Modified bacteria for protein production and secretion

WO2026188108A1PCT designated stage Publication Date: 2026-09-10BOARD OF RGT THE UNIV OF TEXAS SYST
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2026/018028
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-06-18
Filing Date
2026-03-06
Publication Date
2026-09-10

Smart Images

  • Figure IMGF000048_0001_TABLE
    Figure IMGF000048_0001_TABLE
  • Figure 00000056_0000
    Figure 00000056_0000
  • Figure 00000057_0000
    Figure 00000057_0000
Patent Text Reader

Abstract

Genetic architectures, expression vectors, and bacterial strains for release of large biomolecule (polypeptides or nucleic acids) are provided. Such systems can be used, e.g., for biomedical (therapeutic), research, biotechnological, biocontrol, bioremediation, environmental and agricultural applications.
Need to check novelty before this filing date? Find Prior Art

Description

DESCRIPTIONMODIFIED BACTERIA FOR PROTEIN PRODUCTION AND SECRETIONBACKGROUND

[0001] This application claims the benefit of United States Provisional Patent Application No. 63 / 768,387, filed March 7, 2025, and United States Provisional Patent Application No. 63 / 826,287, filed June 18, 2025, the entirety of which are incorporated herein by reference.

[0002] This invention was made with government support under Grant no. EFMA2223735 awarded by the National Science Foundation. The government has certain rights in the invention.

[0003] This application contains a Sequence Listing XML, which has been submitted electronically and is hereby incorporated by reference in its entirety. Said Sequence Listing XML, created on February 12, 2026, is named UTFBP1387WO.xml, and is 6,950 bytes in size.1. Field

[0004] The present disclosure relates generally to the field of molecular biology, biotechnology and medicine. More particularly, it concerns bacterial systems that can be used for producing and releasing biomolecules or proteins.2. Description of Related Art

[0005] Recombinant protein production is a cornerstone of research and key to the development of diagnostics, therapeutics and novel functional materials. For these purposes, non-native protein expression systems offer unparalleled control of the production process. In particular, bacterial expression systems benefit from short doubling times, inexpensive media, genetic tractability, and ease of scaling up. Nonetheless, although bacterial cells are remarkable self-contained bioreactors, proteins are produced in a membrane-bound environment. Protein release must, therefore, circumvent the bacterial cell envelope, which in Gram-negative species comprises two membranes. For applications that rely on the use of pure protein, this is mediated by mechanical or chemical envelope disruption. However, applications that depend on in situ protein production and release necessitate a way for the protein to transverse the cell envelope. In nature, bacteria have evolved secretion systems to provide a conduit from the cytosol to the- 1 - 4902-7488-2187, v 1environment, but the selective specificity of each secretion apparatus renders the delivery of unnatural cargo very challenging. This means that for many applications that rely on protein delivery, there is still an unmet need for regulated protein production and release without human intervention. Clearly, there is a need for improved methods for protein production and release.- 2 - 4902-7488-2187, v 1SUMMARY

[0007] The present disclosure overcomes limitations in the prior art by providing protein release circuits that can be used for the production and release of protein molecules in situ. In addition to protein secretion systems, certain bacteria deliver large proteinaceous toxins, called bacteriocins, through “self-lysis” (e.g.. Fig. 1). Bacteriocins are functionally variable toxins that are native to numerous bacterial species, and their production is regulated by stress responses (for example response to DNA damage). Upon detection of a stress signal the toxin and its anti-toxin (that prevents cytotoxicity to the producing population) are produced in high quantities, followed by the production of a release element that compromises the bacterial membranes and achieves toxin release. The genetic systems delivering bacteriocins are naturally refractory to escape, and have evolved to co-exist with their bacterial hosts and to continuously release large (>50 kDa) toxins at high amounts. The present disclosure utilized bacteriocin-encoding operons that can advantageously be used in genetic circuits for the delivery of heterologous cargo or polypeptides by modified bacteria in situ. The below examples demonstrate that methods provided herein can be used to continuously produce and release polypeptides of up to 165 kDa, 180 kDa, or greater (e.g., 182.6 kDa) in size from living bacteria (e.g., Fig. 7). As shown in the below examples, a duet vector can be used to separately express different gene products from different promoters in these methods and approaches (e.g., Fig. 10, Fig. 11); for example, a first promoter (e.g., constitutive promoter, a conditional promoter, etc.) can be used to drive the expression of a polypeptide (e.g., large polypeptide of about 50-180 kDa) and a second promoter can be used to express the release machinery from the bacteria. The duet promoter can be a dual-inducible promoter wherein each gene product is controlled by a different inducible promoter (e.g., IPTG vs. arabinose) for tunable stoichiometry. Release of functional large polypeptides is demonstrated (e.g., Fig. 8, Fig. 9). Experiments demonstrate that these approaches can be used to drive expression and cause release of large bioactive cargo at high amounts from bacterial cells (e.g., FIG. 11). These systems can be effective for producing (e.g., releasing from a cell) a therapeutic nucleic acid, as observed based on expression of microRNA. The approaches provided herein can be used to produce and secrete / release biomolecules (including polypeptides) up to 300 kDa in size from living bacteria that may be used in a variety of clinical (e.g., treating a gastrointestinal disease in a mammalian subject) and environmental (e.g., protecting crops from disease or promoting crop growth) applications. If desired, a therapeutic nucleic acid, such as a therapeutic microRNA can be produced and released by the bacteria. As shown in the below- 3 - 4902-7488-2187, v 1examples, use of colicin lysis proteins is preferred and can be used to cause a slow and sustained release of the cargo biomolecule or therapeutic polypeptide from a bacteria, in contrast to release of the protein due to explosive cell lysis. Without wishing to be bound by any theory and while the precise mechanism of action is unclear, the data supports the idea that the colicin lysis protein can compromise the membranes leading to cellular content release without causing explosive cell lysis, hence allowing for slower more continual polypeptide release.

[0008] An aspect of the present disclosure relates to a nucleic acid vector encoding: (i) a lysis protein; (ii) a toxin-antitoxin (TA) module encoding a toxin protein and preferably an antitoxin protein; and (iii) a cargo biomolecule selected from a therapeutic polypeptide and a therapeutic nucleic acid (e.g., a siRNA, microRNA, antisense, shRNA, saRNA, RNA aptamer, ribozyme) wherein the vector induces expression of the lysis protein, the toxin protein, and the therapeutic polypeptide in bacteria. Preferably the vector induces expression of the antitoxin protein. The lysis protein may be encoded by a gene selected from a bacteriocin operon or another lytic gene. For example, the lysis protein may preferably be a colicin lysis protein (colicinogenic lys protein). The lysis protein may be encoded by a gene selected from the group El lys (CelA), or a lysis gene from a bacteriocin operon. The lysis gene may be lys A, lys El, lys E2, lys E3, lys E4, lys E5, lys E6, lys E7, lys E8, lys E9 (colicin E9), lys K, lys L, lys N, lys S4, lys U, or lys Y.3. In some aspects, the lysis gene is preferably not a bacteriophage-derived lysis protein. The lysis gene may preferably be a colicin lysis protein (colicinogenic lys protein), such as lysEl, lysE2, lysE3, lysE4, lysE5, lysE6, lysE7, lysE8, or lysE9. The therapeutic protein may be an anti-microbial protein, nanobody, immunotoxin, antibody, antivirulence agent, or environmental control agent (e.g., anti-microbial peptide or protein, antiviral peptides / proteins, anti-nematode peptides / proteins). In some aspects, the cargo biomolecule or therapeutic protein is less than 300, 275, 250, 225, 200, 190, 180, 170, or 165 kDa in size. The therapeutic protein may be less than 165 kDa in size. The toxin molecule and / or therapeutic polypeptide may be an antimicrobial protein, wherein the antimicrobial protein is a bacterial colicin protein, and wherein the antitoxin is an immunity protein. The immunity protein may be a cognate immunity protein of the bacterial colicin protein, or a noncognate immunity protein. The colicin protein may be colicin A, colicin El, colicin El, colicin E2, colicin E3, colicin E4, colicin E5, colicin E6, colicin E7, colicin E8, colicin E9, colicin K, colicin L, colicin N, colicin S4, colicin U, or colicin Y. The nucleic may encode a colicin immunity pair protein, preferably an immunity pair protein from a group A or group B bacteriocin plasmid, such as preferably a colicin-immunity pair. The nucleic acid may encode- 4 - 4902-7488-2187, v 1a non-cognate immunity protein, wherein preferably the non-cognate immunity protein can protect the bacteria from toxicity due to the bacterial colicin protein. The nucleic acid vector may encode the polypeptide and at least one of: (Colicin El and ImmEl); (Colicin E2 and ImmE2); (Colicin E4 and ImmE4); (Colicin E8 and ImmE8). The nucleic acid vector may encode the therapeutic polypeptide and at least one of: (Colicin A and ImmA), (Colicin E2 and ImmE2), (Colicin E3 and ImmE3), (Colicin E7 and ImmE7), or (Colicin D and ImmD). The nucleic acid may further encode an antibiotic resistance cassette. The lysis protein, cargo biomolecule, and / or TA module may be expressed via a single promoter. The single promoter may be a constitutive promoter or a conditional promoter. The lysis protein, therapeutic polypeptide, toxin-antitoxin (TA) module, and / or immunity protein may be expressed via separate promoters. The separate promoters may each be a constitutive promoter or a conditional promoter. The promoter(s) may each independently selected from the group consisting of: IPTG inducible, lac operon inducible, or L(+)-arabinose inducible promoters; a promoter inducible by xylose, rhamnose, vanillin, m-Toluic acid; a conditional promoter such as temperature-inducible promoters, pH-inducible promoter, metabolite-inducible promoter (e.g., lactose-inducible promoter, for example so lactase enzyme cargo can be produced upon the detection of lactase in lactose-intolerant patients), a heavy metal-inducible promoter, a toxin-inducible promoter, a virus-inducible promoter, a bile-inducible promoter, an acidinducible promoter, a light-inducible promoter, or an oxygen-inducible promoter, bacterial-density regulated promoters (quorum-sensing). In some aspects, the toxin-antitoxin (TA) module does not encode an antitoxin protein.

[0009] Another aspect of the present disclosure relates to a bacterial cell comprising the nucleic acid described above or herein. The bacterial cell may be a Alphaproteobacteria (e.g., Rhodobacter sphaeroides), Gammaproteobacteria, Enterobacteriaceae (e.g., Pectobacterium, Escherichia coli e.g., K-12, B, Nissle), Klebsiella aerogenes, Salmonella enterica, Shigella spp.), Pseudomonadaceae (Pseudomonas spp. Including Pseudomonas putida), or Yersiniaceae (Serratia spp.) bacteria. The bacterial cell may be a probiotic bacterium, an attenuated bacterium, or the bacterium is substantially or essentially safe for human consumption. In some aspects, the bacteria may be Nissle 1917, S. enterica VNP20009, or an Enterobacterial vaccine strains (e.g., Shigella, Salmonella). The bacterial cell may be substantially or essentially safe for environmental use. The bacterium may be a Rhodobacter sphaeroides. Pectobacterium, Serratia, Pseudomonas putida, Shewanella oneidensis or-5 - 4902-7488-2187, v 1rhizosphere bacteria. The nucleic acid may be recombinantly or chromosomally expressed by the bacteria. The nucleic acid may be episomally expressed by the bacteria.

[0010] Yet another aspect of the present disclosure relates to a material or composition comprising the bacterial cell described above or herein. The material may comprise one or more hydrogels, cellulose, films, fibers, micro-nanogels, condensates and active materials.

[0011] Another aspect of the present disclosure relates to a method of treating a disease in a mammalian subject comprising administering a bacterial cell described above or herein to the mammalian subject. The bacterial cell may be delivered to the gastrointestinal system of a mammalian subject. The bacterial cells may be administered orally, nasogastrically, colonically, or to the nose mucosa of the subject. The mammalian subject may be a human. The disease may be a gastrointestinal disease. The gastrointestinal disease may be a cancer or an inflammatory disease (e.g., inflammatory bowel disease (IBD), Chron’s disease). The disease may be a cancer. In some aspects the disease is not a gastrointenstinal cancer. The bacterial cell may be injected into a tumor in the subject.

[0012] Yet another aspect of the present disclosure relates to a method of treating a plant disease, preventing a plant disease, or promoting growth in a plant comprising contacting a bacterial cell described above or herein to a plant.

[0013] Another aspect of the present disclosure relates to a method of producing a therapeutic polypeptide, comprising: (i) culturing a bacterial cell described above or herein, and (ii) substantially purifying or isolating the therapeutic polypeptide.

[0014] A variety of cargo, such as proteins and nucleic acids, can be produced using the compositions and methods provided herein. For example, the cargo biomolecule or therapeutic polypeptide may be:1) therapeutic molecules (including, but not limited to delivery of large proteinaceous toxins, antimicrobial peptides, peptide hormones, immunostimulatory proteins / peptides, nanobodies, antibodies, anti-virulence agents (for example antitoxins to known toxins, for example neutralizing proteins against Shiga, anthrax or cholera toxins), viral proteins, enzymes for enzyme therapy (for example digestive enzymes, enzymes that help repair wounds etc), genetic engineering proteins (such as-6- 4902-7488-2187, v 1CRISPR-Cas elements including associated RNAs), nucleic acids (for example small RNA molecules used to subvert, treat or diagnose the host).2) building blocks for the production of functionalized materials (proteins that can form a gel, a paste, a mesh etc).3) recombinant proteins, including proteins for industrial and research purposes for example, enzymes for detergents or food processing (this circuit has the capacity to release heterologously expressed proteins in large amounts into the cell supernatant without need for membrane disruption).4) Release of genetic engineering enzymes for research purposes (for example, for the purpose of generating mutants in model organisms).5) environmental control agents (for example, release of proteinaceous compounds capable of eliminating pests).6) proteins used in bioremediation (for example enzymes that break down hydrocarbons to clean up oil spills or proteins that scavenge heavy metals).7) extraction of rare earth elements (for example, lanthanide binding proteins, like lanmodulin).7) proteins used in agricultural applications, for example proteins that act as pesticides for use in pest control (e.g. antimicrobial, anti-virus, anti-nematode) or enzymes used to increase crop yield by increasing the bioavailability of nutrients in the soil (for example, phosphatases, dehydrogenases, ureases).8) bioplastics (polyhydroxyalkanoates can be continuously produced and released), or biowaste degrading enzymes (like PETases that liberate the monomers for use in downstream bioplastic polymerization processes).

