Inducible artificial microrna (amirna) expression constructs and methods for their use

Abstract

Provided herein are inducible artificial microRNA (amiRNA) expression vectors for use in the treatment of cancer. In particular, the amiRNAs may be useful for the treatment of cancers selected from one or more of the following: carcinoma; leukemia; lymphoma; myeloma; and sarcoma. More particularly this invention relates to amiRNA expression vectors that are induced by the presence of cell type specific transcription factors and / or cell specific promoters. Such compositions may be designed for the treatment of a wide variety of cancers.

Description

INDUCIBLE ARTIFICIAL MICRORNA (AMIRNA) EXPRESSION CONSTRUCTSAND METHODS FOR THEIR USETECHNICAL FIELD

[0001] This invention relates to inducible artificial microRNA (amiRNA) expression vectors. More particularly this invention relates to amiRNA expression vectors that are induced by the presence of cell type specific transcription factors and / or cell specific promoters. Such compositions may be used therapeutically, including for the treatment of cancer.BACKGROUND

[0002] Our bodies contain a broad array of organ and tissue cell types, which are utilized to provide homeostatic functions. For example, in our digestive system, cell types such as: G cells (gastrin producing), D cells (Somatostatin producing), enterochromaffin cells, EC-like cells (histamine-producing) and X / A cells (ghrelin-producing), enterocytes, gastric chief cells, parietal cells, mucous secreting goblet cells, endocrine cells and Paneth cells!1]. The liver and kidneys are similarly composed of a variety of specialised cell types, from podocytes and mesangial cells to cholangiocytes and hepatocytes!2]. The emergence of tissue cell type from resident stem cells is dictated by the convergence of epigenetic, transcriptional regulators, and transcription factors (TFs). More broadly, cell function, communication and environmental responses are channeled through genomic control by TFs and their associated response elements (TFREs). The regulatory functions of TFs and TFREs are mediated through both direct DNA binding to consensus gene promoter elements, such as GATA factors and GATA elements!3'4'5], and protein-protein interactions inside and outside the nucleus that indirectly result in DNA binding at specific elements such as the p65 protein binding to p50 protein to form the NF-kB complex resulting in nuclear translocation and binding to consensus DNA binding sequences!6' 7], TF action then results in a coordinated expression or repression of genes in response to a given stimulus (Cytokine, growth factor) or niche signaling proteins (WNTs) that dictate cellular reaction (i.e. communication, growth, death, differentiation, metabolism, etc.).

[0003] Lineage associated TFs such as CDXI / 2,!8'9'10'11] GATA1-6,!3'4'5] HNF4A!12'13], FOXA2,!6'11’13'14'15] and FOXP1 (TFs) along with a host of common co-TFs such asinflammatory TF Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-KB)116'171, STATl-5,12'14'18'19'2°1 AP-1, and SMAD1-716'71 are central to mediating cell type differentiation and thus cellular function. Squamous cell types are governed by TFs such as SOX2, TP63 and SOX15 for example, which control the expression of a variety of keratins that underlie the function of this cell type!21'22'231 GATA factors such as GATA4 and GATA6 are highly expressed in intestinal and gastric tissues respectively and govern glandular formation and the presence of mucus secreting goblet cells!3' 4, 5, 8, ii]

[0004] In pathological conditions, such as cancer, genomic instability leading to mutation and copy number variation leads to amplifications of loci containing tissue specific lineage associated TFs such as GATA factors (GATA4 and GATA6) in esophageal adenocarcinoma, or TP63, SOX15 and TRPS1 in esophageal squamous cell carcinoma!21' 24, 25] other critical onco-associated TFs, include the proto-oncogene MYC (c-myc, n-myc)!15'26'27'28'29'3°1 and common lineage associated TFs involved in the development of various immune cell types. These factors often exhibit amplified or constitutively expression in over 70% of cancers. Constitutive activation of inflammatory TFs, such as NF-KB and STAT3, is also observed in many cancer types due to cytokine and growth factors in the tissue microenvironment (TME),!16'31'32'331 providing crosstalk between inflammatory and cancer-associated signaling at multiple points. Metastasis of cancer cells from their source tumour is supported by epithelial-mesenchymal transitions that are regulated by TFs such as PREP1, FOXCI, RUNX1, RUNX2, KLF8, SMAD3, SMAD4, HIF1A and SIX in lung, colon, gastric, breast and prostate cancers!34' 35, 36, 37, 38, 39, 0, 41, 42, 43] _

[0005] Targeting, coopting, or augmenting of transcriptional control in cancer cells would provide a mechanism to dictate tumour cell response to their own mutational landscape and to factors within the tumour microenvironment such as immune cells, growth, and inflammatory factors. This approach could also be used to alter the differentiation, growth, metastatic or apoptotic pathways in cancer cells to induce synthetic lethality or alter the equilibrium between immune-mediated cancer cell killing and cancerous cell escape.

[0006] Another critical cell type embedded throughout the organs and tissues of our body are immune cell types. The wide array of immune system-associated cellsprovides a tunable mechanism to provide host protection from pathogens, damage response, and pathological conditions. Lineage specifying TFs such as E2A, Pax5, EBF, PU.l, Ikaros, GATA3, Th-POK, Tbet, Bcl6, NF-KB, STATS, IRFS and FOXP1 and FOXP3 drive the differentiation and maturation fates of T cells, which depends on environmental exposures, infections, or pathological conditions resulting in heterogenous T cell states / sub-types!2'18'29'31'44'45'46'47'48'49!. T-box protein expressed in T cells (T-bet), GATA binding protein 3 (Gata-3), aryl hydrocarbon receptor (AhR), retinoic acid-related orphan receptor gamma t (RORyt), and Forkhead box P3 (FoxP3) are lineage-specific TFs of Thl, Th2, Th22, Thl7, and iTreg cells, respectively!48'49'50'51]. Naive CD4 T cells are matured into Thl subset through exposure to IL 12 and IFN-gamma mediated through the T-bet TF, '44'51'52'531 Th22 subset through IL6 exposure mediated through the AhR TF, Thl7 subset through IL6 and TGFb exposure through the RORyt TF,!48' 52, 53]anc] frreg subset through IL2 and TGFb signalling mediated through FOXP3 transcriptional activity. A similar level of transcriptional control is observed in B cells through such TFs as PRDM1 or BLIMP1, XBP1, IKZF1 and TCF3!54'55'56'57L Natural killer cells are another lymphocyte lineage of the innate immune system best known for killing virally infected cells, surveillance, and controlling early cancerous cells.Maturation and function of these cells is controlled by TFs such as E4BP4, TCF1 and ID2!48'49'50'51'58'59].

[0007] In pathological conditions such as cancer, genomic instability may lead to mutation and copy number variation or amplifications of loci containing oncogenes or proto-oncogenes and their respective promoters such as hTERT, ERBB2 / HER2, CCND1, MYC, MYCL1, MYCN, AKT2 and REL (et al.). For example, the hTERT gene is somatically variable in 97% of gastrointestinal cancers. Other important onco-associated TFs include the proto-oncogene MYC (c-myc, n-myc)!15'26'27'28'29'3°1 commonly amplified or constitutively expressed in over 70% of cancers. Additionally, structural variations to Cis- regulatory regions are common in cancers and similarly associated with increased expression of nearby onco-associated genes such as hTERT, ERBB2 and CDK2 in cancers. Furthermore, amplification of loci coding for tissue specific lineage specifying TFs are common in some cancers such as esophageal, gastric, colon and pancreatic. GATA factor (GATA4 and GATA6) TFs show copy number variation (CNV) in esophageal, gastric, pancreatic and colonic adenocarcinomas; whereas the TFs TP63, SOX15 andTRPS1 show CNV esophageal squamous cell carcinoma!21' 24, 25] Constitutive activation of inflammatory TFs such as NF-KB and STAT3 is also observed in many cancer types due to cytokine and growth factors in the tissue microenvironment (TME),!16'31<32'331 providing crosstalk between inflammatory and cancer-associated signaling at multiple points. Metastasis of cancer cells from their source tumour is supported by epithelial-mesenchymal transitions that are regulated by TFs such as PREP1, FOXCI, RUNX1, RUNX2, KLF8, SMAD3, SMAD4, HIF1A and SIX in lung, colon, gastric, breast and prostate cancers!34' 35, 36, 37, 38, 39, 0, 41, 42, 43],

[0008] The TFs NF-kB and STAT3, involved in mediating response to cytokines, infections and external stressors, are commonly hyper-activated in cancer cells promoting increased cell survival and metastatic potentials. Cytokines such as IL8 and TNFa, activate NF-kB -mediated transcription to initiate inflammation, immune cell activation, induce apoptotic cell death and differentiation in a context specific manner. Neutralizing antibodies of TNF are among the most successful drugs for the treatment of chronic inflammatory and autoimmune pathologies. TNFa overproduction has been associated with acquired resistance to immunotherapies. TNFa levels are frequently higher in cancer patients and in tumor sites where it can mediate cell death through binding to the TNFR-1 cell surface receptor or survival through NF-kB -mediated expression of inhibitor of apoptosis genes (IAP1) and CCND1. Mediation of cell death by immune cells may further exacerbate ongoing inflammation supporting carcinogenesis. Furthermore, roles for TNFa in angiogenesis and metastasis have also been uncovered in certain cancer types. Comparatively, cytokines such as OSM, LIF and IL6 communicate responses through STAT3 -dimerization and DNA binding to mediate inflammation, neutrophil expansion, responses to pathogen-associated molecular patterns, cellular differentiation in the liver, brain and immune systems, and regulation of metabolism. All three cytokines have been shown to promote cancer cell proliferation and cancer cell survival in a variety of cancer types. Oncostatin M (OSM), the most potent of these, is broadly similar to leukemia inhibitory factor (LIF) and communicates through gpl30 protein, leukemia inhibitory factor receptor (LIFR) and its own OSMR receptor. OSM is mainly secreted by T lymphocytes, neutrophils, and macrophages and thus is a major component of immune function and the tumour microenvironment. OSM has been shown to drive intestinal inflammation and itsabundance predicts response to tumor necrosis factor-neutralizing therapy in patients with inflammatory bowel disease. It is also known to promote epithelial-mesenchymal (EMT) transitions, associated with increased cancer invasive potentials, through cooperative STAT3-SMAD3 signaling and the acquisition of cancer stem cell (CSC) properties. Furthermore, adipose-tissue Treg cells restrain differentiation of stromal adipocyte precursors through OSM to promote insulin sensitivity and metabolic homeostasis.

[0009] Severe combined immunodeficiency (SCID) may be present from birth such as allergic immune responses, asthma and eczema, or may be temporary and acquired immune deficiencies associated with infections, opportunistic infections, chemotherapy, or organ transplant drugs. Autoimmune diseases such as celiac disease (CD), inflammatory bowel diseases (Crohn's disease and ulcerative colitis), multiple sclerosis, reactive arthritis, rheumatoid arthritis, and type I diabetes are malfunctions of the innate immune system that elicit immune responses to host proteins. The tumour microenvironment is composed of a variety of tissue associated cell types, a host of tumour infiltrating lymphocytes (TIL), and tumour associated macrophages (TAM), which initially attempt to eliminate cancerous cells, reach an equilibrium in delivery of this function and eventual tumour escape. Recent advances in cancer therapeutics have harnessed these T cell functions to target the tumour microenvironment and mediated cancer cell killing through chimeric antigen receptor T cell receptors (CAR-T) targeting cancer antigens!60’ 61, 62, 63] Collectively, inflammatory reactions, functions and dysfunctions are driven by immune cell lineages utilizing their respective lineage specifying TF repertoires.

[0010] Immunosuppressants, anti-inflammatory drugs, corticosteroids, and biologies such as TNF inhibitors, interleukin inhibitors, and B and T cell inhibitors have been developed to push and pull the levels of the immune response in a coarse fashion. More recently, therapeutic augmentation of immune responses, such as by immune checkpoint inhibitors,!641 aim to circumnavigate the critical dampener restraining the immune response thus releasing a large tumour immune response. Therefore, approaches for fine tuning immune responses or augmenting maturation trajectories of immune cells are likely to provide the ability to tailor or edit cellular responses during cancer, infections, and other immune pathologies.

[0011] Targeting, co-opting, or augmenting of transcriptional control in cancer cells would provide a mechanism to dictate tumour cell response to their own mutational landscape and to factors within the tumour microenvironment such as immune cells, growth, and inflammatory factors. This approach could also be used to alter the differentiation, growth, metastatic or apoptotic pathways in cancer cells and in cells in the microenvironment, to induce synthetic lethality or alter the equilibrium between immune-mediated cancer cell killing and cancerous cell escape.

[0012] The power of RNA interference to control gene expression through post-transcriptional gene silencing has revolutionized functional biology and therapeutic development through identifying therapeutic targets. Small inhibitory RNA (siRNA) are noncoding double-stranded RNA molecules similar to processed, natively occurring microRNAs (miRNAs)!65'66'67'68L The structure of siRNA is short and well-defined, usually between 20 and 24 base pairs that are processed by cellular proteins and unwound into single stranded RNA inside the cell where they bind to complementary messenger RNA (mRNA) to target it for degradation. This gene suppression is transient, but it was hoped that siRNAs would become a therapeutic option through targeting disease-associated proteins and altering the levers of signaling pathway. However, methods for mitigating off target or bystander effects and disease tissue targeting have hampered their usefulness.

[0013] Short hairpin RNAs (shRNAs), utilise the hairpin structure of the pre-miRNA combined with the more specific complementarity of siRNA to mediated gene silencing!69]. shRNAs are generally delivered to cells in plasmid form to provide more stable expression and longer gene silencing. Expression is driven by cellular RNA Pol III promoters to ensure defined transcriptional start and termination sites as these are critical to producing a functional shRNA!70'711. However, if shRNAs were driven by Pol II promoters, they would be very inefficient at producing functional shRNA, as the Pol II start and termination sites are not as fixed as Pol III promoter sites and transcriptional regulation from Pol II promoters is more complex and tightly regulated than Pol III promoters, where alternative transcriptional start and termination sites (FIG. 1) are facilitated by TF binding to specific consensus sequences upstream of the TATA box core promoter!67'69, 72] Therefore, in the context of gene silencing, Pol II promoterswould produce functional miRNAs while Pol III promoters would produce functional shRNAs.SUMMARY

[0014] The present invention is based in part, on the surprising discovery that particular inducible artificial microRNA (amiRNA) isolated nucleic acid constructs are capable of effectively modulating cancer cells in a targeted manner. Specifically, particular amiRNA isolated nucleic acid constructs as are identified herein, are designed to target specific cancer cells and to minimize expression at non-target cells. The inducible artificial microRNA (amiRNA) isolated nucleic acid constructs may be derived from recombinant nucleic acid molecules encoding a promoter-enhancer region operably linked with a sequence encoding the amiRNA expression cassette as described herein or the inducible amiRNA isolated nucleic acid constructs may be synthesized using nucleic acid based manufacturing techniques. Alternatively, the amiRNA isolated nucleic acid constructs are suitable for targeting of viral sequences.

[0015] Recently, siRNAs have been utilised to screen libraries and to explore esophageal and other cancer cell sensitivities and dependencies upon essential, and copy number variable genes!73' 74, 75, 76] yyehave also highlighted that copy number variation (CNV) of lineage specifying TFs is a feature of many esophageal cancer cases and subtypes (squamous and adenocarcinoma). TFs and their combinations play very important regulatory roles in our immune response to cancer cells among other immunological commitments. RNAi silencing-based therapeutic strategies may be capable of interfering with cellular machinery through gene specific methods but lack cell type targetability and are dependent upon the essentiality of that gene to affect functional outcome. Advances in DNA / RNA and lipid nanoparticle (LNP) technologies, such as those deployed in the recent COVID 19 pandemic, have shown the acceptability and utility of guided control of gene expression through viral-like self-amplification of antigens and delivery to the immune system in LNP formulations. Contemplating the nature of viral protein-assisted self-amplifying RNA constructs, we considered whether a system utilising eukaryotic transcription factor binding sites in synthetic DNA would be amenable to controlling therapeutic protein delivery, or more critically, provide control over antisense technology-based therapeutics. The system described herein includes a DNA construct composed of TF binding elements, such as those listed inTABLE 1 and 2, and a minimal promoter upstream of an shRNA or miRNA could selectively target the expression genes that are important for cell viability, such as those in TABLE 3 or synthetically lethal genes that would mediate cell death under suppression; or target genes that may alter maturation, differentiation, growth, apoptosis metastasis or any other cellular functions that may underlie disease states (exemplars in TABLES 1-3).

[0016] TABLE 1: Transcription Factors Associated with Transcription Factor Response ElementsCancer-Associated Transcription FactorsAP-1 SOX13 NKX2-1AP-2 SOX15 NKX2-2MYC SOX18 OCT1MAX TRPS1 OCT2NFKB1 GLI OCT3NFKB2 NFAT1 RUNX1RELA1 NFAT2 E2F1RELB NFAT4 FOXQ1REL NFAT5 TFEBSTAT3 EWS:: FLI1 SRYSTAT5A FL1 LEF1STAT5B ETS1 SRFSTAT6 ETS2 JUNGATA2 ERG FOSGATA3 ELF1 BATF:: JUNGATA4 ELF2 GABPGATA6 ELF3 KLF8TP63 ETV1 SIX1TP73 ETV4 RUNX2SOX2 ETV5 RARA:: RXRASOX3 ETV6 TAL1SOX4 TMPRSS2:: ETV1 GATA1:: TAL1SOX5 PU.1 TAL1:: TCF3SOX6 ELK1 FOXA1SOX8 ELK4 HIF1ASOX9 FOXM1 EPAS1SOX10 HES1 TBX1SOX11 HES6 TBX2SOX12 YAPOrphan ReceptorsNR2F1 NR2E3 NR2C1NR2F2 NR1D1 NR2C2 NR6A1 NR1D2 NR4A1 NR4A1 NR2E1 NR4A2Immune CellDifferentiation andImmune FactorsIRF1 TCF4 BLIMP1 IRF3 TCF7 XBP1 IRF4 TCF7L1 MIZ1 IRF5 TCF7L2 BCL6 IRF7 LEF1 HHEX IRF8 TBX21 GATA1 STAT1 TBX3 GATA2 STAT2 TBX5 GATA3 STAT3 HES1 IKZF1 STAT4 HES5 IKZF2 STAT5A BATF IKZF3 STAT5B PAX5 TEAD1 STAT6 MEF2C TEAD2 STAT1:: STAT2 SPIB BCL11B F0XP3 BCL6 SATB1 RORA MEF2B NFIL3 RORB E2F1 NFATC1 RORC FOXO1 NFATC2 TCF3 FOXO3 NFATC3 TAL1:: TCF3 BACH2 NFATC4 EndocrineReceptorsAR RARB PGR ESR1 RARG VDR ESR2 THRA NR3C1 RARA THRB NR3C2 Adopted OrphanReceptorsNR1I3 NR1C1 NR2B1 NR3B1 NR1C2 NR2B2 NR3B2 NR1C3 NR2B3 NR3B3 NR1F1 NR5A1 NR1H4 NR1F2 NR1I2 HNF4A NR1F3 NR1H3 PPARA:: RXRAMitotic bookmarkingfactorsNF-YA NF-YC NRF1NF-YB Sp2 FOXA1TABLE 2: Cancer-enhanced or Cell / Tissue Type Specific Promoters.Cancer SV / CNA / Fusion Metastatic / T reatment Tissue / Cell type Enhanced Associated Environmental Responsive specific CEA MUC-1 COX-2 HSPA5 CXCR4 TERT ErbB2 CXCR4 p53 BGLAP COX-2 EGFR HK2 HSPA4 SLP-1 CXCR4 VEGFR2 VEGFR1 GADD45A EGFR Survivin VEGFR3 VEGFR2 BRCA1 VEGFR1 MUC-1 FGF18 VEGFR3 NFKB1 VEGFR2 ErbB2 BCL-XL PLAUR IL6 VEGFR3 PEG-3 MCL1 FGF18 TNF PAX5 TFF-1 AURKA MTDH ABCB1 IKZF1 RAD51 CCND1 CYR61 EBF1 CCKAR BRAF VIM INPP5D HSPA5 SRC FN1 Albumin HK2 FGF4 CDH2 PSA SLP-1 BCL-2 TGFB1 GFAP XRCC2 ALK CTNNB1 SP-B EGFR KRAS SNAI1 B29 VEGFR1 C-MYC SNAI2 CD45 VEGFR2 N-MYC TWIST1 TRP-1 VEGFR3 L-MYC ZEB1 TTF-1 CD71 MDM2 ZEB2 PSMA AFP MET EGR1 MBP EA4D GATA4 PRRX1 NSE E2F1 GATA6 MMP1 vWF PROM1 TP63 mPbsn GPC3 SOX2 HOXB13 LALBA BCR (BCR-Abl PLG fusion)PLAUR ETV6 (ETV6- CD68 Runxl fusion)FGF18 KMT2A(MLL-AF4 CELA1 fusion)HE4 GPIIb A33 SYN1 MTDH WASP CYR61 CaMKII PRC1 SERPINA1 PAX5 CD14 BCL-XL MGB1 MCL1 KRT1HRAS KRT5NRAS KRT6 KRAS KRT8 RELA KRT10 AURKA KRT14 CCND1 KRT18 RAD50 EHD3 BRAF Tf SRC TTR FGF4 MUC2 KMT2A MUC4 BCL-2 MUC5AC ALK MUC5B RET MUC6 PSA MUC16 C-MYC BCR N-MYC NES L-MYC CDH16 MDM2 PDX1 MET AMH ESR1 CYP19A1 PGR MUC1 MUC4 TBGRRM2TABLE 3: amiRNA Target GenesChemot ProtoOncogenes Anti- Metastasis Immune DNA Metabol herapy oncog apoptotic Evasion Synthes ism Resista ene or regulators is and nee cell Repair cycleTS MAD2 RET BCL2L BCL2L12 SRPK1 PKN3 PD-1 RRM1 IDH112DPD WEE1 JAK2 BCL-2 BCL-2 NR2F1 RhoC PD-L1 RRM2 IDH2 DHFR PLK1 FOS BCL- BCL-XL FOXM1 RAC1 CTLA-4 TK1 LDHA XL CDA CDK4 MDM2 MCL-1 MCL-1 PDK1 KRAS CXCR4 PARP1 PKM2 ABCB1 CDK6 KIT Survivi Survivin CD44 NRAS FASLG PCNA mTOR nMRP1 CDK1 NOTO MDM2 MDM2 PTPN22 HRAS FOXP3 POLQ GLUT16 H1MRP2 AURK PDGF XIAP XIAP STAT3 PLK1 GPRC5 ATM GLUT3A RA B ABCG2 AURK NTRK EGFR STAT4 TSG6 ATR GLUT4B 1CFTR CHK1 NTRK MET STAT6 VEG FA HSPE12ABCG5 Klf11 NTRK HER2 MET VEGFB3ABCG8 CDK1 FGFR PIK3C KIF2A VEGFC1 AMGMT CSN5 FGFR ALK KIF2B VEGFD2TRPS1 RAN FGFR SRC KIF3A CXCR43CCND FGFR Survivi KIF3B ALK1 4 nSOX2 ROS1 FLT3 KIF5A TGFplE2F1 AKT1 MYBL2 KIF5B PAR2E2F3 AKT2 TWIST KIF5C MEGF61E2F5 AKT3 TWIST KIF7 MOK2E2F6 FGR STAT3 KIF11 HIF1AE2F7 MUC1 KIF15 EPAS1E2F8 CTNN KIFC1 NFKB1B1NFKB XIAP GSTP1 NFKB21NFKB C- GRB7 DKK12 MYCRUNX N- 1 MYCHIF1AEPAS1

[0017] In a first embodiment, there is provided an isolated nucleic acid construct, the isolated nucleic acid construct including: (a) an amiRNA expression cassette, theamiRNA expression cassette including: (i) a 5’ amiRNA flanking sequence; (ii) a 3’amiRNA flanking sequence; and fiiij a hairpin sequence positioned between the 5’ amiRNA flanking sequence and the 3’ amiRNA flanking sequence, wherein the hairpin sequence includes a terminal loop and two stem regions (stem duplex), whereby one of the stem regions encodes a functional guide sequence; and (b) a promoter-enhancer region operably linked with the sequence encoding the amiRNA expression cassette; wherein the functional guide sequence is capable of reducing the expression of a target nucleic acid; and wherein the reverse complement of the isolated nucleic acid construct sequence lacks predicted promoter sites and transcriptional start sites, unless regulated by one or more transcription factors; or wherein the reverse complement sequence comprises a reverse amiRNA expression cassette as set out in (i), (ii), and (iii), operably linked to a promoter-enhancer region.

[0018] In a further embodiment, there is provided a method to reduce the expression of a target nucleic acid in a eukaryotic cell or a eukaryotic organism including delivering the isolated nucleic acid construct described herein to the eukaryotic cell or the eukaryotic organism.

[0019] In a further embodiment, there is provided a method of treating cancer, wherein the method includes: (a) obtaining biomarker data from at least one biological sample from a subject, wherein the subject is a human patient having cancer, suspected of having cancer, or at risk for a cancer; (b) identifying, at least one cancer biomarker in the biomarker data from (a) is an indication of cancer type, wherein the at least one cancer biomarker is selected from one or more of the following: (i) tumour type, tissue type, or cell type; (ii) TNM classification; (iii) genetic structural variant detection; and i v) genomic analysis (c) obtaining the subject’s cancer data, wherein the subject’s cancer data comprises (i) previous cancer treatments; and (ii) family history of hereditary cancers; (d) choosing an isolated nucleic acid construct as described herein based on the at least one cancer biomarker (b) and the subject’s cancer data (c); and (e) providing the isolated nucleic acid construct to the subject.

[0020] In a further embodiment, there is provided a use of an isolated nucleic acid construct described herein to reduce the expression of a target nucleic acid in a eukaryotic cell or a eukaryotic organism.

[0021] In a further embodiment, there is provided a use of an isolated nucleic acid construct described herein for the treatment of cancer.

[0022] In a further embodiment, there is provided a use of an isolated nucleic acid construct described herein in the manufacture of a medicament to reduce the expression of a target nucleic acid in a eukaryotic cell or a eukaryotic organism.

[0023] In a further embodiment, there is provided a use of an isolated nucleic acid construct described herein in the manufacture of a medicament for the treatment of cancer.

[0024] In a further embodiment, there is provided a pharmaceutical composition for to reduce the expression of a target nucleic acid in a eukaryotic cell or a eukaryotic organism, including an isolated nucleic acid construct described herein and a pharmaceutically acceptable carrier.

[0025] In a further embodiment, there is provided a pharmaceutical composition for the treatment of cancer, including an isolated nucleic acid construct described herein and a pharmaceutically acceptable carrier.

[0026] In a further embodiment, there is provided an isolated nucleic acid construct described herein for treating cancer.

[0027] In a further embodiment, there is provided a pharmaceutical composition, the pharmaceutical composition including: (a) an isolated nucleic acid construct described herein; and (b) a lipid-based nanoparticle (LNPs) or a polymeric nanoparticle.

[0028] In a further embodiment, there is provided a method of treating breast cancer, wherein the method includes: (a) determining whether the patient is estrogen receptor (ER) positive (+) or negative (-); (b) determining whether the patient is human epidermal growth factor receptor 2 (HER2) positive (+) or negative (-); (c) determining whether the patient is telomerase reverse transcriptase (TERT) positive (+) or negative (-); (d) choosing an isolated nucleic acid construct of any one of claims 1-18 as follows: (i) wherein the patient is ER+ and HER- selecting ER as the TFRE; (ii) wherein the patient is ER+ and HER+ selecting ERBB2 promoter; (iii) wherein the patient is ER- and HER- and TERT+ selecting a cancer enhanced promotor TERT; (iv) wherein the patientis ER- and HER- and TERT- selecting a tissue specific promoter MUC1; and (e) providing the isolated nucleic acid construct to the subject.

[0029] The amiRNA expression cassette may be repeated in the forward or the reverse complement sequence or both. The isolated nucleic acid construct may further include a second amiRNA expression cassette encoding an alternative functional guide sequence in the forward or the reverse complement sequence or both.

[0030] The lack of a predicted promoter site or lack of a predicted transcriptional start site may be based on one or more of the following: (a) a promotor 2™ analysis score of less than 0.5; and (b) an ElemeNT™ version 2023 analysis algorithm was set to 40.4% GC value as background, with search parameters selected as follows at default cutoff values: TATA box (cutoff 6.0); BRE upstream (cutoff 5.8); BRE downstream (cutoff 4.2); GAGA (cutoff 6.7); Mammalian Initiator (cutoff 0.7); BBCABW Initiator (cutoff 3.6); Human TCT motif (cutoff 6.0); XCPE1 (cutoff 4.0); XCPE2 (cutoff 6.0); MTE (cutoff 8.5); and DPE (cutoff 0.7). When these prediction methods are used the default parameters may be applied for the analysis.

[0031] The predicted promoter sites or transcriptional start sites may further be evaluated for sequence identity of greater than or equal to 90% to a known promoter site or transcriptional start site, in deciding whether the isolated nucleic acid construct needs to be changed to exclude the predicted promoter site or transcriptional start site.

[0032] The isolated nucleic acid construct may be between 200-400 bp. The target nucleic acid may be selected from one or more of the following categories: protooncogene; oncogene; cell cycle; DNA synthesis and repair; metastasis; immune evasion; metabolism; anti-apoptotic regulators; and chemotherapy resistance.

[0033] The target nucleic acid may be selected from one or more of the following: mitotic arrest deficient 2 like 1 (MAD2); WEE1 G2 checkpoint kinase (WEE1); polo like kinase 1 (PLK1); cyclin dependent kinase 4 (CDK4); cyclin dependent kinase 6 (CDK6); cyclin dependent kinase 16 (CDK16); Aurora kinase A (AURKA); Aurora kinase B (AURKB); checkpoint kinase 1 (CHK1); kinesin family member 11 (Kif11); cyclin dependent kinase 1 (CDK1); COP9 signalosome subunit 5 (CSN5); Ras-related nuclear protein (RAN); cyclin D1 (CCND1); SRY-Box Transcription Factor 2 (SOX2); E2F Transcription Factor 1 (E2F1); E2F Transcription Factor 3 (E2F3); E2F TranscriptionFactor 5 (E2F5); E2F Transcription Factor 6 (E2F6); E2F Transcription Factor 7 (E2F7); E2F Transcription Factor 8 (E2F8); Nuclear Factor Kappa B Subunit 1 (NFKB1); Nuclear Factor Kappa B Subunit 2 (NFKB2); RUNX Family Transcription Factor 1 (RUNX1); Hypoxia inducible factor 1 subunit alpha (HIF1A); Endothelial PAS domain protein 1 (EPAS1); MYC proto-oncogene, bHLH transcription factor (C-MYC); MYCN protooncogene, bHLH transcription factor (N-MYC); MYCL proto-oncogene, bHLH transcription factor L (L-MYC); KRAS Proto-Oncogene, GTPase (KRAS); NRAS ProtoOncogene, GTPase (NRAS); HRAS Proto-Oncogene, GTPase (HRAS); B-Raf protooncogene, serine / threonine kinase (BRAF); ABL1 proto-oncogene 1, non-receptor tyrosine kinase (ABL1); BCR activator of RhoGEF and GTPase (BCR)-ABL1 protooncogene 1, non-receptor tyrosine kinase (BCR-ABL1); Epidermal Growth Factor Receptor (EGFR); MET Proto-Oncogene, Receptor Tyrosine Kinase (MET); erb-b2 receptor tyrosine kinase 2 (HER2); Phosphatidylinositol-4,5-bisphosphate 3-kinase Catalytic Subunit Alpha (PIK3CA); ALK receptor tyrosine kinase (ALK); SRC protooncogene, non-receptor tyrosine kinase (SRC); BCL2 like 12 (BCL2L12); BCL2 apoptosis regulator (BCL2); BCL2 like 1 (Bcl-xL); Myeloid cell leukemia-1 (MCL1); Survivin also known as Baculoviral IAP Repeat Containing 5 (BIRC5); Fms related receptor tyrosine kinase 3 (FLT3); ret proto-oncogene (RET); Janus kinase 2 (JAK2); Fos proto-oncogene, AP-1 Transcription Factor Subunit (FOS); MDM2 proto-oncogene (MDM2); KIT protooncogene, receptor tyrosine kinase (KIT); Notch receptor 1 (NOTCH1); Platelet Derived Growth Factor Receptor Alpha (PDGFRA); Neurotrophic receptor tyrosine kinase 1 (NTRK1); Neurotrophic receptor tyrosine kinase 2 (NTRK2); Neurotrophic receptor tyrosine kinase 3 (NTRK3); Fibroblast Growth Factor Receptor 1 (FGFR1); Fibroblast Growth Factor Receptor 2 (FGFR2); Fibroblast Growth Factor Receptor 3 (FGFR3); Fibroblast Growth Factor Receptor 4 (FGFR4); ROS proto-oncogene 1, receptor tyrosine kinase (ROS1); AKT Serine / Threonine Kinase 1 (AKT1); AKT Serine / Threonine Kinase 2 (AKT2); AKT Serine / Threonine Kinase 3 (AKT3); FGR proto-oncogene, Src family tyrosine kinase (FGR); Mucin 1 (MUC1); Catenin beta 1 (CTNNB1); X-linked inhibitor of apoptosis (XIAP); MYB proto-oncogene like 2 (MYBL2); Twist family bHLH transcription factor 1 (TWIST1); Twist family bHLH transcription factor 2 (TWIST2); Ribonucleotide reductase catalytic subunit Ml (RRM1); Ribonucleotide reductase regulatory subunit M2 (RRM2); Thymidine kinase 1 (TK1); Poly(ADP-Ribose) polymerase 1 (PARP1); Proliferating cell nuclear antigen (PCNA); DNA polymerasetheta (POLQ); ATM serine / threonine kinase (ATM); ATR serine / threonine kinase (ATR); protein kinase N3 (PKN3); Ras homolog family member C (RhoC); Rac family small GTPase 1 (RAC1); KRAS Proto-Oncogene, GTPase (KRAS); NRAS Proto-Oncogene, GTPase (NRAS); HRAS Proto-Oncogene, GTPase (HRAS); TNF alpha induced protein 6 (TSG6); vascular endothelial growth factor A (VEGFA); vascular endothelial growth factor B (VEGFB); vascular endothelial growth factor C (VEGFC); vascular endothelial growth factor D (VEGFD); C-X-C motif chemokine receptor 4 (CXCR4); ALK receptor tyrosine kinase (ALK); transforming growth factor beta 1 (TGFB1); Proteinase-activated receptor 2 (PAR2); multiple EGF-like domains 6 (MEGF6); MOK protein kinase (MOK); glutathione S-transferase pi 1 (GSTP1); kinesin family member 3B (KIF3B); SRSF protein kinase 1 (SRPK1); nuclear receptor subfamily 2 group F member 1 (NR2F1); forkhead box M1 (FOXM1); pyruvate dehydrogenase kinase 1 (PDK1); CD44 molecule (IN blood group) (CD44); protein tyrosine phosphatase non-receptor type 22 (PTPN22); signal transducer and activator of transcription 3 (STAT3); signal transducer and activator of transcription 4 (STAT 4); signal transducer and activator of transcription 6 (STAT6); kinesin family member 2 A (KIF2A); kinesin family member 2B (KIF2B); kinesin family member 3A (KIF3A); kinesin family member 5A (KIF5A); kinesin family member 5B (KIF5B); kinesin family member 5C (KIF5C); kinesin family member 7 (KIF7); kinesin family member 11 (KIF11); kinesin family member 15 (KIF15); kinesin family member C1 (KIFC1); Programmed cell death 1 (PD-1);Programmed Cell Death 1 Ligand 1 (PD-L1); Cytotoxic T-Lymphocyte Associated Protein 4 (CTLA4); C-X-C Motif Chemokine Receptor 4 (CXCR4); Fas Ligand (FASLG); Forkhead Box P3 (FOXP3); Isocitrate Dehydrogenase (NADP(+)) 1 (IDH1); Isocitrate Dehydrogenase (NADP(+)) 2 (IDH2); Lactate Dehydrogenase A (LDHA); Pyruvate Kinase Ml / 2 (PKM2); Mechanistic Target Of Rapamycin Kinase (mTOR); solute carrier family 2 member 1 (GLUT1); solute carrier family 2 member 3 (GLUT3); solute carrier family 2 member 4 (GLUT4); Heat Shock Protein Family E (Hsp10) Member 1 (HSPE1); Thymidylate synthetase (TS); Dihydropyrimidine dehydrogenase (DPD); Dihydrofolate reductase (DHFR); Cytidine deaminase (CDA); ATP binding cassette subfamily B member 1 (ABCB1); Multidrug resistance-associated protein 1 (MRP1); Multidrug Resistance Protein 2 (MRP2); ATP binding cassette subfamily G member 2 (ABCG2); Cystic fibrosis transmembrane conductance regulator (CFTR); ATP binding cassettesubfamily G member 5 (ABCG5); ATP binding cassette subfamily G member 8 (ABCG8); and 0-6-methylguanine-DNA methyltransferase (MGMT).

[0034] The target nucleic acid may alternatively be selected from one or more of the following: growth factor receptor bound protein 7 (GRB7); G protein-coupled receptor class C group 5 member B (GPRC5B); transcriptional repressor GATA binding1 (TRPS1); and dickkopf Wnt signaling pathway inhibitor 1 (DKK1).

[0035] The promoter-enhancer region operably linked with the sequence encoding the amiRNA expression cassette may be selected from one or more of the following categories: cancer-enhanced promotors; somatic variation / copy number amplifications / fusion associated; metastatic / environmental; treatment responsive; cell tissue promotors.

