleotides” has 5, 4, 3, 2, 1, or 0 unmodified nucleotides. When "no more than” is present before a series of numbers or a range, it is understood that "no more than” can modify each of the numbers in the series or range.

[0039] As used herein, the term "administration” refers to the administration of a composition (e.g., a compound or a preparation that includes a compound as described herein) to a subject or system.Docket No. 27013 / 70816 / PC

[0040] The term "oligonucleotide” or "antisense oligonucleotide” as used herein, is a molecule including two or more nucleotides. The term "nucleotide” refers to a nucleobase, a sugar moiety, and an internucleotide linkage. Oligonucleotides are commonly made in the laboratory by solid-phase chemical synthesis followed by purification. When referring to a sequence of the oligonucleotide, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides. The oligonucleotide described herein may be man-made, and is chemically synthesized, and is typically purified or isolated. Oligonucleotide is also intended to include (I) compounds that have one or more furanose moieties that are replaced by furanose derivatives or by any structure, cyclic or acyclic, that may be used as a point of covalent attachment for the base moiety, (ii) compounds that have one or more phosphodiester linkages that are either modified, as in the case of phosphoramidate or phosphorothioate linkages, or completely replaced by a suitable linking moiety as in the case of formacetal or riboacetal linkages, and / or (iii) compounds that have one or more linked sugar-phosphodiester linkage moieties replaced by any structure, cyclic or acyclic, that may be used as a point of covalent attachment for the nucleobase moiety. The oligonucleotide described herein may include one or more alternative nucleotides (e.g., including those described herein). It is also understood that oligonucleotide includes compositions lacking a sugar moiety or nucleobase but is still capable of forming a pairing with or hybridizing to a target sequence. Oligonucleotides as used herein comprise 100 or fewer nucleotides.

[0041] The terms "nucleobase” and "base” include the purine (e.g., adenine and guanine) and pyrimidine (e.g. uracil, thymine, and cytosine) moiety present in nucleosides and nucleotides that form hydrogen bonds in nucleic acid hybridization. The term nucleobase also encompasses alternative nucleobases that may differ from naturally-occurring nucleobases but are functional during nucleic acid hybridization. In this context, "nucleobase” refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, as well as alternative nucleobases. Such variants are for example described in Hirao et al (2012) Accounts of Chemical Research vol 45, page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1.

[0042] "G,” "C,” "A,” "T,” and "U” each generally stand for a naturally-occurring nucleotide that contains guanine, cytosine, adenine, thymidine, and uracil as a nucleobase, respectively. However, G, C, A, T and U can also refer to the guanine, cytosine, adenine, thymidine, and uracil nucleobase with a sugar moiety other than ribose (or deoxyribose). Such alternate sugar moieties are discussed herein.

[0043] In a some embodiments, the nucleobase moiety is modified by changing the purine or pyrimidine into a modified purine or pyrimidine, such as substituted purine or substituted pyrimidine, such as an "alternative nucleobase” selected from isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil, 5-thiazolo-uracil, 2-thio-uracil, pseudouracil, 1 -methylpseudouracil, 5-methoxyuracil, 2'-thio-thymine, hypoxanthine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.Docket No. 27013 / 70816 / PC

[0044] The nucleobase moieties may be indicated by the letter code for each corresponding nucleobase, e.g. A, T, G, C, or U, wherein each letter may optionally include alternative nucleobases of equivalent function.

[0045] A "sugar” or "sugar moiety,” includes sugars having a furanose ring (e.g., ribose, deoxyribose, arabinose). A sugar also includes an "alternative sugar,” defined as a structure that is capable of replacing the furanose ring of a nucleoside. In certain embodiments, alternative sugars are non-furanose (or 4'-substituted furanose) rings or ring systems or open systems. Such structures include a six-membered ring (e.g., a pyranose ring), or non-ring moieties such as those used in peptide nucleic acids. Alternative sugars may also include a morpholino, a pyranyl, or hexitol ring system. Sugar moieties useful in the preparation of oligonucleotides having motifs include, without limitation, p-D-ribose, p-D-2'-deoxyribose, methoxy-substituted sugars (e.g., p-D-2'methoxyribose), MOE-substituted sugars (e.g., p-D-2'methoxyethylribose), fluoro substituted sugars (e.g., 2'-deoxy-2-fluororibose and p-D-2'-deoxy-2'-fluoroarabinofurose, also referred to herein as 2'-fluoroarabinose), substituted sugars (such as 2', 5' and bis substituted sugars), 4'-S-sugars (such as 4'-S-ribose, 4-S-2'-deoxyribose and 4'-S-2'-substituted ribose), bicyclic alternative sugars (such as locked nucleic acid (LNA) having a 2'-O— CH2-4' or 2'-O— (CH2)2-4' bridged ribose derived bicyclic sugar) and sugar surrogates (such as when the ribose ring has been replaced with a morpholino, a pyran, or a hexitol ring system, such as a p-D-homoDNA). A p-D-homoDNA sugar moiety is a pyran ring substituted as shown in this structure (where N is the nucleobase):

[0046] The internucleotide linkage of the nucleotide can be a phosphate linkage. Other internucleotide linkages are known in the art, including, but not limited to, phosphorothioate or boronophosphate. Other internucleotide linkages include phosphotriester, phosphorothionate, phosphoramidate, and other variants of the phosphate backbone.

[0047] The term "nucleoside” refers to a monomeric unit of an oligonucleotide or a polynucleotide having a nucleobase and a sugar moiety.

[0048] The oligonucleotide may be of any length that permits binding to a desired target - e.g., to a miRNA binding site in the 3'UTR of MeCP2, and may range from about 15-50 nucleotides in length. Ranges intermediate to the above recited ranges are also contemplated to be part of the oligonucleotides described herein.

[0049] As used herein, and unless otherwise indicated, the term "complementary," when used to describe a first nucleotide or nucleoside sequence in relation to a second nucleotide or nucleoside sequence, refers to the ability of an oligonucleotide or polynucleotide including the first nucleotide or nucleoside sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide including the second nucleotide sequence, as will be understood by the skilled person. Such conditions can, for example, beDocket No. 27013 / 70816 / PCstringent conditions, where stringent conditions can include: 400 mM NaCI, 40 mM PIPES pH 6.4, 1 mM EDTA, 50 °C, or 70 °C, for 12-16 hours followed by washing (see, e.g., "Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides or nucleosides.

[0050] "Complementary” sequences, as used herein, can also include, or be formed entirely from, non-Watson-Crick base pairs and / or base pairs formed from non-natural and alternative nucleotides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairing.

[0051] As used herein, the term "region of complementarity" refers to the region on the oligonucleotide that is substantially complementary to all or a portion of a gene, primary transcript, a sequence (e.g., a target sequence; e.g., a target sequence having a target nucleobase, e.g., adenosine), or pre-mRNA or processed mRNA, so as to modify the expression of the endogenous gene.

[0052] The phrase "contacting a cell with an oligonucleotide," such as an antisense oligonucleotide as described herein, includes contacting a cell by any possible means. Contacting a cell with an oligonucleotide includes contacting a cell in vitro with the oligonucleotide or contacting a cell in vivo with the oligonucleotide. The contacting may be done directly or indirectly. Thus, for example, the oligonucleotide may be put into physical contact with the cell by the individual performing the method, or alternatively, the oligonucleotide agent may be put into a situation that will permit or cause it to subsequently come into contact with the cell.

[0053] In one embodiment, contacting a cell with an oligonucleotide includes "introducing" or "delivering the oligonucleotide into the cell" by facilitating or effecting uptake or absorption into the cell. Absorption or uptake of an oligonucleotide can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. Introducing an oligonucleotide into a cell may be in vitro and / or in vivo. For example, for in vivo introduction, oligonucleotide s can be injected into a tissue site or administered systemically. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below and / or are known in the art.

[0054] As used herein, "lipid nanoparticle" or "LNP" is a vesicle including a lipid layer encapsulating a pharmaceutically active molecule, such as a nucleic acid molecule, e.g., an oligonucleotide. LNP refers to a stable nucleic acid-lipid particle. LNPs typically contain a cationic, ionizable lipid, a non-cationic lipid, and a lipid that prevents aggregation of the particle (e.g., a PEG-lipid conjugate). LNPs are described in, for example, U.S. Pat. Nos. 6,858,225; 6,815,432; 8,158,601; and 8,058,069, the entire contents of which are hereby incorporated herein by reference.

[0055] As used herein, the term "liposome" refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer, e.g., one bilayer or a plurality of bilayers. Liposomes include unilamellar and multilamellarDocket No. 27013 / 70816 / PCvesicles that have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the oligonucleotide composition. The lipophilic material isolates the aqueous interior from an aqueous exterior, which typically does not include the oligonucleotide composition, although in some examples, it may. Liposomes also include "sterically stabilized" liposomes, a term which, as used herein, refers to liposomes including one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids.

[0056] "Micelles" are defined herein as a particular type of molecular assembly in which amphipathic molecules are arranged in a spherical structure such that all the hydrophobic portions of the molecules are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The converse arrangement exists if the environment is hydrophobic.

[0057] As used herein, the terms "effective amount,” "therapeutically effective amount,” and "a "sufficient amount” of an agent that results in a therapeutic effect (e.g., in a cell or a subject) described herein refer to a quantity sufficient to, when administered to the subject, including a human, effect beneficial or desired results, including clinical results, and, as such, an "effective amount” or synonym thereto depends on the context in which it is being applied. For example, in the context of treating a disorder, it is an amount of the agent that is sufficient to achieve a treatment response as compared to the response obtained without administration. The amount of a given agent will vary depending upon various factors, such as the given agent, the pharmaceutical formulation, the route of administration, the type of disease or disorder, the identity of the subject (e.g., age, sex, and / or weight) or host being treated, and the like, but can nevertheless be routinely determined by one of skill in the art. Also, as used herein, a "therapeutically effective amount” of an agent is an amount that results in a beneficial or desired result in a subject as compared to a control. As defined herein, a therapeutically effective amount of an agent may be readily determined by one of ordinary skill by routine methods known in the art. Dosage regimen may be adjusted to provide the optimum therapeutic response.

[0058] A "therapeutically-effective amount” includes an amount (either administered in a single or in multiple doses) of an oligonucleotide that produces some desired local or systemic effect at a reasonable benefit / risk ratio applicable to any treatment. Oligonucleotides employed in the methods as disclosed herein may be administered in a sufficient amount to produce a reasonable benefit / risk ratio applicable to such treatment.

[0059] By "determining the level of a protein” is meant the detection of a protein, or an mRNA encoding the protein, by methods known in the art either directly or indirectly. "Directly determining” means performing a process (e.g., performing an assay or test on a sample or "analyzing a sample” as that term is defined herein) to obtain the physical entity or value. "Indirectly determining” refers to receiving the physical entity or value from another party or source (e.g., a third-party laboratory that directly acquired the physical entity or value). Methods to measure protein level generally include, but are not limited to, western blotting, immunoblotting, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), immunoprecipitation, immunofluorescence, surface plasmon resonance, chemiluminescence, fluorescent polarization, phosphorescence, immunohistochemicalDocket No. 27013 / 70816 / PCanalysis, matrix-assisted laser desorption / ionization time-of-flight (MALDI-TOF) mass spectrometry, liquid chromatography (LC)-mass spectrometry, microcytometry, microscopy, fluorescence activated cell sorting (FACS), and flow cytometry, as well as assays based on a property of a protein including, but not limited to, enzymatic activity or interaction with other protein partners. Methods to measure mRNA levels are known in the art.

[0060] "Percent (%) sequence identity” with respect to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleotides or amino acids in a candidate sequence that are identical to the nucleotides or amino acids in the reference polynucleotide or polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For example, percent sequence identity values may be generated using the sequence comparison computer program BLAST. As an illustration, the percent sequence identity of a given sequence, A, to, with, or against a given sequence, B, (which can alternatively be phrased as a given sequence, A that has a certain percent sequence identity to, with, or against a given sequence, B) is calculated as follows:100 multiplied by (the fraction X / Y)where X is the number of nucleotides or amino acids scored as identical matches by a sequence alignment program (e.g., BLAST) in that program's alignment of A and B, and where Y is the total number of nucleotides or amino acids in B. It will be appreciated that where the length of sequence A is not equal to the length of sequence B, the percent sequence identity of A to B will not equal the percent sequence identity of B to A.

[0061] By "level” is meant a level or activity of a protein, or mRNA encoding the protein, as compared to a reference. The reference can be any useful reference, as defined herein. By a "decreased level” or an "increased level” of a protein is meant a decrease or increase in protein level, as compared to a reference (e.g., a decrease or an increase by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 150%, about 200%, about 300%, about 400%, about 500%, or more; a decrease or an increase of more than about 10%, about 15%, about 20%, about 50%, about 75%, about 100%, or about 200%, as compared to a reference; a decrease or an increase by less than about 0.01 -fold, about 0.02-fold, about 0.1 -fold, about 0.3-fold, about 0.5-fold, about 0.8-fold, or less; or an increase by more than about 1.2-fold, about 1.4-fold, about 1.5-fold, about 1.8-fold, about 2.0-fold, about 3.0-fold, about 3.5-fold, about 4.5-fold, about 5.0-fold, about 10-fold, about 15-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold, about 100-fold, about 1000-fold, or more). A level of a protein may be expressed in mass / vol (e.g., g / dL, mg / mL, pg / mL, ng / mL) or percentage relative to total protein or mRNA in a sample.Docket No. 27013 / 70816 / PC

[0062] The term "pharmaceutical composition,” as used herein, represents a composition containing a compound described herein formulated with a pharmaceutically acceptable excipient, and preferably manufactured or sold with the approval of a governmental regulatory agency as part of a therapeutic regimen for the treatment of disease in a mammal. Pharmaceutical compositions can be formulated, for example, for oral administration in unit dosage form (e.g., a tablet, capsule, caplet, gelcap, or syrup); for topical administration (e.g., as a cream, gel, lotion, or ointment); for intravenous administration (e.g., as a sterile solution free of particulate emboli and in a solvent system suitable for intravenous use); for intrathecal injection; for intracerebroventricular injections; for intraparenchymal injection; or in any other pharmaceutically acceptable formulation.

[0063] A "pharmaceutically acceptable excipient,” as used herein, refers any ingredient other than the compounds described herein (for example, a vehicle capable of suspending or dissolving the active compound) and having the properties of being substantially nontoxic and non-inflammatory in a patient. Excipients may include, for example: antiadherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, flavors, fragrances, glidants (flow enhancers), lubricants, preservatives, printing inks, sorbents, suspensing or dispersing agents, sweeteners, and waters of hydration. Exemplary excipients include, but are not limited to: butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, crosslinked polyvinyl pyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methyl paraben, microcrystalline cellulose, polyethylene glycol, polyvinyl pyrrolidone, povidone, pregelatinized starch, propyl paraben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethyl cellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol.

[0064] As used herein, the term "pharmaceutically acceptable salt” means any pharmaceutically acceptable salt of an oligonucleotide as described herein. For example, pharmaceutically acceptable salts include those that are within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and animals without undue toxicity, irritation, allergic response and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, pharmaceutically acceptable salts are described in: Berge et al., J. Pharmaceutical Sciences 66:1-19, 1977 and in Pharmaceutical Salts: Properties, Selection, and Use, (Eds. P.H. Stahl and C.G. Wermuth), Wiley-VCH, 2008. The salts can be prepared in situ during the final isolation and purification of the compounds described herein or separately by reacting a free base group with a suitable organic acid.

[0065] Pharmaceutically acceptable salts may be acid addition salts involving inorganic or organic acids or the salts maybe prepared from inorganic or organic bases. Frequently, pharmaceutically acceptable salts are prepared as addition products of pharmaceutically acceptable acids or bases. Suitable pharmaceutically acceptable acids and bases and methods for preparation of the appropriate salts are well-known in the art. SaltsDocket No. 27013 / 70816 / PCmay be prepared from pharmaceutically acceptable non-toxic acids and bases including inorganic and organic acids and bases. Representative acid addition salts include acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, and valerate salts. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, and magnesium, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, and ethylamine.

[0066] By a "reference” is meant any useful reference used to compare protein or mRNA or pre-mRNA levels or activity. The reference can be any sample, standard, standard curve, or level that is used for comparison purposes. The reference can be a normal reference sample or a reference standard or level. A "reference sample” can be, for example, a control, e.g., a predetermined negative control value such as a "normal control” or a prior sample taken from the same subject; a sample from a normal healthy subject, such as a normal cell or normal tissue; a sample (e.g., a cell or tissue) from a subject not having a disease; a sample from a subject that is diagnosed with a disease, but not yet treated with a compound described herein; a sample from a subject that has been treated by a compound described herein; or a sample of a purified protein (e.g., any described herein) at a known normal concentration. By "reference standard or level” is meant a value or number derived from a reference sample. A "normal control value” is a pre-determined value indicative of non-disease state, e.g., a value expected in a healthy control subject. Typically, a normal control value is expressed as a range ("between X and Y”), a high threshold ("no higher than X”), or a low threshold ("no lower than X”). A subject having a measured value within the normal control value for a particular biomarker is typically referred to as "within normal limits” for that biomarker. A normal reference standard or level can be a value or number derived from a normal subject not having a disease or disorder; a subject that has been treated with a compound described herein. In preferred embodiments, the reference sample, standard, or level is matched to the sample subject sample by at least one of the following criteria: age, weight, sex, disease stage, and overall health. A standard curve of levels of a purified protein, e.g., any described herein, within the normal reference range can also be used as a reference.

[0067] As used herein, the term "subject” refers to any organism to which a composition in accordance with the disclosure may be administered, e.g., for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include any animal (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans). A subject may seek or be in need of treatment, require treatment, be receiving treatment, be receivingDocket No. 27013 / 70816 / PCtreatment in the future, or be a human or animal who is under care by a trained professional for a particular disease or condition.

[0068] As used herein, the terms "treat," "treated," or "treating" mean both therapeutic treatment and prophylactic or preventative measures wherein the object is to prevent or slow down (lessen) an undesired physiological condition, disorder, or disease, or obtain beneficial or desired clinical results. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of the extent of a condition, disorder, or disease; stabilized (i.e., not worsening) state of condition, disorder, or disease; delay in onset or slowing of condition, disorder, or disease progression; amelioration of the condition, disorder, or disease state or remission (whether partial or total), whether detectable or undetectable; an amelioration of at least one measurable physical parameter, not necessarily discernible by the patient; or enhancement or improvement of condition, disorder, or disease. Treatment includes eliciting a clinically significant response without excessive levels of side effects. Treatment also includes prolonging survival as compared to expected survival if not receiving treatment.

[0069] As used herein, the terms "variant” and "derivative” are used interchangeably and refer to naturally-occurring, synthetic, and semi-synthetic analogues of a compound, peptide, protein, or other substance described herein. A variant or derivative of a compound, peptide, protein, or other substance described herein may retain or improve upon the biological activity of the original material.

[0070] The details of one or more embodiments described herein are set forth in the description below. Other features, objects, and advantages described herein will be apparent from the description and from the claims.