[0015] A variety of promoters can be used to induce expression of the lysis protein, (toxin-antitoxin) TA module, and cargo. For example, in addition to IPTG-inducible and L(+)-arabinose inducible promoters, other promoters can be used if desired. The promoter may respond to induction by other molecules - e.g., xylose, rhamnose, vanillin, m-Toluic acid, etc. Constitutive promoters can be used, e.g., for continuous cargo protein production and / or- 7 - 4902-7488-2187, v 1continuous lysis. Conditional promoters such as temperature-inducible promoters, pH-inducible promoters, metabolite-inducible promoters e.g. lactose-inducible promoters (e.g., to allow lactase enzyme cargo to be produced upon the detection of lactose in a lactose-intolerant patient), heavy metal-inducible promoters (for bioremediation), toxin-inducible promoters, virus-inducible promoters, bile-inducible promoters, acid-inducible promoters, light-inducible promoters, oxygen-inducible promoters, bacterial-density (e.g., quorum-sensing) regulated promoters, or any other promoter that has demonstrated conditional activity can also be used.

[0016] Aspects of the present disclosure can be understood by the following sentences: 1. A nucleic acid vector encoding: (i) a lysis protein; (ii) a toxin-antitoxin (TA) module encoding a toxin protein and preferably an antitoxin protein; and (iii) a cargo biomolecule selected from a therapeutic polypeptide and a therapeutic nucleic acid, wherein the vector induces expression of the lysis protein, the toxin protein, the antitoxin protein, and the therapeutic polypeptide in bacteria.2. The nucleic acid of sentence 1, wherein the lysis protein is a colicin lysis protein (colicinogenic lys protein) or a lysis gene from a bacteriocin operon.3. The nucleic acid of sentence 2, wherein the lysis gene is a colicin lysis protein selected from the group consisting of lysEl, lysE2, lysE3, lysE4, lysE5, lysE6, lysE7, lysE8, and lysE9.4. The nucleic acid of any one of sentences 1 -3, wherein the therapeutic protein is an antimicrobial protein, nanobody, immunotoxin, antibody, anti -virulence agent, or environmental control agent (e.g., anti-microbial peptide or protein, anti-viral peptides / proteins, anti-nematode peptides / proteins).5. The nucleic acid of any one of sentences 1-4, wherein the therapeutic protein is less than 180 kDa in size.6. The nucleic acid of sentence 5, wherein the therapeutic protein is less than 165 kDa in size.7. The nucleic acid of any one of sentences 1-4, wherein the toxin molecule and / or therapeutic polypeptide is an antimicrobial protein, wherein the antimicrobial protein is a bacterial colicin protein, and wherein the antitoxin is an immunity protein.- 8 - 4902-7488-2187, v 18. The nucleic acid of sentence 7, wherein the immunity protein is a cognate immunity protein of the bacterial colicin protein, or a non-cognate immunity protein.9. The nucleic acid of any one of sentences 7-8, wherein the colicin protein is colicin A, colicin El, colicin El, colicin E2, colicin E3, colicin E4, colicin E5, colicin E6, colicin E7, colicin E8, colicin E9, colicin K, colicin L, colicin N, colicin S4, colicin U, or colicin Y. 10. The nucleic acid of any one of sentences 8-9, wherein the nucleic encodes a colicin immunity pair protein, preferably an immunity pair protein from a group A or group B bacteriocin plasmid.11. The nucleic acid of any one of sentences 8-10, wherein the nucleic acid encodes a noncognate immunity protein, wherein preferably the non-cognate immunity protein can protect the bacteria from toxicity due to the bacterial colicin protein.12. The nucleic acid of any one of sentences 8-11, wherein the nucleic acid vector encodes the polypeptide and at least one of: (Colicin El and ImmEl); (Colicin E2 and ImmE2); (Colicin E4 and ImmE4); (Colicin E8 and ImmE8).13. The nucleic acid of any one of sentences 1-12, wherein the nucleic acid further encodes an antibiotic resistance cassette.14. The nucleic acid of any one of sentences 1-13, wherein the lysis protein, cargo biomolecule, and / or TA module are expressed via a single promoter.15. The nucleic acid of sentence 14, wherein the single promoter is a constitutive promoter or a conditional promoter.16. The nucleic acid of any one of sentences 1-13, wherein the lysis protein, therapeutic polypeptide, and / or immunity protein are expressed via separate promoters.17. The nucleic acid of sentence 16, wherein the separate promoters are each a constitutive promoter or a conditional promoter.18. The nucleic acid of any one of sentences 14-17, wherein the promoter(s) are each independently selected from the group consisting of: IPTG inducible, lac operon inducible, or L(+)-arabinose inducible promoters; a promoter inducible by xylose, rhamnose, vanillin, m-Toluic acid; a conditional promoter such as temperature-inducible promoters, pH-inducible- 9 - 4902-7488-2187, v 1promoter, metabolite-inducible promoter (e.g., lactose-inducible promoter, for example so lactase enzyme cargo can be produced upon the detection of lactase in lactose-intolerant patients), a heavy metal-inducible promoter, a toxin-inducible promoter, a virus-inducible promoter, a bile-inducible promoter, an acid-inducible promoter, a light-inducible promoter, or an oxygen-inducible promoter, bacterial-density regulated promoters (quorum-sensing). 19. The nucleic acid of any one of sentences 1-18, wherein the toxin-antitoxin (TA) module does not encode an antitoxin protein.20. A bacterial cell comprising the nucleic acid of any one of sentences 1-19.21. The bacterial cell of sentence 20, wherein the bacterial cell is a Alphaproteobacteria (e.g., Rhodobacter sphaeroides), Gammaproteobacteria, Enterobacteriaceae (e.g., Pectobacterium, Escherichia coli e.g., K12, B, Nissle), Klebsiella aerogenes, Salmonella enterica, Shigella spp.), Pseudomonadaceae (Pseudomonas spp. Including Pseudomonas putida), or Yersiniaceae (Serratia spp.) bacteria.22. The bacterial cell of any one of sentences 20-21, wherein the bacterial cell is a probiotic bacterium, an attenuated bacterium, or the bacterium is substantially or essentially safe for human consumption.23. The bacterial cell of sentence 22, wherein the bacterium is a Nissle 1917, 5. enterica VNP20009, or an Enterobacterial vaccine strains (e.g., Shigella, Salmonella).24. The bacterial cell of any one of sentences 20-23, wherein the bacterial cell is substantially or essentially safe for environmental use.25. The bacterial cell of sentence 24, wherein the bacterial cell is a Rhodobacter sphaeroides, Pectobacterium, Serratia, Pseudomonas putida, or rhizosphere bacteria.26. The bacterial cell of any one of sentences 20-25, wherein the nucleic acid is recombinantly or chromosomally expressed by the bacterial cell.27. The bacterial cell of any one of sentences 20-25, wherein the nucleic acid is episomally expressed by the bacteria.28. A material comprising the bacterial cell of any one of sentences 20-27 or the nucleic acid of any one of sentences 1-19.- 10 - 4902-7488-2187, v 129. The material of sentence 28, wherein the material is further defined as comprising one or more hydrogels, cellulose, films, fibers, micro-nanogels, condensates and active materials.30. A method of treating a disease in a mammalian subject comprising administering a bacterial cell of any one of sentences 20-27 to the mammalian subject.31. The method of sentence 30, wherein the bacterial cell is delivered to the gastrointestinal system of a mammalian subject.32. The method of sentence 31, wherein the bacterial cells is administered orally, nasogastrically, colonically, or to the nose mucosa of the subject.33. The method of any one of sentences 30-32, wherein the mammalian subject is a human.34. The method of any one of sentences 30-33, wherein the disease is a gastrointestinal disease.35. The method of sentence 34, wherein the gastrointestinal disease is a cancer or an inflammatory disease, such as inflammatory bowel disease (IBD) or Chron’s disease.36. The method of any one of sentences 30-35, wherein the disease is a cancer.37. The method of any one of sentences 30-35, wherein the bacterial cell is injected into a tumor in the subject.38. A method of treating a plant disease, preventing a plant disease, or promoting growth in a plant comprising contacting the bacterial cell of any one of sentences 20-27 to a plant. 39. A method of producing a therapeutic polypeptide, comprising: (i) culturing a bacterial cell of any one of sentences 20-27, and (ii) substantially purifying or isolating the therapeutic polypeptide.

[0017] As used herein the specification, “a” or “an” may mean one or more. As used herein in the claim(s), when used in conjunction with the word “comprising,” the words “a” or “an” may mean one or more than one.

[0018] The use of the term “or” in the claims is used to mean “and / or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the- 11 - 4902-7488-2187, v 1disclosure supports a definition that refers to only alternatives and “and / or.” As used herein “another” may mean at least a second or more.

[0019] Throughout this application, the term “about” is used to indicate that a value includes the inherent variation of error for the device, the inherent variation in the method being employed to determine the value, the variation that exists among the study subjects, or a value that is within 10% of a stated value.

[0020] As used herein, “essentially free,” in terms of a specified component, is used herein to mean that none of the specified component has been purposefully formulated into a composition and / or is present only as a contaminant or in trace amounts. The total amount of the specified component resulting from any unintended contamination of a composition is therefore well below 0.05%, preferably below 0.01 %. Most preferred is a composition in which no amount of the specified component can be detected with standard analytical methods.

[0021] As used in this specification and claim(s), the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have" and “has”), “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0022] The terms “in operable combination”, “in operable order”, and “operably linked” refer to a linkage wherein the components so described are in a relationship permitting them to function in their intended manner, for example, a linkage of nucleic acid sequences in such a manner that a nucleic acid molecule capable of directing the transcription of a given gene or the synthesis of desired protein molecule, or a linkage of amino acid sequences in such a manner so that a fusion protein is produced.

[0023] The terms “subject,” “host,” “patient,” and “individual” are used interchangeably herein to refer to any mammalian subject for whom therapy is desired, particularly humans. Other subjects may include cattle, dogs, cats, guinea pigs, rabbits, rats, mice, horses, and so on.

[0024] The term “unit dose” when used in reference to a therapeutic composition refers to physically discrete units suitable as unitary dosage for the subject, each unit containing a- 12 - 4902-7488-2187, v 1predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required diluent, i.e., carrier, or vehicle.

[0025] Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.- 13 - 4902-7488-2187, v 1BRIEF DESCRIPTION OF THE DRAWINGS

[0026] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

[0027] FIG. 1. (Top row) Natural bacteriocin operons (left box) comprise toxin, antitoxin and release genes. Upon induction (ON), all gene products are expressed at high amounts; the anti-toxin (smaller circles) protects the toxin producer from intoxication. The release element impairs the cell envelope via a novel mechanism of action, thus disrupting both the inner and outer cell membrane. This results in toxin release in the extracellular milieu. (Bottom row) This system can be repurposed as a protein delivery platform (right box) by using synthetic regulation and by addition of heterologous protein cargo. In this synthetic circuit, the toxin / anti-toxin genes ensure plasmid maintenance. The bacteria will deliver both the toxin and the heterologous protein cargo upon system induction (ON).

[0028] FIG. 2. GFP release assay on E. coli BZB1011 or BL21(DE3) strains labelled with a single gfp copy on their Tn7 chromosomal locus (BZB 1011 -gfp). The release element Qys) from the natural colicin El operon was cloned in several commonly used vectors. pDM1 is a pACYC vector derivative developed in the Mavridou lab and is induced with IPTG. pBAD is induced with L(+)-arabinose and pET28a is induced with IPTG. Three biological replicates in technical triplicate.

[0029] FIG. 3. General schematic of pOtter circuits. All of them contain the three-part architecture of the natural colicin operons (toxin, immunity and release element genes for the colicin El operon) under the influence of the araBAD promoter. The strength of the RBS and the copy number of the origin can vary (marked by *). Tentative location of the cargo protein is shown both on the vector map and on the inset inside the dotted line.

[0030] FIG.4. GFP release assay on E. coli BZB1011 strains labelled with a single gfp copy on their Tn7 chromosomal locus (BZB 1011-gfp) and harboring diverse pOtter constructs. pColEl is the natural El colicinogenic plasmid and is used for comparison purposes. pOtter-ColOp and pOtter(h)-ColOp encompass the natural colicin operon RBS; pOtter(h) is a high-- 14 - 4902-7488-2187, v 1copy variant of pOtter. pOtter-UA-ColOp and pOtter(h)-UA-ColOp encompass the strong RBS from the pUA plasmid series. Three biological replicates in technical triplicate.

[0031] FIGS. 5A-C. (A) GFP release assay on E. coli BZB1011 labelled with a single gfp copy on its Tn7 chromosomal locus (BZB1011-gfp) and harboring pOtter-ColOp or E. coli BZB 1011 harboring variants of pOtter-ColOp. pOtter-ColOp-gfp expresses the colicin E1 gene fused with GFP at its N-terminus (758 amino acids, 83.9 kDa); pOtter-2(ColOp-gfp), includes an N-terminal duplication of the GFP -tagged colicin El gene (1,515 amino acids, 167.7 kDa). Three biological replicates in technical triplicate. (B) SDS PAGE of supernatants of the induced cultures from (A) stained for total protein. The cargos of pOtter-ColOp (colicin), pOtter-ColOp-g / p (GFP-colicin fusion), and pOtter-2(ColOp-g / p) (GFP-colicin-GFP-colicin fusion) are indicated with arrows in columns 2-4, respectively. (C) Immunoblot of the gel in (B), using an anti-GFP antibody. The colicin cargo pOtter-ColOp is not detected as it does not have a GFP tag. The cargos of pOtter-ColOp-g / p (GFP-colicin fusion), and pOtter-2(ColOp-g / p) (GFP-colicin-GFP-colicin fusion) are indicated with arrows in columns 3 and 4, respectively.

[0032] FIGS. 6A-B. (A) GFP release assay on E. coli BZB1011 labelled with a single gfp copy on its Tn7 chromosomal locus (BZB 1011 -gfp) and harboring pOtter-ColOp or other Enterobacteria harboring pOtter-ColOp-g / p. The following strains were used: E. coli BZB 1011, E. coli Nissle 1917, K. aero genes FRI, 5. enterica VNP20009. Three biological replicates in technical triplicate. (B) SDS PAGE of supernatants of the induced cultures from (A) stained for total protein.

