Sirna for inhibiting APOC3 gene expression and use thereof
Patent Information
- Application Number
- PCT/CN2026/082716
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-12-12
- Filing Date
- 2026-03-11
- Publication Date
- 2026-09-17
Smart Images

Figure CN2026082716_17092026_PF_FP_ABST
Abstract
Description
siRNAs that inhibit APOC3 gene expression and their applications Technical Field
[0001] This application relates to the field of small nucleic acid drugs, specifically to siRNAs, siRNA conjugates, or the uses thereof for inhibiting APOC3 expression. Background Technology
[0002] Apolipoprotein C III (also known as APOC3, apoC III, and APOC III), encoded by the human apolipoprotein C III gene, has recently emerged as a promising target for the treatment of diseases associated with hypertriglyceridemia. Elevated serum triglyceride (TG) levels have been identified as an independent risk factor for cardiovascular disease and as a contributing factor in the development of atherosclerosis. Individuals with severe hypertriglyceridemia (typically >500 mg / dL) are also at risk of recurrent pancreatitis. Triglycerides are transported in the blood as major components of very low-density lipoprotein cholesterol (VLDL C) and chylomicron particles (known as TG-rich lipoproteins). Lipoproteins consist of a hydrophobic triglyceride and cholesterol ester core and a hydrophilic outer layer of phospholipids, cholesterol, and apolipoproteins. APOC3 is one of these apolipoproteins.
[0003] APOC3 plays a crucial role in the synthesis, metabolism, and clearance of triglyceride-rich lipoproteins (TG) in the liver and plasma. Several gain-of-function polymorphisms have been identified in the promoter region of the APOC3 gene, presumed to be contributing factors in the development of hypertriglyceridemia. Increased APOC3 synthesis in the liver promotes the secretion of TG-rich VLDL C. Furthermore, excessive APOC3 inhibits the activity of lipoprotein lipases and hepatic lipases, further increasing serum TG levels by delaying the catabolism of TG-rich lipoproteins. In addition, elevated APOC3 also delays the hepatic clearance of TG-rich lipoproteins and their residual particles by interfering with the binding of TG-rich lipoproteins to hepatic receptors.
[0004] Increased APOC3 levels can lead to hypertriglyceridemia or the development of diseases associated with elevated triglycerides (TG). Elevated triglyceride levels are associated with a variety of diseases, including cardiovascular disease, atherosclerosis, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis (NAFLD), polycystic ovary syndrome (PCOS), kidney disease, obesity, type 2 diabetes (insulin resistance), hypertension, and skin lesions (xanthoma). Very high TG levels also increase the risk of acute pancreatitis. Therefore, regulating APOC3 metabolism may be an important new therapeutic approach for managing hypertriglyceridemia and related diseases. RNA interference (RNAi) refers to the highly conserved phenomenon of efficient and specific degradation of homologous mRNA induced by double-stranded small interfering RNA (siRNA) during evolution. Researching and developing siRNAs targeting APOC3 gene expression is of great significance. Therefore, the development of APOC3 inhibitors has enormous clinical value and market potential. Summary of the Invention
[0005] This application aims to at least partially address one of the technical problems existing in the prior art. To this end, this application provides an siRNA, siRNA conjugate, or salt thereof for inhibiting APOC3 expression, which can achieve RNA-induced silencing complex (RISC)-mediated cleavage of the APOC3 gene RNA transcript, thereby inhibiting APOC3 gene expression. The siRNA, siRNA conjugate, or salt thereof of this application exhibits good APOC3 inhibitory activity both in vivo and in vitro, possessing high in vivo delivery efficiency and good stability, and exhibiting high gene expression inhibitory activity against APOC3 and / or low toxicity.
[0006] In a first aspect of this application, this application proposes an siRNA comprising a sense strand and an antisense strand, wherein the antisense strand has a double-stranded region with at least partially base-paired bases with the sense strand; wherein the antisense strand comprises a nucleotide sequence as shown in any one of SEQ ID NO:119, SEQ ID NO:117, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:74, SEQ ID NO:85, SEQ ID NO:116, SEQ ID NO:63–SEQ ID NO:67, SEQ ID NO:69, SEQ ID NO:71–SEQ ID NO:73, SEQ ID NO:75–SEQ ID NO:84, SEQ ID NO:86–SEQ ID NO:115, SEQ ID NO:118, and SEQ ID NO:120–SEQ ID NO:124, or a nucleotide sequence containing at least 10 consecutive nucleotides thereof.