[0071] I. MeCP2 and MeCP2-Associated Disorders

[0072] The MeCP2 (methyl-CpG binding protein 2) gene is located on the X chromosome and encodes a protein that plays a crucial role in brain development and function. MeCP2 is part of a family of methyl-CpG-binding domain proteins (MBD), but possesses its own unique differences which help set it apart from the group. It has two functional domains: a methyl-cytosine-binding domain (MBD) composed of 85 amino acids; and a transcriptional repression domain (TRD) composed of 104 amino acids. The MBD domain forms a wedge and attaches to the methylated CpG sites on the DNA strands. The TRD region then reacts with SIN3A to recruit histone deacetylases (HDAC). There are also unusual, repetitive sequences found at the carboxyl terminus. This region is closely related to the fork head family, at the amino acid level.

[0073] The role of MeCP2 in disease is primarily associated with either a loss of function (under expression) of the MeCP2 gene as in Rett syndrome or in a gain of function (over expression) as in MeCP2 duplication syndrome. As described further herein, many mutations have been associated with loss of expression of the MeCP2 gene and have been identified in Rett syndrome patients. These mutations include changes in single DNA base pairs (SNP), insertions or deletions of DNA in the MeCP2 gene, and changes that affect how the gene information is processed into a protein (RNA splicing). Mutations in the gene alter the structure of the MeCP2 protein or lead to reduced amounts of the protein. As a result, the protein is unable to bind to DNA or turn otherDocket No. 27013 / 70816 / PCgenes on or off. Genes that are normally repressed by MeCP2 remain active when their products are not needed. Other genes that are normally activated by MeCP2 remain inactive leading to a lack of gene product. This defect probably disrupts the normal functioning of nerve cells, leading to the signs and symptoms of Rett syndrome.

[0074] Rett syndrome is mainly found in girls with a prevalence of around 1 in every 10,000; male fetuses with normal karyotypes afflicted with this condition rarely survive to term and if so, usually die shortly after birth. Patients are born with very hard to find signs of a disorder, but after about six months to a year and half, speech and motor function capabilities start to decrease. This is followed by seizures, growth retardation and cognitive and motor impairment. The MeCP2 locus is X-linked and the disease-causing alleles are dominant. Due to its prevalence in females, it has been linked to male lethality, or to a predominant transmission with the paternal X chromosome; nevertheless, in rare cases some males can also be affected by Rett syndrome. Males with gene duplications of MeCP2 at the Xq28 locus are also at risk for recurrent infections & meningitis in infancy.

[0075] Mutations in the MeCP2 gene have also been identified in people with several other disorders affecting the central nervous system. For example, MeCP2 mutations are associated with some cases of moderate to severe X-linked mental retardation. Mutations in the gene have also been found in males with severe brain dysfunction (neonatal encephalopathy) who live only into early childhood. In addition, several people with features of both Rett syndrome and Angelman syndrome (a condition characterized by mental retardation, problems with movement, and inappropriate laughter and excitability) have mutations in the MeCP2 gene. Lastly, MeCP2 mutations or changes in the gene's activity have been reported in some cases of autism (a developmental disorder that affects communication and social interaction).

[0076] More recent studies reported genetic polymorphisms in the MeCP2 gene in patients with systemic lupus erythematosus (SLE). SLE is a systemic autoimmune disease that can affect multiple organs. MeCP2 polymorphisms have been reported so far in European-derived and Asian lupus patients.

[0077] The genetic loss of MECP2 has been identified as changing the properties of cells in the locus ceruleus, the exclusive source of noradrenergic innervation to the cerebral cortex and hippocampus.

[0078] As described herein, the methods and compositions, including the antisense oligonucleotides provided herein, are useful for ameliorating one or more symptoms of, or treating a disease or disorder associated with expression of MeCP2, including but not limited to Rett syndrome (RTT), Pitt Hopkins Syndrome, CDKL5-deficiency disorder, Alzheimer's disease, Parkinson's disease, idiopathic autism, and cancer, as well as a disorder mentioned above / herein.

[0079] Treatment may be performed in a subject of any age, starting from infancy to adulthood. Subjects may begin treatment, for example, at birth, six months, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, or 18 years of age.Docket No. 27013 / 70816 / PC

[0080] In certain embodiments, the oligonucleotide increases (e.g., an increase by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 400%, 500%, 600%. 700%, 800%, 900%, 1000% or more, or an increase by more than 1.2-fold, 1.4-fold, 1.5-fold, 1.8-fold, 2.0-fold, 3.0-fold, 3.5-fold, 4.5-fold, 5.0-fold, 10-fold, 15-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold, 1000-fold, or more) protein expression (e.g., MeCP2 expression) or protein activity in vitro and / or in vivo.II. Oligonucleotides

[0081] The present disclosure provides antisense oligonucleotides useful in modifying the expression of MeCP2. Exemplary oligonucleotide sequences and target sites / regions are provided below and described further herein. As described herein, in some embodiments the present disclosure provides antisense oligonucleotides that block the binding miRNA to miRNA binding sites, so-called sbASOs or site-blocking antisense oligonucleotides.

[0082] As described herein, the ASOs may be modified to increase stability and half-life. For example, in one embodiment, sb181 includes all phosphorothioate and 2'-MOE modifications. In other embodiments, sb22, sb132 and sb483 are fully phosphorothioate modified and locked nucleic acid are made to all bases.

[0083] Micro RNAs miR181, miR22, miR132 and miR483 are known in the art and are short noncoding RNAs that repress translation or induce cleavage of their target mRNAs with which they interact. As described herein, each of these micro RNAs bind to a region (binding site) in the MeCP23' UTR. The present disclosure provides antisense oligonucleotides that prevent one or more of these micro RNAs from binding to their binding sites in the MeCP23’ UTR.

[0084] miR181 RNA sequence: (SEQ ID NO: 9): AACAUUCAACGCUGUCGGUGAGU

[0085] miR181 binding site sequence on MeCP2 pre-mRNA (SEQ ID NO: 10):AAACCTGTCTGAATGTACCTGT

[0086] miR22 RNA sequence: (SEQ ID NO: 11): UGUCAAGAAGUUGACCGUCGAA

[0087] miR22 binding site sequence on MeCP2 pre-mRNA (SEQ ID NO: 12):AACAAGAAUAAAGGCAGCUGUUGUCDocket No. 27013 / 70816 / PC

[0088] miR132 RNA sequence: (SEQ ID NO: 13): GCUGGUACCGACAUCUGACAAU

[0089] miR132 binding site sequence on MeCP2 pre-mRNA (SEQ ID NO: 14):CCAGGACUGUUACUCAAUGUGUGCCGAG

[0090] miR483 RNA sequence: (SEQ ID NO: 15): GAGGGAAGAAAGGAGGGCAGAA

[0091] miR483 binding site sequence on MeCP2 pre-mRNA (SEQ ID NO: 16):GUGCCCCGUCUACAGCUCCCC

[0092] In some embodiments, one or more of the nucleobases of an oligonucleotide described herein is chemically modified to enhance stability or other beneficial characteristics. Without being bound by theory, it is believed that certain modification can increase nuclease resistance and / or serum stability or decrease immunogenicity. For example, oligonucleotides described herein may contain nucleotides found to occur naturally in DNA or RNA (e.g., adenine, thymidine, guanosine, cytidine, uridine, or inosine) or may contain nucleotides that have one or more chemical modifications to one or more components of the nucleotide (e.g., the nucleobase, sugar, or internucleotide linkage).

[0093] In some embodiments, the internucleotide linkage is a phosphoroamidate, phosphorothioate, phosphorodithioate, methylphosphonate, thiophosphate, 3'-thiophosphate, or 5' -thiophosphate.

[0094] In some embodiments, the internucleotide linkages of the oligonucleotides described herein comprise at least 30% (e.g., at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%) phosphoramidate and / or phosphorothioate linkages. In some embodiments, the oligonucleotides described herein have 30-70% (e.g., 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%) phosphorothioate and phosphoroamidate linkages. In some embodiments, the oligonucleotides described herein have 40-60% (e.g., 40%, 45%, 50%, 55%, 60%) phosphorothioate and phosphoroamidate linkages.

[0095] In some embodiments, 100% of the internucleotide linkages are phosphorothioate linkages.

[0096] In some embodiments, the oligonucleotides described herein may further include a 5' cap structure. In some embodiments, the 5' cap structure is a 2,2,7-trimethylguanosine cap.

[0097] In some embodiments the oligonucleotides described herein include a GalNAc moiety at the 5' end of the oligonucleotide. In some embodiments the oligonucleotides described herein include a GalNAc moiety at the 3' end of the oligonucleotide.

[0098] Oligonucleotides described herein can be synthesized by standard methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc.

[0099] The oligonucleotide can be prepared using solution-phase or solid-phase organic synthesis or both. Organic synthesis offers the advantage that the oligonucleotide including unnatural or alternative nucleotides canDocket No. 27013 / 70816 / PCbe easily prepared. Single-stranded oligonucleotides described herein can be prepared using solution-phase or solid-phase organic synthesis or both.

[0100] It is contemplated that for any sequence identified herein, further optimization could be achieved by systematically either adding or removing linked nucleosides to generate longer or shorter sequences. Such optimized sequences can be adjusted by, e.g., the introduction of alternative nucleosides, alternative sugar moieties, and / or alternative internucleotide linkages as described herein or as known in the art, including alternative nucleosides, alternative sugar moieties, and / or alternative internucleotide linkages as known in the art and / or discussed herein to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, targeting to a particular location or cell type, and / or increasing interaction with target sequences.

[0101] The oligonucleotides described herein may be synthesized and / or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Inc., New York, N.Y., USA, which is hereby incorporated herein by reference. Representative U.S. patents that teach the preparation of the oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,564; 5,405,938;5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, the entire contents of each of which are hereby incorporated herein by reference.

[0102] Some embodiments include oligonucleotides with phosphorothioate backbones, and / or oligonucleotides with heteroatom backbones, and in particular -CH2-NH-CH2-, -CH2-N(CH3)-O-CH2-[known as a methylene (methylimino) or MMI backbone], -CH2-O-N(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2- and -N(CH3)-CH2-CH2-[wherein the native phosphodiester backbone is represented as -O-P-O-CH2-] of the above-referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above-referenced U.S. Pat. No. 5,602,240. In some embodiments, the oligonucleotides featured herein have morpholino backbone structures of the abovereferenced U.S. Pat. No. 5,034,506. In some embodiments, the oligonucleotides described herein include phosphorodiamidate morpholino oligomers (PMO), in which the deoxyribose moiety is replaced by a morpholine ring, and the charged phosphodiester inter-subunit linkage is replaced by an uncharged phophorodiamidate linkage, as described in Summerton, et al., Antisense Nucleic Acid Drug Dev. 1997, 7:63-70.

[0103] Various modifications can be introduced to a sugar and / or nucleobase in accordance with the present disclosure. For example, in some embodiments, a modification is a modification described in US 9006198. In some embodiments, a modification is a modification described in US 9394333, US 9744183, US 9605019, US 9982257, US 20170037399, US 20180216108, US 20180216107, US 9598458, WO 2017 / 062862, WO 2018 / 067973, WO 2017 / 160741, WO 2017 / 192679, WO 2017 / 210647, WO 2018 / 098264, WO 2018 / 022473, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 032612, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784, WO 2019 / 032612,Docket No. 27013 / 70816 / PCWO 2020 / 191252, and / or WO 2021 / 071858, the sugars, bases, and internucleotide linkages of each of which are independently incorporated herein by reference.

[0104] Alternative nucleotides and nucleosides include those with modifications including, for example, end modifications, e.g., 5'-end modifications (phosphorylation, conjugation, inverted linkages) or 3'-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.); base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g., at the 2'-position or 4'-position) or replacement of the sugar; and / or backbone modifications, including modification or replacement of the phosphodiester linkages. The nucleobase may also be an isonucleoside in which the nucleobase is moved from the C1 position of the sugar moiety to a different position (e.g. C2, C3, C4, or C5). Specific examples of oligonucleotide compounds useful in the embodiments described herein include but are not limited to alternative nucleosides containing modified backbones or no natural internucleotide linkages. Nucleotides and nucleosides having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, alternative RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In some embodiments, an oligonucleotide will have a phosphorus atom in its internucleoside backbone.

[0105] Alternative internucleotide linkages include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boronophosphates having normal 3'-5' linkages, 2'-5'-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts, and free acid forms are also included.

[0106] Representative U.S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209; 6,239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and U.S. Pat. RE39464, the entire contents of each of which are hereby incorporated herein by reference.

[0107] Alternative internucleotide linkages that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleotide linkages, mixed heteroatoms and alkyl or cycloalkyl internucleotide linkages, or one or more short chain heteroatomic or heterocyclic internucleotide linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methyleneDocket No. 27013 / 70816 / PCformacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, 0, S, and CH2 component parts.

[0108] Representative U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and, 5,677,439, the entire contents of each of which are hereby incorporated herein by reference.

[0109] In other embodiments, suitable oligonucleotides include those in which both the sugar and the internucleotide linkage, i.e., the backbone, of the nucleotide units are replaced. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, a mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar of a nucleoside is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are hereby incorporated herein by reference. Additional PNA compounds suitable for use in the oligonucleotides described herein are disclosed in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

[0110] Alternative nucleosides and nucleotides can also contain one or more substituted sugar moieties. The oligonucleotides, e.g., oligonucleotides, featured herein can include one of the following at the 2'-position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted Ci to C10 alkyl or C2 to C10 alkenyl and alkynyl. Exemplary suitable modifications include -O[(CH2)nO]mCH3, -O(CH2)nOCH3, -O(CH2)n-NH2, -O(CH2)nCH3, -O(CH2)n-ONH2, and -O(CH2)n-ON[(CH2)nCH3]2, where n and m are from 1 to about 10. In other embodiments, oligonucleotides include one of the following at the 2' position: Ci to C10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkary I or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. In some embodiments, the modification includes a 2'-methoxyethoxy (2'-O-CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-O-MOE) (Martin et al., Helv. Chin. Acta, 1995, 78:486-504) i.e., an alkoxyalkoxy group. 2'-O-MOE nucleosides confer several beneficial properties to oligonucleotides including, but not limited to, increased nuclease resistance, improved pharmacokinetics properties, reduced non-specific protein binding, reduced toxicity, reduced immunostimulatory properties, and enhanced target affinity as compared to unmodified oligonucleotides.Docket No. 27013 / 70816 / PC

[0111] Another exemplary alternative contains 2'-dimethylaminooxyethoxy, i.e., a -O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-(CH2)2-O-(CH2)2-N(CH3)2. Further exemplary alternatives include: 5'-Me-2'-F nucleotides, 5'-Me-2'-OMe nucleotides, 5'-Me-2'-deoxynucleotides, (both R and S isomers in these three families); 2'-alkoxyalkyl; and 2'-NMA (N-methylacetamide).

[0112] Other alternatives include 2'-methoxy (2'-OCH3), 2'-aminopropoxy ^'-OCF CF CF NF ) and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the nucleosides and nucleotides of an oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligonucleotides can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of which are commonly owned with the instant application. The entire contents of each of the foregoing are hereby incorporated herein by reference.

[0113] Oligonucleotides described herein can also include nucleobase (often referred to in the art simply as "base") alternatives (e.g., modifications or substitutions). Unmodified or natural nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).Alternative nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine, 5-hydroxymethylcytosine, 5-formylcytosine, 5-carboxycytosine, pyrrolocytosine, dideoxycytosine, uracil, 5-methoxyuracil, 5-hydroxydeoxyuracil, dihydrouracil, 4-thiouracil, pseudouracil, 1-methyl-pseudouracil, deoxyuracil, 5-hydroxybutynl-2' -deoxyuracil, xanthine, hypoxanthine, 7-deaza-xanthine, thienoguanine, 8-aza-7-deazaguanine, 7-methylguanine, 7-deazaguanine, 6-aminomethyl-7-deazaguanine, 8-aminoguanine, 2,2,7-trimethylguanine, 8-methyladenine, 8-azidoadenine, 7-methyladenine, 7-deazaadenine, 3-deazaadenine, 2,6-diaminopurine, 2-aminopurine, 7-deaza-8-aza-adenine, 8-amino-adenine, thymine, dideoxythymine, 5-nitroindole, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 8-azaguanine and 8-azaadenine, and 3-deazaguanine. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., (1991) Angewandte Chemie, International Edition, 30:613, and those disclosed by Sanghvi, Y S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., ORC Press, 1993. Certain of these nucleobases are particularlyDocket No. 27013 / 70816 / PCuseful for increasing the binding affinity of the oligomeric compounds described herein. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications.

[0114] Representative U.S. patents that teach the preparation of certain of the above noted alternative nucleobases as well as other alternative nucleobases include, but are not limited to, the above noted U.S. Pat. Nos. 3,687,808, 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255;5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are hereby incorporated herein by reference.

[0115] In other embodiments, the sugar moiety in the nucleotide may be a ribose molecule, optionally having a 2'-O-methyl, 2’-O-MOE, 2'-F, 2'-amino, 2'-O-propyl, 2'-aminopropyl, or 2’ -OH modification.

[0116] In some embodiments, oligonucleotides described herein include one or more bicyclic sugar moieties. A "bicyclic sugar" is a furanosyl ring modified by the bridging of two atoms. A "bicyclic nucleoside" ("BNA") is a nucleoside having a sugar moiety including a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4'-carbon and the 2'-carbon of the sugar ring. Thus, in some embodiments, oligonucleotides described herein may include one or more locked nucleosides. A locked nucleoside is a nucleoside having a modified ribose moiety in which the ribose moiety includes an extra bridge connecting the 2' and 4' carbons. In other words, a locked nucleoside is a nucleoside including a bicyclic sugar moiety including a 4-CH2-O-2' bridge. This structure effectively "locks" the ribose in the 3'-endo structural conformation. The addition of locked nucleosides to oligonucleotides has been shown to increase oligonucleotide stability in serum, and to reduce off-target effects (Grunweller, A. et al., (2003) Nucleic Acids Research 31 (12):3185-3193). Examples of bicyclic nucleosides include without limitation nucleosides including a bridge between the 4' and the 2' ribosyl ring atoms. In certain embodiments, oligonucleotides include one or more bicyclic nucleosides including a 4' to 2' bridge. Examples of such 4' to 2' bridged bicyclic nucleosides, include but are not limited to 4'-(CH2)-O-2' (LNA); 4'-(CH2)-S-2'; 4'-(CH2)2-O-2' (ENA); 4'-CH(CH3)-O-2' (also referred to as "constrained ethyl" or "cEt") and 4'-CH(CH2OCH3)-O-2' (and analogs thereof; see, e.g., U.S. Pat. No. 7,399,845); 4'-C(CH3)(CH3)-O-2' (and analogs thereof; see e.g., U.S. Pat. No. 8,278,283); 4'-CH2-N(OCH3)-2' (and analogs thereof; see e.g., U.S. Pat. No. 8,278,425); 4'-CH2-O-N(CH3)2-2' (see, e.g., U.S. Patent Publication No. 2004 / 0171570); 4'-CH2-N(R)-O-2', wherein R is H, Ci-Ci2alkyl, or a protecting group (see, e.g., U.S. Pat. No. 7,427,672); 4'-CH2-C(H)(CH3)-2' (see, e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, US-134); and 4'-CH2-C(=CH2)-2' (and analogs thereof; see, e.g., U.S. Pat. No. 8,278,426). The entire contents of each of the foregoing are hereby incorporated herein by reference.Docket No. 27013 / 70816 / PC

[0117] Additional representative U.S. Patents and US Patent Publications that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U.S. Pat. Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133; 7,084,125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US 2008 / 0039618; and US 2009 / 0012281, the entire contents of each of which are hereby incorporated herein by reference.