[0033] FIGS. 7A-C. (A) GFP release assay on E. coli BZB 1011 harboring variants of pOtter-ColOp. pOtter-ColOp-g / p expresses the colicin El gene fused with GFP at its N-terminus (758 amino acids, 83.9 kDa); pOtter-ColOp-g / p- T7genel expresses T7 genel N-terminally fused to the GFP-colicin El fusion (1,640 amino acids, 182.6 kDa). Two biological replicates in technical triplicate. (B) SDS PAGE of supernatants of the induced cultures from (A) stained for total protein. The cargos of pOtter-Col Op-g / p (GFP-colicin fusion) andpOtter-CoiOp-gfp-T7genel (T7 genel -GFP-colicin fusion) are indicated with red and blue arrows, respectively. (C) Immunoblot of the gel in (B), using an anti-GFP antibody. The cargos of pOtter-ColOp-gfp (GFP-colicin fusion), and pOtter-ColOp-gfp-T7gene1 (T7 genel -GFP-colicin fusion) are indicated with red and blue arrows, respectively.- 15 - 4902-7488-2187, v 1

[0034] FIGS. 8A-B. (A) GFP release assay on E. coli BZB1011 labelled with a single gfp copy on its Tn7 chromosomal locus (BZB 1011-gfp) and harboring a pET_RTX_(exo-) expressing a ~90kDa thermostable protein derived from the KOD DNA polymerase. Cells also harbor either pOtter-ColOp or the empty vector control (pOtter). Single biological replicate in technical triplicate. (B) Polymerase activity assays performed with supernatants from pOtter-ColOp-harboring cells shown in (A). (Top) Supernatants from cultures, whereby pOtter-ColOp expression was repressed were used in the presence (left) and absence (right) of DNA template. (Bottom) Supernatants from cultures, whereby pOtter-ColOp expression was induced were used in the presence (left) and absence of DNA template (right).

[0035] FIGS. 9A-B. (A) Alkaline phosphatase activity assay on supernatants of E. coli BZB 1011 and harboring pOtter-ColOp-g / p or pOtter-phoA whereby the pho A gene is replacing the colEl toxin and immunity genes of pOtter-ColOp. Single biological replicate in technical triplicate. (B) SDS PAGE of supernatants of the induced cultures from (A) stained for total protein.

[0036] FIGS. 10A-C. (A) GFP release assay on E. coli BZB1011 harboring duet pOtter-ColOp circuits with different site orientations, pOterDUET-ColOp-^' / p or pOtterDUET-g / p-ColOp. One biological replicate in technical triplicate. (B) GFP release assay on E. coli BZB 1011 labelled with a single gfp copy on its Tn7 chromosomal locus (BZB 1011-gfp) harboring pOtter-ColOp or E. coli BZB 1011 horboring pOtter-ColOp variants with duet architectures encoding both the release circuit and a constitutively expressed GFP protein cargo under the control of different RBS elements. Two biological replicates in technical triplicate.(C) GFP release assay on E. coli BZB 1011 labelled with a single gfp copy on its Tn7 chromosomal locus (BZBlOll-g / p) harboring pOtter-ColOp or E. coli BZB 1011 horboring pOtter-ColOp variants with duet architectures encoding both the release circuit and an IPTG-inducible GFP protein cargo under the control of different RBS elements. One biological replicate in technical triplicate.

[0037] FIG. 11. Northern blot of RNA isolated from E. coli BL21 (DE3) cells harboring pOtter-ColOp-g / p and pET28a(+)Cm-BLV-B5 or from their culture supernatants. pET28a(+)Cm-BLV-B5 encodes the BLV-B5 microRNA (PMID: 22308400). Expression of the release circuit and the microRNA cargo were induced or repressed, and the BLV-B5 microRNA was detected with a specific probe as described in Szymanik et al. 2025. The size of the BLV-B5 microRNA is indicated with a red arrow. The blue arrow denotes a band- 16- 4902-7488-2187, v 1originating from the BLV-B5 premiRNA DNA sequence on the pET28a(+)Cm-BLV-B5 plasmid that is also released into the supernatant and remains as an impurity during RNA extraction.- 17 - 4902-7488-2187, v 1DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

[0038] Certain bacteriocin operons found in Escherichia coli are known to release colicin toxins to eliminate closely related competitors. By screening several different colicinogenic strains, natural operons were identified with ideal gene architectures for efficient toxin release. Next, the balance between operon regulation and activity of the release element was explored (Fig. 1). It was discovered that the release element functions atypically, by overwhelming the lipoprotein processing machinery of the bacterium. This results in disruption of the membranes without explosive lysis, therefore achieving continuous cytoplasmic content release.

[0039] Chosen colicinogenic operons were ported into a synthetic vector backbone. Its regulation was engineered to be dependent on the use of safe compounds, while still achieving protein release levels that are similar to the natural colicinogenic strains. Moreover, for the purpose of these studies, the toxin molecule was engineered to harbor a green fluorescent protein (GFP) tag at its N-terminus, thus allowing the release of protein cargo to be tracked. As shown in the below examples, studies using E. coli and other Enterobacteria showed that this approach can be used to deliver large proteins (e.g., > 165 kDa, >180 kDa) at high amounts upon induction with safe compounds. The methods provided herein can be used for continuous delivery of protein cargo of this size and at these amounts using bacterial vectors.

[0040] This demonstration presents a unique platform for the delivery of large biomolecules by bacteria in situ. Simply considering the capacity of bacteria for protein production, the applications of such a platform are substantial. Bacteria safe for human consumption carrying the circuit described herein can be used as live therapeutics when delivering antimicrobial proteins (like the natural cargo of these operons), immunostimulatory proteins or peptides, nanobodies, antibodies, anti-virulence agents, and genetic engineering proteins (like CRISPR-Cas elements). Similarly, bacteria that are safe for environmental uses can become vehicles for the delivery of building blocks for the production of functionalized materials, for example proteins that can form gels, or pastes upon self-assembly. Alternatively, similar strains could be used as environmental control agents, for the release of proteinaceous compounds that reduce or eliminate crop pests, or promote plant growth. This system may be used as a research or industry tool, for example for protein expression / purification applications, whereby it will be used to release heterologous proteins in large amounts into the- 18 - 4902-7488-2187, v 1cell supernatant without the need for membrane disruption. Finally, considering the size of cytoplasmic molecules released via the circuit, applications are not limited to the delivery of proteins. Its applications can be extended to other bioactive molecules; for example, release of nucleic acids in the form of small RNAs falls within the current size limitations of the circuit described herein.Nucleic Acids

[0041] In certain embodiments, the present disclosure provides isolated nucleic acid molecules encoding a polypeptide as described herein. The nucleic acid molecules may include, without limitation, DNA, complementary DNA (cDNA), and RNA sequences. In some embodiments, the nucleic acid molecule encodes only a portion of the polypeptide, such as the ectodomain. The nucleic acid molecules disclosed herein may be operably incorporated into a vector, such as an expression vector, to facilitate transcription and / or translation in a host cell.

[0042] In some embodiments, the nucleic acid is an RNA molecule, including, but not limited to, a self-replicating RNA, a modified RNA (e.g., chemically modified for enhanced stability or translational efficiency), or a circular RNA. Also provided herein are compositions comprising one or more of the nucleic acid molecules described.

[0043] The nucleic acid molecules encoding a polypeptide typically comprise an open reading frame (ORF) encoding the amino acid sequence of the polypeptide. Unless expressly stated otherwise, reference to a particular nucleic acid sequence encompasses all degenerate codon variants that encode the same amino acid sequence by virtue of the redundancy in the genetic code.

[0044] The nucleic acid molecules described herein may include one or more expression control elements or regulatory elements operably linked to the ORF. These elements are configured to modulate transcription and / or translation of the encoded polypeptide in a host cell. Non-limiting examples of regulatory elements include transcription initiation elements (e.g., promoters, enhancers, TATA boxes), translation initiation sequences (e.g., ribosome binding sites), sequences influencing mRNA stability, polyadenylation signals, secretory signal sequences, and untranslated regions (UTRs).

[0045] In bacterial expression systems, suitable expression control elements include promoters that may be constitutive or inducible. Non-limiting examples of inducible bacterial- 19 - 4902-7488-2187, v 1promoters include: isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible promoters, such as the lac operon; L(+)-arabinose-inducible promoters (e.g., araBAD); xylose-inducible promoters; rhamnose-inducible promoters; vanillin-inducible promoters; m-toluic acidinducible promoters; and metabolite-inducible promoters, including lactose-inducible promoters for use in applications such as targeted production of lactase enzyme in lactose-intolerant individuals. Conditional promoters may include temperature-inducible promoters, pH-inducible promoters, heavy metal-inducible promoters, toxin-inducible promoters, virusinducible promoters, bile-inducible promoters, acid-inducible promoters, light-inducible promoters, oxygen-inducible promoters, and quorum-sensing regulated promoters (e.g., bacterial density-dependent). Constitutive bacterial promoters, such as those from the Anderson promoter series, may also be utilized.

[0046] In mammalian expression systems, expression control elements may similarly be constitutive or inducible. Non-limiting examples of constitutive promoters include the cytomegalovirus (CMV) immediate early promoter, the elongation factor- 1 alpha (EF-lot) promoter, the simian virus 40 (SV40) early promoter, and the ubiquitin C (UbC) promoter. Examples of inducible mammalian promoters include tetracycline -responsive promoters (Tet-on / Tet-off systems), mifepristone -inducible promoters, ecdysone -inducible promoters, and heat shock protein (HSP)-inducible promoters.

[0047] Regulatory elements described herein may be derived from natural sources, such as bacterial genomes (e.g., Escherichia coli, Salmonella enterica, Shigella flexneri, Vibrio cholerae"), bacteriophages, eukaryotic organisms, or may be synthetically designed. The choice of regulatory element can be tailored to the intended application and host system to achieve desired expression levels and patterns.

[0048] In certain embodiments, additional regulatory sequences may be included to enhance gene expression and / or allow for controlled translation. Such elements may include mRNA stability-enhancing sequences, untranslated regions (5' and / or 3' UTRs), internal ribosome entry sites (IRES), or ribosomal binding sites.

[0049] In some embodiments, the expression vector into which the nucleic acid is introduced may further comprise one or more selectable marker genes, including but not limited to, antibiotic resistance genes. The expression vector may be episomal or integrative, and may be configured for replication in bacterial, mammalian, or other host cells.- 20 - 4902-7488-2187, v 1Lysis Proteins

[0050] In certain embodiments, the present disclosure relates to bacterial lysis proteins. As used herein, "lysis proteins" refer to proteins capable of disrupting or degrading bacterial cell wall or membrane structures, leading to lysis of the bacterial cell and release of intracellular contents. Lysis proteins are commonly derived from colicinogenic operons, bacteriophages, autolysis systems, or other naturally occurring bacterial systems, and may function enzymatically or by pore formation or by other mechanisms. Preferably the lysis protein is not a bacteriophage-derived lysis protein and does not cause explosive cell lysis.

[0051] The lysis protein may be a colicinogenic lys protein. Colicinogenic lys proteins are described, e.g., in Cole et al. 1985, Mader et al., 2015; Cavard et al., 1989; Lloubes et al.1993). Exemplary colicinogenic lysis proteins include, but are not limited to: LysEl, LysE2, LysE3, LysE4, LysE5, LysE6, LysE7, LysE8, and LysE9. These lysis proteins may differ in structure, catalytic domain, target specificity, and mechanism of action. Preferably the toxin does not kill the cell either due to reduced expression and / or due the presence of an antitoxin cognate pair. Bacteriocin lysis elements are smaller (e.g., typically less than 50 amino acids) lipopeptides with an unknown mechanism of action. They may localize in the inner and outer membrane of bacteria and their expression can lead to disruption of these membranes and release of cytoplasmic cell content, in a process that has been referred to as "quasilysis." This process is not the same as explosive lysis (for example performed by elements encoded by phage). As shown in the below examples, this quasilysis can result in slow and sustainable protein release.

[0052] Lysis proteins, especially ones derived from bacteriophage, may also function through enzymatic cleavage of cell wall components, such as N-acetylmuramoyl-L-alanine amidase, glycosidase, or endopeptidase activity, or through formation of membrane pores that compromise membrane integrity. The activity of such proteins can be rapid, highly specific to bacterial species, and tunable based on environmental conditions or engineered features.

[0053] In certain embodiments, lysis proteins may include one or more functional domains such as catalytic domains, binding domains, or secretion signals. Some lysis proteins may operate independently, while others may require co-factors, chaperones, or the presence of specific host factors to exert their lytic effect. Modular lysis proteins may be engineered by fusing domains from different natural lytic enzymes to tailor activity, specificity, or regulatory properties.- 21 - 4902-7488-2187, v 1

[0054] Lysis proteins may be used in a range of biotechnological and biomedical applications, including controlled bacterial self-lysis for protein or metabolite release, biosensing applications where lysis serves as a readout signal, biocontainment strategies to eliminate engineered organisms, and therapeutic systems where bacterial lysis delivers therapeutic payloads or disrupts pathogenic bacteria in situ.

[0055] In some embodiments, lysis proteins are designed to function under specific environmental triggers. For example, temperature-sensitive or pH-sensitive variants may undergo conformational changes that activate lytic activity only under defined conditions. Other variants may be responsive to the presence of bile salts, metabolites (e.g., lactose), oxygen levels, or quorum sensing signals. These context-specific lysis proteins enable spatiotemporal control of bacterial lysis in diverse physiological and industrial environments.

[0056] Lysis proteins may further be engineered to enhance their solubility, reduce host toxicity, improve folding efficiency, or increase resistance to proteolytic degradation. In certain embodiments, lysis proteins may be modified to include degradation tags, secretion sequences, or localization signals, allowing for precise control of cellular distribution and degradation kinetics.