[0036] The promoter-enhancer region operably linked with the sequence encoding the amiRNA expression cassette comprises a promoter, wherein the promoter is selected from one or more of the following: Carcinoembryonic Antigen-Related Cell Adhesion Molecule 5 (CEA); Telomerase Reverse Transcriptase (TERT); Cyclooxygenase 2 (COX-2); C-X-C Motif Chemokine Receptor 4 (CXCR4); Survivin also known as Baculoviral IAP Repeat Containing 5 (BIRC5); Mucin 1 (MUC-1); Erb-B2 Receptor Tyrosine Kinase 2 (ERBB2); Paternally Expressed 3 (PEG-3); Transcription Termination Factor 1 (TTF-1); RAD51 Recombinase (RAD51); Cholecystokinin A Receptor (CCKAR); Heat Shock Protein Family A Member 5 (HSPA5); Hexokinase 2(HK2); Stomatin-Like Protein 1 (SLP-1); X-Ray Repair Cross Complementing 2 (XRCC2); Epidermal Growth Factor Receptor (EGFR); Vascular Endothelial Growth Factor Receptor 1 (VEGFR1 / FLT1); Vascular Endothelial Growth Factor Receptor 2 (VEGFR2 / KDR); Vascular Endothelial Growth Factor Receptor 3 (VEGFR3 / FLT4); Transferrin receptor (CD71); Alpha Fetoprotein (AFP); AFP promoter variant (EA4D); E2F Transcription Factor 1 (E2F-1); Prominin 1 (PR0M1); Glypican 3 (GPC3); Lactalbumin Alpha (LALBA); Urokinase-type Plasminogen Activator Receptor (uPAR / PLAUR); Fibroblast Growth Factor 18 (FGF18); Human Epididymis Protein 4 (HE4); Glycoprotein A33 (A33); Metadherin (MTDH); Cysteine Rich Angiogenic Inducer 61 (CYR61); Cellular Communication Network Factor 1 (CCN1); Protein Regulator of Cytokinesis 1 (PRC1); Ribonucleoside-Diphosphate Reductase Subunit M2 (RRM2); Paired Box 5 (PAX5); Bcl-2-related gene x, long isoform (BCL-XL); Myeloid cell leukemia-1 (MCL1); HRAS Proto-Oncogene, GTPase (HRAS);NRAS Proto-Oncogene, GTPase (NRAS); KRAS Proto-Oncogene, GTPase (KRAS); RELA Proto-Oncogene, NF-KB Subunit (RELA); Aurora Kinase A (AURKA); cyclin D1 (CCND1); RAD50 Double Strand Break Repair Protein (RAD50); B-Raf Proto-Oncogene -Serine / Threonine Kinase (BRAF); pp60c-Src Nonreceptor Tyrosine Kinase (SRC);Fibroblast growth factor 4 (FGF4 / HST); B-cell lymphoma protein-2 (BCL-2); Anaplastic Lymphoma Kinase (ALK); Rearranged During Transfection (RET); Prostate-Specific Antigen (PSA) [or Kallikrein Related Peptidase 3 (KLK3)]; MYC proto-oncogene, bHLH transcription factor (C-MYC); MYCN proto-oncogene, bHLH transcription factor (N-MYC); MYCL proto-oncogene, bHLH transcription factor L (L-MYC); MDM2 protooncogene (MDM2); MET Proto-Oncogene, Receptor Tyrosine Kinase (MET); Estrogen Receptor 1 (ESRI); Progesterone Receptor (PGR); Mucin 4 (MUC4); Mucin 1 (MUC1); Erb-B2 Receptor Tyrosine Kinase 2 (ERBB2); Epidermal Growth Factor Receptor (EGFR); Vascular Endothelial Growth Factor Receptor 2 (VEGFR2 / KDR); Vascular Endothelial Growth Factor Receptor 3 (VEGFR3 / FLT4); Fibroblast Growth Factor 18 (FGF18); Bcl-2 -related gene x, long isoform (BCL-XL); Myeloid cell leukemia-1 (MCL1); Aurora Kinase A (AURKA); cyclin D1 (CCND1); B-Raf Proto-Oncogene -Serine / Threonine Kinase (BRAF); pp60c-Src Nonreceptor Tyrosine Kinase (SRC);Fibroblast growth factor 4 (FGF4 / HST); B-cell lymphoma protein-2 (BCL-2); Anaplastic Lymphoma Kinase (ALK); KRAS Proto-Oncogene, GTPase (KRAS); MYC proto-oncogene, bHLH transcription factor (C-MYC); MYCN proto-oncogene, bHLH transcription factor (N-MYC); MYCL proto-oncogene, bHLH transcription factor L (L-MYC); MDM2 protooncogene (MDM2); MET Proto-Oncogene, Receptor Tyrosine Kinase (MET); GATA binding protein 4 (GATA4); GATA binding protein 6 (GATA6); Tumor Protein p63 (TP63); SRY-box transcription factor 2 (SOX2); Breakpoint Cluster Region (BCR); ETS Variant Transcription Factor 6 (ETV6); Lysine Methyltransferase 2A (KMT2A);Cyclooxygenase 2 (COX-2); C-X-C Motif Chemokine Receptor 4 (CXCR4); Hexokinase 2(HK2); Vascular Endothelial Growth Factor Receptor 1 (VEGFR1 / FLT1); Vascular Endothelial Growth Factor Receptor 2 (VEGFR2 / KDR); Vascular Endothelial Growth Factor Receptor 3 (VEGFR3 / FLT4); Urokinase-type Plasminogen Activator Receptor (uPAR / PLAUR); Fibroblast Growth Factor 18 (FGF18); Metadherin (MTDH); Cysteine Rich Angiogenic Inducer 61 (CYR61); Vimentin (VIM); Fibronectin (FN1); Cadherin 2 (CDH2); Transforming growth factor beta 1 (TGFB1); Catenin beta 1 (CTNNB1); Snail family transcriptional repressor 1 (SNAI1); Snail family transcriptional repressor 2(SNAI2 ); Twist family bHLH transcription factor 1 (TWIST1); Zinc finger E-box binding homeobox 1 (ZEB1); Zinc finger E-box binding homeobox 2 (ZEB2); Early growth response 1 (EGR1); Paired related homeobox 1 (PRRX1); Heat Shock Protein Family A Member 5 (HSPA5); Tumor Protein p53 (p53); Heat Shock Protein Family A (Hsp70) Member 4 (HSPA4); Growth Arrest and DNA Damage Inducible Alpha (GADD45A); BRCA1 DNA repair associated (BRCA1); Nuclear Factor Kappa B Subunit 1 (NFKB1); Interleukin 6 (IL6); Tumor Necrosis Factor (TNF); ATP Binding Cassette Subfamily B Member 1 (ABCB1); C-X-C Motif Chemokine Receptor 4 (CXCR4); Osteocalcin (BGLAP); Stomatin-Like Protein 1 (SLP-1); Epidermal Growth Factor Receptor (EGFR); Vascular Endothelial Growth Factor Receptor 1 (VEGFR1 / FLT1); Vascular Endothelial Growth Factor Receptor 2 (VEGFR2 / KDR); Vascular Endothelial Growth Factor Receptor 3 (VEGFR3 / FLT4); Paired Box 5 (PAX5); IKAROS Family Zinc Finger 1 (IKZF1); EBF Transcription Factor 1 (EBF1); Inositol polyphosphate-5 -phosphatase D (INPP5D); Albumin; Glial Fibrillary Acidic Protein (GFAP); Surfactant Protein B (SP-B); B-Cell-Specific Glycoprotein B29 (B29); Cell Surface Glycoprotein CD45 (CD45); Tyrosinase Related Protein 1 (TRP-1); Thyroid Transcription Factor 1 (TTF-1); Prostate-Specific Membrane Antigen (PSMA); Myelin Basic Protein (MBP); Neuron Specific Enolase (NSE); von Willebrand Factor (vWF); Probasin (mPbsn); Homeobox B13 (H0XB13); Plasminogen; CD68 Antigen (CD68); Elastase-1 (CELA1); Platelet Membrane Glycoprotein lib (GPIIb); Synapsin I (SYN1); Wiskott-Aldrich Syndrome Protein (WASP); Calcium / Calmodulin-Dependent Protein Kinase II (CaMKII); Serpin Family A Member 1 (SERPINA1); CD 14 Antigen (CD 14); Mammoglobin (MGB1); Keratin 1 (KRT1); Keratin 5 (KRT5); Keratin 6 (KRT6); Keratin 8 (KRT8); Keratin 10 (KRT10); Keratin 14 (KRT14); Keratin 18 (KRT18); EH Domain-Containing Protein 3 (EHD3); Transferrin (Tf); Transthryetin (TTR); Mucin 2 (MUC2); Mucin 5AC (MUC5AC); Mucin 5B (MUC5B); Mucin 6 (MUC6); Mucin 16 (MUC16); Breakpoint Cluster Region (BCR); Nestin (NES); Cadherin 16 (CDH16); Pancreatic and Duodenal Homeobox 1 (PDX1); Anti-Mullerian Hormone (AMH); Cytochrome P450 Family 19 Subfamily A Member 1 (CYP19A1); and Thyroxine-Binding Globulin (TBG).

[0037] The promoter-enhancer region operably linked with the sequence encoding the amiRNA expression cassette comprises a promoter, wherein the promoter is alternatively from Matrix Metallopeptidase 1 (MMP1).

[0038] The promoter-enhancer region operably linked with the sequence encoding the amiRNA expression cassette may include a transcription factor response element (TFRE) and the TFRE is responsive to a transcription factor selected from one or more of the following categories: cancer-associated transcription factors; immune cell differentiation; immune factors; endocrine receptors; mitotic bookmarking factors; adopted orphan receptors; and orphan receptors.

[0039] The TFRE may be responsive to a transcription factor selected from one or more of the following: Activator protein-1 (AP-1); Activating enhancer binding protein 2 alpha (AP-2); Basic leucine zipper ATF-like transcription factor- Jun proto-oncogene, AP-1 transcription factor subunit (BATF:: JUN); E2F transcription factor 1 (E2F1); E74 like ETS transcription factor 1 (ELF1); E74 like ETS transcription factor 2 (ELF2); E74 like ETS transcription factor 3 (ELF3); ETS transcription factor ELK1 (ELK1); ETS transcription factor ELK4 (ELK4); Endothelial PAS Domain Protein 1 (EPAS1); ETS proto-oncogene 1, transcription factor (ETS 1 ); ETS proto-oncogene 2, transcription factor (ETS2); ETS variant transcription factor 1 (ETV1); ETS variant transcription factor 4 (ETV4); ETS variant transcription factor 5 (ETV5); ETS variant transcription factor 6 (ETV6); ETS transcription factor ERG (ERG); Ewing's sarcoma oncogene-Fli-1 proto-oncogene, ETS transcription factor (EWS:: FLI1); Fli-1 proto-oncogene, ETS transcription factor (FLI1); Fos proto-oncogene, AP-1 transcription factor subunit (FOS); Forkhead box A1 (FOXA1); Forkhead box M1 (FOXM1); Forkhead box Q1 (FOXQ1); GA binding protein transcription factor subunit alpha (GABPA); GATA binding protein 1-TAL bHLH transcription factor 1, erythroid differentiation factor (GATA1:: TAL1); GATA binding protein 2 (GATA2); GATA binding protein 3 (GATA3); GATA binding protein 4 (GATA4); GATA binding protein 6 (GATA6); Glioma-associated oncogene transcription factor (GLI); hes family bHLH transcription factor 1 (HES1); hes family bHLH transcription factor 6 (HES6); Hypoxia inducible factor 1 subunit alpha (HIF1A); Jun proto-oncogene, AP-1 transcription factor subunit (JUN); KLF transcription factor 8 (KLF8); Lymphoid enhancer binding factor 1 (LEF1); MYC associated factor X (MAX); MYC proto-oncogene, bHLH transcription factor (MYC); Nuclear Factor of Activated T Cells 2 (NFAT1); Nuclear Factor of Activated T Cells 1 (NFAT2); Nuclear Factor of Activated T Cells 3 (NFAT4); Nuclear Factor of Activated T Cells 5 (NFAT5); Nuclear Factor kappa B Subunit 1 (NFKB1); Nuclear Factor kappa B Subunit 2 (NFKB2); NK2 homeobox 1 (NKX2-1); NK2 homeobox 2 (NKX2-2); POU class2 homeobox 1 (OCTI); POU class 2 homeobox 2 (OCT2); POU domain class 5 transcription factor 3 (OCT3); Spi-1 proto-oncogene (PU.l); Retinoic acid receptor alpha-Retinoid X receptor alpha (RARA:: RXRA); RELA proto-oncogene, NF-kB subunit (RELA1); RELB proto-oncogene, NF-kB subunit (RELB); REL proto-oncogene, NF-kB subunit (REL); RUNX family transcription factor 1 (RUNX1); RUNX family transcription factor 2 (RUNX2); SIX homeobox 1 (SIX1); Signal Transducer and Activator of Transcription 3 (STAT3); Signal Transducer and Activator of Transcription 5A (STAT5A); Signal Transducer and Activator of Transcription 5B (STAT5B); Signal Transducer and Activator of Transcription 6 (STAT6); SRY-box Transcription Factor 2 (SOX2); SRY-box Transcription Factor 3 (SOX3); SRY-box Transcription Factor 4 (SOX4); SRY-box Transcription Factor 5 (SOX5); SRY-box Transcription Factor 6 (SOX6); SRY-box Transcription Factor 8 (SOX8); SRY-box Transcription Factor 9 (SOX9); SRY-box Transcription Factor 10 (SOX10); SRY-box Transcription Factor 11 (SOX11); SRY-box Transcription Factor 12 (SOX12); SRY-box Transcription Factor 13 (SOX13); SRY-box Transcription Factor 15 (SOX15); SRY-box Transcription Factor 18 (SOX18); Serum Response Factor (SRF); Sex Determining Region Y (SRY); TAL bHLH transcription factor 1, erythroid differentiation factor (TALI); TAL bHLH transcription factor 1, erythroid differentiation factor-Transcription factor 3 (TAL1:: TCF3); T-box transcription factor 1 (TBX1); T-box transcription factor 2 (TBX2); Transcription Factor EB (TFEB); Transmembrane Serine Protease 2- ETS variant transcription factor 1 (TMPRSS2:: ETV1); Tumor protein p63 (TP63); Tumor protein p73 (TP73);Transcriptional repressor GATA binding 1 (TRPS1); Yesl associated transcriptional regulator (YAP); BTB domain and CNC homolog 2 (BACH2); Basic leucine zipper ATF-like transcription factor (BATF); PR / SET domain 1 (BLIMP1); BCL11 transcription factor B (BCL11B); BCL6 transcription repressor (BCL6); E2F transcription factor 1 (E2F1); Forkhead box O1 (FOXO1); Forkhead box O3 (FOXO3); Forkhead box P3 (FOXP3); GATA binding protein 1 (GATA1); GATA binding protein 2 (GATA2); GATA binding protein 3 (GATA3); hes family bHLH transcription factor 1 (HES1); hes family bHLH transcription factor 5 (HES5); Hematopoietically Expressed Homeobox (HHEX); IKAROS family zinc finger 1 (IKZF1); IKAROS family zinc finger 2 (IKZF2); IKAROS family zinc finger 3 (IKZF3); Interferon regulatory factor 1 (IRF1); Interferon regulatory factor 3 (IRF3); Interferon regulatory factor 4 (IRF4); Interferon regulatory factor 5 (IRF5); Interferon regulatory factor 7 (IRF7); Interferon regulatory factor 8 (IRF8);Lymphoid enhancer binding factor 1 (LEF1); Myocyte enhancer factor 2B (MEF2B); Myocyte enhancer factor 2C (MEF2C); Protein inhibitor of activated STAT 2 (MIZ1); Nuclear Factor of Activated T-cells 1 (NFATC1); Nuclear Factor of Activated T-cells 2 (NFATC2); Nuclear Factor of Activated T-cells 3 (NFATC3); Nuclear Factor of Activated T-cells 4 (NFATC4); Nuclear factor, interleukin 3 regulated (NFIL3); Paired box 5 (PAX5); RAR related orphan receptor A (RORA); RAR related orphan receptor B (RORB); RAR related orphan receptor C (RORC); SATB homeobox 1 (SATB1); Spi-B transcription factor (SPIB); Signal transducer and activator of transcription 1 (STAT1); Signal transducer and activator of transcription 2 (STAT2); Signal transducer and activator of transcription 1-Signal transducer and activator of transcription 2 (STAT1:: STAT2); Signal transducer and activator of transcription 3 (STAT3); Signal transducer and activator of transcription 4 (STAT4); Signal transducer and activator of transcription 5A (STAT5A); Signal transducer and activator of transcription 5B (STAT5B); Signal transducer and activator of transcription 6 (STAT6); TAL bHLH transcription factor 1, erythroid differentiation factor-Transcription factor 3 (TAL1:: TCF3); T-box transcription factor 21 (TBX21); T-box transcription factor 3 (TBX3); T-box transcription factor 5 (TBX5); Transcription factor 3 (TCF3);Transcription factor 4 (TCF4); Transcription factor 7 (TCF7); Transcription factor 7 like 1 (TCF7L1); Transcription factor 7 like 2 (TCF7L2); TEA domain transcription factor 1 (TEAD1); TEA domain transcription factor 2 (TEAD2); X-box binding protein 1 (XBP1); Androgen receptor (AR); Estrogen receptor 1 (ESR1); Estrogen receptor 2 (ESR2); Nuclear receptor subfamily 3 group C member 1 (NR3C1); Nuclear receptor subfamily 3 group C member 2 (NR3C2); Progesterone receptor (PGR); Retinoic acid receptor alpha (RARA); Retinoic acid receptor beta (RARB); Retinoic acid receptor gamma (RARG); Thyroid hormone receptor alpha (THRA); Thyroid hormone receptor beta (THRB); Vitamin D receptor (VDR); Forkhead box A1 (FOXA1); Nuclear transcription factor Y subunit alpha (NF-YA); Nuclear transcription factor Y subunit beta (NF-YB); Nuclear transcription factor Y subunit gamma (NF-YC); Nuclear respiratory factor 1 (NRF1); Sp2 transcription factor (Sp2 ); Hepatocyte nuclear factor 4 alpha (HNF4A); Peroxisome proliferator activated receptor alpha- Retinoid X receptor alpha (PPARA: RXRA);Peroxisome proliferator activated receptor alpha (NR1C1); Peroxisome proliferator activated receptor delta (NR1C2); Peroxisome proliferator activated receptor gamma (NR1C3); RAR related orphan receptor A (NR1F1); RAR related orphan receptor B(NR1F2); RAR related orphan receptor C (NR1F3); Nuclear receptor subfamily 1 group H member 3 (NR1H3); Nuclear receptor subfamily 1 group H member 4 (NR1H4);Retinoid X receptor alpha (NR2B1); Retinoid X receptor beta (NR2B2); Retinoid X receptor gamma (NR2B3); Nuclear receptor subfamily 1 group I member 2 (NR1I2); Nuclear receptor subfamily 1 group I member 3 (NR1I3); Estrogen related receptor alpha (NR3B1); Estrogen related receptor beta (NR3B2); Estrogen related receptor gamma (NR3B3); Nuclear receptor subfamily 5 group A member 1 (NR5A1); Nuclear receptor subfamily 1 group D member 1 (NR1D1); Nuclear receptor subfamily 1 group D member 2 (NR1D2); Nuclear receptor subfamily 2 group C member 1 (NR2C1);Nuclear receptor subfamily 2 group C member 2 (NR2C2); Nuclear receptor subfamily 2 group E member 1 (NR2E1); Nuclear receptor subfamily 2 group E member 3 (NR2E3); Nuclear receptor subfamily 2 group F member 1 (NR2F1); Nuclear receptor subfamily 2 group F member 2 (NR2F2); Nuclear receptor subfamily 4 group A member 1 (NR4A1); Nuclear receptor subfamily 4 group A member 2 (NR4A2); and Nuclear receptor subfamily 6 group A member 1 (NR6A1).

[0040] The the 5’ amiRNA flanking sequence and the 3’ amiRNA flanking sequence may be selected from: mmu-miR-155; hsa-miR-155; hsa-miR-30a; hsa-miR-451; hsa-miR-33; hsa-miR-31; hsa-miR-122; hsa-miR-223; miR-30; miR-E; miR-AB; miR-N; miR-S; and miR-GE.

[0041] The isolated nucleic acid construct may further include one or more of the following: a transcriptional pause site; a poly A signal; and a reporter gene. The isolated nucleic acid construct may further include one or more, additional amiRNA expression cassettes comprising: a 5’ amiRNA flanking sequence; a 3’ amiRNA flanking sequence; and a hairpin sequence positioned between the 5’ amiRNA flanking sequence and the 3’ amiRNA flanking sequence.

[0042] The promoter-enhancer region may include one or more sequence motifs selected from: TATA box; TFIIB Recognition Element (BRE); Initiator (Inr); Motif Ten Element (MTE); Downstream Promotor Element (DPE); Downstream Core Element (DCE); and X Core Promoter Element 1 (XCPE1). The promoter-enhancer region may include a Pol II minimal promotor selected from the following: (a) MinP (SEQ ID NO.169); (b) miniCMV (SEQ ID NO.168); or (c) miniTK (SEQ ID N0.170). The promoterenhancer region may include one of more of the following: (a) SSRCGCC[G / C-G / C-G / A-C-G-C-C] (SEQID NO.562); (b) TCAKTY[T-C-A-G / T-T-T / C] (SEQID NO.563); (c) RGWYV[A / G-G-A / T-C / T-G / A / C] (SEQID NO.564); (d) CSARCSSAACGS[C-G / C-A-G / A-C-G / C-G / C-A-A-C-G-G / C] (SEQID NO.565); (e) CTTC CTGT AGO (SEQID NO.566); and (f) DSGYGGRASNM[G / A / T-G / C-G-T / C-G-G-G / A-A-G / C-N-A / C] (SEQID NO.567). The promoter-enhancer region may be selected from the following: a cancer enhanced promoter; a structural variant (SV) or a copy number variation / alteration (CNA / CNV) fusion associated promoter; a metastatic or environmental promoter; a treatment responsive promoter; and a cell / tissue specific promoter.

[0043] The promoter-enhancer region may include a promoter selected from one or more of the following genes: (a) CEA; TERT; COX-2; CXCR4; Survivin; MUC-l; ErbB2; PEG-3; TFF-1; RAD51; CCKAR; HSPA5; HK2; SLP-1; XRCC2; EGFR; VEGFR1; VEGFR2; VEGFR3; CD71; AFP; EA4D; E2F1; PR0M1; GPC3; LALBA; PLAUR; FGF18; HE4; A33; MTDH; CYR61; PRC1; PAX5; BCL-XL; MCL1; ERAS; NRAS; KRAS; RELA; AURKA; CCND1; RAD50; BRAF; SRC; FGF4; KMT2A; BCL-2; ALK; RET; PSA; C-MYC; N-MYC; L-MYC;MDM2; MET; ESRI; PGR; MUC4; and RRM2; (b) MUC-1; ErbB2; EGFR; VEGFR2; VEGFR3; FGF18; BCL-XL; MCL1; AURKA; CCND1; BRAF; SRC; FGF4; BCL-2; ALK; KRAS; C-MYC; N-MYC; L-MYC; MDM2; MET; GATA4; GATA6; TP63; S0X2; BCR (BCR-Abl fusion); ETV6 (ETV6-Runxl fusion); and KMT2A(MLL-AF4 fusion); (c) COX-2; CXCR4; HK2; VEGFR1; VEGFR2; VEGFR3; PLAUR; FGF18; MTDH; CYR61; VIM; FN1; CDH2; TGFB1; CTNNB1; SNAI1; SNAI2; TWIST1; ZEB1; ZEB2; EGR1; and PRRX1; (d) HSPA5; p53; HSPA4;GADD45A; BRCA1; NFKB1; IL6; TNF; and ABCB1; (e) CXCR4; BGLAP; SLP-1; EGFR; VEGFR1; VEGFR2; VEGFR3; PAX5; IKZF1; EBF1; INPP5D; Albumin; PSA; GFAP; SP-B; B29; CD45; TRP-1; TTF-1; PSMA; MBP; NSE; vWF; mPbsn; HOXB13; PLG; CD68; CELA1; GPIIb; SYN1; WASP; CaMKII; SERPINA1; CD 14; MGB1; KRT1; KRT5; KRT6; KRT8;KRT10; KRT14; KRT18; EHD3; Tf; TTR; MUC2; MUC4; MUC5AC; MUC5B; MUC6; MUC16; BCR; NES; CDH16; PDX1; AMH; CYP19A1; MUC1; and TBG. Alternatively, the promoterenhancer region may include a promoter from MMP1.

[0044] The isolated nucleic acid construct may be capable of reducing the expression of a target nucleic acid in the eukaryotic cell or the eukaryotic organism for use in the treatment of a cancer.

[0045] The cancer may be selected from one or more of the following: AIDS-related cancer; anal cancer; brain cancer; bile duct cancer; bladder cancer; blood cancer; bonecancer; breast cancer; bronchial cancer; cardiac cancer; central nervous system cancer; cervical cancer; colorectal cancer; endometrial cancer; esophageal cancer; eye cancer; fallopian tube cancer; gallbladder cancer; gastric cancer; germ cell cancer; gastrointestinal cancer; heart cancer; hepatocellular cancer; hypopharyngeal cancer; islet cell cancer; lung cancer; Langerhans cell histiocytosis (LCH); metastatic cancer; nasopharyngeal cancer; neuroendocrine cancer; ovarian cancer; pancreatic cancer; prostate cancer; renal cancer; rectal cancer; skin cancer; testicular cancer; thyroid cancer; urethral cancer; uterine cancer; vaginal cancer; vascular cancer; and vulvar cancer. The cancer may be selected from one or more of the following: carcinoma; leukemia; lymphoma; myeloma; and sarcoma. The cancer may be selected from one or more of the following: astrocytoma; blastoma; craniopharyngioma; chordoma; ependymoma; glioblastoma; histiocytoma; melanoma; multiple myeloma; nephroblastoma; neuroblastoma; osteosarcoma; paraganglioma; pheochromocytoma; plasmacytoma; pleuropulmonary blastoma; retinoblastoma; rhabdomyosarcoma; sarcoma; thymoma and thymic carcinoma; and uterine sarcoma. The cancer may be selected from one or more of the following: acute lymphoblastic leukemia (ALL); acute myeloid leukemia (AML); adrenocortical carcinoma; AIDS-related lymphoma; astrocytoma; basal cell carcinoma; Burkitt lymphoma; cholangiocarcinoma; chronic lymphocytic leukemia (CLL); chronic myelogenous leukemia (CML); cutaneous T-cell lymphoma; diffuse intrinsic pontine glioma (DIPG); ductal carcinoma in situ (DCIS); endometrial uterine cancer; esthesioneuroblastoma; Ewing sarcoma; gastrointestinal neuroendocrine tumors; gastrointestinal stromal tumors (GIST); gestational trophoblastic disease (GTD); hairy cell leukemia; Hodgkin lymphoma; hypopharyngeal cancer; intraocular melanoma; Kaposi sarcoma; malignant fibrous histiocytoma; malignant mesothelioma; medulloblastoma; merkel cell carcinoma; midline tract carcinoma; multiple endocrine neoplasia (MEN) syndrome; myeloproliferative neoplasms; myelodysplastic syndrome; mycosis fungoids; nasopharyngeal cancer; nasal cavity and paranasal sinus cancer; neuroblastoma; Non-Hodgkin lymphoma; non-small cell lung cancer; oral cancer; oropharyngeal cancer; osteosarcoma; papillomatosis; paraganglioma; parathyroid cancer; penile cancer; pharyngeal cancer; pituitary cancer; plasma cell neoplasm; pleuropulmonary blastoma; primary CNS lymphoma; pulmonary inflammatory myofibroblastic tumor; retinoblastoma; rhabdomyosarcoma; salivarygland cancer; small cell lung cancer; squamous cell carcinoma; tracheobronchial cancer; uterine sarcoma; and Wilms tumor.

[0046] Where the cancer is a chronic myeloid leukemia with no previous treatment and has a BCR ABL1 fusion mutation, the promoter is a myeloid specific pBCR or SV-associated promoter (BCL-ABLfus pBCR), and the target specific sequence may be ABL and / or PLK1. Where the cancer is an acute myeloid leukemia having FTL3-ITD FLT3-TKD mutations and not responsive to midostaurin treatment, the promoter is a myeloid specific pCD33, and the target specific sequence may be FLT3 and / or MCL1. Where the cancer is a breast cancer that is ER positive and HER2 negative with TMN stage T4 N1 MO and CDK4 / 6 is overexpressed, the promoter is a cancer cell enhanced TFRE pESRl-TFRE, and the target specific sequence may be CDK4 / 6 and / or RhoC. Where the cancer is a glioma that is Nestin high, the promoter is a cancer cell enhanced cell type specific pNESTIN, and the target specific sequence may be S0X2 and / or IDH1. Where the cancer is a metastatic gastric adenocarcinoma chromosome instability, TMN stage T3, Nl, MO and hTERT positive, ERBB2 positive and chemoresistant, the promoter is phTERT, and the target specific sequence may be TS and / or DPD 5FU. Where the cancer is a metastatic colon adenocarcinoma with TMN stage T4, Nib, Mia and cancer enhanced TF panel and VEGF enhanced, and the target specific sequence may be RRM2 and / or RRM1.

[0047] The promoter may be selected for the isolated nucleic acid construct based on the tissue or cell type as follows: (a) wherein the tissue or cell type is immune, the promotor may be selected from one or more of the following: CD34; CXCR4; SLP-1; PAX5; IKZF1; EBF1; SHIP1 / INPP5D; GFAP; B29; CD45; CD68; GPIIb; WASP; CD14; and BCR; (b) wherein the tissue or cell type is brain or central nervous system (CNS), the promotor may be selected from one or more of the following: CD33; NES; SLP-1; TTF-1; MBP; NSE; SYN1; CaMKII; and EHD3; (c) wherein the tissue or cell type is breast, the promotor may be MGB1; and MUC1; (d) wherein the tissue or cell type is colon, the promotor may be selected from one or more of the following: MUC2; and KRT18; (e) wherein the tissue or cell type is gastric, the promotor may be selected from one or more of the following: MUC5AC; and MUC6; (f) wherein the tissue or cell type is liver, the promotor may be selected from one or more of the following: albumin; PLG;SERPINA1; Tf; TTR; and TBG; (g) wherein the tissue or cell type is kidney, the promotormay be CDH16; (h) wherein the tissue or cell type is testes, the promotor is PSA; Ji] wherein the tissue or cell type is prostate, the promotor may be selected from one or more of the following: PSA; PSMA; mPbsn; and HOXB13; Q) wherein the tissue or cell type is ovarian, the promotor may be selected from one or more of the following:MUC16; AMH; and CYP19A1; (kJ wherein the tissue or cell type is pancreatic, the promotor may be selected from one or more of the following: CELA1; and PDX1; (1) wherein the tissue or cell type is skin, the promotor may be selected from one or more of the following: TRP-1; KRT1; KRT5; KRT6; KRT10; and KRT14; (mJ wherein the tissue or cell type is lung, the promotor may be selected from one or more of the following: SP-B; TTF-1; MUC5AC; and MUC5B; (nJ wherein the tissue or cell type is bone, the promotor may be BGLAP; Jo] wherein the tissue or cell type is epithelial, the promotor may be selected from one or more of the following: SLP-1; EGFR; KRT1; KRT5; KRT6; KRT8; KRT14; and KRT18; and Jp] wherein the tissue or cell type is endothelial, the promotor may be selected from one or more of the following: VEGFR1; VEGFR2;VEGFR3; vWF; andEHD3.

[0048] The TFRE may be responsive to a transcription factor selected from one or more of the following: AP-1; AP-2; MYC; MAX; NFKB1; NFKB2; RELA1; RELB; REL; STAT3; STAT5A; STAT5B; STAT6; GATA2; GATA3; GATA4; GATA6; TP63; TP73; SOX2; SOX3; S0X4; SOX5; SOX6; SOX8; SOX9; SOXIO; SOX11; S0X12; S0X13; S0X15; S0X18; TRPS1; GLI; NFAT1; NFAT2; NFAT4; NFAT5; EWS:: FLI1; FLU; ETS1; ETS2; ERG; ELF1; ELF2; ELF3; ETV1; ETV4; ETV5; ETV6; TMPRSS2:: ETV1; PU.l; ELK1; ELK4; F0XM1; HES1; HES6; YAP; NKX2-1; NKX2-2; OCTI; 0CT2; 0CT3; RUNX1; E2F1; FOXQ1; TFEB; SRY; LEF1; SRF; JUN; FOS; BATF:: JUN; GABPA; KLF8; SIX1; RUNX2; RARA:: RXRA; TAL1;GATA1:: TAL1; TAL1:: TCF3; FOXA1; HIF1A; EPAS1; TBX1; TBX2; IRF1; IRF3; IRF4; IRF5; IRF7; IRF8; STAT1; STAT2; STAT4; STAT1:: STAT2; FOXP3; RORA; RORB; RORC; TCF3; TCF4; TCF7; TCF7L1; TCF7L2; TBX21; TBX3; TBX5; HES5; BATF; PAX5; MEF2C; SPIB; BCL6; MEF2B; FOXO1; FOXO3; BACH2; BLIMP1; XBP1; MIZ1; BCL6; HHEX; GATA1; IKZF1; IKZF2; IKZF3; TEAD1; TEAD2; BCL11B; SATB1; NFIL3; NFATC1; NFATC2;NFATC3; NFATC4; AR; ESRI; ESR2; RARA; RARB; RARG; THRA; THRB; PGR; VDR;NR3C1; NR3C2; NF-YA; NF-YB; NF-YC; Sp2; NRF1; NR1I3; NR3B1; NR3B2; NR3B3; NR1H4; HNF4A; PPARA:: RXRA; NR1C1; NR1C2; NR1C3; NR1F1; NR1F2; NR1F3; NR2B1; NR2B2; NR2B3; NR5A1; NR1I2; NR1H3; NR2F1; NR2F2; NR6A1; NR4A1; NR2E3;NR1D1; NR1D2; NR2E1; NR2C1; NR2C2; NR4A1; NR4A2.

[0049] The target nucleic acid may be selected for the isolated nucleic acid construct as follows: (a) wherein the target nucleic acid is associated with chemotherapy resistance, the target nucleic acid may be selected from one or more of the following: TS; DPD; DHFR; CDA; ABCB; 1MRP1; MRP2; ABCG2; CFTR; ABCG5; ABCG8; and MGMT; (b) wherein the target nucleic acid is a proto-oncogene or associated with cell cycle, the target nucleic acid may be selected from one or more of the following: MAD2; WEE1; PLK1; CDK4; CDK6; CDK16; AURKA; AURKB; CHK1; Kifll; CDK1; CSN5; RAN; CCND1; SOX2; E2F1; E2F3; E2F5; E2F6; E2F7; E2F8; NFKB1; NFKB2; RUNX1; HIF1A; and EPAS1; (c) wherein the target nucleic acid is an oncogene, the target nucleic acid may be selected from one or more of the following: RET; BCL2L12; JAK2; BCL-2; FOS; BCL-XL; MDM2; MCL-1; KIT; Survivin; NOTCH1; MDM2; PDGFRA; XIAP; NTRK1; EGFR; NTRK2; MET; NTRK3; HER2; FGFR1; PIK3CA; FGFR2; ALK; FGFR3; SRC; FGFR4; ROS1; AKT1; AKT2; AKT3; Survivin; FGR; FLT3; MUC1; MYBL2; CTNNB1; TWIST1; XIAP; TWIST2; C-MYC; STAT3; and N-MYC; (d) wherein the target nucleic acid is an anti-apoptotic regulator, the target nucleic acid may be selected from one or more of the following: BCL2L12; BCL-2; BCL-XL; MCL-1; Survivin; MDM2; and XIAP; (e) wherein the target nucleic acid is associated with metastasis, the target nucleic acid may be selected from one or more of the following: SRPK1; PKN3; NR2F1; RhoC; F0XM1; Rac1; PDK1; KRAS; CD44; NRAS; PTPN22; HRAS; STAT3; PLK1; STAT4; TSG6; STAT6; VEGFA; MET; VEGFB; KIF2A; VEGFC; KIF2B; VEGFD; KIF3A; CXCR4; KIF3B; ALK; KIF5A; TGF-β1; KIF5B; PAR2; KIF5C; MEGF6; KIF7; MOK; KIF11; HIF1A; KIF15; EPAS1; KIFC1; NFKB1; GSTP1; NFKB2; GRB7; and DKK1; (f) wherein the target nucleic acid is associated with immune evasion, the target nucleic acid may be selected from one or more of the following: PD-1; PD-L1; CTLA-4; CXCR4; FASLG; FOXP3; and GPRC5B; (g) wherein the target nucleic acid is associated with DNA synthesis and repair, the target nucleic acid may be selected from one or more of the following: RRM1; RRM2; TK1; PARP1; PCNA; POLQ; ATM; and ATR; and (h) wherein the target nucleic acid is associated with metabolism, the target nucleic acid may be selected from one or more of the following: IDH1; IDH2; LDHA; PKM2; mTOR; GLUT1; GLUT3; GLUT4; andHSPEl.

[0050] The TFRE may be responsive to a transcription factor selected from one or more of the following: (a) wherein the TFRE is operable to bind a transcription factor and the transcription factor is a cancer associated transcription factor may be selected from one or more of the following: AP-1; AP-2; MYC; MAX; NFKB1; NFKB2; RELA1; RELB; REL;STAT3; STAT5A; STAT5B; STAT6; GATA2; GATA3; GATA4; GATA6; TP63; TP73; S0X2; S0X3; S0X4; S0X5; S0X6; S0X8; S0X9; SOXIO; SOX11; SOX12; SOX13; SOX15; SOX18; TRPS1; GLI; NFAT1; NFAT2; NFAT4; NFAT5; EWS:: FLI1; FLU; ETS1; ETS2; ERG; ELF1; ELF2; ELF3; ETV1; ETV4; ETV5; ETV6; TMPRSS2:: ETV1; PU.l; ELK1; ELK4; FOXM1; HES1; HES6; YAP; NKX2-1; NKX2-2; OCTI; OCT2; OCT3; RUNX1; E2F1; FOXQ1; TFEB; SRY; LEF1; SRF; JUN; FOS; BATF:: JUN; GABPA; KLF8; SIX1; RUNX2; RARA:: RXRA; TAL1; GATA1:: TAL1; TAL1:: TCF3; FOXA1; HIF1A; EPAS1; TBX1; and TBX2; (b) wherein the TFRE is operable to bind a transcription factor and the transcription factor is an orphan receptor transcription factor may be selected from one or more of the following: NR2F1; NR2F2; NR6A1; NR4A1; NR2E3; NR1D1; NR1D2; NR2E1; NR2C1; NR2C2; NR4A1; and NR4A2; (c) wherein the TFRE is operable to bind a transcription factor and the transcription factor is an immune cell differentiation or immune associated transcription factor maybe selected from one or more of the following: IRF1; IRF3; IRF4; IRF5; IRF7; IRF8; STAT1; STAT2; STAT3; STAT4; STAT5A; STAT5B; STAT6;STAT1:: STAT2; FOXP3; RORA; RORB; RORC; TCF3; TAL1:: TCF3; TCF4; TCF7; TCF7L1; TCF7L2; LEF1; TBX21; TBX3; TBX5; HES1; HES5; BATF; PAX5; MEF2C; SPIB; BCL6; MEF2B; E2F1; FOXO1; FOXO3; BACH2; BLIMP1; XBP1; MIZ1; BCL6; HHEX; GATA1; GATA2; GATA3; IKZF1; IKZF2; IKZF3; TEAD1; TEAD2; BCL11B; SATB1; NFIL3; NFATC1; NFATC2; NFATC3; and NFATC4; (d) wherein the TFRE is operable to bind a transcription factor and the transcription factor an endocrine associated transcription factor maybe selected from one or more of the following: AR; ESRI; ESR2; RARA; RARB; RARG; THRA; THRB; PGR; VDR; NR3C1; and NR3C2; (e) wherein the TFRE is operable to bind a transcription factor and the transcription factor an adopted orphan receptor associated transcription factor may be selected from one or more of the following: NR1I3; NR3B1; NR3B2; NR3B3; NR1H4; HNF4A; PPARA:: RXRA; NR1C1; NR1C2; NR1C3; NR1F1; NR1F2; NR1F3; NR2B1; NR2B2; NR2B3; NR5A1; NR1I2; and NR1H3; (f) wherein the TFRE is operable to bind a transcription factor and the transcription factor a mitotic bookmarking transcription factor may be selected from one or more of the following: NF-YA; NF-YC; NRF1; NF-YB; Sp2; and F0XA1.