[0118] Any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example o-L-ribofuranose and p-D-ribofuranose (see WO 99 / 14226).

[0119] Oligonucleotides described herein can also be modified to include one or more constrained ethyl nucleotides. As used herein, a "constrained ethyl nucleotide" or "cEt" is a locked nucleic acid including a bicyclic sugar moiety including a 4'-CH(CH3)-O-2' bridge. In one embodiment, a constrained ethyl nucleotide is in the S conformation referred to herein as "S-cEt."

[0120] Oligonucleotides described herein may also include one or more "conformationally restricted nucleotides" ("CRN"). CRN are nucleotide analogs with a linker connecting the C2' and C4' carbons of ribose or the C3 and -C5' carbons of ribose. CRN lock the ribose ring into a stable conformation and increase the hybridization affinity to mRNA. The linker is of sufficient length to place the oxygen in an optimal position for stability and affinity resulting in less ribose ring puckering.

[0121] Representative publications that teach the preparation of certain of the above noted CRN include, but are not limited to, US Patent Publication No. 2013 / 0190383; and PCT publication WO 2013 / 036868, the entire contents of each of which are hereby incorporated herein by reference.

[0122] In some embodiments, the oligonucleotides described herein include one or more monomers that are UNA (unlocked nucleic acid) nucleotides. UNA is unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked "sugar" residue. In one example, UNA also encompasses monomer with bonds between CT-C4' have been removed (i.e. the covalent carbon-oxygen-carbon bond between the CT and C4' carbons). In another example, the C2'-C3' bond (i.e. the covalent carbon-carbon bond between the C2' and C3' carbons) of the sugar has been removed (see Nuc. Acids Symp. Series, 52, 133-134 (2008) and Fluiter et al., Mol. Biosyst., 2009, 10, 1039 hereby incorporated by reference).

[0123] Representative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S. Pat. No. 8,314,227; and US Patent Publication Nos. 2013 / 0096289; 2013 / 0011922; and 2011 / 0313020, the entire contents of each of which are hereby incorporated herein by reference.

[0124] The ribose molecule may also be modified with a cyclopropane ring to produce a tricyclodeoxynucleic acid (tricyclo DNA). The ribose moiety may be substituted for another sugar such as 1 ,5,-anhydrohexitol, threose to produce a threose nucleoside (TNA), or arabinose to produce an arabino nucleoside. The ribose molecule can also be replaced with non-sugars such as cyclohexene to produce cyclohexene nucleoside or glycol to produce glycol nucleosides.Docket No. 27013 / 70816 / PC

[0125] The ribose molecule can also be replaced with non-sugars such as cyclohexene to produce cyclohexene nucleic acid (CeNA) or glycol to produce glycol nucleic acids (GNA). Potentially stabilizing modifications to the ends of nucleotide molecules can include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-O-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3"-phosphate, inverted base dT(idT) and others. Disclosure of this modification can be found in PCT Publication No. WO 2011 / 005861.

[0126] Other alternatives chemistries of the oligonucleotides described herein include a 5' phosphate or 5' phosphate mimic, e.g., a 5'-terminal phosphate or phosphate mimic of an oligonucleotide. Suitable phosphate mimics are disclosed in, for example US Patent Publication No. 2012 / 0157511, the entire contents of which are incorporated herein by reference.

[0127] Exemplary oligonucleotides described herein include sugar-modified nucleosides and may also include DNA or RNA nucleosides. In some embodiments, the oligonucleotide includes sugar-modified nucleosides and DNA nucleosides. Incorporation of alternative nucleosides into the oligonucleotides described herein may enhance the affinity of the oligonucleotide for the target nucleic acid. In that case, the alternative nucleosides can be referred to as affinity enhancing alternative nucleotides.

[0128] In some embodiments, the oligonucleotides described herein includes at least 1 alternative nucleoside, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least I I, at least 12, at least 13, at least 14, at least 15 or at least 16 alternative nucleosides. In other embodiments, the oligonucleotides include from 1 to 10 alternative nucleosides, such as from 2 to 9 alternative nucleosides, such as from 3 to 8 alternative nucleosides, such as from 4 to 7 alternative nucleosides, such as 6 or 7 alternative nucleosides. In an embodiment, the oligonucleotides described herein may include alternatives, which are independently selected from these three types of alternative (alternative sugar moiety, alternative nucleobase, and alternative internucleotide linkage), or a combination thereof. Preferably the oligonucleotide includes one or more nucleosides including alternative sugar moieties, e.g., 2' sugar alternative nucleosides. In some embodiments, the oligonucleotides described herein include the one or more 2' sugar alternative nucleoside independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, ANA, 2'-fluoro-ANA, and BNA (e.g., LNA) nucleosides. In some embodiments, the one or more alternative nucleoside is a BNA.III. Pharmaceutical Uses

[0129] The antisense oligonucleotides described herein may be used to treat any disorder associated with MeCP2 expression, including expression of MeCP2 mutants. Levels of MeCP2 mRNA of MeCP2 protein can be determined using known techniques.

[0130] The level of mRNA of a gene of interest, e.g., MeCP2, that is expressed by a cell or group of cells may be determined using any method known in the art for assessing mRNA expression. In one embodiment, theDocket No. 27013 / 70816 / PClevel of expression of MeCP2in a sample is determined by detecting a transcribed polynucleotide, or portion thereof, e.g., mRNA of MeCP2. RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol / guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNEASY™ RNA preparation kits (Qiagen) or PAXgene (PreAnalytix, Switzerland). Typical assay formats utilizing ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays, northern blotting, in situ hybridization, and microarray analysis. Circulating mRNA of MeCP2may be detected using methods the described in PCT Publication WC2012 / 177906, the entire contents of which are hereby incorporated herein by reference. In some embodiments, the level of expression of MeCP2is determined using a nucleic acid probe. The term "probe," as used herein, refers to any molecule that is capable of selectively binding to a specific sequence, e.g. to an mRNA or polypeptide. Probes can be synthesized by one of skill in the art, or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.

[0131] Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or northern analyses, polymerase chain reaction (PGR) analyses, and probe arrays. One method for the determination of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to the mRNA of MeCP2. In one embodiment, the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in an AFFYMETRIX gene chip array. A skilled artisan can readily adapt known mRNA detection methods for use in determining the level of mRNA of a gene of interest.

[0132] An alternative method for determining the level of expression of MeCP2in a sample involves the process of nucleic acid amplification and / or reverse transcriptase (to prepare cDNA) of for example mRNA in the sample, e.g., by RT-PCR (the experimental embodiment set forth in Mullis, 1987, U.S. Pat. No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193), self-sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86: 1173-1177), Q-Beta Replicase (Lizardi et al. (1988) Bio / Technology 6:1197), rolling circle replication (Lizardi et al., U.S. Pat. No. 5,854,033) or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers. In some embodiments, the level of expression of MeCP2 is determined by quantitative fluorogenic RT-PCR (i.e., the TAQMAN™ System) or the DUAL-GLO® Luciferase assay.

[0133] The expression levels of mRNA of MeCP2 may be monitored using a membrane blot (such as used in hybridization analysis such as northern, Southern, dot, and the like), or microwells, sample tubes, gels, beads or fibers (or any solid support including bound nucleic acids). See U.S. Pat. Nos. 5,770,722; 5,874,219; 5,744,305;Docket No. 27013 / 70816 / PC5,677,195; and 5,445,934, which are incorporated herein by reference. The determination of gene expression level may also include using nucleic acid probes in solution.

[0134] In some embodiments, the level of mRNA expression is assessed using branched DNA (bDNA) assays or real time PCR (qPCR). The use of this PCR method is described and exemplified in the Examples presented herein. Such methods can also be used for the detection of nucleic acids of MeCP2.

[0135] The level of protein produced by the expression of MeCP2 may be determined using any method known in the art for the measurement of protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, fluid or gel precipitin reactions, absorption spectroscopy, a colorimetric assays, spectrophotometric assays, flow cytometry, immunodiffusion (single or double), Immunoelectrophoresis, western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, electrochemiluminescence assays, and the like. Such assays can also be used for the detection of proteins indicative of the presence or replication of proteins produced by the gene of interest. Additionally, the above assays may be used to report a change in the mRNA sequence of interest that results in the recovery or change in protein function thereby providing a therapeutic effect and benefit to the subject, treating a disorder in a subject, and / or reducing of symptoms of a disorder in the subject.Delivery of Oligonucleotides

[0136] The delivery of oligonucleotides described herein to a cell e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as a subject having a disorder like Rett syndrome) can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with an oligonucleotide described herein either ex vivo, in vitro or in vivo. In vivo delivery may also be performed directly by administering a composition including an oligonucleotide to a subject. Alternatively, in vivo delivery may be performed indirectly by administering one or more vectors that encode and direct the expression of the oligonucleotide. Combinations of in vitro and in vivo methods of contacting a cell are also possible. Contacting a cell may be direct or indirect, as discussed above. Furthermore, contacting a cell may be accomplished via a targeting ligand, including any ligand described herein or known in the art. In some embodiments, the targeting ligand is a carbohydrate moiety, e.g., a GalNAcs ligand, or any other ligand that directs the oligonucleotide to a site of interest. Cells can include those of the central nervous system, or muscle cells.

[0137] Contacting of a cell with an oligonucleotide may be done in vitro or in vivo. For in vivo delivery, factors to consider in order to deliver an oligonucleotide molecule include, for example, biological stability of the delivered molecule, prevention of non-specific effects, and accumulation of the delivered molecule in the target tissue. The non-specific effects of an oligonucleotide can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically administering the preparation. Local administration to a treatment site maximizes local concentration of the agent, limits the exposure of the agent to systemic tissuesDocket No. 27013 / 70816 / PCthat can otherwise be harmed by the agent or that can degrade the agent, and permits a lower total dose of the oligonucleotide molecule to be administered.

[0138] For administering an oligonucleotide systemically for the treatment of a disease, the oligonucleotide can include alternative nucleobases, alternative sugar moieties, and / or alternative internucleotide linkages, or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the oligonucleotide by endo- and exo-nucleases in vivo. Modification of the oligonucleotide or the pharmaceutical carrier can also permit targeting of the oligonucleotide composition to the target tissue and avoid undesirable off-target effects. Oligonucleotide molecules can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. In an alternative embodiment, the oligonucleotide can be delivered using drug delivery systems such as a nanoparticle, a lipid nanoparticle, a polyplex nanoparticle, a lipoplex nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system. Positively charged cationic delivery systems facilitate binding of an oligonucleotide molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an oligonucleotide by the cell. Cationic lipids, dendrimers, or polymers can either be bound to an oligonucleotide, or induced to form a vesicle or micelle that encases an oligonucleotide. The formation of vesicles or micelles further prevents degradation of the oligonucleotide when administered systemically. In general, any methods of delivery of nucleic acids known in the art may be adaptable to the delivery of the oligonucleotides described herein. Methods for making and administering cationic oligonucleotide complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, D R., et al. (2003) J. Mol. Biol 327:761-766; Verma, U N. et al., (2003) Clin. Cancer Res. 9:1291-1300; Arnold, A S et al., (2007) J. Hypertens. 25:197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems useful for systemic delivery of oligonucleotides include DOTAP (Sorensen, D R., et al (2003), supra; Verma, U N. et al., (2003), supra), Oligofectamine, "solid nucleic acid lipid particles" (Zimmermann, T S. et al., (2006) Nature 441:111-114), cardiolipin (Chien, P Y. et al., (2005) Cancer Gene Ther. 12:321-328; Pal, A. et al., (2005) Int J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet M E. et al., (2008) Pharm. Res. Aug 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, D A. et al., (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H. et al., (1999) Pharm. Res.16:1799-1804). In some embodiments, an oligonucleotide forms a complex with cyclodextrin for systemic administration. Methods for administration and pharmaceutical compositions of oligonucleotides and cyclodextrins can be found in U.S. Pat. No. 7,427,605, which is herein incorporated by reference in its entirety. In some embodiments the oligonucleotides described herein are delivered by polyplex or lipoplex nanoparticles. Methods for administration and pharmaceutical compositions of oligonucleotides and polyplex nanoparticles and lipoplex nanoparticles can be found in U.S. Patent Application Nos. 2017 / 0121454;2016 / 0369269; 2016 / 0279256; 2016 / 0251478; 2016 / 0230189; 2015 / 0335764; 2015 / 0307554; 2015 / 0174549; 2014 / 0342003; 2014 / 0135376; and 2013 / 0317086, which are herein incorporated by reference in their entirety.

[0139] I. Membranous Molecular Assembly Delivery MethodsDocket No. 27013 / 70816 / PC

[0140] Oligonucleotides described herein can also be delivered using a variety of membranous molecular assembly delivery methods including polymeric, biodegradable microparticle, or microcapsule delivery devices known in the art. For example, a colloidal dispersion system may be used for targeted delivery an oligonucleotide agent described herein. Colloidal dispersion systems include macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. Liposomes are artificial membrane vesicles that are useful as delivery vehicles in vitro and in vivo. It has been shown that large unilamellar vesicles (LUV), which range in size from 0.2-4.0 m can encapsulate a substantial percentage of an aqueous buffer containing large macromolecules. Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomal bilayer fuses with bilayer of the cellular membranes. As the merging of the liposome and cell progresses, the internal aqueous contents that include the oligonucleotide are delivered into the cell where the oligonucleotide can specifically bind to a target RNA and can mediate RNase H-mediated gene silencing. In some cases, the liposomes are also specifically targeted, e.g., to direct the oligonucleotide to particular cell types. The composition of the liposome is usually a combination of phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used. The physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations.

[0141] A liposome containing an oligonucleotide can be prepared by a variety of methods. In one example, the lipid component of a liposome is dissolved in a detergent so that micelles are formed with the lipid component. For example, the lipid component can be an amphipathic cationic lipid or lipid conjugate. The detergent can have a high critical micelle concentration and may be nonionic. Exemplary detergents include cholate, CHAPS, octylglucoside, deoxycholate, and lauroyl sarcosine. The oligonucleotide preparation is then added to the micelles that include the lipid component. The cationic groups on the lipid interact with the oligonucleotide and condense around the oligonucleotide to form a liposome. After condensation, the detergent is removed, e.g., by dialysis, to yield a liposomal preparation of oligonucleotide.

[0142] If necessary, a carrier compound that assists in condensation can be added during the condensation reaction, e.g., by controlled addition. For example, the carrier compound can be a polymer other than a nucleic acid (e.g., spermine or spermidine). The pH can also be adjusted to favor condensation.

[0143] Methods for producing stable oligonucleotide delivery vehicles, incorporating a oligonucleotide / cationic lipid complex as a structural component of the delivery vehicle, are further described in, e.g., WO 96 / 37194, the entire contents of which are incorporated herein by reference. Liposome formation can also include one or more aspects of exemplary methods described in Feigner, P. L. et al., (1987) Proc. Natl. Acad. Sci. USA 8:7413-7417; U.S. Pat. No. 4,897,355; U.S. Pat. No. 5,171,678; Bangham et al., (1965) M. Mol. Biol. 23:238; Olson et al., (1979) Biochim. Biophys. Acta 557:9; Szoka et al., (1978) Proc. Natl. Acad. Sci. 75: 4194; Mayhew et al., (1984) Biochim. Biophys. Acta 775:169; Kim et al., (1983) Biochim. Biophys. Acta 728:339; and Fukunaga et al., (1984) Endocrinol. 115:757. Commonly used techniques for preparing lipid aggregates of appropriate size for use asDocket No. 27013 / 70816 / PCdelivery vehicles include sonication and freeze-thaw plus extrusion (see, e.g., Mayer et al., (1986) Biochim. Biophys. Acta 858:161. Microfluidization can be used when consistently small (50 to 200 nm) and relatively uniform aggregates are desired (Mayhew et al., (1984) Biochim. Biophys. Acta 775:169. These methods are readily adapted to packaging oligonucleotide preparations into liposomes.

[0144] Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged nucleic acid molecules to form a stable complex. The positively charged nucleic acid / liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al. (1987) Biochem. Biophys. Res. Commun., 147:980-985).

[0145] Liposomes entrap nucleic acids rather than complex with them. Since both the nucleic acid and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some nucleic acid is entrapped within the aqueous interior of these liposomes. pH sensitive liposomes have been used to deliver nucleic acids encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al. (1992) Journal of Controlled Release, 19:269-274).

[0146] One major type of liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid and / or phosphatidylcholine and / or cholesterol.

[0147] Examples of other methods to introduce liposomes into cells in vitro and in vivo include U.S. Pat. No.5,283,185; U.S. Pat. No. 5,171,678; WO 94 / 00569; WO 93 / 24640; WO 91 / 16024; Feigner, (1994) J. Biol. Chem.269:2550; Nabel, (1993) Proc. Natl. Acad. Sci. 90:11307; Nabel, (1992) Human Gene Ther. 3:649; Gershon, (1993) Biochem. 32:7143; and Strauss, (1992) EMBO J. 11:417.

[0148] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems including non-ionic surfactant and cholesterol. Non-ionic liposomal formulations including NOVASOME™ I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and NOVASOME™ II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporine A into different layers of the skin (Hu et al., (1994) S.T.P. Pharma. Sci., 4(6):466).

[0149] Liposomes may also be sterically stabilized liposomes, including one or more specialized lipids that result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) includes one or more glycolipids, such as monosialoganglioside GMI, or (B) is derivatized with one or moreDocket No. 27013 / 70816 / PChydrophilic polymers, such as a polyethylene glycol (PEG) moiety. While not wishing to be bound by any particular theory, it is thought in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes derives from a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., (1987) FEBS Letters, 223:42; Wu et al., (1993) Cancer Research, 53:3765).

[0150] Various liposomes including one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci., (1987), 507:64) reported the ability of monosialoganglio side GM1, galactocerebroside sulfate, and phosphatidylinositol to improve blood half-lives of liposomes. These findings were expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A., (1988), 85:6949). U.S. Pat. No. 4,837,028 and WO 88 / 04924, both to Allen et al., disclose liposomes including (1) sphingomyelin and (2) the ganglioside GMI or a galactocerebroside sulfate ester. U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes including sphingomyelin. Liposomes including 1 ,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97 / 13499 (Lim et al).

[0151] In one embodiment, cationic liposomes are used. Cationic liposomes possess the advantage of being able to fuse to the cell membrane. Non-cationic liposomes, although not able to fuse as efficiently with the plasma membrane, are taken up by macrophages in vivo and can be used to deliver oligonucleotides to macrophages.

[0152] Further advantages of liposomes include: liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated oligonucleotides in their internal compartments from metabolism and degradation (Rosoff, in "Pharmaceutical Dosage Forms," Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.

[0153] A positively charged synthetic cationic lipid, N-[1 -(2,3-dioleyloxy)propyl]-N, N, N-trimethylammonium chloride (DOTMA) can be used to form small liposomes that interact spontaneously with nucleic acid to form lipid-nucleic acid complexes which are capable of fusing with the negatively charged lipids of the cell membranes of tissue culture cells, resulting in delivery of oligonucleotides (see, e.g., Feigner, P. L. et al., (1987) Proc. Natl. Acad. Sci. USA 8:7413-7417, and U.S. Pat. No. 4,897,355 for a description of DOTMA and its use with DNA).