[0057] In industrial or therapeutic contexts, bacterial lysis proteins offer advantages such as reduced reliance on mechanical disruption methods, improved recovery of labile intracellular products, and compatibility with in vivo applications where host-specific lysis is required. When used in engineered microbial systems, lysis proteins may form part of a controlled release mechanism for therapeutic agents, vaccines, or metabolic products.Toxin- Antitoxin (TA) Modules

[0058] In certain embodiments, the present disclosure relates to bacterial toxinantitoxin (TA) modules. TA modules are naturally occurring genetic systems composed of a toxin protein capable of inhibiting or killing the host cell, and an antitoxin protein that neutralizes the toxin's activity under regulated conditions (Singh et al., 2021). These modules function in post-segregational killing, stress response, programmed cell death, and maintenance of mobile genetic elements, and may be adapted for use in biocontainment, kill-switch systems, or regulated population control in engineered microbial systems.- 22 - 4902-7488-2187, v 1

[0059] In some embodiments, the toxin component is a colicin protein. Colicins are a class of bacteriocins produced by Escherichia coli and related bacterial species, which act by disrupting membrane integrity, degrading nucleic acids, or inhibiting protein synthesis in susceptible cells. Exemplary colicin proteins include, but are not limited to: Colicin A, Colicin D, Colicin E2, Colicin E3, and Colicin E7. These toxins exhibit different mechanisms of action: for example, Colicin A forms voltage-dependent pores in bacterial membranes, Colicin D acts as a tRNase, Colicin E2 and E3 are nucleases targeting DNA and rRNA, respectively, and Colicin E7 functions as a DNase (Calcuttawala et al., 2022).

[0060] The antitoxin component may be a cognate immunity protein that specifically binds and neutralizes the associated colicin toxin. Cognate antitoxins can form form tight, often stoichiometric, complexes with their corresponding toxins, thereby preventing their lethal activity under normal conditions, or otherwise, protect specific cellular structures, like the bacterial membranes. Exemplary toxin-antitoxin (TA) pairs include, without limitation: Colicin El and ImmEl; Colicin E2 and ImmE2; Colicin E4 and ImmE4; Colicin E8 and ImmE8. Exemplary colicin proteins are provided as follows:Colicin El (GenBank ID AAA59418.1), ImmEl (GenBank ID AAA26071.1)Colicin E2 (GenBank ID CAA25609.1), ImmE2 (GenBank ID CAA25610.1)Colicin E8 (GenBank ID CAA29491.1), ImmE8 (GenBank ID CAA29492.1)Colicin E4 (nucleic acid sequence: atgagcggtggagatggacgTgGccacaacagtggcgcacataacacaggtggtaacattaatggcggccctacggggcttggtg gaaatggtggggcttctgacggctccggatggagttcggaaaataacccatggggtggcggttcCggtagtggtgttcactggggag gtggctccggccatggcaatggTggggggaatggtaattccggtggtggcagcaaCtcatccgtagcagcagtggcatttggttttc ctgctttggcagctcctggtgccggaacactgggtatcgccgtctctggtgaggctttatctgcggcaatagcggatatcttgcagAcct gaaaggtccgtttaaattcagtgcatggggtattgcGCTTTACAGCATTCTGCCATCTGAAATAGCAAA AGATGACCCGAAAATGATGTCAAAGATTGTGACGTCATTACCGGCAGAAACCGT GACGAATGTCCAGGTCAGTACACTTCCGCTGGACCAGGCAACGGTCAGAGTGAC GAAGCGTGTAACAGATGTTGTGAAGGACAAACGACAGCATATTGCCGTGGTTGC GGGTGTACCTATGAGTGTGCCTGTTGTAAATGCTAAACCAACACGTACTCCTGGT GTATTTCGCGCATCATTTCCTGGTGTCCCTTCTCTGACACTTAGCACTGTCAAAGG CCTTCCGGCGTCAACAACCCTTCCCCGTGGTATTACGGAGGATAAAGGCCGGACT GCCTCTCCTGCAGGATTTACCTTTGGTGGTGGTTCACATGAAGCGGTGATCCGTTT- 23 - 4902-7488-2187, v 1TCCGAAAGAAAGTGGGCAGAAGCCGGTTTATGTATCAGTAACAGATGTTCTTACC TCTGCACAGGTAAAACAACGTCAGGATGAAGAGAATCGCCTCCAGCAGGAATGG AATGACACACATCCGGTAGAAGTAGCTGAACGCAATTATGAACAGGCTCGCGCA GAACTGAATCAGGCTAATAAGGATGTTGCCAGAAATCAGGAACGACAGGCTAAA GCTGTTCATGTTTATAATTCGCGTAAAAGTGAACTTGATGCAGCGAATAAAACTT TTGCTGATGCAAAGGCTGAAATAAAGCGATTCgagcgatttgctcgagaaccaatggctgctggtcac agaatgtggcaaatggcagggcttaaggcccagcgggcacagacggatgtaaataataagaaggctgcatttgatgctgccgcaaa agagaagtcagCAgcagatgctgcattgagttctgcgatggaaagcaggaagaagaaagaagataagaaaaggagtgctgaaaat aaattaaacgaggaaaaaaacaagcctcgcaagggagttaaagattacggtcatgattatcatcccgctccaaagaccgaagaaataa aggggttgggggaattaaaaaaagcacctaaaaaaacacctaaacaaggtggtggtggtagacgtgaccgctggattggtgataaag gccgtaagatttatgaatgggactcccagcacggtgagcttgaagggtatcgtgccagtgatggcgaacacatcggggcatttgaccc aaaaacgggtaaacaaattaaaggtccggatccgaaagggcgaaatattaaaaaatatctttaa) (SEQ ID NO:1) Imm E4 (nucleic acid sequence: atgagcggtggagatggacgTgGccacaacagtggcgcacataacacaggtggtaacattaatggcggccctacggggcttggtg gaaatggtggggcttctgacggctccggatggagttcggaaaataacccatggggtggcggttcCggtagtggtgttcactggggag gtggctccggccatggcaatggTggggggaatggtaattccggtggtggcagcaaCtcatccgtagcagcagtggcatttggttttc ctgctttggcagctcctggtgccggaacactgggtatcgccgtctctggtgaggctttatctgcggcaatagcggatatcttgcagAcct gaaaggtccgtttaaattcagtgcatggggtattgcGCTTTACAGCATTCTGCCATCTGAAATAGCAAA AGATGACCCGAAAATGATGTCAAAGATTGTGACGTCATTACCGGCAGAAACCGT GACGAATGTCCAGGTCAGTACACTTCCGCTGGACCAGGCAACGGTCAGAGTGAC GAAGCGTGTAACAGATGTTGTGAAGGACAAACGACAGCATATTGCCGTGGTTGC GGGTGTACCTATGAGTGTGCCTGTTGTAAATGCTAAACCAACACGTACTCCTGGT GTATTTCGCGCATCAT TCCTGGTGTCCCTTCTCTGACACTTAGCACTGTCAAAGG CCTTCCGGCGTCAACAACCCTTCCCCGTGGTATTACGGAGGATAAAGGCCGGACT GCCTCTCCTGCAGGATTTACCTTTGGTGGTGGTTCACATGAAGCGGTGATCCGTTT TCCGAAAGAAAGTGGGCAGAAGCCGGTTTATGTATCAGTAACAGATGTTCTTACC TCTGCACAGGTAAAACAACGTCAGGATGAAGAGAATCGCCTCCAGCAGGAATGG AATGACACACATCCGGTAGAAGTAGCTGAACGCAATTATGAACAGGCTCGCGCA GAACTGAATCAGGCTAATAAGGATGTTGCCAGAAATCAGGAACGACAGGCTAAA GCTGTTCATGTTTATAATTCGCGTAAAAGTGAACTTGATGCAGCGAATAAAACTT TTGCTGATGCAAAGGCTGAAATAAAGCGATTCgagcgatttgctcgagaaccaatggctgctggtcac agaatgtggcaaatggcagggcttaaggcccagcgggcacagacggatgtaaataataagaaggctgcatttgatgctgccgcaaa agagaagtcagCAgcagatgctgcatgagttctgcgatggaaagcaggaagaagaaagaagataagaaaaggagtgctgaaaat- 24 - 4902-7488-2187, v 1aaattaaacgaggaaaaaaacaagcctcgcaagggagttaaagattacggtcatgattatcatcccgctccaaagaccgaagaaataa aggggttgggggaattaaaaaaagcacctaaaaaaacacctaaacaaggtggtggtggtagacgtgaccgctggattggtgataaag gccgtaagatttatgaatgggactcccagcacggtgagcttgaagggtatcgtgccagtgatggcgaacacatcggggcatttgaccc aaaaacgggtaaacaaattaaaggtccggatccgaaagggcgaaatattaaaaaatatctttaa)(SEQ ID NO:2)

[0061] In certain embodiments, non-cognate immunity proteins may be employed, wherein an immunity protein can interact with and preferably neutralize a non-native toxin. Such cross-reactivity may be partial or engineered, allowing for the creation of orthogonal or tunable TA systems. Non-cognate combinations may be leveraged to design multi-layered safety switches or to introduce competitive regulatory elements within microbial populations.

[0062] The toxin and antitoxin proteins may each include one or more functional domains. For example, colicin toxins may comprise a receptor-binding domain, a translocation domain, and an active domain responsible for cytotoxic activity. Immunity proteins may consist of a-helical domains that bind to and occlude the toxin’s active site. Variants and fragments of the native proteins that retain functional activity (i.e., cytotoxicity or neutralization) are within the scope of the disclosure (Singh et al., 2021).

[0063] TA module activity may be conditionally regulated at the protein or transcriptional level. In some embodiments, the toxin is constitutively expressed while the antitoxin is inducible or environmentally sensitive (e.g., degraded under specific conditions), allowing for the implementation of programmable or environment-responsive kill-switches. Alternatively, both components may be co-expressed under independent or coordinated control, enabling dynamic tuning of system stability and toxicity thresholds.

[0064] TA modules may be integrated into episomal or chromosomal loci, and may be configured as part of broader genetic constructs including expression cassettes, selectable markers, or biosafety elements. In certain embodiments, TA modules are employed in engineered bacteria to prevent escape or persistence in off-target environments. Upon loss of the antitoxin, either due to plasmid segregation, environmental signal, or metabolic depletion, the unneutralized toxin exerts its lethal effect, thereby enforcing containment or termination of the engineered cell.

[0065] TA modules as described herein may be used in microbial therapeutics, environmental biosensors, biomanufacturing platforms, or any application where conditional cell death, gene circuit stabilization, or selective pressure is desired. The modules may also be- 25 - 4902-7488-2187, v 1adapted to control population density, inter-strain competition, or spatial localization of engineered bacterial populations.Bacteria

[0066] In certain embodiments, the present disclosure relates to bacterial strains that are suitable for use in the generation, expression, delivery, or production of therapeutic, or industrial proteins. The bacteria described herein may be naturally occurring, laboratory-adapted, attenuated, or genetically engineered, and may be selected or modified to optimize attributes such as growth kinetics, genetic stability, transformation efficiency, secretion capacity, biosafety, or environmental resilience, depending on the application.

[0067] Suitable bacterial strains may belong to a range of phylogenetic classes including, but not limited to, Alphaproteobacteria and Gammaproteobacteria. Representative families include Ent erob act eriaceae, Pseudomonadaceae, and Yersiniaceae. Within these groups, species and strains may include Rhodobacter sphaeroides, members of the genus Pectobacterium, strains of Escherichia coli including KI 2, B and the probiotic strain Nissle 1917, Klebsiella aero genes, Salmonella enterica including attenuated strains such as VNP20009, Shigella species including vaccine strains, Serratia. species, and Pseudomonas species such as Pseudomonas putida. These bacterial hosts may be utilized in a wide variety of contexts requiring the production or delivery of proteins or other biomolecules.

[0068] In therapeutic applications, bacterial strains such as E. coli Nissle 1917 may be used as live bacterial therapeutics for mucosal delivery of biologies, immunomodulators, or antigens. Such strains may be further engineered to include expression constructs encoding therapeutic proteins, secretion signals, or genetic safeguards such as kill-switch systems or toxin-antitoxin modules. Attenuated strains such as Salmonella enterica VNP20009 may be used in oncology applications, delivering therapeutic pay loads directly to the tumor microenvironment under tightly regulated conditions. Shigella and Salmonella vaccine strains may serve as delivery vehicles for mucosal immunization or localized release of antigens or adjuvants.

[0069] In industrial contexts, strains such as Rhodobacter sphaeroides, Pectobacterium, Serratia, and Pseudomonas putida may be employed for high-efficiency expression of enzymes, pathway intermediates, or biocatalytic agents. These strains may be adapted for the biosynthesis of small molecules, biodegradable polymers, biofuels, or high-- 26 - 4902-7488-2187, v 1value metabolites. For example, Pseudomonas putida is particularly suited for metabolic engineering due to its tolerance of toxic intermediates, ability to utilize diverse carbon sources, and compatibility with complex synthetic pathways (Aryal, 2022). Rhodobacter sphaeroides, as a photosynthetic bacterium, is capable of light-dependent biosynthesis and may be exploited for cofactor production or as a chassis for light-responsive synthetic biology circuits (Aizawa, 2014).

[0070] In some embodiments, rhizosphere-associated bacteria such as Pectobacterium, Serratia, or Pseudomonas species may be utilized for plant-associated biotechnological applications, including delivery of agronomic traits, biosensors, or enzymes that influence soil health or nutrient uptake. These strains may be engineered for enhanced interaction with plant roots or for expression of bioactive proteins in proximity to crops.

[0071] The bacterial strains described herein may be further engineered to contain exogenous genetic elements including, but not limited to, expression cassettes, secretion signals, biosafety modules, environmental sensors, or genetic circuits that enable regulated protein expression or delivery. The bacteria may be transformed with plasmids or genomic integrations encoding proteins of interest, and may include regulatory systems that allow for inducible, repressible, or constitutive expression under specific conditions.

[0072] In certain embodiments, the bacterial strains may be selected for compatibility with defined growth media, metabolic substrates, oxygen requirements, or environmental conditions, including aerobic, anaerobic, or facultative growth. The strains may also be adapted to specific bioproduction environments, host interactions, or delivery mechanisms. Engineered strains may include additional genetic modifications for enhanced expression, translation efficiency, stress tolerance, or cellular containment.

[0073] The bacterial strains disclosed herein may be employed in free-living, encapsulated, surface-adhered, or biofilm-associated formats, and may be delivered or deployed through various administration routes or process conditions depending on the system requirements. Formulations may be prepared in liquid, frozen, lyophilized, or stabilized forms, and may include excipients, carriers, or matrices to facilitate use in laboratory, clinical, field, or manufacturing environments.- 27 - 4902-7488-2187, v 1Cargo Biomolecules / Polypeptides

[0074] In certain embodiments, the present disclosure relates to cargo biomolecules, including polypeptides and nucleic acids, that are intended for therapeutic, diagnostic, industrial, or environmental applications. The term “cargo” refers to any biologically active molecule that is delivered, expressed, or produced by a host cell or delivery system, and which confers a functional effect on the local environment, target cell, or organism. Such biomolecules may be naturally derived, recombinant, synthetic, or chimeric in origin and may be produced in situ, secreted into the extracellular space, or retained within the producing organism depending on the intended application. The cargo biomolecule may be a polypeptide up to 300, 290, 280, 270, 260, 250, 240, 230, 220, 210, 200, 190, 180, 170, 160, 150, 140, 130, 120, 100, 90, 80, 70, 60, 50 kDa or any range derivable therein. Preferably, the cargo biomolecule is a polypeptide less than 190 kDa or less than 187 kDa.

