METHODS AND COMPOSITIONS RELATED TO CITYRNA CLEAVAGE OF mRNA

Abstract

Cleavage-inducing tinyRNA (cityRNA)-dependent gene silencing heavily relies on target cleavage. cityRNAs can be designed to preferentially silence the mRNA of a mutant target nucleic acid over its wild type mRNA counterpart.

Description

[0001] Atorney Docket No. 103362-059WO1 METHODS AND COMPOSITIONS RELATED TO CITYRNA CLEAVAGE OF mRNA STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0002] This invention was made with Government Support under Grant No. R01 GM138997 awarded by the National Institutes of Health. The Government has certain rights in the invention.

[0003] CROSS-REFERENCE TO RELATED APPLICATIONS

[0004] This application claims benefit of U.S. Provisional Application No. 63 / 765,142, filed February 28, 2025, and U.S. Provisional Application No. 63 / 790,341, filed April 17, 2025, and U.S. Provisional Application No. 63 / 867,179, filed August 20, 2025, and U.S. Provisional Application No. 63 / 917,440, filed November 14, 2025, all of which are hereby incorporated herein by reference in their entirety.

[0005] SEQUENCE LISTING A Sequence Listing conforming to the rules of WIPO Standard ST.26 is hereby incorporated by reference. Said Sequence Listing has been filed as an electronic document via PatentCenter encoded as XML in UTF-8 text. The electronic document, created on February 26, 2026, is entitled “103362-059W01_ST26.xml”, and is 125,663 bytes in size.

[0006] BACKGROUND

[0007] The Argonaute protein family (AGO) plays a central role in RNA silencing processes as essential components of the RNA-induced silencing complex (RISC). RISC is responsible for the gene silencing phenomenon known as RNA interference (RNAi). Small interfering RNAs (siRNAs) and AGOs form RISCs that bind to specific mRNAs and repress the gene expression. siRNAs recruit the AGOs to target mRNAs, which depends on the base complementarity between the siRNA and the target. When siRNAs are loaded into human AGO1, AGO3, or AGO4, they induce slicer-independent gene silencing through translational repression or mRNA destabilization (e.g., deadenylation). When siRNAs are incorporated into AGO2, there are roughly two pathways. The AGO2-RISC causes the slicer-independent gene silencing, like the other AGOs, when the siRNA and the target mRNA form partial base pairing. In addition, the AGO2-RISC directly cleaves the target mRNA when the target sequence is perfectly (or nearly perfectly) complementary to the siRNA. Therefore, even though an siRNA is designed to be fully complementary to the target site, it could also bind to other partially complementary mRNAs,Atorney Docket No. 103362-059WO1 causing undesired slicer-independent gene silencing. This off-target issue has been a long-standing problem of siRNA application for therapeutics (Fig. 1).

[0008] In contrast, AG02 and AG03 loaded with cleavage-inducing tiny guide RNAs (cityRNAs), which form cityRNA-loaded RISCs (cityRISCs), recognize target RNAs differently from their siRNA-bound counterparts. CityRISCs can cause sufficient gene silencing only when two requirements are satisfied. First, the target site must be fully complementary to the cityRNA. Second, the upstream region of the tinyRNA-target site (UTy) must not be recognized by the AGO of the cityRISC. Both requirements were reported (Zhang et al., Cell Rep. 2024).

[0009] What is needed in the art are cityRNA-unique features to target single-nucleotide polymorphisms (SNP) and other mutations found in nucleic acid.

[0010] SUMMARY

[0011] Disclosed herein is a composition comprising a cityRISC, wherein said cityRISC comprises a cityRNA and an AGO molecule, wherein the cityRNA is complementary to a specific target site in a target nucleic acid, and further wherein the cityRNA preferentially cleaves the target site compared to a nucleic acid with a one or two nucleotide difference at a defined position in the target site (Figure 2).

[0012] Also disclosed herein is a method of cleaving a nucleic acid with a SNP, the method comprising: a) providing a composition comprising a cityRISC, wherein said cityRISC comprises a cityRNA and an AGO molecule, wherein the cityRNA is complementary to a SNP of a target nucleic acid, and further wherein the cityRNA preferentially cleaves the SNP compared to a corresponding wild-type (WT) nucleic acid; and b) exposing the SNP to the cityRISC, thereby cleaving the SNP.

[0013] A method of treating or preventing a disease or disorder in a subject, wherein the disease or disorder is a result of a genetic mutation; the method comprising administering to the subject a composition comprising a cityRISC, wherein said cityRISC comprises a cityRNA and an AGO molecule, wherein the cityRNA is complementary to a specific target site in a target nucleic acid, and further wherein the cityRNA preferentially cleaves the target site compared to a nucleic acid with a one or two nucleotide difference at a defined position in the target site, wherein the target site comprises the genetic mutation, thereby treating or preventing the disease or disorder associated with the genetic mutation.Atorney Docket No. 103362-059WO1 BRIEF DESCRIPTION OF FIGURES

[0014] The accompanying figures, which are incorporated in and constitute a part of this specification, illustrate several aspects described below.

[0015] Figure 1 shows cityRNA-dependent silencing heavily relies on target cleavage. MiRNA-loaded RISCs cause gene silencing through three different pathways: Translational repression, mRNA destabilization, and direct target cleavage. Even though siRNAs are designed to be fully complementary to the target mRNA, they bind to other undesired mRNAs, which is known as an off-target issue. In contrast, it was found that cityRNAs cause gene silencing heavily depending on the target cleavage rather than translational repression or mRNA destabilization.

[0016] Figures 2A-2C show 2-nucleotide (nt) mismatches at target nucleotide positions 10-11 (tlO-tl 1) ruin the target cleavage by cityRISCs. (A) shows (Top) 14-nt let-7a (bottom strand) and 7a*-20a' target RNA (top strand) used in (A-C) (7a1: 14-nt let-7a tinyRNA-binding site highlighted. 20au: Uty whose sequence is complementary to miR-20a). The tlO-tll mismatches incorporated in the target (upper right) are shown. (Bottom) Homogeneous AGO3: 14-nt let-7a, AGO2: 14-nt let-7a, or AGO2:21-nt let-7a was incubated with the 5'-end radiolabeled 7at-20aI, or the corresponding tlO-tl 1 mismatched targets for 0.5, 20, and 40 min. The reactions were resolved on denaturing gels. (B) shows either of the target sites used in (A) was incorporated in the 3' untranslated region (3'UTR) of the Renilla luciferase reporter gene in the psiCHECK-2 plasmid. The resultant plasmid is named psiCHECK-7at-20au. (C) shows reliance of cityRISC-driven gene silencing on target cleavage. Dual-luciferase reporter assays (DLRAs) were performed in four cell lines, HET293T, HCT116, A549, and HeLa, co-transfected with psiCHECK-7at-20au, including a fully complementary (bars in dark colors with “F” underneath) or tlO-tl 1 mismatched tyRNA target site (bars in light colors with “M” underneath) and an siRNA duplex, cyBR-7am, or cyDR-7am. Data are shown as relative luciferase activity and normalized to no-guide control. Data are depicted as mean ± SD (n = 3 biological replicates). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 (ANOVA with Dunnett’s post hoc test). It is noted that the superscript “m" (as in cyBR-7am) means that every single nucleotide is modified (Zhang, Huaqun et al. Cell Reports, Volume 43, Issue 10, 114806).

[0017] Figures 3A-3C show a model mechanism of cleaving three different targets by cityRISC. (A) recognition of a target lacking a UTy by cityRISC. This state reflects the current structure (Fig. 5 A). The tapered central cleft inhibits the bound target from continuing to pair with the postseed region (i.e., guide nucleotide positions 9-14, (g9-gl4)), which bends the target between t9 and tlO and directs the tl2 to tl4 towards the PAZ domain. Without a UTy, the target does not have enough dynamics to bind the tl 1 -tl4 in the vicinity of the post-seed region. (B) RecognitionAtorney Docket No. 103362-059WO1 of a 20au-like UTy by city RISC. The 20au-like UTy barely interacts with a UTy-binding site on AGO. The resultant dynamic movement of UTy allows the target to quickly form a duplex with the cityRNA, thereby drastically facilitating the catalytic reaction. (C) Recognition of a 7au-like UTy by cityRISC. The 7au-like UTy interacts with the UTy-binding site, which prevents the downstream t9-tl4 from quickly pairing with the post-seed region (g9-gl4). As a result, the 7au-like UTy barely or moderately enhances the catalytic reaction.

[0018] Figure 4 shows the most common KRAS mutations in all cancers, lung cancer, colon cancer, and pancreatic cancer..

[0019] Figures 5A-5F show the structure of target-bound AG03 -cityRISC and the previously determined structure of AG02 mature RISC with and without target. (A) Crystal structure of AGO3:14-nt miR-20a in complex with a 16-nt target RNA. The structure of AG03 is depicted as a ribbon model. The sequence complementarity between the guide and target is shown. The base pairings observed in the structure are shown as black lines, while nucleotides with disordered electron density maps are underscored. An asterisk (*) indicates a phosphorothioate bond between tlO and tl 1. The U at tl 1 has a 2'-O-methyl group. (B) Superposition of AG03 : 14-nt miR-20a and AG03 with full-length miRNA (grey) (PDB ID: 5VM9). Their RMSD is 4.553 A over 775 Ca atoms. Differences in a7 and guide RNA movement are highlighted in the inset at the bottom. For clarity, the guide and target are not shown on the top. (C) Superposition of four crystal structures of AG02-mature RISC in State I (PDB ID: 40LA), State II (PDB ID: 4W5O), State III (PDB ID: 6N4O), and State IV (PDB ID: 6MDZ) on their PIWI domains. (D) Superposition of the current AG03 structure with the AG02 structure in State III (PDB ID: 6N4O). (E-F) Different trajectories of the guide-target duplexes in the current AG03 structure (E) and in State II of AG02-mature RISC (PDB ID: 4W5O) (F).

[0020] Figures 6A-6K show that the existence of an unpaired target region upstream of the tyRNA-target site enhances target cleavage by cityRISCs. (A-D and F-G) Single-turnover cleavage assays of different-length targets by homogeneous AG03: 14-nt miR-20a (A-B) (SEQ ID NOS: 25-29 and 18, from top to bottom), AGO3:14-nt let-7a (C-D) (SEQ ID NOS: 30-34 and 19, from top to bottom), AGO2: 14-nt miR-20a (F), and AGO2: 14-nt let-7a (G). (E) Binding isotherms of the indicated four tyRNA-associated RISCs with targets whose sequences are fully complementary to their parental miRNAs. (H) Base pairing of 23 -nt miR-20a with 14-, 16-, 18-, 20-, and 23-nt complementary targets (SEQ ID NOS: 25-28 from top to bottom). (I) Time course of different-length target cleavage by homogeneous AGO2:23-nt miR-20a. (I) Base pairing of 21-nt let-7a with 14-, 16-, 18-, 20-, and 21-nt complementary targets (SEQ ID NOS: 30-34 from top to bottom). (K) Time course of different-length target cleavage by homogeneous AGO2:21-nt let-Atorney Docket No. 103362-059WO1 7a. Target RNA lengths shown in B, D, F, G, I, and K do not include the two 3' end adenylates (grey) depicted in A, C, H, and J. Initial velocities, Vo, were determined by fitting the data to a single exponential. For all cleavage assays in this figure, [target] = 2.5 nM. [RISC] = 10 nM. Data are depicted as mean ± SD (n=3 technical replicates).

[0021] Figure 7 shows passenger RNA for siKRAS(G12C) (SEQ ID NO: 3). The passenger RNA forms a 20-nt perfectly complementary stem with siKRAS(G12C) (SEQ ID NO: 4), and the resultant duplex has a 3' 2-nt overhang at each terminus. This passenger has a 5'-OH. “p” stands for a 5 '-end monophosphate group.

[0022] Figure 8 shows specific nucleotides of siRNA enhancing the target cleavage by human AGO2. The figure was adopted from Wang and Bartel Mol. Cell 2024.

[0023] Figure 9 shows cityRNA targeting KRAS (G12C) (cyKRAS(G12C)). The gl-gl4 of cyKRAS(G12C) (SEQ ID NO: 7) was designed as follows so that it would fully pair with the KRAS (G12C) target (SEQ ID NO: 2) but has one nucleotide mismatch with the KRAS (WT) (SEQ ID NO: 1) target.

[0024] Figures 10A-10B show cyBRD-KRAS(G12C) and cyDRR-KRAS(G12C). The superscript “D” of cyBRDmeans that the hairpin passenger is DNA, while the superscript “R” of cyDRR-means that the focy and passenger are RNA. In cyBRD-KRAS(G12C), there is a nick between C at cyKRAS(G12C) position 14 (SEQ ID NO: 7) and G at Booster position 1 (SEQ ID NO: 8). Therefore, cyBRD-KRAS(G12C) is composed of two separate RNA and DNA oligonucleotides. A tetraloop of GTAA is highlighted in bold. The cyDRRconstruct is composed of three separate RNAs; a 14-nt cityRNA, an 11-nt following of the cityRNA (focy, / ’fou.si / ), and a 25-nt passenger. There is a nick between C at cyKRAS(G12C) position 14 and G at position 1 of the focy. SEQ ID NOS: 7, 65, and 69 are shown (numbered consecutively)

[0025] Figure 11 shows the mRNA fragment of KRAS(WT) (SEQ ID NO: 5) or KRAS(G12C) (SEQ ID NO: 6) was cloned into the 3' untranslated region (3'UTR) of the Renilla Luciferase of psiCHECK-2 reporter plasmid. The mutation site and the corresponding nucleotide position in WT are shown in bold lowercase.

[0026] Figure 12 shows cityRNA preferentially silenced KRAS(G12C) over (WT) in HCT116 cells. The relative luciferase activities when encoding a fragment of KRAS(WT) or KRAS(G12C) in the 3'UTR of the Renilla luciferase gene are shown as (W) and (M), respectively. The Renilla luciferase activity was normalized by Firefly luciferase activity. siKRAS \p = 0.9556] had n = 11 with 4 biological replicates, while cyBRD\p < 0.0001] and cyDRR\p < 0.0001] had n = 13 and 3 with 5 and 1 biological replicates, respectively. Data are shown as relative luciferase activity normalized to a control without a guide and depicted as mean±SD. Statistical analyses wereAtorney Docket No. 103362-059WO1 performed using GraphPad Prism (version 10.4.1) with a two-way ANOVA test (Sidak's multiple comparison).

[0027] Figure 13 shows the design of 22-nt siRNA for the KRAS (G12A) mRNA (SEQ ID NO: 10). siRNA targeting KRAS (G12A) (siKRAS(G12A)), SEQ ID NO: 9. This siRNA exemplifying the conventional ~22-nt siRNAs was used as a control.

[0028] Figure 14 shows passenger RNA for siKRAS(G12A) (SEQ ID NO: 4). The passenger RNA forms a 20-nt perfectly complementary stem with siKRAS(G12A) (SEQ ID NO: 3), and the resultant duplex has a 3' 2-nt overhang at each terminus.

[0029] Figure 15 shows cityRNA targeting KRAS (G12A) (cyKRAS(G12A)), SEQ ID NO: 9 (wild type is SEQ ID NO: 1). The gl-gl4 of cyKRAS(G12A) shares the same with that of siKRAS(G12A).

[0030] Figures 16A-16B show (A) cyBRD-KRAS(G12A) and (B) cyDRR-KRAS(G12A). In the cyBRDconstruct there is a nick between C at cyKRAS(G12A) position 14 and G at Booster position 1 (SEQ ID NO: 9). Therefore, cyBRD-KRAS(G12A) is composed of separate RNA and DNA oligonucleotides. A tetraloop of GTAA is highlighted in bold. Booster is SEQ ID NO: 8. The cyDRRconstruct is composed of three separate RNAs; a 14-nt cityRNA, an 11-nt following of the cityRNA (focy, / 'fou.si / ), and a 25-nt passenger. There is a nick between C at cyKRAS(G12A) position 14 and G at position 1 of the focy. SEQ ID NOS: 12, 48, and 53 are shown (numbered consecutively).

[0031] Figure 17 shows the design of KRAS(WT) (SEQ ID NO: 11) and KRAS(G12A) reporter genes (SEQ ID NO: 12). The fragment of KRAS(WT) or KRAS(G12A) was cloned into the 3'UTR of the Renilla Luciferase of psiCHECK-2 reporter plasmid.

[0032] Figure 18 shows optimizing cityRNAs for the KRAS (G12A) mRNA (SEQ ID NO: 14). cityRNA targeting KRAS (G12A) A to G mutation at g2 (cyKRAS(G12A)g2G) is shown (WT SEQ ID NO: 1, SEQ ID NO: 9).

[0033] Figure 19 shows cyBRD-KRAS(G12A)g2G. There is a nick between C at cyKRAS(G12A)g2G (SEQ ID NO: 14) position 14 and G at Booster position 1 (SEQ ID NO: 15). Therefore, cyBRD-KRAS(G12A)g2G is composed of separate RNA and DNA oligonucleotides. A tetraloop of GTAA is highlighted in bold.

[0034] Figure 20 shows optimizing cityRNA for the KRAS (G12A) mRNA. cityRNA targeting KRAS (G12A) A to G mutation at glO (cyKRAS(G12A)glOG) is shown (SEQ ID NO: 16, WT is SEQ ID NO: 1).

[0035] Figure 21 shows cyBRD-KRAS(G12A)glOG. There is a nick between C at cyKRAS(G12A)glOG position 14 and G at Booster position 1. Therefore, cyBRD-Atorney Docket No. 103362-059WO1 KRAS(G12A)glOG is composed of separate RNA and DNA oligonucleotides. A tetraloop of GTAA is highlighted in bold. SEQ ID NO: 14 is the mutant, SEQ ID NO: 17 is the Booster.

[0036] Figure 22 shows cityRNA preferentially silenced KRAS(G12A) over (WT). The relative luciferase activities when encoding a fragment of KRAS(WT) or KRAS(G12A) in the 3'UTR of the Renilla luciferase gene are shown as (W) and (M), respectively. The Renilla luciferase activity was normalized by Firefly luciferase activity. siRNA \p = 0.3624], cyBRD\p < 0.0001], and cyDRR\p < 0.0001] targeting KRAS(G12A) at t8C are shown. Data are shown as relative luciferase activity normalized to a control without a guide and depicted as mean±SD across 4 (n = 9; siRNA), 5 (n = 9; cyBRD) or 3 (n = 8; cyDRR) biological replicates. Statistical analyses were performed using GraphPad Prism (version 10.4.1) with a two-way ANOVA test (Sidak's multiple comparison).

[0037] Figure 23 shows optimized cityRNA specifically silenced KRAS(G12A) but not (WT). The relative luciferase activities when encoding a fragment of KRAS(WT) or KRAS(G12A) in the 3'UTR of the Renilla luciferase gene are shown as (W) and (M), respectively. The Renilla luciferase activity was normalized by Firefly luciferase activity. cityRNA optimized with a mismatch (+ 1 mm) at g2G \p < 0.0001] or glOG \p < 0.0001] are shown. Data are shown as relative luciferase activity normalized to a control without a guide and depicted as mean±SD across 2 (n = 4) biological replicates. Statistical analyses were performed using GraphPad Prism (version 10.4.1) with a two-way ANOVA test (Sidak's multiple comparison).

[0038] Figure 24 shows 14-nt cyKRAS (G12V, SEQ ID NO: 22) hybridized with the WT and with KRAS (G12V) mRNAs (SEQ ID NO: 24)

[0039] Figure 25 shows that cityRNA preferentially silences KRAS(G12V) over (WT). The relative luciferase activities when encoding a fragment of KRAS(WT) or KRAS(G12V) in the 3'UTR of the Renilla luciferase gene are shown as (W) and (M), respectively. The Renilla luciferase activity was normalized by Firefly luciferase activity. siKRAS \p = 0.9984], cyBRD\p < 0.0001], and cyDRR\p < 0.0001] had n = 7, 11, and 7 across 3, 4, and 3 biological replicates, respectively. Data are shown as relative luciferase activity normalized to a control without a guide and depicted as mean±SD. Statistical analyses were performed using GraphPad Prism (version 10.4.1) with a two-way ANOVA test (Sidak's multiple comparison).