[0051] The TNM classification is selected from the following: T is selected from one of Tx, Tis, TO, Tl, T2, T3, and T4; N is selected from one of Nx, NO, Nl, N2, and N3; and M is selected from one of MO or Ml.BRIEF DESCRIPTION OF THE DRAWINGS

[0052] FIGURE 1 shows eukaryotic RNA polymerases and transcription of miRNA and shRNA, wherein A. shows a schematic of Pol III and Pol II transcription. Pol III contains defined transcriptional start and termination sites, while Pol II is more variable and tightly regulated; and B. shows a schematic of RNAi, where Pol II transcribes pri-miRNAs, which are processed and exported out of the nucleus to carry out their function of transcriptional repression, mRNA degradation, or mRNA cleavage, and where Pol III can transcribe functional shRNA, driven off a U6 promoter on a synthetic plasmid that is introduced into cells. The shRNA is then exported out of the nucleus and processed prior to cleaving target mRNA.

[0053] FIGURE 2 shows schematics of isolated nucleic acid constructs having an amiRNA expression cassette and a promoter-enhancer region. Three schematics are shown schematic of isolated nucleic acid constructs with an miRNA expression cassette, driven by a Pol II promoter that drives transcription of an mCherry™ fluorescent protein reporter and one or multiple artificial miRNAs (amiRNAs) in an amiRNA expression cassette, as well as a polyA signal to ensure mRNA tailing, and a transcriptional pause site placed before the Pol II promoter to reduce background nonspecific transcription. The second schematic shows an NFKB expression cassette that was used in some examples, consisting of NFKB response elements (TFRE) and minimal promoter to drive transcription of mCherry™ and miRNAs targeting GFP, GAPDH, PLK1. The third schematic shows a promoter-enhancer region control where the TFRE expression cassette has the TFRE element deleted and only contains a minimal promoter (MinP).

[0054] FIGURE 3 shows amplicon-based NFKB response element constructs have minimal background amiR-GFP mediated knockdown in deletion control condition. 293T-GFP cells were transfected with the indicated NFKB response element (RE) or RE deletion (RE DEL) miRNA constructs in the form of (A.) plasmids, (B.) linearized plasmids, produced by digesting with BstBi, or (C.) amplicons with plasmid backbones removed, produced by PCR-based amplification of the Pause-NFKB-mCherry™-miRNA-BGH region. 6 hours post transfection, cells were stimulated with TNFa (10 ng / mL). Green (GFP) fluorescence intensity and Red (mCherry™) fluorescence was monitored for 72h using the Incucyte S3™ system. Tiles in (A., B., and C.) are representative images taken 72h post transfection of both the red (mCherry™) and green (GFP)channels. Bar graphs on the right panels are mean ±SD of green integrated intensity / well normalized to cell confluence per well at 72 post transfection. Stats are Student's t tests, * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001.

[0055] FIGURE 4 shows a NFKB RE amiRNA construct in plasmid, amplicon (without plasmid backbone i.e. just the pause site, promoter, mCherry™, amiRNA, and polyA signal), and mini-circle forms, designed to target endogenous protein GAPDH, where 293T cells were transfected with the indicated NFKB RE or RE deletion (RE DEL) amiRNA constructs in the form of (A.) plasmids, (B.) amplicons, or (C.) mini-circles. Constructs in (C.) do not contain the mCherry™ fluorescent protein and thus fluorescence was not measured. 6 hours post transfection, cells in (A.-C.) were stimulated with TNFa (10 ng / mL). For (A-B), Red (mCherry™) fluorescence was monitored for 72h using the Incucyte S3™ system and tiles are representative images taken 72h post transfection. For (A.-C.), RNA was collected 72h post transfection and gene expression assessed by RT-qPCR, where the bar graphs are gene expression of GAPDH as measured by qPCR, expressed as 2 (AACt) values, compared to endogenous control 18S and normalized to the amiR-CNTRL (Stats are Student's t tests, * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001).

[0056] FIGURE 5 shows amplicons of promoter amiRNA constructs acting in concentration dependent manner, where 293T cells were transfected with the NFKB RE amiR-GAPDH or RE DEL miR-GAPDH amplicon over a range of doses from 50-300ng followed by treatment with vehicle or TNFa (10 ng / mL). mCherry™ fluorescence was monitored and imaged for 72h using the Incucyte S3™ system. RNA was collected 72h post transfection and gene expression assessed by RT-qPCR. Bar graph shows mCherry™ mean fluorescence intensity (MFI) (lefty-axis) and gene expression of GAPDH (righty-axis) as measured by qPCR, expressed as 2 (AACt) values, compared to endogenous control 18S and normalized to the RE DEL miR-GAPDH amplicon for each condition. Results are mean ±SD.

[0057] FIGURE 6 shows NFKB response element amplicons with amiRNA targeting endogenous GAPDH, where 293T cells were transfected with the indicated amplicon constructs - NFKB response element (RE) miR-CNTRL, NFKB RE miR-GAPDH, or NFKB Deletion (DEL) miR-GAPDH, and 6 hours post transfection, cells were stimulated with Vehicle, TNFa (10 ng / mL), or TNFa (10 ng / mL) and the NFKB inhibitor TPCA1 (1 pM).24 hours post transfection, media was changed and replaced with fresh mediacontaining the indicated compounds. (A.) 72 hours post transfection, phase and mCherry™ fluorescence were imaged with the Incucyte S3™ system. Bar graphs are mean ±SD of mCherry™ (red) integrated intensity / image and are expressed on a loglO scale. (B.) 72 hours post transfection, RNA was collected and gene expression assessed by RT-qPCR. Results are mean ±SD and are expressed as 2_CAAC0 values, compared to endogenous control 18S and normalized to the amiR-CNTRL amplicon for each condition (Stats for (A.) and (B.) are Student's t tests, * p<0.05, ** p<0.01, *** p<0.001, **** p<o. OOOl. (C.) 72 hours post transfection, protein was collected and protein levels assessed with the Wes Simple Western automated capillary western blot system using anti-GAPDH and anti-ACTIN primary antibodies).

[0058] FIGURE 7 shows TNFa-induced Caspase-3 cleavage mediated through actions of NFKB RE amiRNA amplicon targeting protein and proto-oncogene PLK1, where following development of NFKB RE amiRNA amplicon to suppress PLK1 gene expression (NFKB RE amiR-PLKl), 293T cells were transfected with control, promoter deletion and test amplicons followed by treatment with vehicle, TNFa (10 ng / mL), or TNFa (10 ng / mL) and TPCA1 (1 pM). (A.) qPCR data of PLK1 mRNA levels by in 293T cells 24 hours post transfection and treatments. Results are mean ±SD and are expressed as 2_(AAtt) values, compared to endogenous control 18S and normalized to vehicle treated NFKB RE amiR-CNTRL transfected cells. Stats are Student's t tests, * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001. (B.) 24h post transfection, Incucyte GFP™ (green) caspase 3 / 7 dye was added to the cells to measure cell apoptosis, and green fluorescence was measured over time with the Incucyte S3™ system. Total green area for each condition was determined using the Incucyte S3™ analysis software. Graphs are mean ±SEM with a focused graph (C.) showing only NFKB RE amiR-CNTRL, NFKB RE amiR-PLKl and RE DEL amiR-PLKl following TNFa treatment.

[0059] FIGURE 8 shows STAT3 TF driven Oncostatin M (OSM) responsive promoter can similarly drive amiRNA production, wherein amplicons similar to those above were created with a STAT3 RE promoter (STAT3 RE miR- CNTRL, STAT3 RE miR-GAPDH) and as before, 293T cells were transfected with STAT3 RE miR-CNTRL, STAT3 RE miR-GAPDH, and RE DEL miR-GAPDH amplicons prior to treatment with vehicle, OSM (10 ng / mL) or OSM (10 ng / mL) plus the STAT inhibitor Ruxolitinib™ (1 pM). 72h post transfection, mCherry™ (Red) reporter output was measured by imaging-based fluorescence analysis (A.) and GAPDH mRNA levels measured by qPCR (B.) Results aremean ±SD. qPCR results (B.) are expressed as 24AACt) values, compared to endogenous control 18S and normalized to STAT3 RE miR-CNTRL transfected cells for each treatment condition. Stats are Student's t tests, * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001.

[0060] FIGURE 9 shows STAT3 RE miR-GAPDH amplicon constructs acting in concentration dependent manner, where 293T cells were transfected with the STAT3 RE miR-GAPDH amplicon over a range of doses from 25-400ng followed by treatment with vehicle (data not shown) or OSM (10 ng / mL). mCherry™ fluorescence was monitored and imaged for 72h using the Incucyte S3™ system. RNA was collected 72h post transfection and gene expression assessed by RT-qPCR. Bar graph shows mCherry™ mean fluorescence intensity (MFI) (lefty-axis) and gene expression of GAPDH (righty-axis) as measured by qPCR, expressed as 24AACt) values, compared to endogenous control 18S and normalized to vehicle treated STAT3 RE miR-GAPDH that was transfected at 25 ng (results are mean ±SD).

[0061] FIGURE 10 shows OSM responsive and STAT3 -driven amiRNA targeting PLK1 results in an activatable Caspase-3 / 7 cleavage (A.), wherein after development of STAT3 RE miRNA amplicon to suppress PLK1 gene expression (STAT3 RE amiR-PLKl), 293T cells were transfected with control, promoter deletion and test amplicons followed by treatment with vehicle, OSM (10 ng / mL), or OSM (10 ng / mL) and Ruxolitinib™ (1 pM), and 24h post transfection, Incucyte GFP™ (green) caspase 3 / 7 dye was added to the cells to measure cell apoptosis, and green fluorescence intensity was measured over time with the Incucyte S3™ system. Total green area for each condition was determined using the Incucyte S3™ analysis software. Results are mean ±SEM. (B.) Focused graph of (A.) showing only STAT3 RE amiR-CNTRL, STAT3 RE miR-PLKl and RE DEL miR-PLKl following OSM treatment.

[0062] FIGURE 11 shows the specificity of action of TNFa- or OSM- driven RE amiRNAs, wherein cross treatment experiments of cytokine-driven control of miRNA production were conducted, testing TNFa (10 ng / mL) treatment of STAT3 RE amiR-GAPDH and OSM (10 ng / mL) treatment of NFKB RE amiR-GAPDH transfected 293T cells. As in preceding experiments, cells were transfected with the test amplicons NFKB RE miR-GAPDH and STAT3 RE miR-GAPDH, control amplicons (CNTRL) and promoter deletion amplicons RE DEL miR GAPDH followed by exposure to either cytokine. 72h post transfection, mCherry™ (red) fluorescent reporter protein was measured (A.) andGAPDH mRNA expression (B.) was examined by qPCR (Results are mean ±SD and qPCR results in (B.) are expressed as 24AACtl values, compared to endogenous control 18S and normalized to Vehicle for each combination of amplicon. Stats are Student's t tests, * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001).

[0063] FIGURE 12 shows amplicon-miRNA constructs created using the gene promoters of genes enhanced or somatically variable in cancers, wherein the hTERT / TERT gene is common amplified in over 97% of gastrointestinal cancers and 60% of all cancers leading to its significant overexpression. Cancer cells of epithelial origin also commonly express higher levels of stem cell markers of the CEACAM family gene (CECAM5 or hCEA). Thus miRNA amplicon constructs driven by the promoters of both hTERT and hCEA were created and tested for their ability to drive mCherry™ (Red) fluorescent reporter protein production (A.), and (B.) GAPDH mRNAs as in previous experiments. Results are mean ±SD and stats are Student's t tests, * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001. qPCR results in (B.) are expressed as 2 (AACt) values, compared to endogenous control 18S and normalized to Prom miR- CNTRL.

[0064] FIGURE 13 shows TERT gene promoter-driven miRNA targeting PLK1 induces Casapse-3 cleavage, wherein qPCR (A.) and Caspase-3 / 7 cleavage levels (B.) following transfection of 293T cells with TERT promoter-driven amplicons targeting PLK1 (Tert Prom amiR-PLKl), control sequence (Tert Prom amiR-CNTRL) and promoter deleted (Prom DEL amiR-PLKl), and (A.) mRNA was collected 72h post transfection and GAPDH mRNA was measured by qPCR. Results are mean ±SD and expressed as 2 (AACt) values, compared to endogenous control 18S and normalized to Tert Prom amiR-CNTRL. Stats are Student's t tests, * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001. (B.) 24h post transfection, Incucyte GFP™ (green) caspase 3 / 7 dye was added to the cells to measure cell apoptosis, and green fluorescence intensity was measured over time with the Incucyte S3™ system. Total green area for each condition was determined using the Incucyte S3™ analysis software. Results are mean ±SEM.

[0065] FIGURE 14 shows that concatenated amiRNAs (miR-GAPDH and miR-PLKl) driven by the Tert promoter (Tert Prom) efficiently knockdown their respective mRNA target. 293T cells were transfected with: 200ng of Tert Prom miR-CNTRL, Tert Prom miR-GAPDH, Tert Prom miR-PLKl, Tert Prom miR-PLKl-miR-Gapdh concatenated, and Tert Prom miR-Gapdh-miR-PLKl concatenated, as well as 100 ng each of Tert Prom miR-PLKl & hTert miR-Gapdh co-transfected. RNA was collected 72h post transfectionand gene expression of GAPDH (left x-axis) and PLK1 (right x-axis) assessed by RT-qPCR. Results are mean ±SD and are expressed as 24AACtl values, compared to endogenous control 18S and normalized to the miR-CNTRL amplicon. Stats are student's t tests compared to miR-CNTRL amplicon, * p<0.05, ** p<0.01, *** p<0.001, ****p<0.0001.

[0066] FIGURE 15 shows the inducibility of the amiRNA, driven by the Tert Promoter (A) and STAT3 TF driven Oncostatin M (OSM) responsive promoter (B) where 293T cells were transfected with the indicated amplicons and treated with vehicle or OSM (10 ng / mL) in (B). RNA was collected 72h post transfection processed and mature amiRNA targeting GAPDH was detected by stem-loop reverse transcription-quantitative PCR (RT-qPCR) using TaqMan™ small RNA assays. Results are expressed as 2 -(AACt) values, compared to RNU24 miRNA control and normalized to Tert Prom miR-GAPDH in (A) or STAT3 RE miR-GAPDH OSM treated in (B). Data are represented as mean ± [SD] and stats are Student's t tests, * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001.

[0067] FIGURE 16 shows knockdown of exemplar amiRNAs in human esophageal adenocarcinoma FLO-1 cells, where FLO-1 cells were transfected with plasmids containing the ubiquitous CMV promoter driving expression of amiRNAs targeting (A) GRB7, (B) GPRC5B, (C) TRPS1, (D) CDK6, and (E) DKK1. For (A.-E.), RNA was collected 72h post transfection and gene expression assessed by RT-qPCR, where the bar graphs are gene expression of (A) GRB7, (B) GPRC5B, (C) TRPS1, (D) CDK6, or (E) DKK1, as measured by qPCR, expressed as 2 -(AACt) values, compared to endogenous control 18S and normalized to miR-CNTRL for each condition. Data are represented as mean ± [SD] and stats are Student's t tests, * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001.

[0068] FIGURE 17 shows promoter activity of exemplar esophageal cancer-enhanced promoters in two esophageal cancer cell lines. FLO-1 (A) or SKGT4 (B) cells were transfected with plasmids containing the indicated promoters (Gata6 promoter, MMP1 promoter, CEA promoter, NFKB RE, or STAT3 RE) driving the expression of mCherry and a CNTRL amiRNA. Cells transfected with the plasmid containing the NFKB RE were stimulated with TNFa (10 ng / mL) and cells transfected with the plasmid containing STAT3 RE were stimulated with OSM (10 ng / mL). 72h post transfection, mCherry™ (Red) reporter output was measured by imaging-based fluorescence analysis using the Incucyte S3™ system, images analyzed using associated software, and expressed as redintegrated intensity / image. Results are mean ± [SD] and stats are Student's t tests comparing each promoter condition to untransfected cells, * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001.DETAILED DESCRIPTION

[0069] The following detailed description will be better understood when read in conjunction with the appended figures. For the purpose of illustrating the invention, the figures demonstrate embodiments of the present invention. However, the invention is not limited to the precise arrangements, examples, and instrumentalities shown.

[0070] Any terms not directly defined herein shall be understood to have the meanings commonly associated with them as understood within the art of the invention.

[0071] As used herein the terms "artificial microRNA” or "amiRNA” (but also miRNA or miR) refer to small RNA molecules that may be designed to silence desired endogenous genes, or reduce the expression of particular endogenous genes. The use of amiRNAs has advantages over alternative RNA-mediated silencing methods in terms of specificity and stability. amiRNAs may be designed to silence a single gene or multiple related genes, or to silence multiple non-related genes simultaneously. Furthermore, more than one amiRNA may be designed to target the same gene. Also, amiRNA expression is quantitative and allows for the use of constitutive, inducible, or tissuespecific promoters. The amiRNAs as described herein may form part of an amiRNA expression cassette.

[0072] As used herein the terms "amiRNA expression cassette” or "amiRNA” refer to a "5’ amiRNA flanking sequence”, a "3’ amiRNA flanking sequence”, a hairpin sequence, wherein the hairpin sequence is positioned between the 5’ amiRNA flanking sequence and the 3’ amiRNA flanking sequence, and wherein the hairpin sequence includes a terminal loop and two stem regions (i.e. a stem duplex), whereby one of the stem regions encodes a functional guide sequence.

[0073] As used herein the term "functional guide sequence” refers to a portion of the designed amiRNA stem duplex that, after being processed from its primary transcript, is capable of reducing the expression of a target nucleic acid. Typically, the "functional guide sequence” undergoes processing (for example, as shown in FIG. 1), whereby the isolated nucleic acid construct is transcribed to form a pri-amiRNA, which may be cleaved to form the pre-amiRNA, and then further cytoplasmic processing to produce the "functional guide sequence”, which can incorporate into the RNA-induced silencing complex (RISC) and direct RISC to complementary target mRNAs for silencing.

[0074] As used herein the terms "5’ amiRNA flanking sequence”, "5’ amiR”, or "5’ miR” and "3’ amiRNA flanking sequence”, "3’ amiR”, or "3’ miR” (for example, see FIG.2 - 5’ miR-155 and 3’ miR-155) refer to DNA flanking sequences residing at the 5’ and 3’ ends of an "amiRNA expression cassette”, which undergoes transcription into a "pri-amiRNA”, which is processed to form the preliminary artificial miRNA (pre-amiRNA), consisting of a hairpin sequence (i.e. terminal loop with two stem regions (stem duplex)) that shuttles into the endogenous miRNA pathway. The 5’ amiRNA flanking sequence and the 3’ amiRNA flanking sequence may be selected from: mmu-miR-155; hsa-miR-155; hsa-miR-30a; hsa-miR-451; hsa-miR-33; hsa-miR-31; hsa-miR-122; hsa-miR-223; miR-30; miR-E; miR-AB; miR-N; miR-S; and miR-GE (see TABLE A).

[0075] TABLE A: Exemplary hairpin sequences and 5' amiRNA flanking sequence / 3' amiRNA flanking sequence sequencesSEQ ID NAME SEQUENCE (Stem = N and Loop region)NO:1 mmu-miR- ctggaggcttgctgaaggctgtatgctgNNNNNNNNNNNNNNNNNN 155 full NNNGTTTTGGCCACTGACTGACNNNNNNNNNNNNNNNNNNNcagga sequence cacaaggcctgttactagcactcacatggaacaaatggcc 2 mmu-miR-155 ctggaggcttgctgaaggctgtatgctg5 ' flank3 mmu-miR-155 caggacacaaggcctgttactagcactcacatggaacaaatggcc 3 ' flank4 CTGAAGGCTTGCTGTAGGCTGTATGCTGNNNNNNNNNNNNNNNNNN hsa-miR-155 NNNGT T T T GGCCACT GACT GACNNNNNNNNNNNNNNNNNNNCAGT G full sequence TATGATGCCTGTTACTAGCATAGCATTCACATGGAACAAATTGC 5 hsa-miR-155 CTGAAGGCTTGCTGTAGGCTGTATGCTG5 ' flank6 hsa-miR-155 CAGT GT AT GAT GCCT GT TACT AGCAT AGCAT T CACAT GGAACAAAT 3 ' flank TGC7 T GT T T GAAT GAGGCT T CAGT ACT T T ACAGAAT CGT T GCCT GCACAT CTTGGAAACACTTGCTGGGATTACTTCTTCAGGTTAACCCAACAGA AGGCTAAAGAAGGTATATTGCTGTTGACAGTGAGCGNNNNNNNNNN NNNNNNNNNNNNTAGTGAAGCCACAGATGTANNNNNNNNNNNNNNN NNNNNNNTGCCTACTGCCTCGGACTTCAAGGGGCTACTTTAGGAGChsa-miR-30a AATTATCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGATA full sequence CAT T T T T AC AAAGC T GAAT T AAAAT GGT AT AAAT T AAAT C AC T T TT GT T T GAAT GAGGCT T CAGT ACT T T ACAGAAT CGT T GCCT GCACAT hsa-miR-30a CTTGGAAACACTTGCTGGGATTACTTCTTCAGGTTAACCCAACAGA 5 ' flank AGGCTAAAGAAGGTATATTGCTGTTGACAGTGAGCG TGCCTACTGCCTCGGACTTCAAGGGGCTACTTTAGGAGCAATTATChsa-miR-30a TTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGATACATTTTT 3 ' flank ACAAAGC T GAAT T AAAAT GGT AT AAAT T AAAT GAG T T T AGATCTTACTGACTGCCAGGGCACTTGGGAATGGCAAGGNNNNNNNhsa-miR-451 NNNNNNNNNNNAGTTNNNNNNNNNNNNNNNNNNTCTTGCTATACCC full sequence AGAAAACGTGCCTTTTTGGTACCAAGCTThsa-miR-451 AGATCTTACTGACTGCCAGGGCACTTGGGAATGGCAAGG5 ' flankhsa-miR-451 TCTTGCTATACCCAGAAAACGTGCCTTTTTGGTACCAAGCTT 3 ' flankAGGGCTCTGCGTTTGCTCCAGGTAGTCCGCTGCTCCCTTGGGCCTG GGCCCACTGACAGCCCTGGTGCCTCTGGCCGGCTGCACACCTCCTG GCGGGCAGCTGTGNNNNNNNNNNNNNNNNNNNNNTGTTCTGGCAAT ACCTGNNNNNNNNNNNNNNNNNNNNNCACGGAGGCCTGCCCTGACTmmu-miR-33 GCCCACGGTGCCGTGGCCAAAGAGGATCTAAGGGCACCGCTGAGGG full sequence CCTACCTAACCATCGTGGGGAATAAGGACAGTGTCACCC AGGGCTCTGCGTTTGCTCCAGGTAGTCCGCTGCTCCCTTGGGCCTGmmu-miR-33 5 ' GGCCCACTGACAGCCCTGGTGCCTCTGGCCGGCTGCACACCTCCTG flank GCGGGCAGCTGTG CACGGAGGCCTGCCCTGACTGCCCACGGTGCCGTGGCCAAAGAGGAmmu-miR-33 3 ' TCTAAGGGCACCGCTGAGGGCCTACCTAACCATCGTGGGGAATAAG flank GACAGTGTCACCC CATAACAACGAAGAGGGATGGTATTGCTCCTGTAACTCGGAACTGG AGAGGNNNNNNNNNNNNNNNNNNNNT GT T GAACT GAGAACCTNNNNmmu-miR-31 NNNNNNNNNNNNNNNNNNTTTCCTGTCTGACAGCAGCTTGGCTACC full sequence TCCGTCCTGTTCCTCCTTGTCTTmmu-miR-31 5 ' CATAACAACGAAGAGGGATGGTATTGCTCCTGTAACTCGGAACTGG flank AGAGGmmu-miR-31 3 ' TTTCCTGTCTGACAGCAGCTTGGCTACCTCCGTCCTGTTCCTCCTT flank GTCTT TGGAGGTGAAGTTAACACCTTCGTGGCTACAGAGTTTCCTTAGCAG AGCTGNNNNNNNNNNNNNNNNNNNNNNNGTCTAAACTATCAANNNNhsa-miR-122 NNNNNNNNNNNNNNNNNGCTACTGCTAGGCAATCCTTCCCTCGATA full sequence AATGTCTTGGCATCGTTTGCTThsa-miR-122 TGGAGGTGAAGTTAACACCTTCGTGGCTACAGAGTTTCCTTAGCAG 5 ' flank AGCTGhsa-miR-122 GCTACTGCTAGGCAATCCTTCCCTCGATAAATGTCTTGGCATCGTT 3 ' flank TGCTT TCTCACTTCCCCACAGAAGCTCTTGGCCTGGCCTCCTGCAGTGCCA CGCTCNNNNNNNNNNNNNNNNNNNNNNGGACACTCCATGTGGTAGAhsa-miR-223 GNNNNNNNNNNNNNNNNNNNNNNAGTGCGGCACATGCTTACCAGCT full sequence CTAGGCCAGGGCAGATGGGATATGACGAhsa-miR-223 TCTCACTTCCCCACAGAAGCTCTTGGCCTGGCCTCCTGCAGTGCCA 5 ' flank CGCTChsa-miR-223 AGTGCGGCACATGCTTACCAGCTCTAGGCCAGGGCAGATGGGATAT 3 ' flank GAG GAT GT T T GAAT GAGGCT T CAGT ACT T T ACAGAAT CGT T GCCT GCACAT CTTGGAAACACTTGCTGGGATTACTTCGACTTCTTAACCCAACAGA AGGCTCGAGAAGGTATATTGCTGTTGACAGTGAGCGNNNNNNNNNN NNNNNNNNNNNNTAGTGAAGCCACAGATGTANNNNNNNNNNNNNNN NNNNNNNTGCCTACTGCCTCGGACTTCAAGGGGCTAGAATTCGAGCmiR-E full AATTATCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGATA sequence CAT T T T T AC AAAGC T GAAT T AAAAT GGT AT AAAT T AAAT C AC T T T T GT T T GAAT GAGGCT T CAGT ACT T T ACAGAAT CGT T GCCT GCACATmiR-E 5 ' CTTGGAAACACTTGCTGGGATTACTTCGACTTCTTAACCCAACAGA flank AGGCTCGAGAAGGTATATTGCTGTTGACAGTGAGCG TGCCTACTGCCTCGGACTTCAAGGGGCTAGAATTCGAGCAATTATCmiR-E 3 ' TTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGATACATTTTT flank ACAAAGC T GAAT T AAAAT GGT AT AAAT T AAAT CAC T T T CTCGAGAAGGTATATTGCTGTTGACAGGATCCGNNNNNNNNNNNNNmiR-AB full NNNNNNNNNTAGTGAAGCCACAGATGTANNNNNNNNNNNNNNNNNN sequence NNNNTGGGCCCTGCCTCGGACTTCAAGGGGCTAGAATTC miR-AB 5 ' CTCGAGAAGGTATATTGCTGTTGACAGGATCCGflankmiR-AB 3 ' TGGGCCCTGCCTCGGACTTCAAGGGGCTAGAATTCflankGGTGATAGCAATGTCAGCAGTGCCTNNNNNNNNNNNNNNNNNNNNNmiR-GE full NGTGAAGCCACAGATGNNNNNNNNNNNNNNNNNNNNNNAAGTAAGG sequence TTGACCATACTCTACmiR-GE 5 ' GGTGATAGCAATGTCAGCAGTGCCTflank33 miR-GE 3 ' AAGTAAGGTTGACCATACTCTACflank

[0076] As used herein the term "promoter” refers to a DNA sequence that contains, or is 5’ to or upstream from a transcription start site, and where proteins bind to initiate the specific transcription of a polynucleotide sequence. Specifically, as used herein a "promoter” is operably linked with the sequence encoding the amiRNA; or to both a DNA sequence that is operably linked with the sequence encoding the amiRNA and operably linked to a transcription factor response element to facilitate transcription of the amiRNA. As used herein, the term "promoter” is meant to encompass a regulatory nucleic acid sequence that drives specific transcription of a polynucleotide sequence. In some instances, this sequence may be just a promoter sequence and in other instances, this sequence may also include an enhancer sequence and / or other regulatory elements to initiate the specific transcription of a polynucleotide sequence. The promoters as described herein may form part of a promoter-enhancer region. Exemplary promoter sequences may be found in TABLE B.

[0077] TABLE B: Exemplary PromotersSEQ NAME SEQUENCE ID NO:34 Carcinoembryonic Antigen-Related Cell Adhesion (SEQ ID NO: 34 ) Molecule 5 (CEA)Telomerase Reverse Transcriptase (TERT) (SEQ ID NO: 35 ) 36 Cyclooxygenase-2 (COX-2) (prostaglandin(SEQ ID NO: 36) endoperoxide synthase 2)37C-X-C Motif Chemokine Receptor 4 (CXCR4) (SEQ ID NO: 37 ) 38 Survivin also known as Baculoviral IAP Repeat (SEQ ID NO: 38 ) Containing 5 (BIRC5 )39Mucin 1 (MUC-1 ) (SEQ ID NO: 34 ) Erb-B2 Receptor Tyrosine Kinase 2 (ERBB2 ) (SEQ ID NO: 40 ) Paternally Expressed 3 (PEG-3) (SEQ ID NO: 41 ) Transcription Termination Factor 1 (TTF-1 ) (SEQ ID NO: 42 ) RAD51 Recombinase (RAD51 ) (SEQ ID NO: 43)Cholecystokinin A Receptor ( CCKAR) ( SEQ ID NO: 44 ) Heat Shock Protein Family A Member 5 (HSPA5 ) ( SEQ ID NO: 45 ) Hexokinase 2 (HK2 ) ( SEQ ID NO: 46 ) Stomatin-Like Protein 1 ( SLP- 1 ) ( SEQ ID NO: 47 ) X-Ray Repair Cross Complementing 2 (XRCC2 )k' Epidermal Growth Factor Receptor ( EGFR) ( SEQ ID NO. 49 ) Vascular Endothelial Growth Factor Receptor 1 ( SEQ ID NO: 50 ) (VEGFR1 )VEGFR2 ( KDR) ( SEQ ID NO: 51 ) VEGFR3 ( FLT4 ) ( SEQ ID NO: 52 ) Trans ferrin receptor ( CD71 ) ( SEQ ID NO: 53 ) Alpha Fetoprotein (AFP ) ( SEQ ID NO: 54 ) AFP promoter variant ( EA4D) ( SEQ ID NO: 55 ) E2 F Transcription Factor 1 ( E2 F1 ) ( SEQ ID NO: 56 ) Prominin 1 ( PROMT ) ( SEQ ID NO: 57 ) Glypican 3 ( GPC3 ) ( SEQ ID NO: 58 ) Lactalbumin Alpha ( LALBA) ( SEQ ID NO: 59 ) Urokinase-type Plasminogen Activator Receptor ( SEQ ID NO: 60 ) ( PLAUR)Fibroblast Growth Factor 18 ( FGF18 ) ( SEQ ID NO: 61 ) Human Epididymis Protein 4 (HE4 ) ( SEQ ID NO: 62 ) Glycoprotein A33 (A33 ) ( SEQ ID NO: 63 ) Metadherin (MTDH) ( SEQ ID NO: 64 ) Cysteine Rich Angiogenic Inducer 61 ( CYR61 ) ( SEQ ID NO: 65 ) Protein Regulator of Cytokines is 1 ( PRC1 ) ( SEQ ID NO: 66 ) Ribonucleos ide-Diphosphate Reductase Subunit ( SEQ ID NO: 67 ) M2 ( RRM2 )Breakpoint Cluster Reg ion ( BCR) ( SEQ ID NO: 68 )ETS Variant Transcription Factor 6 ( ETV6 ) ( SEQ ID NO: 69 ) Paired Box 5 ( PAX5 ) ( SEQ ID NO: 70 ) Bcl-2 -related gene x, long isoform ( BCL-XL ) ( SEQ ID NO: 71 ) Myeloid cell leukemia- 1 (MCL1 ) ( SEQ ID NO: 72 ) HRAS Proto-Oncogene, GTPase (HRAS ) ( SEQ ID NO: 73 ) NRAS Proto-Oncogene, GTPase (NRAS ) (SEQ ID NO: 74 ) KRAS Proto-Oncogene, GTPase ( KRAS ) ( SEQ ID NO: 75 ) RELA Proto-Oncogene NF-KB Subunit ( RELA) (SEQ ID NO: 76) Aurora Kinase A (AURKA) ( SEQ ID NO: 77 ) cyclin D1 ( CCND1 ) ( SEQ ID NO: 78 ) RAD50 Double Strand Break Repair Protein ( SEQ ID NO: 79 ) (RAD50 )B-Raf Proto-Oncogene - Serine / Threonine Kinase ( SEQ ID NO: 80 ) (BRAF)pp 60c-Src Nonreceptor Tyros ine Kinase ( SRC) ( SEQ ID NO: 81 ) fibroblast growth factor 4 ( FGF4 / HST ) ( SEQ ID NO: 82 ) Lys ine Methyltrans ferase 2A ( KMT2A) ( SEQ ID NO: 83 ) B-cell lymphoma protein-2 ( BCL-2 ) ( SEQ ID NO: 84 ) Anaplastic Lymphoma Kinase (ALK) ( SEQ ID NO: 85 ) Rearranged During Trans fection ( RET ) ( SEQ ID NO: 86 ) Estrogen Receptor 1 ( ESRI ) ( SEQ ID NO: 87 ) Progesterone Receptor ( PGR) ( SEQ ID NO: 88 ) GATA binding protein 4 ( GATA4 ) ( SEQ ID NO: 89 ) GATA binding protein 6 ( GATA6 ) ( 2000bp ) ( SEQ ID NO: 90 ) Tumor Protein p63 ( Tp 63 ) ( SEQ ID NO: 91 ) SRY-box transcription factor 2 ( SOX2 ) ( SEQ ID NO: 92 ) Mucin 4 (MUC4 ) ( SEQ ID NO: 93 )Vimentin (VIM) ( SEQ ID NO: 94 ) Fibronectin ( FN1 ) ( SEQ ID NO: 95 ) Cadherin 2 ( CDH2 ) ( SEQ ID NO: 96 ) Trans forming growth factor beta 1 ( TGFB1 ) ( SEQ ID NO: 97 ) Catenin Beta 1 ( CTNNB1 ) ( SEQ ID NO: 98 ) Snail family transcriptional repressor 1 ( SEQ ID NO: 99 ) ( SNAI 1 )Snail family transcriptional repressor 2 ( SEQ ID NO: 100 ) ( SNAI2 )Twist family bHLH transcription factor 1 ( SEQ ID NO: 101 ) (TWIST1 )Zinc finger E-box binding homeobox 1 ( ZEB1 ) ( SEQ ID NO: 102 ) Zinc finger E-box binding homeobox 2 ( ZEB2 ) ( SEQ ID NO: 103 ) Early growth response 1 ( EGR1 ) ( SEQ ID NO: 104 ) Paired related homeobox 1 ( PRRX1 ) ( SEQ ID NO: 105 ) Albumin ( SEQ ID NO: 106) Prostate-Speci fic Antigen ( PSA) [ or Kalli krein ( SEQ ID NO: 107 ) Related Peptidase 3 ( KLK3 ) ]Glial Fibrillary Acidic Protein ( GFAP ) ( SEQ ID NO. 108 ) Surfactant Protein B ( SP-B) <S EQI D NO: 1 0 9) B-Cell-Speci f ic Glycoprotein B29 ( B29 ) ( SEQ ID NO: 110 ) Cell Surface Glycoprotein CD45 ( CD45 ) ( SEQ ID NO: 111 ) Tyros inase Related Protein 1 ( TRP- 1 ) ( SEQ ID NO: 112 ) Thyroid Transcription Factor 1 ( TTF- 1 ) ( SEQ ID NO: 113 ) Prostate-Speci fic Membrane Antigen ( PSMA) ( SEQ ID NO: 114 ) Myelin Bas ic Protein (MBP ) ( SEQ ID NO: 115 ) Neuron Speci fic Enolase (NSE ) ( SEQ ID NO: 116) von Willebrand Factor (vWF) ( SEQ ID NO: 117 ) Probas in from mus musculus ( Pbsn) ( SEQ ID NO: 118 )Homeobox B13 (HOXB13 ) ( SEQ ID NO: 119 ) Plasminogen ( PLG) ( SEQ ID NO: 120 ) CD68 Antigen ( CD68 ) ( SEQ ID NO: 121 ) Elastase- 1 ( CELA1 ) ( SEQ ID NO: 122 ) Platelet Membrane Glycoprotein l ib ( GPI Ib ) ( SEQ ID NO: 123 ) Synaps in I ( SYN1 ) ( SEQ ID NO: 124 ) Wiskott-Aldrich Syndrome Protein (WASP ) ( SEQ ID NO: 125 ) Calcium / Calmodulin-Dependent Protein Kinase II ( SEQ ID NO: 126) (CaMKI I )Serpin Family A Member 1 ( SERPINA1 ) ( SEQ ID NO: 127 ) CD14 Antigen ( CD14 ) ( SEQ ID NO: 128 ) Mammoglobin (MGB1 ) ( SEQ ID NO: 129 ) Keratin 1 ( KRT1 ) ( SEQ ID NO: 130 ) Keratin 5 ( KRT5 ) ( SEQ ID NO: 131 ) Keratin 6A ( KRT6 ) ( SEQ ID NO: 132 ) Keratin 8 ( KRT8 ) ( SEQ ID NO: 133 ) Keratin 10 ( KRT10 ) ( SEQ ID NO: 134 ) Keratin 14 ( KRT14 ) ( SEQ ID NO: 135 ) Keratin 18 ( KRT18 ) ( SEQ ID NO: 136) EH Domain-Containing Protein 3 ( EHD3 ) ( SEQ ID NO: 137 ) Trans ferrin ( Tf) ( SEQ ID NO: 138 ) Transthryetin (TTR) ( SEQ ID NO: 139 ) Mucin 2 (MUC2 ) ( SEQ ID NO: 140 ) Mucin 5AC (MUC5AC) ( SEQ ID NO: 141 ) Mucin 5B (MUC5B) ( SEQ ID NO: 142 ) Mucin 6 (MUC6 ) ( SEQ ID NO: 143 ) Mucin 16 (MUC16) ( SEQ ID NO: 144 )Osteocalcin ( BGLAP ) ( SEQ ID NO: 145 ) IKAROS Family Zinc Finger 1 ( IKZF1 ) ( SEQ ID NO: 146) EBF Transcription Factor 1 ( EBF1 ) ( SEQ ID NO: 147 ) Inositol polyphosphate-5-phosphatase D ( SEQ ID NO: 148 ) ( INPP5D)Nestin (NES ) ( SEQ ID NO: 149 ) Cadherin 16 ( CDH16 ) ( SEQ ID NO: 150 ) pancreatic and duodenal homeobox 1 ( PDX1 ) ( SEQ ID NO: 151 ) anti-Mullerian hormone (AMH) ( SEQ ID NO: 152 ) cytochrome P450 family 19 subfamily A member 1 ( SEQ ID NO: 153 ) (CYP19A1 )thyroxine-binding globulin ( TBG) ( SEQ ID NO: 154 ) Tumor Protein p53 (p53 ) ( SEQ ID NO: 155 ) Heat Shock Protein Family A (Hsp70 ) Member 4 ( SEQ ID NO: 156) (HSPA4 )Growth Arrest and DNA Damage Inducible Alpha ( SEQ ID NO: 157 ) (GADD45A)BRCA1 DNA repair as sociated ( BRCA1 ) ( SEQ ID NO: 158 ) Nuclear Factor Kappa B Subunit 1 (NFKB1 ) ( SEQ ID NO: 159 ) Interleukin 6 ( IL 6 ) ( SEQ ID NO: 160 ) Tumor Necros is Factor (TNF) ( SEQ ID NO: 161 ) ATP Binding Cassette Subfamily B Member 1 ( SEQ ID NO: 162 ) (ABCB1 )MYC proto-oncogene, bHLH transcription factor ( SEQ ID NO: 163 ) (C-MYC)MYCN proto-oncogene, bHLH transcription factor ( SEQ ID NO: 164 ) (N-MYC)MYCL proto-oncogene, bHLH transcription factor ( SEQ ID NO: 165 ) L ( L-MYC)MDM2 proto-oncogene (MDM2 ) ( SEQ ID NO: 166) MET Proto-Oncogene, Receptor Tyros ine Kinase ( SEQ ID NO: 167 ) (MET )168 miniCMV (SEQ ID NO: 168) 169 minP (SEQ ID NO: 169) 170 miniTK (SEQ ID NO: 170) 568 GATA binding protein 6 (GATA6) ( lOOObp) (SEQ ID NO: 568) 569 Matrix Metallopeptidase 1 (MMP1): (SEQ ID NO: 569)

[0078] As used herein a "promoter-enhancer region” encompasses a non-coding region that includes transcription start sites, and a promoter, and may optionally include one or more transcription factor response elements (TFREs) or promoter response elements (PREs). A promoter facilitates RNA polymerase II binding and an enhancer is typically upstream (i.e. 5’) from the promoter and the enhancer includes TFREs that bind transcription factors, which regulate RNA polymerase binding and transcription. Alternatively and / or additionally there may be one or more TFREs in the promoter (i.e. PREs), which regulate RNA polymerase binding and transcription. Furthermore, additional structural and mediator proteins may bind to the promoter-enhancer region to stabilize the structure and facilitate controlled transcription. The "promoterenhancer region” also encompasses eukaryotic inducible synthetic promoters and fusions of known promoters and known TFREs and / or PREs.