[0075] In some embodiments, the cargo comprises a therapeutic or industrial polypeptide. These polypeptides may exhibit a range of biological functions including, but not limited to, antimicrobial activity, cytotoxic activity, immune modulation, enzymatic degradation, or receptor binding. Non-limiting examples of such therapeutic or industrial proteins include antimicrobial peptides or proteins, nanobodies, immunotoxins, full-length or truncated antibodies, anti-virulence agents, anti-viral proteins, anti-nematode proteins, or environmental control proteins. Antimicrobial peptides and proteins may function through membrane disruption, pore formation, or inhibition of key microbial metabolic processes. Nanobodies, immunotoxins, and antibody-based constructs may be used to target specific cells or molecules for immune clearance, receptor inhibition, or localized cytotoxicity. Antivirulence or anti-nematode peptides and proteins may disrupt pathogen-host interactions, inhibit developmental processes, or neutralize pathogenic factors. Environmental control agents may be applied to modulate microbial communities, suppress harmful species, or promote beneficial ecosystem functions.

[0076] Cargo polypeptides may be encoded by exogenous nucleic acids introduced into a microbial or non-microbial host, and may include additional elements such as secretion signals, fusion partners, purification tags, or degradation-resistant motifs. These polypeptides may be constitutively expressed, inducibly regulated, or conditionally activated in response to environmental or physiological cues. In certain embodiments, the polypeptides may be- 28 - 4902-7488-2187, v 1localized to the periplasm, outer membrane, cytoplasm, or extracellular milieu of a bacterial host, or may be expressed in a eukaryotic or cell-free system.

[0077] In additional embodiments, the cargo comprises one or more therapeutic or industrial nucleic acids. These nucleic acids may be DNA, RNA, or synthetic analogs thereof, and may include single-stranded, double-stranded, circular, or linear molecules. Cargo nucleic acids may encode therapeutic proteins, regulatory RNAs, or editing components such as guide RNAs or base editors. In certain embodiments, the nucleic acid itself may be the functional agent, such as antisense RNA, small interfering RNA (siRNA), messenger RNA (mRNA), aptamers, or ribozymes. Such molecules may be used to modulate gene expression, inhibit pathogenic targets, activate host responses, or encode downstream therapeutic functions.

[0078] Therapeutic or industrial nucleic acids may include regulatory elements such as promoters, terminators, untranslated regions (UTRs), polyadenylation signals, ribosome binding sites, and elements that enhance expression, stability, or translation efficiency. The expression of such nucleic acids may be transient or stable, and may occur within a host organism, delivery vehicle, or in vitro system. In some embodiments, the nucleic acids may be delivered via plasmid, phagemid, integrative cassette, viral vector, lipid nanoparticle, or extracellular vesicle.

[0079] In certain embodiments, cargo biomolecules as described herein are delivered via engineered bacteria, eukaryotic cells, synthetic carriers, or other programmable platforms, and may be deployed in therapeutic, agricultural, environmental, or biomanufacturing settings. The cargo may be selected or optimized for high expression, solubility, folding, resistance to proteolysis, host compatibility, or activity in diverse physical or chemical conditions.Pharmaceutical Formulations

[0080] The pharmaceutical formulations provided herein may further include, as optional ingredients, pharmaceutically acceptable carriers, diluents, solubilizing or emulsifying agents, and salts of the type that are available in the art. Examples of such substances include normal saline solutions such as physiologically buffered saline solutions and water. Specific non-limiting examples of the carriers and / or diluents that are useful in the pharmaceutical formulations of the present invention include water and physiologically acceptable buffered saline solutions such as phosphate buffered saline solutions pH 7.0-8.0. Suitable pharmaceutical carriers include, but are not limited to sterile water, salt solutions (such as- 29 - 4902-7488-2187, v 1Ringer's solution), alcohols, polyethylene glycols, gelatin, carbohydrates such as lactose, amylose or starch, magnesium stearate, talc, silicic acid, viscous paraffin, fatty acid esters, hydroxymethylcellulose, polyvinylpyrrolidone, etc. The pharmaceutical preparations can be mixed with auxiliary agents, e.g., lubricants, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and / or aromatic substances and the like which do not deleteriously react with the active compounds. They can also be combined where desired with other active substances, e.g., ileal brake hormone regulatory substances to improve metabolism and ameliorate metabolic syndromes.

[0081] Cells provided herein may be formulated in a pharmaceutical composition, which may include pharmaceutically acceptable carriers, thickeners, diluents, buffers, surface active agents, neutral or cationic lipids, lipid complexes, liposomes, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients and the like in addition to the cells.

[0082] Pharmaceutical compositions may also include one or more active ingredients such as, anti-inflammatory agents, anesthetics, and the like. Formulations for oral or intratumoral administration may include buffers, liposomes, diluents and other suitable additives. The compositions provided herein may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions may contain additional compatible pharmaceutically-active materials such as, e.g., statins, linaclotide, ileal brake hormone releasing substances, anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the composition of present invention, such as dyes, flavoring agents, antioxidants, opacifiers, thickening agents and stabilizers. Depending on the particular active ingredients, the formulations may be administered in the same pill or tablet or as a distinct pill or tablet as part of a co-administration protocol. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions provided herein.

[0083] Cells provided herein may be used in combination with one or more additional active agents and encapsulated in a particulate dosage form. In this manner, certain cells provided here, alone or in combination with other active agents, are released at that site over time to provide a sustained therapeutic benefit.-30- 4902-7488-2187, v 1

[0084] In preferred embodiments, the pharmaceutical composition of the invention is administered orally, mucosally, parenterally, sublingually, rectally or intratumorally. Dosing can be dependent on a number of factors, including severity and responsiveness of the disease state to be treated, and with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Toxicity and therapeutic efficacy of compounds provided herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals.

[0085] Suitable dosage amounts for gram-negative bacteria or probiotic organisms may, for example, vary from about 105to 1012organisms, typically about 106based on the numbers of organisms found in the ileum of said patient. Similarly, delivery of gram-negative bacteria provided herein will be specific to particular cells, conditions, and locations, such as ileum. In general, dosage is from tablets, capsules, granules and microgranules, powders, liquids and alike, and which may be given once or more daily, weekly, monthly or yearly, or even less frequently. In the treatment or prevention of certain conditions, an appropriate dosage level will generally be as above per day which can be administered in single or multiple doses. Live, killed or attenuated microorganisms or therapeutic compounds according to the invention (e.g., live, killed or attenuated organisms) may be formulated into pharmaceutical compositions for administration according to known methodologies, including for example using immediate-release, as well as pulsatile-release, and delayed-release technologies. Pharmaceutical compositions may, for example, comprise one or more constructs, in combination with a pharmaceutically acceptable carrier, excipient or diluent. Such carriers will be non-toxic to recipients at the dosages employed. A suitable dosage may be from about as above, per species at least 105to 1012oral and various ranges within these amounts being still more typical for administration. It will be evident to those skilled in the art that the number and frequency of administration will be dependent upon the response of the host. " Pharmaceutically acceptable carriers" for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro edit.1985). For example, saline and phosphate-buffered saline at physiological pH may be used. Stabilizers, dyes and even flavoring agents may be provided in the pharmaceutical composition.

[0086] " Pharmaceutically acceptable salt" refers to salts of the compounds of the present invention derived from the combination of such compounds and an organic or inorganic- 31 - 4902-7488-2187, v 1acid (acid addition salts) or an organic or inorganic base (base addition salts). The compounds of the present invention may be used in either the free base or salt forms, with both forms being considered as being within the scope of the present invention.

[0087] However, pharmaceutical compositions provided herein may be in any form which allows for the composition to be administered to a patient by the oral route and less commonly by sublingual or rectal routes. The pharmaceutical composition is formulated so as to allow the active ingredients contained therein to be bioavailable at the site targeted upon administration of the composition to a patient. Compositions that will be administered to a patient take the form of one or more dosage units, where tablet may be a single dosage unit, and a container of one or more compounds of the invention in oral form may hold a plurality of dosage units.

[0088] For oral administration, an excipient and / or binder may be present. Examples are sucrose, kaolin, glycerin, starch dextrins, sodium alginate, carboxymethylcellulose and ethyl cellulose. Coloring and / or flavoring agents may be present. A coating shell may be employed, applying common membranes used for microencapsulation and suitable for the microencapsulation of live, killed or attenuated probiotic organisms include biodegradable synthetic "polymers" such as poly -lactide, poly glycolic acid, and poly anhydride. Established "polymers" for live encapsulation and enzyme encapsulation include alginate-polylysine-alginate (APA), alginate -polymethylene-co-guanidine-alginate (A-PMCG-A), hydroymethylacrylate-methyl methacrylate (HEMA-MMA), Multilayered HEMA-MMA-MAA, polyacrylonitrilevinylchloride (PAN-PVC), acrylonitrile / sodium methally-Isulfonate (AN-69), polyethylene glycol / poly pentamethylcyclopentasiloxane / polydimethylsiloxane (PEG / PD5 / PDMS), poly N, N-dimethyl acrylamide (PD-MAAm), Siliceous encapsulates and cellulose sulphate / Sodium alginate / polymethylene-co-guanidine (CS / A / PMCG). Other materials that are useful include, without limitation, cellulose acetate phthalate, calcium alginate and k-carrageenan-Locust bean gum gel beads, gellan-xanthan beads, poly(lactide-co-glycolides), carrageenan, starch poly-anhydrides, starch polymethacrylates, polyamino acids, enteric coating polymers.

[0089] A liquid pharmaceutical composition as used herein, whether in the form of a solution, suspension or other like form, may include one or more of the following adjuvants: diluents such as water, preferably fixed oils such as synthetic mono or diglycerides which may serve as the solvent or suspending medium, polyethylene glycols, glycerin, propylene glycol-32- 4902-7488-2187, v 1or other solvents; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose.

[0090] In addition to pharmaceutical compositions intended for human or animal administration, the formulations described herein may be adapted for use in the treatment, prevention, or amelioration of plant diseases. Such pharmaceutical compositions for plants may similarly include pharmaceutically acceptable carriers, diluents, and excipients that are suitable for agricultural or horticultural applications. These compositions may comprise live or attenuated probiotic bacteria, cells, or microbial constructs capable of colonizing plant tissues or rhizospheres, thereby promoting plant health, enhancing resistance to pathogens, and improving overall plant vigor.

[0091] Suitable carriers for plant-directed pharmaceutical compositions may include aqueous solutions, suspensions, gels, emulsions, or other delivery vehicles compatible with foliar sprays, soil drenches, seed coatings, or root inoculants. The formulations may further comprise adjuvants such as surfactants, wetting agents, spreaders, or other additives commonly used in agrochemical preparations to improve adherence, penetration, and persistence of the active biological agents on or within plant tissues.

[0092] Dosage and administration regimens for plant pharmaceutical compositions will be dependent on factors including plant species, target disease or pathogen, mode of application, and environmental conditions. The compositions may be formulated to provide immediate or sustained release of active biological agents, facilitating prolonged protective or therapeutic effects. Compatibility with other agricultural inputs such as fertilizers, pesticides, or biostimulants may also be considered to optimize efficacy and crop safety.

[0093] The use of probiotic bacteria or other microbial cells in pharmaceutical compositions for plants aligns with integrated pest management and sustainable agriculture approaches, offering environmentally friendly alternatives or complements to conventional chemical treatments. These compositions may modulate plant microbiomes to suppress pathogenic microorganisms, induce systemic resistance mechanisms, or enhance nutrient uptake, thus contributing to plant disease control and improved agricultural productivity.- 33 - 4902-7488-2187, v 1Diseases

[0094] The bacterial cell compositions provided herein can be used to treat, ameliorate, or prevent diseases, disorders, or symptoms described herein. The bacterial cell compositions provided herein can be used to treat, ameliorate, or prevent diseases, disorders, or symptoms associated with cancer. The compositions and methods provided herein may involve administering a bacterial cell composition provided herein, optionally in combination with a second or additional therapy.

[0095] The disease may be an infectious disease. The infectious disease may be an enteric disease in the gut (e.g., as cholera, shigellosis, salmonella infection) or an infection of the skin or in the lung e.g., that may result from a separate disease such as cystic fibrosis). The infectious disease may result from microbes such as bacteria, such as Helicobacter pylori (can cause stomach disorder), group B Streptococcus (can be found in vaginal tract), Klebsiella pneumoniae (can be found in the gut).

[0096] Bacteria and systems provided herein can be used to deliver a therapeutic polypeptide that is not produced by a subject. For example, the lactose polypeptide could be provided as a supplement to treat a subject that is lactose intolerant. Diseases, such as those of the skin, lung or gut, which are characterized by the subject not producing a protein / enzyme may be treated using systems and bacteria provided herein to provide the missing protein / enzyme.

[0097] The bacterial cell compositions provided herein may be used to treat PSMA expressing tumors, such as, for example, prostate cancer.

[0098] The subject may have been treated with a therapeutic agent targeting the disease or condition, e.g. the tumor, prior to administration of the bacterial cell composition provided herein. The subject may be refractory or non-responsive to the other therapeutic agent.

[0099] The subject may have persistent or relapsed disease, e.g., following treatment with another therapeutic intervention, including chemotherapy, radiation, and / or hematopoietic stem cell transplantation (HSCT), e.g., allogenic HSCT. The administration may effectively treat the subject despite the subject having become resistant to another therapy.

[0100] The subject may be responsive to the other therapeutic agent, and treatment with the therapeutic agent reduces disease burden. The subject may be initially responsive to the- 34 - 4902-7488-2187, v 1therapeutic agent, but exhibits a relapse of the disease or condition over time. The subject may have not relapsed. The subject may be determined to be at risk for relapse, such as at a high risk of relapse, and thus the bacterial cell is administered prophylactically, e.g., to reduce the likelihood of or prevent relapse. The subject may not have received prior treatment with another therapeutic agent.