[0040] Figure 26 shows the mechanism that mutations on ABCA4 gene cause Stargardt disease. ABCR is the protein produced from ABCA4. A) Cases of Stargardt disease have been characterized in compound heterozygotes possessing a WT allele and L541P / A1038V allele. B) Selectively silencing expression of L541P / A1038V could reduce or eliminate expression of Stargardt disease.Atorney Docket No. 103362-059WO1 Figure 27 shows cyABCA4-A 1038V preliminary screening. DLRAs were performed in HCT116 cells co-transfected with psiCHECK-2 plasmid encoding either the WT or mutant ABCA4 gene and a cyBRDconstruct containing one of three candidate cityRNAs targeting the SNP at glOA [p = 0.0012], gllA [p = 0.0309], gl2A [p <0.0001], Data are shown as relative luciferase activity normalized to a control without a guide and depicted as mean±SD across 2 (n = 6) biological replicates. Statistical analyses were performed using GraphPad Prism (version 10.4.1) with a two-way ANOVA test (Sidak's multiple comparison).

[0041] Figure 28 shows cyABCA4-A 1038V glOA specifically silenced the expression of the ABCA4 A1038V mutant gene. DLRAs were performed in HCT116 cells co-transfected with psiCHECK-2 plasmid encoding either the WT or mutant ABCA4 gene and either siRNA [p = 0.7077] or cyABCA4 (cyDR) [p < 0.0001], Data are shown as relative luciferase activity normalized to a control without a guide and depicted as mean±SD across 3 biological replicates (n=9). Statistical analyses were performed using GraphPad Prism (version 10.4.1) with a two-way ANOVA test (Tukey's multiple comparison).

[0042] Figure 29 shows the design of 23-nt siRNA for the ABCA4 (A1038V) mRNA (SEQ ID NO: 38). Specifically, what is shown is siRNA targeting ABCA4 (A1038V) at glOA: “siABCA4(A1038V) glOA”. This siRNA, exemplifying a conventional ~23-nt siRNA, was used as a control. Wild type ABCA4 is SEQ ID NO: 39 and the ABCA4 (A1038V) is SEQ ID NO: 40.

[0043] Figure 30 shows passenger RNA for siABCA4(A 1038V) glOA (SEQ ID NO: 41). The passenger RNA (forms a 21-nt perfectly complementary stem with siABCA4(A 1038V) glOA (SEQ ID NO: 38), and the resultant duplex has a 3' 2-nt overhang at each terminus. This passenger has a 5'-OH.

[0044] Figure 31 shows cityRNA targeting ABCA4 (A1038V) at glOA: “cyABCA4(A1038V) glOA”. The gl-gl4 of cyABCA4(A 1038V) (SEQ ID NO: 42) was designed as follows so that it would fully pair with the ABCA4 (A1038V) (SEQ ID NO: 40) target but has one nucleotide mismatch with the ABCA4 (WT) target (SEQ ID NO: 39).

[0045] Figure 32 shows cityRNA targeting ABCA4 (A1038V) at gllA: “cyABCA4(A1038V) gllA”. The gl-gl4 of cyABCA4(A 1038V) (SEQ ID NO: 43) was designed as shown so that it would fully pair with the ABCA4 (A1038V) (SEQ ID NO: 40) target but has one nucleotide mismatch with the ABCA4 (WT) target (SEQ ID NO: 39).

[0046] Figure 33 shows cityRNA targeting ABCA4 (A1038V) at gl2A: “cyABCA4(A1038V) gl2A”. The gl-gl4 of cyABCA4(A 1038V) (SEQ ID NO: 44) was designed as follows so that it would fully pair with the ABCA4 (A1038V) target (SEQ ID NO: 40) but has one nucleotide mismatch with the ABCA4 (WT) target (SEQ ID NO: 39) .Atorney Docket No. 103362-059WO1 Figure 34 shows cyBRD-ABCA4(A 1038V) glOA. cyBRD-ABCA4(A1038V) is composed of a 14-nt cityRNA and a 38-nt hairpin passenger. The superscript “D” of cyBRD-ABCA4(A1038V) means that the hairpin passenger is DNA. There is a nick between C at cyABCA4(A 1038V) position 14 and G at position 1 of the hairpin passenger. A tetraloop of GTAA is highlighted in bold. SEQ ID NOS: 42 and 45 are shown (numbered consecutively).

[0047] Figure 35 shows cyBRD-ABCA4(A 1038V) gllA. cyBRD-ABCA4(A1038V) gllA is composed of a 14-nt cityRNA and a 38-nt hairpin DNA passenger. The superscript “D” of cyBRD-ABCA4(A1038V) means that the hairpin passenger is DNA. There is a nick between U at cyABCA4(A 1038V) position 14 and G at position 1 of the hairpin passenger. A tetraloop of GTAA is highlighted in bold. SEQ ID NOS: 43 and 46 are shown (numbered consecutively).

[0048] Figure 36 shows cyBRD-ABCA4(A 1038V) gl2A. cyBRD-ABCA4(A1038V) gl2A is composed of a 14-nt cityRNA and a 38-nt hairpin passenger. The superscript “D” of cyBRD-ABCA4(A1038V) means that the hairpin passenger is DNA. There is a nick between C at cyABCA4(A 1038V) position 14 and G at position 1 of the hairpin passenger. A tetraloop of GTAA is highlighted in bold. SEQ ID NOS: 44 and 47 are shown (numbered consecutively).

[0049] Figure 37 shows cyDRR-ABCA4(A 1038V) glOA. cyDRR-ABCA4(A 1038V) glOA is composed of three separate RNAs; a 14-nt cityRNA, an 11 -nt following of the cityRNA (focy, / 'fou.si / ), and a 25-nt passenger. The superscript “R” of cyBRR-ABCA4(A 1038V) glOA means that the focy and passenger are RNA. There is a nick between C at cyABCA4(A 1038V) position 14 and G at position 1 of the focy. SEQ ID NOS: 42, 48, and 49 are shown (numbered consecutively).

[0050] Figure 38 shows the design of ABCA4(WT) and ABCA4(A1038V) reporter genes. The following fragment of ABCA4(WT) or ABCA4(A1038V) was cloned into the 3 JTR of the Renilla Luciferase of psiCHECK-2 reporter plasmid. The mutation site and the corresponding nucleotide position in WT are shown in bold. The lower-case letters are Xhol and Notl insert sites for psiCHECK-2. SEQ ID NOS: 50 and 51 are shown (numbered consecutively).

[0051] Figures 39A-39B shows (A) cyBRD-KRAS(G12V) and (B) cyDRR-KRAS(G12V). In the cyBRDconstruct, there is a nick between C at cyKRAS(G12V) position 14 (SEQ ID NO 24) and G at Booster position 1 (SEQ ID NO: 54). Therefore, cyBRD-KRAS(G12A) is composed of two separate RNA and DNA oligonucleotides. A tetraloop of GTAA is highlighted in bold. Booster is SEQ ID NO: 54. The cyDRRconstruct is composed of three separate RNAs; a 14-nt cityRNA, an 11-nt following of the cityRNA (focy, / 'fou.si / ), and a 25-nt passenger. There is a nick between C at cyKRAS(G12A) position 14 and G at position 1 of the for. SEQ ID NOS: 24, 48, and 55 are shown (numbered consecutively).Atorney Docket No. 103362-059WO1 Figure 40 shows the design of 22-nt siAGOl (AF180) g4-5. SEQ ID NOS: 57, 58, 59, 60, and 61 are depicted.

[0052] Figure 41 shows the design of 14-nt cyAGOl (AF180) g4-5. SEQ ID NOS: 57. 62. 59. 60.

[0053] 65, 60, and 66 are depicted.

[0054] Figure 42 shows the design of 15-nt cyAGOl (AF180) g4-5. SEQ ID NOS: 67, 68, 69, and 57 are depicted.

[0055] Figure 43 shows DLRA to test cyAGOl(AF180). Data are depicted as mean ± SD. 4 biological replicates (n = 10). All statistics were performed as a 2-way ANOVA with Sidak's multiple comparisons. ***p < 0.0001.

[0056] Figure 44 shows DLRA to test 15-nt cyAGOl(AF180). Data are depicted as mean ± SD.

[0057] 2 biological replicates (n = 10). All statistics were performed as a 2-way ANOVA with Sidak's multiple comparisons. ***p < 0.0001.

[0058] Figure 45 shows cyDR-ABCA4(A 1038V) (i.e., cyDR, SEQ ID NO: 42) reduced the relative luciferase activity of ABCA4(WT, SEQ ID NO: 70) and ABCA4(A1038V, SEQ ID NO: 71) by 30% and 80%, respectively. Similarly, a duplex of cyABCA4(A1038V, SEQ ID NO: 72) (i.e., 15-nt duplex) reduced the relative luciferase activity of AGOl(WT) and ABCA4(A1038V) by 19% and 63%, respectively. Both cyDR-ABCA4(A1038) and 15-nt cyABCA4(A1038V) duplex preferentially silenced the mutant mRNA over the WT, suggesting that 15-nt cityRNAs may induce gene silencing even without Boosters (SEQ ID NO: 73). This 15-nt duplex format may facilitate its delivery.

[0059] Figure 46 shows the design of 14-nt cyABCA4 (A1038V). SEQ ID NOS: 42, 43, and 70-73 are depicted.

[0060] Figure 47 shows the design of 15-nt cyABCA4 (A1038V). SEQ ID NOS: 73, 70, 71, and 75 are depicted.

[0061] Figures 48A-48E shows CityRNA preferentially silence single-nucleotide KRAS G12 mutants. (A) Schematics of cityRNA guide positioning relative to target KRAS G12A mRNA. SEQ ID NOS: 77, 12, and 78-81 are shown in order, top to bottom. (B) Transfection-compatible cyBR, cyDR, and siRNA duplex designs used for DLRA screenings. (C) DLRA in HCT116 cells co-transfected with the designated RNA and psiCHECK-2 encoding the KRAS fragment gene containing the G12A mutation. (D) Schematics of cityRNA guide positioning relative to target KRAS G12C and G12V mRNAs. SEQ ID NOS: 82-87 are shown, in order, top to bottom. (E) DLRAs in HCT116 cells co-transfected with the designated RNA and psiCHECK-2 encoding the KRAS fragment gene containing the G12C or G12V mutation. DLRA significance levels betweenAtorney Docket No. 103362-059WO1 WT and mutant were determined using a two-way ANOVA (Sidak's adhoc; ***P< 0.0001; ***P<0.001; **P<0.01; *P < 0.05; NS, P > 0.05).

[0062] Figures 49A-49I show that cityRNAs preferentially cleave KRAS G12 mutants. (A-F) In vitro target cleavage assays of the KRAS G12A (A and D), G12C (B and E), and G12V (C and F) mRNAs by the cognate siRNA- or cityRNA-loaded AGO2 (A-C) and AGO3 (D-F).

[0063] Target cleavage data points are plotted as the mean of three replicates ± the standard deviation. (G-H) Representative gel images, corresponding to C and F, of in vitro target cleavage assays using AGO2 (G) and AGO3 (H) against 5' 32P-labeled 77-nt in vitro transcribed KRAS mRNA fragments. (I) Correlation between weighted target cleavage and silencing selectivity for cityRNAs and siRNAs.

[0064] Figures 50A-50B shows cityRNA preferentially silenced the mRNA of the KRAS G12V mutant over that of the wild type (WT) mRNA at every different concentration (A), whereas the corresponding siRNAs failed to discriminate between the two mRNAs at all concentrations (B). These results show that cityRNAs can discriminate single-nucleotide variants (SNVs) between the WT and mutant mRNAs.

[0065] Figures 51A-51D shows in vitro target cleavage by tyRISCs and mature RISCs. Singleturnover kinetics of target cleavage by homogeneous AGO3-RISC loaded with 14nt miR-20a, let-7a, miR-19b, or miR-16. Each RISC was incubated with the 60-, 58-, 60-, or 59nt corresponding target with a 5'-cap radiolabel (A). Representative denaturing gels of 22- or 14-nt target cleavage by homogeneous AGO3: 14-nt miR-16 (B), or AGO2: 14-nt miR-16 (C). (D): Top: Base pairing of a 60-nt target with 23- and 14-nt miR-20a (SEQ ID NOS: 25 and 18).

[0066] Bottom: Time course of the 60-nt target cleavage by homogeneous AGO2 with 23-nt miR-20a or 14-nt miR-20a. For all cleavage assays, [target] = 2.5 nM. [RISC] = 10 nM (SEQ ID NOS: 25 and 19). Data are depicted as mean ± SD (n=3 technical replicates).

[0067] DETAILED DESCRIPTION

[0068] The following description of the disclosure is provided as an enabling teaching of the disclosure in its best, currently known embodiment s). To this end, those skilled in the relevant art will recognize and appreciate that many changes can be made to the various embodiments of the invention described herein, while still obtaining the beneficial results of the present disclosure. It will also be apparent that some of the desired benefits of the present disclosure can be obtained by selecting some of the features of the present disclosure without utilizing other features. Accordingly, those who work in the art will recognize that many modifications and adaptations to the present disclosure are possible and can even be desirable in certain circumstances and are aAtorney Docket No. 103362-059WO1 part of the present disclosure. Thus, the following description is provided as illustrative of the principles of the present disclosure and not in limitation thereof.

[0069] Reference will now be made in detail to the embodiments of the invention, examples of which are illustrated in the drawings and the examples. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein.

[0070] Terminology

[0071] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. The term “comprising” and variations thereof as used herein is used synonymously with the term “including” and variations thereof and are open, non-limiting terms. Although the terms “comprising” and “including” have been used herein to describe various embodiments, the terms “consisting essentially of’ and “consisting of’ can be used in place of “comprising” and “including” to provide for more specific embodiments and are also disclosed. As used in this disclosure and in the appended claims, the singular forms “a,” “an,” “the,” include plural referents unless the context clearly dictates otherwise.

[0072] The following definitions are provided for the full understanding of terms used in this specification.

[0073] The terms "about" and "approximately" are defined as being “close to” as understood by one of ordinary skill in the art. In one non-limiting embodiment the terms are defined to be within 10%. In another non-limiting embodiment, the terms are defined to be within 5%. In still another non-limiting embodiment, the terms are defined to be within 1%.

[0074] As used herein, the terms "may," "optionally," and "may optionally" are used interchangeably and are meant to include cases in which the condition occurs as well as cases in which the condition does not occur. Thus, for example, the statement that a formulation "may include an excipient" is meant to include cases in which the formulation includes an excipient as well as cases in which the formulation does not include an excipient.

[0075] “Composition” refers to any agent that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects, e.g., treatment of a disorder or other undesirable physiological condition, and prophylactic effects, e.g., prevention of a disorder or other undesirable physiological condition. The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically mentioned herein, including, but not limited to, a vector, polynucleotide, cells, salts, esters, amides, proagents, active metabolites, isomers, fragments, analogs, and the like. When the term “composition” is used,Atorney Docket No. 103362-059WO1 then, or when a particular composition is specifically identified, it is to be understood that the term includes the composition per se as well as pharmaceutically acceptable, pharmacologically active vector, polynucleotide, salts, esters, amides, proagents, conjugates, active metabolites, isomers, fragments, analogs, etc.

[0076] "Comprising" is intended to mean that the compositions, methods, etc. include the recited elements, but do not exclude others. "Consisting essentially of' when used to define compositions and methods, shall mean including the recited elements, but excluding other elements of any essential significance to the combination. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants from the isolation and purification method and pharmaceutically acceptable carriers, such as phosphate buffered saline, preservatives, and the like. "Consisting of' shall mean excluding more than trace elements of other ingredients and substantial method steps for administering the compositions provided and / or claimed in this disclosure. Embodiments defined by each of these transition terms are within the scope of this disclosure.

[0077] An "increase" can refer to any change that results in a greater amount of a symptom, disease, composition, condition, or activity. An increase can be any individual, median, or average increase in a condition, symptom, activity, composition in a statistically significant amount. Thus, the increase can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100% or more increase so long as the increase is statistically significant.

[0078] A "decrease" can refer to any change that results in a smaller amount of a symptom, disease, composition, condition, or activity. A substance is also understood to decrease the genetic output of a gene when the genetic output of the gene product with the substance is less relative to the output of the gene product without the substance. Also, for example, a decrease can be a change in the symptoms of a disorder such that the symptoms are less than previously observed. A decrease can be any individual, median, or average decrease in a condition, symptom, activity, composition in a statistically significant amount. Thus, the decrease can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100%, or more decrease so long as the decrease is statistically significant.

[0079] "Inhibit," "inhibiting," and "inhibition" mean to decrease an activity, response, condition, disease, or other biological parameter. This can include but is not limited to the complete ablation of the activity, response, condition, or disease. This may also include, for example, a 10% reduction in the activity, response, condition, or disease as compared to the native or control level. Thus, the reduction can be a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction below, above, or in between the given ranges as compared to native or control levels.Atorney Docket No. 103362-059WO1 By “reduce” or other forms of the word, such as “reducing” or “reduction,” means lowering of an event or characteristic (e.g., tumor growth). It is understood that this is typically in relation to some standard or expected value, in other words it is relative, but that it is not always necessary for the standard or relative value to be referred to. For example, “reduces tumor growth” means reducing the rate of growth of a tumor relative to a standard or a control.

[0080] By “prevent” or other forms of the word, such as “preventing” or “prevention,” is meant to stop a particular event or characteristic, to stabilize or delay the development or progression of a particular event or characteristic, or to minimize the chances that a particular event or characteristic will occur. Prevent does not require comparison to a control as it is typically more absolute than, for example, reduce. As used herein, something could be reduced but not prevented, but something that is reduced could also be prevented. Likewise, something could be prevented but not reduced, but something that is prevented could also be reduced. It is understood that where reduce or prevent are used, unless specifically indicated otherwise, the use of the other word is also expressly disclosed.

[0081] The term “subject” refers to any individual who is the target of administration or treatment. The subject can be a vertebrate, for example, a mammal. In one aspect, the subject can be human, non-human primate, bovine, equine, porcine, canine, or feline. The subject can also be a guinea pig, rat, hamster, rabbit, mouse, or mole. Thus, the subject can be a human or veterinary patient. The term “patient” refers to a subject under the treatment of a clinician, e.g., physician.

[0082] A “control” is an alternative subject or sample used in an experiment for comparison purposes. A control can be "positive" or "negative."

[0083] As used herein, “wild-type” refers to the genetic and physical characteristics of the typical form of a species as it occurs in nature. A wild-type or wild type characteristic is conceptualized as a product of the standard “normal” allele at a gene locus, in contrast to that produced by a nonstandard “mutant” allele.

[0084] As used herein, “diagnose,” “diagnosed,” “diagnosing,” and any grammatical variations thereof as used herein, refers to the act of process of identifying the nature of an illness, disease, disorder, or condition in a subject by examination or monitoring of symptoms.

[0085] “Expression” as used herein refers to the process by which information from a gene is used in the synthesis of a functional gene product that enables it to produce a peptide / protein end product, and ultimately affect a phenotype, as the final effect.

[0086] As used herein, the term “genetically modified” refers to a living cell, tissue, or organism whose genetic material has been altered using genetic engineering techniques. The genetic modification results in an alteration that does not occur naturally by mating and / or naturalAtorney Docket No. 103362-059WO1 recombination. Modified genes can be transferred within the same species, across species (creating transgenic organisms), and across kingdoms. New, exogenous genes can be introduced, or endogenous genes can be enhanced, altered, or knocked out.

[0087] A "gene" refers to a polynucleotide containing at least one open reading frame that is capable of encoding a particular polypeptide or protein after being transcribed and translated. Any of the polynucleotides sequences described herein may be used to identify larger fragments or full-length coding sequences of the gene with which they are associated.

[0088] The terms “treat,” “treating,” and grammatical variations thereof as used herein, include partially or completely delaying, alleviating, mitigating, or reducing the intensity of one or more attendant symptoms of a disorder or condition and / or alleviating, mitigating, or impeding one or more causes of a disorder or condition. Treatments according to the disclosure may be applied preventively, prophylactically, palliatively, or remedially. Treatments are administered to a subject prior to onset (e.g., before obvious signs of disease or disorder), during early onset (e.g., upon initial signs and symptoms of disease or disorder), or after an established development of disease or disorder.

[0089] The term “interaction” refers to an action that occurs as two or more objects have an effect on one another either with or without physical contact. In terms of biological interactions, cell, proteins, and other macromolecules can have said effects on one another to impact biological functions, such as cell / tumor growth, cell death, and cell signaling pathways.