[0154] A DOTMA analogue, 1,2-bis(oleoyloxy)-3-(trimethylammonia)propane (DOTAP) can be used in combination with a phospholipid to form DNA-complexing vesicles. LI POFECTI N™ Bethesda Research Laboratories, Gaithersburg, Md.) is an effective agent for the delivery of highly anionic nucleic acids into living tissue culture cells that include positively charged DOTMA liposomes which interact spontaneously with negatively charged polynucleotides to form complexes. When enough positively charged liposomes are used, the net charge on the resulting complexes is also positive. Positively charged complexes prepared in this way spontaneously attach to negatively charged cell surfaces, fuse with the plasma membrane, and efficiently deliverDocket No. 27013 / 70816 / PCfunctional nucleic acids into, for example, tissue culture cells. Another commercially available cationic lipid, 1,2-bis(oleoyloxy)-3,3-(trimethylammonia)propane ("DOTAP") (Boehringer Mannheim, Indianapolis, Ind.) differs from DOTMA in that the oleoyl moieties are linked by ester, rather than ether linkages.

[0155] Other reported cationic lipid compounds include those that have been conjugated to a variety of moieties including, for example, carboxyspermine which has been conjugated to one of two types of lipids and includes compounds such as 5-carboxyspermylglycine dioctaoleoylamide ("DOGS") (TRANSFECTAM™, Promega, Madison, Wis.) and dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide ("DPPES") (see, e.g., U.S. Pat. No. 5,171,678).

[0156] Another cationic lipid conjugate includes derivatization of the lipid with cholesterol ("DC-Chol") which has been formulated into liposomes in combination with DOPE (See, Gao, X. and Huang, L, (1991) Biochim. Biophys. Res. Commun. 179:280). Lipopolylysine, made by conjugating polylysine to DOPE, has been reported to be effective for transfection in the presence of serum (Zhou, X. et al., (1991) Biochim. Biophys. Acta 1065:8). For certain cell lines, these liposomes containing conjugated cationic lipids, are said to exhibit lower toxicity and provide more efficient transfection than the DOTMA-containing compositions. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, Calif.) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, Md.). Other cationic lipids suitable for the delivery of oligonucleotides are described in WO 98 / 39359 and WO 96 / 37194.

[0157] Liposomal formulations are particularly suited for topical administration, liposomes present several advantages over other formulations. Such advantages include reduced side effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer oligonucleotides into the skin. In some implementations, liposomes are used for delivering oligonucleotides to epidermal cells and also to enhance the penetration of oligonucleotides into dermal tissues, e.g., into skin. For example, the liposomes can be applied topically. Topical delivery of drugs formulated as liposomes to the skin has been documented (see, e.g., Weiner et al., (1992) Journal of Drug Targeting, vol.2,405-410 and du Plessis et al., (1992) Antiviral Research, 18:259-265; Mannino, R. J. and Fould-Fogerite, S., (1998) Biotechniques 6:682-690; Itani, T. et al., (1987) Gene 56:267-276; Nicolau, C. et al. (1987) Meth.Enzymol. 149:157-176; Straubinger, R. M. and Papahadjopoulos, D. (1983) Meth. Enzymol. 101:512-527; Wang, C. Y. and Huang, L, (1987) Proc. Natl. Acad. Sci. USA 84:7851-7855).

[0158] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems including non-ionic surfactant and cholesterol. Non-ionic liposomal formulations including Novasome I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and Novasome II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether) were used to deliver a drug into the dermis of mouse skin. Such formulations with oligonucleotide are useful for treating a dermatological disorder.

[0159] The targeting of liposomes is also possible based on, for example, organ-specificity, cell-specificity, and organelle-specificity and is known in the art. In the case of a liposomal targeted delivery system, lipid groupsDocket No. 27013 / 70816 / PCcan be incorporated into the lipid bilayer of the liposome in order to maintain the targeting ligand in stable association with the liposomal bilayer. Various linking groups can be used for joining the lipid chains to the targeting ligand. Additional methods are known in the art and are described, for example in U.S. Patent Application Publication No. 20060058255, the linking groups of which are herein incorporated by reference.

[0160] Liposomes that include oligonucleotides can be made highly deformable. Such deformability can enable the liposomes to penetrate through pore that are smaller than the average radius of the liposome. For example, transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes can be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet.Transfersomes can be made by adding surface edge activators, usually surfactants, to a standard liposomal composition. Transfersomes that include oligonucleotides can be delivered, for example, subcutaneously by infection in order to deliver oligonucleotides to keratinocytes in the skin. In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. In addition, due to the lipid properties, these transfersomes can be selfoptimizing (adaptive to the shape of pores, e.g., in the skin), self-repairing, and can frequently reach their targets without fragmenting, and often self-loading. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.

[0161] Other formulations amenable to the disclosed oligonucleotides and methods are described in WO 2009 / 086558, and WO 2009 / 088891. WO 2008 / 042973 also describes formulations that are amenable to the present oligonucleotides and methods.

[0162] Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile / lipophile balance (HLB). The nature of the hydrophilic group (also known as the "head") provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

[0163] If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general, their HLB values range from 2 to about 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated / propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.Docket No. 27013 / 70816 / PC

[0164] If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are the alkyl sulfates and the soaps.

[0165] If the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.

[0166] If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines, and phosphatides.

[0167] The use of surfactants in drug products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

[0168] The oligonucleotide for use in the methods described herein can also be provided as micellar formulations. Micelles are a particular type of molecular assembly in which amphipathic molecules are arranged in a spherical structure such that all the hydrophobic portions of the molecules are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The converse arrangement exists if the environment is hydrophobic.

[0169] ii. Lipid Nanoparticle-Based Delivery Methods

[0170] Oligonucleotides described herein may be fully encapsulated in a lipid formulation, e.g., a lipid nanoparticle (LNP), or other nucleic acid-lipid particle. LNPs are extremely useful for systemic applications, as they exhibit extended circulation lifetimes following intravenous (i.v.) injection and accumulate at distal sites (e.g., sites physically separated from the administration site). LNPs include "pSPLP," which include an encapsulated condensing agent-nucleic acid complex as set forth in PCT Publication No. WO 00 / 03683. The particles of the present disclosure typically have a mean diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 70 nm to about 90 nm, and are substantially nontoxic. In addition, the nucleic acids when present in the nucleic acid-lipid particles are resistant in aqueous solution to degradation with a nuclease. Nucleic acid-lipid particles and their method of preparation are disclosed in, e.g., U.S. Pat. Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; U.S. Publication No. 2010 / 0324120 and PCT Publication No. WO 96 / 40964.

[0171] In one embodiment, the lipid to drug ratio (mass / mass ratio) (e.g., lipid to oligonucleotide ratio) will be in the range of from about 1:1 to about 50:1, from about 1:1 to about 25:1, from about 3:1 to about 15:1, from about 4: 1 to about 10:1, from about 5: 1 to about 9: 1 , or about 6: 1 to about 9:1. Ranges intermediate to the above recited ranges are also contemplated to be part described herein.Docket No. 27013 / 70816 / PC

[0172] Non-limiting examples of cationic lipid include N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N- (l-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N- (l-(2,3-dioleyloxy)propyl)-N, N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1 ,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1 ,2-Dilinolenyloxy-N.N-dimethylaminopropane (DLenDMA), 1,2-Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1.2-Dilinoleyoxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1 ,2-Dilinoleyoxy-3-morpholinopropane (DLin-MA), 1 ,2-Dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1 ,2-Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1 ,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.CI), 1 ,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.CI), 1 ,2-Dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N,N-Dilinoleylamino)-1 ,2-propanediol (DLinAP), 3-(N,N-Dioleylamino)-1 ,2-propanedio (DOAP), 1 ,2-Dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 1 ,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or analogs thereof, (3aR,5s,6aS)-N, N-dimethyl- 2.2-di((9Z, 12Z)-octadeca-9, 12-dienyetetrahydro— 3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl4-(dimethylamino)bu- tanoate (MC3), 1 , 1'-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)ami- no)ethyl)piperazin-1-yeethylazanediyedidodecan-2-ol (Tech G1), or a mixture thereof. The cationic lipid can include, for example, from about 20 mol % to about 50 mol % or about 40 mol % of the total lipid present in the particle.

[0173] The ionizable / non-cationic lipid can be an anionic lipid or a neutral lipid including, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPO), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1 -carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1 -trans PE, 1 -stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), cholesterol, or a mixture thereof. The non-cationic lipid can be, for example, from about 5 mol % to about 90 mol %, about 10 mol %, or about 58 mol % if cholesterol is included, of the total lipid present in the particle.

[0174] The conjugated lipid that inhibits aggregation of particles can be, for example, a polyethyleneglycol (PEG)-lipid including, without limitation, a PEG-diacylglycerol (DAG), a PEG-dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide (Ger), or a mixture thereof. The PEG-DAA conjugate can be, for example, a PEG-dilauryloxypropyl (Ci?), a PEG-dimyristyloxypropyl (Ci4), a PEG-dipalmityloxypropyl (Cie), or a PEG-disteary loxy propyl (C]s). The conjugated lipid that prevents aggregation of particles can be, for example, from 0 mol % to about 20 mol % or about 2 mol % of the total lipid present in the particle.

[0175] In some embodiments, the nucleic acid-lipid particle further includes cholesterol at, e.g., about 10 mol % to about 60 mol % or about 50 mol % of the total lipid present in the particle.Docket No. 27013 / 70816 / PCIV. Pharmaceutical Compositions

[0176] The oligonucleotides described herein are preferably formulated into pharmaceutical compositions for administration to human subjects in a biologically compatible form suitable for administration in vivo.

[0177] The oligonucleotides described herein may be administered, for example, by oral, parenteral, intrathecal, intracerebroventricular, intraparenchymal, buccal, sublingual, nasal, rectal, patch, pump, intratumoral, or transdermal administration and the pharmaceutical compositions formulated accordingly. Parenteral administration includes intravenous, intraperitoneal, subcutaneous, intramuscular, transepithelial, nasal, intrapulmonary, intrathecal, intracerebroventricular, intraparenchymal, rectal, and topical modes of administration. Parenteral administration may be by continuous infusion over a selected period of time.

[0178] An oligonucleotide described herein may be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or it may be enclosed in hard- or soft-shell gelatin capsules, or it may be compressed into tablets, or it may be incorporated directly with the food of the diet. For oral therapeutic administration, an oligonucleotide described herein may be incorporated with an excipient and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, and wafers. An oligonucleotide described herein may also be administered parenterally. Solutions of an oligonucleotide described herein can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, DMSO, and mixtures thereof with or without alcohol, and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms. Conventional procedures and ingredients for the selection and preparation of suitable formulations are described, for example, in Remington's Pharmaceutical Sciences (2012, 22nd ed.) and in The United States Pharmacopeia: The National Formulary (USP 41 NF 36), published in 2018. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that may be easily administered via syringe. Compositions for nasal administration may conveniently be formulated as aerosols, drops, gels, and powders. Aerosol formulations typically include a solution or fine suspension of the active substance in a physiologically acceptable aqueous or non-aqueous solvent and are usually presented in single or multidose quantities in sterile form in a sealed container, which can take the form of a cartridge or refill for use with an atomizing device. Alternatively, the sealed container may be a unitary dispensing device, such as a single dose nasal inhaler or an aerosol dispenser fitted with a metering valve which is intended for disposal after use. Where the dosage form includes an aerosol dispenser, it will contain a propellant, which can be a compressed gas, such as compressed air or an organic propellant, such as fluorochlorohydrocarbon. The aerosol dosage forms can also take the form of a pump-atomizer. Compositions suitable for buccal or sublingual administration include tablets, lozenges, and pastilles, where the active ingredient is formulated with a carrier, such as sugar, acacia, tragacanth, gelatin, and glycerine. Compositions for rectal administration are conveniently in the form of suppositories containing a conventional suppository base, such as cocoa butter. An oligonucleotide described herein may be administeredDocket No. 27013 / 70816 / PCi ntratumorally , for example, as an intratumoral injection. Intratumoral injection is injection directly into the tumor vasculature and is specifically contemplated for discrete, solid, accessible tumors. Local, regional, or systemic administration also may be appropriate.

[0179] The oligonucleotides described herein may be administered to an animal, e.g., a human, alone or in combination with pharmaceutically acceptable carriers, as noted herein, the proportion of which is determined by the solubility and chemical nature of the oligonucleotide, chosen route of administration, and standard pharmaceutical practice.V. Dosages

[0180] The dosage of the compositions (e.g., a composition including an oligonucleotide) described herein, can vary depending on many factors, such as the pharmacodynamic properties of the compound; the mode of administration; the age, health, and weight of the recipient; the nature and extent of the symptoms; the frequency of the treatment, and the type of concurrent treatment, if any; and the clearance rate of the compound in the animal to be treated. One of skill in the art can determine the appropriate dosage based on the above factors. The compositions described herein may be administered initially in a suitable dosage that may be adjusted as required, depending on the clinical response. In some embodiments, the dosage of a composition (e.g., a composition including an oligonucleotide) is a prophylactically or a therapeutically effective amount.VI. Kit

[0181] Provided herein are kits including (a) a pharmaceutical composition including an oligonucleotide that results in deamination of an adenosine in an mRNA in a cell or subject described herein, and (b) a package insert with instructions to perform any of the methods described herein. In some embodiments, the kit includes (a) a pharmaceutical composition including an oligonucleotide that results in deamination of an adenosine in an mRNA in a cell or subject described herein, (b) an additional therapeutic agent, and (c) a package insert with instructions to perform any of the methods described herein.EXAMPLES

[0182] Example 1: Site-Blocking Antisense Oligonucleotides as a Mechanism to Fine-Tune MeCP2 Expression

[0183] Rett syndrome (RTT) is a neurodevelopmental disorder caused by loss-of-function mutations in the methyl CpG binding protein 2 (MECP2) gene. Despite its severe phenotypes, studies in mouse models suggest that restoring MeCP2 levels can reverse RTT symptomology. Nevertheless, traditional gene therapy approaches are hindered by MeCP2's narrow therapeutic window, complicating the safe delivery of viral constructs without overshooting the threshold for toxicity. The 3' untranslated region (3'UTR) plays a key role in gene regulation, where factors like miRNAs bind to pre-mRNA and fine-tune expression. Given that each miRNA's contribution is modest, blocking miRNA binding may represent a potential therapeutic strategy for diseases with high dosage sensitivity, like RTT. The Example presents a series of site-blocking antisense oligonucleotides (sbASOs) designed to outcompete repressive miRNA binding at the MECP23'UTR. This strategy aims to increase MeCP2Docket No. 27013 / 70816 / PClevels in patients with missense or late-truncating mutations, where the hypomorphic nature of the protein can be offset by enhanced abundance. The results herein demonstrate that sbASOs can elevate MeCP2 levels in a dose-dependent manner in SH-SY5Y and patient fibroblast cell lines, plateauing at levels projected to be safe. Confirming in vivo functionality, sbASO administration in wild-type mice led to significant Mecp2 upregulation and the emergence of phenotypes associated with Mecp2 overexpression. In a T158M neural stem cell model of RTT, sbASO treatment significantly increased MeCP2 expression and levels of the downstream effector protein Brain-Derived Neurotrophic Factor (BDNF). These findings highlight the potential of sbASO-based therapies for MeCP2-related disorders and advocate for their continued development.

[0184] RESULTS

[0185] Differential Expression of miRNAs in RTT Autopsy Samples

[0186] To define the miRNA expression profile in the brains of RTT patients, age-, sex-, and postmortem interval (PMI) -matched temporal cortex autopsy samples were obtained from five neurotypical controls, three individuals with the T158M mutation, and four with the R255X mutation in MeCP2. Total miRNA levels were quantified using nCounter® miRNA Expression Panels and compared relative to neurotypical controls. When analyzed as a combined "all RTT" group encompassing both mutations, 66 significantly downregulated and 78 significantly upregulated miRNAs were identified (Fig. 1A). The top 15 upregulated miRNAs are: hsa-miR-29b-3p, hsa-miR-451a, hsa-miR-125b-5p, hsa-miR-7-5p, hsa-let-7c-5p, hsa-miR-218-5p, hsa-miR-29a-3p, hsa-miR-148b-3p, hsa-miR-125a-5p, hsa-miR-374a-5p, hsa-miR-15a-5p, hsa-miR-191-5p, hsa-miR-29c-3p, hsa-miR-149-5p, hsa-miR-126-3p, and the top 15 downregulated miRNAs are: hsa-miR-4516, hsa-miR-942-5p, hsa-miR-877-5p, hsa-miR-563, hsa-miR-1281, hsa-miR-1306-3p, hsa-miR-1268b, hsa-miR-376c-5p, hsa-miR-6720-3p, hsa-miR-548a-5p, hsa-miR-519d-3p, hsa-miR-514a-3p, hsa-miR-323b-5p, hsa-miR-133a-3p, hsa-miR-203a-5p. Further analysis by patient subpopulation revealed distinct miRNA expression patterns specific to each mutation.9 decreased and 19 increased miRNAs were identified that were uniquely disrupted in patients with the T158M mutation (Fig. 1 A). Conversely, there were 5 increased and 15 decreased miRNAs that were specific to the R255X mutation (Fig. 1A).

[0187] When comparing the magnitude of change between the increased and decreased microRNAs, those that were upregulated exhibited a significantly greater disruption (~16-fold) relative to those that were downregulated (~3-fold) (Fig. 1B). This suggests that a primary function of MeCP2 may involve repressing miRNA biogenesis and that mutations in MeCP2 result in a de-repression of global miRNA levels (Cheng et al.2014; Woo and Kim 2014). Mutation-specific effects were also evident in this analysis, with the T158M mutation causing significantly higher disruptions than the R255X mutation (Fig. 1B). The average difference between the two groups was 10-fold, with the largest difference being 275-fold. Given that the R255X mutation is among the most clinically severe (Frullanti et al. 2019; Brown et al. 2016), these results demonstrate the surprising result of a greater impact on miRNA regulation by the T158M mutation.

[0188] MECP2-Targeted sbASO DesignDocket No. 27013 / 70816 / PC

[0189] Increasing the level of mutant MeCP2 protein has been shown to rescue symptoms in RTT model mice (Lamonica et al. 2017). Steric blockage of miRNA repression was hypothesized as a viable mechanism to achieve this goal. To test this theory, antisense oligonucleotides (ASOs) were designed that were complimentary to the 3'UTR miRNA seed sequence and the surrounding sequence specific to the MECP23'UTR (Fig. 2). These site-blocking ASOs were modified with a phosphorothioate backbone to improve stability and locked nucleic acid modifications to increase binding affinity (Clave et al. 2021; Koshkin et al. 1998; Vester and Wengel 2004).

[0190] Three target miRNAs were selected for proof-of-concept studies based on two main criteria: 1) existing literature demonstrating their repressive effects on MeCP2 (Pejhan et al. 2020; Alvarez-Saavedra et al. 2011; Hansen et al. 2010; Jovicic et al. 2013; Rastegar-Moghaddam et al. 2022; Tong et al. 2020; Matson et al. 2023; Han et al. 2013) and 2) Nanostring nCounter® analysis showing increased expression of the target miRNA in clinical populations, suggesting a role in repressing mutant forms of MeCP2. miR-22-3p and miR-132-3p fulfilled both criteria, while miR-483-5p was not detected in the nCounter® panel but had substantial preclinical evidence supporting its interaction with MECP2 (Han et al. 2013; Matson et al. 2023).