[0101] The bacterial cell disclosed in the present invention can be administered to an animal, preferably a mammal, even more preferably a human, to treat a cancer. In addition, the bacterial cell of the present invention can be used for the treatment of any condition related to a cancer, especially a cell-mediated immune response against a tumor cell(s), where it is desirable to treat or alleviate the disease. The types of cancers to be treated with the bacterial cell or pharmaceutical compositions of the invention include, carcinoma, blastoma, and sarcoma, and certain leukemia or lymphoid malignancies, benign and malignant tumors, and malignancies e.g., sarcomas, carcinomas, and melanomas. Other exemplary cancers include but are not limited breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, renal cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer, thyroid cancer, and the like. The cancers may be non-solid tumors (such as hematological tumors) or solid tumors. Adult tumors / cancers and pediatric tumors / cancers are also included.

[0102] The cancer may be a solid tumor or a hematological tumor. The cancer may be a carcinoma. The cancer may be a sarcoma. The cancer may be a leukemia. The cancer may be a solid tumor.

[0103] Solid tumors are abnormal masses of tissue that usually do not contain cysts or liquid areas. Solid tumors can be benign or malignant. Different types of solid tumors are named for the type of cells that form them (such as sarcomas, carcinomas, and lymphomas). Examples of solid tumors, such as sarcomas and carcinomas, include fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, and other sarcomas, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, lymphoid malignancy, pancreatic cancer, breast cancer, lung cancers, ovarian cancer, prostate cancer, hepatocellular carcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, medullary thyroid carcinoma, papillary thyroid carcinoma, pheochromocytomas sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma,-35 - 4902-7488-2187, v 1hepatoma, bile duct carcinoma, choriocarcinoma, Wilms' tumor, cervical cancer, testicular tumor, seminoma, bladder carcinoma, melanoma, and CNS tumors (such as a glioma (such as brainstem glioma and mixed gliomas), glioblastoma (also known as glioblastoma multiforme) astrocyto a, CNS lymphoma, germinoma, medulloblastoma, Schwannoma craniopharyogioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, neuroblastoma, retinoblastoma and brain metastases).

[0104] Carcinomas that can be amenable to therapy by a method disclosed herein include, but are not limited to, esophageal carcinoma, hepatocellular carcinoma, basal cell carcinoma (a form of skin cancer), squamous cell carcinoma (various tissues), bladder carcinoma, including transitional cell carcinoma (a malignant neoplasm of the bladder), bronchogenic carcinoma, colon carcinoma, colorectal carcinoma, gastric carcinoma, lung carcinoma, including small cell carcinoma and non-small cell carcinoma of the lung, adrenocortical carcinoma, thyroid carcinoma, pancreatic carcinoma, breast carcinoma, ovarian, prostate carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, renal cell carcinoma, ductal carcinoma in situ or bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical carcinoma, uterine carcinoma, testicular carcinoma, osteogenic carcinoma, epithelial carcinoma, and nasopharyngeal carcinoma.

[0105] Sarcomas that can be amenable to therapy by a method disclosed herein include, but are not limited to, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, chordoma, osteogenic sarcoma, osteosarcoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's sarcoma, leiomyosarcoma, rhabdomyosarcoma, and other soft tissue sarcomas.

[0106] “Treatment” and “treating” refer to administration or application of a therapeutic agent to a subject or performance of a procedure or modality on a subject for the purpose of obtaining a therapeutic benefit of a disease or health-related condition. For example, a treatment may include administration of a pharmaceutically effective amount of the bacterial cells composition, either alone or in combination with other therapies.

[0107] The term “subject” as used herein refers to any individual or patient to which the subject methods are performed. Generally, the subject is human, although as will be- 36- 4902-7488-2187, v 1appreciated by those in the art, the subject may be an animal. Thus, other animals, including mammals, such as rodents (including mice, rats, hamsters, and guinea pigs), cats, dogs, rabbits, farm animals (including cows, horses, goats, sheep, pigs, etc.), and primates (including monkeys, chimpanzees, orangutans, and gorillas) are included within the definition of subject.

[0108] The term “therapeutic benefit’’ or “therapeutically effective” as used throughout this application refers to anything that promotes or enhances the well-being of the subject with respect to the medical treatment of this condition. This includes, but is not limited to, a reduction in the frequency or severity of the signs or symptoms of a disease. For example, treatment of caner may involve, for example, complete or partial remission.

[0109] In addition to being used as a monotherapy, the bacterial cells of the present invention may also find use in combination therapies. Effective combination therapy may be achieved with a single composition or pharmacological formulation that includes both agents, or with two distinct compositions or formulations, administered at the same time, wherein one composition includes a bacterial cell composition of this invention, and the other includes the second agent(s). Alternatively, the composition therapy may precede or follow the other agent treatment by intervals ranging from minutes to months.

[0110] Various combinations may be employed, such as when a bacterial cell composition of the present invention is “A” and “B” represents a secondary agent, non-limiting examples of which are described below:A / B / A B / A / B B / B / A A / A / B A / B / B B / A / A A / B / B / B B / A / B / B B / B / B / A B / B / A / B A / A / B / B A / B / A / B A / B / B / A B / B / A / A B / A / B / A B / A / A / B A / A / A / B B / A / A / A A / B / A / A A / A / B / A

[0111] The bacterial cell composition may be administered to the subject in a series of treatments. The bacterial cell composition and a second treatment may be administered in any order or concurrently. The bacterial cell composition may be administered to patients that have previously undergone treatment with the second treatment. The bacterial cell composition and the second treatment may be administered substantially simultaneously or concurrently. For example, a subject may be given the bacterial cell composition while undergoing a course of treatment with the second treatment. The bacterial cell composition may be administered within 1 year of the treatment with the second treatment. The bacterial cell composition may be- 37 - 4902-7488-2187, v 1administered within 10, 8, 6, 4, or 2 months of any treatment with the second treatment. The bacterial cell composition may be administered within 4, 3, 2, or 1 week of any treatment with the second treatment. The bacterial cell composition may be administered within 5, 4, 3, 2, or 1 days of any treatment with the second treatment. The two treatments may be administered to the subject within a matter of hours or minutes (i.e., simultaneously).

[0112] The subject may be provided a secondary treatment. Secondary treatments include but are not limited to chemotherapy, radiation, surgery, and medications.

[0113] The second treatment may comprise an antibody. Thus, treatment can involve the combined administration of a bacterial cell composition provided herein with antibodies against additional antigens, such as, but not limited to PD-1 antagonist or anti-CTLA-4 antibody or antigen binding fragment thereof. The second treatment may comprise a biotherapeutic agent including but not limited to antibodies to VEGF, EGFR, Her / neu, VEGF receptor, other growth factors, CD20, CD40, CD-40L, OX-40, 4-1BB and ICOS. Combined administration can include co-administration, either in a single pharmaceutical formulation or using separate formulations, or consecutive administration in either order but generally within a time period such that all active agents can exert their biological activities simultaneously.

[0114] Inflammatory diseases encompass a broad range of pathological conditions characterized by an inappropriate or dysregulated immune response leading to tissue inflammation, injury, and dysfunction. Such diseases may affect various organs and systems within the body, and are frequently associated with chronic or recurrent inflammation that results in structural damage, loss of function, and a spectrum of clinical manifestations. The inflammatory process is often driven by complex interactions among immune cells, cytokines, chemokines, and molecular signaling pathways that collectively contribute to the initiation and perpetuation of tissue pathology. Inflammatory diseases may arise due to genetic predisposition, environmental triggers, autoimmune reactions, infections, or a combination thereof.

[0115] In one aspect, the present application provides a method for treating an inflammatory disorder in a subject in need thereof, the method comprising administering to the subject a pharmaceutically active dose of a pharmaceutical composition described herein. In one embodiment, the inflammatory disorder is an inflammatory bowel disease (IBD), which represents a group of chronic inflammatory conditions primarily affecting the gastrointestinal- 38 - 4902-7488-2187, v 1tract. IBD is characterized by persistent or relapsing inflammation that disrupts normal intestinal structure and function, resulting in symptoms such as abdominal pain, diarrhea, bleeding, and malabsorption. The two main forms of IBD are ulcerative colitis and Crohn’s disease, each distinguished by distinct pathological and clinical features.

[0116] Clinically, Crohn’s disease manifests with symptoms including persistent abdominal pain, diarrhea which may be bloody, weight loss, fatigue, fever, and signs of malnutrition due to impaired absorption of nutrients. The disease course is variable, with periods of exacerbation and remission, and patients frequently experience extraintestinal manifestations such as arthritis, skin disorders, ocular inflammation, and hepatobiliary complications. The etiology of Crohn’s disease is multifactorial, involving a complex interplay between genetic predisposition, environmental factors, disruption of the intestinal epithelial barrier, and an aberrant immune response to intestinal microbiota. These factors collectively drive chronic intestinal inflammation and progressive tissue damage.

[0117] Current treatment for Crohn’s disease aims to induce and maintain remission, reduce inflammation, heal mucosal injury, and prevent complications. Pharmacological therapies include anti-inflammatory agents such as aminosalicylates and corticosteroids, which are often used for induction of remission. Immunomodulators such as azathioprine, 6-mercaptopurine, and methotrexate serve to maintain remission and reduce corticosteroid dependence. In recent years, biologic therapies targeting specific components of the immune response have become a cornerstone in treatment, including tumor necrosis factor-alpha (TNF-a) inhibitors (e.g., infliximab, adalimumab), integrin antagonists (e.g., vedolizumab), and interleukin inhibitors (e.g., ustekinumab). Despite advances, a significant proportion of patients exhibit incomplete response, lose response over time, or experience adverse effects, necessitating surgical intervention for complications such as strictures, fistulae, abscesses, or refractory disease (Mayo Clinic, 2025).

[0118] In another aspect, the present application provides a method for treating a plant disease or agricultural condition in a plant or crop in need thereof, the method comprising administering to the plant, crop, or agricultural environment an effective amount of a composition described herein. In one embodiment, the composition may be applied to prevent, mitigate, or remediate pathogenic infection, physiological stress, or environmental damage that impairs plant health, productivity, or yield. Plant diseases may be caused by a variety of biotic agents including fungi, bacteria, viruses, and nematodes, as well as abiotic factors such as- 39- 4902-7488-2187, v 1nutrient deficiencies, drought stress, or chemical toxicity. These plant diseases often result in reduced crop quality and economic loss, and current treatment options are limited in efficacy, sustainability, or environmental compatibility.

[0119] In another aspect, the plant disease being treated is a fungal infection commonly affecting economically significant crops, such as powdery mildew, downy mildew, rusts, blights, or root rots. Powdery mildew, for example, is a widespread fungal disease caused by species within the Erysiphaceae family and is characterized by white powdery lesions on leaves, stems, and fruits. It affects a wide range of host plants, including grains, grapes, cucurbits, and solanaceous crops, leading to chlorosis, defoliation, stunted growth, and reduced yield (Boeckman, 2025). Downy mildew, caused by oomycetes such as Peronospora or Plasmopara species, presents as yellowing and necrotic leaf lesions with a downy growth on the undersides of leaves, and is particularly devastating in viticulture and leafy greens production (Wilcox, 2024).

[0120] In a further embodiment, the agricultural condition being treated may include bacterial wilt, a disease caused by Ralstonia solanacearum, which leads to sudden wilting, vascular browning, and death of a wide range of host plants including tomatoes, potatoes, peppers, and bananas. Bacterial wilt spreads rapidly under warm and moist conditions and can persist in soil for extended periods, making eradication and control particularly difficult (Moorman, 2023). Other target agricultural diseases include viral infections such as Tomato Mosaic Virus (ToMV) and Cucumber Mosaic Virus (CMV), both of which can result in chlorosis, leaf deformation, stunted growth, and significant loss in fruit production.The composition of the present invention may be formulated to inhibit pathogen growth, disrupt pathogen-host interactions, or induce systemic resistance in the host plant. In some embodiments, the composition may comprise bioactive agents such as plant-derived antimicrobials, microbial biocontrol organisms, signaling molecules, or other phytoprotective compounds. Application may be achieved through foliar spray, soil drench, seed treatment, or incorporation into irrigation systems, and may be performed pre -infection or as a curative treatment post-infection. The invention thus provides a versatile and environmentally sustainable approach for managing a wide variety of plant diseases and enhancing crop productivity in diverse agricultural settings.- 40 - 4902-7488-2187, v 1IV. Examples

[0121] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.Example 1 -

[0122] The release element of natural bacteriocin operons is sufficient for protein delivery. First, it was ensured that the release element of colicinogenic operons is responsible and sufficient for cytoplasmic protein release and investigated what vector architecture would be useful for the circuit design described herein. For this purpose, the release element (lys) was cloned from the natural colicin El operon (which performed the best in terms of toxin release in the preliminary experiments) into three commonly used vectors. pDM1, is a custom pACYC vector derivative containing a multi-cloning site and the capacity for IPTG induction, pBAD18, which is L(+)-arabinose inducible and pET28a, which is inducible with IPTG. The first two constructs were tested in the workhorse K- 12 strain E. coli BZB 1011, while the latter was tested in BL21(DE3) cells. A specific GFP release assay was used, whereby the amount of GFP, expressed from a single chromosomal gene copy and detected in the culture supernatants, offers a quantitative measure of cytoplasmic content release (Fig. 2). It is clear that lys expressed in the pBAD18 backbone induces cytoplasmic GFP release specifically upon induction with L(+)-arabinose.

[0123] Testing different circuit architectures for protein release. After identifying pBAD18 as a good starting point for the circuit design, a variant of pBAD18 was generated, pOtter, harboring the pl 5 origin of replication. This modification was performed because in the past success has been had with pl 5-based vectors when wanting to recapitulate biologically relevant results. From pOtter, pOtter(h) was generated, which is a high-copy variant.

[0124] Then four circuits were generated with the same general architecture (Fig. 3). The colicin El operon in its entirety was cloned into pOtter or pOtter(h) and put under- 41 - 4902-7488-2187, v 1arabinose induction. The strength of the RBS was also varied, thus generating a) pOtter-ColOp and b) pOtter(h)-ColOp that encompass the natural colicin operon RBS, c) pOtter-UA-ColOp and d) pOtter(h)-UA-ColOp that encompass the strong RBS from the pUA plasmid series.