[0090] The term “detect” or “detecting” refers to an output signal released for the purpose of sensing of physical phenomenon. An event or change in environment is sensed and signal output released in the form of light, heat, color change, or the like.

[0091] A “nucleotide” is a compound consisting of a nucleoside, which consists of a nitrogenous base and a 5-carbon sugar, linked to a phosphate group forming the basic structural unit of nucleic acids, such as DNA or RNA. The four types of nucleotides are adenine (A), cytosine (C), guanine (G), uracil (U) and thymine (T), each of which are bound together by a phosphodiester bond to form a nucleic acid molecule.

[0092] A “nucleic acid” is a chemical compound that serves as the primary information-carrying molecules in cells and make up the cellular genetic material. Nucleic acids comprise nucleotides, which are the monomers made of a 5-carbon sugar (usually ribose or deoxyribose), a phosphate group, and a nitrogenous base. A nucleic acid can also be a deoxyribonucleic acid (DNA) or a ribonucleic acid (RNA). A chimeric nucleic acid comprises two or more of the same kind of nucleic acid fused together to form one compound comprising genetic material.

[0093] A “full length” polynucleotide sequence is one containing at least a translation initiationAtorney Docket No. 103362-059WO1 codon (e.g., methionine) followed by an open reading frame and a translation termination codon. A “full length” polynucleotide sequence encodes a “full length” polypeptide sequence.

[0094] A “variant,” “mutant,” or “derivative” of a particular nucleic acid sequence may be defined as a nucleic acid sequence having at least 50% sequence identity to the particular nucleic acid sequence over a certain length of one of the nucleic acid sequences using blastn with the “BLAST 2 Sequences” tool available at the National Center for Biotechnology Information's website. (See Tatiana A. Tatusova, Thomas L. Madden (1999), “Blast 2 sequences — a new tool for comparing protein and nucleotide sequences”, FEMS Microbiol Lett. 174:247-250). In some embodiments a variant polynucleotide may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to a reference polynucleotide.

[0095] As used herein, “guide RNA” refer to a specifically designed RNA sequence that recognizes a target nucleic acid of interest and directs an enzyme, including but not limited to an exonuclease enzymes and RNA-induced silencing complex enzymes (such as, for example Argonaute protein (AGOs)) to the target nucleic acid for gene editing.

[0096] The term “mRNA” refers to messenger ribonucleic acid, or single stranded molecule of RNA that corresponds to the genetic sequence of a gene and is translated by a ribosome in the process of synthesizing a protein. mRNA is created during the process of transcription, where a gene is converted into a primary transcript mRNA (or pre-mRNA). The primary transcript is further processed through RNA splicing to only contain regions that will encode protein. mRNA can also be targeted for epigenetic modifications, such as methylation, to impact mRNA translation, nuclear retention, nuclear export, processing, and splicing.

[0097] A nuclease is an enzyme capable of cleaving the phosphodiester bonds between nucleotides of nucleic acids. Nuclease can possess properties to cause double or single stranded breaks to target nucleic acids. Nucleases are commonly used in gene editing practices to modify a host genome to express or inhibit a target gene. An ’’exonuclease” refers to a type of enzyme essential to genome stability by acting to cleave, trim, or cut the free ends (such as the three prime (3') end or the five prime (5') end) of nucleic acids, including but not limited to DNA. Exonucleases are also involved in several aspects of cellular metabolism and maintenance.

[0098] As used herein, “RNAi” or RNA interference” refers to a process where small RNA molecules, including but not limited to tinyRNA, cityRNA, siRNA, miRNA, and shRNA, can shut down gene expression by binding and blocking the mRNA, protein translation enzymes, or a combination thereof, from performing intended functions.Atorney Docket No. 103362-059WO1 “Downstream” means in a direction of transcription, the direction of transcription being from a promoter sequence to an RNA-encoding sequence. For a template strand of a doublestranded DNA molecule, the direction of transcription is 3 ' to 5 ' . For a non-template strand of the double-stranded DNA molecule, the direction of transcription is 5' to 3'. “Upstream” means in a direction opposite the direction of transcription. “Upstream” and “downstream” may be used in reference to either strand of a double-stranded DNA molecule even when relative to a sequence on one strand of a double-stranded DNA molecule.

[0099] Methods and Compositions Comprising tinyRNAs to Discriminately Cleave Target Nucleic Acid

[0100] MicroRNAs (miRNAs), small interfering RNA (siRNAs), and piwi-interacting RNAs (piRNAs) exemplify small non-coding RNAs that regulate gene expression, with lengths ranging from 20 to 30 nt (Girard 2006; Elbashir 2001; Bartel 2018). While piRNAs follow a unique biogenesis pathway (Czech 2018), miRNAs and siRNAs share a common biogenesis machinery. Specifically, their precursors are processed by Dicer into ~22-nt miRNA- and siRNA-duplexes, which are then loaded into Argonaute proteins (AGOs) with assistance from chaperones (Iwasaki 2010; Nakanishi 2016). Following passenger-strand ejection, the remaining miRNA and siRNA form the mature RNA-induced silencing complex (mature RISC), having both the 5' and 3' ends recognized by the MID and PAZ domains of AGO, respectively (Wang 2008). Utilizing the guide nucleotide positions 2-8 (g2-g8) known as the seed region, the mature RISC surveys the complementary sequences of target RNAs. Of the four human AGOs, only AGO3 shares the same catalytic tetrad as AGO2 (Nakanishi 2012) but has shown limited slicing activity with ~22-nt guide RNAs (park 2017). Therefore, AGO2 was thought to be the only slicer (Liu 2004; Meister 2004).

[0101] Previous studies in humans and plants have identified AGO-associated RNAs with lengths shorter than standard small non-coding RNAs, and those RNAs were named tiny RNAs (tyRNAs) (Baldrich 2019; Li 2009; Nakanishi 2021). With lengths of 17 nt or less, tyRNAs are too short to position their 3 ' end at the PAZ domain, and thus, tyRNA-associated RISCs (tyRISCs) are defined separately from miRNA-associated RISCs (mature RISCs), which capture both ends of miRNA simultaneously (Sim 2023). RNA sequencing analyses indicate that tyRNAs are derived from endogenous miRNAs and transfer RNAs (tRNAs), and even viral miRNAs (Li 2009; Kuscu 2018; Han 2022). It was recently reported that specific 3'— >5' exonucleases trim AGO-associated miRNAs to 13-14-nt tyRNAs. tyRNAs were initially thought to regulate gene expression similarly to miRNAs, but some function as cleavage-inducing tyRNAs (cityRNAs), enhancing AGO3Atorney Docket No. 103362-059WO1 endonuclease activity up to ~82-fold (Park 2020). cityRNAs and their relationship to RISC and target nucleic acid are depicted in Figures 5 and 6. When a cityRNA is in complex with a RISC, it is referred to as a “cityRISC.”

[0102] Specifically, disclosed herein is a composition comprising a cityRISC, wherein said cityRISC comprises cityRNA and an AGO molecule, wherein the cityRNA is complementary to a specific target site in a target nucleic acid, and further wherein the cityRNA preferentially cleaves the target site compared to a nucleic acid with even one nucleotide difference, such as a one or two nucleotide difference at a defined position in the target site. The “target nucleic acid” is the entire nucleic acid, which is being targeted, and can be any length. It can be anywhere from 14 nucleotides long, to 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 150, 200, 250, 500, 1000, or more nucleotides in length. It can be a gene, or can be part of genomic nucleic acid, or any fragment thereof. It can be mRNA, or any other form of RNA or other nucleic acid. The target nucleic acid may further comprise a reporter gene, a pathogen-associated gene, e.g., a viral, protozoal, or bacterial gene, or an endogenous gene, e.g., an endogenous mammalian, particularly human gene. The “target site” is within the target nucleic acid and is considered the region which is bound by (hybridized to) the cityRNA itself. It can be the full length of the cityRNA.

[0103] By “defined position” in the target site is meant the nucleotides of the target site which hybridize (fully or partially) with the associated cityRNA. For example, looking at Figure 6A, the guide RNA (cityRNA) hybridizes with the target RNA. When looking at the target site in a 3' to 5' orientation, the first nucleotide of the target nucleic acid (tl) that hybridizes with the 1stguide nucleotide position (gl) of the cityRNA. Even if there is a mismatch at this first position, it is still the first nucleotide of the target site where the cityRNA is present. Going from 3' to 5', the target site has positions tl, t2, t3, t4, t5, t6, t7, t8, t9, tlO, til, tl2, tl3, tl4, tl5, tl6, etc, depending on the length of the target site. Therefore, when referring to the cleavage of the target site compared to a non-target with one or two nucleotide differences, the position of these differences can be referred to by the t position. Therefore, when one nucleotide difference is present, this can occur at any of positions tl, t2, t3, t4, t5, t6, t7, t8, t9, tlO, til, tl2, tl3, tl4, tl5, or tl6. When two nucleotide differences are present between the target compared to a non-target, it can occur at any two of these positions, in any combination thereof.

[0104] The present invention is drawn to compositions, systems, and methods which allow for loading of AGOs (either endogenous or engineered) with desired cityRNAs. Again, unlikeAtorney Docket No. 103362-059WO1 microRNAs, cityRNA-mediated silencing relies on target cleavage. The present invention uses AGO’s intrinsic capability to autonomously recognize target sequences to manipulate cleavage for gene silencing. Further information about AGOs which can be used with the cityRISC described herein can be found below.

[0105] The present disclosure also provides methods of designing, developi ng, and / or engi neering cityRNA to be used with AGO to form a cityRISC, in order to target specific nucleic acid sequences, particularly those which comprise a SNP (single nucleotide polymorphism) or other genetic aberrations with respect to the WT molecule. Importantly, this invention centers on the finding that cityRNAs are capable of targeting and cleaving nucleic acids which differ by a single nucleotide from another nucleic acid. In other words, cityRNAs can be designed which can discriminate between a single nucleotide base difference when hybridizing and cleaving. Of course, it can also discriminate between 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides.

[0106] The cityRNAs disclosed herein can be naturally or non-naturally occurring (engineered). If they are naturally occurring, they are engineered to be a length which is not naturally occurring. Furthermore, even if the cityRNA is naturally occurring, it can be paired with an AGO to form a cityRISC, where either the AGO is not naturally occurring, or other components of the cityRISC are not naturally occurring. These additional elements include, but are not limited to, Booster as well as passenger nucleic acid, which are discussed in more detail below. Furthermore, the cityRISC can be placed in an environment where it would not be naturally occurring, such as in vitro, ex vivo, or in organisms, such as humans, where they would not naturally occur.

[0107] In one aspect, disclosed herein is a method of designing and / or developing a cityRNA to be used with an AGO molecule, wherein said AGO molecule, when loaded with said cityRNA, cleaves a target nucleic acid. The method comprises the steps of: a) determining a non-base-pairing region of the target nucleic acid, wherein non-base-pairing region is recognized by the AGO molecule associated with the cityRNA, but wherein the cityRNA does not bind the non-basepairing region; and b) designing a cityRNA which is complementary to a base-pairing region (“target site”) of the target nucleic acid, thereby developing a cityRNA molecule. The cityRNA molecule can then be synthesized. It is noted that the silencing strength of cityRNAs can be predicted based on their in vitro target cleavage, as shown in Figure 49.

[0108] The cityRNA disclosed herein can be about 14 nucleotides in length. In some embodiments, the cityRNA is 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides in length. The cityRNA can be designed to be specific to any target nucleic acid desired. The cityRNA can be modified to comprise certain features which provide desirable properties. Specifically, the cityRNA can comprise one or more mismatched or wobble-base nucleotides against the target siteAtorney Docket No. 103362-059WO1 of the target nucleic acid, wherein the one or more mismatched or wobble-base nucleotides against the target site do not include the defined position of the target site.

[0109] The city RISC can also recognize the sequence of an upstream region of the cityRNA-target site (UTy), which corresponds to the tl 5 to t23 in the case of 14-nt cityRNAs. When a target RNA does not include specific UTy sequences that can be recognized by the cityRISC, the target retains enough dynamics to form a duplex with the g9-gl5 of the cityRNA (Fig. 3), thereby enhancing the cleavage of the target site by the cityRISC.

[0110] Specifically, disclosed herein is a method of cleaving a nucleic acid with a single nucleotide polymorphism (SNP), the method comprising: a) providing a composition comprising a cityRISC, wherein said cityRISC comprises cityRNA and AGO molecule, wherein the cityRNA is complementary to a SNP of a target nucleic acid (a “target site”), and further wherein the cityRNA preferentially cleaves the target site comprising the SNP compared to a corresponding WT nucleic acid; and b) exposing the target site to the cityRISC, thereby cleaving the target site which comprises the SNP.

[0111] KRAS-Related Diseases and Disorders

[0112] The present disclosure relates to the development of allele-specific inhibitory RNAs designed to selectively target and silence pathogenic variants of the Kirsten rat sarcoma viral oncogene homolog (KRAS) gene. KRAS is a member of the RAS family of small GTP -binding proteins that function as key molecular switches in cellular signaling pathways controlling proliferation, differentiation, and survival. KRAS cycles between an inactive GDP-bound state and an active GTP -bound state, with activation typically triggered by upstream receptor tyrosine kinases. In normal physiology, KRAS activity is tightly regulated; however, oncogenic mutations within KRAS disrupt its intrinsic GTPase activity, resulting in constitutive activation of downstream signaling cascades such as the MAPK / ERK and PI3K / AKT pathways.

[0113] Mutations at codon 12 of KRAS are among the most frequently observed oncogenic alterations in human cancers. One such mutation, KRAS(G12V), involves the substitution of glycine with valine at position 12. This single amino acid change profoundly reduces GTP hydrolysis, effectively locking KRAS in its GTP -bound, active state and promoting uncontrolled cell division. The KRAS(G12V) mutation has been detected in a wide range of malignancies, including but not limited to pancreatic ductal adenocarcinoma, colorectal carcinoma, non-small cell lung cancer, and certain hematologic malignancies. Due to its prevalence and its role as a driver mutation in tumorigenesis, KRAS(G12V) represents a highly significant molecular target for therapeutic intervention.Atorney Docket No. 103362-059WO1 While inhibition of KRAS function has long been recognized as a desirable cancer treatment strategy, the high degree of similarity between mutant and WT KRAS sequences has posed substantial challenges for allele-specific targeting. Non-selective suppression of KRAS expression could impair essential signaling functions in normal cells, leading to unacceptable toxicity. Thus, it is of great therapeutic significance to develop inhibitory molecules that can discriminate between KRAS(G12V) and KRAS(WT) with high specificity.

[0114] The present disclosure provides cleavage-inducing tinyRNAs (cityRNAs) specifically designed to target KRAS(G12V) mRNA while sparing KRAS(WT) mRNA. These cityRNAs exploit the single-nucleotide difference in the mutant transcript to achieve preferential binding and gene silencing. Exemplary cityRNA sequences demonstrating this selective inhibitory activity are provided as SEQ ID NOS: 7, 9, and 24. In cellular assays, these cityRNAs have been shown to markedly reduce KRAS(G12V) expression levels, leading to attenuation of downstream oncogenic signaling, while exhibiting minimal suppression of WT KRAS expression. These features include, but are not limited to, cyKRAS(AG12A)g2G and cyKRAS(G12A)glOG. Examples 1-2 describe this in more detail.

[0115] The therapeutic applications of these KRAS(G12V)-selective cityRNAs are broad, encompassing multiple KRAS-driven malignancies. In pancreatic ductal adenocarcinoma, where KRAS mutations occur in over 90% of cases and KRAS(G12V) is a recurrent variant, allelespecific inhibition could halt tumor growth and sensitize cancer cells to chemotherapeutic agents such as gemcitabine or FOLFIRINOX. In colorectal cancer, selective suppression of KRAS(G12V) may restore sensitivity to anti-EGFR monoclonal antibodies, which are otherwise ineffective in RAS-mutated tumors. In non-small cell lung cancer, the combination of KRAS(G12V)-selective silencing with immune checkpoint blockade may enhance anti -turn or immune responses.

[0116] In certain embodiments, the disclosed cityRNAs may be used as monotherapy to directly inhibit KRAS(G12V)-driven oncogenesis. In other embodiments, they may be administered in combination with other targeted agents, chemotherapies, radiotherapy, or immunotherapies to achieve synergistic effects. For example, combining allele-specific cityRNA therapy with MEK or ERK inhibitors could provide dual blockade of the RAS / MAPK pathway, reducing the likelihood of resistance. Likewise, co-administration with immune modulators may promote the clearance of cancer cells undergoing KRAS(G12V)-targeted silencing. The cityRNAs may be formulated for systemic delivery, including lipid nanoparticle-based carriers, or for local administration to the tumor microenvironment, depending on cancer type and location.Atorney Docket No. 103362-059WO1 The development of these KRAS(G12V)-selective cityRNAs represents a precision oncology approach that directly addresses one of the most intractable oncogenic drivers in human cancer, offering the potential for potent anti-tumor activity with reduced toxicity compared to non-selective KRAS inhibition.

[0117] Stargardt Disease / ABCA4-Related Disorders

[0118] Stargardt disease is a macular dystrophy inherited through mutations in the ATP -binding cassette transporter subfamily A member (ABCA4) gene. Symptoms include dyschromatopsia, central scotomata, and macular atrophy, while heterogeneity of the ABCA4 gene culminates in variation of the age at which symptoms manifest and their rate of progression (Maugeri, A. et al). Mutations in the ABCA4 (ABCR) gene are the major cause of autosomal recessive cone- rod dystrophy (Am J Hum Genet 67, 960-966 (2000)). Although Stargardt disease is typically inherited in an autosomal recessive manner, some cases involve compound heterozygosity (Maugeri 2000). For example, an allele with two mutations - L541P and A1038V - has been associated with compound heterozygosity among German patients (Maugeri 2000). Even when another WT allele is present, compound heterozygotes express Stargardt disease (Figure 26). However, selectively silencing the expression of L541P / A1038V while sparing the WT, can reduce or eliminate Stargardt disease-related symptoms (Figure 26). Disclosed herein is targeting ABCA4 (Al 038V). Examples of these cityRNAs comprise SEQ ID NOS: 38, 42-44, 46, 72, and 74.. For example, the one or more mismatches to the cityRNA can comprise a nucleic acid which encodes a substitution of a glycine (Gly) base for non-Gly residue. This can be, by way of example, an alanine (Ala) residue. Example 3 describes this in more detail.

[0119] Argonaute Syndrome

[0120] The present disclosure relates to the identification and selective silencing of a pathogenic variant of the human Argonaute 1 (AGO1) gene. Argonaute l isa member of the Argonaute family of proteins, which are key components of the RNA-induced silencing complex (RISC) and play an essential role in RNA interference (RNAi)-mediated gene regulation. The AGO1 protein binds small RNAs, such as microRNAs (miRNAs) and small interfering RNAs (siRNAs), and facilitates the sequence-specific targeting and silencing of complementary RNA transcripts. Proper AGO1 function is critical for normal cellular development, including neural differentiation and maintenance.

[0121] It has been discovered that deletion of the phenylalanine residue at position 180 of AGO1, referred to herein as AGOl(F180Del), is causative of a neurodevel opmental disorder known as Argonaute syndrome. This syndrome is characterized by a spectrum of neurological andAtorney Docket No. 103362-059WO1 developmental impairments, including delayed cognitive development, speech and motor difficulties, and, in some cases, seizures or behavioral abnormalities. Patients affected by this condition have been shown to carry the AGOl(F180Del) mutation in a heterozygous state, such that one allele of AGO1 encodes the deletion mutant while the other allele encodes the WT (AGOl(WT)) protein. The presence of both alleles complicates therapeutic strategies, as complete inhibition of AGO1 expression would interfere with the function of the normal protein and risk deleterious effects.

[0122] To address this challenge, the present disclosure provides chemically modified inhibitory RNAs, referred to herein as “cityRNAs” (cleavage-inducing tiny RNAs), that are capable of preferentially silencing AGOl(F180Del) without substantially affecting AGOl(WT). These cityRNAs are designed to exploit sequence or structural differences between the mutant and WT alleles, thereby achieving selective knockdown of the pathogenic variant while preserving the physiological function of the WT protein. Exemplary cityRNA sequences having this selective silencing capability are disclosed as SEQ ID NO: 62 and SEQ ID NO: 63. These sequences have been demonstrated to preferentially reduce AGOl(F180Del) expression in cellular models, with minimal off-target suppression of AGOl(WT). Examples 4 and 5 describe this in more detail.