[0079] As used herein, a "promoter response element” refers specifically to a DNA sequence within a promoter region of a gene that acts as a binding site for transcription factors, while a "transcription factor response element” as used herein is a broader term encompassing any DNA sequence that a specific transcription factor can bind to, which could be located within the promoter, enhancer, or other regions of a isolated nucleic acid construct, or gene.

[0080] A eukaryotic inducible synthetic promoter typically comprises one or more promoter response elements (PREs), and a minimal promoter.

[0081] The PREs may be chosen or designed to respond to a specific tumour microenvironment (for example, inflammatory signals; the tumor’s hypoxic environment; transcription factors (i.e. TFREs) associated with the target cells or tissues; etc.)

[0082] As used herein a "minimal promoter” or "core promoter” or "min-P” is meant to encompass a short DNA sequence that facilitates the formation of a transcription initiation complex at or near the transcription start site and initiation of transcription of one or more amiRNA expression cassettes. As described herein there are a number of exemplified minimal promoters sequences (for example, see SEQ ID NOs: 168-170 and 562-567).

[0083] A "constitutive” promoter is a nucleotide sequence, which, when operably linked with a polynucleotide, which encodes an amiRNA expression cassette, causes the functional guide sequence to be produced in a cell under most or all physiological conditions of the cell.

[0084] An "inducible” promoter is a nucleotide sequence which, when operably linked with a polynucleotide, which encodes an amiRNA expression cassette, causes the functional guide sequence to be produced in a cell substantially only when an inducer which corresponds to the promoter is present in the cell.

[0085] A "tissue-specific" promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes an amiRNA expression cassette, causes the functional guide sequence to be produced in a cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.

[0086] A "cancer enhanced" promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes an amiRNA expression cassette, causes the functional guide sequence to be produced in a cell substantially only if the cell is a cell specific to a cancer or group of cancers, such that those cancer cells promote transcription of the amiRNA expression cassette. In particular, the promoter may be activated by one or more transcription factors (TFs) associated with a cancer or group of cancers or by one or more TFs that are over expressed in a cancer or group of cancers or a TF that is post-translationally modified (for example, by hyperphosphorylation) to become more active in a cancer or group of cancers. Alternatively, the promoter may be activated by the general microenvironment of a cancer or group of cancers.

[0087] As used herein “a transcription factor response element” or “TFRE” refers to a DNA sequence within a promoter sequence or within an enhancer sequence that are responsive to binding by a specific transcription factor or specific transcription factors,wherein the binding of the specific transcription factor (s) regulate transcription of DNA sequences downstream from the promoter. TABLE C below shows exemplary TFRE consensus sequences. A TFRE may be responsive to a transcription factor selected from one or more of the following: Activator protein- 1 (AP-1); Activating enhancer binding protein 2 alpha (AP-2); Basic leucine zipper ATF-like transcription factor- Jun protooncogene, AP-1 transcription factor subunit (BATF:: JUN); E2F transcription factor 1 (E2F1); E74 like ETS transcription factor 1 (ELF 1); E74 like ETS transcription factor 2 (ELF2); E74 like ETS transcription factor 3 (ELF3); ETS transcription factor ELK1 (ELK1); ETS transcription factor ELK4 (ELK4); Endothelial PAS Domain Protein 1 (EPAS1); ETS proto-oncogene 1, transcription factor (ETS 1 ); ETS proto-oncogene 2, transcription factor (ETS2); ETS variant transcription factor 1 (ETV1); ETS variant transcription factor 4 (ETV4); ETS variant transcription factor 5 (ETV5); ETS variant transcription factor 6 (ETV6); ETS transcription factor ERG (ERG); Ewing's sarcoma oncogene-Fli-1 proto-oncogene, ETS transcription factor (EWS:: FLI1); Fli-1 protooncogene, ETS transcription factor (FLI1); Fos proto-oncogene, AP-1 transcription factor subunit (FOS); Forkhead box A1 (FOXA1); Forkhead box M1 (FOXM1); Forkhead box Q1 (FOXQ1); GA binding protein transcription factor subunit alpha (GAB PA); GATA binding protein 1-TAL bHLH transcription factor 1, erythroid differentiation factor (GATA1:: TAL1); GATA binding protein 2 (GATA2); GATA binding protein 3 (GATA3); GATA binding protein 4 (GATA4); GATA binding protein 6 (GATA6); Glioma-associated oncogene transcription factor (GLI); hes family bHLH transcription factor 1 (HES1); hes family bHLH transcription factor 6 (HES6); Hypoxia inducible factor 1 subunit alpha (HIF1A); Jun proto-oncogene, AP-1 transcription factor subunit (JUN); KLF transcription factor 8 (KLF8); Lymphoid enhancer binding factor 1 (LEF1); MYC associated factor X (MAX); MYC proto-oncogene, bHLH transcription factor (MYC); Nuclear Factor of Activated T Cells 2 (NFAT1); Nuclear Factor of Activated T Cells 1 (NFAT2); Nuclear Factor of Activated T Cells 3 (NFAT4); Nuclear Factor of Activated T Cells 5 (NFAT5); Nuclear Factor kappa B Subunit 1 (NFKB1); Nuclear Factor kappa B Subunit 2 (NFKB2); NK2 homeobox 1 (NKX2-1); NK2 homeobox 2 (NKX2-2); POU class 2 homeobox 1 (OCT1); POU class 2 homeobox 2 (OCT2); POU domain class 5 transcription factor 3 (OCT3); Spi-1 proto-oncogene (PU.l); Retinoic acid receptor alpha-Retinoid X receptor alpha (RARA:: RXRA); RELA proto-oncogene, NF-kB subunit (RELA1); RELB proto-oncogene, NF-kB subunit (RELB); REL proto-oncogene, NF-kBsubunit (REL); RUNX family transcription factor 1 (RUNX1); RUNX family transcription factor 2 (RUNX2); SlXhomeobox 1 (SIX1); Signal Transducer and Activator of Transcription 3 (STAT3); Signal Transducer and Activator of Transcription 5A (STAT5A); Signal Transducer and Activator of Transcription 5B (STAT5B); Signal Transducer and Activator of Transcription 6 (STAT6); SRY-box Transcription Factor 2 (SOX2); SRY-box Transcription Factor 3 (SOX3); SRY-box Transcription Factor 4 (SOX4); SRY-box Transcription Factor 5 (SOX5); SRY-box Transcription Factor 6 (SOX6); SRY-box Transcription Factor 8 (SOX8); SRY-box Transcription Factor 9 (SOX9); SRY-box Transcription Factor 10 (SOX10); SRY-box Transcription Factor 11 (SOX11); SRY-box Transcription Factor 12 (SOX12); SRY-box Transcription Factor 13 (SOX13); SRY-box Transcription Factor 15 (SOX15); SRY-box Transcription Factor 18 (SOX18); Serum Response Factor (SRF); Sex Determining Region Y (SRY); TAL bHLH transcription factor 1, erythroid differentiation factor (TALI); TAL bHLH transcription factor 1, erythroid differentiation factor-Transcription factor 3 (TAL1:: TCF3); T-box transcription factor 1 (TBX1); T-box transcription factor 2 (TBX2); Transcription Factor EB (TFEB); Transmembrane Serine Protease 2- ETS variant transcription factor 1 (TMPRSS2:: ETV1); Tumor protein p63 (TP63); Tumor protein p73 (TP73);Transcriptional repressor GATA binding 1 (TRPS1); Yesl associated transcriptional regulator (YAP); BTB domain and CNC homolog 2 (BACH2); Basic leucine zipper ATF-like transcription factor (BATF); PR / SET domain 1 (BLIMP1); BCL11 transcription factor B (BCL11B); BCL6 transcription repressor (BCL6); E2F transcription factor 1 (E2F1); Forkhead box O1 (FOXO1); Forkhead box O3 (FOXO3); Forkhead box P3 (FOXP3); GATA binding protein 1 (GATA1); GATA binding protein 2 (GATA2); GATA binding protein 3 (GATA3); hes family bHLH transcription factor 1 (HES1); hes family bHLH transcription factor 5 (HES5); Hematopoietically Expressed Homeobox (HHEX); IKAROS family zinc finger 1 (IKZF1); IKAROS family zinc finger 2 (IKZF2); IKAROS family zinc finger 3 (IKZF3); Interferon regulatory factor 1 (IRF1); Interferon regulatory factor 3 (IRF3); Interferon regulatory factor 4 (IRF4); Interferon regulatory factor 5 (IRF5); Interferon regulatory factor 7 (IRF7); Interferon regulatory factor 8 (IRF8); Lymphoid enhancer binding factor 1 (LEF1); Myocyte enhancer factor 2B (MEF2B); Myocyte enhancer factor 2C (MEF2C); Protein inhibitor of activated STAT 2 (MIZ1); Nuclear Factor of Activated T-cells 1 (NFATC1); Nuclear Factor of Activated T-cells 2 (NFATC2); Nuclear Factor of Activated T-cells 3 (NFATC3); Nuclear Factor of ActivatedT-cells 4 (NFATC4); Nuclear factor, interleukin 3 regulated (NFIL3); Paired box 5 (PAX5); RAR related orphan receptor A (RORA); RAR related orphan receptor B (RORB); RAR related orphan receptor C (RORC); SATB homeobox 1 (SATB1); Spi-B transcription factor (SPIB); Signal transducer and activator of transcription 1 (STAT1); Signal transducer and activator of transcription 2 (STAT2); Signal transducer and activator of transcription 1-Signal transducer and activator of transcription 2 (STAT1:: STAT2); Signal transducer and activator of transcription 3 (STAT3); Signal transducer and activator of transcription 4 (STAT4); Signal transducer and activator of transcription 5A (STAT5A); Signal transducer and activator of transcription 5B (STAT5B); Signal transducer and activator of transcription 6 (STAT6); TAL bHLH transcription factor 1, erythroid differentiation factor-Transcription factor 3 (TAL1:: TCF3); T-box transcription factor 21 (TBX21); T-box transcription factor 3 (TBX3); T-box transcription factor 5 (TBX5); Transcription factor 3 (TCF3);Transcription factor 4 (TCF4); Transcription factor 7 (TCF7); Transcription factor 7 like 1 (TCF7L1); Transcription factor 7 like 2 (TCF7L2); TEA domain transcription factor 1 (TEAD1); TEA domain transcription factor 2 (TEAD2); X-box binding protein 1 (XBP1); Androgen receptor (AR); Estrogen receptor 1 (ESR1); Estrogen receptor 2 (ESR2); Nuclear receptor subfamily 3 group C member 1 (NR3C1); Nuclear receptor subfamily 3 group C member 2 (NR3C2); Progesterone receptor (PGR); Retinoic acid receptor alpha (RARA); Retinoic acid receptor beta (RARB); Retinoic acid receptor gamma (RARG); Thyroid hormone receptor alpha (THRA); Thyroid hormone receptor beta (THRB); Vitamin D receptor (VDR); Forkhead box A1 (FOXA1); Nuclear transcription factor Y subunit alpha (NF-YA); Nuclear transcription factor Y subunit beta (NF-YB); Nuclear transcription factor Y subunit gamma (NF-YC); Nuclear respiratory factor 1 (NRF1); Sp2 transcription factor (Sp2); Hepatocyte nuclear factor 4 alpha (HNF4A); Peroxisome proliferator activated receptor alpha- Retinoid X receptor alpha (PPARA: RXRA);Peroxisome proliferator activated receptor alpha (NR1C1); Peroxisome proliferator activated receptor delta (NR1C2); Peroxisome proliferator activated receptor gamma (NR1C3); RAR related orphan receptor A (NR1F1); RAR related orphan receptor B (NR1F2); RAR related orphan receptor C (NR1F3); Nuclear receptor subfamily 1 group H member 3 (NR1H3); Nuclear receptor subfamily 1 group H member 4 (NR1H4); Retinoid X receptor alpha (NR2B1); Retinoid X receptor beta (NR2B2); Retinoid X receptor gamma (NR2B3); Nuclear receptor subfamily 1 group I member 2 (NR1I2);Nuclear receptor subfamily 1 group I member 3 (NR1I3); Estrogen related receptor alpha (NR3B1); Estrogen related receptor beta (NR3B2); Estrogen related receptor gamma (NR3B3); Nuclear receptor subfamily 5 group A member 1 (NR5A1); Nuclear receptor subfamily 1 group D member 1 (NR1D1); Nuclear receptor subfamily 1 group D member 2 (NR1D2); Nuclear receptor subfamily 2 group C member 1 (NR2C1);Nuclear receptor subfamily 2 group C member 2 (NR2C2); Nuclear receptor subfamily 2 group E member 1 (NR2E1); Nuclear receptor subfamily 2 group E member 3 (NR2E3); Nuclear receptor subfamily 2 group F member 1 (NR2F1); Nuclear receptor subfamily 2 group F member 2 (NR2F2); Nuclear receptor subfamily 4 group A member 1 (NR4A1); Nuclear receptor subfamily 4 group A member 2 (NR4A2); and Nuclear receptor subfamily 6 group A member 1 (NR6A1).

[0088] TABLE C: Exemplary TFRE Consensus SequencesSEQ ID NO: NAME SEQUENCE171 AP-1 TGASTCA172 AP-2 GCCNNNGGC173 MYC CACGTG174 MAX CACGTG175 NFKB1 GGGRNNYYCC176 NFKB2 GGGRNNYYCC177 RELA1 GGGRNNYYCC178 RELB RNATTCCCC179 REL GGGGRNWTTCC180 STAT3 TTCTGGGAA181 STAT3 AGCTTCATTTCCCGTAAATCGTCGA182 STAT5A TTCCMRGAA183 STAT5A AGTTCTGAGAAAAGT184 STAT5B TTCCMRGAA185 STAT5B AGTTCTGAGAAAAGT186 STAT5B TTCCCAGAA187 STAT 6 TTCCTGAGAA188 GATAW (SEQ ID NO: 188) OR WYCTTATCWS (SEQ ID GATA2NO: 400 )189 GATA3 AGATAAGA190 GATA4 CCTTATCT191 GAT A 6 YCTTATCWGAT A 6 AGATAAGATP 63 RCATGYNNNNNCATGYY TP73 RCATGYYNNRRCAYGY SOX2 ACAATRRSOX3 ACAATRRSOX4 RACAAWRRSOX 4 AACAATTGCAGTGTT SOX 5 AACAATRSOX5 ATTGTTSOX6 YCWTTGTYYYSOX8 MGAACAATRSSOX8 AACAATGTGCAGTGTT SOX9 CSATTGTTYSOXIO CWTTGT SOX 10 NNACAAAGNSOX 11 RRACAAAGS OX 11 AACAAT T KCAKT GT T SOX12 MCCGAACAAYSOX 13 RRACAATGGNN SOX15 YYWTTGTTTTSOX18 RACAAYRSTRPS1 YCTTATCWGLI RCGACCACMCWR NFAT1 TTTTCCANFAT2 TGGAAAWNFAT4 YGGAAMMWNFAT4 KWWTTCCYWNFAT5 ATGGAAAAEWS:: FLU GGAAGGAAGGAAGGAAGG FL1 RMMGGAARYRRETS1 YWTCCKETS1 RSMGGAWRYETS2 RCCGGAWRYERG WMMGGAWRY ELF1 RRRMSMGGAAGYR ELF2 RWMSCGGAARYR ELF3 WASCCGGAAGTRRELF3 NNYYWCTTCCTSNW ETV1 RCMGGAWRYETV4 RCCGGAWRYETV5 RCCGGAWRYETV5 SACTTCCKSETV6 SMGGAARYR TMPRSS2::ETV1 RSMGGAARYPU. 1 MRRAASWELK1 RCCGGAARYELK4 RCCGGAWRYELK4 YRTTCCKSFOXM1 GTAAAYAHES1 GGCRCGYGSSHES6 GGCACGTGTYYAP MTTACGTAAK NKX2-1 CACTTGANKX2-2 CCACTCAAOCTI TATGYWAAT OCT2 NKMATTTGCATRW OCT2 WTATGCAAATKWR OCT 3 WWATGCAAANRUNX1 WWTTGYGGTWWE2F1 WWWGGCGCCMWW E2F1 RSGCGSSARRFOXQ1 RWWGTTTAKWTFEB CACRTGMY SRY WAACAAW LEFT RRAGATCAAAGGRWW SRF YWWKNCCWWAWAAGGMMR SRF TGMCCATATAWGGKMW JUN WWRRTGAKGYMAY JUN RRRRRRTGASTCAK FOS KSTGASTCAYY BATE:: JUN RRWATGASTCA GABPA CACTTCCTGGT GABPA ACCGGAGWSKLF8 CYRCCCCCCCCACSIX1 GWAACCTGAKMRUNX2 KKKKKYTGTGGTTTKRUNX2 WRACCRCARRARA:: RXRA RGKTCANSGRGAGGTCA TALI GCACCTGG GAT Al:: TALI TTATCWSNNNNNNNCAG TALI:: TCF3 AMCAKMTGKTFOXA1 TRTTTACWYWKFOXA1 GTAAACATHIF1A ACGTGCEPAS1 CGCACGTASTBX1 AGGTGTGATBX2 AGGTGTGAAIRF1 GAAAGYGAAACCIRF1 NNYYRSTTTCRSTTTCNNTTT IRF3 RRAAMGGAAACCGAAACIRF4 CGAAACCGAAACYAIRF5 CCGAAACCGAAACTIRF7 CGAAARYGAAARTIRF8 CGAAACCGAAACTSTAT1 TTCYRGGAASTAT1 GGAAAACGAAACTGSTAT2 RRAAACAGAAASWSTAT1:: STAT2 TAGTTTCACTTTCCCSTAT3 TTCTGGGAASTAT3 AGCTTCATTTCCCGTAAATCGTCGA STAT4 YTTCYRGGAARNNRSTAT5A TTCCMRGAASTAT5A AGTTCTGAGAAAAGTSTAT5B TTCCMRGAASTAT5B AGTTCTGAGAAAAGTSTAT5B TTCCCAGAASTAT 6 TTCCTGAGAAFOXP3 RYAAACARORA WWSWRGGTCA RORB WWTTRGGTCA RORC AWNTRGGTCA TCF3 CACCTGCTALI:: TCF3 AMCATCTGKTTCF4 RCACCTGTCF7 CTTTGAWTCF7L1 AAAGATCAAAGG TCF7L2 RRASWTCAAAGRLEFT AAAGATCAAAGGRWW LEFT CCTTTGATSTT TBX21 AAGGTGTGAATBX21 TTTCACACCTTTBX3 GRGGTGTSATBX3 RAGGTGTGAAATBX5 AGGTGTGAHES1 GGCRCGTGSCHES5 GRCACGTGYCBATF TGACTCA PAX5 GCGTGACCMEF2C CYAAAAATAGMSPIB TCACTTCCTCTTT BCL6 GCTTTCKAGGAAT MEF2B RCTAWAAATAGME2F1 TTTGGCGCCAAA FOXO1 GTAAACAFOXO3 KGTAAACABACH2 CATGASTCATSBACH2 AAANSATGACGTSATSNTT BL IMP 1 WRAAAGTGAAAGTRA BLIMP1 YWCTTTCTCTYXBP1 GMCACGTCATCMIZ1 AATCGATTBCL6 GCTTTCKAGGAATHHEX TYKAATTAGATA1 WWCTAATCTWW GATA2 GATAWGATA2 WYCTTATCWYY GATA3 AGATAAGAIKZF1 AACAGGAAIKZF2 AGGAAGIKZF3 CAGGAAGTGTEAD1 ACATTCCAGTEAD2 ACATTCCBCL11B AAACCACAASATB1 WWWCTAATAACWW NFIL3 TTATGYAAYNFATC1 TGGAAANFATC2 AATGGAAANFATC3 RYGGAAMMWNFATC4 ARYGGAAAMWNR2F1 CARRGGTCAMRRG NR2F1 RRGGTCAAAGGTCA NR2F1 RRGGTCRNTGACCTY NR2F2 AAGGTCANR6A1 CAAGKTCAAGKKCA NR4A1 AAAGGTCANR2E3 CAAGCTTNR1D1 RGGTYAGTRGGTCA NR1D2 RGGTTAGTRKGTCR NR2E1 AAAAGTCAANR2C1 RGGTCANR2C2 GRGGTCARAGGTCA NR2C2 RRGGTCANR4A1 AAAGGTCANR4A2 AAAGGTCAAR RRGAACANNNWGTNC ESRI RGGTCACSRTGACCT ESR2 RGGTCASMSTGMCCY RARA AGGTCAYSYAAAGGTCA RARA GAGGTCAAAAGGTCAAKKRARB RAGGTCRTGACCY RARG AGGTCATGACCTT THRA GTGTCCTCANRTGACCTY THRB RGGTCAAAGGTCA THRB TGACCTYRNYRGGTCA THRB TGACCTYACGTGACCTYA PGR ACAKWMTGT VDR TRRGTTCA NR3C1 RRGWACAYNRTGTWCYM NR3C2 RGWACAYWRTGTWCY NR1I3 RTGAACTTTNR3B1 YCAAGGTCANR3B2 TCAAGGTCAWWNR3B3 TCAAGGTCANR1H4 KYAATGACCNHNF4A CAAAGTCCAHNF4A RRGTCCAAAGGTCA NR1C1 AAGGTCPPARA:: RXRA AWNTRGGTCAAAGGTCAN NR1C2 RRGGTCAAAGGTCA NR1C3 TAGGTCACSGTGACCYACT NR1F1 WAWSTAGGTCANR1F2 AWTTRGGTCANR1F3 AWNTAGGTCANR2B1 GRGGTCAAAGGTCA NR2B2 GGGGTCAAAGGTCA NR2B3 GRGGTCAAAGGTCA NR5A1 YCAAGGYCAYNR1I2 YGAACTSRRTGAACT NR1H3 AGGKCANF-YA RRCCAATCASMNF-YB CYCATTGGCCARNF-YB AAAYSRRCCAATCAG NF-YC CCAATCASp2 GYCCCGCCYCYYCCC Sp2 MTAAGYCCCGCCCMCTY408 Sp2 GGGGCGGGG409 NRF1 GCGCMTGCGCR

[0089] As used herein a "target specific sequence” refers to any sequence whose reduced transcription or silencing of transcription might benefit a subject in the treatment of a cancer or resulting in reduced expression of a target nucleic acid. In particular, the targeting, coopting or augmentation of transcriptional control in cancer cells may provide a mechanism to dictate tumour cell response within the mutational landscape and to factors within the tumour microenvironment such as immune cells, growth, and inflammatory factors. These same targets could also be used to alter the differentiation, growth, metastatic or apoptotic pathways in cancer cells to induce synthetic lethality or alter the equilibrium between immune-mediated cancer cell killing and cancerous cell escape. As used herein a "functional guide sequence” is capable of reducing the expression of a "target nucleic acid” or "target specific sequence” (see TABLE E below) and is derived from a "hairpin sequence” (see TABLE D below). A "target specific sequence” may be selected from one or more of the following: mitotic arrest deficient 2 like 1 (MAD2); WEE1 G2 checkpoint kinase (WEE1); polo like kinase 1 (PLK1); cyclin dependent kinase 4 (CDK4); cyclin dependent kinase 6 (CDK6); cyclin dependent kinase 16 (CDK16); Aurora kinase A (AURKA); Aurora kinase B (AURKB); checkpoint kinase 1 (CHK1); kinesin family member 11 (Kif11); cyclin dependent kinase 1 (CDK1); COP9 signalosome subunit 5 (CSN5); Ras-related nuclear protein (RAN); cyclin D1 (CCND1); SRY-Box Transcription Factor 2 (SOX2); E2F Transcription Factor 1 (E2F1); E2F Transcription Factor 3 (E2F3); E2F Transcription Factor 5 (E2F5); E2F Transcription Factor 6 (E2F6); E2F Transcription Factor 7 (E2F7); E2F Transcription Factor 8 (E2F8); Nuclear Factor Kappa B Subunit 1 (NFKB1); Nuclear Factor Kappa B Subunit 2 (NFKB2); RUNX Family Transcription Factor 1 (RUNX1); Hypoxia inducible factor 1 subunit alpha (HIF1A); Endothelial PAS domain protein 1 (EPAS1); MYC protooncogene, bHLH transcription factor (C-MYC); MYCN proto-oncogene, bHLH transcription factor (N-MYC); MYCL proto-oncogene, bHLH transcription factor L (L-MYC); KRAS Proto-Oncogene, GTPase (KRAS); NRAS Proto-Oncogene, GTPase (NRAS); HRAS Proto-Oncogene, GTPase (HRAS); B-Raf proto-oncogene, serine / threonine kinase (BRAF); ABL1 proto-oncogene 1, non-receptor tyrosine kinase (ABL1); BCR activator of RhoGEF and GTPase (BCR)-ABLl proto-oncogene 1, non-receptor tyrosine kinase (BCR-ABL1); Epidermal Growth Factor Receptor (EGFR); MET Proto-Oncogene, ReceptorTyrosine Kinase (MET); erb-b2 receptor tyrosine kinase 2 (HER2); Phosphatidylinositol-4,5-bisphosphate 3-kinase Catalytic Subunit Alpha (PIK3CA); ALK receptor tyrosine kinase (ALK); SRC proto-oncogene, non-receptor tyrosine kinase (SRC); BCL2 like 12 (BCL2L12); BCL2 apoptosis regulator (BCL2); BCL2 like 1 (BCL-XL); Myeloid cell leukemia-1 (MCL1); Survivin also known as Baculoviral IAP Repeat Containing 5 (BIRC5); Fms related receptor tyrosine kinase 3 (FLT3); ret protooncogene (RET); Janus kinase 2 (JAK2); Fos proto-oncogene, AP-1 Transcription Factor Subunit (FOS); MDM2 proto-oncogene (MDM2); KIT proto-oncogene, receptor tyrosine kinase (KIT); Notch receptor 1 (NOTCH1); Platelet Derived Growth Factor Receptor Alpha (PDGFRA); Neurotrophic receptor tyrosine kinase 1 (NTRK1); Neurotrophic receptor tyrosine kinase 2 (NTRK2); Neurotrophic receptor tyrosine kinase 3 (NTRK3); Fibroblast Growth Factor Receptor 1 (FGFR1); Fibroblast Growth Factor Receptor 2 (FGFR2); Fibroblast Growth Factor Receptor 3 (FGFR3); Fibroblast Growth Factor Receptor 4 (FGFR4); ROS proto-oncogene 1, receptor tyrosine kinase (ROS1); AKT Serine / Threonine Kinase 1 (AKT1); AKT Serine / Threonine Kinase 2 (AKT2); AKT Serine / Threonine Kinase 3 (AKT3); FGR proto-oncogene, Src family tyrosine kinase (FGR); Mucin 1 (MUC1); Catenin beta 1 (CTNNB1); X-linked inhibitor of apoptosis (XIAP); MYB proto-oncogene like 2 (MYBL2); Twist family bHLH transcription factor 1 (TWIST1); Twist family bHLH transcription factor 2 (TWIST2); Ribonucleotide reductase catalytic subunit Ml (RRM1); Ribonucleotide reductase regulatory subunit M2 (RRM2); Thymidine kinase 1 (TK1); Poly(ADP-Ribose) polymerase 1 (PARP1); Proliferating cell nuclear antigen (PCNA); DNA polymerase theta (POLQ); ATM serine / threonine kinase (ATM); ATR serine / threonine kinase (ATR); protein kinase N3 (PKN3); Ras homolog family member C (RHOC); Rac family small GTPase 1 (RAC1); KRAS Proto-Oncogene, GTPase (KRAS); NRAS Proto-Oncogene, GTPase (NRAS); HRAS Proto-Oncogene, GTPase (HRAS); TNF alpha induced protein 6 (TSG6); vascular endothelial growth factor A (VEGFA); vascular endothelial growth factor B (VEGFB); vascular endothelial growth factor C (VEGFC); vascular endothelial growth factor D (VEGFD); C-X-C motif chemokine receptor 4 (CXCR4); ALK receptor tyrosine kinase (ALK); transforming growth factor beta 1 (TGFB1); Proteinase-activated receptor 2 (PAR2); multiple EGF-like domains 6 (MEGF6); MOK protein kinase (MOK); glutathione S-transferase pi 1 (GSTP1); SRSF protein kinase 1 (SRPK1); nuclear receptor subfamily 2 group F member 1 (NR2F1); forkhead box M1 (FOXM1); pyruvate dehydrogenasekinase 1 (PDK1); CD44 molecule (IN blood group) (CD44); protein tyrosine phosphatase non-receptor type 22 (PTPN22); signal transducer and activator of transcription 3 (STAT3); signal transducer and activator of transcription 4 (STAT 4); signal transducer and activator of transcription 6 (STAT6); kinesin family member 2 A (KIF2A); kinesin family member 2B (KIF2B); kinesin family member 3A (KIF3A); kinesin family member 3B (KIF3B); kinesin family member 5A (KIF5A); kinesin family member 5B (KIF5B); kinesin family member 5C (KIF5C); kinesin family member 7 (KIF7); kinesin family member 11 (KIF11); kinesin family member 15 (KIF15); kinesin family member C1 (KIFC1); Programmed cell death 1 (PD-1); Programmed Cell Death 1 Ligand 1 (PD-L1); Cytotoxic T-Lymphocyte Associated Protein 4 (CTLA4); C-X-C Motif Chemokine Receptor 4 (CXCR4); Fas Ligand (FASLG); Forkhead Box P3 (FOXP3);Isocitrate Dehydrogenase (NADP(+)) 1 (IDH1); Isocitrate Dehydrogenase (NADP(+)) 2 (IDH2); Lactate Dehydrogenase A (LDHA); Pyruvate Kinase Ml / 2 (PKM2); Mechanistic Target Of Rapamycin Kinase (mTOR); solute carrier family 2 member 1 (GLUT1); solute carrier family 2 member 3 (GLUT3); solute carrier family 2 member 4 (GLUT4); Heat Shock Protein Family E (Hsp10) Member 1 (HSPE1); Thymidylate synthetase (TS);Dihydropyrimidine dehydrogenase (DPD); Dihydrofolate reductase (DHFR); Cytidine deaminase (CDA); ATP binding cassette subfamily B member 1 (ABCB1); Multidrug resistance-associated protein 1 (MRP1); Multidrug Resistance Protein 2 (MRP2); ATP binding cassette subfamily G member 2 (ABCG2); Cystic fibrosis transmembrane conductance regulator (CFTR); ATP binding cassette subfamily G member 5 (ABCG5); ATP binding cassette subfamily G member 8 (ABCG8); 0-6-methylguanine-DNA methyltransferase (MGMT); Vascular Endothelial Growth Factor Receptor 2.Furthermore, a "target specific sequence” may be chosen based on the type of cancer (i.e. tumour type, tissue type, or cell type); based on TNM classification; based on genetic structural variant detection; based on the subject’s (i) previous cancer treatments; and (ii) family history of hereditary cancers (i.e. data about their cancer).