[0191] Dose-Dependent Efficacy of sbASOs In Vitro

[0192] The efficacy of all three sbASO was initially evaluated in the human SH-SY5Y neuroblastoma cell line to establish proof of concept. This cell line was chosen for its neuron-like characteristics, high levels of MeCP2 expression, and the relative abundance of all three target miRNAs (Jung et al. 2003; Lopez-Suarez et al. 2022). sbASOs were transfected with a dose range of 1.5 nM, 5 nM, 50 nM, and 125 nM, and nuclear protein was isolated 48 hours later. Under identical conditions, a similarly modified fluorescent control ASO (BLOCK-ITTM Fluorescent Oligo) achieved approximately 50-75% transfection efficiency with no cell death observed at concentrations below 250 nM.

[0193] All three sbASOs caused a significant and dose-dependent increase in MeCP2 expression, quantified via fluorescent Western blot. Elevated MeCP2 protein levels reached a ceiling effect at low (40% for sbASO. mlR-22), intermediate (75% for sbASO. miR-483), and high (200% for sbASO. miR-132) levels, highlighting the distinct regulatory capacity of each miRNA (Fig. 3B-D). The expression plateau observed between 50 nM and 125 nM suggests that the repressive effects of each miRNA can be saturated over a broad concentration range, which is a critical advantage of this approach in the context of MeCP2's narrow therapeutic index (Collins and Neul 2022).

[0194] To build on these findings, the potential for additive effects was explored by co-transfecting all three sbASOs simultaneously at concentrations in which no significant effect was observed individually. Cotransfection at sub-effective concentrations (sbASO. miR-22 = 5 nM, sbASO. miR-483 = 1.5 nM, and sbASO. mlR-132 = 0.5 nM) resulted in a significant increase in MeCP2 expression in SH-SY5Y cells, confirming the potential of sbASOs to have additive effects (Fig. 3E).

[0195] To determine whether the increase in MeCP2 protein was mediated through transcriptional or translational mechanisms, MECP2 mRNA levels was examined. Total RNA was isolated from SH-SY5Y cells treated with 50 nM sbASO, followed by cDNA synthesis and qRT-PCR of MECP2 mRNA. The 50 nM dosageDocket No. 27013 / 70816 / PCwas selected as it significantly increased MeCP2 protein across all sbASOs (Fig 3B-D). qRT-PCR analysis revealed that cells treated at this concentration showed no changes in MECP2 mRNA levels. These findings indicate that the sbASOs exert their effects primarily through translational repression rather than mRNA destabilization (Fig. 3F). In summary, administration of all three sbASOs in SH-SY5Y cells led to a dosedependent increase in MeCP2 protein, which plateaued within the predicated therapeutic window for RTT.

[0196] sbASOs Increase Mecp2 Expression in Wild-Type Mice

[0197] Having established proof of concept for the sbASO approach in vitro, a similar efficacy profile in vivo was sought. The human-to-mouse homology of the sbASO. miR-22, sbASO. miR-132, sbASO. miR-483 target sequences are 100%, 100%, 55%, respectively (Fig. 2C). Consequently, at least sbASO. miR-22 and sbASO. miR-132 are predicted to function similarly in both species. Effective delivery of ASOs to the brain and spinal cord has been demonstrated via several distinct mechanisms in rodents (DeVos and Miller 2013). In the present example study, an osmotic pump implanted subcutaneously was used, connected via a catheter to a cannula surgically placed into the right lateral ventricle of wild-type C57BL / 6J mice (Fig. 4A). This method was chosen based on its demonstrated effectiveness in seminal studies on spinal muscular atrophy (SMA) (Passini et al. 2011; Hua et al. 2010) and amyotrophic lateral sclerosis (ALS) (McCampbell et al. 2018; Miller et al. 2020). Successful catheter implantation and robust delivery potential were verified using 2.5% FastGreen dye, as coronal brain sections demonstrated the presence of the dye throughout the ventricular system. sbASO or saline solutions were infused into the cerebral spinal fluid for 5 days at a concentration of 50 pig / day . Nuclear Mecp2 protein was quantified in the frontal cortex and hippocampus using fluorescent Western blot.

[0198] Animals treated with sbASO. miR-22 and sbASO. miR-132 recovered well post-implantation, showing no adverse effects throughout the study period. Conversely, mice administered sbASO. miR-483 exhibited severe adverse phenotypes, including ataxia and orofacial dyskinesia, resulting in euthanasia before the full 5-day postimplantation period. It is unknown whether these effects were on- or off-target mediated; however, due to their severity, sbASO. miR-483 was excluded from all remaining in vivo experiments.

[0199] Western blot analysis showed that sbASO. miR-22 did not produce a notable increase in Mecp2 protein in either brain region examined (Fig. 4B-C). In contrast, with only five days post-implantation, sbASO. miR-132 exhibited strong efficacy, resulting in a significant increase in Mecp2 of 42% in the frontal cortex and 80% in the hippocampus (Fig. 4B-C).

[0200] sbASOs Induce Anxiety-like Phenotypes in Wild-Type Mice

[0201] Mecp2 dosage is known to bi-directionally regulate several phenotypes in mice, including anxiety in the elevated zero maze (EZM), motor learning on the rotarod, and associative learning in contextual fear conditioning assays (Collins and Neul 2022; Na et al. 2012). In this study, anxiety-like behaviors were selected as the primary outcome measure, as the presence of an osmotic pump could confound assessments of motor and freezing behaviors. To assess whether sbASO administration led to the predicted changes in anxiety, wild-type mice were infused with either saline, sbASO. miR-22, or sbASO. miR-132, and tested in the EZM after 5 days. sbASO-Docket No. 27013 / 70816 / PCtreated mice exhibited a significant reduction in the time spent in the open sections of the maze compared to the saline group (Fig. 4D), indicative of increased anxiety-like behavior. Importantly, there were no significant differences in the total distance traveled in the EZM between any of the treatment groups (Fig. 4E), suggesting that the anxiety-like phenotype was not attributable to altered locomotor activity. Notably the anxiety-related outcomes following sbASO.miR-22 administration was observed despite the absence of significant changes in Mecp2 protein expression in the hippocampus and frontal cortex (Fig. 4B-C). This unexpected finding suggests that sbASO.miR-22 may influence anxiety-like behaviors through mechanisms involving Mecp2 regulation in brain regions not examined or in subpopulations of cells that were too granular to detect in bulk tissue analysis.

[0202] Mutation-Specific Efficacy of sbASOs in Rett Patient-Derived Fibroblasts

[0203] The present findings from female RTT autopsies indicate that the magnitude of miRNA disruption may be uniquely affected by mutation type, potentially impacting the efficacy of sbASOs in different patient subpopulations. To investigate this variable in vitro, sbASOs were administered to fibroblast lines derived from RTT patients with five of the most common MeCP2 mutations (R133C, T158M, R306C, R270X, and R294X) and compared protein levels relative to vehicle-treated controls from each line (Fig. 5A-B). Consistent with previous observations, human fibroblasts demonstrated rapid uptake of the control fluorescent ASOs, achieving approximately 75% transfection efficiency after 12 hours.

[0204] Fluorescent Western blot quantification of MeCP2 levels across five different RTT fibroblast cell lines revealed several key findings. sbASO.miR-132 demonstrated a robust capacity to increase MeCP2 protein levels in all cell lines tested, although effective concentrations varied depending on the specific mutation (Fig. 5D). In contrast, sbASO.miR-22 and sbASO.miR-483 showed less consistent efficacy across the different cell lines (Fig.5C and E; representative Westerns: Fig. S4 and S5). For example, in missense mutations, the minimal effective concentrations of sbASO.miR-132 were 27.5 nM, 50 nM, and 125 nM, in the T158M, R133C, and R306C patient cell lines, respectively (Fig. 5D; Fig. S4B, E, H). Conversely, sbASO.miR-22 was only effective in the R133C (50 nM) and R306C (125 nM) lines, while sbASO.miR-483 showed no efficacy in cell lines with missense mutations (Fig. 5C; Fig. S4G).

[0205] Fibroblast lines from individuals with RTT are mosaic for the wild-type and mutant MECP2 alleles, making it impossible to isolate sbASO effects on the mutant protein in the R133C, T158M, and R306C missense lines. However, truncating mutations produce two distinct protein sizes: the full-length (FL) wild-type protein and a smaller truncated protein. Analysis of the R270X cell line was limited to the FL protein, as the R270X truncated protein is unstable (Cuddapah et al. 2014), leading to rapid degradation and rendering it undetectable by Western blot. Both sbASO.miR-132 and sbASO.miR-483 effectively increased FL R270X MeCP2 protein levels at 27.5 nM, while sbASOmiR-22 had no efficacy (Fig. 5E-D).

[0206] In contrast, the R294X truncated protein is known to be more stable and less prone to nonsense-mediated decay (Merritt et al. 2020), making it a promising target for therapeutic interventions. In this cell line, truncated R294X MeCP2 protein levels increased in response to all three sbASOs across various concentrations:Docket No. 27013 / 70816 / PCsbASO. miR-22 (1.5, 5, 27.5, 50, and 125 nM), sbASO.miR-132 (5 and 27.5 nM), and sbASO.miR-483 (27.5 nM) (Fig. 5C-E). Unexpectedly, FL MeCP2 protein levels were only upregulated with sbASO.miR-132, showing efficacy at 1.5, 5, and 50 nM concentrations (Fig. 5D; Fig. S5E). Together, these findings indicate that mutationspecific properties significantly influence sbASO responsiveness, highlighting the need to tailor therapeutic strategies based on the specific MeCP2 mutation.

[0207] To determine whether the shift in effective sbASO concentrations across mutations was linked to unique expression patterns of the target miRNAs, miR-22, miR-132, and miR-483 expression was quantified using qRT-PCR. miRNA expression in all five cell lines was compared to a wild-type, monoclonal cell line derived from the T158M mosaic cell line. Consistent with findings in the human autopsy samples, the expression of sbASO target miRNAs was significantly increased in most cases, but the pattern varied across mutations and did not correlate with sbASO efficacy. These results suggest that factors beyond the levels of the target miRNA may also contribute to the effectiveness of each sbASO.

[0208] sbASO Efficacy in MECP2-T158M Neural Stem Cells

[0209] To confirm the efficacy of ASO treatment in a model more relevant to the neuronal pathology of RTT, the sbASOs were tested in neural stem cells (NSCs) expressing either the mutant (T158MMT) or wild-type isogenic control allele (T158MWT). NSC differentiation from human induced pluripotent stem cells (IPSCs) was confirmed via immunofluorescence, showing positive Nestin expression and the absence of the pluripotency marker Oct4.

[0210] LNA-ASOs have shown significant potential as central nervous system therapeutics due to their ability to enter cells without delivery reagents. This ‘unassisted uptake' is facilitated by clathrin-mediated, context-dependent endocytic pathways, enabling delivery to traditionally difficult-to-transfect cells, such as neurons (Geary et al. 2015; Juliano et al. 2013). Compared to transfection methods, unassisted uptake requires higher ASO concentrations and has slower kinetics of internalization. In these experiments, sbASOs or a scramble control sbASO (sbASO. Scr) were diluted directly in the culture medium at concentrations ranging from 125 to 375 nM and incubated for 5 days. After treatment, proteins were extracted for analysis (Fig. 6A).

[0211] Using this strategy, a significant increase in MeCP2 protein levels was observed in sbASO-treated cells compared to sbASO. Scr-treated cells (Fig. 6B-J). This increase was achieved without the use of transfection agents, indicating that the sbASOs were efficiently internalized by the NSCs through unassisted uptake. Similar to what was observed in R294X fibroblasts, the sbASOs exhibited a left-shifted dose response in T158MMT NSCs relative to isogenic control lines, suggesting a more pronounced response in mutant cells at lower concentrations (Fig. 6B-D, H-J). This finding may be attributed to the global increase in miRNA levels described in Figure 1, which likely results in overly repressed baseline levels of mutant MeCP2 protein. The heightened repressive tone in T158MMT NSCs could thus enhance the potential to respond to sbASOs, leading to a more substantial increase in MeCP2 at lower concentrations.

[0212] sbASOs Increase Total BDNF Levels in T158M Neural Stem CellsDocket No. 27013 / 70816 / PC

[0213] Whether the increase in mutant T158M MeCP2 protein translates to afunctional improvement in RTT pathophysiology was next determined. Although RTT is a heterogeneous disorder, one consistent finding across patient samples and animal models is decreased levels of Brain-Derived Neurotrophic Factor (BDNF) (Li and Pozzo-Miller 2014). To assess whether sbASO administration normalizes BDNF levels, ELISA experiments were performed using isolated cytoplasmic extracts from sbASO-treated wild-type and mutant T158M NSCs. These experiments quantified a significant elevation in BDNF levels in T158MMT NSCs at the 250 nM concentration for sbASO. miR-22 and sbASO. miR-132 (Fig. 7A-C). Consistent with their reduced efficacy on MeCP2, sbASOs also had muted effects on BDNF in isogenic control NSCs, with only sbASO. miR-22 showing an increase in expression (Fig. 7A). These data indicate that sbASOs can enhance the expression of mutant MeCP2 in a T158M NSC model of RTT, which correlates with the upregulation of a protein whose deficiency is a known contributor to the pathophysiology of the disorder in BDNF.

[0214] DISCUSSION:

[0215] Over the past decade, numerous studies have demonstrated the remarkable potential of MeCP2 reexpression to improve disease symptoms in RTT (Guy et al. 2007; Luikenhuis et al. 2004; Garg et al. 2013). This groundbreaking discovery has fundamentally shifted the perception of RTT from a hardwired neurodevelopmental disorder to one that can potentially be reversed. As a result, there has been a surge in research focused on restoring MeCP2 expression through genome, base, and RNA editing, alongside delivery platforms such as gene therapy, protein replacement, and mRNA therapies (Palmieri et al. 2023). Despite these advancements, the dosage sensitivity of MeCP2 remains a critical challenge, as both insufficient and excessive levels result in neurological dysfunction. Moreover, these methods are difficult to implement across the entire brain and carry the risk of permanent adverse effects.

[0216] Restoring optimal MeCP2 levels is further complicated by the fact that most RTT patients carry hypomorphic mutations that result in only partial loss of function (Brown et al. 2016; Heckman et al. 2014). Therapeutic strategies must therefore account for the varying degrees of functionality retained by each respective mutation. For instance, the R133C mutation is associated with a mild clinical presentation. While adding a MECP2 transgene rescues null models of RTT, it evokes MDS-like motor and cognitive effects in Mecp2R133C / + mice (Vermudez et al. 2021). The crux of the challenge lies in achieving the correct level of MeCP2 in a context where the required amount varies with factors like mutation type, developmental stage, and cell type (Ip et al. 2018). These complexities underscore the need for alternative strategies that enable precise and controlled modulation of MeCP2 expression, preferably from the endogenous locus, where the majority of regulatory elements remain intact (Shao et al. 2021).

[0217] In the present Example, site-blocking antisense oligonucleotides were designed to target miRNA binding sites within the MECP23'UTR. The clinical success of ASOs in SMA (Passini et al. 2011; Hua et al. 2010) and ALS (McCampbell et al. 2018; Miller et al. 2020) highlights their potential as therapeutics for genetic disorders of the nervous system. Building on these seminal advancements, our approach leverages the ability ofDocket No. 27013 / 70816 / PCmiRNAs to fine-tune protein levels, providing a precision medicine strategy that can be tailored for each mutation to counteract diminished MeCP2 protein function by increasing its abundance.

[0218] The Role of MeCP2 in miRNA Biogenesis

[0219] miRNAs are small, non-coding RNAs that regulate gene expression post-transcriptionally by binding to the 3' UTRs of target mRNAs, leading to their degradation or translational repression (Hong and Jeong 2023; Shang et al. 2023). These regulatory interactions play crucial roles in neural development, synaptic plasticity, and neuronal differentiation (Shang et al. 2023; Ye et al. 2016; Szulwach et al. 2010). Before targeting miRNA-MECP2 interactions, we first sought to define the miRNA expression profile in the brains of RTT patients. These experiments identified significant dysregulation of miRNAs in patient samples, consistent with prior in vivo and in vitro studies reporting widespread miRNA alterations in RTT (Mellios et al. 2018; Wu et al. 2010).

[0220] The genome-wide disruption of miRNAs in RTT arises from both indirect and direct consequences of MeCP2 loss of function. MeCP2 regulates global gene expression, triggering compensatory alterations in noncoding RNA levels, including miRNAs, to buffer against harmful changes in gene dosage (Good et al. 2021). Directly, MeCP2 represses primary miRNA (pri-miRNA) transcription by binding to methylated CpG sites within promoter regions (Ip et al. 2018; Szulwach et al. 2010). When MeCP2 is deficient, pri-miRNA transcription increases, leading to higher levels of mature miRNAs. Thus, pathogenic mutations in the methyl binding, transcriptional repression, and / or NCoR interacting domains are predicted to increase the expression of MeCP2-regulated miRNAs, as we have reported here (Ip et al. 2018). Additionally, MeCP2 can inhibit miRNA biogenesis by sequestering a key component of the microprocessor complex, DGCR8, and stalling RNA polymerase II at methylated miRNA gene boundaries (Cheng et al. 2014; Woo and Kim 2014). In patients with C-terminal mutations or truncations, the binding between MeCP2 and DGCR8 is likely disrupted, allowing Drosha to bind and activate pri-mRNA processing (Cheng et al. 2014; Tsujimura et al. 2015). While speculative, this differential regulation of miRNA biogenesis may account for the distinct miRNA expression patterns observed in T158M and R255X patient samples and could explain the variable efficacy of sbASOs depending on the specific MeCP2 mutation.

[0221] Nanostring analysis indicated that upregulated miRNAs were more significantly disrupted compared to downregulated miRNAs, including two key targets in our study: miR-22 and miR-132. This observation is consistent with earlier studies in Mecp2 knockout mice (Wu et al. 2010). The inverse regulatory relationship between MeCP2 and both miRNAs has been well established. Specifically, reduced MeCP2 leads to increased expression of miR-22 and miR-132, whereas overexpression suppresses these miRNAs. For miR-22, these effects are likely mediated by MeCP2 binding to an enhancer region upstream of the miR-22 gene, resulting in increased CpG methylation and reduced miR-22 levels (Tong et al. 2020). The relationship between miR-132 and MeCP2 involves a dynamic regulatory loop where elevated MeCP2 increases BDNF levels, and BDNF in turn induces miR-132 expression to provide negative feedback on MECP2 (Pejhan et al. 2020). These complexDocket No. 27013 / 70816 / PCfeedback loops illustrate how non-coding miRNAs maintain appropriate levels of dosage-sensitive genes like MECP2.