[0123] In addition, it has been discovered that truncated duplex RNA structures can be used to achieve efficient gene silencing in this context. Specifically, a 15-nt cityRNA corresponding to SEQ ID NO: 67 was found to induce silencing activity comparable to its full-length counterpart when annealed to a 13 -nt passenger strand. This finding illustrates that reduced-length guidepassenger duplexes can retain potent silencing activity, offering potential advantages in terms of stability, delivery efficiency, and reduced immunogenicity.

[0124] The data disclosed herein demonstrate that cityRNAs can be tailored to achieve highly selective suppression of disease-causing alleles in dominant-negative or gain-of-function genetic disorders such as Argonaute syndrome. This approach offers a precision-medicine strategy for preserving WT protein function while mitigating the pathogenic effects of a mutant allele.

[0125] In addition to the allele-specific silencing strategies described herein, alternative therapeutic approaches for the treatment of AGO 1 -associated Argonaute syndrome may include, without limitation, small molecule modulators of Argonaute protein function, antisense oligonucleotides (ASOs) directed against the mutant AGO1 transcript, RNA aptamers, gene replacement therapies utilizing adeno-associated virus (AAV) or lentiviral vectors, and genomeediting strategies such as CRISPR / Cas-mediated correction of the F180Del mutation. Pharmacological interventions targeting downstream pathways dysregulated by AGOl(F180Del), including modulators of neuronal signaling, synaptic plasticity, or neurotrophic factor expression,Atorney Docket No. 103362-059WO1 may also provide symptomatic benefit. In certain embodiments, the cityRNA molecules disclosed herein may be administered in combination with one or more of these alternative strategies to achieve synergistic or additive therapeutic effects. For example, an allele-selective cityRNA targeting AGOl(F180Del) may be co-administered with an AAV-delivered AGOl(WT) transgene to simultaneously suppress the pathogenic allele and enhance functional protein expression. Likewise, combination therapy with cityRNA and small-molecule neuroprotective agents may both reduce mutant protein levels and promote neuronal survival, thereby addressing both the molecular cause and the functional consequences of the disorder. Such combination regimens may be administered concurrently or sequentially, and may be formulated for delivery via the same or different routes, including systemic, intrathecal, or intracerebroventricular administration.

[0126] Methods of Treating or Preventing Disease

[0127] Disclosed herein is a method of treating or preventing a disease or disorder in a subject, wherein the disease or disorder is a result of a genetic mutation; the method comprising administering to the subject a composition comprising a cityRISC, wherein said cityRISC comprises a cleavage-inducing tyRNA (cityRNA) and an Argonaute (AGO) molecule, wherein the cityRNA is complementary to a specific target site in a target nucleic acid, and further wherein the cityRNA preferentially cleaves the target site compared to a nucleic acid with a one or two nucleotide difference at a defined position in the target site, wherein the target site comprises the genetic mutation, thereby treating or preventing the disease or disorder associated with the genetic mutation. In some embodiments, said disease or disorder is cancer, or a genetic defect.

[0128] By “treating” is meant a reduction in symptoms or applicable markers of the disease or disorder. By “preventing” is meant that the subject does not develop symptoms or markers of the disease. Treating or preventing can be partial or complete. When partial, it can result in 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% reduction in symptoms or markers associated with that disease or disorder.

[0129] Once RISC has been loaded with cityRNA, it can be used to slice, or cleave, the target nucleic acid. This can effectively “silence” the target nucleic acid. This can be used to treat a variety of diseases and disorders. One can imagine that any time that a nucleic acid should beAtorney Docket No. 103362-059WO1 destroyed or silenced, the method disclosed herein can be employed. For example, dysfunctional gene expression can be modified in a disease and / or disorder including, but not limited to cancers (such as, for example acoustic neuroma, adenocarcinoma, adrenal gland cancer, anal cancer, angiosarcoma (e.g., lymphangiosarcoma, lymphangioendotheliosarcoma, hemangiosarcoma), appendix cancer, benign monoclonal gammopathy, biliary cancer (e.g., cholangiocarcinoma), bladder cancer, breast cancer (e.g., adenocarcinoma of the breast, papillary carcinoma of the breast, mammary cancer, medullary carcinoma of the breast), brain cancer (e.g., meningioma; glioma, e.g., astrocytoma, oligodendroglioma; medulloblastoma), bronchus cancer, carcinoid tumor, cervical cancer (e.g., cervical adenocarcinoma), choriocarcinoma, chordoma, craniopharyngioma, colorectal cancer (e.g., colon cancer, rectal cancer, colorectal adenocarcinoma), epithelial carcinoma, ependymoma, endotheliosarcoma (e.g., Kaposi's sarcoma, multiple idiopathic hemorrhagic sarcoma), endometrial cancer (e.g., uterine cancer, uterine sarcoma), esophageal cancer (e.g., adenocarcinoma of the esophagus, Barrett's adenocarinoma), Ewing's sarcoma, eye cancer (e.g., intraocular melanoma, retinoblastoma), familiar hypereosinophilia, gall bladder cancer, gastric cancer (e.g., stomach adenocarcinoma), gastrointestinal stromal tumor (GIST), head and neck cancer (e.g., head and neck squamous cell carcinoma, oral cancer (e.g., oral squamous cell carcinoma (OSCC), throat cancer (e.g., laryngeal cancer, pharyngeal cancer, nasopharyngeal cancer, oropharyngeal cancer)), hematopoietic cancers (e.g., leukemia such as acute lymphocytic leukemia (ALL) (e.g., B-cell ALL, T-cell ALL), acute myelocytic leukemia (AML) (e.g., B-cell AML, T-cell AML), chronic myelocytic leukemia (CML) (e.g., B-cell CML, T-cell CML), and chronic lymphocytic leukemia (CLL) (e.g., B-cell CLL, T-cell CLL); lymphoma such as Hodgkin lymphoma (HL) (e.g., B-cell HL, T-cell HL) and non-Hodgkin lymphoma (NHL) (e.g., B-cell NHL such as diffuse large cell lymphoma (DLCL) (e.g., diffuse large B-cell lymphoma (DLBCL)), follicular lymphoma, chronic lymphocytic leukemia / small lymphocytic lymphoma (CLL / SLL), mantle cell lymphoma (MCL), marginal zone B-cell lymphomas (e.g., mucosa-associated lymphoid tissue (MALT) lymphomas, nodal marginal zone B-cell lymphoma, splenic marginal zone B-cell lymphoma), primary mediastinal B-cell lymphoma, Burkitt lymphoma, lymphoplasmacytic lymphoma (i.e., “Waldenstrom's macroglobulinemia”), hairy cell leukemia (HCL), immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma and primary central nervous system (CNS) lymphoma; and T-cell NHL such as precursor T-lymphoblastic lymphoma / leukemia, peripheral T-cell lymphoma (PTCL) (e.g., cutaneous T-cell lymphoma (CTCL) (e.g., mycosis fungiodes, Sezary syndrome), angioimmunoblastic T-cell lymphoma, extranodal natural killer T-cell lymphoma, enteropathy type T-cell lymphoma, subcutaneous panniculitis-like T-cell lymphoma, anaplastic large cellAtorney Docket No. 103362-059WO1 lymphoma); a mixture of one or more leukemia / lymphoma as described above; and multiple myeloma (MM)), heavy chain disease (e.g., alpha chain disease, gamma chain disease, mu chain disease), hemangioblastoma, inflammatory myofibroblastic tumors, immunocytic amyloidosis, kidney cancer (e.g., nephroblastoma a.k.a. Wilms' tumor, renal cell carcinoma), liver cancer (e.g., hepatocellular cancer (HCC), malignant hepatoma), lung cancer (e.g., bronchogenic carcinoma, small cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), adenocarcinoma of the lung), leiomyosarcoma (LMS), mastocytosis (e.g., systemic mastocytosis), myelodysplastic syndrome (MDS), mesothelioma, myeloproliferative disorder (MPD) (e.g., polycythemia Vera (PV), essential thrombocytosis (ET), agnogenic myeloid metaplasia (AMM) a.k.a. myelofibrosis (MF), chronic idiopathic myelofibrosis, chronic myelocytic leukemia (CML), chronic neutrophilic leukemia (CNL), hypereosinophilic syndrome (HES)), neuroblastoma, neurofibroma (e.g., neurofibromatosis (NF) type 1 or type 2, schwannomatosis), neuroendocrine cancer (e.g., gastroenteropancreatic neuroendoctrine tumor (GEP-NET), carcinoid tumor), osteosarcoma, ovarian cancer (e.g., cystadenocarcinoma, ovarian embryonal carcinoma, ovarian adenocarcinoma), papillary adenocarcinoma, pancreatic cancer (e.g., pancreatic adenocarcinoma, intraductal papillary mucinous neoplasm (IPMN), Islet cell tumors), penile cancer (e.g., Paget's disease of the penis and scrotum), pinealoma, primitive neuroectodermal tumor (PNT), prostate cancer (e.g., prostate adenocarcinoma), rectal cancer, rhabdomyosarcoma, salivary gland cancer, skin cancer (e.g., squamous cell carcinoma (SCC), keratoacanthoma (KA), melanoma, basal cell carcinoma (BCC)), small bowel cancer (e.g., appendix cancer), soft tissue sarcoma (e.g., malignant fibrous histiocytoma (MFH), liposarcoma, malignant peripheral nerve sheath tumor (MPNST), chondrosarcoma, fibrosarcoma, myxosarcoma), sebaceous gland carcinoma, sweat gland carcinoma, synovioma, testicular cancer (e.g., seminoma, testicular embryonal carcinoma), thyroid cancer (e.g., papillary carcinoma of the thyroid, papillary thyroid carcinoma (PTC), medullary thyroid cancer), urethral cancer, vaginal cancer and vulvar cancer (e.g., Paget's disease of the vulva)), neurodegenerative diseases (such as, for example Alzheimer’s disease, ataxia, Huntington’s disease, Parkinson’s disease, amyotrophic lateral sclerosis (ALS), Friedreich ataxia, Lewy body disease, spinal muscular atrophy, Alpers’ disease, Batten disease, Cerebro-oculo-facio- skeletal syndrome, Leigh syndrome, Prion diseases, monomelic amyotrophy, multiple system atrophy, striatonigral degeneration, motor neuron disease, multiple sclerosis (MS), Creutzfeldt-Jakob disease, Parkinsonism, spinocerebellar ataxia, dementia, and other related diseases), cardiovascular diseases (such as, for example coronary artery disease, high / low blood pressure, cardiac arrest / heart failure, congestive heart failure, congenital heart defects / diseases (including, but not limited to atrial septal defects, atrioventricular septal defects, coarctation of theAtorney Docket No. 103362-059WO1 aorta, double-outlet right ventricle, d-transposition of the great arteries, Ebstein anomaly, hypoplastic left heart syndrome, and interrupted aortic arch), arrhythmia, peripheral artery disease, stroke, cerebrovascular disease, renal artery stenosis, aortic aneurysm, cardiomyopathies, hypertensive heart disease, pulmonary heart disease, cardiac dysrhythmias, endocarditis, inflammatory cardiomegaly, myocarditis, eosinophilic myocarditis, valvular heart diseases, rheumatic heart diseases, and other related cardiovascular diseases), respiratory diseases (such as, for example asthma, chronic obstructive pulmonary disease (COPD), pulmonary fibrosis, pneumonia, bronchitis (chronic or acute bronchitis), emphysema, cystic fibrosis / bronchiectasis, pleural effusion, acute chest syndrome, acute respiratory distress syndrome, asbestosis, aspergilosis, severe acute respiratory syndrome (including, but not limited to SARS-CoV-1 and SARS-CoV-2), respiratory syncytial virus (RSV), middle eastern respiratory syndrome (MERS), mesothelioma, pneumothorax, pulmonary arterial hypertension, pulmonary hypertension, pulmonary embolism, sarcoidosis, sleep apnea, and other respiratory diseases), congenital diseases (such as, for example albinism, amniotic band syndrome, anencephaly, Angelman syndrome, Barth syndrome, chromosomal abnormalities (including, but not limited to abnormalities to chromosome 9, 10, 16, 18, 20, 21, 22, X chromosome, and Y chromosome), cleft lip / palate, club foot, congenital adrenal hyperplasia, congenital hyperinsulinism, congenital sucrase-isomaltase deficiency (CSID), cystic fibrosis, De Lange syndrome, fetal alcohol syndrome, first arch syndrome, gestational diabetes, Haemophilia, heterochromia, Jacobsen syndrome, Katz syndrome, Klinefelter syndrome, Kabuki syndrome, Kyphosis, Larsen syndrome, Laurence-Moon syndrome, macrocephaly, Marfan syndrome, microcephaly, Nager’s syndrome, neonatal jaundice, neurofibromatosis, Noonan syndrome, Pallister-Killian syndrome, Pierre Robin syndrome, Poland syndrome, Prader-Willi syndrome, Rett syndrome, sickle cell disease, Smith-Lemli-Optiz syndrome, spina bifida, congenital syphilis, teratoma, Treacher Collins syndrome, Turner syndrome, Umbilical hernia, Usher syndrome, Waardenburg syndrome, Werner syndrome, Wolf-Hirschhom syndrome, Wolff-Parkinson-White syndrome, and other congenital diseases or disorders), gastrointestinal diseases (such as, for example heartburn, irritable bowel syndrome, lactose intolerance, gallstones, cholecystitis, cholangitis, anal fissure, hemorrhoids, proctitis, colon polyps, infective colitis, ulcerative colitis, ischemic colitis, Crohn’s disease, radiation colitis, celiac disease, diarrhea (chronic or acute), constipation (chronic or acute), diverticulosis, diverticulitis, acid reflux (gastroesophageal reflux (GER) or gastroesophageal reflux disease (GERD)), Hirschsprung disease, abdominal adhesions, achalasia, acute hepatic porphyria (AHP), anal fistulas, bowel incontinence, centrally mediated abdominal pain syndrome (CAPS), clostridioides difficile infection, cyclic vomiting syndrome (CVS), dyspepsia, eosinophilicAtorney Docket No. 103362-059WO1 gastroenteritis, globus, inflammatory bowel disease, malabsorption, scleroderma, volvulus, and other gastrointestinal diseases), and metabolic diseases (such as, for example diabetes mellitus Type I, diabetes mellitus Type II, familial hypercholesterolemia, Gaucher disease, Hunter syndrome, Krabbe syndrome, metachromatic leukodystrophy, Niemann-Pick syndrome, phenylketonuria (PKU), Tay-Sachs disease, Wilson’s disease, hemachromatosis, mitochondrial disorders or diseases (including, but not limited to Alpers Disease; Barth syndrome; beta.-oxidation defects:camitine-acyl-camitine deficiency; carnitine deficiency; coenzyme Q10 deficiency; Complex I deficiency; Complex II deficiency; Complex III deficiency; Complex IV deficiency: Complex V deficiency; cytochrome c oxidase (COX) deficiency, LHON Leber Hereditary Optic Neuropathy; MM Mitochondrial Myopathy: LIMM Lethal Infantile Mitochondrial Myopathy; MMC Maternal Myopathy and Cardiomyopathy; NARP Neurogenic muscle weakness, Ataxia, and Retinitis Pigmentosa; Leigh Disease: FICP — Fatal Infantile Cardiomyopathy Plus, a MELAS-associated cardiomyopathy: MELAS Mitochondrial Encephalomyopathy with Lactic Acidosis and Strokelike episodes; LDYT Leber's hereditary optic neuropathy and Dystonia; MERRF Myoclonic Epilepsy and Ragged Red Muscle Fibers; MHCM Maternally inherited Hypertrophic CardioMyopathy; CPEO Chronic Progressive External Opthalmoplegia; KSS Kearns Sayre Syndrome; DM Diabetes Mellitus; DMDF Diabetes Mellitus+DeaFness; CIPO Chronic Intestinal Pseudoobstruction with myopathy and Opthalmoplegia; DEAF Maternally inherited DEAFness or aminoglycoside-induced DEAFness; PEM Progressive encephalopathy; SNHL SensoriNeural Hearing Loss; Encephalomyopathy; Mitochondrial cytopathy: Dilated Cardiomyopathy: GER Gastrointestinal Reflux: DEMCHO Dementia and Chorea; AMDF Ataxia, Myoclonus; Exercise Intolerance: ESOC Epilepsy, Strokes, Optic atrophy, & Cognitive decline; FBSN Familial Bilateral Striatal Necrosis: FSGS Focal Segmental Glomerulosclerosis: LIMM Lethal Infantile Mitochondrial Myopathy; MDM Myopathy and Diabetes Mellitus: MEPR Myoclonic Epilepsy and Psychomotor Regression; MERME MERRF / MELAS overlap disease; MHCM Maternally Inherited Hypertrophic CardioMyopathy; MICM Maternally Inherited Cardiomyopathy; MILS Maternally Inherited Leigh Syndrome; Mitochondrial Encephalocardiomyopathy; Multisystem Mitochondrial Disorder (myopathy, encephalopathy, blindness, hearing loss, peripheral neuropathy); NAION Nonarteritic Anterior Ischemic Optic Neuropathy; NIDDM Non-Insulin Dependent Diabetes Mellitus; PEM Progressive Encephalopathy; PME Progressive Myoclonus Epilepsy; RTT Rett Syndrome: SIDS Sudden Infant Death Syndrome: MIDD Maternally Inherited Diabetes and Deafness; and MODY Maturity-Onset Diabetes of the Young, and MNGIE), and other metabolic diseases).Atorney Docket No. 103362-059WO1 Additional Embodiments

[0130] Booster Nucleic Acid

[0131] In some embodiments, the cityRISC further comprises a Booster nucleic acid, which hybridizes with the cityRNA. Examples of these are found in Figures 10, 16, 19, and 21. In some embodiments, a cityRISC comprising a cityRNA and a Booster is referred to as a “cyBR” or a “cyDR”. In some embodiments, the Booster nucleic acid and cityRNA together form a secondary structure. As used herein, a “nucleic acid secondary structure” or a “secondary structure” refers to a structure formed from the base pairing interactions within a single nucleic acid or between two or more nucleic acids. Non-limiting examples of nucleic acid secondary structures include, but are not limited to a double helix, a stem loop, and pseudoknot. In some embodiments, the Booster nucleic acid and cityRNA together form a double helix. In some embodiments, the Booster nucleic acid and cityRNA together form a stem loop. In some embodiments, the Booster nucleic acid and cityRNA together for a pseudoknot. In some embodiments, the gRNA is greater than 18 nucleotides in length when Booster is hybridized to cityRNA. In some embodiments, the gRNA hybridized to the Booster comprises 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more nucleotides in length. In some embodiments, the Booster nucleic acid is RNA or DNA. In some embodiments, the Booster nucleic acid comprises at least 2 nucleotides. In some embodiments, the Booster nucleic acid comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more nucleotides. In some embodiments, the Booster nucleic acid comprises 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, or 38 nucleotides. Other examples of Boosters which can be used with the present invention can be found in PCT / U52024 / 043488, herein incorporated by reference in its entirety for its teachings concerning Booster technology with cityRISC.

[0132] Modifications to cityRNA

[0133] In some embodiments, the cityRNA and / or the Booster can comprise at least one chemically modified nucleotide comprises a chemically modified nucleobase, a chemically modified ribose, a chemically modified phosphodiester linkage, or a combination thereof.

[0134] In some embodiments, the chemically modified nucleobase is selected from 5-formylcytidine (5fC), 5-methylcytidine (5meC), 5-methoxycytidine (5moC), 5-hydroxycytidine (5hoC), 5-hydroxymethylcytidine (5hmC), 5-formyluridine (5fU), 5-methyluridine (5-meU), 5-methoxyuridine (5moU), 5-carboxymethylesteruridine (5camU), pseudouridine (T), Nl-methylpseudouridine (mel'P), N6-methyladenosine (me6A), or thienoguanosine (thG).Atorney Docket No. 103362-059WO1 In some embodiments, the chemically modified ribose is selected from 2'-O-methyl (2'-O-Me), 2'-Fluoro (2'-F), 2'-deoxy-2'-fluoro-beta-D-arabino-nucleic acid (2'F-ANA), 4'-S, 4'- SFANA, 2'-azido, UNA, 2 '-O-m ethoxy-ethyl (2'-0-ME), 2'-O-Allyl, 2'-O-Ethylamine, 2'-O-Cyanoethyl, Locked nucleic acid (LAN), Methylene-cLAN, N-MeO-amino BNA, or N-MeO-aminooxy BNA.