[0125] Next, a GFP release assay was used, whereby the amount of GFP, expressed from a single chromosomal gene copy and detected in the culture supernatants, offers a quantitative measure of cytoplasmic content release (Fig. 4). It is clear that only pOtter-ColOp achieves high levels of cytoplasmic protein release specifically upon induction with L(+)-arabinose. The amount of protein released is at -60% of the release achieved with the natural colicin El plasmid (pColEl). pOtter(h)-ColOp achieves much lower release levels, while pOtter-UA-ColOp and pOtter(h)-UA-ColOp release more protein when not induced than when induced, therefore exhibiting poor regulatory control.

[0126] Labelling the cargo position reveals size and amounts of protein released. The colicin El gene of pOtter-ColOp was fused with GFP at its N-terminus (758 amino acids, 83.9 kDa) resulting in pOtter-ColOp-GFP. From pOtter-ColOp-GFP, pOtter-2(ColOp-GFP) was constructed; pOtter-2(ColOp-GFP) includes an N-tenuinal duplication of the GFP-tagged colicin El gene, creating a translational fusion of 1515 amino acids (167.7 kDa). These constructs allowed for further probing of both the size of the protein cargo that can be delivered with the circuit, and the amount of protein released, by directly monitoring the fluorescence signal in the supernatant.

[0127] The GFP release assay (Fig. 5A) demonstrated large amounts of GFP fusions in the supernatant achieved by both pOtter-ColOp-g / p and pOtter-2(ColOp-g^>) as compared to the fluorescence levels achieved by a strain labelled with gfp on the chromosome of strains harboring pOtter-ColOp; the latter level is more indicative of the release levels of endogenous proteins expressed from genomic loci. This demonstrates capacity of the system to deliver large amounts of protein cargo. This was further corroborated by SDS PAGE analysis of the culture supernatants showing that both fusions of 83.9 and 167.7 kDa were intact (Fig. 5BC) and abundantly present in the samples (Fig. 5B).

[0128] Circuit functionality in diverse hosts. After validating the capacity of the pOtter-ColOp circuits to deliver large protein cargo as high amounts, the functionality of this system was tested in other bacterial hosts. The following strains were chosen that are largely safe for use in humans: a) E. coli Nissle 1917, isolated from the human gut and the gold- 42 - 4902-7488-2187, v 1standard for Enterobacterial probiotics; b) K. aerogenes FRI, isolated from the human nasal mucosa; c). S', enterica VNP20009, safe for human administration and specifically developed for tumoral administration. The GFP release assay demonstrated that all of these bacterial hosts deliver the GFP-colicin E1 fusion (from pOtter-ColOp-gfp) in similar or higher levels as the laboratory E. coli BZB1011 strain (Fig. 6A). Subsequently, SDS PAGE analysis confirmed that the released fusion is intact and present at high amounts (Fig. 6B).

[0129] An additional, larger cargo protein was evaluated using pOtter-ColOp-gfp-T7gene1, which expresses T7 gene1 N-terminally fused to the GFP-colicin El fusion protein (1,640 amino acids; 182.6 kDa). This cargo was also efficiently released, as shown by quantification of GFP in culture supernatants (Fig. 6Fig. 7A) and by detection of the released protein via SDS-PAGE analysis (Fig. 6Fig. 7BC). Together, these results confirm the successful release of protein cargoes with molecular weights up to 182.6 kDa.

[0130] Circuit-dependent release of functional enzymes. After validating the functionality of pOtter-ColOp circuits in diverse bacterial hosts, we evaluated the folding and activity of the released protein cargo. First, we used a two plasmid-system approach where we combined pOtter-ColOp with pET_RTX_(exo-) (Addgene Plasmid # 102786). a plasmid that encodes a ~90kDa thermostable protein (RTX) derived from the KOD DNA polymerase. This enzyme can synthesize DNA from both DNA and RNA templates (reverse transcriptase activity), while lacking the usual 3'— 5' exonuclease (proofreading) activity. The combination of the two constructs leads to robust release of cytoplasmic content as measured using our GFP release assay, whereby the amount of GFP, expressed from a single chromosomal gene copy and detected in the culture supernatants, offers a quantitative measure of cytoplasmic content release (Fig.8A). Supernatants from these cultures were assessed for DNA polymerase activity by performing a PCR reaction, as described in Ellefson et al. 2016. Simultaneous induction of the pOtter-ColOp circuit and of the RTX enzyme results in supernatants with DNA polymerase activity as shown from the detection of DNA product of the right size in large amounts (Fig.8B; bottom) only in reactions where the DNA template was present. By contrast use of supernatants from cultures where pOtter-ColOp was repressed show low and less specific DNA polymerase activity (Fig. 8B; top).

[0131] To evaluate the ability of pOtter-ColOp circuits to handle complex protein cargoes, we tested their capacity to release an enzyme that requires oxidative protein folding (formation of disulfide bonds) for enzymatic activity. To this end, we generated pOtter-phoA- 43 - 4902-7488-2187, v 1by replacing the colEl toxin and immunity genes in pOtter-ColOp with the E. coli phoA gene. E. coli PhoA is a periplasmic protein that undergoes disulfide bond formation within the cell envelope and this folding step is essential for the production of correctly fielded, active enzyme. Induction of pOtter-phoA produced supernatants with high alkaline phosphatase activity (Fig.9A), which was further confirmed by SDS-PAGE analysis showing robust PhoA release (Fig.9B).

[0132] Together, these experiments demonstrate that pOtter-ColOp circuits are capable of releasing active enzymes at high levels into culture supernatants. Notably, this is achieved even for enzymes that require complex folding processes, such as periplasmic translocation followed by disulfide bond formation.

[0133] Alternative circuit architectures. We generated more complex pOtter-ColOp circuits that harbor both the release circuit and the protein cargo on the same plasmid backbone. Namely, pOtterDUET-ColOp-gfp was engineered to follow the same architecture as existing duet vectors, whereby two distinct promoter-RBS-MCS units are separated by a 45-nucleotide spacer. In pOtterDUET-ColOp-gfp, Site 1 comprises the protein release circuit of pOtter-ColOp, and Site 2, which is located downstream of Site 1, contains the GFP protein cargo that is expressed constitutively. To determine the effect of DUET site orientation, pOtterDUET-gfp-ColOp was generated to constitutively express GFP from Site 1 and the release circuit from Site 2. The two construct were assessed for GFP release and were found to be largely equivalent (Fig. 10A). As such, further testing was focused on the architecture of pOtterDUET-ColOp-gfp.

[0134] Site 2 RBS variants of pOtterDUET-ColOp-g / p were generated, yielding pOtterDUET-ColOp-gfp2 and pOtterDUET-ColOp-gfp3 in which the Site 2 RBS driving the expression of GFP was replaced with stronger RBS elements. In pOtterDUET-ColOp-gfp2 the RBS from the pULTRA plasmid series (PMID: 27693407) was used, whereas pOtterDUET-ColOp-gfp3 carries the RBS from the commercial vector pET22b(+) (Novagen). GFP release assays (Fig. 10B) demonstrated that pOtterDUET-ColOp-gfp2 and pOtterDUET-ColOp-gfp3 achieved substantially increased cargo release compared to the original pOtterDUET-ColOp-gfp construct. This showed that the efficiency of cargo production and release can be easily tuned through the regulation of Site 2.- 44 - 4902-7488-2187, v 1

[0135] An inducible Site 2 variant of pOtterDUET-ColOp-gfp, pOtterDUET-ColOp-gfp4 was also generated. In this construct, all Site 2 regulatory elements were replaced with the IPTG-inducible Ptac promoter-operator and RBS. This construct was further mutated to replace its RBS with the RBS from the pULTRA plasmid series (PMID: 27693407), yielding pOtterDUET-ColOp-gfp5. Both constructs were assessed for GFP release (Fig. 10C) and pOtterDUET-ColOp-gfp5 was found to release GFP at high amounts in the culture supernatant.

[0136] Together, these results show that complex pOtter-ColOp circuits harboring the release circuit and the protein cargo on the same plasmid backbone are also successful in releasing the cargo at high amounts into the culture supernatant.

[0137] Circuit-dependent release of microRNA. Considering the size of cytoplasmic molecules released via our circuits, their applications are not limited to the delivery of proteins. Their uses can be extended to other bioactive molecules; for example, release of nucleic acids in the form of small RNAs falls within the current size limitations of our constructs. For this reason, we tested the capacity of pOtter-ColOp circuits to release microRNAs. To this end, we generated pET28a(+)Cm-BLV-B5 expressing the BLV-B5 microRNA described in PMID: 22308400 and co-transformed it with our pOtter-ColOp-gfp circuit. Northern blotting on RNA extracted from intact cells and culture supernatants indicates release of BLV-B5 microRNA (Fig. 11) because of the expression of pOtter-ColOp-gfp circuit.

[0138] Methods

[0139] Plasmids. The release element expression constructs, pBAD18- / ys, pDMl- / ) s, and pET28a-Z}’.s were generated by cloning the release element gene lys) from the natural ColEl operon into the respective vectors via restriction cloning. For pBAD18, which lacks a Shine-Dalgarno sequence, aggaggaaacg (ribosome binding site (RBS) and spacer) was added upstream of the lysis gene start codon.

[0140] pOtter was created by replacing the pBR and Ml 3 origins of pBAD18 with the pl 5 origin from pACYC. Notably, pOtter retains the arabinose inducible promoter of pBAD18. pOtter(h) is a high-copy variant of pOtter, attributable to a point mutation in the origin of replication.

[0141] pOtter-ColOp encodes the protein release circuit, comprising the colEl operon and its native RBS sequence under the arabinose-inducible promoter of pOtter. The colEl- 45 - 4902-7488-2187, v 1operon was cloned into pOtter using NEBuilder HiFi DNA Assembly according to the manufacturer’s instructions. pOtter(h)-ColOp was obtained in the same way, using pOtter(h). pOtter-U A -ColOp was obtained the same way as pOtter-ColOp, except that a strong (RBS) from the pUA series of reporter plasmids (www.nature.com / articles / nmeth895) was used instead of the native RBS sequence of the colEl operon. pOtter(h)-UA-ColOp was obtained in the same way, using pOtter(h).

[0142] pOtter-phoA was generated by replacing the colEl toxin and immunity genes of pOtter-ColOp with the phoA gene using NEBuilder HiFi DNA Assembly according to the manufacturer’s instructions.

[0143] pOtter-ColOp-gfp was generated by fusing the colicin E1 gene with gfp at its N-terminus in pOtter-ColOp (758 amino acids, 83.9 kDa). pOtter-2(ColOp-gfp), includes an N-terminal duplication of the GFP-tagged colicin E1 gene, creating a translational fusion of 1,515 amino acids (167.7 kDa). pOtter-ColOp-gfp-T7gene1 was generated by fusing an N-terminal T7 gene1 to pOtter-ColOp-gfp, creating a translational fusion of 1,640 amino acids (182.6 kDa). These constructs were cloned using NEBuilder HiFi DNA Assembly according to the manufacturer’s instructions.

[0144] pOtterDUET -ColOp-g / p was engineered to follow the same architecture as existing duet vectors. Briefly, there are two distinct promoter-RBS-MCS units separated by a 45 -nucleotide spacer (TCGAACAGAAAGTAATCGTATTGTACACGGCCGCATAATCGAAAT; SEQ ID NO:3). Site 1 comprises the protein release circuit of pOtter-ColOp, that is, the colEl operon and its native RBS sequence under the arabinose-inducible araBAD promoter. Site 2, located downstream of Site 1, comprises the constitutive regulatory elements of the in-house vector pDM2 (based on vector pDMl (PMID: 35025730), whereby the strong BIOFAB promoter apFAB46 has replaced the IPTG inducible promoter), which was cloned using NEBuilder HiFi DNA Assembly according to the manufacturer’s instructions. The spacer between Site 1 and Site 2 was inserted using the NEB Q5 site directed mutagenesis kit according to the manufacturer’s instructions. Similarly, to determine the effect of DUET site orientation, pOtterDUET-g / p-ColOp was cloned as described for pOtterDUET-ColOp-g / p.

[0145] Site 2 RBS variants of pOtterDUET-ColOp-g / p were generated using the NEB Q5 site directed mutagenesis kit according to the manufacturer’s instructions. This yielded- 46 - 4902-7488-2187, v 1pOtterDUET-ColOp-g / p2 and pOtterDUET-ColOp-g / p3 in which the Site 2 RBS driving GFP translation was replaced with the RBS from the pULTRA plasmid series (PMID: 27693407) and the commercial vector pET22b(+) (Novagen), respectively.

[0146] An inducible Site 2 variant of pOtterDUET-ColOp-gfp, pOtterDUET-ColOp-gfp4 was generated using the NEB Q5 site directed mutagenesis kit according to the manufacturer’s instructions. In this construct, all Site 2 regulatory elements were replaced with the IPTG-inducible Ptac promoter-operator and RBS. This construct was further mutated to replace its RBS with the RBS from the pULTRA plasmid series (PMID: 27693407), yielding pOtterDUET-ColOp-gfp5.

[0147] pET28a(+)Cm, a chloramphenicol resistant variant of pET28a(+) (Novagen) was generated by replacing the kanamycin resistance gene, neo, with the chloramphenicol gene, cat, using NEBuilder HiFi DNA Assembly according to the manufacturer’s instructions.

[0148] pET28a(+)Cm-BLV-B5 was generated by inserting the BLV-B5 premiRNA DNA sequence downstream of the T7 promoter using the NEB Q5 site directed mutagenesis kit according to the manufacturer’s instructions.

[0149] pET_RTX_(exo-) was kindly provided by Andrew Ellington (Addgene Plasmid # 102786). Briefly, it encodes a ~90kDa thermostable protein derived from the KOD DNA polymerase that can synthesize DNA from both DNA and RNA templates (reverse transcriptase activity) and lacks the usual 3'— >5' exonuclease (proofreading) activity.