[0090] TABLE D: Exemplary Hairpin SequencesSEQ ID NO: NAME SEQUENCE410 TS_amiRNA TTCTCTGGTGGAGAATCCCAGGTTTTGGCCACTGACTGACCTGGGA 1 TTCCACCAGAGAATS_amiRNA_2 TCCACTGGAAGCCATAAACTGGTTTTGGCCACTGACTGACCAGTTTATCTTCCAGTGGA ATCTTCCAGTGGATS_amiRNA_3 TGCAGTTGGTCAACTCCCTGTGTTTTGGCCACTGACTGACACAGGGAGGACCAACTGCA AGGACCAACTGCATS_amiRNA_4 TTTGCAGTTGGTCAACTCCCTGTTTTGGCCACTGACTGACAGGGAGTTCCAACTGCAAA TTCCAACTGCAAADHFR_amiRNA_1 TTCCTCACATAACTTAGTCATGTTTTGGCCACTGACTGACATGACTAATATGTGAGGAA AATATGTGAGGAADHFR_amiRNA_2 TTTCCTCACATAACTTAGTCAGTTTTGGCCACTGACTGACTGACTAAAGATGTGAGGAAA AGATGTGAGGAAADHFR_amiRNA_3 TAAAGGTCGATTCTTCTCAGGGTTTTGGCCACTGACTGACCCTGAGAAATCGACCTTTA AAATCGACCTTTADHFR_amiRNA_4 TGTACTTAATGCCTTTCTCCTGTTTTGGCCACTGACTGACAGGAGAAACATTAAGTACA AACATTAAGTACACDK4_amiRNA_1 TTGACTGTTCCACCACTTGTCGTTTTGGCCACTGACTGACGACAAGTGGGAACAGTCAA TGGGAACAGTCAACDK4_amiRNA_2 TAGATAAGAGTGCTGCAGAGCGTTTTGGCCACTGACTGACGCTCTGCAACTCTTATCTA CAACTCTTATCTACDK4_amiRNA_3 CATTAAGGCAGCAAAGTAATCGTTTTGGCCACTGACTGACGATTACTTCTGCCTTAATG TTCTGCCTTAATGCDK4_amiRNA_4 TAAAGGTAGGGAAAGGGACAAGTTTTGGCCACTGACTGACTTGTCCCTCCCTACCTTTA CTCCCTACCTTTACDK6_amiRNA_1 TTCTTTCCCTGCAGGGCTGAAGTTTTGGCCACTGACTGACTTCAGCCCCAGGGAAAGAA CCCAGGGAAAGAACDK6_amiRNA_2 TTTCTTTGCACCTTTCCAGGTGTTTTGGCCACTGACTGACACCTGGAAGTGCAAAGAAA AAGTGCAAAGAAACDK6_amiRNA_3 TAAAGCTGCAATCACTCTTGCGTTTTGGCCACTGACTGACGCAAGAGTTTGCAGCTTTA GTTTGCAGCTTTACDK6_amiRNA_4 TAGACAGCTTCACACAGGGCAGTTTTGGCCACTGACTGACTGCCCTGTGAAGCTGTCTA GTGAAGCTGTCTAKif11_amiRNA_1 TTGAATGGGCGCTAGCTTTCCGTTTTGGCCACTGACTGACGGAAAGCTCGCCCATTCAA CTCGCCCATTCAAKif11_amiRNA_2 TTTAGTAGATGCTCCAAACACGTTTTGGCCACTGACTGACGTGTTTGGCATCTACTAAA GGCATCTACTAAAKif11_amiRNA_3 ATTAGGTGACCTTTCACCTTCGTTTTGGCCACTGACTGACGAAGGTGAGGTCACCTAAT GAGGTCACCTAATKif11_amiRNA_4 TATCCATCGCTTATGCTGACAGTTTTGGCCACTGACTGACTGTCAGCAAGCGATGGATA CAAGCGATGGATAMyc_amiRNA_1 ATGAAACTCTGGTTCACCATGGTTTTGGCCACTGACTGACCATGGTGACAGAGTTTCAT GACAGAGTTTCATMyc_amiRNA_2 TTGACATTCTCCTCGGTGTCCGTTTTGGCCACTGACTGACGGACACCGGAGAATGTCAA CGGAGAATGTCAAMyc_amiRNA_3 TTCCGTAGCTGTTCAAGTTTGGTTTTGGCCACTGACTGACCAAACTTGCAGCTACGGAA TGCAGCTACGGAAMyc_amiRNA_4 TTGTGAAGGCAGCAGAAGCTGGTTTTGGCCACTGACTGACCAGCTTCTTGCCTTCACAA CTTGCCTTCACAAKRAS_amiRNA_1 ATAACTTCTTGCTAAGTCCTGGTTTTGGCCACTGACTGACCAGGACTTCAAGAAGTTAT TTCAAGAAGTTATKRAS_amiRNA_2 TATAGAAGGCATCATCAACACGTTTTGGCCACTGACTGACGTGTTGATTGCCTTCTATA ATTGCCTTCTATAKRAS_amiRNA_3 AGTCCATGCTGTGAAACTCTCGTTTTGGCCACTGACTGACGAGAGTTTCAGCATGGACT TTCAGCATGGACTKRAS_amiRNA_4 AATGCATGACAACACTGGATGGTTTTGGCCACTGACTGACCATCCAGTTGTCATGCATT GTTGTCATGCATTCTNNB1_amiRNA_1 TGAAGCTGCTCCTCAGACCTTGTTTTGGCCACTGACTGACAAGGTCTGGAGCAGCTTCA TGGAGCAGCTTCACTNNB1_amiRNA_2 TTAGAAAGCTGATGGACCATAGTTTTGGCCACTGACTGACTATGGTCCCAGCTTTCTAA CCCAGCTTTCTAACTNNB1_amiRNA_3 TACAATAGCAGACACCATCTGGTTTTGGCCACTGACTGACCAGATGGTCTGCTATTGTA GTCTGCTATTGTACTNNB1_amiRNA_4 AAAGCTTGCATTCCACCAGCTGTTTTGGCCACTGACTGACAGCTGGTGATGCAAGCTTT TGATGCAAGCTTTMDM2_amiRNA_1 AAGCTTGGCACGCCAAACAAAGTTTTGGCCACTGACTGACTTTGTTTGGTGCCAAGCTT TGGTGCCAAGCTTMDM2_amiRNA_2 TACACCAGCATCAAGATCCGGGTTTTGGCCACTGACTGACCCGGATCTATGCTGGTGTA CTATGCTGGTGTAMDM2_amiRNA_3 TTCACTATTCCACTACCAAAGGTTTTGGCCACTGACTGACCTTTGGTAGGAATAGTGAA TAGGAATAGTGAAMDM2_amiRNA_4 TGCAGATGAACATCATGATGTGTTTTGGCCACTGACTGACACATCATGGTTCATCTGCA TGGTTCATCTGCAMET_amiRNA_1 AACACCTCCTGATAAATTGGCGTTTTGGCCACTGACTGACGCCAATTTCAGGAGGTGTT TTCAGGAGGTGTTMET_amiRNA_2 AATGTATGCTCCACAATCACTGTTTTGGCCACTGACTGACAGTGAT A_2 TGGAGCATACATTMET_amiRNA_3 TTGACTGCAGGACTGGAAATGGTTTTGGCCACTGACTGACCATTTC CACCTGCAGTCAAMET_amiRNA_4 AAACCTTGTAGATTGCAGGCAGTTTTGGCCACTGACTGACTGCCTG CACTACAAGGTTTHIF1A_amiRNA_1 AAATCAAACACACTGTGTCCAGTTTTGGCCACTGACTGACTGGACACAGTGTTTGATTT CAGTGTTTGATTTHIF1A_amiRNA_2 ATCAGCACCAAGCAGGTCATAGTTTTGGCCACTGACTGACTATGACCTTTGGTGCTGAT CTTTGGTGCTGATHIF1A_amiRNA_3 TTGGCAAGCATCCTGTACTGTGTTTTGGCCACTGACTGACACAGTACAATGCTTGCCAA CAATGCTTGCCAAHIF1A_amiRNA_4 AAATGATGCTACTGCAATGCAGTTTTGGCCACTGACTGACTGCATTGCTAGCATCATTT GCTAGCATCATTTBCL2_amiRNA_1 TATCGTACCCTGTTCTCCCAGGTTTTGGCCACTGACTGACCTGGGAGAAGGGTACGATA GAAGGGTACGATABCL2_amiRNA_2 TTCAGGTACTCAGTCATCCACGTTTTGGCCACTGACTGACGTGGATGAGAGTACCTGAA GAGAGTACCTGAABCL2_amiRNA_3 TGGATGTACTTCATCACTATCGTTTTGGCCACTGACTGACGATAGTGAAAGTACATCCA GAAAGTACATCCABCL2_amiR TTAAACTCCGAACAGCAAATGGTTTTGGCCACTGACTGACCATTTG NA_4 CTTCGGAGTTTAABIRC5_amiRNA_1 CAAATCTGGCGGTTAATGGCGGTTTTGGCCACTGACTGACCGCCATTACGCCAGATTTG TACGCCAGATTTGBIRC5_amiRNA_2 TTGACAGAAAGGAAAGCGCAAGTTTTGGCCACTGACTGACTTGCGCTTCTTTCTGTCAA TTCTTTCTGTCAABIRC5_amiRNA_3 AACAAGAGCACAGTTGAAACAGTTTTGGCCACTGACTGACTGTTTCAAGTGCTCTTGTT AAGTGCTCTTGTTBIRC5_amiRNA_4 AGAAACACTGGGCCAAGTCTGGTTTTGGCCACTGACTGACCAGACTTGCCAGTGTTTCT TGCCAGTGTTTCTBCLXL_amiRNA_1 AACACCTGCTCACTCACTGAGGTTTTGGCCACTGACTGACCTCAGTGAGAGCAGGTGTT GAGAGCAGGTGTTBCLXL_amiRNA_2 AGAGAAAGTCAACCACCAGCTGTTTTGGCCACTGACTGACAGCTGGTGTGACTTTCTCT TGTGACTTTCTCTBCLXL_amiRNA_3 TATCCTTTCTGGGAAAGCTTGGTTTTGGCCACTGACTGACCAAGCTTTCAGAAAGGATA TTCAGAAAGGATABCLXL_amiRNA_4 AAGGGTTGCACCAATCAGGTAGTTTTGGCCACTGACTGACTACCTGATGTGCAACCCTT ATGTGCAACCCTTPDL1_amiRNA_1 TACTCTACCACATATAGGTCCGTTTTGGCCACTGACTGACGGACCTATGTGGTAGAGTA ATGTGGTAGAGTAPDL1_amiRNA_2 TGACATGTCAGTTCATGTTCAGTTTTGGCCACTGACTGACTGAACATGCTGACATGTCA TGCTGACATGTCAPDL1_amiRNA_3 TTGTCCAGATGACTTCGGCCTGTTTTGGCCACTGACTGACAGGCCGAAGTCATCTGGACAA AACATCTGGACAAPDL1_amiRNA_4 AGGACTTGATGGTCACTGCTTGTTTTGGCCACTGACTGACAAGCAGTGCATCAAGTCCT TGCATCAAGTCCTIDH1_amiR AAATCAGTTGCTCTGTATTGAGTTTTGGCCACTGACTGACTCAATA NA_1 CAGCAACTGATTTIDH1_amiRNA_2 TTCAAACTGGGACTTGTACTGGTTTTGGCCACTGACTGACCAGTACCAGTACAAGTCCCAGTTTGAAIDH1_amiR TGAAGCCTCCCTCTGATTTCAGTTTTGGCCACTGACTGACTGAAAT NA_3 CAGGGAGGCTTCAIDH1_amiR TCATCATGCCGAGAGAGCCATGTTTTGGCCACTGACTGACATGGCT NA_4 CTCGGCATGATGARRM2_amiRNA_1 TGAACTTCTTGGCTAAATCGCGTTTTGGCCACTGACTGACGCGATTTACAAGAAGTTCA TACAAGAAGTTCARRM2_amiRNA_2 AGAAACAGCGGGCTTCTGTAAGTTTTGGCCACTGACTGACTTACAGAACCGCTGTTTCT AACCGCTGTTTCTRRM2_amiRNA_3 AAGCAGAGCGAGCAGCCAGGAGTTTTGGCCACTGACTGACTCCTGGCTTCGCTCTGCTT CTTCGCTCTGCTTRRM2_amiRNA_4 ATCACAGTGTAAACCCTCATCGTTTTGGCCACTGACTGACGATGAGGGTACACTGTGAT GGTACACTGTGATPARP2_amiRNA_1 ATTTAATGCTCTCGCCCTGCCGTTTTGGCCACTGACTGACGGCAGGGCGAGCATTAAAT GCGAGCATTAAATPARP2_amiRNA_2 ATTCATTGCATGCTTCCATGAGTTTTGGCCACTGACTGACTCATGGAAATGCAATGAAT AAATGCAATGAATPARP2_amiRNA_3 TATAGTGTTGGTCCAATGGGTGTTTTGGCCACTGACTGACACCCATTGCCAACACTATA TGCCAACACTATAPARP2_amiRNA_4 TTATGAAGGTCCTCTCTGAAGGTTTTGGCCACTGACTGACCTTCAGAGGACCTTCATAA AGGACCTTCATAAPLK1_amiRNA_1 TAAGCAGCTCGTTAATGGTTGGTTTTGGCCACTGACTGACCAACCATTCGAGCTGCTTA TTCGAGCTGCTTAGAPDH_amiRNA_1 TATTGATGGTACATGACAAGGGTTTTGGCCACTGACTGACCCTTGTCATACCATCAATA CATACCATCAATAGRB7_amiRNA_1 AAAGCTGCCAGCATTCAGGAAGTTTTGGCCACTGACTGACTTCCTGAACTGGCAGCTTT AACTGGCAGCTTTGPRC5B_amiRNA_1 TACACGTTGCTTCTAAACGGAGTTTTGGCCACTGACTGACTCCGTTTAAGCAACGTGTA TAAGCAACGTGTATRPS1_amiRNA_1 ATATCTTGAGGGTCATCTGCCGTTTTGGCCACTGACTGACGGCAGATGCCTCAAGATAT TGCCTCAAGATAT573 CDK6_amiRNA_5 ACATCAAACAACCTGACCACGGTTTTGGCCACTGACTGACCGTGGTCATTGTTTGATGT CAT T GT TT GAT GT574 DKK1_amiRNA_1 TGGAATACCCATCCAAGGTGCGTTTTGGCCACTGACTGACGCACCTTGTGGGTATTCCA TGTGGGTATTCCA

[0091] When an amiRNA regulates gene expression by binding to the mRNA, the "functional guide sequence” binds to the target specific mRNA sequences (TABLE E).

[0092] TABLE E: Exemplary Target Specific SequencesSEQ ID NO: NAME SEQUENCE484 TS_amiRNA_l CTGGGATTCTCCACCAGAGAA485 TS_amiRNA_2 CAGTTTATGGCTTCCAGTGGA486 TS_amiRNA_3 ACAGGGAGTTGACCAACTGCA487 TS_amiRNA_4 AGGGAGTTGACCAACTGCAAA488 DHFR_amiRNA_l ATGACTAAGTTATGTGAGGAA489 DHFR_amiRNA_2 TGACTAAGTTATGTGAGGAAA490 DHFR_amiRNA_3 CCTGAGAAGAATCGACCTTTA491 DHFR_amiRNA_4 CCTGAGAAGAATCGACCTTTA492 CDK4_amiRNA_l GACAAGTGGTGGAACAGTCAA493 CDK4_amiRNA_2 GCTCTGCAGCACTCTTATCTA494 CDK4_amiRNA_3 GATTACTTTGCTGCCTTAATG495 CDK4_amiRNA_4 TTGTCCCTTTCCCTACCTTTA496 CDK6_amiRNA_l TTCAGCCCTGCAGGGAAAGAA497 CDK6_amiRNA_2 ACCTGGAAAGGTGCAAAGAAA498 CDK6_amiRNA_3 GCAAGAGTGATTGCAGCTTTA499 CDK6_amiRNA_4 TGCCCTGTGTGAAGCTGTCTA500 Kif11_amiRNA_1 GGAAAGCTAGCGCCCATTCAA501 Kif11_amiRNA_2 GTGTTTGGAGCATCTACTAAA502 Kif11_amiRNA_3 GAAGGTGAAAGGTCACCTAATKifll amiRNA_4 T GT CAGCAT AAGCGAT GGATA Myc_amiRNA_1 CATGGTGAACCAGAGTTTCAT Myc_amiRNA_2 GGACACCGAGGAGAATGTCAA Myc_amiRNA_3 CAAACTTGAACAGCTACGGAA Myc amiRNA_4 CAGCTTCTGCTGCCTTCACAA KRAS amiRNA_l CAGGACTTAGCAAGAAGTTAT KRAS amiRNA_2 GTGTTGATGATGCCTTCTATA KRAS amiRNA_3 GAGAGTTTCACAGCATGGACT KRAS amiRNA_4 CATCCAGTGTTGTCATGCATT CTNNB1_amiRNA_1 AAGGTCTGAGGAGCAGCTTCA CTNNB1_amiRNA_2 TATGGTCCATCAGCTTTCTAA CTNNB1 amiRNA_3 CAGATGGTGTCTGCTATTGTA CTNNB1 amiRNA_4 AGCTGGTGGAATGCAAGCTTT MDM2 amiRNA_l TTTGTTTGGCGTGCCAAGCTT MDM2_amiRNA_2 CCGGATCTTGATGCTGGTGTA MDM2_amiRNA_3 CTTTGGTAGTGGAATAGTGAA MDM2 amiRNA_4 ACATCATGATGTTCATCTGCA MET amiRNA_l GCCAATTTATCAGGAGGTGTT MET_amiRNA_2 AGTGATTGTGGAGCATACATT amiRNA_3 CATTTCCAGTCCTGCAGTCAAMET_amiRNA_4 TGCCTGCAATCTACAAGGTTT HIF1A_amiRNA_1 TGGACACAGTGTGTTTGATTT HIF1A amiRNA_2 TATGACCTGCTTGGTGCTGAT HIF1A_amiRNA_3 ACAGTACAGGATGCTTGCCAA HIF1A_amiRNA_4 TGCATTGCAGTAGCATCATTT BCL2_amiRNA_1 CTGGGAGAACAGGGTACGATABCL2_amiRNA_2 GTGGATGACTGAGTACCTGAA BCL2_amiRNA_3 GATAGTGATGAAGTACATCCA BCL2_amiRNA_4 CATTTGCTGTTCGGAGTTTAA BIRC5_amiRNA_l CGCCATTAACCGCCAGATTTG BIRC5_amiRNA_2 TTGCGCTTTCCTTTCTGTCAA BIRC5_amiRNA_3 TGTTTCAACTGTGCTCTTGTT BIRC5_amiRNA_4 CAGACTTGGCCCAGTGTTTCT BCLXL_amiRNA_l CTCAGTGAGTGAGCAGGTGTT BCLXL_amiRNA_2 AGCTGGTGGTTGACTTTCTCT BCLXL_amiRNA_3 CAAGCTTTCCCAGAAAGGATA BCLXL_amiRNA_4 TACCTGATTGGTGCAACCCTT PDL1_amiRNA_1 GGACCTATATGTGGTAGAGTA PDL1_amiRNA_2 TGAACATGAACTGACATGTCA PDL1_amiRNA_3 AGGCCGAAGTCATCTGGACAA PDL1_amiRNA_4 AAGCAGTGACCATCAAGTCCT IDH1_amiRNA_l TCAATACAGAGCAACTGATTT IDH1_amiRNA_2 CAGTACAAGTCCCAGTTTGAA IDH1_amiRNA_3 TGAAATCAGAGGGAGGCTTCA IDH1_amiRNA_4 ATGGCTCTCTCGGCATGATGA RRM2_amiRNA_l GCGATTTAGCCAAGAAGTTCA RRM2_amiRNA_2 TTACAGAAGCCCGCTGTTTCT RRM2_amiRNA_3 TCCTGGCTGCTCGCTCTGCTT RRM2_amiRNA_4 GATGAGGGTTTACACTGTGAT PARP2_amiRNA_l GGCAGGGCGAGAGCATTAAAT PARP2_amiRNA_2 TCATGGAAGCATGCAATGAAT PARP2_amiRNA_3 ACCCATTGGACCAACACTATAPARP2_amiRNA_4 C T T CAGAGAGGAC C T T C AT AA PLK1_amiRNA_1 CAACCATTAACGAGCTGCTTA GAPDH_amiRNA_l CCTTGTCATGTACCATCAATA GRB7_amiRNA_l TTCCTGAATGCTGGCAGCTTT GPRC5B_amiRNA_1 TCCGTTTAGAAGCAACGTGTA TRPS1_amiRNA_1 GGCAGATGACCCTCAAGATAT CDK6_amiRNA_5 CGTGGTCAGGTTGTTTGATGT DKK1_amiRNA_1 GCACCTTGGATGGGTATTCCA

[0093] As used herein, "lacking predicted promoter sites and transcriptional start sites” means that the reverse complement of the isolated nucleic acid construct sequence, when analyzed using bioinformatics tools (for example, promoter 2™ analysis or ElemeNT™ version 2023), shows no identifiable regions (for example, promoter 2™ analysis 0.5 score "marginal prediction”) that would typically be recognized as regions where transcription would be initiated (i.e. promoter sites) or a location where RNA polymerase might start to transcribe a gene (i.e. transcriptional start sites), unless regulated by a transcription factor in accordance with the design of the amiRNA construct, to avoid unregulated transcription of the isolated nucleic acid construct and interference with amiRNA production. However, although less likely, it is also possible that the forward compliment might also have unintended promoter sites and transcriptional start sites, which might interfere with the transcription of the amiRNAs, which produce the functional guide sequence or functional guide sequences.Accordingly, lacking predicted promoter sites and transcriptional start sites would mean that the reverse compliment (or forward complement) of the isolated nucleic acid construct sequence would be unable or unlikely to undergo gene expression, unless regulated by a transcription factor in accordance with the isolated nucleic acid construct design.

[0094] An "effective amount” of nucleic acid construct as described herein includes a therapeutically effective amount or a prophylactically effective amount. A "therapeutically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result, such as reducedtumor size, increased life span or increased life expectancy. A therapeutically effective amount of a compound may vary according to factors such as the disease state, age, sex, and weight of the subject, and the ability of the compound to elicit a desired response in the subject. Dosage regimens may be adjusted to provide the optimum therapeutic response. A therapeutically effective amount is also one in which any toxic or detrimental effects of the compound are outweighed by the therapeutically beneficial effects. Typically, a prophylactic dose is used in subjects prior to or at an earlier stage of disease, so that a prophylactically effective amount may be less than a therapeutically effective amount.

[0095] The term "transfected” or "transformed” or "transduced” as used herein refers to a process by which an exogenous amiRNA nucleic acid is transferred or introduced into the host cell. A "transfected” or "transformed” or "transduced” cell is one into which an exogenous amiRNA nucleic acid construct has been inserted into a cell, wherein the cell includes the primary subject cell and its progeny. However, in a transfected cell, the exogenous amiRNA nucleic acid construct may be "transient”, meaning that progeny cells may lose the exogenous amiRNA nucleic acid construct.

[0096] The phrase "under transcriptional control” or "operably linked” as used herein means that the promoter is in the correct location and orientation in relation to an amiRNA polynucleotide to control the initiation of transcription by RNA polymerase and expression of the polynucleotide.

[0097] A "vector” is a composition of matter which comprises an isolated nucleic acid and which may be used to deliver the isolated nucleic acid construct to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, mini circles, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term "vector” includes an autonomously replicating plasmid or a virus, but the term may also be construed to include nonplasmid and non-viral compounds, which facilitate transfer of the isolated nucleic acid construct into cells, such as, for example, polylysine compounds, liposomes, lipid nanoparticles (LNPs), and the like. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, and the like.

[0098] It is to be noted that dosage values may vary with the severity of the condition to be alleviated. For any particular subject, specific dosage regimens may be adjusted over time according to the individual need and the professional judgment of the personadministering or supervising the administration of the compositions. Dosage ranges set forth herein are exemplary only and do not limit the dosage ranges that may be selected by medical practitioners. The amount of active compound(s) in the composition may vary according to factors such as the disease state, age, sex, and weight of the subject. Dosage regimens may be adjusted to provide the optimum therapeutic response. For example, a single bolus may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation. It may be advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage.

[0099] In general, nucleic acid constructs as described herein should be used without causing substantial toxicity. Toxicity of the nucleic acid constructs as described herein can be determined using standard techniques, for example, by testing in cell cultures or experimental animals and determining the therapeutic index, i.e., the ratio between the LDso (the dose lethal to 50% of the population) and the LD100 (the dose lethal to 100% of the population). In some circumstances however, such as in severe disease conditions, it may be appropriate to administer substantial excesses of the nucleic acid constructs. Some compounds as described herein may be toxic at some concentrations. Titration studies may be used to determine toxic and non-toxic concentrations. Toxicity may be evaluated by examining a particular nucleic acid construct's specificity across cell lines.

[0100] Nucleic acid constructs as described herein may be administered to a subject. As used herein, a "subject" may be a human, non-human primate, rat, mouse, cow, horse, pig, sheep, goat, dog, cat, etc. The subject may be suspected of having or at risk for having a cancer.

[0101] As used herein "cancer” is meant to include a group of diverse diseases resulting from abnormal cell growth, usually due to uncontrolled cell growth, where the cells have the potential to invade or spread to other parts of the body. The cancer may be selected from one or more of the following: AIDS-related cancer; anal cancer; brain cancer; bile duct cancer; bladder cancer; blood cancer; bone cancer; breast cancer; bronchial cancer; cardiac cancer; central nervous system cancer; cervical cancer; colorectal cancer; endometrial cancer; esophageal cancer; eye cancer; fallopian tube cancer; gallbladder cancer; gastric cancer; germ cell cancer; gastrointestinal cancer;heart cancer; hepatocellular cancer; hypopharyngeal cancer; islet cell cancer; lung cancer; Langerhans cell histiocytosis (LCH); metastatic cancer; nasopharyngeal cancer; neuroendocrine cancer; ovarian cancer; pancreatic cancer; prostate cancer; renal cancer; rectal cancer; skin cancer; testicular cancer; thyroid cancer; urethral cancer; uterine cancer; vaginal cancer; vascular cancer; and vulvar cancer. Alternatively, the cancer may be selected from one or more of the following: carcinoma; leukemia; lymphoma; myeloma; and sarcoma. Alternatively, the cancer is selected from one or more of the following: astrocytoma; blastoma; craniopharyngioma; chordoma; ependymoma; glioblastoma; histiocytoma; melanoma; multiple myeloma; nephroblastoma; neuroblastoma; osteosarcoma; paraganglioma; pheochromocytoma; plasmacytoma; pleuropulmonary blastoma; retinoblastoma; rhabdomyosarcoma; sarcoma; thymoma and thymic carcinoma; and uterine sarcoma. Alternatively, the cancer may be selected from one or more of the following: acute lymphoblastic leukemia (ALL); acute myeloid leukemia (AML); adrenocortical carcinoma; AIDS-related lymphoma; astrocytoma; basal cell carcinoma; Burkitt lymphoma; cholangiocarcinoma; chronic lymphocytic leukemia (CLL); chronic myelogenous leukemia (CML); cutaneous T-cell lymphoma; diffuse intrinsic pontine glioma (DIPG); ductal carcinoma in situ (DCIS); endometrial uterine cancer; esthesioneuroblastoma; Ewing sarcoma; gastrointestinal neuroendocrine tumors; gastrointestinal stromal tumors (GIST); gestational trophoblastic disease (GTD); hairy cell leukemia; Hodgkin lymphoma; hypopharyngeal cancer; intraocular melanoma; Kaposi sarcoma; malignant fibrous histiocytoma; malignant mesothelioma; medulloblastoma; merkel cell carcinoma; midline tract carcinoma; multiple endocrine neoplasia (MEN) syndrome; myeloproliferative neoplasms; myelodysplastic syndrome; mycosis fungoids; nasopharyngeal cancer; nasal cavity and paranasal sinus cancer; neuroblastoma; NonHodgkin lymphoma; non-small cell lung cancer; oral cancer; oropharyngeal cancer; osteosarcoma; papillomatosis; paraganglioma; parathyroid cancer; penile cancer; pharyngeal cancer; pituitary cancer; plasma cell neoplasm; pleuropulmonary blastoma; primary CNS lymphoma; pulmonary inflammatory myofibroblastic tumor; retinoblastoma; rhabdomyosarcoma; salivary gland cancer; small cell lung cancer; squamous cell carcinoma; tracheobronchial cancer; uterine sarcoma; and Wilms tumor.

[0102] Alternatively, the cancer may be selected from one or more of the following: carcinoma, squamous cell carcinoma, adenocarcinoma, sarcoma, leukemia, neuroma, melanoma, lymphoma and myeloma.

[0103] Alternatively, the cancer may be a squamous cell carcinoma selected from one or more of the following: cervix, sputum, conjunctiva, vagina, lung, oral cavity, skin, bladder, tongue, larynx or esophagus.

[0104] Alternatively, the cancer may be an adenocarcinoma selected from one or more of the following: prostate, small intestine, endometrium, cervix, large intestine, lung, pancreas, esophagus, rectum, uterus, stomach, breast or ovary.

[0105] Alternatively, the cancer may be selected from one or more of the following: lung cancer, colon cancer, esophageal cancer, ovarian cancer, melanoma, or lymphoma. The lung cancer is lung squamous cell carcinoma or lung adenocarcinoma. Alternatively, the cancer may be selected from one or more of the following: breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, renal cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer. Examples of a cancer include, but are not limited to, melanoma, lung cancer, brain cancer, breast cancer, colorectal cancer, pancreatic cancer, liver cancer, prostate cancer, skin cancer, kidney cancer, bladder cancer, or prostate cancer.

[0106] In some embodiments, the nucleic acid constructs, described herein, may be used the treatment of one or more cancers. In some embodiments the nucleic acid constructs may be used in the preparation of a medicament or a composition for systemic treatment of an indication in a subject in need of treatment. In some embodiments, methods of systemically treating any of the indications described herein are also provided.

[0107] As used herein "genomic analysis” encompasses the determination of overexpressed genes and pathways useful in the determination of local and micro-environmental contexts that are capable of driving promoter activity or that may be targeted by amiRNA to inhibit oncogenesis or modulate native immune-associated activity to achieve a therapeutic effect.

[0108] As used herein "tumour type, tissue type, or cell type” include pathology and clinical case reports associated with the particular tumour, tissue, or cell type. In particular, the pathology of a malignant cell may be characterized based on cell morphology, acceleration of the cell cycle, genomic alterations, invasive growth,increased cell mobility, chemotaxis, changes in the cellular surface, secretion of lytic factors, etc.

[0109] Various alternative embodiments and examples are described herein. These embodiments and examples are illustrative and should not be construed as limiting the scope of the invention.

[0110] MATERIALSAND METHODS

[0111] Cell Lines, Antibodies, Cytokines, and Inhibitors

[0112] HEK293T cells (ATCC) were cultured in Dulbecco’s modified Eagle medium (DMEM, Gibco™) containing L-Glutamine, supplemented with 10% fetal bovine serum (FBS, Corning) and Penicillin-Streptomycin (Gibco™). FLO-1 and SKGT4 cells were cultured in Roswell Park Memorial Institute (RPMI) 1640, supplemented with 10% FBS (Corning) and 1% Penicillin-Streptomycin (Gibco™). Cells were maintained at 37 °C in 5% CO2 at 100% relative humidity.

[0113] Primary antibodies used were GAPDH (2118S, Cell Signaling Technology™) and P -actin (497 OS, Cell Signaling Technology™). Human TNF-alpha Recombinant Protein (A42552, ThermoFisher Scientific™) was reconstituted in sterile double-distilled water to 100 pg / mL, aliquoted, and stored at -20 °C. Human Oncostatin M Recombinant Protein (PHC5015, Gibco™) was reconstituted in sterile, distilled water to a concentration of 10 pg / mL, aliquoted, and stored at -20 °C. TPCA-1 (abl45522, Abeam™) and Ruxolitinib™ (11609-1, Cayman Chemical Co. ™) were reconstituted to 100 mM and 50 mM, respectively, in DMSO, aliquoted, and stored at -80 °C.

[0114] Plasmids and promoter cloning

[0115] Plasmids containing mCherry™ and an amiRNA targeting GFP were synthesized and cloned into the pcDNA3.1(+) backbone by Genscript™. In this construct, the CMV enhancer / promoter sequence drives the expression of mCherry™ and the amiRNA. This plasmid served as the vector backbone for subsequent cloning of other amiRNAs as well as alternative promoters.

[0116] The NFKB response element (RE) promoter was cloned into the mCherry™-amiRNA pcDNA3.1 (+) vector backbone by restriction digestion of an in house plasmid containing a transcriptional pause site linked to 5 NFKB RES and a minimal promoter. Following dephosphorylation of the vector backbone (Quick CIP™, NEB™) and gel extraction of the vector backbone and inserts (Monarch DNA Gel Extraction Kit™, NEB™), the backbone and inserts were ligated using T4 DNA ligase (NEB™) and transformed into NEB™ Stable competent E. coli (NEB™). The resulting plasmid was verified by sanger sequencing (Genewiz™) and contained a transcriptional pause site, 5x NFKB RE, and a minimal promoter operably linked to mCherry™ and an amiRNA in the pcDNA3.1(+) vector backbone. The STAT3 RE, hTERT, CEA, Gata6, andMMP1 promoters were synthesized by Genscript™ and cloned using traditional cloning (as described above) into the mCherry™-amiRNA pcDNA3.1(+) vector backbone. For the hTERT, CEA, Gata6, and MMP1 promoters, the resulting plasmid did not contain a minimal promoter (as with the NFKB RE and STAT3 RE constructs), but did retain all other elements of the plasmid as described above.

[0117] Full promoter and response element deletion plasmids were generated by seamless cloning. In brief, PCR was performed using primers that flanked the region to be deleted and the Q5 Hot Start High-Fidelity 2x Master Mix™ (NEB™), followed by phosphorylation of the DNA ends from the PCR product and subsequent ligation using the NEB KLD enzyme mix. Ligation products were then transformed into NEB stable competent cells and Sanger sequencing was performed (Genewiz™) to confirm the deletion.

[0118] amiRNA design and cloning

[0119] Artificial miRNAs (amiRNAs) were designed using the Invitrogen BLOCK-iT™ RNAi Designer Web Tool™. Accession numbers (eg. NM_001289746.2 for GAPDH and NM_005030.6 for PLK1) were used for input of human genes, while the GFP nucleotide sequence was entered manually. The web tool generated a list of 21-mer sense sequences and designed the corresponding miR RNAi, which included the reverse complement of the 21-mer sense sequence, an optimized loop sequence, and nucleotides 1-8 and 11-21 of the sense strand. A negative, non-targeting control miR RNAi sequence, designed to form a hairpin structure and be processed into mature miRNA, was also obtained. 5’ and 3’ flanking regions of mmu miR-155 were also added to aid in processing and stability of the amiRNA. Lastly, appropriate restriction enzyme cut sites were added on the 5’ (BamHI) and 3’ (Bglll, EcoRI) ends of the mmu miR-155 flanking regions. In summary, the resulting amiRNAs to be synthesized included, from 5’ to 3’: BamHI - 5’ mmu miR155 - miR RNAi - 3’ mmu miR155 - Bglll - EcoRI.

[0120] amiRNAs were synthesized by Genscript™ (amiR-Cntrl, amiR-GRB7, amiR-GPRC5B, amiR-TRPSl, amiR-CDK6, amiR-DKKl) and IDT (amiR-PLKl, amiR-GAPDH). Traditional cloning was performed, using restriction enzymes BamHI-HF (NEB™) and EcoRI-HF (NEB™) to clone the amiRNAs into the mCherry™-amiRNA pcDNA3.1(+) vector backbone. For cloning multiple amiRNAs in a single vector (chaining), a modified mCherry™-amiRNA pcDNA3.1(+) vector backbone that lacked the Bglll RE cut siteupstream of the promoter region (mCherry™-amiRNA Bglll DEL pcDNA3.1(+)) was first produced by seamless cloning, using PCR and the NEB KLD™ enzyme mix as described above. To clone chained amiRNAs, the mCherry™-amiRNA Bglll DEL pcDNA3.1(+) vector backbone was digested with Bglll (NEB™) and Xhol (NEB™), while the amiRNA to be inserted was digested with BamHI-HF (NEB™) and Xhol (NEB™). Subsequent traditional cloning steps were then performed as described above (see 'Plasmids and promoter cloning’).

[0121] Promoter 2.0™ Prediction of Promoter Sites and Transcriptional Start Sites

[0122] The reverse complement plasmid backbones were run through 'promoter 2.0™' (https: / / services.healthtech.dtu.dk / services / Promoter-2.0 / ). Note thatthe "forward" of the reverse complement (which is what promoter 2.0™ measures) is representative of promoter activity in the reverse direction.

[0123] pcDNA3.1 Backbone (CMV promoter / amplicon region removed)Position Score Likelihood1400 0.630 Marginal prediction 2300 0.551 Marginal prediction 3000 0.558 Marginal prediction 3700 0.685 Marginal prediction

[0124] pLJM backbone (CMV promoter region removed) pLJM_noamplicon_reverse_complement _6855 bp_, 6855 nucleotidesPosition Score Likelihood700 0.619 Marginal prediction 1500 0.622 Marginal prediction 3100 1.052 Highly likely3700 1.108 Highly likely4600 0.738 Marginal prediction 5800 0.708 Marginal prediction

[0125] pCaggs backbone (CMV promoter region removed)

[0126] pCaggs_noCMV_reverse_complement _3065 bp_, 3065 nucleotides Position Score Likelihood1300 0.630 Marginal prediction

[0127] ElemeNT™ analysis for the the identification of core promoter elements and transcription factor binding sites

[0128] ElemeNT™ (ElemeNT version 2023 - Elements Navigation Tool) program predicts and identifies core promoter elements, transcription factor binding sites and analyzes their relationship to one another!78!. The output gives a score for the individual elements and lists those, if any, that are found ‘together’, indicating a greater likelihood of possible promoter activity.

[0129] Parameters:

[0130] Set ElemeNT™ algorithm to Human with 40.4% GC value (%) as background.

[0131] The sequence of interest is then entered. Since the "position” given by the promoter 2.0™ output indicates a transcriptional start site within 100 base pairs upstream of the "position”, we entered this (the sequence that is 100 base pairs upstream of the "position”) into the ElemeNT™ analysis program.

[0132] Search parameters were selected as follows with default cutoff values: TATA box (cutoff 6.0); BRE upstream (cutoff 5.8); BRE downstream (cutoff 4.2); GAGA (cutoff 6.7); Mammalian Initiator (cutoff 0.7); BBCABW Initiator (cutoff 3.6); Human TCT motif (cutoff 6.0); XCPE1 (cutoff 4.0); XCPE2 (cutoff 6.0); MTE (cutoff 8.5); and DPE (cutoff 0.7).

[0133] If no combinations are identified, ElemeNT™ lists the elements found with the scores, etc., but will output " No combinations of core promoter elements were detected in the input sequence.” To further narrow down the marginal findings, ElemeNT™ may predict at least 1 combination of core promoter elements based on the above analysis parameters (within the sequence predicted by promoter 2.0™).

[0134] Linearized plasmid, amplicon, and mini-circle production

[0135] To generate linearized plasmids for transfection, plasmids of interest were digested with BstBI (NEB™) and gel extracted (Monarch DNA Gel Extraction Kit™, NEB™). To generate amplicons, PCR was performed on the plasmids of interest using the Q5 Hot Start High-Fidelity 2x Master Mix™ with the forward primer (GCTACAACAAGGCAAGGCTTGA (SEQ ID NO:558J) and reverse primer (AGCTGGTTCTTTCCGCCTC (SEQ ID NO:559J). The resulting PCR amplicon was then purified by gel extraction prior to transfection.

[0136] Mini circles were synthetically produced from amiRNA plasmids that lacked mCherry™. Therefore, prior to mini-circle production, the mCherry™ fluorescent marker was removed from the promoter-mCherry™-amiRNA pcDNA3.1(+) vector backbones by seamless cloning, using PCR and the NEB™ KLD enzyme mix as described above. Then, mini circle DNA that lacks the components in the pcDNA3.1(+) vector backbone was synthetically produced following the method described by Oliynyk and Church (2022) I77]. To summarize the protocol, PCR was first performed on the mCherry™ deletion plasmids - containing the transcriptional pause site, NFKB RE (or without the NFKB RE, denoted by RE DEL), Minimal Promoter, amiRNA (Cntrl or GAPDH), and BGH poly-A signal - using Q5 Hot Start High-Fidelity 2x Master Mix™ with the forward primer (ATCGTAGGTCTCAAACCGCTACAACAAGGCAAGGCTTGA (SEQ ID NO:560J) and reverse primer (ATCGTAGGTCTCAGGTTTAGCTGGTTCTTTCCGCCTC (SEQ ID NO:561)). After gel extraction of the PCR products, circularization of the PCR products was performed by incubating T4 DNA Ligase (NEB™), BsaI-HFv2 (NEB™), and Adenosine 5 '-Triphosphate (ATP, NEB™) with 6 pg of the PCR products in a thermocycler at 37 °C for 60 minutes, followed by 65 °C for 15 minutes. The remaining linear DNA was then digested with T5 Exonuclease (NEB™) followed by PCR cleanup of the resulting mini circle DNA (QIAquick PCR Purification Kit™, Qiagen™).