[0135] In some embodiments, the chemically modified phosphodiester linkage is selected from Phosphorothioate (PS), Boranophosphate, phosphodithioate (PS2), 3 ',5 '-amide, N3'-phosphoramidate (NP), Phosphodiester (PO), or 2',5'-phosphodiester (2',5'-PO).

[0136] Modifications to RISC

[0137] In some embodiments, the RISC complex or any systems thereof may comprise additional complexes in addition to the AGO polypeptide. For example, additional components of the RISC complex may be present. Non-limiting examples of the additional components include, but are not limited to a Dicer protein, a ribosomal protein (such as, for example a 60S ribosomal protein, and 5S ribosomal protein), a helicase protein, a ribonucleoprotein, an RNA-binding protein, epigenetic regulatory proteins, transcription regulation proteins, and protein translation regulation proteins.

[0138] Also disclosed herein is a passenger strand. In the natural process of RNAi and gene silencing using RISC, long double-stranded RNAs are cleaved by the RNase III family member, Dicer, into nucleotides (nt) fragments with 5' phosphorylated ends and 2-nt unpaired and unphosphorylated 3' ends. AGOs then incorporate the guide strand into the RNA Interference Specificity Complex (RISC), while the passenger strand is released. The conditions which allow for loading of the double-stranded RNA molecule into RISC include the degradation of the passenger strand, thereby forming the cityRNA.

[0139] RISC uses the guide strand to find the target nucleic acid that has a complementary sequence leading to the endonucleolytic cleavage of the target mRNA. Therefore, the doublestranded RNA disclosed herein can be cleaved before exposure to RISC. Alternatively, only the cityRNA can be introduced to the RISC molecule.

[0140] AGOs

[0141] The highly conserved AGO family members play a central role in the regulation of gene expression networks, orchestrating the establishment and the maintenance of cell identity throughout the entire life cycle, as well as in several human disorders, including cancers. Four functional AGOs (AGO1, AGO2, AGO3, and AGO4), with high structure similarity, have been described in humans and mice.Atorney Docket No. 103362-059WO1 In some embodiments, the AGO, such as AGO3 polypeptide used with the methods disclosed herein, is from a yeast. In some embodiments, the AGO polypeptide is from Vanderwaltozyma polyspora (also known as Kluyveromyces polysporus). Additional non-limiting examples of yeast AGO polypeptides can be from additional yeast species of the genus Kluyveromyces: K. aestuari, K. africanus, K. bacillisporus, K. blattae, K. dobzhanskii, K. hubeiensis, K. lactis, K. lodderae, K. marxianus, K. nonfermentans, K. piceae, K. sinensis, K. thermotolerans, K. waltii, K. wickerhamii, or K. yarrowii. Additional non-limiting examples of yeast AGO polypeptides can be from Yarrowia lipolytica, Pichia pastori, Candida vulgaris, Saccharomyces castellii, or Schizosaccharomyces pombe.

[0142] In some embodiments, the AGO polypeptide used with the methods disclosed herein is from a eukaryote. In some embodiments, the AGO polypeptide is from a mammal. In some embodiments, the AGO polypeptide is from a primate. In some embodiments, the AGO polypeptide is from a human.

[0143] In some embodiments, the AGO polypeptide is a full length AGO polypeptide. In some embodiments, the AGO polypeptide comprises a portion of the AGO protein. In some embodiments, the AGO polypeptide is a WT sequence. In some embodiments, the AGO polypeptide is a sequence with at least one mutation. In some embodiments, the AGO polypeptide comprises an amino acid sequence that is different from a naturally occurring AGO polypeptide.

[0144] In some embodiments, the AGO polypeptide comprises at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity of a full length AGO polypeptide. In some embodiments, the AGO polypeptide comprises at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity of a WT AGO protein. In some embodiments, the full length AGO polypeptide comprises any one of the following protein accession identified numbers: Q9UL18, Q5TA57, Q6P4S0, Q9UKV8, Q8TCZ5, Q8WV58, Q96ID1, Q9H9G7, B1ALI0, Q5TA55, Q9H1U6, Q9HCK5, A7MD27, or any derivatives thereof (including, but not limited to polypeptide derivatives originating from primates or other mammals).

[0145] Cells

[0146] In one aspect, disclosed herein is a cell comprising the cityRNA of any preceding aspect or the cityRISC of any preceding aspect. In some embodiments, the cell is a prokaryotic cell or a eukaryotic cell. In some embodiments, the cell is a mammalian cell, a bacterial cell, or a yeast cell, including, but not limited to HEK cells, CHO cells, and HeLa cells.Atorney Docket No. 103362-059WO1 cityRNA Kits, Compositions, and Components

[0147] Also disclosed herein is a kit comprising the cityRNA and / or the cityRISC of any preceding aspect. In some embodiments, the kit further comprises at least one Booster of any preceding aspect. In some embodiments, the kit further comprises a full length AGO peptide, a fragment or portion of an AGO peptide, or any derivative of an AGO peptide. In some embodiments, the kit further comprises at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity of a WT AGO peptide or a full length AGO peptide. In some embodiments, the kit can further comprise a complete RISC, a partial RISC, or any components thereof.

[0148] The kit can also include other components which can be used in the methods disclosed herein. For example, the kit can comprise components suitable for AGO and the double stranded nucleic acid to form a complex. In some embodiments, the kit further comprises reagents, buffers, and / or containers (including, but not limited to tubes and bags) suitable for forming a complex, suitable for storing one or more components / compositions or any preceding aspect, or suitable for executing a desired function (including, but not limited to regulating expression of a target nucleic acid and determining a suitable Booster nucleic acid).

[0149] For pharmaceutical applications, the present disclosure also provides a pharmaceutical composition comprising as an active agent having at least one cityRNA of any preceding aspect, or a precursor thereof. The active agent may also comprise a DNA molecule encoding the cityRNA molecule or the precursor thereof, and a pharmaceutical carrier. The composition may be used for diagnostic and therapeutic applications in human medicine or in veterinary medicine.

[0150] For diagnostic or therapeutic applications the composition may be in form of an excipient, a diluent, a salt, a buffer, a stabilizer, a lipid, an emulsion, a nanoparticle, a cream, its native form, or the like. The carrier may be any suitable pharmaceutical carrier. Preferably, a carrier is used for increasing the efficacy of RNA molecules to enter the target cells. Suitable examples of such carriers are liposomes, particularly cationic liposomes.

[0151] The composition of any preceding aspect may be administered in such amounts, time, and route deemed necessary in order to achieve the desired result. The exact amount of the composition of any preceding will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the disease or disorder, the particular composition of any preceding, its mode of administration, its mode of activity, and the like. The composition of any preceding is preferably formulated in dosage unit form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the composition of any preceding will be decided by the attending physician within the scope of sound medical judgment.Atorney Docket No. 103362-059WO1 The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disease or disorder being treated and the severity of the disease or disorder; the activity of the composition of any preceding aspect employed; the specific composition of any preceding aspect employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific composition of any preceding aspect employed; the duration of the treatment; drugs used in combination or coincidental with the specific composition of any preceding aspect employed; and like factors well known in the medical arts.

[0152] The composition of any preceding aspect may be administered by any route. In some embodiments, the composition of any preceding aspect is administered via a variety of routes, including oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, subcutaneous, intraventricular, transdermal, interdermal, rectal, intravaginal, intraperitoneal, topical (as by powders, ointments, creams, and / or drops), mucosal, nasal, buccal, enteral, sublingual; by intratracheal instillation, bronchial instillation, and / or inhalation; and / or as an oral spray, nasal spray, and / or aerosol. In general, the most appropriate route of administration will depend upon a variety of factors including the nature of the composition of any preceding aspect (e.g., its stability in the environment of the gastrointestinal tract), the condition of the subject (e.g., whether the subject is able to tolerate oral administration), etc.

[0153] The exact amount of composition of any preceding aspect required to achieve a therapeutically or prophylactically effective amount will vary from subject to subject, depending on species, age, and general condition of a subject, severity of the side effects, identity of the particular compound(s), mode of administration, and the like. The amount to be administered to, for example, a child or an adolescent can be determined by a medical practitioner or person skilled in the art and can be lower or the same as that administered to an adult.

[0154] A number of embodiments of the disclosure have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.

[0155] By way of non-limiting illustration, examples of certain embodiments of the present disclosure are given below.

[0156] EXAMPLES

[0157] The following examples are set forth below to illustrate the compositions, devices, methods, and results according to the disclosed subject matter. These examples are not intended to be inclusive of all aspects of the subject matter disclosed herein, but rather to illustrateAtorney Docket No. 103362-059WO1 representative methods and results. These examples are not intended to exclude equivalents and variations of the present invention which are apparent to one skilled in the art.

[0158] Example 1: Gene Silencing of KRAS SNP G12C

[0159] METHODS

[0160] Design of 22-nt siRNA for the KRAS (G12C) mRNA

[0161] The general scheme for this method is shown in Figures 9-11. Part of the mRNA of KRAS WT is represented by SEQ ID NO: 1 (3' CGG AUG CGG UGG UCG AGG UUG AUG GUG 5') and the G12U mutant is represented by SEQ ID NO: 2 (3' CGG AUG CGG UGU UCG AGG UUG AUG GUG 5'). The 22 nt siRNA targeting KRAS (G12C) (shown as “siKRAS(G12C)”) in the figures) is represented by SEQ ID NO: 3 (5' pUAC GCC ACA AGC UCC AAC UAC C 3'). The passenger strand for siKRASG12C 22 nt is represented by SEQ ID NO: 4 (3' AA AUG CGG UGU UCG AGG UUG AU 5').

[0162] The designed guide RNA (SEQ ID NO: 3) is protected by the passenger RNA (SEQ ID NO: 4) until hybridization with the target (SEQ ID NO: 1 or 2). The SNP site in SEQ ID NO: 2 is underscored. This setup is seen in Figures 9 and 10. The actual mRNA sequence cloned in the 3'UTR is represented by SEQ ID NO: 5 (5'AUGACUGAAUAUAAACUUGUGGUAGUUGGAGCUgGUGGCGUAGGCAAGAGUGC CUUGACGAUACAGCUAAUUCAGAAUCAUUUUGUGGACGAAUAUGAUCCAACAUA GAG 3') for the wild type, and SEQ ID NO: 6 (5' AUGACUGAAUAUAAACUUGUGGUAGUUGGAGCUuGUGGCGUAGGCAAGAGUGCC UUGACGAUACAGCUAAUUCAGAAUCAUUUUGUGGACGAAUAUGAUCCAACAUAG AG-31) for the G12C mutation. Regular Watson-Crick base pairs are shown as vertical lines in the figures. The guide nucleotide position is shown as numbers in above the sequence. A “p” at the 5' end indicates the existence of a monophosphate group.

[0163] Design of 14-nt cityRNA for the KRAS (G12C) mRNA and its cyBRD

[0164] The Bartel group reported that specific nucleotides at g7, glO, and gl7 in ~22-nt siRNAs enhance target cleavage by the siRNA-loaded AGO2 (Wang and Bartel Mol. Cell 2024). To design cityRNAs, Python code was used. A cityRNA-Booster for RNAi (cyBR) composed of a 14-nt cityRNA and a DNA Booster referred to as “hybrid cyBR” in T2025-50 but, in this study, named cyBRD(i.e., the superscript “D” indicates DNA Booster).Atorney Docket No. 103362-059WO1 cityRNA targeting KRAS (G12C) ( cyKRAS(G12C))

[0165] The gl-gl4 of cyKRAS(G12C) was designed as follows so that it would fully pair with the KRAS (G12C) target but has one nucleotide mismatch with the KRAS (WT) target. The 14-nt cyKRAS(G12C) is represented by SEQ ID NO: 7 (5' pUAC GCC ACA AGC UC 3').

[0166] cyBRD-KRAS(G12C)

[0167] There is a nick between C at cyKRAS(G12C) position 14 and G at Booster position 1. Therefore, cyBR°KRAS(G12C) is composed of two separate RNA and DNA oligonucleotides. A tetraloop of GTAA is highlighted in bold. The Booster is represented by SEQ ID NO: 8 (5' UCG GGC CCG GGG T A ACC CGG GCC CGA GCT TGT GGC GTA AA 3'). Figure 10 shows the Booster (SEQ ID NO: 8) along with the G12C mutant (SEQ ID NO: 7).

[0168] Design of KRAS(WT) and KRAS(G12C) reporter genes

[0169] A fragment of KRAS(WT) (SEQ ID NO: 5) or KRAS(G12C) (SEQ ID NO: 7) was cloned into the 3'UTR of the Renilla Luciferase of psiCHECK-2 reporter plasmid. The mutation site and the corresponding nucleotide position in WT are shown in bold lowercase.

[0170] RESULTS

[0171] 22-nt siKRAS(G12C) silenced the KRAS(WT) and KRAS(G12C) reporter genes by 85% and 89%, respectively (Fig. 12 middle). Since the two targets have only one nucleotide difference, the result indicates that the siRNA repressed the gene expression of both WT and mutant targets sufficiently but could not distinguish the SNP.

[0172] Since 22-nt siKRAS(G12C) extensively pairs with the KRAS(WT) target but with one nucleotide mismatch at g9, the guide cleaves the target less efficiently. However, the partial base pairing is enough to trigger translational repression and mRNA destabilization (e.g., deadenylation), thereby causing slicer-independent gene silencing.

[0173] In contrast, cyBRD-KRAS(G12C) silenced the KRAS(G12C) reporter gene by 76% while failing to repress the gene expression of the KRAS (WT) (Fig. 12). These results show that cityRNAs can be used as a therapeutic of many SNP -mediated diseases.Atorney Docket No. 103362-059WO1 Example 2: Gene Silencing of KRAS SNP G12A

[0174] METHODS

[0175] Design of 22-nt siRNA for the KRAS (GJ 2 A) mRNA

[0176] The general scheme for this method is shown in Figures 13-21. Part of the mRNAofKRAS WT is represented by SEQ ID NO: 1 and the G12U mutant is represented by SEQ ID NO: 2. The 22 nt siRNA targeting KRAS (G12A) (shown as “siKRAS(G12A)”) in the figures) is represented by SEQ ID NO: 9 (5' pUAC GCC AGO AGO UCC AAC UAC C3'). The passenger strand for siKRASG12A 22 nt is represented by SEQ ID NO: 10 (3' AA AUG CGG UCG UCG AGG UUG AU 5').

[0177] The designed guide RNA (SEQ ID NO: 9) is protected by the passenger RNA (SEQ ID NO: 10) until hybridization with the target (SEQ ID NO: 1 or 2). The SNP site in SEQ ID NO: 2 is underscored. This setup is seen in Figures 13 and 14. The actual mRNA sequence cloned in the 3'UTR is represented by SEQ ID NO: 5 (wild type) and SEQ ID NO: 11 (5'-AUGACUGAAUAUAAACUUGUGGUAGUUGGAGCUGcUGGCGUAGGCAAGAGUGCC UUGACGAUACAGCUAAUUCAGAAUCAUUUUGUGGACGAAUAUGAUCCAACAUAG AG-31) for the G12A mutation . Regular Watson-Crick base pairs are shown as vertical lines in the figures. The guide nucleotide position is shown as numbers in above the sequence. A “p” at the 5' end indicates the existence of a monophosphate group.

[0178] cityRNA targeting KRAS (G12A) ( cyKRAS(G12A))

[0179] The gl-gl of cyKRAS(G12A) was designed as follows so that it would fully pair with the KRAS (G12A) target but has one nucleotide mismatch with the KRAS (WT) target. The 14-nt cyKRAS(G12A) is represented by SEQ ID NO: 12 (5' pUAC GCC AGC AGC UC 3'). This setup is seen in Figure 15.

[0180] cyBRD-KRAS(G12C)

[0181] There is a nick between C at cyKRAS(G12A) position 14 and G at Booster position 1. Therefore, cyBR°KRAS(G12A) is composed of two separate RNA and DNA oligonucleotides. A tetraloop of GTAA is highlighted in bold. The Booster is represented by SEQ ID NO: 13 (51- GGG CCC GGG GTA ACC CGG GCC CGA GCT GCT GGC GT A AA-3'). Figure 16 shows the Booster (SEQ ID NO: 13) along with the G12A mutant (SEQ ID NO: 12).Atorney Docket No. 103362-059WO1 Design of KRAS(WT) and KRAS(G12A) reporter genes

[0182] A fragment of KRAS(WT) (SEQ ID NO: 5) or KRAS(G12A) (SEQ ID NO: 11) was cloned into the 3'UTR of the Renilla Luciferase of psiCHECK-2 reporter plasmid. The mutation site and the corresponding nucleotide position in WT are shown in bold lowercase. This can be seen in Figure 17.

[0183] Optimizing cyRNAs for the KRAS (GJ 2 A) mRNA

[0184] Although cyKRAS(G12A) silenced the KRAS(G12A) reporter gene more efficiently than the KRAS(WT) reporter one, it silenced the WT gene expression by 34% (Figure 22). To avoid silencing the WT reporter gene, we replaced an A at g2 of cyKRAS(G12A) with G so that the resultant cyKRAS(G12A)g2G can form one wobble base pair with the KRAS(G12A) target, while it has one mismatch at 8 and one wobble base pair at g2 (Figure 18). A wobble base pair is unstable compared to regular Watson-Crick base pairs. Therefore, incorporating one mismatch into cyKRAS(G12A) was expected to reduce the cleavage of the KRAS(G12A) reporter gene drastically. G-to-A replacement is possible at which the pairing nucleotide on target is U (e.g., the KRAS(WT) mRNA has U at t2). In this experiment, the g2 position was mutated. This is represented by SEQ ID NO: 14 ( 5' pUGC GCC AGC AGC UC 3'). This can be seen in Figure 18.

[0185] cyBRD-KRAS(GJ2A)g2G

[0186] There is a nick between C at cyKRAS(G12A) position 14 and G at Booster position 1. Therefore, cyBR°KRAS(G12A)g2G is composed of two RNAs. A tetraloop of GTAA is highlighted in bold. The Booster with the g2G mutation is represented by SEQ ID NO: 15 (51-GGG CCC GGG GTA ACC CGG GCC CGA GCT GCT GGC GCA AA-3'). This is shown in Figure 19.

[0187] Optimizing cyRNA for the KRAS (GJ 2 A) mRNA

[0188] cityRNA targeting KRAS (G12A) A to G mutation at glO (cyKRAS(G12A)glOG) is shown in Figure 20. 14-nt cyKRAS(G12A)glOG is represented by SEQ ID NO: 16 (5' pUAC GCC AGC GGC UC 3'). The A-go-G replacement was incorporated at glO so that the replaced G could form one wobble base pair with U at tlO of the KRAS(WT) mRNA.

[0189] cyBRD-KRAS(GJ2A)gJ0G

[0190] There is a nick between C at cyKRAS(G12A) position 14 and G at Booster position 1. Therefore, cyBR°KRAS(G12A)glOG is composed of two RNAs. A tetraloop of GTAA isAtorney Docket No. 103362-059WO1 highlighted in bold. The sequence of the Booster for 14-nt cyKRAS(G12A)glOG is represented by SEQ ID NO: 17 (5'- GGG CCC GGG GTA ACC CGG GCC CGA GCC GCT GGC GTA AA-3'). This is shown in Figure 21.

[0191] RESULTS

[0192] siKRAS(G12A) silenced the KRAS(WT) and KRAS(G12A) reporter genes by 97% and 92%, respectively (Fig. 22). Since the two targets have only one nucleotide difference, the result indicates that siRNAs repress the gene expression of both WT and mutant targets sufficiently but cannot distinguish SNP targets. Since siRNAKRAS(G12A) extensively pairs with the KRAS(WT) target with one nucleotide mismatch at g8, it is expected to cleave the target less efficiently. However, the partial but extensive base pairing is enough to trigger translational repression and mRNA destabilization (e.g., deadenylation), thereby causing slicer-independent gene silencing. In contrast, cyBRD-KRAS(G12A) silenced the KRAS(WT) and KRAS(G12A) reporter genes by 31 and 64% respectively, showing the usefulness of cityRNAs for the therapeutic treatment of many SNP -mediated diseases (Fig. 22).