[0222] The concerted action of many repressive miRNAs likely represents a primary mechanism for why reduced levels of mutant MeCP2 protein are commonly observed in RTT (Khan et al. 2018; Woo and Kim 2014). Loss of MeCP2-mediated repression leads to increased miRNA expression, which further suppresses MeCP2 levels, exacerbating the effects of loss-of-function mutations. sbASOs are designed to disrupt this cycle, as supported by studies showing that transgenic overexpression of the Mecp2-T158M allele rescues RTT-like phenotypes in mice (Lamonica et al. 2017).

[0223] Dose-Dependent Increase of MeCP2 in vitro

[0224] The present Example focuses on SH-SY5Y cells due to their high transfection efficiency and endogenous expression of MeCP2 (Hoffmann et al. 2022; Lopez-Suarez et al. 2022). In this cell line, sbASO treatment elevated MeCP2 levels in a dose-dependent manner, plateauing at subtoxic thresholds. Notably, subeffective concentrations of sbASOs exhibited additive effects, a property that could be critical in cases where the target miRNA is not uniformly expressed across all cell types or developmental stages, or where severe mutations necessitate higher therapeutic thresholds.

[0225] Interestingly, sbASO treatment in SH-SY5Y cells did not significantly alter MECP2 mRNA levels, despite the typical model wherein miRNAs induce deadenylation followed by translational repression. While unexpected, this discrepancy between transcript and protein levels is not uncommon and could result from complex regulatory mechanisms not yet fully understood (Bauernfeind and Babbitt 2017). These results suggest that in this context, sbASO may primarily impact translation without impacting mRNA stability, or that compensatory pathways modulate the response.

[0226] To identify RTT subpopulations likely to respond to this approach, the present Example includes patient-derived fibroblasts stdies modeling five common RTT-causing mutations. sbASOs showed a consistent ability to increase MeCP2 levels in this model, pointing to a broad utility across mutation types. Similarly, experiments in RTT patient-derived neuronal stem cells demonstrated successful elevation of MeCP2 levels, providing further support for sbASOs in a more clinically relevant context. One notable finding was the mutationdependent shift in dose-response curves. No overt correlation between sbASO efficacy and miRNA levels could be established in these cell lines; however, mutation-specific miRNA expression patterns were observed in human brain samples, suggesting that this relationship may merit further study. Alternatively, the fluorescent oligo used for transfection optimization may not accurately reflect each cell line's unique sbASO uptake capacity. Future studies will quantify sbASO uptake to address this important consideration.

[0227] Functional Rescue

[0228] The therapeutic potential of the sbASO approach depends on whether increasing levels of mutant MeCP2 can rescue functional deficits. To address this, levels of BDNF, a downstream effector of MeCP2 thatDocket No. 27013 / 70816 / PCplays a critical role in RTT pathogenesis (Gonzales et al. 2012; Li and Pozzo-Miller 2014), were determined. BDNF levels are consistently reduced across various brain regions in RTT model mice (Chahrour and Zoghbi 2007; Erickson et al. 1996; Abuhatzira et al. 2007; Schmid et al. 2012), and strategies to elevate BDNF through genetic or pharmacological means have been shown to mitigate deficits in similar models (Chang et al. 2006).

[0229] In the present Example, treatment with all three sbASOs resulted in a significant increase in BDNF levels in T158MMT NSCs, suggesting that upregulating mutant MeCP2 can potentially mitigate neurotrophic deficits associated with RTT. However, this effect was not consistently mirrored across all effective sbASO concentrations, indicating a more complex regulatory mechanism at play between the two proteins. Early research suggested that MeCP2 represses BDNF by binding to its promoter, with transcription activated upon neuronal depolarization (Chen et al. 2003; Ballas et al. 2005; Zhou et al. 2006; Martinowich et al. 2003). Other studies, however, highlighted an activator role, as evidenced by reduced BDNF levels in Mecp2-null mice (Chang et al. 2006; Li et al. 2012). More recent models propose a dual function for Mecp2, capable of repressing or activating BDNF transcription depending on its phosphorylation status or other epigenetic factors (Li and Pozzo-Miller 2014).

[0230] This duality likely explains the inconsistent correlation between sbASO-induced MeCP2 increases and changes in BDNF levels. While sbASOs increased MeCP2 expression, additional factors— such as phosphorylation status, microRNA interactions, or post-transcriptional regulation— may have influenced BDNF expression. Furthermore, the use of an ELISA assay to measure total BDNF does not distinguish between its pre-, pro-, and mature forms, which may have masked more nuanced regulatory changes. These distinct BDNF isoforms may have differing relationships with MeCP2, contributing to the observed discrepancies.

[0231] sbASOs increase Mecp2 levels in vivo

[0232] Administration of sbASO. miR-132 significantly increased Mecp2 protein levels in the frontal cortex and hippocampus of WT mice. This in vivo upregulation of Mecp2 serves as a proof-of-concept for the potential use of sbASOs in a complex biological environment. Interestingly, both sbASO. miR-22 and sbASO. miR-132 administration led to the emergence of MDS-like anxiety phenotypes in WT mice. While the anxiety-related outcomes for sbASO. miR-132 were anticipated due to the robust effect on Mecp2 levels, the behavioral alterations observed with sbASO. miR-22 were unexpected given the lack of differences in protein expression compared to saline control.

[0233] Conclusions

[0234] The present Example demonstrates the use of sbASOs in modulating MeCP2 expression across multiple experimental models. The observed global de-repression of miRNA quantified in patient brains, coupled with the in vitro and in vivo efficacy of sbASOs, underscores their therapeutic potential as a treatment strategy for RTT. The mutation-specific and neuronal efficacy of sbASOs further support their versatility as a personalized treatment strategy.Docket No. 27013 / 70816 / PC

[0235] METHODS:

[0236] Animals

[0237] Animals were provided food and water ad libitum, with cages changed weekly. All mice were maintained on a 12-hour light / 12-hour dark cycle, received routine veterinary monitoring, and were cared for in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. All studies were approved by the Institutional Animal Care and Use Committee of Loyola University Chicago. Post-surgical mice were single-housed to protect sutures and tubing. Male C57BL / 6 J mice, obtained from Jackson Laboratories, were aged to 6 weeks for all experiments.

[0238] sbASO Synthesis and Design

[0239] Site-blocking ASOs were designed to cover the target miRNA seed region and a portion of the surrounding sequence that was unique to MECP2. The backbones of sbASOs were fully phosphorothioate modified to increase stability and locked nucleic acid modifications were made to all bases to increase binding affinity. The modified ASOs were synthesized by Ciagen and Integrated DNA Technologies. The sbASO sequences are: sbASO.miR-22 (5'-GAGCCAACAGCTGCCT-3') (SEC ID NO: 2), sbASO.miR-132 (5'-AGTAACAGTCCTGGTG-3') (SEC ID NO: 3), and sbASO.miR-483 (5'-TGTAGACGGGGCACTG-3') (SEC ID NO: 4).

[0240] Cell Culture and Treatment

[0241] SH-SY5Y Cells: Immortalized human neuroblastoma cells were obtained from ATCC® (CRL-2266™) and were cultured in IMDM (1X) (Gibco™, Thermo Fisher Scientific; #12440053) supplemented with 10% heat-inactivated FBS, 1% antibiotic-antimycotic (100X), and 0.5% MEM non-essential amino acids (100X) (Gibco™, Thermo Fisher Scientific; #16140071, 15240062, 11140035). These cells were maintained at 37°C and 5% CO2, and passaged using TrypLE™ Express (1X) (Gibco™, Thermo Fisher Scientific; #12605010).

[0242] Human Fibroblast Cells: Primary human fibroblasts derived from RTT patients were obtained from the Rett Syndrome Research Trust (RSRT) and cultured in DMEM (1X), high glucose, (Gibco™, Thermo Fisher Scientific; #11965092) supplemented with 15% heat-inactivated FBS, 1% antibiotic-antimycotic (100X), and 1% MEM non-essential amino acids (100X). These fibroblasts were also maintained at 37°C and 5% CO2, and passaged using TrypLE™ Express (1X).

[0243] Neural Stem Cells: NSCs were generated from iPSCs following the Life Technologies protocol for "Induction of Neural Stem Cells from Human Pluripotent Stem Cells” (Publication number: MAN0008031). This included both the MeCP2 T158M mutation (T158MMT) and isogenic control (T158MWT) cell lines. Briefly, the differentiation process involved three stages. First, iPSCs were cultured to 90% confluency in Essential 8™ Medium (Gibco™, Thermo Fisher Scientific; #A1517001 ) on a Vitronectin substrate (Gibco™, Thermo Fisher Scientific; #CTS279S3). Second, neural induction from iPSCs was initiated using PSC Neural Induction Medium (Gibco™, Thermo Fisher Scientific; #A1647801) for 7 days. Third, terminal differentiation was achieved byDocket No. 27013 / 70816 / PCapplying a Neural Differentiation Medium with an 80% media change every 48 hours for 30 days. The differentiation of NSCs was confirmed by immunofluorescence staining, showing positive expression of neural markers such as Nestin and the absence of pluripotent stem cell marker Oct4 in differentiated cells. Once the control and mutant lines were differentiated, ASO delivery was initiated.

[0244] ASO Delivery

[0245] Assisted Transfections: Cells were plated in surface-treated 6-well sterile tissue culture plates and grown to approximately 80% confluency before transfection with sbASOs or BLOCK-iTTM Fluorescent Oligo (Invitrogen life technologies; #1370-070) using Lipofectamine™ 3000 Transfection Reagent (Invitrogen ™ , Thermo Fisher Scientific; #L3000150) in Opti-MEM reduced serum medium (Gibco™ , Thermo Fisher Scientific; #31985070). Cells were treated with 3, 10, 55, 100, and 125 nM sbASO per transfection. After 12-18 hours, transfected cells were washed with DPBS, maintained in growth medium for 24 hours, harvested using TrypLE™ Express (1X), and stored at -80°C until processing.

[0246] Unassisted ASO Uptake: Cells were plated in Geltrex-treated 12-well sterile tissue culture plates and grown to approximately 40-60% confluency before unassisted sbASO treatment. sbASOs or scramble control sbASOs were directly added to the IPSC-derived NSC culture medium at concentrations of 125 nM, 250 nM, and 375 nM for 5 days to allow for internalization. After incubation, cells were harvested using StemPro™ Accutase™ Cell Dissociation Reagent (Gibco™, Thermo Fisher Scientific; #A1110501) and stored at -80°C until processing.

[0247] Osmotic Pump Implantation Surgery

[0248] Osmotic pumps were prepared according to the manufacturer's protocol (Alzet; pump model #100070). Mice were anesthetized with a 5% isoflurane / oxygen mixture and confirmed to be unconscious before being placed in a Kopf model stereotaxic apparatus fitted with ear bars. The osmotic pump was implanted subcutaneously and connected via a catheter to a cannula surgically inserted into the right lateral ventricle, positioned 1.1 mm lateral and 0.5 mm posterior to the bregma. sbASO or saline solutions were infused into the cerebrospinal fluid for 5 days at a rate of 50 pig / day . Five days post-implantation, brains were harvested, and total Mecp2 protein levels were quantified in the frontal cortex and hippocampus.

[0249] Elevated Zero Maze (EZM)

[0250] To assess anxiety, mice were placed on a continuous circular platform with two closed and two open regions for 5 min under full light conditions (>400 lux). The time spent exploring the open regions, as well as the distance traveled in both open and closed regions, was quantified by ANY-maze software.

[0251] Subcellular Fractionation

[0252] Cells: Transfected cells were collected and fractionated into nuclear and cytoplasmic fractions using the Lyse and Wash protocol (Senichkin et al. 2021) to isolate cytoplasmic and nuclear protein.Docket No. 27013 / 70816 / PC

[0253] Tissue: Frontal cortex and hippocampal samples were harvested from wild-type mice post osmotic pump implantation and behavioral assays. The tissue samples were homogenized in ice-cold hypotonic buffer and incubated on ice for 20 minutes. Triton X-100 was then added to a final concentration of 0.1%, followed by a 10-minute incubation on ice with intermittent vortexing. The cell suspension was centrifuged at 2,000 ref at 4°C for 10 minutes to separate the nuclei (pellet) from the cytoplasm (supernatant). The cytoplasmic supernatant was further centrifuged at 12,000 ref at 4°C for 10 minutes to remove debris, and the clean supernatant was collected as the cytoplasmic fraction. The nuclear pellets were combined and resuspended in ice-cold isotonic buffer, incubated on ice for 10 minutes with vortexing, and centrifuged at 12,000 ref at 4°C for 10 minutes. The supernatant was discarded, and the pellet was used for DNA digestion. DNase was added to DNase buffer, the nuclear pellet was resuspended in this mixture, passed through a 27-gauge needle five times, and incubated for 1 hour with vortexing to ensure thorough digestion.

[0254] Western Blot

[0255] Nuclear protein concentration was measured using the Micro BCA™ Protein Assay Kit (Thermo Fisher Scientific™; #23235). Samples were diluted to equal concentrations before gel electrophoresis in 4-20% Criterion™ TGX™ precast polyacrylamide gels (Bio-Rad Laboratories; #5671095) and subsequent immunoblotting with Histone H3 (1B1B2) mouse mAb and MeCP2 (D4F3) rabbit mAb (Cell Signaling Technologies; #14269S, #3456S, respectively). Western blots were imaged using the Odyssey® Imaging System (LICORbio™) and quantified with Empiria Studio® Software (LICORbio™).

[0256] Enzyme-Linked Immunosorbent Assay (ELISA)

[0257] The total BDNF in the cytoplasmic protein extracts from cell samples was quantified using the Human BDNF Simple Step ELISA kit (Abeam; ab212166), according to the manufacturer's instructions. The absorbance was measured at 450 nM on a BioTek Cytation5 Microplate Reader (Agilent Technologies), and BDNF concentrations were calculated from a standard curve, providing precise quantification of BDNF levels in the samples.

[0258] mRNA and miRNA Isolation

[0259] mRNA and miRNA were isolated from cells or tissue using the PureLink™ miRNA Isolation Kit (Invitrogen ™ ; Thermo Fisher Scientific; #K157001 ) per manufacturer instructions. Resultant mRNA and miRNA were diluted in DEPC-treated water, tested for purity and concentration using a NanoDrop™ Lite Spectrophotometer (Thermo Fisher Scientific), and stored at -80°C until cDNA synthesis.

[0260] mRNA Reverse Transcription and qRT-PCR

[0261] cDNA was synthesized using SuperScript™ IV VILO™ Master Mix (Invitrogen™; Thermo Fisher Scientific; #11756050). MECP2 transcript levels were measured by qRT-PCR using the TaqMan® Gene Expression Assay for MECP2 (Thermo Fisher Scientific; #4351372). qRT-PCR was performed in triplicate for each sample with the CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad Laboratories; #1855196),Docket No. 27013 / 70816 / PCusing glucose-6-phosphate dehydrogenase (G6PD) levels measured by the TaqMan® Gene Expression Assay (Invitrogen™; Thermo Fisher Scientific; #4331182) as the internal control for normalization, with negative controls in each plate.

[0262] miRNA Reverse Transcription and qRT-PCR

[0263] miR-cDNA was synthesized from isolated and purified miRNA using the TaqMan™ MicroRNA Reverse Transcription Kit (applied Biosystems™; #4366596) for target miRNAs miR-22-3p (assay #000398), miR-132-3p (assay #000457), miR-483-5p (assay #002338), and U6 snRNA (assay #001973). miRNA qRT-PCR was performed in triplicate for each sample using the CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad Laboratories; #1855196). Quantification data was collected with CFX Maestro™ Software (Bio-Rad Laboratories; #12013758) and evaluated for fold changes using the AACt method, normalized to neurotypical expression levels in isogenic wild-type HDFa human dermal fibroblasts derived from heterozygous T158M RTT patient fibroblasts.

[0264] nCounter® miRNA Expression Panels

[0265] Total miRNA was isolated from postmortem temporal cortices of T158M and R255X RTT patients, as well as neurotypical controls, obtained from the NIH NeuroBioBank and the University of Maryland Brain and Tissue Bank. Samples were submitted to the NUSeq Core at Northwestern University (Chicago, Illinois) for nCounter® miRNA expression analysis following manufacturer protocols. miRNA expression levels were normalized to total RNA levels and compared to neurotypical controls using nCounter® Advanced Analysis Software.

[0266] Statistical Analysis

[0267] Statistics were carried out using Prism 8 (GraphPad) and Excel (Microsoft). All data shown represent mean ± SEM to provide a measure of variability and accuracy. Post hoc tests were conducted for all statistical comparisons to identify specific group differences. Researchers conducting the analyses were blind to the experimental conditions to ensure unbiased results. Statistical significance was assessed using appropriate tests, and p-values were determined to evaluate the differences between experimental groups.

[0268] Example 2: sb181 - an miRNA site blocking antisense oligonucleotide regulator of MeCP2 expression

[0269] The 3'untranslated region (UTR) is an essential site for post-transcriptional mRNA regulation where dozens of microRNAs (miRNA) and RNA binding proteins additively contribute to fine-tune gene expression. The impact of each individual miRNA on total protein levels is generally modest, making strategies that disrupt miRNA regulation of the 3'UTR potentially valuable tools for disorders where the therapeutic window of the target gene is narrow. Here we have developed a 3'UTR targeted therapeutic approach for one such disorder known as Rett syndrome (RTT). RTT is a devastating neurodevelopmental disorder for which there are only very limitedDocket No. 27013 / 70816 / PCtreatment strategies. 95% of RTT cases are the result of loss of function mutations in a methyl reader protein known as methyl CpG binding protein 2 (MeCP2), and seminal studies show that the disease can be reversed if MeCP2 levels are restored in mouse models, even at advanced symptomatic stages.

[0270] On the surface, RTT appears to be an ideal candidate for gene therapy; however, targeting MeCP2 itself with traditional viral gene replacement is complicated by a precise requirement for protein dosage, whereby even a 1-fold increase over neurotypical levels evokes adverse effects. The narrow therapeutic window for MeCP2 restoration is cemented by the presence of a related neurodevelopmental disorder known as MeCP2 Duplication Syndrome (MDS), which presents with duplication of the MeCP2 locus. The practical challenge created by these narrow dosage requirements is that not only does viral MeCP2 delivery need to be efficient across the entire human brain, but each cell must receive roughly the same, relatively small amount.

[0271] The repressive role of miRNAs on MeCP2 expression has been reproducibly shown at multiple sites in the 3'UTR and overexpression of repressive miRNAs can reverse symptoms in MDS mouse models; however, the therapeutic potential in RTT remains understudied. As described in Example 1, a series of locked nucleic acid (LNA) site-blocking antisense oligonucleotides (sbASOs) were designed to "out-compete” endogenous miRNAs for 3'UTR binding and increase I de-repress MeCP2 expression in sub-toxic increments. These sbASOs targeted the mir-22, mir-132 / 212, and mir-483 binding sites and increase MeCP2 protein levels in a dosedependent manner in vitro. Importantly, all three sbASOs had broad effective concentrations that are capped at low (75%), intermediate (125%), and high (200%) increases over wild-type MeCP2 levels, depending on the target miRNA. Efficacy was established in human fibroblasts from RTT patients, wild type mice, and in neuronal stem cells from a RTT patient. However, inconsistent efficacy was observed across common disease causing MeCP2 mutations. For example, sbASO.22 significantly increased MeCP2 experssion in cells from patients with R133C and R294X mutations, but not T158M, R270X. or R255X. Even for sbASOs where effective concentration could be established across common mutations (i.e. sbASO.132), the EC50 was shifted dramatically as a function of mutation. These data suggest that the nature of the MeCP2 mutation impacts the efficacy of sbASOs.