[0137] DNA Transfections

[0138] HEK293T cells were seeded and grown to approximately 60% confluency in 24-well plates. Cells were then transfected using jetPRIME™ (Polyplus™) transfection reagent, with either circular plasmid (0.5 pg / well), linearized plasmid (0.5 pg / well), amplicon (0.2 pg / well), or mini circle (0.2 pg / well). Per well, 1 pL and 0.5 pL ofjetPRIME reagent™ was used for the 0.5 pg / well and 0.2 pg / well conditions respectively, with both conditions requiring 50uL of jetPRIME buffer™. The remaining transfection steps were performed according to the manufacturer’s protocol. When applicable, cytokines and / or inhibitors were added to transfection reagent-containing media 6h post transfection. 18-24h post transfection, the media was replaced with fresh media, also containing the appropriate cytokine and / or inhibitor when applicable. Cells were imaged using the Incucyte S3™ (Sartorius™) starting at 6h post-transfection, with RNA and protein collected at 72h post-transfection when applicable.

[0139] DNA Transfections section update for transfecting esophageal cancer cell lines

[0140] FLO-1 and SKGT4 cells were seeded according to experimental requirements. For exemplary amiRNA transfection experiments, FLO-1 cells were seeded at 1 x 105cells per well in 12-well plates. For promoter reporter assays, FLO-1 and SKGT4 cells were seeded at 5 x 104cells per well in 24-well plates. Cells were incubated overnight at 37 °C with 5% CO2to reach approximately 70% confluency. Transfection mixtures were prepared in sterile 1.5 mL microcentrifuge tubes using 100ul Opti-MEM. For exemplary amiRNA transfection experiments, 0.5 pg of plasmid DNA (miR-CNTRL, miR-GRB7, miR-CDK6, miR-TRPSl, miR-DKKl, or miR-GPRC5B) was mixed with 1.5 pL X-tremeGENE™ HP DNA Transfection Reagent (Sigma™) in 100 pL Opti-MEM. For promoter activity experiments, 0.5 pg plasmid DNA (GATA6 Prom, MMP1 Prom, CEA Prom, NFKB RE, or STAT3 RE) was combined with 1 pL X-tremeGENE™ HP DNA Transfection Reagent in 100 pL Opti-MEM. Transfection mixtures were incubated for 30 minutes at room temperature and then added dropwise to the corresponding wells. For promoter and amiRNA transfection experiments, plates were placed in the IncuCyte S3™ (Sartorius™) and imaged 4 to 8 hours post-transfection. Media was replaced with fresh media after 24 hours, and TNFa or Oncostatin M was added to freshly changed media at a concentration of 10 ng / mL for wells transfected with NFKB RE or STAT3 RE, respectively.

[0141] Detection of processed and mature amiRNA by stem-loop reverse transcription-quantitative PCR (RT-qPCR) using TaqMan™ small RNA assays

[0142] 72h post transfection, RNA was collected using the miRNeasy Tissue / Cells Advanced Mini Kit™ (Qiagen™) according to manufacturer’s protocol. Single strandedsmall RNA was converted to cDNA by performing a RT using the TaqMan™ MicroRNA Reverse Transcription Kit (ThermoFisher Scientific™) and RT primers specific to RNU24 (Assay ID: 001001, Cat No. 4427975) or GAPDH (Custom TaqMan™ small RNA assay, Cat No. 4398987, context sequence TATTGATGGTACATGACAAGGG (SEQ ID N0:580)), according to manufacturer’s protocol and using 10ng of RNA as input. qPCR reactions were prepared according to the TaqMan™ small RNA assay protocol. In brief, each 10pL qPCR reaction contains, 0.5 p. L of TaqMan™ Small RNA Assay (2 Ox) for GAPDH (FAM-labeled, Custom TaqMan™ small RNA assay Cat No. 4398987, context sequence TATTGATGGTACATGACAAGGG (SEQ ID N0:580)) or RNU24 (FAM-labeled, Assay ID: 001001, Cat No. 4427975), 5pL of TaqMan™ Universal Master Mix II, no UNG (Applied Biosystems™), 3.84pL of nuclease-free water, and 0.67pL of cDNA template from above RT reaction. Amplification was performed on a Quant Studio 5™ (Applied Biosystems™) using standard cycling conditions: hold 95 °C for 10min, 40x cycles of 95°C 15 seconds and 60 °C 1 minute. Data was exported from the QuantStudio Design & Analysis Software™ (vl.5.2). Relative expression levels were calculated using the AACt method, where miR-GAPDH small RNA Ct values were normalized to the RNU24 reference miRNA (ACt), then further normalized to the Tert Prom-miR-GAPDH sample or STAT3 RE miR-GAPDH OSM treated sample (AACt), and expressed as 2A(-AACt).

[0143] Fluorescence-based promoter and amiRNA assays

[0144] 6h post transfection, cell images were acquired with an Incucyte S3™ livecell imaging system (Sartorius™) with an S3 / SX1 G / R Optical Module. For 24-well plates, either 4 or 5 images per well were acquired every 4h up to 72h post-transfection using a standard scan type at 4x magnification. The system was set to capture phase contrast, red fluorescence (400 ms acquisition time) for mCherry™, and green fluorescence (300 ms acquisition time) for GFP (when applicable).

[0145] Data analysis was performed using Incucyte Software™ (Versions 2022 A & 2023A). Confluence was measured using Al confluence segmentation under standard settings. Red mean fluorescence intensity per image was measured using standard settings. Red integrated intensity was analyzed using Surface Fit segmentation, a threshold of 0.1 RCU, edge split off, and no filters. Data for red integrated intensity was presented as red integrated intensity per well or per image and was normalized to confluence when indicated. Green fluorescence intensity for HEK293T-GFP amiR-GFPexperiments was analyzed using Top-Hat™ segmentation with a radius of 100 pm, a threshold of 1 GCU, edge split off, and no filters. Data for the green channel was presented as green fluorescence intensity per well normalized to confluence.

[0146] Quantitative PCR Gene Expression Analysis

[0147] 72h post transfection, RNA was collected using the RNeasy mini prep kit™ (Qiagen™) according to manufacturer’s protocol. RNA was then converted to cDNA using the High-Capacity cDNA Reverse Transcription Kit™ with RNase (ThermoFisher Scientific™). Quantitative PCR (qPCR) was performed using TaqMan Gene Expression Assays™ with GAPDH (FAM-labeled, Assay ID: Hs02786624_gl) or PLK1 (FAM-labeled, Assay ID: Hs00983227_ml), GRB7 (FAM-labeled, Assay ID: Hs00917999_gl), DKK1 (FAM-labeled, Assay ID: Hs00183740_ml), TRPS1 (FAM-labeled, Assay ID:Hs00936363_ml), GPRC5B (FAM-labeled, Assay ID: Hs00212116_ml), or CDK6 (FAM-labeled, Assay ID: Hs01026371_ml) as the target genes and 18S rRNA (VIC-labeled, Assay ID: Hs99999901_sl) as the reference gene. Reactions were prepared using the TaqMan Gene Expression Master Mix™ (Applied Biosystems™) in 10uL volumes, according to manufacturer’s protocol. Amplification was performed on a Quant Studio 5™ (Applied Biosystems™) using standard cycling conditions: hold 50 °C for 2 min, hold 95 °C for 10min, 40x cycles of 95°C 15 seconds and 60 °C 1 minute. Data was exported from the QuantStudio Design & Analysis Software™ (vl.5.2). Relative expression levels were calculated using the AACt method, where GAPDH or PLK1 Ct values were normalized to the 18S rRNA reference gene (ACt), then further normalized to the control sample (AACt), and expressed as 2A(-AACt).

[0148] Protein Expression Analysis

[0149] 72h post transfection, cells were washed once with PBS and lysed with RIPA buffer containing the Halt Protease and Phosphatase Inhibitor Cocktail™ (ThermoFisher Scientific™). Protein expression was analyzed using the Wes Simple Western™ automated capillary western blot system (ProteinSimple™) according to the manufacturer’s instructions. Briefly, protein lysates were quantified using the Pierce BCA Protein Assay Kit™ (ThermoFisher Scientific™), and 4 pg of total protein was loaded per capillary. Samples were separated by size, immobilized, and probed with primary antibodies against GAPDH and loading control, p-actin. Detection was performed using the Anti-Rabbit Detection Module (ProteinSimple™) andchemiluminescence signals were visualized and exported using the Compass for Simple Western Software™ (v6.1.0).

[0150] Cell Viability Assay

[0151] Black 96-well plates with clear bottom (ViewPlate-96 F TC, PerkinElmer™) were coated with Poly-D -Lysine (50 pg / mL working concentration, Gibco™) prior to seeding HEK293T cells and growing them to a confluency of approximately 50%. Cells were then transfected using jetPRIME™ (Polyplus™) transfection reagent with 40 ng of DNA amplicon, 0.1 pL of jetPRIME™ reagent, and 10 pL of jetPRIME™ buffer per well, following the manufacturer’s protocol. When applicable, cytokines and / or inhibitors were added to transfection reagent-containing media 6h post transfection. 18-24h post transfection, the media was replaced with fresh media, also containing the appropriate cytokine and / or inhibitor when applicable, as well as the Incucyte Caspase 3 / 7 Green Dye™ (Sartorius™) diluted into the media at a 1:1000 ratio. Cells were imaged using the Incucyte S3™ live-cell imaging system (Sartorius™) starting at 24h post-transfection following the settings as described in 'Fluorescence-based promoter and amiRNA assays’, with the exception of using 10x magnification and collecting 4 images / well.

[0152] Data analysis was performed using Incucyte Software™ (Version 2023A). Spectral unmixing was applied prior to image analysis, with '%R contributes to G' set between 1.4 and 1.6, adjusted per experiment based on single-color controls, and '%G contributes to R' set to 0. Confluence was measured using Al confluence segmentation under standard settings. Green fluorescence intensity was analyzed using surface fit segmentation at a threshold of 2.5 GCU and with edge split off. Area filters were also applied for the green channel, with a minimum area cutoff of 20 pm2and a maximum area cutoff of IE 5 pm2. Red fluorescence intensity was analyzed using surface fit segmentation at a threshold of 0.5 RCU, with edge split off, and with no filters applied.

[0153] Statistical Analysis

[0154] Statistical analysis was performed using GraphPad Prism Software™ (Version 10). Student's ttests were performed, with * p<0.05, ** p<0.01, *** p<0.001, ****p<0.0001.

[0155] General Nucleic Acid Manufacturing

[0156] The synthesis of an nucleic-acid based therapeutics may include:Chemical synthesis, enzymatic synthesis, cell-based nucleic acid production (for example, plasmid or mini circle DNA production), or cell-free nucleic acid production, including but not limited to solid-phase oligonucleotide synthesis, polymerase-mediated amplification, and microbial or cell-free production systems, optionally followed by purification, modification, encapsulation and formulation steps for delivery and storage, and each step may be achieved using processes described herein or known in the art.

[0157] EXAMPLES

[0158] EXAMPLE 1: Development of a Nuclear factor-KB (NF-KB) inducible artificial microRNA (amiRNA)-mediated knockdown of target gene expression

[0159] Herein are described artificial miRNA expression cassettes containing NF-KB response elements upstream of a minimal promoter (FIG. 2), for which specific and controlled expression of a miRNA is demonstrated, which functions to reduce expression of a target gene in response to stimuli that activates, or is under the control of, the NF-KB signaling pathway, such as Tumor necrosis factor a (TNFa).

[0160] As proof of concept of this system, we induced stable expression of GFP protein in Hek293T cell lines and designed miRNA sequences targeting GFP. We first determined the ability of our synthetically designed GFP miRNA to suppress the targeted protein by transfecting into cells a constitutive cytomegalovirus (CMV) promoter driven construct, which contains a CMV promoter that drives the expression of the mCherry™ fluorescent reporter protein and the miRNA. Once we confirmed the miRNA was functional under a constitutive promoter, we replaced the CMV promoter with the inducible NF-KB promoter response element (RE). We then transfected this inducible NF-KB RE miRNA construct into Hek293T cells that stably express GFP under a CMV promoter (Hek293T-GFP cells) and stimulated the cells with TNFa to induce expression of the NF-KB responsive construct. Stimulation of cells with TNFa was performed at 6 hours post transfection and cells were imaged over 72h to observe red reporter and green target fluorescence intensities over time. As expected, an increase in mCherry™ reporter signal in response to TNFa in cells transfected with NF-KB RE miR-GFP and miR-CNTRL constructs was observed, but reduced mCherry™ signal in RE DEL miR-GFP transfected cells lacking the NF-KB RE promoter was also seen (FIG. 3 A).Deletion of the NF-KB RE element resulted elevated GFP levels that were significant when compared with the complete NF-KB miR-GFP, but did not return to basal control levels of GFP expression (NF-KB RE miR-CNTRL) in response to TNFa. The fact that decreased GFP target protein signal was observed in both the NF-kB RE miR-GFP and NFkB promoter deletion RE DEL miR-GFP constructs (FIG.3 A) suggests plasmid crosstalk or reverse promoter activity mediating leakage of the miRNA from the circularised plasmid construct (see below Promoter 2.0™ and ElemeNT™ analyses -TABLE 5).

[0161] Thus, we next explored whether plasmid linearization, produced by restriction enzyme digestion and cleanup, would improve the specificity of action of the test expression cassette and limit non-specific leakage / release of gene targeting miRNA, using the NF-KB RE and RE DEL miR-GFP constructs. As expected, we do not detect mCherry™ fluorescence in response to TNFa in the cells transfected with the RE DEL miR-GFP construct (FIG.3B). However, we do still detect a reduction in GFP target gene levels in RE DEL miR-GFP transfected cells, indicating that linearization of the plasmid alone did not rescue the observed miRNA leakage (FIG.3B). Thus, 3D structure, in this case linearization, was not responsible for the observed leakage. Note that reverse leakage would result in non-functional protein (mCherry™) but functional miRNA, whereas forward leakage would result in both mCherry™ and miRNA production.

[0162] We next explored whether construct size reduction or non-specific sequence removal may facilitate improved promoter control fidelity. For this, selective PCR amplification of the regions coding the transcriptional pause site, promoter, mCherry™, miRNA, and poly-A signal were performed from the plasmid constructs followed by purification of this linear fragment. These "amplicons” were then transfected and treated as in the preceding experiments. In these experiments deletion of the promoter response elements (RE DEL miR-GFP) resulted in effectively no reduction in levels of GFP reporter when compared to NFKB RE miR-CNTRL in response to TNFa treatment of transfected cells (FIG. 3C). Critically, GFP fluorescence were only reduced in NFkB RE miR-GFP amplicon transfected cells following TNFa exposure (FIG. 3C). These findings support the conclusion that amplicon expression cassettes that lack plasmid backbone sequence elements provide improved fidelity over plasmids in TF binding element-driven promotion of miRNA-mediated silencing. Thus, eukaryote promoter-mediatedcontrol of miRNA production may be harnessed for targeted silencing of disease-associated gene expression in the settings and contexts as outlined above and below.

[0163] In excluding sequences from isolated nucleic acid construct, the focus has been on the contiguous segment between the amiRNA expression cassette or the polyA signal; and the pause site or the promoter, whereby a sequence may be present that could initiate transcription in the reverse direction. These sequences may be on the sense or antisense strand. The sequences to "exclude” would most likely be on the antisense strand, but it is possible that a transcription factor (TF) can bind to the sense strand as well to help initiate transcription, which may not be desirable.

[0164] For a circular construct, the sequences of interest to possibly exclude are located is this ‘contiguous’ segment. For a linear construct, it would be the segment downstream of the poly A signal (as there would be a physical ending to the sequence that naturally does not include the pause site or promoter, as this is at the beginning of the linear construct).

[0165] Any sequence downstream of the amiRNA expression cassette that causes unintended reverse transcriptional activity would be a sequence to exclude. However, while our experimental evidence demonstrates that sequences downstream of the polyA signal (i.e. after the amiRNA cassette) are potentially problematic, the ElemeNT™ analysis does still sometimes predict some transcription start sites (TSSs) within the polyA signal, but the Promoter 2.0™ analysis does not. Since the predicted sequences in the polyA signal do not actually result in transcription initiation, the ElemeNT™ predictions may be ignored in the polyA signal, and their presence in this region does not seem to have a significant effect on ‘reverse’ amiRNA production.

[0166] To exclude sequences from isolated nucleic acid construct, we may use computational algorithms and programs to predict the locations of transcriptional start sites. To assess potential reverse transcription events, the reverse complement of the sequence of interest is generated and analyzed using these predictive methods. Any known promoters present in the sequence of interest, such as the bidirectional SV40 promoter, may be identified using molecular biology tools and may also be removed.

[0167] Alternatively, another method to exclude sequences from isolated nucleic acid construct, might involve curating a database of known promoters (for example, from theEukaryotic promoter database, or other databases that store viral and bacterial promoter sequences) and create a local searchable database using those curated promoters. Especially where there is experimental evidence that the excluded sequences impaired the ability of a functional guide sequence to reduce the expression of a target nucleic acid. A sequence search of the backbone sequences may be done with the local curated database.

[0168] As shown in TABLE 5 below, a comparison of MiniCircle, Amplicon and Plasmid sequences for RE DEL miR-GAPDH Reverse Complement and NFKB RE miR-GAPDH Reverse Complement underwent Promoter 2.0™ and ElemeNT™ analyses.

[0169] TABLE 5: Promoter 2.0™ and ElemeNT™ analysesRE DEL miR-GAPDH Reverse ComplementPromoter 2.0™ ElemeNT™ Analysis Annotation Position Score Sequence 100 bp upstream Description of location of (Likelihood) of Promoter 2.0™ Promoter 2.0™ predicted prediction TSS (SnapGene™) Mini Circle No Promoter N / A N / APredictedAmplicon Position Score No combinations of core Within the 3' miR-155(Likelihood) promoter elements detected flanking sequence and part of the hairpin400 0.581(Marginal)Plasmid 1300 0.630 Mammalain Initiator + DPE; ColEl / pMBl / pBR322 / pUC (Marginal) BBCABW Initiator + DPE origin of replication 1800 0.542 No combination of core ColEl / pMBl / pBR322 / pUC (Marginal) promoter elements identified origin of replication et al. 2100 0.551 No combination of core E coll catabolite activator (Marginal) promoter elements identified protein binding site / portion of the promoter for the E coll lac operon2800 0.558 Mammalain Initiator + DPE; Neomycin / Kanamycin (Marginal) BBCABW Initiator + DPE antibiotic resistance gene 4000 0.766 No combination of core Within the fl bacteriophage (Marginal) promoter elements identified origin of replication 4600 0.581 No combination of core Within the 3' mi R- 155 (Marginal) promoter elements identified flanking region and part of the hairpin5600 0.690 combination of core Within the MinP and non(Marginal) promoter elements: TATA annotated sequence box + BRE Downstream +Mammalian Initiator;Mammalian Initiator + DPE;TATA box + BREDownstream + MammalianInitiator; MammalianInitiator + DPE; TATA box +BRE Downstream +Mammalian Initiator; TATAbox + BRE Downstream +BBCABW Initiator; BBCABWInitiator + DPE; BBCABWInitiator + DPE; TATA box +BRE DownstreamNFKB RE mi l-GAPDH Reverse ComplementMini Circle No Promoter N / A N / APredictedAmplicon 400 0.581 No combinations of core Within the 3' miR-155(Marginal) promoter elements detected flanking sequence and part of the hairpinPlasmid Same as above Same as above for RE DEL Same as above for RE DEL for RE DEL miR- miR-GAPDH Reverse miR-GAPDH Reverse GAPDH Reverse Complement Complement Complement

[0170] As performed in preceding experiments using miRGFP, we next developed and utilised amplicons driving miRNAs targeting eukaryotic genes (GAPDH) of the NF-kB-RE-miR-Cntrl, NF-kB-RE-miR-GAPDH and NFkB promoter deletion miR-GAPDH (RE DEL miR-GAPDH) constructs to validate the significant improvements achieved through removal of the plasmid backbone. As previously described, HEK293T cells were transfected with the indicated linear amplicons followed by treatment with vehicle, TNFa or TNFa plus the NF-kB inhibitor, TPCA1. RNA was extracted 72 Hours post transfection and analysed by real time RT-qPCR for GAPDH and 18s gene expression (FIG. 6). The levels of GAPDH were significantly suppressed in response to TNFa (FIG.6B). TNFa-induced GAPDH suppression was fully abrogated (100%) in cells transfected with the NF-kB promoter deletion miR- GAPDH (FIG. 6B). Additionally, GAPDH levels were partially abrogated (45%) by co-treatment with the NF-kB inhibitor TPCA1 in NF-kB-RE-miR-GAPDH amplicon transfected cells (FIG. 6B). At the protein level using capillary western blotting (WES system) the findings demonstrated at the mRNA level were verified (FIG. 6C). However, at the protein level, TPCA1 treatment completely abrogated TNFa-mediated GAPDH suppression in NF-kB RE miR-GAPDH transfected cells. Thus, specific control over target gene expression could be demonstrated using both a stable (GFP) or native (GAPDH)gene expression system with the TF-driven miRNA system.

[0171] In order to examine the sensitivity of control, mediated by the released miRNAs, we next examined both reporter protein and GAPDH levels following cytokine treatment of cells transfected with differing amplicon dose ranges. Dose ranges from 50ng to 300ng NF-kB-RE-amiR-GAPDH resulted in a stepwise increase in reporter protein production (red fluorescence) under TNFa treatment conditions (FIG. 5) and dose ranges from 25ng to 400ng STAT3-RE-amiR-GAPDH resulted in a stepwise increase in reporter protein production under Oncostatin M treatment conditions (FIG.9). Increasing concentrations of transfected RE DEL amiR-GAPDH resulted in marginalchanges in red reporter output and was significantly lower than that observed under promoter intact conditions.

[0172] Next we examined the ability of our promoter RE miRNA amplicons to mediate impactful alterations to cellular function in a controllable fashion. This would be achieved through selection of a gene that is important for cell viability, such as polo-like kinase 1 (PLK1), to be targeted by a synthetically designed pre-miRNA in the NF-kB-RE-miR amplicon. The PLK1 protein is a serine / threonine-protein kinase, with central roles in spindle assembly and thus mitosis and meiosis. Furthermore, PLK1 is a known proto-oncogene facilitating KRAS mutant driven tumorigenesis. Cells were transfected as before with the 3 amplicons NF- kB-RE-miR-CNTRL, NF-kB-RE-miR-PLKl and RE-DEL-miR-PLKl followed by treatment with vehicle, TNFa or TNFa+TCPAl (NF-kB inhibitor). Quantitative PCR (qPCR) analysis of gene expression showed that 24 hrs post transfection, PLK1 levels were reduced in TNFa treated NF-kB-RE-miR-PLKl transfected cells when compared control or promoter deletion transfected cells (FIG.7A). A fluorescence-based assay of apoptosis (cell death), measured by caspase-3 / 7 cleavage, was next utilised to quantify what were obvious changes in cell health under white light microscopy. High levels of caspase-3 / 7 cleavage were observed following TNFa treatment of cells transfected with the NF-kB-RE-miR-PLKl when compared to vehicle (FIG. 7B). Critically, this TNF-mediated caspase-3 / 7 cleavage in NFkB RE miR-PLK1 conditions was abrogated in response to the NF-kB inhibitor TPCA1 and deletion of the NFkB RE (RE DEL miR-PLKl) (FIG. 7B). Greater levels of caspase-3 / 7 cleavage were observed in NF-kB-RE-miR-PLKl transfected cells than either NF-kB-RE-miR-CNTRL or NFkB RE deleted RE DEL-miR-PLKl following vehicle treatment, reflecting basal NF-kB activity. Thus, TNFa induced and NF-kB -mediated induction of the synthetically designed miRNA, from our NF-kB RE miR-PLKl amplicon targeting PLK1 gene, resulted in accurate silencing of PLK1 and ensuing induction of a functional consequence, cell death, in a controlled manner.

[0173] EXAMPLE 2: NF-kB inducible miRNA-mediated targeted gene knockdown from mini circles

[0174] The presence of sequences, and thus proteins, and unmethylated CpG motifs of prokaryotic origin in pDNA vectors limits their clinical development and applicabilitythrough immune responses. Furthermore, the presence of these prokaryotic sequences may impact eukaryotic gene control. Supercoiled minicircles contain just the eukaryotic therapeutic cassette of interest, devoid of the vast majority of prokaryotic sequences. Furthermore, inclusion of scaffold / matrix attachment regions, although large (5kb), can confer episomal maintenance enabling minicircle replication at each eukaryotic cell cycle if persistence of the desired transgene is needed.

[0175] Amplicons possess numerous benefits, such as agility in chemical synthesis and an ability to add chemically protected nucleic acids. The supercoiling achieved by circular constructs, however, provides alternative benefits such as potentially higher transfectability and innate protection from degradation. That said, plasmids contain numerous non-eukaryotic sequences that impact synthetic promoter function, as detailed in preceding experimental data above. Thus, minicircle (>2000bps, non-viral DNA delivery vectors) versions of our promoter constructs were created, devoid of prokaryotic or viral sequences such as antibiotic resistance markers and containing our synthetic promoters driving payload amiRNA (i.e. isolated nucleic acid constructs), which as shown above may be scanned for such sequences that might interfere with the controlled amiRNA transcription (see EXAMPLE 1 and TABLE 5) to produce functional guide sequences that are capable of reducing the expression of a target nucleic acid. Minicircle constructs of the NF-kB RE miR-Cntrl, NF-kB-RE-miR-GAPDH and RE DEL miR-GAPDH constructs were created using a bacteria-free and virus-free fully synthetic method, and compared to their parental constructs. A similar level of TNFa- inducible GAPDH gene suppression was observed between amplicon and minicircle formats of the NF-kB- RE-miR-GAPDH construct (FIG.4C). Similarly, GAPDH returned to basal levels following deletion of the promoter region in both formats (FIG.4C).

[0176] EXAMPLE 3: Development of a Signal transducer and activator of transcription 3 (STAT3) inducible microRNA (miRNA) -mediated knockdown of target gene expression.

[0177] The STAT3 TF is the ying to NF-kB’s yang with respect to inflammation, cancer and cellular differentiation. Cytokines of the IL6 family mediate their signaling through receptor-associated Janus kinases (JAKs) resulting in phosphorylation of STAT3, dimerization and DNA binding in combination with NF-kB and SMAD -associatedproteins. IL6 family members include Leukemia inhibitory factor (LIF) and oncostatin M (OSM), which is a potent member of the cytokine family.

[0178] As per the approaches above a construct containing STAT3: STAT3 consensus response elements (SIE) was created and coupled with miR-GAPDH (STAT3 RE miR-GAPDH) and stimulated with OSM (10 ng / ml), resulting in a significant reduction in GAPDH expression at 72 hours when compared to control transfected (STAT3 RE miR-CNTRL) or vehicle treated cells (FIG. 8B). Treatment with the JAK inhibitor, Ruxolitinib, successfully abrogated OSM mediated GAPDH suppression, showcasing the specificity of the SIE response element driving the miRNA. (FIG. 8B). Importantly, the suppression of GAPDH in response to STAT3 RE miR-GAPDH transfection was dose dependent increasing over a 25-400ng / ml range of amplicon concentrations (FIG.9). Next a miRNA designed to target PLK1, was engineered into our STAT3 RE miR construct (STAT3 RE miR-PLKl). Cell health was monitored by a fluorescent caspase-3 / 7 cleavage assay following exposure of construct transfected cells to OSM. All control constructs performed as expected and were not significantly different from each other (FIG. 10). However, significantly higher caspase cleavage occurred in STAT3 RE miR-PLK1 transfected cells in response to OSM than vehicle treated cells, validating the approach (FIG. 10). Both deletion of the STAT3 RE element or Ruxolitinib treatment successfully inhibited the OSM -mediated alterations in caspase-3 cleavage verifying construct-specific function (FIG. 10).

[0179] EXAMPLE 4: Promoter specificity between TNFa- and OSM- driven promoters

[0180] To examine the specificity of promoter activity to external stimuli we next exposed cells transfected with the NF-kB RE miR-GAPDH to OSM and in turn cells transfected with STAT3 RE miR-GAPDH to TNFa inclusive of appropriate controls (FIG.11). Utilizing the red reporter channel no significant induction was observed when promoters were cross tested (eg. TNFa) with the alternate cytokine (STAT3 RE miR-GAPDH) when compared to control amplicon cells. All induction was inhibited in promoter deletion constructs (FIG. 11). Whereas correct matching of cytokine (eg. OSM) and promoter amplicon (eg. STAT3 RE miR-GAPDH) resulted in both significant induction of red reporter protein and suppression of GAPDH gene expression whencompared to the control amplicon (NF-kB RE miR-CNTRL) transfected cells (FIG. 11).Co-treatment with both TNFa and OSM did not result in any significant changes in either amplicon constructs when compared to either cytokine alone. Interestingly, co transfection of both NF-kB- and STAT3- RE miR-GAPDH followed by co treatment with both cytokines (TNFa and OSM) results in the most significant suppression of GAPDH gene than either cytokines alone (FIG. 11). This was not reflected in the red reporter channel due to signal reaching max capacity. Significantly, marginal or no suppression of GAPDH was noted under any condition treatment in promoter deleted constructs.

[0181] EXAMPLE 5: Cancer-enhanced promoters driving miRNA-mediated gene silencing and functional outcomes

[0182] Telomere shortening is a hallmark of aging and is counteracted by telomerase. The telomerase reverse transcriptase (TERT or hTERT) is a critical component of the telomerase complex that lengthens telomeres in DNA strands to prevent chromosomal degradation during successive rounds of replication. Thus, TERT is often upregulated in adult stem cells and importantly in the majority of cancer cells to protect from deleterious chromosomal damage. Significant correlations have been shown between telomerase activity and malignant tumours with 90% of malignancies displaying increased activity. Cancer associated pathways known to affect the expression of TERT include those associated with GSK3, STAT3, leptin, RAS, MYC / MAX / MAD, and mTOR. Mutations in the TERT promoter are known to create de novo ETS binding sites and to destroy MAD / MAX1 inhibitory EBOX sites relieving the transcriptional repression. These mutations occur highly in wide variety of cancer types (TABLE 6). Alternatively, structural alterations in the enhancer regions and copy number variation at the hTERT locus are similarly common (TABLE 6). Finally, infection of oncogenic virus is responsible for up to 15% of human malignancies

[0067] , and activation of telomerase is one of the key mechanisms behind viral carcinogenesis

[0047] , Thus a miRNA construct driven by a TERT promoter would be of significant and wide reaching consequence to all cancer types.

[0183] TABLE 6: Mutation typesMUTATION REARRANGMENT COPY NUMBER_ AMPLIFICATION _ GBM glioblastoma multiforme SARC sarcoma OV ovarian serouscystadenocarcinomaSKCM skin cutaneous melanoma LIHC liver hepatocellular ESCA esophageal carcinoma carcinomaBLCA bladder urothelial carcinoma KICH kidney chromophobe ACC adrenocortical carcinomaLIHC liver hepatocellular carcinoma Lung cancersLGG brain lower-grade gliomaHNSC head and neck squamous cellcarcinoma

[0184] The human carcinoembryonic antigen (CEA) family of genes were initially discovered through its primary member CEA in immunological tolerance and absorption studies of gastrointestinal cancers. Also known as CECAM5 or CD66e, CEA expression is the only blood based prognostic biomarker clinically approved for treatment regime determination and surveillance of tumour recurrence in postoperative CRC patients. Expression of CEA is predominant on epithelial cancers, 60% of all cancer types and 97% of gastrointestinal tumours. For the past few decades CEA targeting has been used in the development of anti-cancer agents such as targeting immune cell-based CAR-T treatments. Thus a miRNA driven by promoter regions of either the TERT or CEA genes would result in enhanced cancer specific action.

[0185] Tert and CEA promoters were cloned into the NFKB plasmid constructs (they replaced the NFKB RE and MinP promoter regions). Tert / CEA miR-CTRL, Tert / CEA miR-GAPDH, and promoter deletion amplicons were subsequently created for use in experiments. Significantly lower levels of GAPDH were observed in cells transfected with the Tert Prom miR-GAPDH construct compared to Tert Prom miR-CNTRL (p<0.0001), with only marginal differences between Tert Prom miR-CTRL and Prom DEL miR-GAPDH (FIG. 12B). As could be seen, utilising the red integrated intensity reading that measures the promoter activity, deletion of the Tert promoter significantly reduced the production of reporter protein (FIG. 12A). Similarly, significantly lower levels of reporter protein production was observed following deletion of the hCEA promoter from the miRNA construct (FIG. 12A) when compared to control of miR-GAPDH cells. As expected, the hCEA driven miR-GAPDH construct successfully suppressed GAPDH expression to a greater degree than control or promoter deleted constructs transfected cells (FIG. 12B). Following this, the constructs were adapted with a miRNA targeting PLK1 as in previous experiments to measure effects on cell health mediated by a Tert promoter-driven Tert Prom miR-PLKl. PLK1 genesuppression was achieved maximally at 72h post transfection with the Tert Prom miR-PLK1 construct, which could be successfully abrogated by deletion of Tert promoter (FIG. 13A), further validating the specificity of our constructs. Lastly, caspase 3 / 7 cleavage was observed after transfection with the Tert Prom miR-PLKl constructs, but not the Tert Prom miR-CNTRL or promoter deletion miR-PLKl constructs (FIG. 13B), demonstrating a clear and specific functional effect of our Tert promoter driven PLK1 knockdown. These data support the utility of constructs that place synthetically designed miRNAs targeting oncogenes or cancer-supporting genes, such as PLK1, under the control of transcription factor- driven promoters, such as those displayed above (Tert, hCEA, NF-kB and STAT3) whose activity is enhanced in or specific to cancer cells.

[0186] The Tert Promoter and STAT3 TF driven Oncostatin M (OSM) responsive promoter were used to test amiR-GAPDH expression (see FIG. 15A and 15B) as compared to control amiRNA and promoter deleted control.

[0187] EXAMPLE 6: FLO-1 Human Esophageal Adenocarcinoma Cell Knockdowns of Cancer Specific Targets

[0188] To test the ability of amiRNAs targeting cancer specific genes in human esophageal adenocarcinoma FLO-1 cells, FLO-1 cells were transfected with plasmids containing the ubiquitous CMV promoter driving expression of amiRNAs targeting (A) GRB7, (B) GPRC5B, (C) TRPS1, (D) CDK6, and (E) DKK1. As shown in FIG. 16A-E, amiRNAs were able to specifically target (A) GRB7, (B) GPRC5B, (C) TRPS1, (D) CDK6, and (E) DKK1.

[0189] EXAMPLE 7: Comparison of Human Esophageal Adenocarcinoma FLO-1 and SKGT4 Cells to Esophageal Cancer-enhanced Promoters

[0190] Gata6 promoter, MMP1 promoter, CEA promoter, NFKB RE promoter, and STAT3 RE promoter activity was tested on two esophageal cancer cell lines (i.e. FLO-1 FIG. 17A and SKGT4 FIG.17B) transfected with plasmids containing the indicated promoters driving the expression of mCherry and a CNTRL amiRNA. Cells transfected with the plasmid containing the NFKB RE were stimulated with TNFa and cells transfected with the plasmid containing STAT3 RE were stimulated with OSM. At 72h post transfection, mCherry™ (Red) reporter output was measured by imaging-basedfluorescence analysis to show red integrated intensity / image as a representation of each promoter to drive reporter expression in FLO-1 and SKGT4 esophageal cancer cell lines (FIG. 17A and FIG. 17B).

[0191] Various alternative embodiments and examples are described herein. These embodiments and examples are illustrative and should not be construed as limiting the scope of the invention.