[0193] The ideal cityRNAs can target the disease-relevant SNP target mRNA but not its WT mRNA. To reduce the target cleavage of KRAS(WT), A was replaced at g2 or glO of cyKRAS(G12A) with G so that it can form a G:U wobble base pair because the existence of G:U wobble pairs are known to reduce target cleavage efficiency by the RISC. Both cyKRAS(G12A)g2G and cyKRAS(G12A)glOG failed to silence the KRAS(G12A) reporter genes (gray bars in Fig. 23), but they reduced the relative luciferase activity by 41 and 40%, respectively (Fig. 23). Incorporation a G:U wobble pair succeeded in silencing only the SNP target but not its WT.

[0194] DISCUSSION

[0195] In this report, the rule proposed by the Bartel lab to design cityRNAs was followed. Although 14-nt miR-16 has G at glO, it barely cleaved different lengths of fully complementary target RNA when loaded into AGO2 or AGO3 (Figure 51, Zhang et al., Cell Reports Volume 43, Issue 10, 22 October 2024).

[0196] In contrast, 14-nt miR-20a possesses neither A / U at g7 nor A / G at glO, but it cleaved a 60-nt fully complementary target RNA with AGO2 and AGO3 (Fig. 51).

[0197] This discrepancy in target cleavage between siRNAs and cityRNAs shows that cityRNAs do not necessarily follow the rule proposed by the Bartel group.Atorney Docket No. 103362-059WO1 14-nt miR-20a pUAAAGUGCUUAUAG (SEQ ID NO: 18)

[0198] 14-nt let-7a pUGAGGUAGUAGGUU (SEQ ID NO: 19)

[0199] 14-nt miR-19b pUGUGCAAAUCCAUG (SEQ ID NO: 20)

[0200] 14-nt miR-16 pUAGCAGCACGUAAA (SEQ ID NO: 21)

[0201] 14-nt cyKRAS(G12A) pUACGCCAGCAGCUC (SEQ ID NO: 12)

[0202] Example 3: Gene Silencing of KRAS SNP G12V

[0203] KRAS(G12V) accounts for 23%, 22%, 21%, and 30% of all, lung, colon, and pancreas cancers (Fig. 4). Therefore, mutation at this point is known to cause different types of cancer. Disclosed herein are cityRNAs capable of targeting specifically the KRAS(G12V) mRNA but not the KRAS(WT) one.

[0204] METHODS KRAS EXON 2 mRNA (G12V) is represented by SEQ ID NO: 22 (5'-AUGACUGAAUAUAAACUUGUGGUAGUUGGAGCUGUUGGCGUAGGCAAGAGUGCC UUGACGAUACAGCUAAUUCAGAAUCAUUUUGUGGACGAAUAUGAUCCAACAUAG AG-3').

[0205] KRAS mutant G12V is represented by SEQ ID NO: 23 (3' CGG AUG CGG UUG UCG AGG UUG AUG GUG 5').

[0206] 14 nt cyKRAS (G12V) is represented by SEQ ID NO: 24 (5' pUAC GCC AAC AGO UC 3'). The experimental setup can be found in Figure 24. The DLRA condition was as follows:

[0207] • 24-well plate

[0208] • 150 ng of psi CHECK-2

[0209] • 6 pmol of RNA

[0210] n = 3; 1 Bio-Rep, in HCT116 cells

[0211] cyKRAS (G12V) was transfected as cyBRD(DNA-Booster).

[0212] Results can be seen in Figure 24.

[0213] Example 4: Silencing the compound heterozygous ABCA4 mutant by cityRNAs BACKGROUND: The conventional approach of using small-molecule inhibitors has been challenging, as structural differences between WT and mutant ABCA4 proteins are not well defined (Weiss, W. A., Taylor, S. S. & Shokat, K. M. Recognizing and exploiting differences between RNAi and small-molecule inhibitors). Nat Chem Biol 3, 739-744 (2007); Xie, T., Zhang, Z., Fang, Q., Du, B. & Gong, X. Structural basis of substrate recognition and translocation byAtorney Docket No. 103362-059WO1 human ABCA4. Nat Commun 12, 3853 (2021)). Meanwhile, siRNAs have been widely used to repress gene expression by being incorporated into AGOs to form RISCs (Jadhav, V., Vaishnaw, A., Fitzgerald, K. & Maier, M. A. RNA interference in the era of nucleic acid therapeutics. Nat Biotechnol 42, 394-405 (2024); Nakanishi, K. Anatomy of four human Argonaute proteins. Nucleic Acids Res 50, 6618-6638 (2022)), but fail to distinguish the intended target from other mRNAs containing partially complementary sequences. Consequently, siRNAs are ineffective in distinguishing SNPs between WT and mutant mRNAs.

[0214] DATA: The Nakanishi group discovered that 14-nt sequence-specific guide RNAs can catalytically activate human AGO3, naming them cleavage-inducing tiny RNAs (city RNAs) (Park, M. S., Sim, G., Kehling, A. C. & Nakanishi, K. Human Argonaute2 and Argonaute3 are catalytically activated by different lengths of guide RNA. Proc Natl Acad Sci U S A 117, 28576-28578 (2020)). Subsequent studies demonstrated that cityRNAs exhibit greater target specificity than siRNAs because AGO2 and AGO3, when loaded with cityRNAs, directly recognize specific nucleotides upstream of the cityRNA-binding site (Zhang, H. et al. Target cleavage and gene silencing by Argonautes with cityRNAs. Cell Rep 43, 114806 (2024)). In addition, booster systems were developed that anneal to cityRNAs, forming duplexes or hairpins that can be transfected into human cells and loaded into endogenous AGOs, enabling cityRNA-driven gene silencing (Zhang 2024). To target the A1038V mutation in ABCA4, several cityRNAs and their corresponding boosters were designed (See Method Section). To evaluate their target specificity for A1038V, initial screening using dual-luciferase reporter assays (DLRAs) in HCT116 cells (Figure 27) were performed. The designed cityRNA-booster complex targeting the ABCA4 mutation, cyBRD-ABCA4(A 1038V), was co-transfected with a psiCHECK-2 plasmid encoding either the WT or mutant ABCA4 gene in the 3' untranslated region of the Renilla luciferase gene (See Method Section). The relative luciferase activity of these samples was compared to that of a control. Since cyABCA4(A 1038V) glOA was promising, cyBRDwas switched to cyDRR(See Method Section) because cyDRRusually shows better gene silencing. While cyABCA4 had minimal impact on the WT reporter gene, it significantly reduced mutant reporter gene expression by 80%, comparable to WT and mutant cells transfected with siRNA (Figure 28). These results show that cityRNAs have the potential to selectively silence mutant ABCA4 — a level of specificity not achievable with conventional siRNAs.

[0215] OVERVIEW: The cyABCA4 design can be optimized by shifting the target site upstream and downstream. Preliminary data for two other cityRNA targeting the SNP at gllA and gl2A have been included (Figure 27). Using the same strategy, cityRNAs that silence the ABCA4 L541P mutation are identified. The synergistic effect of two promising cityRNAs, each targetingAtorney Docket No. 103362-059WO1 L541P or A1038V, respectively, are evaluated using DLRAs in HCT116 cells co-transfected with both cityRNAs. Once identified, the best cityRNA candidates are programmed into recombinant human AGO2 and AGO3 proteins. The resulting ribonucleoprotein complexes are incubated with 5 '-end radiolabeled ABCA4 WT, L541P, or Al 038V target RNA to assess whether these AGOs selectively cleave the mutant targets.

[0216] METHODS

[0217] Part of the mRNAs of ABCA4 WT and Al 038V mutant show their pairing with the guide. The SNP site is bolded and underscored. The actual mRNA sequence cloned in the 3'UTR is shown in Section 3. Regular Watson-Crick base pairs are shown as vertical lines. The guide nucleotide position is shown as numbers above the sequence. A “p” at the 5Zend indicates the existence of a monophosphate group. The details are shown in Figures 29-38, which are described in detail above.

[0218] Example 4: cityRNAs targeting AGO1 syndrome mutant, AGOl(F180Del) Deletion of Phel80 codon of Argonautel, AGOl(AF180), causes neurodevelopmental disorders called AGO1 syndrome. Disclosed here are cityRNAs for useful in treating AGO syndrome.

[0219] Protocol: HCT-116 cells were seeded in 24-well plate with 1 mL of McCoy's supplemented with 10% FBS and cultured at 37 °C in 5% CO2 to around 70% confluency. The old media was replaced with fresh, supplemented media before transfection. The cells were cotransfected with 150 ng of psiCHECK-2 encoding the target sequence and 6 pmol of RNA using 2.5 pL of TransIT-X2 (Minis) and 100 pL of Opti-MEM (Gibco). 24 hours post-transfection, cells were washed with 1 mL total of lx Phosphate Buffered Saline (PBS) per well, followed by cell lysis with 100 pL of lx Passive Lysis Buffer (PLB) per well. Centrifuged cell lysate at 21,130 xg for 5 minutes and separated supernatant for use in dual luciferase assay. Luciferase activities were measured using GloMax® Navigator System (Promega). All luciferase emission measurements were performed using the Dual -Luciferase® Reporter assay (Promega). 15 pL of cell lysate was transferred to LLMITRAC™ (Greiner Bio-One) 96-well plates for luminescence recordings. 100 pL of Luciferase Assay Reagent II reagent (Promega) was added to each well to measure Flue activity. Then, the same volume of Stop & Gio® reagent (Promega) was added to measure Rluc activity. Rluc luminescence was divided by Flue luminescence, followed by normalizing to the cells transfected with only psiCHECK-2 encoding the target sequence.

[0220] The design of the sequences are depicted in Figures 40-42.Atorney Docket No. 103362-059WO1 Results: siAGOl(AF180) (i.e., siRNA g4-5) reduced the relative luciferase activity of AGO1(WT) and AGOl(AF180) by 68% and 90%, respectively (Fig. 43). Similarly, cyAGOl(AF180) (i.e., cyDR g4-5) reduced the relative luciferase activity of AGOl(WT) and AGOl(AF180) by 54% and 86%, respectively (Fig. 43). Both siAGOl(AF180) and cyAGOl(AF180) preferentially silenced the mutant mRNA over the WT, likely because the mutant mRNA lacks three nucleotides (Figure 40), a difference substantial enough for the siRNA to discriminate between the two transcripts.

[0221] cyDR-AGOl(AF180) (i.e., the 14-nt cyDR) reduced the relative luciferase activity of AG01(WT) and AGOl(AF180) by 52% and 84%, respectively (Fig. 44). Likewise, a 15-nt cyAGOl(AF180) duplex (i.e., 15-nt duplex) reduced the activity by 49% and 80%, respectively. Both cyDR-AGOl(AF180) and the 15-nt cyAGOl(AF180) duplex preferentially silenced the mutant mRNA over the WT. The 15-nt duplex format can also facilitate brain delivery.

[0222] Example 5: 15-nt cityRNA duplex, without Booster, silences ABCA4 (A1038V) It was previously reported that 14-nt cityRNAs silenced ABCA4(A1038V) when transfected as cyBR and cyDR (Zhang et al., Cell Rep. 2024). Here, a 15-nt cityRNA with a 13-nt passenger was created, and the duplex was transfected into HC116T to test its efficacy in gene silencing using dual-luciferase reporter assays.

[0223] HCT-116 cells were seeded in 24-well plate with 1 mL of McCoy's supplemented with 10% FBS and cultured at 37 °C in 5% CO2 to around 70% confluency. The old media was replaced with fresh, supplemented media before transfection. The cells were co-transfected with 150 ng of psiCHECK-2 encoding the target sequence and 6 pmol of RNA using 2.5 pL of TransIT-X2 (Minis) and 100 pL of Opti-MEM (Gibco). 24 hours post- transfection, cells were washed with 1 mL total of lx Phosphate Buffered Saline (PBS) per well, followed by cell lysis with 100 pL of lx Passive Lysis Buffer (PLB) per well. Centrifuged cell lysate at 21,130 xg for 5 minutes and separated supernatant for use in dual luciferase assay. Luciferase activities were measured using GloMax® Navigator System (Promega). All luciferase emission measurements were performed using the Dual -Luciferase® Reporter assay (Promega). 15 pL of cell lysate was transferred to LUMITRAC™ (Greiner Bio-One) 96-well plates for luminescence recordings. 100 pL of Luciferase Assay Reagent II reagent (Promega) was added to each well to measure Flue activity. Then, the same volume of Stop & Gio® reagent (Promega) was added to measure Rluc activity. Rluc luminescence was divided by Flue luminescence, followed by normalizing to the cells transfected with only psiCHECK-2 encoding the target sequence. Results are shown in Figures 45-47.Atorney Docket No. 103362-059WO1 Example 6: CityRNAs Selectively Silence KRAS Mutants by Discriminating Single-Nucleotide Variants (SNVs)

[0224] Abstract

[0225] SiRNAs of ~22 nt have been widely developed for RNAi therapeutics. Although chemical modifications enhance the stability of siRNAs in vivo and target specificity, they often fail to discriminate between target mRNAs and their SNVs, thereby limiting the therapeutic applications. Here, 14-nt unmodified cityRNAs were evaluated for their ability to selectively silence SNV targets, in direct comparison with their cognate siRNAs. Using KRAS G12A, G12C, and G12V mutant mRNAs that differ from the WT by a single nucleotide, a two-step screening with dualluciferase reporter assays identified cityRNAs that preferentially silenced the G12C and G12V reporters, whereas corresponding siRNAs silenced both WT and mutant equally. When programmed into human AG02 or AG03, these cityRNAs directed efficient cleavage of complementary RNAs in vitro, and their cleavage activity positively correlated with reporter silencing — unlike their siRNA counterparts. This comparison of unmodified cityRNAs and siRNAs reveals the intrinsic potential of cityRNAs as selective RNAi therapeutics for SNV-driven diseases.

[0226] Introduction

[0227] Kirsten rat sarcoma virus oncogene homolog (KRAS) missense mutations at codon 12 are among the most prevalent oncogenic drivers (Huang 2021; Singhal 2024). Given that the small size and smooth surface of the KRAS protein make it challenging to target with small-molecule inhibitors, RNAi therapeutics have been explored as an alternative (Moore 2020; Dang 2017; Cox 2025). However, siRNAs can accommodate single-nucleotide mismatches, leading to off-target silencing (Alshaer 2021; Hu 2020; Jadhav 2024). In this context, we discovered cityRNAs as 14-nt guide RNAs capable of catalytically activating AGO2 and AGO3, the latter of which was previously thought to lack slicing activity (Park 2020; Park 2017). The following example revealed that cityRNA-mediated silencing heavily relies on target cleavage (Zhang 2024). These results investigation of the intrinsic potential of cityRNAs for targeting SNVs, as exemplified by KRAS mutants. To this end, this example focused on non-modified forms of cityRNAs and siRNAs.

[0228] Results

[0229] As a model for the impact of cityRNAs for SNV targets, the KRAS G12A mutation was selected, which currently has no mutant-specific inhibitors (Urtecho 2025). It is known that cityRNAs need to be loaded into AGO2 and AGO3 to induce gene silencing and that their endonuclease activity depends on the 14-nt sequence (Park 2020; Zhang 2024). To identify theAtorney Docket No. 103362-059WO1 best cityRNA-binding site, three unmodified 14-nt cityRNAs were designed, which possess a uridine at guide nucleotide position 1 (glU) and the g2-gl4 fully complementary to three different ranges across the KRAS G12A mRNA (Fig. 48A). Of 13 possible alignments, the three cityRNAs targeting KRAS G12A, cyKRASG12A-8, -10, and -11, were selected to pair g8, glO, and gll with the SNV nucleotide (Fig. 48A). The silencing activity of these cityRNAs was evaluated using dual luciferase reporter assays (DLRAs) in HCT116 cells transfected with psiCHECK-2, whose Renilla luciferase gene had a fragment of WT or G12A KRAS in its 3' untranslated region. CityRNAs were annealed with auxiliary RNAs, called Boosters, in a previous study to form a cityRNA-Booster for RNAi (cyBR) system, which facilitated their loading into endogenous AGOs in transfected cells (Zhang 2024). To reduce the cost of the first screening, DNA Boosters were used to form cyBR-KRASG12A (Fig. 48B). Among the three cityRNAs, only cyKRASG12A-8 significantly silenced the mutant reporter nearly twice as much as the WT (Fig. 48C). This cityRNA showed an even stronger silencing when transfected as cityRNA-Delooped Booster for RNAi (cyDR-KRASG12A) (Figs. 48B-C). Next, a corresponding “parent” 22-nt siRNA duplex was designed, whose gl-gl4 were identical to cyKRASG12A-8, and the gl5-g22 were complementary to the KRAS mutant mRNA (Fig. 48A). The resultant siRNA, named siKRASG12A-8, was transfected as a duplex, showing strong indiscriminate silencing for both WT and mutant reporters (Figs. 48B-C). These results suggested that cityRNAs could recognize sequence differences at the single-nucleotide resolution for gene silencing, unlike siRNAs (Fig.

[0230] 48C).

[0231] Since cyKRASG12A-8 preferentially silenced the mutant reporter gene, the same targeting frame was applied to design two 14-nt cityRNAs, cyKRASG12C-9 and cyKRASG12V-8, fully complementary to the KRAS G12C and G12V mRNAs, respectively (Fig. 48D). Their corresponding “parent” 22-nt siRNA duplexes, siKRASG12C9 and siKRASG12V-8, indiscriminately silenced both WT and mutant reporter genes (Figs. 48D-E) as seen in siKRASG12A-8 (Fig. 48C), showing that some siRNAs are not competent enough to distinguish SNVs for specific silencing without modification. In contrast, transfection of cyKRASG12C-9, as cyBR and cyDR, silenced 66% and 52% more mutant reporter than the WT (Fig. 48E, left). Similarly, transfection of cyKRASG12V-8, as cyBR and cyDR, silenced 63% and 60% more mutant reporter than the WT (Fig. 48E, right). Although both cityRNAs for G12C and G12V silenced the WT reporter 20-40% more as cyDR than as cyBR, they desirably increased mutant KRAS silencing to nearly 90%, indicating that cyDR silencing efficacy has comparable strength to its corresponding siRNA.Atorney Docket No. 103362-059WO1 To investigate whether these discriminatory differences between cityRNA and siRNA silencing patterns were cleavage-dependent, a series of target cleavage assays validating AGO2-and AGO3-mediated cleavage levels of in vitro transcribed 77-nt KRAS target RNAs harboring the same target sequences in Figs. 48A and 48D were conducted. cityRNAs retained similar cleavage patterns across AGO2 and AGO3 (Figs. 49A-H), whereas AGO3 siRNA-directed cleavage significantly decreased (Figs. 49D-F) (Park 2020; Park 2017). Notably, each cityRNA directed more mutant-target cleavage and less WT-target one, compared to their parent siRNAs. Especially, both AGO2 and AGO3 showed notable discrepancies between mutant and WT cleavage for cyKRASG12C-9 and cyKRASG12V-8 (Figs. 49B-C and 49E-F). These two cityRNAs showed selective silencing between the mutant and WT reporters (Fig. 48E). In contrast, cyKRASG12A8 had the smallest margin between mutant and WT cleavage (Figs. 49A and 49D), and as a result, silenced both transcripts more similarly in the DLRA (Fig. 48C). Thus, targets cleaved greater in vitro were also silenced greater in cellulo, and targets not cleaved well in vitro were not silenced well in cellulo. For cityRNAs, silencing selectivity was significantly predicted by cleavage selectivity (slope = 1.20, p = 0.063), whereas siRNAs showed no significant relationship (slope = 0.47, p = 0.519) (Fig. 491). These results indicate that mutant-specific silencing by cityRNAs, but not siRNAs, depends on catalytic target cleavage efficiency.

[0232] Discussion

[0233] CityRNAs preferentially silenced single-nucleotide KRAS G12 mutants over the WT, whereas most of their corresponding siRNAs indiscriminately silenced both. The strengths of mutant silencing and cleavage were comparable between cityRNAs and siRNAs. These results suggest that cityRNAs are potent silencers with lower mismatch tolerance and thus greater specificity for distinguishing single-nucleotide differences (Alshaer 2021; Hu 2020; Jadhav 2024). Target cleavage correlated with cityRNA- but not siRNA-mediated silencing, supporting a model in which cityRNAs act through target cleavage, while siRNAs also employ additional slicerindependent mechanisms that contribute to off-target effects (Zhang 2024; Nakanishi 2023). In AGO2 complexes, cityRNAs cleaved more KRAS mutant targets over time than siRNAs (Figs.