[0007] In some embodiments of this application, the antisense strand includes a nucleotide sequence as shown in any one of SEQ ID NO:119, SEQ ID NO:117, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:74, SEQ ID NO:79, SEQ ID NO:84, SEQ ID NO:85 and SEQ ID NO:116, or a nucleotide sequence containing at least 10 consecutive nucleotides thereof.
[0008] In some embodiments of this application, the antisense strand includes a nucleotide sequence as shown in any one of SEQ ID NO:119, SEQ ID NO:117, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:74, SEQ ID NO:84, SEQ ID NO:85 and SEQ ID NO:116, or a nucleotide sequence containing at least 10 consecutive nucleotides thereof.
[0009] In some embodiments of this application, the antisense strand includes a nucleotide sequence as shown in any one of SEQ ID NO:119, SEQ ID NO:74, SEQ ID NO:79, SEQ ID NO:84, SEQ ID NO:116 and SEQ ID NO:117, or a nucleotide sequence containing at least 10 consecutive nucleotides thereof.
[0010] In some embodiments of this application, the positive chain includes a nucleotide sequence as shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:23, SEQ ID NO:54, SEQ ID NO:1 to SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 to SEQ ID NO:11, SEQ ID NO:13 to SEQ ID NO:22, SEQ ID NO:24 to SEQ ID NO:53, SEQ ID NO:56 and SEQ ID NO:58 to SEQ ID NO:62, or a nucleotide sequence containing at least 10 consecutive nucleotides thereof.
[0011] In some embodiments of this application, the positive chain includes a nucleotide sequence as shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:17, SEQ ID NO:22, SEQ ID NO:23 and SEQ ID NO:54, or a nucleotide sequence containing at least 10 consecutive nucleotides thereof.
[0012] In some embodiments of this application, the positive chain comprises a nucleotide sequence as shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:12, SEQ ID NO:17, SEQ ID NO:22 and SEQ ID NO:54, or at least 10 consecutive nucleotides thereof.
[0013] In some embodiments of this application, the positive chain includes nucleotide sequences as shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:23 and SEQ ID NO:54, or nucleotide sequences containing at least 10 consecutive nucleotides thereof.
[0014] In some embodiments of this application, each nucleotide in the sense strand and / or antisense strand is independently a modified or unmodified nucleotide. The siRNA according to embodiments of this application can inhibit APOC3 expression, thereby effectively preventing and / or treating APOC3-related diseases.
[0015] In some embodiments of this application, the siRNA may further include at least one of the following technical features:
[0016] In some embodiments of this application, the positive chain comprises a nucleotide sequence as shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:23, SEQ ID NO:54, SEQ ID NO:1 to SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 to SEQ ID NO:11, SEQ ID NO:13 to SEQ ID NO:22, SEQ ID NO:24 to SEQ ID NO:53, SEQ ID NO:56 and SEQ ID NO:58 to SEQ ID NO:62, or differs from it by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides.
[0017] In some embodiments of this application, the positive chain comprises a nucleotide sequence as shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:17, SEQ ID NO:22, SEQ ID NO:23 and SEQ ID NO:54, or differs from it by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides.
[0018] In some embodiments of this application, the positive chain comprises a nucleotide sequence as shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:6, SEQ ID NO:12, SEQ ID NO:17, SEQ ID NO:22, SEQ ID NO:23 and SEQ ID NO:54, or differs from it by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides.
[0019] In some embodiments of this application, the positive chain includes the nucleotide sequence of any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:23 and SEQ ID NO:54, or differs from it by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 nucleotides.
[0020] In some embodiments of this application, the positive chain comprises a nucleotide sequence as shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:12, SEQ ID NO:17, SEQ ID NO:22 and SEQ ID NO:54, or differs from it by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides.