[0272] MeCP2 is involved in the biogenesis of certain classes of miRNA, creating a potential feedback-loop whereby increased MeCP2 expression increases levels of repressive-mi RN A, thereby keeping its own dosage within a narrow safety window. In this context, restoring this feedback loop with an sbASO could compromise efficacy of the sbASO over time. Further, distinct domains of the MeCP2 protein regulate different aspects of miRNA biogenesis (i.e. transcription, maturation, etc), creating a mechanism by which the location of a mutation could have unique effects on feedback regulation. An ideal sbASO would target a miRNA that had the capacity to repress MeCP2 expression, but whose own biogenesis was MeCP2-independent, and thus would not subject to feedback regulation.

[0273] To address this need, the brains of RTT patient autopsies were profiled and several miRNA were identified whose levels were unaffected by disease causing mutations, but had predicted binding sites in the 3'UTR. By designing an sbASO to one of these sites, miRNA 181, robust and consistent efficacy was observedDocket No. 27013 / 70816 / PCacross all common MeCP2 mutations, while still maintaining the safety and efficacy profile observed with other sbASOs. We now consider sb181 to be our lead sbASO.

[0274] As shown in Figure 8, administration of sb181 in dose response shows robust efficacy across multiple common mutations, which was not observed with previous sbASOs. Further, the potency is left-shifted suggestive of a greater affect at lower concentrations.

[0275] Trofinetide is symptomatic management of disease. The sbASOs described herein target MeCP2 itself, and thus can rescue all symproms and pathologies associated with RTT. Viral gene therapy is also being explored in clinical trials for RTT, however, given the narrow dosage window for MeCP2, this approach risks permenant side effects associated with over expression. The sbASOs described herein have a phosphothionate modified backbone that increases halflife in humans to >6 months. Thus, while they are long-lasting, any potential adverse effects would be reversible as the sbASO degrades.

[0276] The sequence of sb181 is 5’ ACAGGTACATTCAGACAGGTTT 3’ (SEQ ID NO: 1). All nucleic acids are 2'-O-methoxyethyl (2-MOE) modified and the entire backbone of the oligonucleotide is phosphorothionate modified. These modifications create a high affinity for a sequence located in the 3'untranslated region of Methyl CpG Binding Protein 2 (MECP2) mRNA. Under normal conditions, miRNA181 binds to these sites and represses gene expression. Sb181 binds to the seed region for miRNA181 and a series of nucleotides that are specific to MECP2. As a consequence, miRNA is no longer able to repress MECP2 expression, resulting in an increase in both wild-type and mutant forms of the MeCP2 protein. It is also of note that sb181 only disrupts the interaction between miRNA181 and MECP2, allowing miRNA181 to perform its normal biological functions at all other loci across the genome, thereby reducing the risk for off-target adverse effects.

[0277] References

[0278] Abuhatzira L, Makedonski K, Kaufman Y, Razin A, Shemer R. 2007. MeCP2 deficiency in the brain decreases BDNF levels by REST / CoREST-mediated repression and increases TRKB production. Epigenetics 2: 214-222.

[0279] Alberti C, Manzenreither RA, Sowemimo I, Burkard TR, Wang J, Mahofsky K, Ameres SL, Cochella L.2018. Cell-type specific sequencing of microRNAs from complex animal tissues. Nat Methods 15: 283-289. https: / / www.nature.com / articles / nMeth.4610 (Accessed September 26, 2024).

[0280] Alvarez-Saavedra M, Antoun G, Yanagiya A, Oliva-Hernandez R, Cornejo-Palma D, Perez-lratxeta C, Sonenberg N, Cheng H-YM. 2011. miRNA-132 orchestrates chromatin remodeling and translational control of the circadian clock. Hum Mol Genet 20: 731-751.

[0281] Amir RE, Van den Veyver IB, Wan M, Tran CQ, Francke U, Zoghbi HY. 1999. Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nat Genet 23: 185-188.

[0282] Ballas N, Grunseich C, Lu DD, Speh JC, Mandel G. 2005. REST and its corepressors mediate plasticity of neuronal gene chromatin throughout neurogenesis. Cell 121: 645-657.Docket No. 27013 / 70816 / PC

[0283] Bauernfeind AL, Babbitt CC. 2017. The predictive nature of transcript expression levels on protein expression in adult human brain. BMC Genomics 18: 322. https: / / doi.org / 10.1186 / s12864-017-3674-x (Accessed September 26, 2024).

[0284] Bijlani S, Pang KM, Bugga LV, Rangasamy S, Narayanan V, Chatterjee S. 2024. Nuclease-free precise genome editing corrects MECP2 mutations associated with Rett syndrome. Front Genome Ed 6. https: / / www.frontiersin.org / journals / genome-editing / articles / 10.3389 / fgeed.2024.1346781 / full (Accessed July 23, 2024).

[0285] Brown K, Selfridge J, Lagger S, Connelly J, De Sousa D, Kerr A, Webb S, Guy J, Merusi C, Koerner MV, et al. 2016. The molecular basis of variable phenotypic severity among common missense mutations causing Rett syndrome. Hum Mol Genet 25: 558-570.

[0286] Carrette LLG, Wang C-Y, Wei C, Press W, Ma W, Kelleher RJ, Lee JT. 2018. A mixed modality approach towards Xi reactivation for Rett syndrome and other X-linked disorders. Proceedings of the National Academy of Sciences 115: E668-E675. https: / / www.pnas.org / doi / full / 10.1073 / pnas.1715124115 (Accessed July 23, 2024).

[0287] Chahrour M, Zoghbi HY. 2007. The story of Rett syndrome: from clinic to neurobiology. Neuron 56: 422-437.

[0288] Chang Q, Khare G, Dani V, Nelson S, Jaenisch R. 2006. The disease progression of Mecp2 mutant mice is affected by the level of BDNF expression. Neuron 49: 341-348.

[0289] Chen RZ, Akbarian S, Tudor M, Jaenisch R. 2001. Deficiency of methyl-CpG binding protein-2 in CNS neurons results in a Rett-like phenotype in mice. Nat Genet 27: 327-331.

[0290] Chen WG, Chang Q, Lin Y, Meissner A, West AE, Griffith EC, Jaenisch R, Greenberg ME. 2003. Derepression of BDNF transcription involves calcium-dependent phosphorylation of MeCP2. Science 302: 885-889.

[0291] Cheng T-L, Wang Z, Liao Q, Zhu Y, Zhou W-H, Xu W, Qiu Z. 2014. MeCP2 Suppresses Nuclear MicroRNA Processing and Dendritic Growth by Regulating the DGCR8 / Drosha Complex. Developmental Cell 28: 547-560. https: / / www.cell. com / developmental-cell / abstract / S1534-5807(14)00073-2 (Accessed July 17, 2024).

[0292] Clave G, Reverte M, Vasseur J-J, Smietana M. 2021. Modified internucleoside linkages for nuclease-resistant oligonucleotides. RSC Chem Biol 2: 94-150.

[0293] Collins AL, Levenson JM, Vilaythong AP, Richman R, Armstrong DL, Noebels JL, David Sweatt J, Zoghbi HY. 2004. Mild overexpression of MeCP2 causes a progressive neurological disorder in mice. Hum Mol Genet 13: 2679-2689.Docket No. 27013 / 70816 / PC

[0294] Collins BE, Neul JL. 2022. Rett Syndrome and MECP2 Duplication Syndrome: Disorders of MeCP2 Dosage. Neuropsychiatr Dis Treat 18: 2813-2835. https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC9719276 / (Accessed July 23, 2023).

[0295] Collotta D, Bertocchi I, Chiapello E, Collino M. 2023. Antisense oligonucleotides: a novel Frontier in pharmacological strategy. Front Pharmacol 14. https: / / www.frontiersin.org / journals / pharmacology / articles / 10.3389 / fphar.2023.1304342 / full (Accessed July 23, 2024).

[0296] Cuddapah VA, Pillai RB, Shekar KV, Lane JB, Motil KJ, Skinner SA, Tarquinio DC, Glaze DG, McGwin G, Kaufmann WE, et al. 2014. Methyl-CpG-binding protein 2 (MECP2) mutation type is associated with disease severity in Rett syndrome. J Med Genet 51: 152-158.

[0297] Dennys CN, Vermudez SAD, Deacon RJM, Sierra-Delgado JA, Rich K, Zhang X, Buch A, Weiss K, Moxley Y, Rajpal H, et al. 2024. MeCP2 gene therapy ameliorates disease phenotype in mouse model for Pitt Hopkins syndrome. Neurotherapeutics e00376. https: / / www.sciencedirect.com / science / article / pii / S187874792400062X (Accessed September 27, 2024).

[0298] DeVos SL, Miller TM. 2013. Direct Intraventricular Delivery of Drugs to the Rodent Central Nervous System. J Vis Exp 50326. https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC3679837 / (Accessed July 23, 2024).

[0299] D'Mello III SR. 2021. MECP2 and the biology of MECP2 duplication syndrome. Journal of Neurochemistry 159: 29-60. https: / / onlinelibrary.wiley.com / doi / abs / 10.1111 / jnc.15331 (Accessed July 23, 2024).

[0300] Erickson JT, Conover JC, Borday V, Champagnat J, Barbacid M, Yancopoulos G, Katz DM. 1996. Mice Lacking Brain-Derived Neurotrophic Factor Exhibit Visceral Sensory Neuron Losses Distinct from Mice Lacking NT4 and Display a Severe Developmental Deficit in Control of Breathing. J Neurosci 16: 5361-5371. https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC6578883 / (Accessed September 26, 2024).

[0301] Flynn MJ, Mayfield AMH, Du R, Gradinaru V, Elowitz MB. 2024. Synthetic dosage-compensating miRNA circuits allow precision gene therapy for Rett syndrome. bioRxiv 2024.03.13.584179. https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC10980028 / (Accessed July 23, 2024).

[0302] Frullanti E, Papa FT, Grillo E, Clarke A, Ben-Zeev B, Pineda M, Bahi-Buisson N, Bienvenu T, Armstrong J, Roche Martinez A, et al. 2019. Analysis of the Phenotypes in the Rett Networked Database. Int J Genomics 2019: 6956934. https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC6458890 / (Accessed July 23, 2024).

[0303] Gadalla KKE, Bailey MES, Spike RC, Ross PD, Woodard KT, Kalburgi SN, Bachaboina L, Deng JV, West AE, Samulski RJ, et al. 2013. Improved survival and reduced phenotypic severity following AAV9 / MECP2 gene transfer to neonatal and juvenile male Mecp2 knockout mice. Mol Ther 21: 18-30.

[0304] Garg SK, Lioy DT, Cheval H, McGann JC, Bissonnette JM, Murtha MJ, Foust KD, Kaspar BK, Bird A, Mandel G. 2013. Systemic Delivery of MeCP2 Rescues Behavioral and Cellular Deficits in Female MouseDocket No. 27013 / 70816 / PCModels of Rett Syndrome. J Neurosci 33: 13612-13620. https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC3755711 / (Accessed July 23, 2024).

[0305] Geary RS, Norris D, Yu R, Bennett CF. 2015. Pharmacokinetics, biodistribution and cell uptake of antisense oligonucleotides. Adv Drug Deliv Rev 87: 46-51.

[0306] Gonzales ML, Adams S, Dunaway KW, LaSalle JM. 2012. Phosphorylation of Distinct Sites in MeCP2 Modifies Cofactor Associations and the Dynamics of Transcriptional Regulation. Mol Cell Biol 32: 2894-2903. https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC3416191 / (Accessed September 26, 2024).

[0307] Good KV, Vincent JB, Ausio J. 2021. MeCP2: The Genetic Driver of Rett Syndrome Epigenetics. Front Genet 12. https: / / www.frontiersin.org / journals / genetics / articles / 10.3389 / fgene.2021.620859 / full (Accessed July 23, 2024).

[0308] Grimm N-B, Lee JT. 2022. Selective Xi reactivation and alternative methods to restore MECP2 function in Rett syndrome. Trends in Genetics 38: 920-943. https: / / www.sciencedirect.com / science / article / pii / S0168952522000075 (Accessed July 23, 2024).

[0309] Guy J, Gan J, Selfridge J, Cobb S, Bird A. 2007. Reversal of neurological defects in a mouse model of Rett syndrome. Science 315: 1143-1147.

[0310] Guy J, Hendrich B, Holmes M, Martin JE, Bird A. 2001. A mouse Mecp2-null mutation causes neurological symptoms that mimic Rett syndrome. Nat Genet 27: 322-326.

[0311] Han K, Gennarino VA, Lee Y, Pang K, Hashimoto-Torii K, Choufani S, Raju CS, Oldham MC, Weksberg R, Rakic P, et al. 2013. Human-specific regulation of MeCP2 levels in fetal brains by microRNA miR-483-5p. Genes Dev 27: 485-490.

[0312] Hansen KF, Sakamoto K, Wayman GA, Impey S, Obrietan K. 2010. Transgenic miR132 Alters Neuronal Spine Density and Impairs Novel Object Recognition Memory. PLOS ONE 5: e15497. https: / / journals.plos.org / plosone / article?id=10.1371 / journal. pone.0015497 (Accessed July 23, 2024).

[0313] He M, Liu Y, Wang X, Zhang MQ, Hannon G, Huang ZJ. 2012. Cell-type based analysis of microRNA profiles in the mouse brain. Neuron 73: 35-48. https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC3270494 / (Accessed September 26, 2024).

[0314] Heckman LD, Chahrour MH, Zoghbi HY. 2014. Rett-causing mutations reveal two domains critical for MeCP2 function and for toxicity in MECP2 duplication syndrome mice ed. C. RosenMund. eLife 3: e02676. https: / / doi.org / 10.7554 / eLife.02676 (Accessed September 12, 2022).

[0315] Hoffmann LF, Martins A, Majolo F, Contini V, Laufer S, Goettert Ml. 2022. Neural regeneration research model to be explored: SH-SY5Y human neuroblastoma cells. Neural Regen Res 18: 1265-1266. https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC9838160 / (Accessed July 24, 2024).Docket No. 27013 / 70816 / PC

[0316] Hong D, Jeong S. 2023. 3'UTR Diversity: Expanding Repertoire of RNA Alterations in Human mRNAs. Mol Cells 46: 48-56. https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC9880603 / (Accessed July 23, 2024).

[0317] Horvath PM, Piazza MK, Kavalali ET, Monteggia LM. 2022. MeCP2 loss-of-function dysregulates microRNAs regionally and disrupts excitatory / inhibitory synaptic transmission balance. Hippocampus 32: 610— 623. https: / / onlinelibrary.wiley.com / doi / abs / 10.1002 / hipo.23455 (Accessed July 23, 2024).

[0318] Hua Y, Sahashi K, Hung G, Rigo F, Passini MA, Bennett CF, Krainer AR. 2010. Antisense correction of SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse model. Genes Dev 24: 1634-1644.

[0319] Ip JPK, Mellios N, Sur M. 2018. Rett syndrome: insights into genetic, molecular and circuit mechanisms. Nat Rev Neurosci 19: 368-382. https: / / www.nature.com / articles / s41583-018-0006-3 (Accessed July 23, 2024).

[0320] Jauhari A, Singh T, Yadav S. 2022. Neurodevelopmental disorders and neurotoxicity: MicroRNA in focus. Journal of Chemical Neuroanatomy 120: 102072. https: / / www.sciencedirect.com / science / article / pii / S0891061822000023 (Accessed July 23, 2024).

[0321] Johnson BS, Zhao YT, Fasolino M, Lamonica JM, Kim YJ, Georgakilas G, Wood KH, Bu D, Cui Y, Goffin D, et al. 2017. Biotin tagging of MeCP2 in mice reveals contextual insights into the Rett syndrome transcriptome. Nat Med 23: 1203-1214. https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC5630512 / (Accessed August 2, 2023).

[0322] Jovicic A, Jolissaint JFZ, Moser R, Santos M de FS, Luthi-Carter R. 2013. MicroRNA-22 (miR-22) Overexpression Is Neuroprotective via General Anti-Apoptotic Effects and May also Target Specific Huntington's Disease-Related Mechanisms. PLOS ONE 8: e54222.https: / / journals.plos.org / plosone / article?id=10.1371 / journal. pone.0054222 (Accessed July 23, 2024).

[0323] Juliano RL, Carver K, Cao C, Ming X. 2013. Receptors, endocytosis, and trafficking: the biological basis of targeted delivery of antisense and siRNA oligonucleotides. Journal of Drug Targeting 21: 27-43. https: / / doi.org / 10.3109 / 1061186X.2012.740674 (Accessed July 23, 2023).

[0324] Jung BP, Jugloff DGM, Zhang G, Logan R, Brown S, Eubanks JH. 2003. The expression of methyl CpG binding factor MeCP2 correlates with cellular differentiation in the developing rat brain and in cultured cells. Journal of Neurobiology 55: 86-96. https: / / onlinelibrary.wiley.com / doi / abs / 10.1002 / neu.10201 (Accessed May 21, 2024).

[0325] Khan AW, Ziemann M, Rafehi H, Maxwell S, Ciccotosto GD, El-Osta A. 2018. MeCP2 interacts with chromosomal microRNAs in brain. Epigenetics 12: 1028-1037. https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC5810764 / (Accessed July 23, 2024).

[0326] Koshkin AA, Singh SK, Nielsen P, Rajwanshi VK, Kumar R, Meldgaard M, Olsen CE, Wengel J. 1998. LNA (Locked Nucleic Acids): Synthesis of the adenine, cytosine, guanine, 5-methylcytosine, thymine and uracilDocket No. 27013 / 70816 / PCbicyclonucleoside monomers, oligomerisation, and unprecedented nucleic acid recognition. Tetrahedron 54: 3607-3630. https: / / www.sciencedirect.com / science / article / pii / S0040402098000945 (Accessed July 23, 2024).

[0327] Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T. 2002. Identification of Tissue-Specific MicroRNAs from Mouse. Current Biology 12: 735-739. https: / / www.cell.com / current-biology / abstract / S0960-9822(02)00809-6 (Accessed September 26, 2024).

[0328] Lamonica JM, Kwon DY, Goffin D, Fenik P, Johnson BS, Cui Y, Guo H, Veasey S, Zhou Z. 2017. Elevating expression of MeCP2 T158M rescues DNA binding and Rett syndrome-like phenotypes. J Clin Invest 127: 1889-1904.

[0329] Li W, Calfa G, Larimore J, Pozzo-Miller L. 2012. Activity-dependent BDNF release and TRPC signaling is impaired in hippocampal neurons of Mecp2 mutant mice. Proc Natl Acad Sci U S A 109: 17087-17092. https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC3479462 / (Accessed September 26, 2024).

[0330] Li W, Pozzo-Miller L. 2014. BDNF deregulation in Rett syndrome. Neuropharmacology 76: 737-746. https: / / www.sciencedirect.com / science / article / pii / S0028390813001202 (Accessed July 23, 2024).

[0331] Lopez-Suarez L, Awabdh SA, Coumoul X, Chauvet C. 2022. The SH-SY5Y human neuroblastoma cell line, a relevant in vitro cell model for investigating neurotoxicology in human: Focus on organic pollutants.NeuroToxicology 92: 131-155. https: / / www.sciencedirect.com / science / article / pii / S0161813X22001231 (Accessed July 23, 2024).