[0234] 49A-C), showing faster turnover due to rapid product release, whereas siRNAs may remain bound longer to cleavage products. In the RISC, cityRNAs engage AGO2 via the seed region (g2-g8) like siRNAs (Zhang 2024), but their unanchored 3' ends leave the post-seed region dynamic (Sim 2023). This flexibility can alter the rate-limiting step of target cleavage turnover, allowing cityRNAs to rapidly engage new targets and make their silencing more cleavage-dependent. Such a mechanism could be harnessed in RNAi therapeutics to minimize off-target effects and targetAtorney Docket No. 103362-059WO1 diseases caused by SNVs. Importantly, the silencing strength of cityRNAs in vivo can successfully be predicted based on their in vitro target cleavage.

[0235] Extended Methods

[0236] Cloning, expression, and purification of recombinant proteins and psiCHECK-2 constructs Recombinant AGOs for target cleavage assays were purified from insect cells as previously reported (Park 2017; Park 2019). WT KRAS ssDNA containing nucleotides 1-105 (Thermofisher, codon G12: 5’- ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTT GACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAG-3’, SEQ ID NO: 88) were ligated into psiCHECK-2 vector constructs using Xhol and Notl restriction sites (Promega) for the dual luciferase reporter assay targets. G12A (35G-C), G12C (34G-U), and G12V (35G-U) mutants were generated via site-directed mutagenesis.

[0237] Dual Luciferase Reporter Assays

[0238] HCT116 cells were grown in McCoy’s 5A (Modified) Medium supplemented with 10% FBS (Gibco) at 37°C in a 5% CO2 incubator. Transfections were conducted using psiCHECK-2 and RNA constructs as previously reported (Zhang 2024). Dual luciferase reporter assays (Promega) were performed according to manufacturer instructions using the GloMax Navigator System (Promega).

[0239] In vitro Target Cleavage Assays

[0240] 25 nM guide RNA was incubated for 1 hour at 37°C with 1 pM of FLAG-AGO2 or FLAG-AGO3 in 1 x Reaction Buffer (25 mM HEPES-KOH pH 7.5, 100 mM KC1, 5 mM MgCh, 5 mM DTT, 0.005% (v / v) NP-40, 0.01 mg / mL baker’s yeast tRNA, 0.05 mg / mL BSA, 0.5 U / pL Ribolock). 50 nM of cold target KRAS WT (5’-GACUGAAUAUAAACUUGUGGUAGUUGGAGCUGGUGGCGUAGGCAAGAGUGCCUU GACGAUACAGCUAAUUCAGAAUC-3’ (SEQ ID NO: 76), codon G12, G12A (35G-C), G12C (34G-U), and G12V (35G-U) RNA spiked with 4000-8000 cpm of32P-labeled target was added to a total volume of 40 pL and incubated at 37°C. 5 pL aliquots were quenched with 2 quenching dye (8 M urea, 1 mM EDTA, 0.05% (w / v) xylene cyanol, 0.05% (w / v) bromophenol blue, 10% (v / v) phenol, 20% glycerol) at 0.5, 2, 5, 10, and 30 minutes after target addition. Cleavage products were resolved on an 8 M urea, 16-20% (29:1) acrylamide / bis-acrylamide denaturing gel. Phosphor images were obtained from Typhoon Imager (GE Healthcare) and band intensity was quantified using Image Lab (Bio-Rad). All data were analyzed and graphed using GraphPad Prism version 10.6.1 (GraphPad Software, Inc.). 77-nt KRAS target RNAs were in vitro transcribed and 5’ radiolabeled as previous (Park 2017).Atorney Docket No. 103362-059WO1 Linear Regression analysis

[0241] To evaluate the relationship between target-cleavage selectivity and gene-silencing selectivity, linear regression analyses were performed in Python 3.11 using the SciPy and NumPy packages. Data from dual-luciferase reporter assays (DLRA) and in vitro cleavage assays were compiled and imported as numeric values. cityRNAs (cyBRs and cyDRs) were combined into a single group as cityRNAs and compared with their corresponding siRNAs. The weighted target cleavage selectivity (mutant - WT, %) was calculated as

[0242] Weighted target cleavage selectivity for RNA1 = {a? C2m(RNAi) + as Csm(RNAi)} - {a? C2W(RNA1) + 0.3 C3W(RNA1)}

[0243] where a? and as are the relative protein levels of AGO2 and AGO3 in HCT116, respectively (a? + as = 1). In this study, a? = 0.75 and as = 0.25 was used, which were estimated from the previously reported data (Johnson 2023). C2m(RNAi) and C2W(RNAI) represent the cleavage percentages of the mutant and WT target RNAs at 10 min by AGO2 loaded with RNAi, while Csm(RNAi) and Csw(RNAi) represent the cleavage percentages of the mutant and WT target RNAs at 30 min by AGO3 loaded with RNAi. The silencing selectivity (mutant - WT, %) was calculated as

[0244] Silencing selectivity for RNAI = Dm(RNAi) - Dw(RNAi)

[0245] where Dm(RNAi) and Dw(RNAi) are the silencing %s of the mutant and WT reporter genes, respectively, when RNAi was transfected for DLRA. For each group, least-squares linear regression (scipy. stats. linregress) was used to fit the model

[0246] y = fo + fi x,

[0247] where x is the weighted target cleavage selectivity (mutant - WT, %), and y is the DLRA silencing selectivity (mutant - WT, %). The regression returned slope (Pi), intercept (Po), and two-tailed p-value.

[0248] It will be apparent to those skilled in the art that various modifications and variations can be made in the present disclosure without departing from the scope or spirit of the invention. Other embodiments of the disclosure will be apparent to those skilled in the art from consideration of the specification and practice of the methods disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims.Atorney Docket No. 103362-059WO1 REFERENCES

[0249] 1. Girard, A., Sachidanandam, R., Hannon, G.J., and Carmell, M.A. (2006). A germlinespecific class of small RNAs binds mammalian Piwi proteins. Nature 442, 199-202.

[0250] 10.1038 / nature04917.

[0251] 2. Elbashir, S.M., Lendeckel, W., and Tuschl, T. (2001). RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev 15, 188-200. 10.1101 / gad.862301.

[0252] 3. Bartel, D.P. (2018). Metazoan MicroRNAs. Cell 173, 20-51. 10.1016 / j cell.2018.03.006. 4. Czech, B., Munafo, M., Ciabrelli, F., Eastwood, E.L., Fabry, M.H., Kneuss, E., and Hannon, G.J. (2018). piRNA-Guided Genome Defense: From Biogenesis to Silencing. Annu Rev Genet 52, 131-157. 10.1146 / annurev-genet- 120417-031441.

[0253] 5. Iwasaki, S., Kobayashi, M., Yoda, M., Sakaguchi, Y., Katsuma, S., Suzuki, T., and Tomari, Y. (2010). Hsc70 / Hsp90 chaperone machinery mediates ATP-dependent RISC loading of small RNA duplexes. Mol Cell 39, 292-299. 10.1016 / j.molcel.2010.05.015.

[0254] 6. Nakanishi, K. (2016). Anatomy of RISC: how do small RNAs and chaperones activate Argonaute proteins? Wiley Interdiscip Rev RNA 7, 637-660. 10.1002 / wrna.1356.

[0255] 7. Wang, Y., Sheng, G., Juranek, S., Tuschl, T., and Patel, D.J. (2008). Structure of the guide- strand-containing argonaute silencing complex. Nature 456, 209-213. 10.1038 / nature07315.

[0256] 8. Shang, R., Lee, S., Senavirathne, G., and Lai, E.C. (2023). microRNAs in action: biogenesis, function and regulation. Nat Rev Genet. 10.1038 / s41576-023-00611-y.

[0257] 9. Nakanishi, K., Weinberg, D.E., Bartel, D.P., and Patel, D.J. (2012). Structure of yeast Argonaute with guide RNA. Nature 486, 368-374. 10.1038 / naturell211.

[0258] 10. Park, M.S., Phan, H.D., Busch, F., Hinckley, S.H., Brackbill, J.A., Wysocki, V.H., and Nakanishi, K. (2017). Human Argonaute3 has slicer activity. Nucleic Acids Res 45, 11867- 11877. 10.1093 / nar / gkx916.

[0259] 11. Liu, J., Carmell, M.A., Rivas, F.V., Marsden, C.G., Thomson, J.M., Song, J. J., Hammond, S.M., Joshua-Tor, L., and Hannon, G.J. (2004). Argonaute2 is the catalytic engine of mammalian RNAi. Science 305, 1437-1441. 10.1126 / science.l 102513.

[0260] 12. Meister, G., Landthaler, M., Patkaniowska, A., Dorsett, Y., Teng, G., and Tuschl, T. (2004).

[0261] Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs. Mol Cell 15, 185-197. 10.1016 / j .molcel.2004.07.007.

[0262] 13. Baldrich, P., Rutter, B.D., Karimi, H.Z., Podicheti, R., Meyers, B.C., and Innes, R.W.

[0263] (2019). Plant Extracellular Vesicles Contain Diverse Small RNA Species and Are Enriched in 10- to 17-Nucleotide "Tiny" RNAs. Plant Cell 31, 315-324. 10.1105 / tpc.l8.00872.

[0264] 14. Li, Z., Kim, S.W., Lin, Y., Moore, P.S., Chang, Y., and John, B. (2009). Characterization of viral and human RNAs smaller than canonical MicroRNAs. J Virol 83, 12751-12758.

[0265] 10.1128 / JVI.01325-09.

[0266] 15. Nakanishi, K. (2021). Are Argonaute-Associated Tiny RNAs Junk, Inferior miRNAs, or a New Type of Functional RNAs? Front Mol Biosci 8, 795356. 10.3389 / fmolb.2021.795356.

[0267] 16. Sim, G., Kehling, A.C., Park, M.S., Divoky, C., Zhang, H., Malhotra, N., Secor, J., and Nakanishi, K. (2023). Determining the defining lengths between mature microRNAs / small interfering RNAs and tinyRNAs. S ci Rep 13, 19761. 10.1038 / s41598-023-46562-6.Atorney Docket No. 103362-059WO1 Kuscu, C., Kumar, P., Kiran, M., Su, Z., Malik, A., and Dutta, A. (2018). tRNA fragments (tRFs) guide Ago to regulate gene expression post-transcriptionally in a Dicer-independent manner. RNA 24, 1093-1105. 10.1261 / ma.066126.118.

[0268] Han, Y., Peng, Y., Liu, S., Wang, X., Cai, C., Guo, C., Chen, Y., Gao, L., Huang, Q., He, M., et al. (2022). tRF3008A suppresses the progression and metastasis of colorectal cancer by destabilizing FOXK1 in an AGO-dependent manner. J Exp Clin Cancer Res 41, 32.

[0269] 10.1186 / s 13046-021 -02190-4.

[0270] Park, M.S., Sim, G., Kehling, A.C., and Nakanishi, K. (2020). Human Argonaute2 and Argonaute3 are catalytically activated by different lengths of guide RNA. Proc Natl Acad Sci U S A 117, 28576-28578. 10.1073 / pnas.2015026117.

[0271] Wee, L.M., Flores-Jasso, C.F., Salomon, W.E., and Zamore, P.D. (2012). Argonaute divides its RNA guide into domains with distinct functions and RNA-binding properties. Cell 151, 1055-1067. 10.1016 / j .cell.2012.10.036.

[0272] Schirle, N.T., Sheu-Gruttadauria, J., and MacRae, I. J. (2014). Structural basis for microRNA targeting. Science 346, 608-613. 10.1126 / science.1258040.

[0273] Schirle, N.T., and MacRae, I.J. (2012). The crystal structure of human Argonaute2. Science 336, 1037-1040. 10.1126 / science.l221551.

[0274] Sheu-Gruttadauria, J., Xiao, Y., Gebert, L.F., and MacRae, I.J. (2019). Beyond the seed: structural basis for supplementary microRNA targeting by human Argonaute2. EMBO J 38, elOl 153. 10.15252 / embj.2018101153.

[0275] Sheu-Gruttadauria, J., Pawlica, P., Klum, S.M., Wang, S., Yario, T.A., Schirle Oakdale, N.T., Steitz, J. A., and MacRae, I.J. (2019). Structural Basis for Target-Directed MicroRNA Degradation. Mol Cell 75, 1243-1255. 10.1016 / j .molcel.2019.06.019.

[0276] Flores-Jasso, C.F., Salomon, W.E., and Zamore, P.D. (2013). Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates. RNA 19, 271-279.

[0277] 10.1261 / rna.036921.112.

[0278] Sim, G, Kehling, A.C., Park, M.S., Secor, J., Divoky, C., Zhang, H., Malhotra, N., Bhagdikar, D., Abd El-Wahab, E.W., and Nakanishi, K. (2022). Manganese-dependent microRNA trimming by 3'— >5' exonucleases generates 14-nucleotide or shorter tiny RNAs. Proc Natl Acad Sci U S A 119, e2214335119. 10.1073 / pnas.2214335119.

[0279] Chen, P.Y., Weinmann, L., Gaidatzis, D., Pei, Y., Zavolan, M., Tuschl, T., and Meister, G. (2008). Strand-specific 5'-O-methylation of siRNA duplexes controls guide strand selection and targeting specificity. RNA 14, 263-274. 10.1261 / rna.789808.

[0280] Grishok, A., Pasquinelli, A.E., Conte, D., Li, N., Parrish, S., Ha, I., Baillie, D.L., Fire, A., Ruvkun, G., and Mello, C.C. (2001). Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell 106, 23-34. 10.1016 / s0092-8674(01)00431-7.

[0281] Hammond, S.M., Boettcher, S., Caudy, A.A., Kobayashi, R., and Hannon, G.J. (2001).

[0282] Argonaute2, a link between genetic and biochemical analyses of RNAi. Science 293, 1146-1150. 10.1126 / science.1064023.

[0283] Wang, P.Y., and Bartel, D.P. (2024). The guide RNA sequence dictates the slicing kinetics and conformational dynamics of the Argonaute silencing complex. bioRxiv.

[0284] 10.1101 / 2023.10.15.562437.Atorney Docket No. 103362-059WO1 31. Nakanishi, K. (2022). Anatomy of four human Argonaute proteins. Nucleic Acids Res 50, 6618-6638. 10.1093 / nar / gkac519.

[0285] 32. Jonas, S., and Izaurralde, E. (2015). Towards a molecular understanding of microRNA- mediated gene silencing. Nat Rev Genet 16, 421-433. 10.1038 / nrg3965.

[0286] 33. Nakanishi, K. (2023). When Argonaute takes out the ribonuclease sword. J Biol Chem,

[0287] 105499. 10.1016 / j.jbc.2023.105499.

[0288] 34. Karginov, F.V., Cheloufi, S., Chong, M.M., Stark, A., Smith, A.D., and Hannon, G.J. (2010).

[0289] Diverse endonucleolytic cleavage sites in the mammalian transcriptome depend upon microRNAs, Drosha, and additional nucleases. Mol Cell 38, 781-788.

[0290] 10.1016 / j.molcel.2010.06.001.

[0291] 35. Hammond, S.M., Bernstein, E., Beach, D., and Hannon, G.J. (2000). An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature 404, 293- 296. 10.1038 / 35005107.

[0292] 36. Yekta, S., Shih, I.H., and Bartel, D.P. (2004). MicroRNA-directed cleavage of HOXB8 mRNA. Science 304, 594-596. 10.1126 / science.1097434.

[0293] 37. Swarts, D.C., Makarova, K., Wang, Y., Nakanishi, K., Ketting, R.F., Koonin, E.V., Patel, D.J., and van der Oost, J. (2014). The evolutionary journey of Argonaute proteins. Nat Struct Mol Biol 21, 743-753. 10.1038 / nsmb.2879.

[0294] 38. McMichael, T.M., Zhang, Y., Kenney, A.D., Zhang, L., Zani, A., Lu, M., Chemudupati, M., Li, J., and Yount, J.S. (2018). IFITM3 Restricts Human Metapneumovirus Infection. J Infect Dis 218, 1582-1591. 10.1093 / infdis / jiy361.

[0295] 39. Chu, Y., Kilikevicius, A., Liu, J., Johnson, K.C., Yokota, S., and Corey, D.R. (2020).

[0296] Argonaute binding within 3 '-untranslated regions poorly predicts gene repression. Nucleic Acids Res 48, 7439-7453. 10.1093 / nar / gkaa478.

[0297] 40. Adams, P.D., Afonine, P.V., Bunkoczi, G., Chen, V.B., Davis, I.W., Echols, N., Headd, J. J., Hung, L.W., Kapral, G.J., Grosse-Kunstleve, R.W., et al. (2010). PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr D Biol Crystallogr 66, 213-221. 10.1107 / S0907444909052925.

[0298] 41. Emsley, P., Lohkamp, B., Scott, W.G., and Cowtan, K. (2010). Features and development of Coot. Acta Crystallogr D Biol Crystallogr 66, 486-501. 10.1107 / S0907444910007493.

[0299] 42. McCoy, A. J., Grosse-Kunstleve, R.W., Adams, P.D., Winn, M.D., Storoni, L.C., and Read, R.J. (2007). Phaser crystallographic software. J Appl Crystallogr 40, 658-674.

[0300] 10.1107 / S0021889807021206.

[0301] 43. Pettersen, E.F., Goddard, T.D., Huang, C.C., Couch, G.S., Greenblatt, D.M., Meng, E.C., and Ferrin, T.E. (2004). UCSF Chimera— a visualization system for exploratory research and analysis. J Comput Chem 25, 1605-1612. 10.1002 / jcc.20084.

[0302] 44. Joosten, R.P., Long, F., Murshudov, G.N., and Perrakis, A. (2014). The PDB REDO server for macromolecular structure model optimization. lUCrJ 1, 213-220.

[0303] 10.1107 / S2052252514009324.

[0304] 45. Lu, W.P., and Fei, L. (2003). A logarithmic approximation to initial rates of enzyme reactions. Anal Biochem 316, 58-65. 10.1016 / s0003-2697(03)00034-4.

[0305] 46. Garces F, Jiang K, Molday LL, et al. Correlating the Expression and Functional Activity of ABCA4 Disease Variants With the Phenotype of Patients With Stargardt Disease. Invest Ophthalmol Vis Sci. 2018;59(6):2305-2315. doi: 10.1167 / iovs.17-23364Atorney Docket No. 103362-059WO1 47. Liu F, Lee J, Chen J. Molecular structures of the eukaryotic retinal importer ABCA4. Drew D, Boudker O, DrewD, Beis K, eds. eLife. 2021;10:e63524. doi:10.7554 / eLife.63524 48. Maugeri A, Klevering BJ, Rohrschneider K, et al. Mutations in the ABCA4 (ABCR) gene are the major cause of autosomal recessive cone-rod dystrophy. Am J Hum Genet.

[0306] 2000;67(4):960-966. doi: 10.1086 / 303079

[0307] 49. Nakanishi K. Anatomy of RISC: how do small RNAs and chaperones activate Argonaute proteins? Wiley Interdiscip Rev RNA. 2016;7(5):637-660. doi:10.1002 / wrna,1356

[0308] 50. Park MS, Sim G, Kehling AC, Nakanishi K. Human Argonaute2 and Argonaute3 are catalytically activated by different lengths of guide RNA. Proceedings of the National Academy of Sciences. 2020;117(46):28576-28578. doi:10.1073 / pnas.2015026117

[0309] 51. Pichi F, Morara M, Veronese C, Nucci P, Ciardella AP. Multimodal imaging in hereditary retinal diseases. J Ophthalmol. 2013;2013:634351. doi: 10.1155 / 2013 / 634351

[0310] 52. Sparrow JR, Fishkin N, Zhou J, et al. A2E, a byproduct of the visual cycle. Vision Research.