[0021] In some embodiments of this application, the antisense strand comprises a nucleotide sequence as shown in any one of SEQ ID NO:119, SEQ ID NO:117, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:74, SEQ ID NO:85, SEQ ID NO:116, SEQ ID NO:63~SEQ ID NO:67, SEQ ID NO:69, SEQ ID NO:71~SEQ ID NO:73, SEQ ID NO:75~SEQ ID NO:84, SEQ ID NO:86~SEQ ID NO:115, SEQ ID NO:118 and SEQ ID NO:120~SEQ ID NO:124, or differs from them by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides.
[0022] In some embodiments of this application, the antisense strand comprises a nucleotide sequence as shown in any one of SEQ ID NO:119, SEQ ID NO:117, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:74, SEQ ID NO:79, SEQ ID NO:84, SEQ ID NO:85 and SEQ ID NO:116, or differs from it by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides.
[0023] In some embodiments of this application, the antisense strand comprises a nucleotide sequence as shown in any one of SEQ ID NO:119, SEQ ID NO:117, SEQ ID NO:68, SEQ ID NO:74, SEQ ID NO:79, SEQ ID NO:84, SEQ ID NO:85 and SEQ ID NO:116, or differs from it by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides.
[0024] In some embodiments of this application, the antisense strand comprises a nucleotide sequence as shown in any one of SEQ ID NO:119, SEQ ID NO:117, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:74, SEQ ID NO:84, SEQ ID NO:85 and SEQ ID NO:116, or differs from it by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides.
[0025] In some embodiments of this application, the antisense strand comprises a nucleotide sequence as shown in any one of SEQ ID NO:119, SEQ ID NO:117, SEQ ID NO:74, SEQ ID NO:79, SEQ ID NO:84 and SEQ ID NO:116, or differs from it by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides.
[0026] In some embodiments of this application, the sense strand comprises a nucleotide sequence as shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:23, SEQ ID NO:54, SEQ ID NO:1~SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9~SEQ ID NO:11, SEQ ID NO:13~SEQ ID NO:22, SEQ ID NO:24~SEQ ID NO:53, SEQ ID NO:56 and SEQ ID NO:58~SEQ ID NO:62, or at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 nucleotides thereof; the antisense strand comprises a sequence as shown in SEQ ID NO:119, SEQ ID NO:117, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:74, SEQ ID NO:85, SEQ ID NO:116, SEQ ID NO:62, SEQ ID NO:70, SEQ ID NO:74, SEQ ID NO:85, SEQ ID NO:116, SEQ ID NO:62, SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:74, SEQ ID NO:85, SEQ ID NO:116, SEQ ID NO:62, SEQ ID NO:57, SEQ ID NO:58 ...79, SEQ ID NO:1 The nucleotide sequence shown in any one of SEQ ID NO:63~SEQ ID NO:67, SEQ ID NO:69, SEQ ID NO:71~SEQ ID NO:73, SEQ ID NO:75~SEQ ID NO:84, SEQ ID NO:86~SEQ ID NO:115, SEQ ID NO:118 and SEQ ID NO:120~SEQ ID NO:124, or at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides thereof.
[0027] In some embodiments of this application, the sense strand comprises a nucleotide sequence as shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:17, SEQ ID NO:22, SEQ ID NO:23, and SEQ ID NO:54, or differs from it by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide; the antisense strand comprises a nucleotide sequence as shown in any one of SEQ ID NO:119, SEQ ID NO:117, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:74, SEQ ID NO:79, SEQ ID NO:84, SEQ ID NO:85, and SEQ ID NO:116, or differs from it by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide.
[0028] In some embodiments of this application, the sense strand comprises a nucleotide sequence as shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:6, SEQ ID NO:12, SEQ ID NO:17, SEQ ID NO:22, SEQ ID NO:23, and SEQ ID NO:54, or at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides thereof; the antisense strand comprises a nucleotide sequence as shown in any one of SEQ ID NO:119, SEQ ID NO:117, SEQ ID NO:68, SEQ ID NO:74, SEQ ID NO:79, SEQ ID NO:84, SEQ ID NO:85, and SEQ ID NO:116, or at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides thereof.