[0332] Luikenhuis S, Giacometti E, Beard GF, Jaenisch R. 2004. Expression of MeCP2 in postmitotic neurons rescues Rett syndrome in mice. Proc Natl Acad Sci U S A 101: 6033-6038.

[0333] Luoni M, Giannelli S, Indrigo MT, Niro A, Massimino L, lannielli A, Passed L, Russo F, Morabito G, Calamita P, et al. 2020. Whole brain delivery of an instability-prone Mecp2 transgene improves behavioral and molecular pathological defects in mouse models of Rett syndrome eds. S. Garel and D.Y. Stainier. eLife 9: e52629. https: / / doi.org / 10.7554 / eLife.52629 (Accessed July 23, 2024).

[0334] Martinowich K, Hattori D, Wu H, Fouse S, He F, Hu Y, Fan G, Sun YE. 2003. DNA methylation-related chromatin remodeling in activity-dependent BDNF gene regulation. Science 302: 890-893.

[0335] Matson K, Macleod A, Mehta N, Sempek E, Tang X. 2023. Impacts of MicroRNA-483 on Human Diseases. Non-Coding RNA 9: 37. https: / / www.mdpi.eom / 2311-553X / 9 / 4 / 37 (Accessed July 23, 2024).

[0336] McCampbell A, Cole T, Wegener AJ, Tomassy GS, Setnicka A, Farley BJ, Schoch KM, Hoye ML, Shabsovich M, Sun L, et al. 2018. Antisense oligonucleotides extend survival and reverse decrement in muscle response in ALS models. J Clin Invest 128: 3558-3567.

[0337] McGowan H, Pang ZP. 2015. Regulatory functions and pathological relevance of the MECP23'UTR in the central nervous system. Cell Regen 4: 9.Docket No. 27013 / 70816 / PC

[0338] Mellios N, Feldman DA, Sheridan SD, Ip JPK, Kwok S, Amoah SK, Rosen B, Rodriguez BA, Crawford B, Swaminathan R, et al. 2018. MeCP2-regulated miRNAs control early human neurogenesis through differential effects on ERK and AKT signaling. Mol Psychiatry 23: 1051-1065. https: / / www.nature.com / articles / mp201786 (Accessed July 17, 2024).

[0339] Merritt JK, Collins BE, Erickson KR, Dong H, Neul JL. 2020. Pharmacological read-through of R294X Mecp2 in a novel mouse model of Rett syndrome. Hum Mol Genet 29: 2461-2470.

[0340] Miller T, Cudkowicz M, Shaw PJ, Andersen PM, Atassi N, Bucelli RC, Genge A, Glass J, Ladha S, Ludolph AL, et al. 2020. Phase 1-2 Trial of Antisense Oligonucleotide Tofersen for SOD1 ALS. New England Journal of Medicine 383: 109-119. https: / / www.nejm.org / doi / full / 10.1056 / NEJMoa2003715 (Accessed July 23, 2024).

[0341] Na ES, Nelson ED, Adachi M, Autry AE, Mahgoub MA, Kavalali ET, Monteggia LM. 2012. A mouse model for MeCP2 duplication syndrome: MeCP2 overexpression impairs learning and memory and synaptic transmission. J Neurosci 32: 3109-3117.

[0342] Natera-Naranjo O, Aschrafi A, Gioio AE, Kaplan BB. 2010. Identification and quantitative analyses of microRNAs located in the distal axons of sympathetic neurons. RNA 16: 1516-1529. https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC2905752 / (Accessed September 26, 2024).

[0343] Neul JL, Fang P, Barrish J, Lane J, Caeg E, Smith EC, Zoghbi H, Percy A, Glaze DG. 2008. Specific Mutations in Methyl-CpG-Binding Protein 2 Confer Different Severity in Rett Syndrome. Neurology 70: 1313— 1321.

[0344] Obad S, dos Santos CO, Petri A, Heidenblad M, Broom O, Ruse C, Fu C, Lindow M, Stenvang J, Straarup EM, et al. 2011. Silencing of microRNA families by seed-targeting tiny LNAs. Nat Genet 43: 371-378. https: / / www.nature.com / articles / ng.786 (Accessed July 23, 2024).

[0345] Palmieri M, Pozzer D, Landsberger N. 2023. Advanced genetic therapies for the treatment of Rett syndrome: state of the art and future perspectives. Front Neurosci 17. https: / / www.frontiersin.Org / journals / neuroscience / articles / 10.3389 / fnins.2023.1172805 / full (Accessed July 23, 2024).

[0346] Passini MA, Bu J, Richards AM, Kinnecom C, Sardi SP, Stanek LM, Hua Y, Rigo F, Matson J, Hung G, et al. 2011. Antisense oligonucleotides delivered to the mouse CNS ameliorate symptoms of severe spinal muscular atrophy. Sci Transl Med 3: 72ra18.

[0347] Pejhan S, Del Bigio MR, Rastegar M. 2020. The MeCP2E1 / E2-BDNF-miR132 Homeostasis Regulatory Network Is Region-Dependent in the Human Brain and Is Impaired in Rett Syndrome Patients. Front Cell Dev Biol 8. https: / / www.frontiersin.org / journals / cell-and-developmental-biology / articles / 10.3389 / fcell.2020.00763 / full (Accessed July 23, 2024).Docket No. 27013 / 70816 / PC

[0348] Rastegar-Moghaddam SH, Ebrahimzadeh-Bideskan A, Shahba S, Malvandi AM, Mohammadipour A.2022. MicroRNA-22: a Novel and Potent Biological Therapeutics in Neurological Disorders. Mol Neurobiol 59: 2694-2701.

[0349] Rodrigues DC, Mufteev M, Ellis J. 2020. Regulation, diversity and function of MECP2 exon and 3'UTR isoforms. Hum Mol Genet 29: R89-R99.

[0350] Sambandan S, Akbalik G, Kochen L, Rinne J, Kahlstatt J, Glock C, Tushev G, Alvarez-Castelao B, Heckel A, Schuman EM. 2017. Activity-dependent spatially localized miRNA maturation in neuronal dendrites. Science 355: 634-637. https: / / doi.org / 10.1126 / science.aaf8995 (Accessed September 26, 2024).

[0351] Santos M, Yan J, Temudo T, Oliveira G, Vieira JP, Fen J, Sommer S, Maciel P. 2008. Analysis of highly conserved regions of the 3'UTR of MECP2 gene in patients with clinical diagnosis of Rett syndrome and other disorders associated with mental retardation. Dis Markers 24: 319-324.

[0352] Schmid DA, Yang T, Ogier M, Adams I, Mirakhur Y, Wang Q, Massa SM, Longo FM, Katz DM. 2012. A TrkB Small Molecule Partial Agonist Rescues TrkB Phosphorylation Deficits and Improves Respiratory Function in a Mouse Model of Rett Syndrome. J Neurosci 32: 1803-1810. https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC3710112 / (Accessed September 26, 2024).

[0353] Senichkin W, Prokhorova EA, Zhivotovsky B, Kopeina GS. 2021. Simple and Efficient Protocol for Subcellular Fractionation of Normal and Apoptotic Cells. Cells 10: 852. https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC8069826 / (Accessed July 23, 2024).

[0354] Shang R, Lee S, Senavirathne G, Lai EC. 2023. microRNAs in action: biogenesis, function and regulation. Nat Rev Genet 24: 816-833. https: / / www.nature.com / articles / s41576-023-00611-y (Accessed July 23, 2024).

[0355] Shao Y, Bajikar SS, Tirumala HP, Gutierrez MC, Wythe JD, Zoghbi HY. 2021. Identification and characterization of conserved noncoding cis-regulatory elements that impact Mecp2 expression and neurological functions. Genes & Development 35: 489. https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC8015713 / (Accessed July 24, 2024).

[0356] Sinnett SE, Boyle E, Lyons C, Gray SJ. 2021. Engineered microRNA-based regulatory element permits safe high-dose miniMECP2 gene therapy in Rett mice. Brain 144: 3005-3019. https: / / doi.org / 10.1093 / brain / awab182 (Accessed July 23, 2024).

[0357] Sinnett SE, Hector RD, Gadalla KKE, Heindel C, Chen D, Zaric V, Bailey MES, Cobb SR, Gray SJ. 2017. Improved MECP2 Gene Therapy Extends the Survival of MeCP2-Null Mice without Apparent Toxicity after Intracisternal Delivery. Molecular Therapy Methods & Clinical Developments: 106-115. https: / / www.cell.com / molecular-therapy-family / methods / abstract / S2329-0501 (17)30061 -X (Accessed July 23, 2024).Docket No. 27013 / 70816 / PC

[0358] Stappert L, Roese-Koerner B, Briistle 0. 2015. The role of microRNAs in human neural stem cells, neuronal differentiation and subtype specification. Cell Tissue Res 359: 47-64. https: / / doi.org / 10.1007 / s00441-014-1981 -y (Accessed September 26, 2024).

[0359] Szulwach KE, Li X, Smrt RD, Li Y, Luo Y, Lin L, Santistevan NJ, Li W, Zhao X, Jin P. 2010. Cross talk between microRNA and epigenetic regulation in adult neurogenesis. Journal of Cell Biology 189: 127-141. https: / / doi.org / 10.1083 / jcb.200908151 (Accessed July 17, 2024).

[0360] Tong D, Zhang J, Wang X, Li Q, Liu L, Lu A, Guo B, Yang J, Ni L, Qin H, et al. 2020. MiR-22, regulated by MeCP2, suppresses gastric cancer cell proliferation by inducing a deficiency in endogenous S-adenosylmethionine. Oncogenesis 9: 1-16. https: / / www.nature.com / articles / s41389-020-00281-z (Accessed July 23, 2024).

[0361] Tsujimura K, Irie K, Nakashima H, Egashira Y, Fukao Y, Fujiwara M, Itoh M, Uesaka M, Imamura T, Nakahata Y, et al. 2015. miR-199a Links MeCP2 with mTOR Signaling and Its Dysregulation Leads to Rett Syndrome Phenotypes. Cell Rep 12: 1887-1901.

[0362] Urdinguio RG, Fernandez AF, Lopez-Nieva P, Rossi S, Huertas D, Kulis M, Liu C-G, Croce CM, Calin GA, Esteller M. 2010. Disrupted microRNA expression caused by Mecp2 loss in a mouse model of Rett syndrome. Epigenetics 5: 656-663. https: / / www.tandfonline.eom / doi / full / 10.4161 / epi.5.7.13055 (Accessed July 23, 2024).

[0363] Vermudez SAD, Gogliotti RG, Arthur B, Buch A, Morales C, Moxley Y, Rajpal H, Conn PJ, Niswender CM. 2021. Profiling beneficial and potential adverse effects of MeCP2 overexpression in a hypomorphic Rett syndrome mouse model. Genes Brain Behav 21: e12752. https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC8599502 / (Accessed July 23, 2024).

[0364] Vester B, Wengel J. 2004. LNA (Locked Nucleic Acid): High-Affinity Targeting of Complementary RNA and DNA. Biochemistry 43: 13233-13241. https: / / doi.org / 10.1021 / bi0485732 (Accessed July 23, 2024).

[0365] Woo J-S, Kim VN. 2014. MeCP2 Caught Moonlighting as a Suppressor of MicroRNA Processing. Developmental Cell 28: 477-478. https: / / www.cell. com / developmental-cell / abstract / S1534-5807(14)00131 -2 (Accessed July 17, 2024).

[0366] Wu H, Tao J, Chen PJ, Shahab A, Ge W, Hart RP, Ruan X, Ruan Y, Sun YE. 2010. Genome-wide analysis reveals methyl-CpG-binding protein 2-dependent regulation of microRNAs in a mouse model of Rett syndrome. Proceedings of the National Academy of Sciences 107: 18161-18166. https: / / www.pnas.org / doi / abs / 10.1073 / pnas.1005595107 (Accessed July 23, 2024).

[0367] Ye Y, Xu H, Su X, He X. 2016. Role of MicroRNA in Governing Synaptic Plasticity. Neural Plasticity 2016: 4959523. https: / / onlinelibrary.wiley.com / doi / abs / 10.1155 / 2016 / 4959523 (Accessed July 23, 2024).

[0368] Zhou Z, Hong EJ, Cohen S, Zhao W, Ho HH, Schmidt L, Chen WG, Lin Y, Savner E, Griffith EC, et al.2006. Brain-Specific Phosphorylation of MeCP2 Regulates Activity-Dependent Bdnf Transcription, DendriticDocket No. 27013 / 70816 / PCGrowth, and Spine Maturation. Neuron 52: 255-269. https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC3962021 / (Accessed September 25, 2024).

Claims

1. Docket No. 27013 / 70816 / PCWhat is claimed is:

1. An antisense oligonucleotide capable of binding to a miRNA binding site of a methyl CpG binding protein 2 (MeCP2) pre-mRNA, wherein the miRNA binding site is a miR181 binding site and wherein said antisense oligonucleotide prevents miR181 from repressing expression of MeCP2.

2. An antisense oligonucleotide comprising the sequence 5' ACAGGTACATTCAGACAGGTTT 3' (SEQ ID NO: 1).

3. An antisense oligonucleotide comprising a sequence that is at least 80% identical to SEQ ID NO: 1, wherein said oligonucleotide is capable of binding to a miRNA181 binding site of a MeCP2 pre-mRNA and wherein said antisense oligonucleotide prevents miR181 from repressing expression of MeCP2.

4. An antisense oligonucleotide of according to any one of claims 1-3, wherein said antisense oligonucleotide is at least 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length.

5. An antisense oligonucleotide of according to any one of claims 1-4, wherein said antisense oligonucleotide is sufficiently complementary to a region of a target RNA and is capable of forming a complex with the target RNA.

6. An antisense oligonucleotide of according to any one of claims 1-5, wherein said antisense oligonucleotide is isolated or purified.

7. An antisense oligonucleotide of according to any one of claims 1-6, wherein each nucleotide of the oligonucleotide comprises a nucleobase, a sugar, and an internucleotide linkage.

8. An antisense oligonucleotide of according to claim 7, wherein one or more sugars are selected from 2'-methoxy-ribose, 2'-MOE-ribose, 2'-deoxy-2'-fluororibose, 2'-fluoro-arabinose, 2-methoxy-arabinose, 2'deoxyribose and a locked nucleic acid (LNA).

9. An antisense oligonucleotide of according to claim 8, wherein all sugars are 2'-MOE-ribose.

10. An antisense oligonucleotide of according to claim 7, wherein one or more internucleotide linkages of the oligonucleotide are phosphorothioate or phosphoramidate linkages.

11. An antisense oligonucleotide of according to claim 10, wherein all internucleotide linkages are phosphorothioate linkages.

12. An antisense oligonucleotide of according to claim 7, wherein one or more nucleobases are naturally occurring nucleobases.

13. An antisense oligonucleotide of according to claim 7, wherein one or more nucleobases are modified nucleobases selected from isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil, 5-thiazolo-uracil, 2-thio-uracil, pseudouracil, 1 -methylpseudouracil, 5-methoxyuracil, 2'-thio-thymine, hypoxanthine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.

14. An antisense oligonucleotide of according to any one of claim 1-13, wherein the antisense oligonucleotide has a GalNAc moiety at the 5' end.

15. An antisense oligonucleotide of according to any one of 1-14, wherein the antisense oligonucleotide has a GalNAc moiety at the 3' end.

16. An antisense oligonucleotide of according to any one of claim 1-15, wherein all sugars are 2'-MOE-ribose and all internucleotide linkages are phosphorothioate linkages.Docket No. 27013 / 70816 / PC17. An antisense oligonucleotide comprising the sequence 5' ACAGGTACATTCAGACAGGTTT 3' (SEQ ID NO: 1), wherein all sugars are 2'-MOE-ribose and all internucleotide linkages are phosphorothioate linkages.

18. An antisense oligonucleotide of according to any one of claim 1-17, wherein the antisense oligonucleotide has a half-life of at least 6 months in a subject.

19. A pharmaceutical composition comprising an antisense oligonucleotide of any one of claim 1-18 and a pharmaceutically acceptable excipient, carrier and / or diluents.

20. A pharmaceutical composition comprising an antisense oligonucleotide of any one of claims 1-19, comprising PBS and / or an artificial cerebrospinal fluid (CSF) solution.

21. The pharmaceutical composition of any one of claims 1-20, wherein the antisense oligonucleotide is formulated in a liposome or a lipid nanoparticle (LNP).

22. A kit to treat or ameliorate the effects of a disease associated with reduced MeCP2 expression in a subject, the kit comprising at least an antisense oligonucleotide according to any one of claims 1-18, packaged in a suitable container, together with instructions for its use.

23. A kit to treat or ameliorate the effects of a disease associated with reduced MeCP2 expression in a subject, the kit comprising at least an antisense oligonucleotide according to any one of claims 1-18, packaged in a suitable container, together with instructions for its use, wherein the disease is selected from Rett syndrome (RTT), Pitt Hopkins Syndrome, CDKL5-deficiency disorder, Alzhimers disease, Parkinsons disease, idiopathic autism, and cancer.

24. The kit according to claim 23 wherein the disease is RTT.

25. A method of increasing expression of MeCP2, said method comprising administering an antisense oligonucleotide according to any one of claims 1-18 or a composition according to any one claims 19-21 to a subject in need thereof.

26. The method according to claim 25, wherein MeCP2 is a wild-type MeCP2 or a mutant MeCPT.

27. The method according to claim 26, wherein the MeCP2 is a mutant MeCP2 and comprises one or more mutations elected from R106W, R111G, R133C, R294X, T158M, R168X, R270X, R255X, and / or R306C.

28. A method of treating a disease or disorder associated with reduced expression of MeCP2, said method comprising administering an antisense oligonucleotide according to any one of claims 1-18 or a composition according to any one claims 19-21 to a subject in need thereof.

29. A method of treating a disease or disorder associated with expression of MeCP2, said method comprising administering an antisense oligonucleotide according to any one of claims 1-18 or a composition according to any one claims 19-21 to a subject in need thereof, wherein the disease or disorder is selected from Rett syndrome (RTT), Pitt Hopkins Syndrome, CDKL5-deficiency disorder, Alzhimers disease, Parkinsons disease, idiopathic autism, and cancer.

30. The method according to claim 29 wherein the disease or disorder is RTT.

31. The method according to any one of claims 25-30, wherein the subject is additionally administered an insulin-like growth factor 1 (IGF-1 ) mimetic, a gene therapy, a protein replacement therapy, a mRNA therapy, or a gene editing therapy.

32. The method according to claim 31, wherein the subject is administered Trofinetide.

33. The method according to any one of claims 25-32, wherein the subject is administered 2 or more antisense oligonucleotides capable of binding to a miRNA binding site of a methyl CpG binding protein 2Docket No. 27013 / 70816 / PC(MeCP2) pre-mRNA, wherein the miRNA binding site is located in the 3' untranslated region (3’UTR) of the MeCP2 pre-mRNA.

34. A method of interfering with miRNAI 81 -associated repression of MeCP2, said method comprising administering an antisense oligonucleotide according to any one of claims 1-18 or a composition according to any one claims 19-21 to a subject in need thereof.