[0311] 2003;43(28):2983-2990. doi:10.1016 / S0042-6989(03)00475-9

[0312] 53. Zhang H, Sim G, Kehling AC, et al. Target cleavage and gene silencing by Argonautes with cityRNAs. Cell Reports. 2024;43(10). doi: 10.1016 / j.celrep.2024.114806

[0313] 54. Zhang N, Tsybovsky Y, Kolesnikov AV, et al. Protein misfolding and the pathogenesis of ABCA4-associated retinal degenerations. Hum Mol Genet. 2015;24(ll):3220-3237. doi:10.1093 / hmg / ddv073

[0314] 55. L. Huang, Z. Guo, F. Wang, L. Fu, KRAS mutation: from undruggable to druggable in cancer. Signal Transduct Target Ther 6, 386 (2021).

[0315] 56. Singhal, B. T. Li, E. M. O'Reilly, Targeting KRAS in cancer. Nat Med 30, 969-983 (2024).

[0316] 57. R. Moore, S. C. Rosenberg, F. McCormick, S. Malek, RAS-targeted therapies: is the undruggable drugged? Nat Rev Drug Discov 19, 533-552 (2020).

[0317] 58. V. Dang, E. P. Reddy, K. M. Shokat, L. Soucek, Drugging the 'undruggable' cancer targets.

[0318] Nat Rev Cancer 17, 502-508 (2017).

[0319] 59. D. Cox, C. J. Der, "Undruggable KRAS": druggable after all. Genes Dev 39, 132-162 (2025).

[0320] 60. W. Alshaer et al., siRNA: Mechanism of action, challenges, and therapeutic approaches. Eur J Pharmacol 905, 174178 (2021).

[0321] 61. Hu et al., Therapeutic siRNA: state of the art. Signal Transduct Target Ther 5, 101 (2020).

[0322] 62. V. Jadhav, A. Vaishnaw, K. Fitzgerald, M. A. Maier, RNA interference in the era of nucleic acid therapeutics. Nat Biotechnol 42, 394-405 (2024).

[0323] 63. S. B. Urtecho et al., Decoding KRAS mutation in non-small cell lung cancer patients receiving immunotherapy: A retrospective institutional comparison and literature review. Lung Cancer 199, 108051 (2025).

[0324] 64. K. Nakanishi, When Argonaute takes out the ribonuclease sword. J Biol Chem

[0325] 10.1016 / j jbc.2023.105499, 105499 (2023).

[0326] 65. M. S. Park et al., Multidomain Convergence of Argonaute during RISC Assembly Correlates with the Formation of Internal Water Clusters. Mol Cell 75, 725-740 (2019).

[0327] 66. K. C. Johnson et al., Consequences of depleting TNRC6, AGO, and DROSHA proteins on expression of microRNAs. RNA 29, 1166-1184 (2023).Atorney Docket No. 103362-059WO1 SEQUENCES SEQ ID NO: 1

[0328] 3 ' CGG AUG CGG UGG UCG AGG UUG AUG GUG 5 '

[0329] SEQ ID NO: 2

[0330] 3 ' CGG AUG CGG UGU UCG AGG UUG AUG GUG 5 '

[0331] SEQ ID NO: 3

[0332] 5' pUAC GCC AC A AGC UCC AAC UAC C 3'

[0333] SEQ ID NO: 4

[0334] 3 ' AA AUG CGG UGU UCG AGG UUG AU 5 '

[0335] SEQ ID NO: 5 5'AUGACUGAAUAUAAACUUGUGGUAGUUGGAGCUgGUGGCGUAGGCAAGAGUGC CUUGACGAUACAGCUAAUUCAGAAUCAUUUUGUGGACGAAUAUGAUCCAACAUA GAG 3

[0336] SEQ ID NO: 6 5'AUGACUGAAUAUAAACUUGUGGUAGUUGGAGCUuGUGGCGUAGGCAAGAGUGC CUUGACGAUACAGCUAAUUCAGAAUCAUUUUGUGGACGAAUAUGAUCCAACAUA GAG-3

[0337] SEQ ID NO: 7

[0338] 5' pUAC GCC AC A AGC UC 3'

[0339] SEQ ID NO: 8

[0340] 5' GGG CCC GGG GTAA CCC GGG CCC GA GCT TGT GGC GTA AA 3'

[0341] SEQ ID NO: 9

[0342] 5' pUAC GCC AGC AGC UCC AAC UAC C3'

[0343] SEQ ID NO: 10

[0344] 3 ' AA AUG CGG UCG UCG AGG UUG AU 5 '

[0345] SEQ ID NO: 11 5'AUGACUGAAUAUAAACUUGUGGUAGUUGGAGCUGcUGGCGUAGGCAAGAGUGC CUUGACGAUACAGCUAAUUCAGAAUCAUUUUGUGGACGAAUAUGAUCCAACAUA GAG-3'

[0346] SEQ ID NO: 12

[0347] 5' pUAC GCC AGC AGC UC 3'

[0348] SEQ ID NO: 13

[0349] 5'- GGG CCC GGG GTA ACC CGG GCC CGA GCT GCT GGC GTA AA-3'Atorney Docket No. 103362-059WO1 SEQ ID NO: 14

[0350] 5' pUGC GCC AGC AGC UC 3'

[0351] SEQ ID NO: 15

[0352] 5'- GGG CCC GGG GTA ACC CGG GCC CGA GCT GCT GGC GCA AA-3'

[0353] SEQ ID NO: 16

[0354] 5' pUAC GCC AGC GGC UC 3'

[0355] SEQ ID NO: 17

[0356] 5'- GGG CCC GGG GTA ACC CGG GCC CGA GCC GCT GGC GTA AA-3'

[0357] SEQ ID NO: 18

[0358] pUAAAGUGCUUAUAG

[0359] SEQ ID NO: 19

[0360] pUGAGGUAGUAGGUU

[0361] SEQ ID NO: 20

[0362] pUGUGCAAAUCCAUG

[0363] SEQ ID NO: 21

[0364] pUAGCAGCACGUAAA

[0365] SEQ ID NO: 22 5'AUGACUGAAUAUAAACUUGUGGUAGUUGGAGCUGuUGGCGUAGGCAAGAGUGC CUUGACGAUACAGCUAAUUCAGAAUCAUUUUGUGGACGAAUAUGAUCCAACAUA GAG-3'

[0366] SEQ ID NO: 23

[0367] 3 ' CGG AUG CGG UUG UCG AGG UUG AUG GUG 5 '

[0368] SEQ ID NO: 24

[0369] 5' pUAC GCC AAC AGC UC 3'

[0370] SEQ ID NO: 25

[0371] AAAUUUCACGAAUAUCACGUCCAUC SEQ ID NO: 26

[0372] AAAUUUCACGAAUAUCACGUCC SEQ ID NO: 27

[0373] AAAUUUCACGAAUAUCACGU SEQ ID NO: 28

[0374] AAAUUUCACGAAUAUCACAtorney Docket No. 103362-059WO1

[0375] SEQ ID NO: 29

[0376] AAAUUUCACGAAUAUC SEQ ID NO: 30 AAACUCCAUCAUCCAACAUAUCA

[0377] SEQ ID NO: 31

[0378] AAACUCCAUCAUCCAACAUAUC SEQ ID NO: 32

[0379] AAACUCCAUCAUCCAACAUA SEQ ID NO: 33

[0380] AAACUCCAUCAUCCAACA SEQ ID NO: 34

[0381] AAACUCCAUCAUCCAA

[0382] SEQ ID NO: 35

[0383] AAAUUUCACGAAUAUC SEQ ID NO: 36 UAAAGUGCUUAUAGUGCAGGUAG SEQ ID NO: 37

[0384] UGAGGUAGUAGGUUGUAUAGU SEQ ID NO: 38

[0385] 5' pUCC AGC UGG ACC UCC UCC UGG GA 3'

[0386] SEQ ID NO: 39

[0387] 3' UAG AGG UCG ACC CGG AGG AGG ACC CUG 5' SEQ ID NO: 40

[0388] 3 ' UAG AGG UCG ACC UGG AGG AGG ACC CUG 5 ' SEQ ID NO: 41

[0389] 3 ' AA AGG UCG ACC UGG AGG AGG ACC 5 '

[0390] SEQ ID NO: 42

[0391] pUCC AGC UGG ACC UC

[0392] SEQ ID NO: 43

[0393] pU UCC AGC UGG ACC UAtorney Docket No. 103362-059WO1 SEQ ID NO : 44

[0394] pUC UCC AGC UGG ACC

[0395] SEQ ID NO: 45

[0396] GGG CCC GGG GTA ACC CGG GCC CGA GGT CCA GCT GGA AA SEQ ID NO: 46

[0397] GGG CCC GGG GTA ACC CGG GCC CAG GTC CAG CTG GAA AA SEQ ID NO: 47

[0398] GGG CCC GGG GTA ACC CGG GCC CGG TCC AGC TGG AGA AA SEQ ID NO: 48

[0399] GGG CCC GGG GU SEQ ID NO: 49

[0400] CCC GGG CCC GAG GUC CAG CUG GAA A SEQ ID NO: 50 cucgagCUGAAAGGAAAGUCCCAGGAGGAGGCCCAGCUGGAGAUGGAAGCCgcggccgc SEQ ID NO: 51 cucgagCUGAAAGGAAAGUCCCAGGAGGAGGTCCAGCUGGAGAUGGAAGCCgcggccgc SEQ ID NO: 52

[0401] CCC GGG CCC GA GCU UGU GGC GUA AA SEQ ID NO: 53

[0402] CCC GGG CCC GA GCU GCU GGC GUA AA SEQ ID NO: 54

[0403] GGG CCC GGG GTAA CCC GGG CCC GA GCT GTT GGC GTA AA SEQ ID NO: 55

[0404] CCC GGG CCC GA GCU GUU GGC GUA AA SEQ ID NO: 56

[0405] 3 ' CGG AUG CGG UCG UCG AGG UUG AUG GUG 5 '

[0406] SEQ ID NO: 57 (AGO1 WT) mRNA for AF180

[0407] 3’ CGG GAG UCC GCC ACU CUU CUU CCU CGC CGG GUG UCC 5’

[0408] SEQ ID NO: 58 si AGO 1 for AF180 (22 nt)

[0409] 5’ U UGA GAA GGA GCG GCC CAC AGG 3’

[0410] SEQ ID NO: 59 (AGO1 AF180)

[0411] 3’ CGG GAG UCC GCC ACU CUU CCU CGC CGG GUG UCC 5’Atorney Docket No. 103362-059WO1

[0412] SEQ ID NO: 60 passenger RNA si AGO 1 AF180:

[0413] 3’ AA A ACU CUU CCU CGC CGG GUG U 5’

[0414] SEQ ID NO: 61: passenger RNA for si AGO 1 AF180:

[0415] 5’ U GUG GGC CGC UCC UUC UCA A AA 3’

[0416] SEQ ID NO: 62: 14nt cyAGOl for AF180

[0417] 5’ U UGA GAA GGA GCG G 3’

[0418] SEQ ID NO: 63: 14 nt cyAGOl (AF180) g4-5:

[0419] 5 ’ UUG AGA AGG AGC GG 3 ’

[0420] SEQ ID NO: 64 (booster for cyAGOl for AF180):

[0421] 3’ AA AAC UCU UCC UCG CC CCC GGG CCC UG GGG CCC GGG 5’

[0422] SEQ ID NO: 65 (The focy sequences of cyDRR-AGOl (AF180) g4-5:

[0423] GGG CCC GGG GU

[0424] SEQ ID NO: 66: 25 nt passenger for cyDRR-AGOl (AF180) g4-5:

[0425] 5’ CCC GGG CCC CC GCU CCU UCU CAA AA 3’

[0426] SEQ ID NO: 67: 15-nt cyAGOl (AF180) g4-5:

[0427] 5 ’ U UGA GAA GGA GCG GC 3 ’

[0428] SEQ ID NO: 68: DUPLEX PASSENGER

[0429] 3’ A ACU CUU CCU CGC5’

[0430] SEQ ID NO: 69 DUPLEX PASSENGER

[0431] 5’ CGC UCC UUC UCA A 3’

[0432] SEQ ID NO: 70 (WT ABCA4)

[0433] 3 ’AG AG GUC GAC CCG GAG GAG GAC CC 5’

[0434] SEQ ID NO: 71 (ABCA4, A1038V))

[0435] 3 ’AG AG GUC GAC CuG GAG GAG GAC CC 5’

[0436] SEQ ID NO: 72 (cyABCA4-A1038V (glOA))

[0437] 5’UC CAG CUG GAC CUC 3’

[0438] SEQ ID NO: 73 (BOOSTER)

[0439] 3’ AA AG GUC GAC CUG GAG CCC GGG CCC UG GGG CCC GGG 5’

[0440] SEQ ID NO: 74 (15 NT cyABCA4 A1038V)

[0441] pUCC AGC UGG ACC UCAtorney Docket No. 103362-059WO1

[0442] SEQ ID NO: 75 (13 nt PASSENGER)

[0443] 3’ AG GUC GAC CUG GA 5’

[0444] SEQ ID NO: 76 GACUGAAUAUAAACUUGUGGUAGUUGGAGCUGGUGGCGUAGGCAAGAGUGCCUU GACGAUACAGCUAAUUCAGAAUC-3 ’

[0445] SEQ ID NO: 77 (KRAS WT)

[0446] GAACGGAUGCGGUGGUCGAGGUUGAUGGUGU SEQ ID NO: 78 (KRAS G12A)

[0447] GAACGGAUGCGGUCGUCGAGGUUGAUGGUGU SEQ ID NO: 79 CYKRAS (G12A10)

[0448] pUCUACGCCAGCAGC

[0449] SEQ ID NO: 80 CYKRAS (G12A11)

[0450] pUCCUACGCCAGCAG

[0451] SEQ ID NO: 81 SIKRAS (G12A8)

[0452] pUACGCCAGCAGCUCCAACUACC

[0453] SEQ ID NO: 82 (KRAS G12A)

[0454] GAACGGAUGCGGUGUUCGAGGUUGAUGGUGU SEQ ID NO: 83 (cyKRAS G12C9)

[0455] pUACGCCACAAGCUC

[0456] SEQ ID NO: 84 (siKRAS G12C9)

[0457] pUACGCCACAAGCUCCAACUACC

[0458] SEQ ID NO: 85 (KRAS G12V)

[0459] GAACGGAUGCGGUUGUCGAGGUUGAUGGUGU SEQ ID NO: 86 (cyKRAS G12V8)

[0460] pUACGCCAACAGCUC

[0461] SEQ ID NO: 87 (siKRAS G128)

[0462] pUACGCCAACAGCUCCAACUACC

[0463] SEQ ID NO: 88 ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTT GACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAG

Claims

Atorney Docket No. 103362-059WO1 CLAIMSWhat is claimed is:

1. A composition comprising a cityRISC, wherein said cityRISC comprises a cleavageinducing tyRNA (cityRNA) and an Argonaute (AGO) molecule, wherein the cityRNA is complementary to a specific target site in a target nucleic acid, and further wherein the cityRNA preferentially cleaves the target site compared to a nucleic acid with a one or two nucleotide difference at a defined position in the target site.

2. The composition of claim 1, wherein the cityRNA is about 14 nucleotides in length.

3. The composition of claim 1 or 2, wherein the Argonaute molecule is AG02 or AG03.

4. The composition of any one of claims 1-3, wherein an upstream region of the cityRNA target site (UTy) enhances cleavage at the target site by cityRISC.

5. The composition of any one of claims 1-4, wherein the cityRISC further comprises a Booster nucleic acid.

6. The composition of claim 5, wherein the Booster is DNA or RNA, or a combination thereof.

7. The composition of claim 5 or 6, wherein the Booster hybridizes to at least part of the cityRNA.

8. The composition of claim 7, wherein the Booster comprises a self-annealing portion.

9. The composition of any one of claims 1-8, wherein the cityRNA is completely complementary to the target site of the target nucleic acid.

10. The composition of any one of claims 1-8, wherein the cityRNA comprises one or more mismatched nucleotide compared to the target site of the target nucleic acid, wherein the one or more mismatched nucleotides compared to the target site do not include the defined position of the target site.

11. The composition of claim 10, wherein the one or more mismatches comprise a nucleic acid which encodes a substitution of a glycine (Gly) base for non-Gly residue.

12. The composition of claim 11, wherein the non-Gly residue comprises an alanine (Ala) residue.Atorney Docket No. 103362-059WO1 13. The composition of any one of claims 1-12, wherein the target site of the target nucleic acid is a single nucleotide polymorphism (SNP).

14. The composition of any one of claims 1-13, wherein the target nucleic acid is KRAS.

15. The composition of claim 13, wherein the KRAS comprises a SNP, as represented by SEQ ID NO: 2.

16. The composition of claim 14, wherein the cityRNA comprises SEQ ID NO: 7, 9, or 24.

17. The composition of any one of claims 1-16, wherein the one or two nucleotide difference occurs at 7, 8, 9, 10, 11, 12, 13, and / or 14thposition of the target site, wherein the target site is defined in a 3' to 5' orientation.

18. The composition of claim 17, wherein the one or two nucleotide difference occurs at the 10thposition, the 11thposition, or both.

19. The composition of any one of claims 1-13, wherein the target nucleic acid is ABCA4.

20. The composition of claim 19, wherein the ABCA4 comprises a SNP, as represented by SEQ ID NO: 40 or SEQ ID NO: 71.

21. The composition of claim 20, wherein the cityRNA comprises SEQ ID NO: 38, 42-44, 46, 72, or 74.

22. The composition of any one of claims 1-13, wherein the target nucleic acid is AF180.

23. The composition of claim 22, wherein the AF180 comprises a SNP, as represented by SEQ ID NO: 59.

24. The composition of claim 23, wherein the cityRNA comprises SEQ ID NO: 62, 63, or 67.

25. A method of cleaving a nucleic acid with a single nucleotide polymorphism (SNP), the method comprising:a. providing a composition comprising a cityRISC, wherein said cityRISC comprises a cleavage-inducing tyRNA (cityRNA) and an Argonaute (AGO) molecule, wherein the cityRNA is complementary to a SNP of a target nucleic acid, and further wherein the cityRNA preferentially cleaves the SNP compared to a corresponding wild type nucleic acid; andAtorney Docket No. 103362-059WO1 b. exposing the SNP to the cityRISC, thereby cleaving the SNP.

26. The method of claim 25, wherein the method is used to treat a disease or disorder associated with the SNP.

27. The method of claim 25 or 26, wherein the composition further comprises a Booster nucleic acid.

28. The method of any of claims 25-27, wherein the cityRNA is completely complementary to a target site of the target nucleic acid.

29. The method of any one of claims 25-27, wherein the cityRNA comprises one or more mismatched nucleotides compared to the target site of the target nucleic acid, wherein the one or more mismatches compared to the target site do not include the site of the SNP.

30. The method of claim 29, wherein the one or more mismatches comprise a substitution of a glycine (Gly) base for non-Gly residue.

31. The method of claim 30, wherein the non-Gly residue comprises an alanine (Ala) residue.

32. The method of any one of claims 25-31, wherein the target nucleic acid is KRAS, ABCA4 or AF180.

33. The method of any one of claims 25-32, wherein the one or two nucleotide difference occurs at the 7, 8, 9, 10, 11, 12, 13, and / or 14thposition of the target site, wherein the target site is defined in a 5' to 3' orientation.

34. The method of claim 33, wherein the one or two nucleotide difference occurs at the 10thposition, the 11thposition, or both.

35. A method of treating or preventing a disease or disorder in a subject, wherein the disease or disorder is a result of a genetic mutation; the method comprising administering to the subject a composition comprising a cityRISC, wherein said cityRISC comprises a cleavage-inducing tyRNA (cityRNA) and an Argonaute (AGO) molecule, wherein the cityRNA is complementary to a specific target site in a target nucleic acid, and further wherein the cityRNA preferentially cleaves the target site compared to a nucleic acid with a one or two nucleotide difference at a defined position in the target site, wherein the target site comprises the genetic mutation, thereby treating or preventing the disease or disorder associated with the genetic mutation.Attorney Docket No. 103362-059WO1 36. The method of claim 35, wherein the target nucleic acid is mRNA.

37. The method of claim 35 or 36, wherein the mutation is a single nucleotide polymorphism (SNP).

38. The method of any one of claims 35-37, wherein the disease or disorder is cancer.

39. The method of any one of claims 35-37, wherein the disease is Stargardt disease.

40. The method of any one of claim 35-37, wherein the disease is Argonaute syndrome.

Images