[0029] In some embodiments of this application, the sense strand comprises a nucleotide sequence as shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:12, SEQ ID NO:17, SEQ ID NO:22, and SEQ ID NO:54, or at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides thereof; the antisense strand comprises a nucleotide sequence as shown in any one of SEQ ID NO:119, SEQ ID NO:117, SEQ ID NO:74, SEQ ID NO:79, SEQ ID NO:84, and SEQ ID NO:116, or at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides thereof.
[0030] In some embodiments of this application, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:22, SEQ ID NO:23, and SEQ ID NO:54, or differs from it by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide; the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NO:119, SEQ ID NO:117, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:74, SEQ ID NO:84, SEQ ID NO:85, and SEQ ID NO:116, or differs from it by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide.
[0031] In some embodiments of this application, the double-stranded region has a length of 17-23 nucleotides, for example, 17, 18, 19, 20, 21, 22 or 23 nucleotides.
[0032] In some embodiments of this application, the double-stranded region has a length of 18-21 nucleotides, for example, 18, 19, 20 or 21 nucleotides.
[0033] In some embodiments of this application, the siRNA includes any one of the sense and antisense strands in Table A, or has a difference of no more than 5 nucleotides from the sense and / or antisense strands, preferably a difference of no more than 4, 3, 2 or 1 nucleotide.
[0034] Table A
[0035] In some embodiments of this application, the sense strand of the siRNA includes any one of the sense and antisense strands of A57, A6, A8, A12, A17, A22, A23, A54, and A56, or differs from the sense and / or antisense strands by no more than 5, 4, 3, 2, and 1 nucleotides, respectively.
[0036] In some embodiments of this application, the sense strand of the siRNA includes any one of the sense and antisense strands from A57, A6, A8, A12, A17, A22, A23, A54, and A56.
[0037] In some embodiments of this application, the sense strand of the siRNA includes any one of the sense and antisense strands of A6, A12, A17, A22, A23, A54, and A57, or differs from the sense and / or antisense strands by no more than 5, 4, 3, 2, and 1 nucleotides, respectively.
[0038] In some embodiments of this application, the sense strand of the siRNA includes any one of the sense and antisense strands of A57, A6, A8, A12, A22, A23, A54 and A56, or differs from the sense and / or antisense strands by no more than 5, 4, 3, 2 and 1 nucleotides, respectively.
[0039] In some embodiments of this application, the sense strand of the siRNA includes any one of the sense and antisense strands from A57, A6, A8, A12, A22, A23, A54, and A56.
[0040] In some embodiments of this application, the siRNA includes the sense strand and antisense strand of any one of A12, A17, A54 and A57, or differs from the sense strand and / or antisense strand by no more than 5, 4, 3, 2 and 1 nucleotides, respectively.
[0041] In some embodiments of this application, the siRNA comprises one of the following groups:
[0042] A-1) The sense strand containing a nucleotide sequence as shown in AAAAGGGACAGUAUUCUCAGA or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand containing a nucleotide sequence as shown in TCUGAGAAUACUGUCCCUUUU or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0043] A-2) The sense strand contains a nucleotide sequence as shown in AAAAGGGACAGUAUUCUCAGA or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in UCUGAGAAUACUGUCCCUUUU or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0044] A-3) The sense strand contains a nucleotide sequence as shown in CUAAAAGGGACAGUAUUCU or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in AGAAUACUGUCCCUUUUAG or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0045] A-4) The sense strand contains a nucleotide sequence as shown in AAAGGGACAGUAUUCUCAGA or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in UCUGAGAAUACUGUCCCUUU or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0046] A-5) The sense strand contains a nucleotide sequence as shown in AAGGGACAGUAUUCUCAGA or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in UCUGAGAAUACUGUCCCUU or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0047] A-6) The sense strand contains a nucleotide sequence as shown in CAGUAUUCUCAGUGCUCUA or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in UAGAGCACUGAGAAUACUG or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0048] A-7) The sense strand contains a nucleotide sequence as shown in GCCUAAAAGGGACAGUAUUCU or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in AGAAUACUGUCCCUUUUAGGC or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0049] A-8) A sense strand containing a nucleotide sequence as shown in GGGACAGUAUUCUCAGUGA or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides; and an antisense strand containing a nucleotide sequence as shown in UCACUGAGAAUACUGUCCC or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides; and
[0050] A-9) A sense strand containing a nucleotide sequence as shown in GGGACAGUAUUCUCAGUAA or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides, and an antisense strand containing a nucleotide sequence as shown in UUACUGAGAAUACUGUCCC or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0051] In some embodiments of this application, the length of the positive chain is no more than 23 nucleotides, preferably no more than 21 nucleotides, such as 19, 20 or 21 nucleotides.