[0192] Although various embodiments of the invention are disclosed herein, many adaptations and modifications may be made within the scope of the invention in accordance with the common general knowledge of those skilled in this art. Such modifications include the substitution of known equivalents for any aspect of the invention in order to achieve the same result in substantially the same way. Numeric ranges are inclusive of the numbers defining the range. The word "comprising” is used herein as an open-ended term, substantially equivalent to the phrase "including, but not limited to”, and the word "comprises” has a corresponding meaning. As used herein, the singular forms "a”, "an” and "the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a thing” includes more than one such thing. Citation of references herein is not an admission that such references are prior art to an embodiment of the present invention. The invention includes all embodiments and variations substantially as hereinbefore described and with reference to the examples and drawings.REFERENCES1 Busslinger GA, Weusten BLA, Bogte A, Begthel H, Brosens LAA, Clevers H. Human gastrointestinal epithelia of the esophagus, stomach, and duodenum resolved at singlecell resolution. Cell Rep 2021;34: 108819.2 Fu J, Sun Z, Wang X, Zhang T, Yuan W, Salem F, et al. The single-cell landscape of kidney immune cells reveals transcriptional heterogeneity in early diabetic kidney disease. Kidney Int 2022;102:1291- 304.3 de Andres MP, Jackson RJ, Felipe I, Zagorac S, Pilarsky C, Schlitter AM, et al. GATA4 and GATA6 loss-of-expression is associated with extinction of the classical programme and poor outcome in pancreatic ductal adenocarcinoma. Gut 2023;72:535-48.4 Farley EK, Olson KM, Zhang W, Brandt AJ, Rokhsar DS, Levine MS. Suboptimization of developmental enhancers. Science 2015;350:325-8.5 Tremblay M, Sanchez-Ferras 0, Bouchard M. GATA transcription factors in development and disease. Development 2018;145.6 Taube JH, Allton K, Duncan SA, Shen L, Barton MC. Foxal functions as a pioneer transcription factor at transposable elements to activate Afp during differentiation of embryonic stem cells. J Biol Chem 2010;285:16135-44.7 Zawel L, Dai JL, Buckhaults P, Zhou S, Kinzler KW, Vogelstein B, et al. Human Smad3 and Smad4 are sequence-specific transcription activators. Mol Cell 1998;1:611-7. 8 Benoit YD, Pare F, Francoeur C, Jean D, Tremblay E, Boudreau F, et al. Cooperation between HNF-lalpha, Cdx2, and GATA-4 in initiating an enterocytic differentiation program in a normal human intestinal epithelial progenitor cell line. Am J Physiol Gastrointest Liver Physiol 2010;298: G504-17.9 Freund JN, Domon-Dell C, Kedinger M, Duluc I. The Cdx-1 and Cdx-2 homeobox genes in the intestine. Biochem Cell Biol 1998;76:957-69.10 Kakizaki F, Aoki K, Miyoshi H, Carrasco N, Aoki M, Taketo MM. CDX transcription factors positively regulate expression of solute carrier family 5, member 8 in the colonic epithelium. Gastroenterology 2010;138:627-35.11 Warren I, Moeller MM, Guiggey D, Chiang A, Maloy M, Ogoke 0, etal. F0XA1 / 2 depletion drives global reprogramming of differentiation state and metabolism in a human liver cell line and inhibits differentiation of human stem cell-derived hepatic progenitor cells. FASEB J 2023;37:e22652.Jones C, Avino M, Giroux V, Boudreau F. HNF4alpha Acts as Upstream Functional Regulator of Intestinal Wnt3 and Paneth Cell Fate. Cell Mol Gastroenterol Hepatol 2023;15:593-612.Shimizu S, Miyamoto Y, Hayashi M. Cell-type dependency of two Foxa / HNF3 sites in the regulation of vitronectin promoter activity. Biochim Biophys Acta 2002;1574:337-44.Kriseman ML, Tang S, Liao Z, Jiang P, Parks SE, Cope DI, et al. SMAD2 / 3 signaling in the uterine epithelium controls endometrial cell homeostasis and regeneration. Commun Biol 2023;6:261.Wang Z, Shen J, Chen C, Wen T, Li C. FOXA2 plays a critical role in hepatocellular carcinoma progression and lenvatinib -associated drug resistance. Biosci Trends 2023;17:136-47.Kistler B, Baumann B, Bergman Y, Wirth T. RelB is a key player for both kappa B-dependent transcription and demethylation in B cells. Immunobiology 1997;198:24-34.Wirth T, Baltimore D. Nuclear factor NF-kappa B can interact functionally with its cognate binding site to provide lymphoid-specific promoter function. EMBO J 1988;7:3109-13.Boccuni L, Podgorschek E, Schmiedeberg M, Platanitis E, Traxler P, Fischer P, et al. Stress signaling boosts interferon-induced gene transcription in macrophages. Sci Signal 2022;15:eabq5389.de Oliveira Santos TC, Pereira G, Coutinho AGG, Dos Santos Silva HP, Lima MMS, Dias FAL, et al. STAT-3 signaling role in an experimental model of nephropathy induced by doxorubicin. Mol Cell Biochem 2023;478:981-9.Stancil IT, Michalski JE, Hennessy CE, Hatakka KL, Yang IV, Kurche JS, et al. Interleukin-6- dependent epithelial fluidization initiates fibrotic lung remodeling. Sci Transl Med 2022;14:eabo5254.Jiang YY, Jiang Y, Li CQ, Zhang Y, Dakle P, Kaur H, et al. TP63, SOX2, and KLF5 Establish a Core Regulatory Circuitry That Controls Epigenetic and Transcription Patterns in Esophageal Squamous Cell Carcinoma Cell Lines. Gastroenterology 2020;159:1311-27 el9.Watanabe H, Ma Q, Peng S, Adelmant G, Swain D, Song W, et al. SOX2 and p63 colocalize at genetic loci in squamous cell carcinomas. J Clin Invest 2014;124:1636-45.Sulahian R, Chen J, Arany Z, Jadhav U, Peng S, Rustgi AK, et al. SOX15 governs transcription in human stratified epithelia and a subset of esophageal adenocarcinomas. Cell Mol Gastroenterol Hepatol 2015;1:598-609 e6.Cancer Genome Atlas Research N, Analysis Working Group: Asan U, Agency BCC, Brigham, Women's H, Broad I, et al. Integrated genomic characterization of oesophageal carcinoma. Nature 2017;541:169-75.Cao W, Lee H, Wu W, Zaman A, McCorkle S, Yan M, et al. Multi-faceted epigenetic dysregulation of gene expression promotes esophageal squamous cell carcinoma. Nat Commun 2020;ll:3675.Attieh M, Asakrah S. B-ALL with synchronous MYC and BCL-2 rearrangement. Blood 2023;141:1894.Liu C, Kudo T, Ye X, Gascoigne K. Cell-to-cell variability in Myc dynamics drives transcriptional heterogeneity in cancer cells. Cell Rep 2023;42:112401.Purhonen J, Banerjee R, Wanne V, Sipari N, Morgelin M, Fellman V, et al. Mitochondrial complex III deficiency drives c-MYC overexpression and illicit cell cycle entry leading to senescence and segmental progeria. Nat Commun 2023;14:2356.Saeed H, Leibowitz BJ, Zhang L, Yu J. Targeting Myc-driven stress addiction in colorectal cancer. Drug Resist Updat 2023;69:100963.Wilson EB, Klein U. An MYC-Driven Vicious Circuit Is a Targetable Achilles' Heel in Lymphoma. Blood Cancer Discov 2023: OF1-OF4.Alburquerque-Bejar JJ, Navajas-Chocarro P, Saigi M, Ferrero-Andres A, Morillas JM, Vilarrubi A, et al. MYC activation impairs cell-intrinsic IFNgamma signaling and confers resistance to anti-PDl / PD-Ll therapy in lung cancer. Cell Rep Med 2023;4:101006. Alhayyani S, McLeod L, West AC, Balic JJ, Hodges C, Yu L, et al. Oncogenic dependency on STAT3 serine phosphorylation in KRAS mutant lung cancer. Oncogene 2022;41:809-23.Kojima Y, Kawashima F, Yasuda T, Odaira K, Inagaki Y, Yamada C, et al. EBF1-JAK2 inhibits the PAX5 function through physical interaction with PAX5 and kinase activity. Int J Hematol 2023.Aga M, Bentz GL, Raffa S, Torrisi MR, Kondo S, Wakisaka N, et al. Exosomal HIFlalpha supports invasive potential of nasopharyngeal carcinoma-associated LMPl-positive exosomes. Oncogene 2014;33:4613-22.Cao Q, WangX, Shi Y, Zhang M, Yang J, Dong M, etal. FOXCI silencing inhibits the epithelial-to-mesenchymal transition of glioma cells: Involvement of beta-catenin signaling. Mol Med Rep 2019;19:251-61.Cherukunnath A, Davargaon RS, Ashraf R, Kamdar U, Srivastava AK, Tripathi PP, et al. KLF8 is activated by TGF-betal via Smad2 and contributes to ovarian cancer progression. J Cell Biochem 2022;123:921-34.Hegde M, Daimary UD, Kumar A, Chinnathambi A, Alharbi SA, Shakibaei M, et al.STAT3 / HIF1A and EMT specific transcription factors regulated genes: Novel predictors of breast cancer metastasis. Gene 2022;818:146245.Kahlert C, Lerbs T, Pecqueux M, Herpel E, Hoffmeister M, Jansen L, et al.Overexpression of SIX1 is an independent prognostic marker in stage I -III colorectal cancer. Int J Cancer 2015;137:2104-13.Kulkarni M, Tan TZ, Syed Sulaiman NB, Lamar JM, Bansal P, Cui J, et al. RUNX1 and RUNX3 protect against YAP -mediated EMT, stem-ness and shorter survival outcomes in breast cancer. Oncotarget 2018;9:14175-92.Liu Y, Han N, Zhou S, Zhou R, Yuan X, Xu H, et al. The DACH / EYA / SIX gene network and its role in tumor initiation and progression. Int J Cancer 2016;138:1067-75.Risolino M, Mandia N, lavarone F, Dardaei L, Longobardi E, Fernandez S, et al.Transcription factor PREP1 induces EMT and metastasis by controlling the TGF-beta-SMAD3 pathway in non-small cell lung adenocarcinoma. Proc Natl Acad Sci U S A 2014;111: E3775-84.Wang X, Zheng M, Liu G, Xia W, McKeown-Longo PJ, Hung MC, et al. Kruppel-like factor 8 induces epithelial to mesenchymal transition and epithelial cell invasion. Cancer Res 2007;67:7184-93.Zhu Y, Tan J, Xie H, Wang J, Meng X, Wang R. HIF-lalpha regulates EMT via the Snail and beta- catenin pathways in paraquat poisoning-induced early pulmonary fibrosis. J Cell Mol Med 2016;20:688- 97.Henderson S, Pullabhatla V, Hertweck A, de Rinaldis E, Herrero J, Lord GM, et al. The Thl cell regulatory circuitry is largely conserved between human and mouse. Life Sci Alliance 2021;4.Hertweck A, Evans CM, Eskandarpour M, Lau JC, Oleinika K, Jackson I, et al. T-bet Activates Thl Genes through Mediator and the Super Elongation Complex. Cell Rep 2016;15:2756-70.Hidaka R, Miyazaki K, Miyazaki M. The E-Id Axis Instructs Adaptive Versus Innate Lineage Cell Fate Choice and Instructs Regulatory T Cell Differentiation. Front Immunol 2022;13:890056.Hu H, Wang B, Borde M, Nardone J, Maika S, Allred L, et al. Foxpl is an essential transcriptional regulator ofB cell development. Nat Immunol 2006;7:819-26.Korchagina AA, Shein SA, Koroleva E, Tumanov AV. Transcriptional control of ILC identity. Front Immunol 2023;14:1146077.Liu Z, Lee DS, Liang Y, Zheng Y, Dixon J. Foxp3 Orchestrates Reorganization of Chromatin Architecture to Establish Regulatory T Cell Identity. bioRxiv 2023.Trujillo-Ochoa JL, Kazemian M, Afzali B. The role of transcription factors in shaping regulatory T cell identity. Nat Rev Immunol 2023.Miller SA, Weinmann AS. Common themes emerge in the transcriptional control of T helper and developmental cell fate decisions regulated by the T-box, GATA and ROR families. Immunology 2009;126:306-15.Kastirr I, Maglie S, Paroni M, Alfen JS, Nizzoli G, Sugliano E, et al. IL-21 is a central memory T cell- associated cytokine that inhibits the generation of pathogenic Thl / 17 effector cells. J Immunol 2014;193:3322-31.Kawabe T. Homeostasis and immunological function of self-driven memory-phenotype CD4(+) T lymphocytes. Immunol Med 2023;46:1-8.Carotta S, Holmes ML, Pridans C, Nutt SL. Pax5 maintains cellular identity by repressing gene expression throughout B cell differentiation. Cell Cycle 2006;5:2452-6. Klein U, Casola S, Cattoretti G, Shen Q, Lia M, Mo T, et al. Transcription factor IRF4 controls plasma cell differentiation and class-switch recombination. Nat Immunol 2006;7:773-82.Nera KP, Kohonen P, Narvi E, Peippo A, Mustonen L, Terho P, etal. Loss ofPax5 promotes plasma cell differentiation. Immunity 2006;24:283-93.Tang TF, Chan YT, Cheong HC, Cheok YY, Anuar NA, Looi CY, et al. Regulatory network of BLIMP 1, IRF4, and XBP1 triad in plasmacytic differentiation and multiple myeloma pathogenesis. Cell Immunol 2022;380:104594.He J, Zhao J, Quan Y, Hou X, Yang M, Dong Z. Full Activation of Kinase Protein Kinase B by Phosphoinositide-Dependent Protein Kinase-1 and Mammalian Target of Rapamycin Complex 2 Is Required for Early Natural Killer Cell Development and Survival. Front Immunol 2020;11:617404.Li D, Wang Y, Yang M, Dong Z. mTORCl and mTORC2 coordinate early NK cell development by differentially inducing E4BP4 and T-bet. Cell Death Differ 2021;28:1900-9.Scott EW, Fisher RC, Olson MC, Kehrli EW, Simon MC, Singh H. PU.l functions in a cell-autonomous manner to control the differentiation of multipotential lymphoid-myeloid progenitors. Immunity 1997;6:437-47.Muzes G, Sipos F. CAR-Based Therapy for Autoimmune Diseases: A Novel Powerful Option. Cells 2023;12.Chiesa R, Georgiadis C, Syed F, Zhan H, Etuk A, Gkazi SA, et al. Base-Edited CAR7 T Cells for Relapsed T-Cell Acute Lymphoblastic Leukemia. N Engl J Med 2023.Manni S, Del Bufalo F, Merli P, Silvestris DA, Guercio M, Caruso S, et al. Neutralizing IFNgamma improves safety without compromising efficacy of CAR-T cell therapy in B-cell malignancies. Nat Commun 2023;14:3423.Inoue T, Narukawa M. Anti-Tumor Efficacy of Anti-PD-l / PD-Ll Antibodies in Combination With Other Anticancer Drugs in Solid Tumors: A Systematic Review and Meta-Analysis. Cancer Control 2022;29:10732748221140694.Caplen NJ, Parrish S, Imani F, Fire A, Morgan RA. Specific inhibition of gene expression by small double -stranded RNAs in invertebrate and vertebrate systems. Proc Natl Acad Sci U S A 2001;98:9742-7.Hamilton AJ, Baulcombe DC. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 1999;286:950-2.Macfarlane LA, Murphy PR. MicroRNA: Biogenesis, Function and Role in Cancer. Curr Genomics 2010;11:537-61.Peng Y, Croce CM. The role of MicroRNAs in human cancer. Signal Transduct Target Ther 2016;l:15004.Moore CB, Guthrie EH, Huang MT, Taxman DJ. Short hairpin RNA (shRNA): design, delivery, and assessment of gene knockdown. Methods Mol Biol 2010;629:141-58. Tiscornia G, Singer 0, Verma IM. Design and cloning of lentiviral vectors expressing small interfering RNAs. Nat Protoc 2006;1:234-40.Wakiyama M, Matsumoto T, Yokoyama S. Drosophila U6 promoter-driven short hairpin RNAs effectively induce RNA interference in Schneider 2 cells. Biochem Biophys Res Commun 2005;331:1163- 70.Gao Z, Herrera-Carrillo E, Berkhout B. RNA Polymerase II Activity of Type 3 Pol III Promoters. Mol Ther Nucleic Acids 2018;12:135-45.Phipps SM, Garry CE, Kamal S, Johnson JD, Gilmer J, Long A, et al. High Content Imaging of Barrett's-Associated High-Grade Dysplasia Cells After siRNA Library Screening Reveals Acid-Responsive Regulators of Cellular Transitions. Cell Mol Gastroenterol Hepatol 2020;10:601-22.Duggan SP, Garry C, Behan FM, Phipps S, Kudo H, Kirca M, et al. siRNA Library Screening Identifies a Druggable Immune-Signature Driving Esophageal Adenocarcinoma Cell Growth. Cell Mol Gastroenterol Hepatol 2018;5:569-90.Micklem DR, Lorens JB. RNAi screening for therapeutic targets in human malignancies. Curr Pharm Biotechnol 2007;8:337-43.Bernards R, Brummelkamp TR, Beijersbergen RL. shRNA libraries and their use in cancer genetics. Nat Methods 2006;3:701-6.Oliynyk, R. T., & Church, G. M. (2022). Efficient modification and preparation of circular DNA for expression in cell culture. Communications Biology, 5(1), 1393. https: / / doi.org / 10.1038 / s42003-022-04363-zAdato 0, Sloutskin A, Komemi H, Brabb I, Duttke S, Bucher P, Unger R, Juven-Gershon T. ElemeNT 2023: an enhanced tool for detection and curation of core promoter elements. Bioinformatics. 2024 Mar 4;40(3):btaell0. doi:10.1093 / bioinformatics / btaell0. PMID: 38407414; PMCID: PMC10950481.

Claims

1. CLAIMS:

1. An isolated nucleic acid construct, the isolated nucleic acid construct comprising:(a) an amiRNA expression cassette, the amiRNA expression cassette comprising:(i) a 5’ amiRNA flanking sequence;(ii) a 3’ amiRNA flanking sequence; and(iii) a hairpin sequence positioned between the 5’ amiRNA flanking sequence and the 3’ amiRNA flanking sequence, wherein the hairpin sequence comprises a terminal loop and two stem regions (stem duplex), whereby one of the stem regions encodes a functional guide sequence; and(b) a promoter-enhancer region operably linked with the sequence encoding the amiRNA expression cassette;wherein the functional guide sequence is capable of reducing the expression of a target nucleic acid; andwherein the reverse complement of the isolated nucleic acid construct sequence lacks predicted promoter sites and transcriptional start sites, unless regulated by one or more transcription factors; orwherein the reverse complement sequence comprises a reverse amiRNA expression cassette as set out in (i), (ii), and (iii), operably linked to a promoterenhancer region.

2. The isolated nucleic acid construct of claim 1, wherein the amiRNA expression cassette is repeated in the forward or the reverse complement sequence or both.

3. The isolated nucleic acid construct of claim 1 or 2, wherein there is a second amiRNA expression cassette encoding an alternative functional guide sequence in the forward or the reverse complement sequence or both.

4. The isolated nucleic acid construct of claim 1, 2, or 3, wherein lack of a predicted promoter site or lack of a predicted transcriptional start site is based on one or more of the following:(a) a promotor 2™ analysis score of less than 0.5; and (b) an ElemeNT™ version 2023 analysis algorithm was set to 40.4% GC value as background, with search parameters selected as follows at default cutoff values for the following sequence elements: TATA box (cutoff 6.0); BRE upstream (cutoff 5.8); BRE downstream (cutoff 4.2); GAGA (cutoff 6.7);Mammalian Initiator (cutoff 0.7); BBCABW Initiator (cutoff 3.6); Human TCT motif (cutoff 6.0); XCPE1 (cutoff 4.0); XCPE2 (cutoff 6.0); MTE (cutoff 8.5); and DPE (cutoff 0.7) to identify the proximity of two or more of the sequence elements.

5. The isolated nucleic acid construct of claim 4, wherein any of the predicted promoter sites or transcriptional start sites have a sequence identity of greater than or equal to 90% when compared to a known promoter site or transcriptional start site.

6. The isolated nucleic acid construct of any one of claims 1-5, wherein the isolated nucleic acid construct is between 200-400 bp.

7. The isolated nucleic acid construct of any one of claims 1-6, wherein the target nucleic acid is selected from one or more of the following categories:proto-oncogene; oncogene; cell cycle; DNA synthesis and repair; metastasis; immune evasion; metabolism; anti-apoptotic regulators; and chemotherapy resistance.

8. The isolated nucleic acid construct of any one of claims 1-7, wherein the target nucleic acid is selected from one or more of the following:mitotic arrest deficient 2 like 1 (MAD2); WEE1 G2 checkpoint kinase (WEE1); polo like kinase 1 (PLK1); cyclin dependent kinase 4 (CDK4); cyclin dependent kinase 6 (CDK6); cyclin dependent kinase 16 (CDK16); Aurora kinase A (AURKA); Aurora kinase B (AURKB); checkpoint kinase 1 (CHK1); kinesin family member 11 (Kif11); cyclin dependent kinase 1 (CDK1); COP9 signalosome subunit 5 (CSN5); Ras-related nuclear protein (RAN); cyclin D1 (CCND1); SRY-Box Transcription Factor 2 (SOX2); E2F Transcription Factor 1 (E2F1); E2F Transcription Factor 3 (E2F3); E2F Transcription Factor 5 (E2F5); E2F Transcription Factor 6 (E2F6); E2F Transcription Factor 7 (E2F7); E2F Transcription Factor 8 (E2F8); Nuclear Factor Kappa B Subunit 1 (NFKB1); NuclearFactor Kappa B Subunit 2 (NFKB2); RUNX Family Transcription Factor 1 (RUNX1); Hypoxia inducible factor 1 subunit alpha (HIF1A); Endothelial PAS domain protein 1 (EPAS1); 0-6-methylguanine-DNA methyltransferase (MGMT);MYC proto-oncogene, bHLH transcription factor (C-MYC); MYCN proto-oncogene, bHLH transcription factor (N-MYC); MYCL proto-oncogene, bHLH transcription factor L (L-MYC); KRAS Proto-Oncogene, GTPase (KRAS); NRAS Proto-Oncogene, GTPase (NRAS); HRAS Proto-Oncogene, GTPase (HRAS); B-Raf proto-oncogene, serine / threonine kinase (BRAF); ABL1 proto-oncogene 1, non-receptor tyrosine kinase (ABL1); BCR activator of RhoGEF and GTPase (BCR)-ABLl proto-oncogene 1, non-receptor tyrosine kinase (BCR-ABL1); Epidermal Growth Factor Receptor (EGFR); MET Proto-Oncogene, Receptor Tyrosine Kinase (MET); erb-b2 receptor tyrosine kinase 2 (HER2);Phosphatidylinositol-4,5-bisphosphate 3-kinase Catalytic Subunit Alpha (PIK3CA); ALK receptor tyrosine kinase (ALK); SRC proto-oncogene, non-receptor tyrosine kinase (SRC); BCL2 like 12 (BCL2L12); BCL2 apoptosis regulator (BCL2); BCL2 like 1 (BCL-XL); Myeloid cell leukemia-1 (MCL1); Survivin also known as Baculoviral IAP Repeat Containing 5 (BIRC5); Fms related receptor tyrosine kinase 3 (FLT3); ret protooncogene (RET); Janus kinase 2 (JAK2); Fos proto-oncogene, AP-1 Transcription Factor Subunit (FOS); MDM2 proto-oncogene (MDM2); KIT proto-oncogene, receptor tyrosine kinase (KIT); Notch receptor 1 (NOTCH1); Platelet Derived Growth Factor Receptor Alpha (PDGFRA); Neurotrophic receptor tyrosine kinase 1 (NTRK1); Neurotrophic receptor tyrosine kinase 2 (NTRK2); Neurotrophic receptor tyrosine kinase 3 (NTRK3); Fibroblast Growth Factor Receptor 1 (FGFR1); Fibroblast Growth Factor Receptor 2 (FGFR2); Fibroblast Growth Factor Receptor 3 (FGFR3); Fibroblast Growth Factor Receptor 4 (FGFR4); ROS proto-oncogene 1, receptor tyrosine kinase (ROS1); AKT Serine / Threonine Kinase 1 (AKT1); AKT Serine / Threonine Kinase 2 (AKT2); AKT Serine / Threonine Kinase 3 (AKT3); FGR proto-oncogene, Src family tyrosine kinase (FGR); Mucin 1 (MUC1); Catenin beta 1 (CTNNB1); X-linked inhibitor of apoptosis (XIAP); MYB proto-oncogene like 2 (MYBL2); Twist family bHLH transcription factor 1 (TWIST1); Twist family bHLH transcription factor 2 (TWIST2);Ribonucleotide reductase catalytic subunit Ml (RRM1); Ribonucleotide reductase regulatory subunit M2 (RRM2); Thymidine kinase 1 (TK1); Poly(ADP-Ribose) polymerase 1 (PARP1); Proliferating cell nuclear antigen (PCNA); DNA polymerasetheta (POLQ); ATM serine / threonine kinase (ATM); ATR serine / threonine kinase (ATR);protein kinase N3 (PKN3); Ras homolog family member C (RhoC); Rac family small GTPase 1 (RAC1); KRAS Proto-Oncogene, GTPase (KRAS); NRAS Proto-Oncogene, GTPase (NRAS); HRAS Proto-Oncogene, GTPase (HRAS); TNF alpha induced protein 6 (TSG6); vascular endothelial growth factor A (VEGFA); vascular endothelial growth factor B (VEGFB); vascular endothelial growth factor C (VEGFC); vascular endothelial growth factor D (VEGFD); C-X-C motif chemokine receptor 4 (CXCR4); ALK receptor tyrosine kinase (ALK); transforming growth factor beta 1 (TGFB1); Proteinase-activated receptor 2 (PAR2); multiple EGF-like domains 6 (MEGF6); MOK protein kinase (MOK); glutathione S-transferase pi 1 (GSTP1); SRSF protein kinase 1 (SRPK1); nuclear receptor subfamily 2 group F member 1 (NR2F1); forkhead box M1 (FOXM1); pyruvate dehydrogenase kinase 1 (PDK1); CD44 molecule (IN blood group) (CD44); protein tyrosine phosphatase non-receptor type 22 (PTPN22); signal transducer and activator of transcription 3 (STAT3); signal transducer and activator of transcription 4 (STAT 4); signal transducer and activator of transcription 6 (STAT6); kinesin family member 2 A (KIF2A); kinesin family member 2B (KIF2B); kinesin family member 3A (KIF3A); kinesin family member 3B (KIF3B); kinesin family member 5A (KIF5A); kinesin family member 5B (KIF5B); kinesin family member 5C (KIF5C); kinesin family member 7 (KIF7); kinesin family member 11 (KIF11); kinesin family member 15 (KIF15); kinesin family member C1 (KIFC1);Programmed cell death 1 (PD-1); Programmed Cell Death 1 Ligand 1 (PD-L1); Cytotoxic T-Lymphocyte Associated Protein 4 (CTLA4); C-X-C Motif Chemokine Receptor 4 (CXCR4); Fas Ligand (FASLG); Forkhead Box P3 (FOXP3);Isocitrate Dehydrogenase (NADP(+)) 1 (IDH1); Isocitrate Dehydrogenase (NADP(+)) 2 (IDH2); Lactate Dehydrogenase A (LDHA); Pyruvate Kinase Ml / 2 (PKM2); Mechanistic Target Of Rapamycin Kinase (mTOR); solute carrier family 2 member 1 (GLUT1); solute carrier family 2 member 3 (GLUT3); solute carrier family 2 member 4 (GLUT4); Heat Shock Protein Family E (Hsp10) Member 1 (HSPE1);Thymidylate synthetase (TS); Dihydropyrimidine dehydrogenase (DPD); Dihydrofolate reductase (DHFR); Cytidine deaminase (CDA); ATP binding cassette subfamily Bmember 1 (ABCB1); Multidrug resistance-associated protein 1 (MRP1); Multidrug Resistance Protein 2 (MRP2); ATP binding cassette subfamily G member 2 (ABCG2); Cystic fibrosis transmembrane conductance regulator (CFTR); ATP binding cassette subfamily G member 5 (ABCG5); and ATP binding cassette subfamily G member 8 (ABCG8).

9. The isolated nucleic acid construct of any one of claims 1-7, wherein the target nucleic acid is selected from one or more of the following:growth factor receptor bound protein 7 (GRB7); G protein-coupled receptor class C group 5 member B (GPRC5B); transcriptional repressor GATA binding 1 (TRPS1); and dickkopfWnt signaling pathway inhibitor 1 (DKK1).

10. The isolated nucleic acid construct of any one of claims 1-9, wherein the promoter-enhancer region operably linked with the sequence encoding the amiRNA expression cassette is selected from one or more of the following categories: cancer-enhanced promotors; somatic variation / copy number amplifications / fusions; metastatic / environmental; treatment responsive; cell tissue promotors.

11. The isolated nucleic acid construct of any one of claims 1-10, wherein the promoter-enhancer region operably linked with the sequence encoding the amiRNA expression cassette is selected from one or more of the following:Carcinoembryonic Antigen-Related Cell Adhesion Molecule 5 (CEA); Telomerase Reverse Transcriptase (TERT); Cyclooxygenase 2 (COX-2); C-X-C Motif Chemokine Receptor 4 (CXCR4); Survivin also known as Baculoviral IAP Repeat Containing 5 (BIRC5); Mucin 1 (MUC-1); Erb-B2 Receptor Tyrosine Kinase 2 (ERBB2); Paternally Expressed 3 (PEG-3); Transcription Termination Factor 1 (TTF-1); RAD51 Recombinase (RAD51); Cholecystokinin A Receptor (CCKAR); Heat Shock Protein Family A Member 5 (HSPA5); Hexokinase 2(HK2); Stomatin-Like Protein 1 (SLP-1); X-Ray Repair Cross Complementing 2 (XRCC2); Epidermal Growth Factor Receptor (EGFR); Vascular Endothelial Growth Factor Receptor 1 (VEGFR1 / FLT1); Vascular Endothelial Growth Factor Receptor 2 (VEGFR2 / KDR); Vascular Endothelial Growth Factor Receptor 3 (VEGFR3 / FLT4); Transferrin receptor (CD71); Alpha Fetoprotein (AFP); AFP promoter variant (EA4D); E2F Transcription Factor 1 (E2F-1); Prominin 1 (PR0M1); Glypican 3 (GPC3); Lactalbumin Alpha (LALBA); Urokinase-type Plasminogen Activator Receptor(uPAR / PLAUR); Fibroblast Growth Factor 18 (FGF18); Human Epididymis Protein 4 (HE4); Glycoprotein A33 (A33); Metadherin (MTDH); Cysteine Rich Angiogenic Inducer 61 (CYR61); Cellular Communication Network Factor 1 (CCN1); Protein Regulator of Cytokinesis 1 (PRC1); Ribonucleoside-Diphosphate Reductase Subunit M2 (RRM2); Paired Box 5 (PAX5); Bcl-2-related gene x, long isoform (BCL-XL); Myeloid cell leukemia-1 (MCL1); HRAS Proto-Oncogene, GTPase (HRAS); NRAS Proto-Oncogene, GTPase (NRAS); KRAS Proto-Oncogene, GTPase (KRAS); RELA Proto-Oncogene, NF-KB Subunit (RELA); Aurora Kinase A (AURKA); cyclin D1 (CCND1); RAD50 Double Strand Break Repair Protein (RAD50); B-Raf Proto-Oncogene - Serine / Threonine Kinase (BRAF); pp60c-Src Nonreceptor Tyrosine Kinase (SRC); Fibroblast growth factor 4 (FGF4 / HST); B-cell lymphoma protein-2 (BCL-2); Anaplastic Lymphoma Kinase (ALK); Rearranged During Transfection (RET); Prostate-Specific Antigen (PSA) [or Kallikrein Related Peptidase 3 (KLK3)]; MYC proto-oncogene, bHLH transcription factor (C-MYC); MYCN proto-oncogene, bHLH transcription factor (N-MYC); MYCL proto-oncogene, bHLH transcription factor L (L-MYC); MDM2 proto-oncogene (MDM2); MET ProtoOncogene, Receptor Tyrosine Kinase (MET); Estrogen Receptor 1 (ESRI); Progesterone Receptor (PGR); Mucin 4 (MUC4);Mucin 1 (MUC1); Erb-B2 Receptor Tyrosine Kinase 2 (ERBB2); Epidermal Growth Factor Receptor (EGFR); Vascular Endothelial Growth Factor Receptor 2 (VEGFR2 / KDR); Vascular Endothelial Growth Factor Receptor 3 (VEGFR3 / FLT4);Fibroblast Growth Factor 18 (FGF18); Bcl-2-related gene x, long isoform (BCL-XL); Myeloid cell leukemia-1 (MCL1); Aurora Kinase A (AURKA); cyclin D1 (CCND1); B-Raf Proto-Oncogene - Serine / Threonine Kinase (BRAF); pp60c-Src Nonreceptor Tyrosine Kinase (SRC); Fibroblast growth factor 4 (FGF4 / HST); B-cell lymphoma protein-2 (BCL-2); Anaplastic Lymphoma Kinase (ALK); KRAS Proto-Oncogene, GTPase (KRAS); MYC proto-oncogene, bHLH transcription factor (C-MYC); MYCN proto-oncogene, bHLH transcription factor (N-MYC); MYCL proto-oncogene, bHLH transcription factor L (L-MYC); MDM2 proto-oncogene (MDM2); MET Proto-Oncogene, Receptor Tyrosine Kinase (MET); GATA binding protein 4 (GATA4); GATA binding protein 6 (GATA6); Tumor Protein p63 (TP63); SRY-box transcription factor 2 (SOX2); Breakpoint Cluster Region (BCR); ETS Variant Transcription Factor 6 (ETV6); Lysine Methyltransferase 2A (KMT2A);Cyclooxygenase 2 (COX-2); C-X-C Motif Chemokine Receptor 4 (CXCR4); Hexokinase 2(HK2); Vascular Endothelial Growth Factor Receptor 1 (VEGFR1 / FLT1); Vascular Endothelial Growth Factor Receptor 2 (VEGFR2 / KDR); Vascular Endothelial Growth Factor Receptor 3 (VEGFR3 / FLT4); Urokinase-type Plasminogen Activator Receptor (uPAR / PLAUR); Fibroblast Growth Factor 18 (FGF18); Metadherin (MTDH); Cysteine Rich Angiogenic Inducer 61 (CYR61); Vimentin (VIM); Fibronectin (FN1); Cadherin 2 (CDH2); Transforming growth factor beta 1 (TGFB1); Catenin beta 1 (CTNNB1); Snail family transcriptional repressor 1 (SNAI1); Snail family transcriptional repressor 2 (SNAI2); Twist family bHLH transcription factor 1 (TWIST1); Zinc finger E-box binding homeobox 1 (ZEB1); Zinc finger E-box binding homeobox 2 (ZEB2); Early growth response 1 (EGR1); Paired related homeobox 1 (PRRX1);Heat Shock Protein Family A Member 5 (HSPA5); Tumor Protein p53 (p53); Heat Shock Protein Family A (Hsp70) Member 4 (HSPA4); Growth Arrest and DNA Damage Inducible Alpha (GADD45A); BRCA1 DNA repair associated (BRCA1); Nuclear Factor Kappa B Subunit 1 (NFKB1); Interleukin 6 (IL6); Tumor Necrosis Factor (TNF); ATP Binding Cassette Subfamily B Member 1 (ABCB1);C-X-C Motif Chemokine Receptor 4 (CXCR4); Osteocalcin (BGLAP); Stomatin-Like Protein 1 (SLP-1); Epidermal Growth Factor Receptor (EGFR); Vascular Endothelial Growth Factor Receptor 1 (VEGFR1 / FLT1); Vascular Endothelial Growth Factor Receptor 2 (VEGFR2 / KDR); Vascular Endothelial Growth Factor Receptor 3 (VEGFR3 / FLT4); Paired Box 5 (PAX5); IKAROS Family Zinc Finger 1 (IKZF1); EBF Transcription Factor 1 (EBF1); Inositol polyphosphate-5 -phosphatase D (INPP5D); Albumin; Glial Fibrillary Acidic Protein (GFAP); Surfactant Protein B (SP-B); B-Cell-Specific Glycoprotein B29 (B29); Cell Surface Glycoprotein CD45 (CD45); Tyrosinase Related Protein 1 (TRP-1); Thyroid Transcription Factor 1 (TTF-1); Prostate-Specific Membrane Antigen (PSMA); Myelin Basic Protein (MBP); Neuron Specific Enolase (NSE); von Willebrand Factor (vWF); Probasin (mPbsn); Homeobox B13 (H0XB13); Plasminogen; CD68 Antigen (CD68); Elastase-1 (CELA1); Platelet Membrane Glycoprotein lib (GPIIb); Synapsin I (SYN1); Wiskott-Aldrich Syndrome Protein (WASP); Calcium / Calmodulin-Dependent Protein Kinase II (CaMKII); Serpin Family A Member 1 (SERPINA1); CD 14 Antigen (CD 14); Mammoglobin (MGB1); Keratin 1 (KRT1); Keratin 5 (KRT5); Keratin 6 (KRT6); Keratin 8 (KRT8); Keratin 10 (KRT10);Keratin 14 (KRT14); Keratin 18 (KRT18); EH Domain-Containing Protein 3 (EHD3); Transferrin (Tf); Transthryetin (TTR); Mucin 2 (MUC2); Mucin 5AC (MUC5AC); Mucin 5B (MUC5B); Mucin 6 (MUC6); Mucin 16 (MUC16); Breakpoint Cluster Region (BCR); Nestin (NES); Cadherin 16 (CDH16); Pancreatic and Duodenal Homeobox 1 (PDX1); Anti-Mullerian Hormone (AMH); Cytochrome P450 Family 19 Subfamily A Member 1 (CYP19A1); Mucin 1 (MUC-1); and Thyroxine-Binding Globulin (TBG).

12. The isolated nucleic acid construct of any one of claims 1-10, wherein the promoter-enhancer region operably linked with the sequence encoding the amiRNA expression cassette comprises a promoter, wherein the promoter is Matrix Metallopeptidase 1 (MMP1).

13. The isolated nucleic acid construct of any one of claims 1-12, wherein the promoter-enhancer region operably linked with the sequence encoding the amiRNA expression cassette comprises a transcription factor response element (TFRE) and the TFRE is responsive to a transcription factor selected from one or more of the following categories: cancer-associated transcription factors; immune cell differentiation; immune factors; endocrine receptors; mitotic bookmarking factors; adopted orphan receptors; and orphan receptors.