[0150] Strains, reagents and growth conditions. Lysogeny broth (LB) (10 g / L NaCl) and agar (1.5% w / v) were used for routine growth of all organisms at 37 °C. All liquid cultures were grown in 5 mL LB medium in 50 mL Falcon tubes, with shaking at 220 RPM. Unless otherwise stated, chemicals and reagents and growth media were acquired from Sigma Aldrich, ThermoFisher Scientific or VWR. For assay purposes, cultures were supplemented with the following, as required: 0.2% w / v D(+)-glucose, 0.2% w / v L(+)-arabinose, 0.5 mM Isopropyl P-D-l- thiogalactopyranoside (IPTG), 50 pg / mL kanamycin (kan), 33 pg / mL chloramphenicol (chi), 12.5 pg / mL tetracycline (tet). The bacterial strains used in this study are listed in Table 1 below.- 47 - 4902-7488-2187, v 1Table 1. Bacterial StrainsStrain GenotypeEscherichia coli BZB1011 W3110, gyrAEscherichia coli BZB1011-gfp W3110, gyrA, attTn7::sfGFPEscherichia coli BL21(DE3) fhuA2 [lon] ompT gal [λ DE3 =λ sBamHIo ΔEcoRI-B int::(lacI:: PlacUV5:: T7 gene1) i21 Δnin5] [dcm] ΔhsdS Escherichia coli BL21(DE3) fhuA2 [lon] ompT gal [λ DE3 =λ sBamHIo ΔEcoRI-B int::(lacI:: PlacUV5:: T7 gene1) i21 Δnin5] [dcm] ΔhsdS Escherichia coli BL21(DE3)-gfp fhuA2 [lon] ompT gal (λ DE3) [dcm] ΔhsdS, attTn7::sfGFP Escherichia coli Nissle 1917 Wild-type strainKlebsiella aerogenes FRI Wild-type strainSalmonella enterica VNP20009 ATCC 14028, purl, msbB

[0151] GFP release assay. Each bacterial strain of interest was inoculated in 5 mL of LB medium with appropriate antibiotics and incubated overnight (ON). The next day, the culture was back-diluted to an OD600 of 0.5, induced as required with appropriate compounds, and incubated ON. On the following day, the culture OD&oo was measured, and 1 mL from each sample was transferred to a 1.7 mL microtube and centrifuged at 10,000xg for 2 minutes. The supernatant was transferred to a new microtube and centrifuged again in the same manner. Finally, the supernatant from both induced and non-induced samples was added into a blackbottom 96-well plate and measured for GFP fluorescence. Supernatants obtained from this assay were subsequently used for the following protein procedures.

[0152] SDS-PAGE. Samples for SDS PAGE were prepared by mixing each supernatant with Laemmli buffer in a 3:1 ratio and boiling for 5 minutes. SDS-PAGE was carried out by using 10% or 12% BisTris NuPAGE gels and MES / SDS running buffer prepared according to the manufacturer’s instructions; pre-stained protein markers (SeeBlue Plus 2) were included.

[0153] Total protein stain. Proteins separated by SDS-PAGE were stained using SimplyBlue™ Safe Stain. Following electrophoresis, the gel underwent three rounds of microwave heating for 1 minute in water, followed by 1 minute of shaking. The water was replaced between each round. SimplyBlue™ Safe Stain was then added to the gel and heated- 48 - 4902-7488-2187, v 1up for 45 sec in the microwave following 1 hour of incubation at room temperature with gentle rocking. To enhance contrast, the gel was washed with water for 60 minutes, replacing the water and leaving it for destaining ON at room temperature. Protein bands were visualized under visible light, and documented for future analysis using a Gel Doc Imager (Bio-Rad).

[0154] Immunoblotting. Proteins were transferred to nitrocellulose membranes (0.45 pm pore size, GE Life Sciences) using the Trans-Blot Turbo transfer system (Bio-Rad) The membranes were then blocked with 5% (w / v) skimmed milk in TBS-T, followed by the addition of primary and secondary antibodies according to manufacturer’s instractions. The primary antibody used was a mouse monoclonal unconjugated anti-GFP antibody (Sigma Aldrich), and the secondary antibody was a goat anti-mouse IgG-AP conjugate (Sigma Aldrich). Membranes were washed four times with TBS-T after exposure to the primary antibody and three times prior to development. AP conjugate detection was performed using a SigmaFast BCIP / NBT tablet according to manufacturer’s instructions, and visualized using a Gel Doc Imager (Bio-Rad).

[0155] Alkaline phosphatase activity assay. Alkaline phosphatase (PhoA) activity was measured using a p-nitrophenyl phosphate (pNPP) hydrolysis assay as an indicator of correctly folded, enzymatically active protein. Supernatants from cultures expressing PhoA were incubated with a reaction buffer comprising pNPP, zinc acetate, and Tris. Enzymatic activity was determined by measuring absorbance at 410 nm at a defined time point under controlled temperature using a plate reader.

[0156] RTX polymerase activity. Assay was done as in Ellefson et al. 2016 to detect activity of the released protein.

[0157] Northern blotting. Assay was done as in Szymanik et al. 2025 to detect the release of microRNA.* * *

[0158] All of the methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the methods and in the steps or in the sequence of steps of the method described herein without departing from the- 49 - 4902-7488-2187, v 1concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.-50- 4902-7488-2187, v 1REFERENCESThe following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.Aizawa, S.-I. (2014). Rhodobacter sphaeroides — A resourceful little bug. In S.-I. Aizawa (Ed.), The Flagellar World (pp. 66-68). Academic Press.Aryal, A. (2022, July 3). Pseudomonas putida. Microbe Notes. Retrieved June 3, 2025, from microbenotes.com / pseudomonas-putida / Boeckmann, C. (2025, May 8). Powdery mildew: How to identify, treat, and prevent powdery mildew. The Old Farmer’s Almanac.Calcuttawala, F., Pal, A., Nath, P., et al. (2022). Structural and functional insights into colicin: A new paradigm in drug discovery. Archives of Microbiology, 204, 37.Cavard D, Howard SP, Lloubes R, Lazdunski C. High-level expression of the colicin A lysis protein. Mol Gen Genet. 1989 Jun;217(2-3):511-9.Cole ST, Saint-Joanis B, Pugsley AP. Molecular characterisation of the colicin E2 operon and identification of its products. Mol Gen Genet. 1985; 198(3):465-72.Ellefson, Jared W., et al. " Synthetic evolutionary origin of a proofreading reverse transcriptase." Science 352.6293 (2016): 1590-1593. PMID: 27339990Joshi, H., Nair, G., Gangakhedkar, R., & Jain, V. (2019). Understanding the role of the lysozyme-like domain of D29 mycobacteriophage-encoded endolysin in host cell lysis and phage propagation. Microbiology, 165(9), 1013-1023.Lloubes R, Vita N, Bernadac A, Shire D, Leplatois P, Geli V, Frenette M, Knibiehler M, Lazdunski C, Baty D. Colicin A lysis protein promotes extracellular release of active human growth hormone accumulated in Escherichia coli cytoplasm. Biochimie. 1993;75(6):451-8. Mader A, von Bronk B, Ewald B, Kesel S, Schnetz K, Frey E, Opitz M. Amount of colicin release in Escherichia coli is regulated by lysis gene expression of the colicin E2 operon. PLoS One. 2015 Mar 9;10(3):e0119124.Mayo Clinic, (n.d.). Crohn's disease - Diagnosis and treatment. Mayo Foundation for Medical Education and Research. Retrieved June 3, 2025, from mayoclinic.org / diseases-conditi ons / crohns -di sease / di agnosis-treatment / drc-20353309Moorman, G. W. (2023, July 5). Bacterial wilt - Ralstonia solanacearum. Penn State Extension, extension.psu.edu / bacterial-wilt-ralstonia-solanacearumSchmelcher, M., Donovan, D. M., & Loessner, M. J. (2012). Bacteriophage endolysins as novel antimicrobials. Future Microbiology, 7(10), 1147-1171.- 51 - 4902-7488-2187, v 1Singh, G., Yadav, M., Ghosh, C., & Rathore, J. S. (2021). Bacterial toxin-antitoxin modules: Classification, functions, and association with persistence. Current Research in Microbial Sciences, 2, 100047. https: / / doi.org / 10.1016 / j.crmicr.2021.100047.Szymanik, Kayla H., et al. " Viral piracy of host RNA phosphatase DUSP11 by avipoxviruses." PLoS pathogens 21.4 (2025): e1013101. PMID: 39211142Wilcox, A. (2024, May 16). How to control downy mildew in the garden. The Old Farmer’s Almanac, www.almanac.com / pest / downy-mildew- 52 - 4902-7488-2187, v 1

Claims

WHAT IS CLAIMED IS:

1. A nucleic acid vector encoding:(i) a lysis protein;(ii) a toxin-antitoxin (TA) module encoding a toxin protein and preferably an antitoxin protein; and(iii) a cargo biomolecule selected from a therapeutic polypeptide and a therapeutic nucleic acid, wherein the vector induces expression of the lysis protein, the toxin protein, the antitoxin protein, and the therapeutic polypeptide in bacteria; preferably wherein the lysis protein is a colicin lysis protein (colicinogenic lys protein) or a lysis gene from a bacteriocin operon; and preferably wherein the lysis gene is a colicin lysis protein selected from the group consisting of lysEl, lysE2, lysE3, lysE4, lysE5, lysE6, lysE7, lysE8, and lysE9.

2. The nucleic acid of claim 1, wherein the therapeutic protein is an anti -microbial protein, nanobody, immunotoxin, antibody, anti-virulence agent, or environmental control agent anti-microbial peptide or protein, anti-viral peptides / proteins, anti-nematode peptides / proteins).

3. The nucleic acid of any one of claims 1-2, wherein the therapeutic protein is less than 180 kDa in size or wherein the therapeutic protein is less than 165 kDa in size.

4. The nucleic acid of any one of claims 1-2, wherein the toxin molecule and / or therapeutic polypeptide is an antimicrobial protein, wherein the antimicrobial protein is a bacterial colicin protein, and wherein the antitoxin is an immunity protein; preferably wherein the immunity protein is a cognate immunity protein of the bacterial colicin protein, or a noncognate immunity protein; preferably wherein the colicin protein is colicin A, colicin El, colicin El, colicin E2, colicin E3, colicin E4, colicin E5, colicin E6, colicin E7, colicin E8, colicin E9, colicin K, colicin L, colicin N, colicin S4, colicin U, or colicin Y.

5. The nucleic acid of any one of claim 4, wherein the nucleic encodes a colicin immunity pair protein, preferably an immunity pair protein from a group A or group B bacteriocin plasmid; preferably wherein the nucleic acid encodes a non-cognate immunity protein, wherein preferably the non-cognate immunity protein can protect the bacteria from toxicity due to the bacterial colicin protein.- 53 - 4902-7488-2187, v 16. The nucleic acid of any one of claims 4-5, wherein the nucleic acid vector encodes the polypeptide and at least one of: (Colicin El and ImmEl); (Colicin E2 and ImmE2); (Colicin E4 and ImmE4); (Colicin E8 and ImmE8).

7. The nucleic acid of any one of claims 1-6, wherein the nucleic acid further encodes an antibiotic resistance cassette and / or wherein the lysis protein, cargo biomolecule, and / or TA module are expressed via a single promoter (e.g., a constitutive promoter or a conditional promoter).

8. The nucleic acid of any one of claims 1-7, wherein the lysis protein, therapeutic polypeptide, and / or immunity protein are expressed via separate promoters, preferably wherein the separate promoters are each a constitutive promoter or a conditional promoter.

9. The nucleic acid of any one of claims 7-8, wherein the promoter(s) are each independently selected from the group consisting of: IPTG inducible, lac operon inducible, or L(+)-arabinose inducible promoters; a promoter inducible by xylose, rhamnose, vanillin, m-Toluic acid; a conditional promoter such as temperature -inducible promoters, pH-inducible promoter, metabolite-inducible promoter (e.g., lactose-inducible promoter, for example so lactase enzyme cargo can be produced upon the detection of lactase in lactose-intolerant patients), a heavy metal-inducible promoter, a toxin-inducible promoter, a virus-inducible promoter, a bile-inducible promoter, an acid-inducible promoter, a light-inducible promoter, or an oxygen-inducible promoter, bacterial-density regulated promoters (quorum-sensing).

10. The nucleic acid of any one of claims 1-9, wherein the toxin-antitoxin (TA) module does not encode an antitoxin protein.

11. A bacterial cell comprising the nucleic acid of any one of claims 1-10.

12. The bacterial cell of claim 11, wherein(i) the bacterial cell is a Alphaproteobacteria (e.g., Rhodobacter sphaeroides), Gammaproteobacteria, Enterobacteriaceae (e.g., P ectobacterium, Escherichia coli (e.g., KI 2, B, Nissle), Klebsiella aerogenes, Salmonella enterica, Shigella spp.), Pseudomonadaceae (Pseudomonas spp. Including Pseudomonas putida), or Yersiniaceae (Serratia spp.) bacteria;(ii) the bacterial cell is a probiotic bacterium, an attenuated bacterium, or the bacterium is substantially or essentially safe for human consumption (e.g., wherein the bacterium is a- 54 - 4902-7488-2187, v 1Nissle 1917,. S', enterica VNP20009, or an Enterobacterial vaccine strains (e.g., Shigella, Salmonella)')(iii) the bacterial cell is substantially or essentially safe for environmental use (e.g., wherein the bacterial cell is a Rhodobacter sphaeroides, Pectobacterium, Serratia, Pseudomonas putida, or rhizosphere bacteria);(iv) the nucleic acid is recombinantly or chromosomally expressed by the bacterial cell; and / or(v) the nucleic acid is episomally expressed by the bacteria.

13. A material comprising the bacterial cell of claim 12 or the nucleic acid of any one of claims 1-10; preferably wherein the material is further defined as comprising one or more hydrogels, cellulose, films, fibers, micro-nanogels, condensates and active materials.

14. A method of treating a disease in a mammalian subject comprising administering a bacterial cell of any one of claims 11-12 to the mammalian subject.

15. The method of claim 14, wherein the bacterial cell is delivered to the gastrointestinal system of a mammalian subject; preferably wherein the bacterial cells is administered orally, nasogastrically, colonically, or to the nose mucosa of the subject; preferably wherein the mammalian subject is a human; preferably wherein the disease is a gastrointestinal disease (e.g., wherein the gastrointestinal disease is a cancer or an inflammatory disease, such as inflammatory bowel disease (IBD) or Chron’s disease).

16. A method of treating a plant disease, preventing a plant disease, or promoting growth in a plant comprising contacting the bacterial cell of any one of claims 11-12 to a plant.

17. A method of producing a therapeutic polypeptide, comprising:(i) culturing a bacterial cell of any one of claims 11-12, and(ii) substantially purifying or isolating the therapeutic polypeptide.-55 - 4902-7488-2187, v 1