14. The isolated nucleic acid construct of claim 13, wherein the TFRE is responsive to a transcription factor selected from one or more of the following:Activator protein-1 (AP-1); Activating enhancer binding protein 2 alpha (AP-2); Basic leucine zipper ATF-like transcription factor- Jun proto-oncogene, AP-1 transcription factor subunit (BATF:: JUN); E2F transcription factor 1 (E2F1); E741ike ETS transcription factor 1 (ELF 1 ); E74 like ETS transcription factor 2 (ELF2); E74 like ETS transcription factor 3 (ELF3); ETS transcription factor ELK1 (ELK1); ETS transcription factor ELK4 (ELK4); Endothelial PAS Domain Protein 1 (EPAS1); ETS proto-oncogene 1, transcription factor (ETS 1 J; ETS proto-oncogene 2, transcription factor (ETS2); ETS variant transcription factor 1 (ETV1); ETS variant transcription factor 4 (ETV4); ETS variant transcription factor 5 (ETV5); ETS variant transcription factor 6 (ETV6); ETS transcription factor ERG (ERG); Ewing's sarcoma oncogene-Fli-1 proto-oncogene, ETS transcription factor (EWS:: FLI1); Fli-1 proto-oncogene, ETS transcription factor (FLI1); Fos proto-oncogene, AP-1 transcription factor subunit(FOS); Forkhead box A1 (FOXA1); Forkhead box M1 (FOXM1); Forkhead box Q1 (FOXQ1); GA binding protein transcription factor subunit alpha (GABPA); GATA binding protein 1-TAL bHLH transcription factor 1, erythroid differentiation factor (GATA1:: TAL1); GATA binding protein 2 (GATA2); GATA binding protein 3 (GATA3); GATA binding protein 4 (GATA4); GATA binding protein 6 (GATA6); Glioma-associated oncogene transcription factor (GLI); hes family bHLH transcription factor 1 (HES1); hes family bHLH transcription factor 6 (HES6); Hypoxia inducible factor 1 subunit alpha (HIF1A); Jun proto-oncogene, AP-1 transcription factor subunit (JUN); KLF transcription factor 8 (KLF8); Lymphoid enhancer binding factor 1 (LEF1); MYC associated factor X (MAX); MYC proto-oncogene, bHLH transcription factor (MYC); Nuclear Factor of Activated T Cells 2 (NFAT1); Nuclear Factor of Activated T Cells 1 (NFAT2); Nuclear Factor of Activated T Cells 3 (NFAT4); Nuclear Factor of Activated T Cells 5 (NFAT5); Nuclear Factor kappa B Subunit 1 (NFKB1); Nuclear Factor kappa B Subunit 2 (NFKB2); NK2 homeobox 1 (NKX2-1); NK2 homeobox 2 (NKX2-2); POU class 2 homeobox 1 (OCT1); POU class 2 homeobox 2 (OCT2); POU domain class 5 transcription factor 3 (OCT3); Spi-1 proto-oncogene (PU.l); Retinoic acid receptor alpha-Retinoid X receptor alpha (RARA:: RXRA); RELA proto-oncogene, NF-kB subunit (RELA1); RELB proto-oncogene, NF-kB subunit (RELB); REL proto-oncogene, NF-kB subunit (REL); RUNX family transcription factor 1 (RUNX1); RUNX family transcription factor 2 (RUNX2); SIX homeobox 1 (SIX1); Signal Transducer and Activator of Transcription 3 (STAT3); Signal Transducer and Activator of Transcription 5A (STAT5A); Signal Transducer and Activator of Transcription 5B (STAT5B); Signal Transducer and Activator of Transcription 6 (STAT6); SRY-box Transcription Factor 2 (SOX2); SRY-box Transcription Factor 3 (SOX3); SRY-box Transcription Factor 4 (SOX4); SRY-box Transcription Factor 5 (SOX5); SRY-box Transcription Factor 6 (SOX6); SRY-box Transcription Factor 8 (SOX8); SRY-box Transcription Factor 9 (SOX9); SRY-box Transcription Factor 10 (SOX10); SRY-box Transcription Factor 11 (SOX11); SRY-box Transcription Factor 12 (SOX12); SRY-box Transcription Factor 13 (SOX13); SRY-box Transcription Factor 15 (SOX15); SRY-box Transcription Factor 18 (SOX18); Serum Response Factor (SRF); Sex Determining Region Y (SRY); TAL bHLH transcription factor 1, erythroid differentiation factor (TALI); TAL bHLH transcription factor 1, erythroid differentiation factor-Transcription factor 3 (TAL1:: TCF3); T-box transcription factor 1 (TBX1); T-box transcription factor 2 (TBX2); Transcription FactorEB (TFEB); Transmembrane Serine Protease 2- ETS variant transcription factor 1 (TMPRSS2:: ETV1); Tumor protein p63 (TP63); Tumor protein p73 (TP73);Transcriptional repressor GATA binding 1 (TRPS1); Yesl associated transcriptional regulator (YAP);BTB domain and CNC homolog 2 (BACH2); Basic leucine zipper ATF-like transcription factor (BATF); PR / SET domain 1 (BLIMP1); BCL11 transcription factor B (BCL11B); BCL6 transcription repressor (BCL6); E2F transcription factor 1 (E2F1); Forkhead box O1 (FOXO1); Forkhead box O3 (FOXO3); Forkhead box P3 (FOXP3); GATA binding protein 1 (GATA1); GATA binding protein 2 (GATA2); GATA binding protein 3 (GATA3); hes family bHLH transcription factor 1 (HES1); hes family bHLH transcription factor 5 (HES5); Hematopoietically Expressed Homeobox (HHEX); IKAROS family zinc finger 1 (IKZF1); IKAROS family zinc finger 2 (IKZF2); IKAROS family zinc finger 3 (IKZF3); Interferon regulatory factor 1 (IRF1); Interferon regulatory factor 3 (IRF3); Interferon regulatory factor 4 (IRF4); Interferon regulatory factor 5 (IRF5); Interferon regulatory factor 7 (IRF7); Interferon regulatory factor 8 (IRF8); Lymphoid enhancer binding factor 1 (LEF1); Myocyte enhancer factor 2B (MEF2B); Myocyte enhancer factor 2C (MEF2C); Protein inhibitor of activated STAT 2 (MIZ1); Nuclear Factor of Activated T-cells 1 (NFATC1); Nuclear Factor of Activated T-cells 2 (NFATC2); Nuclear Factor of Activated T-cells 3 (NFATC3); Nuclear Factor of Activated T-cells 4 (NFATC4); Nuclear factor, interleukin 3 regulated (NFIL3); Paired box 5 (PAX5); RAR related orphan receptor A (RORA); RAR related orphan receptor B (RORB); RAR related orphan receptor C (RORC); SATB homeobox 1 (SATB1); Spi-B transcription factor (SPIB); Signal transducer and activator of transcription 1 (STAT1); Signal transducer and activator of transcription 2 (STAT2); Signal transducer and activator of transcription 1-Signal transducer and activator of transcription 2 (STAT1:: STAT2); Signal transducer and activator of transcription 3 (STAT3); Signal transducer and activator of transcription 4 (STAT 4); Signal transducer and activator of transcription 5A (STAT5A); Signal transducer and activator of transcription 5B (STAT5B); Signal transducer and activator of transcription 6 (STAT6); TAL bHLH transcription factor 1, erythroid differentiation factor-Transcription factor 3 (TAL1:: TCF3); T-box transcription factor 21 (TBX21); T-box transcription factor 3 (TBX3); T-box transcription factor 5 (TBX5); Transcription factor 3 (TCF3); Transcription factor 4 (TCF4); Transcription factor 7 (TCF7);Transcription factor 7 like 1 (TCF7L1); Transcription factor 7 like 2 (TCF7L2); TEAdomain transcription factor 1 (TEAD1); TEA domain transcription factor 2 (TEAD2); X-box binding protein 1 (XBP1);Androgen receptor (AR); Estrogen receptor 1 (ESR1); Estrogen receptor 2 (ESR2); Nuclear receptor subfamily 3 group C member 1 (NR3C1); Nuclear receptor subfamily 3 group C member 2 (NR3C2); Progesterone receptor (PGR); Retinoic acid receptor alpha (RARA); Retinoic acid receptor beta (RARB); Retinoic acid receptor gamma (RARG); Thyroid hormone receptor alpha (THRA); Thyroid hormone receptor beta (THRB); Vitamin D receptor (VDR);Forkhead box A1 (FOXA1); Nuclear transcription factor Y subunit alpha (NF-YA); Nuclear transcription factor Y subunit beta (NF-YB); Nuclear transcription factor Y subunit gamma (NF-YC); Nuclear respiratory factor 1 (NRF1); Sp2 transcription factor (Sp2);Hepatocyte nuclear factor 4 alpha (HNF4A); Peroxisome proliferator activated receptor alpha- Retinoid X receptor alpha (PPARA: RXRA); Peroxisome proliferator activated receptor alpha (NR1C1); Peroxisome proliferator activated receptor delta (NR1C2); Peroxisome proliferator activated receptor gamma (NR1C3); RAR related orphan receptor A (NR1F1); RAR related orphan receptor B (NR1F2); RAR related orphan receptor C (NR1F3); Nuclear receptor subfamily 1 group H member 3 (NR1H3); Nuclear receptor subfamily 1 group H member 4 (NR1H4); Retinoid X receptor alpha (NR2B1); Retinoid X receptor beta (NR2B2); Retinoid X receptor gamma (NR2B3); Nuclear receptor subfamily 1 group I member 2 (NR1I2); Nuclear receptor subfamily 1 group I member 3 (NR1I3); Estrogen related receptor alpha (NR3B1); Estrogen related receptor beta (NR3B2); Estrogen related receptor gamma (NR3B3); Nuclear receptor subfamily 5 group A member 1 (NR5A1);Nuclear receptor subfamily 1 group D member 1 (NR1D1); Nuclear receptor subfamily 1 group D member 2 (NR1D2); Nuclear receptor subfamily 2 group C member 1 (NR2C1); Nuclear receptor subfamily 2 group C member 2 (NR2C2); Nuclear receptor subfamily 2 group E member 1 (NR2E1); Nuclear receptor subfamily 2 group E member 3 (NR2E3); Nuclear receptor subfamily 2 group F member 1 (NR2F1); Nuclear receptor subfamily 2 group F member 2 (NR2F2); Nuclear receptor subfamily 4 group A member1 (NR4A1); Nuclear receptor subfamily 4 group A member 2 (NR4A2); and Nuclear receptor subfamily 6 group A member 1 (NR6A1).

15. The isolated nucleic acid construct of any one of claims 1-14, wherein the 5’ amiRNA flanking sequence and the 3’ amiRNA flanking sequence are selected from: mmu-miR-155; hsa-miR-155; hsa-miR-30a; hsa-miR-451; hsa-miR-33; hsa-miR-31; hsa-miR-122; hsa-miR-223; miR-30; miR-E; miR-AB; miR-N; miR-S; and miR-GE.

16. The isolated nucleic acid construct of any one of claims 1-15, wherein the isolated nucleic acid construct further comprises one or more of the following: a transcriptional pause site; a poly A signal; and a reporter gene.

17. The isolated nucleic acid construct of any one of claims 1-16, wherein the isolated nucleic acid construct further comprises one or more, additional amiRNA expression cassettes comprising: a 5’ amiRNA flanking sequence; a 3’ amiRNA flanking sequence; and a hairpin sequence positioned between the 5’ amiRNA flanking sequence and the 3’ amiRNA flanking sequence.

18. The isolated nucleic acid construct of any one of claims 1-17, wherein the promoter-enhancer region comprises one or more sequence motifs selected from: TATA box; TFIIB Recognition Element (BRE); Initiator (Inr); Motif Ten Element (MTE);Downstream Promotor Element (DPE); Downstream Core Element (DCE); and X Core Promoter Element 1 (XCPE1).

19. The isolated nucleic acid construct of any one of claims 1-18, wherein the promoter-enhancer region comprises a Pol II minimal promotor selected from the following:(a) MinP: TAGAGGGTATATAATGGAAGCTCGACTTCCAG (SEQID NO.169);(b) miniCMV: GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTfSEQ ID NO.168); or(c) miniTK:ATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGCGACCCGCTTAAAA(SEQID NO.170).

20. The isolated nucleic acid construct of any one of claims 1-18, wherein the promoter-enhancer region comprises one of more of the following:(a) SSRCGCC[G / C-G / C-G / A-C-G-C-C] (SEQ ID NO.562);(b) TCAKTY[T-C-A-G / T-T-T / C] (SEQ ID NO.563);(c) RGWYV[A / G-G-A / T-C / T-G / A / C] (SEQ ID NO.564);(d) CSARCSSAACGS[C-G / C-A-G / A-C-G / C-G / C-A-A-C-G-G / C] (SEQ ID NO.565);(e) CTTC CTGT AGC (SEQ ID NO.566); and(f) DSGYGGRASNM[G / A / T-G / C-G-T / C-G-G-G / A-A-G / C-N-A / C] (SEQ ID NO.567).

21. The isolated nucleic acid construct of any one of claims 1-20, wherein the promoter-enhancer region is selected from the following: a cancer enhanced promoter; a structural variant (SV) or a copy number variation / alteration (CNA / CNV) or gene fusion-associated promoter; a metastatic or environmental promoter; a treatment responsive promoter; and a cell / tissue specific promoter.

22. The isolated nucleic acid construct of claim 21, wherein the promoterenhancer region comprises a promoter selected from one or more of the following genes:(a) CEA; TERT; COX-2; CXCR4; Survivin; MUC-l; ErbB2; PEG-3; TFF-1; RAD51; CCKAR; HSPA5; HK2; SLP-1; XRCC2; EGFR; VEGFR1; VEGFR2; VEGFR3; CD71; AFP; EA4D; E2F1; PR0M1; GPC3; LALBA; PLAUR; FGF18; HE4; A33; MTDH; CYR61; PRC1; PAX5; BCL-XL; MCL1; ERAS; NRAS; KRAS; RELA; AURKA; CCND1; RAD50; BRAF; SRC; FGF4; KMT2A; BCL-2; ALK; RET; PSA; C-MYC; N-MYC; L-MYC; MDM2; MET; ESRI; PGR; and MUC4;(b) MUC-1; ErbB2; EGFR; VEGFR2; VEGFR3; FGF18; BCL-XL; MCL1; AURKA; CCND1; BRAF; SRC; FGF4; BCL-2; ALK; KRAS; C-MYC; N-MYC; L-MYC; MDM2; MET; GATA4; GATA6; TP63; SOX2; BCR (BCR-Abl fusion); ETV6 (ETV6-Runxl fusion); and KMT2A(MLL-AF4 fusion);(c) COX-2; CXCR4; HK2; VEGFR1; VEGFR2; VEGFR3; PLAUR; FGF18; MTDH; CYR61; VIM; FN1; CDH2; TGFB1; CTNNB1; SNAI1; SNAI2; TWIST1; ZEB1; ZEB2; EGR1; and PRRX1;(d) HSPA5; p53; HSPA4; GADD45A; BRCA1; NFKB1; IL6; TNF; and ABCB1; (e) CXCR4; BGLAP; SLP-1; EGFR; VEGFR1; VEGFR2; VEGFR3; PAX5; IKZF1; EBF1; INPP5D; Albumin; PSA; GFAP; SP-B; B29; CD45; TRP-1; TTF-1; PSMA; MBP; NSE; vWF; mPbsn; H0XB13; PLG; CD68; CELA1; GPIIb; SYN1; WASP; CaMKII; SERPINA1; CD14; MGB1; KRT1; KRT5; KRT6; KRT8; KRT10; KRT14; KRT18; EHD3; Tf; TTR; MUC2; MUC4; MUC5AC; MUC5B; MUC6; MUC16; BCR; NES; CDH16; PDX1; AMH; CYP19A1; MUC1; and TBG.

23. The isolated nucleic acid construct of claim 21, wherein the promoterenhancer region comprises a promoter selected from one or more of the following genes:(a) CEA; TERT; COX-2; CXCR4; Survivin; MUC-l; ErbB2; PEG-3; TFF-1; RAD51; CCKAR; HSPA5; HK2; SLP-1; XRCC2; EGFR; VEGFR1; VEGFR2; VEGFR3; CD71; AFP; EA4D; E2F1; PR0M1; GPC3; LALBA; PLAUR; FGF18; HE4; A33; MTDH; CYR61; PRC1; PAX5; BCL-XL; MCL1; HRAS; NRAS; KRAS; RELA; AURKA; CCND1; RAD50; BRAF; SRC; FGF4; KMT2A; BCL-2; ALK; RET; PSA; C-MYC; N-MYC; L-MYC; MDM2; MET; ESRI; PGR; MUC4; RRM2; andMMPl;(b) MUC-1; ErbB2; EGFR; VEGFR2; VEGFR3; FGF18; BCL-XL; MCL1; AURKA; CCND1; BRAF; SRC; FGF4; BCL-2; ALK; KRAS; C-MYC; N-MYC; L-MYC; MDM2; MET; GATA4; GATA6; TP63; SOX2; BCR (BCR-Abl fusion); ETV6 (ETV6-Runxl fusion); and KMT2A(MLL-AF4 fusion);(c) COX-2; CXCR4; HK2; VEGFR1; VEGFR2; VEGFR3; PLAUR; FGF18; MTDH; CYR61; VIM; FN1; CDH2; TGFB1; CTNNB1; SNAI1; SNAI2; TWIST1; ZEB1; ZEB2; EGR1; and PRRX1;(d) HSPA5; p53; HSPA4; GADD45A; BRCA1; NFKB1; IL6; TNF; and ABCB1; (e) CXCR4; BGLAP; SLP-1; EGFR; VEGFR1; VEGFR2; VEGFR3; PAX5; IKZF1; EBF1; INPP5D; Albumin; PSA; GFAP; SP-B; B29; CD45; TRP-1; TTF-1; PSMA; MBP; NSE; vWF; mPbsn; H0XB13; PLG; CD68; CELA1; GPIIb; SYN1; WASP; CaMKII; SERPINA1;CD14; MGB1; KRT1; KRT5; KRT6; KRT8; KRT10; KRT14; KRT18; EHD3; Tf; TTR; MUC2; MUC4; MUC5AC; MUC5B; MUC6; MUC16; BCR; NES; CDH16; PDX1; AMH; CYP19A1; MUC1; and TBG.

24. The isolated nucleic acid construct of claim 21, wherein the promoterenhancer region comprises a promoter, wherein the promoter is MMP1.

25. A method to reduce the expression of a target nucleic acid in a eukaryotic cell or a eukaryotic organism comprising delivering the isolated nucleic acid construct of any one of claims 1-20 to the eukaryotic cell or the eukaryotic organism.

26. The method of claim 25, wherein the isolated nucleic acid construct is capable of reducing the expression of a target nucleic acid in the eukaryotic cell or the eukaryotic organism for use in the treatment of a cancer.

27. The method of claim 26, wherein the cancer is selected from one or more of the following: AIDS-related cancer; anal cancer; brain cancer; bile duct cancer; bladder cancer; blood cancer; bone cancer; breast cancer; bronchial cancer; cardiac cancer; central nervous system cancer; cervical cancer; colorectal cancer; endometrial cancer; esophageal cancer; eye cancer; fallopian tube cancer; gallbladder cancer; gastric cancer; germ cell cancer; gastrointestinal cancer; heart cancer; hepatocellular cancer; hypopharyngeal cancer; islet cell cancer; lung cancer; Langerhans cell histiocytosis (LCH); metastatic cancer; nasopharyngeal cancer; neuroendocrine cancer; ovarian cancer; pancreatic cancer; prostate cancer; renal cancer; rectal cancer; skin cancer; testicular cancer; thyroid cancer; urethral cancer; uterine cancer; vaginal cancer; vascular cancer; and vulvar cancer.

28. The method of claim 26 or 27, wherein the cancer is selected from one or more of the following: carcinoma; leukemia; lymphoma; myeloma; and sarcoma.

29. The method of claim 26, 27, or 28, wherein the cancer is selected from one or more of the following: astrocytoma; blastoma; craniopharyngioma; chordoma; ependymoma; glioblastoma; histiocytoma; melanoma; multiple myeloma; nephroblastoma; neuroblastoma; osteosarcoma; paraganglioma; pheochromocytoma; plasmacytoma; pleuropulmonary blastoma; retinoblastoma; rhabdomyosarcoma; sarcoma; thymoma and thymic carcinoma; and uterine sarcoma.

30. The method of any one of claims 26-29, wherein the cancer is selected from one or more of the following: acute lymphoblastic leukemia (ALL); acute myeloid leukemia (AML); adrenocortical carcinoma; AIDS-related lymphoma; astrocytoma; basal cell carcinoma; Burkitt lymphoma; cholangiocarcinoma; chronic lymphocytic leukemia (CLL); chronic myelogenous leukemia (CML); cutaneous T-cell lymphoma; diffuse intrinsic pontine glioma (DIPG); ductal carcinoma in situ (DCIS); endometrial uterine cancer; esthesioneuroblastoma; Ewing sarcoma; gastrointestinal neuroendocrine tumors; gastrointestinal stromal tumors (GIST); gestational trophoblastic disease (GTD); hairy cell leukemia; Hodgkin lymphoma; hypopharyngeal cancer; intraocular melanoma; Kaposi sarcoma; malignant fibrous histiocytoma; malignant mesothelioma; medulloblastoma; merkel cell carcinoma; midline tract carcinoma; multiple endocrine neoplasia (MEN) syndrome; myeloproliferative neoplasms; myelodysplastic syndrome; mycosis fungoids; nasopharyngeal cancer; nasal cavity and paranasal sinus cancer; neuroblastoma; Non-Hodgkin lymphoma; non-small cell lung cancer; oral cancer; oropharyngeal cancer; osteosarcoma; papillomatosis; paraganglioma; parathyroid cancer; penile cancer; pharyngeal cancer; pituitary cancer; plasma cell neoplasm; pleuropulmonary blastoma; primary CNS lymphoma; pulmonary inflammatory myofibroblastic tumor; retinoblastoma; rhabdomyosarcoma; salivary gland cancer; small cell lung cancer; squamous cell carcinoma; tracheobronchial cancer; uterine sarcoma; and Wilms tumor.

31. The method of any one of claims 26-30, wherein:(a) the cancer is a chronic myeloid leukemia with no previous treatment and has a BCR ABL1 fusion mutation, the promoter is a myeloid specific pBCR or SV- associated promoter (BCL-ABLfus pBCR), and the target specific sequence is ABL and / or PLK1;(b) the cancer is an acute myeloid leukemia having FTL3-ITD FLT3-TKD mutations and not responsive to midostaurin treatment, the promoter is a myeloid specific pCD33, and the target specific sequence is FLT3 and / or MCL1; (c) the cancer is a breast cancer that is ER positive and HER2 negative with TMN stage T4 N1 MO and CDK4 / 6 is overexpressed, the promoter is a cancer cellenhanced TFRE pESRl-TFRE, and the target specific sequence is CDK4 / 6 and / or RhoC;(dj the cancer is a glioma that is Nestin high, the promoter is a cancer cell enhanced cell type specific pNESTIN, and the target specific sequence is SOX2 and / or IDH1;(ej the cancer is a metastatic gastric adenocarcinoma chromosome instability, TMN stage T3, Nl, MO and hTERT positive, ERBB2 positive and chemoresistant, the promoter is phTERT, and the target specific sequence is TS and / or DPD 5FU; or(f) the cancer is a metastatic colon adenocarcinoma with TMN stage T4, Nib, Mia and cancer enhanced TF panel and VEGF enhanced, and the target specific sequence is RRM2 and / or RRM1.

32. A method of treating cancer, wherein the method comprises:(a) obtaining biomarker data from at least one biological sample from a subject, wherein the subject is a human patient having cancer, suspected of having cancer, or at risk for a cancer;(b) identifying, at least one cancer biomarker in the biomarker data from (a) is an indication of cancer type, wherein the at least one cancer biomarker is selected from one or more of the following:(i) tumour type, tissue type, or cell type;(if) TNM classification;(iif) genetic structural variant or mutation detection; and(iv) genomic analysis;(c) obtaining the subject’s cancer data, wherein the subject’s cancer data comprises (i) previous cancer treatments; and (if) family history of hereditary cancers;(dj choosing an isolated nucleic acid construct of any one of claims 1-18 based on the at least one cancer biomarker (b) and the subject’s cancer data (c); and (ej providing the isolated nucleic acid construct to the subject.

33. The method of claim 32, wherein the promoter-enhancer region comprises a promoter, wherein the promoter is selected for the isolated nucleic acid construct based on the tissue or cell type as follows:(a] wherein the tissue or cell type is immune, the promotor is selected from one or more of the following: CD34; CXCR4; SLP-1; PAX5; IKZF1; EBF1; SHIP1 / INPP5D; GFAP; B29; CD45; CD68; GPIIb; WASP; CD 14; and BCR;(b] wherein the tissue or cell type is brain or central nervous system (CNS), the promotor is selected from one or more of the following: CD33; NES; SLP-1; TTF-1; MBP; NSE; SYN1; CaMKII; and EHD3;(c] wherein the tissue or cell type is breast, the promotor is MGB1; and MUC1;(d] wherein the tissue or cell type is colon, the promotor is selected from one or more of the following: MUC2; and KRT18;(e] wherein the tissue or cell type is gastric, the promotor is selected from one or more of the following: MUC5AC; and MUC6;(f] wherein the tissue or cell type is liver, the promotor is selected from one or more of the following: albumin; PLG; SERPINA1; Tf; TTR; and TBG;(g] wherein the tissue or cell type is kidney, the promotor is CDH 16;(Tf) wherein the tissue or cell type is testes, the promotor is PSA;(i) wherein the tissue or cell type is prostate, the promotor is selected from one or more of the following: PSA; PSMA; mPbsn; and HOXB13;Q) wherein the tissue or cell type is ovarian, the promotor is selected from one or more of the following: MUC16; AMH; and CYP19A1;(k) wherein the tissue or cell type is pancreatic, the promotor is selected from one or more of the following: CELA1; and PDX1;(l) wherein the tissue or cell type is skin, the promotor is selected from one or more of the following: TRP-1; KRT1; KRT5; KRT6; KRT10; and KRT14;(mJ wherein the tissue or cell type is lung, the promotor is selected from one or more of the following: SP-B; TTF-1; MUC5AC; and MUC5B;(nJ wherein the tissue or cell type is bone, the promotor is BGLAP;Jo] wherein the tissue or cell type is epithelial, the promotor is selected from one or more of the following: SLP-1; EGFR; KRT1; KRT5; KRT6; KRT8; KRT14; and KRT18; andJp] wherein the tissue or cell type is endothelial, the promotor is selected from one or more of the following: VEGFR1; VEGFR2; VEGFR3; vWF; and EHD3.

34. The method of claim 32 or 33, wherein the promoter-enhancer region comprises a TFRE, wherein the TFRE is operably linked to a promoter, wherein the TFRE is responsive to a transcription factor selected from one or more of the following: AP-1; AP-2; MYC; MAX; NFKB1; NFKB2; RELA1; RELB; REL; STAT3; STAT5A; STAT5B; STAT6; GATA2; GATA3; GATA4; GATA6; TP63; TP73; SOX2; SOX3; S0X4; SOX5; SOX6; SOX8; SOX9; SOXIO; SOX11; SOX12; SOX13; SOX15; SOX18; TRPS1; GLI; NFAT1; NFAT2; NFAT4; NFAT5; EWS:: FLI1; FLU; ETS1; ETS2; ERG; ELF1; ELF2; ELF3; ETV1; ETV4; ETV5; ETV6; TMPRSS2:: ETV1; PU.l; ELK1; ELK4; F0XM1; HES1; HES6; YAP; NKX2-1; NKX2-2; OCTI; OCT2; OCT3; RUNX1; E2F1; FOXQ1; TFEB; SRY; LEF1; SRF; JUN; FOS; BATF:: JUN; GABPA; KLF8; SIX1; RUNX2; RARA:: RXRA; TAL1; GATA1:: TAL1; TAL1:: TCF3; F0XA1; HIF1A; EPAS1; TBX1; TBX2;NR2F1; NR2F2; NR6A1; NR4A1; NR2E3; NR1D1; NR1D2; NR2E1; NR2C1; NR2C2;NR4A1; NR4A2;IRF1; IRF3; IRF4; IRF5; IRF7; IRF8; STAT1; STAT2; STAT3; STAT4; STAT5A; STAT5B; STAT6; STAT1:: STAT2; FOXP3; RORA; RORB; RORC; TCF3; TAL1:: TCF3; TCF4; TCF7; TCF7L1; TCF7L2; LEF1; TBX21; TBX3; TBX5; HES1; HES5; BATF; PAX5; MEF2C; SPIB; BCL6; MEF2B; E2F1; FOXO1; FOXO3; BACH2; BLIMP1; XBP1; MIZ1; BCL6; HHEX;GATA1; GATA2; GATA3; IKZF1; IKZF2; IKZF3; TEAD1; TEAD2; BCL11B; SATB1; NFIL3; NFATC1; NFATC2; NFATC3; NFATC4;AR; ESRI; ESR2; RARA; RARB; RARG; THRA; THRB; PGR; VDR; NR3C1; NR3C2;NR1I3; NR3B1; NR3B2; NR3B3; NR1H4; HNF4A; PPARA:: RXRA; NR1C1; NR1C2; NR1C3; NR1F1; NR1F2; NR1F3; NR2B1; NR2B2; NR2B3; NR5A1; NR1I2; NR1H3;NF-YA; NF-YB; NF-YC; Sp2; NRF1; and F0XA1.

35. The method of claim 32, 33, or 34, wherein a target nucleic acid is selected for the isolated nucleic acid construct as follows:(a) wherein the target nucleic acid is associated with chemotherapy resistance, the target nucleic acid is selected from one or more of the following: TS; DPD; DHFR; CDA; ABCB1; 1MRP1; MRP2; ABCG2; CFTR; ABCG5; ABCG8; and MGMT;(b) wherein the target nucleic acid is a proto-oncogene or associated with cell cycle, the target nucleic acid is selected from one or more of the following: MAD 2;WEE1; PLK1; CDK4; CDK6; CDK16; AURKA; AURKB; CHK1; Kifll; CDK1; CSN5; RAN; CCND1; SOX2; E2F1; E2F3; E2F5; E2F6; E2F7; E2F8; NFKB1; NFKB2; RUNX1; HIF1A; andEPASl;(c) wherein the target nucleic acid is an oncogene, the target nucleic acid is selected from one or more of the following: RET; BCL2L12; JAK2; BCL-2; FOS; BCL-XL; MDM2; MCL-1; KIT; Survivin; NOTCH1; MDM2; PDGFRA; XIAP; NTRK1; EGFR; NTRK2; MET; NTRK3; HER2; FGFR1; PIK3CA; FGFR2; ALK; FGFR3; SRC; FGFR4; ROS1; AKT1; AKT2; AKT3; Survivin; FGR; FLT3; MUC1; MYBL2; CTNNB1; TWIST1; XIAP; TWIST2; C-MYC; STAT3; and N-MYC;(d) wherein the target nucleic acid is an anti-apoptotic regulator, the target nucleic acid is selected from one or more of the following: BCL2L12; BCL-2; BCL-XL; MCL-1; Survivin; MDM2; and XIAP;(e) wherein the target nucleic acid is associated with metastasis, the target nucleic acid is selected from one or more of the following: SRPK1; PKN3; NR2F1; RhoC; F0XM1; Rac1; PDK1; KRAS; CD44; NRAS; PTPN22; HRAS; STAT3; PLK1; STAT4; TSG6; STAT6; VEGFA; MET; VEGFB; KIF2A; VEGFC; KIF2B; VEGFD; KIF3A; CXCR4; KIF3B; ALK; KIF5A; TGF-β1; KIF5B; PAR2; KIF5C; MEGF6; KIF7; MOK; KIF11; HIF1A; KIF15; EPAS1; KIFC1; NFKB1; GSTP1; NFKB2; GRB7; and DKK1;(f) wherein the target nucleic acid is associated with immune evasion, the target nucleic acid is selected from one or more of the following: PD-1; PD-L1; CTLA-4; CXCR4; FASLG; FOXP3; and GPRC5B;(g) wherein the target nucleic acid is associated with DNA synthesis and repair, the target nucleic acid is selected from one or more of the following: RRM1; RRM2; TK1; PARP1; PCNA; POLQ; ATM; and ATR; and(h) wherein the target nucleic acid is associated with metabolism, the target nucleic acid is selected from one or more of the following: IDH1; IDH2; LDHA; PKM2; mTOR; GLUT1; GLUT3; GLUT4; andHSPEl.

36. The method of claim 32, 33, or 34, wherein a target nucleic acid is selected for the isolated nucleic acid construct as follows:(a) wherein the target nucleic acid is associated with chemotherapy resistance, the target nucleic acid is selected from one or more of the following: TS; DPD; DHFR; CDA; ABCB1; 1MRP1; MRP2; ABCG2; CFTR; ABCG5; ABCG8; MGMT; and TRPS1;(b) wherein the target nucleic acid is a proto-oncogene or associated with cell cycle, the target nucleic acid is selected from one or more of the following: MAD 2;WEE1; PLK1; CDK4; CDK6; CDK16; AURKA; AURKB; CHK1; Kifll; CDK1; CSN5; RAN; CCND1; SOX2; E2F1; E2F3; E2F5; E2F6; E2F7; E2F8; NFKB1; NFKB2; RUNX1; HIF1A; andEPASl;(c) wherein the target nucleic acid is an oncogene, the target nucleic acid is selected from one or more of the following: RET; BCL2L12; JAK2; BCL-2; FOS; BCL-XL; MDM2; MCL-1; KIT; Survivin; NOTCH1; MDM2; PDGFRA; XIAP; NTRK1; EGFR; NTRK2; MET; NTRK3; HER2; FGFR1; PIK3CA; FGFR2; ALK; FGFR3; SRC; FGFR4; ROS1; AKT1; AKT2; AKT3; Survivin; FGR; FLT3; MUC1; MYBL2; CTNNB1; TWIST1; XIAP; TWIST2; C-MYC; STAT3; and N-MYC;(d) wherein the target nucleic acid is an anti-apoptotic regulator, the target nucleic acid is selected from one or more of the following: BCL2L12; BCL-2; BCL-XL; MCL-1; Survivin; MDM2; and XIAP;Je] wherein the target nucleic acid is associated with metastasis, the target nucleic acid is selected from one or more of the following: SRPK1; PKN3; NR2F1; RhoC; F0XM1; Rael; PDK1; KRAS; CD44; NRAS; PTPN22; ERAS; STAT3; PLK1; STAT4; TSG6; STAT6; VEGFA; MET; VEGFB; KIF2A; VEGFC; KIF2B; VEGFD; KIF3A; CXCR4; KIF3B; ALK; KIF5A; TGF-pl; KIF5B; PAR2; KIF5C; MEGF6; KIF7; MOK; KIF11; HIF1A; KIF15; EPAS1; KIFC1; NFKB1; GSTP1; NFKB2; GRB7; and DKK1;(f) wherein the target nucleic acid is associated with immune evasion, the target nucleic acid is selected from one or more of the following: PD-1; PD-L1; CTLA-4; CXCR4; FASLG; FOXP3; and GPRC5B;Jg] wherein the target nucleic acid is associated with DNA synthesis and repair, the target nucleic acid is selected from one or more of the following: RRM1; RRM2; TK1; PARP1; PCNA; POLQ; ATM; and ATR; and(h) wherein the target nucleic acid is associated with metabolism, the target nucleic acid is selected from one or more of the following: IDH1; IDH2; LDHA; PKM2; mTOR; GLUT1; GLUT3; GLUT4; andHSPEl.

37. The method of claim 32 or 33, wherein the promoter-enhancer region comprises a TFRE, wherein the TFRE is operably linked to a promoter, wherein the TFRE is responsive to a transcription factor selected from one or more of the following:(a) wherein the TFRE is operable to bind a transcription factor and the transcription factor is a cancer associated transcription factor selected from one or more of the following: AP-1; AP-2; MYC; MAX; NFKB1; NFKB2; RELA1; RELB; REL;STAT3; STAT5A; STAT5B; STAT6; GATA2; GATA3; GATA4; GATA6; TP63; TP73; SOX2; SOX3; S0X4; SOX5; SOX6; SOX8; SOX9; SOXIO; SOX11; SOX12; SOX13; SOX15; SOX18; TRPS1; GLI; NFAT1; NFAT2; NFAT4; NFAT5; EWS:: FLI1; FLU; ETS1; ETS2; ERG; ELF1; ELF2; ELF3; ETV1; ETV4; ETV5; ETV6; TMPRSS2:: ETV1; PU.l; ELK1; ELK4; F0XM1; HES1; HES6; YAP; NKX2-1; NKX2-2; OCTI; OCT2; OCT3; RUNX1; E2F1; FOXQ1; TFEB; SRY; LEF1; SRF; JUN; FOS; BATF:: JUN; GABPA; KLF8; SIX1; RUNX2; RARA:: RXRA; TAL1; GATA1:: TAL1; TAL1:: TCF3; F0XA1; HIF1A; EPAS1; TBX1; and TBX2;Jb] wherein the TFRE is operable to bind a transcription factor and the transcription factor is an orphan receptor transcription factor selected from one ormore of the following: NR2F1; NR2F2; NR6A1; NR4A1; NR2E3; NR1D1; NR1D2; NR2E1; NR2C1; NR2C2; NR4A1; and NR4A2;(c) wherein the TFRE is operable to bind a transcription factor and the transcription factor is an immune cell differentiation or immune associated transcription factor selected from one or more of the following: IRF1; IRF3; IRF4; IRF5; IRF7; IRF8; STAT1; STAT2; STAT3; STAT4; STAT5A; STAT5B; STAT6; STAT1:: STAT2; FOXP3; RORA; RORB; RORC; TCF3; TAL1:: TCF3; TCF4; TCF7; TCF7L1; TCF7L2; LEF1; TBX21; TBX3; TBX5; HES1; HES5; BATF; PAX5; MEF2C; SPIB; BCL6; MEF2B; E2F1; FOXO1; FOXO3; BACH2; BLIMP1; XBP1; MIZ1; BCL6; HHEX; GATA1; GATA2; GATA3; IKZF1; IKZF2; IKZF3; TEAD1; TEAD2; BCL11B; SATB1; NFIL3; NFATC1; NFATC2;NFATC3; and NFATC4;(d) wherein the TFRE is operable to bind a transcription factor and the transcription factor an endocrine associated transcription factor selected from one or more of the following: AR; ESRI; ESR2; RARA; RARB; RARG; THRA; THRB; PGR; VDR; NR3C1; and NR3C2;(e) wherein the TFRE is operable to bind a transcription factor and the transcription factor an adopted orphan receptor associated transcription factor selected from one or more of the following: NR1I3; NR3B1; NR3B2; NR3B3; NR1H4; HNF4A; PPARA:: RXRA; NR1C1; NR1C2; NR1C3; NR1F1; NR1F2; NR1F3; NR2B1; NR2B2; NR2B3; NR5A1; NR1I2; and NR1H3; and(f) wherein the TFRE is operable to bind a transcription factor and the transcription factor a mitotic bookmarking transcription factor selected from one or more of the following: NF-YA; NF-YC; NRF1; NF-YB; Sp2; and F0XA1.

38. The method of any one of claims 32-37, wherein the TNM classification is selected from the following:T is selected from one of Tx, Tis, TO, Tl, T2, T3, and T4;N is selected from one of Nx, NO, Nl, N2, and N3; andM is selected from one of MO or Ml.

39. A method of treating breast cancer, wherein the method comprises:(a) determining whether the patient is estrogen receptor (ER) positive (+) or negative (-);(b) determining whether the patient is human epidermal growth factor receptor 2 (HER2) positive (+) or negative (-);(c) determining whether the patient is telomerase reverse transcriptase (TERT) positive (+) or negative (-);(d) choosing an isolated nucleic acid construct of any one of claims 1-18 as follows:(i) wherein the patient is ER+ and HER- selecting ER as the TFRE; (ii) wherein the patient is ER+ and HER+ selecting ERBB2 promoter; (iii) wherein the patient is ER- and HER- and TERT+ selecting a cancer enhanced promotor TERT;(iv) wherein the patient is ER- and HER- and TERT- selecting a tissue specific promoter MUC1; and(e) providing the isolated nucleic acid construct to the subject.

40. A pharmaceutical composition, the pharmaceutical composition comprising:(a) an isolated nucleic acid construct of any one of claims 1-20; and(b) a lipid-based nanoparticle (LNPs) or a polymeric nanoparticle.

Images