[0052] In some embodiments of this application, the length of the antisense strand is no more than 25 nucleotides, preferably no more than 24 nucleotides, such as 19, 20, 21, 22, 23 or 24 nucleotides.
[0053] In some embodiments of this application, the justice chain has a 3' protrusion and / or a 5' protrusion.
[0054] In some embodiments of this application, the antisense chain has a 3' protrusion and / or a 5' protrusion.
[0055] In some embodiments of this application, the 3' protrusion and / or 5' protrusion comprises one or two nucleotides or the like.
[0056] In some embodiments of this application, the nucleotides of the 3' protrusion and / or 5' protrusion are each independently selected from A, U, C, G, T, dA, dU, dC, dG, or dT.
[0057] In this document, "dX" represents deoxyribonucleotide, where "dA" refers to deoxyadenine, "dU" refers to deoxyuracil, "dC" refers to deoxycytosine, "dG" refers to deoxyguanine, and "dT" refers to deoxythymidine. In an optional embodiment of this application, the antisense strand contains a 3' overhang, which comprises one or two nucleotides or analogues thereof.
[0058] In some embodiments of this application, the siRNA includes any one of the sense and antisense strands in Table B, or differs from the sense and / or antisense strands by no more than 5, 4, 3, 2, or 1 nucleotides, respectively.
[0059] Table B
[0060] In some embodiments of this application, the siRNA includes the sense strand and antisense strand of any one of B91, B6, B12, B17, B23, B24, B82 and B105, or differs from the sense strand and / or antisense strand by no more than 5, 4, 3, 2 and 1 nucleotides, respectively.
[0061] In some embodiments of this application, the siRNA includes the sense and antisense strands of any one of B91, B6, B12, B17, B23, B24, B82, and B105.
[0062] In some embodiments of this application, the siRNA includes the sense strand and antisense strand of any one of B6, B12, B17, B23, B24, B82 and B91, or differs from the sense strand and / or antisense strand by no more than 5, 4, 3, 2 and 1 nucleotides, respectively.
[0063] In some embodiments of this application, the siRNA includes the sense and antisense strands of any one of B12, B17, B82, and B91, or differs from the sense and / or antisense strands by no more than 5, 4, 3, 2, and 1 nucleotides, respectively.
[0064] In some embodiments of this application, the siRNA comprises one of the following groups:
[0065] B-1) The sense strand contains a nucleotide sequence as shown in AAAAGGGACAGUAUUCUCAGA or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in TCUGAGAAUACUGUCCCUUUUA or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0066] B-2) The sense strand contains a nucleotide sequence as shown in AAAAGGGACAGUAUUCUCAGA or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in UCUGAGAAUACUGUCCCUUUUA or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0067] B-3) The sense strand contains a nucleotide sequence as shown in CUAAAAGGGACAGUAUUCU or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in AGAAUACUGUCCCUUUUAGGC or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0068] B-4) The sense strand contains a nucleotide sequence as shown in AAAGGGACAGUAUUCUCAGA or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in UCUGAGAAUACUGUCCCUUUU or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0069] B-5) The sense strand contains a nucleotide sequence as shown in AAGGGACAGUAUUCUCAGA or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in UCUGAGAAUACUGUCCCUUUU or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0070] B-6) The sense strand contains a nucleotide sequence as shown in CAGUAUUCUCAGUGCUCUA or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in UAGAGCACUGAGAAUACUGUC or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0071] B-7) The sense strand containing a nucleotide sequence as shown in GGGACAGUAUUCUCAGUGA or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides; and the antisense strand containing a nucleotide sequence as shown in UCACUGAGAAUACUGUCCCGU or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides; and
[0072] B-8) A sense strand containing a nucleotide sequence as shown in GCCUAAAAGGGACAGUAUUCU or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides, and an antisense strand containing a nucleotide sequence as shown in AGAAUACUGUCCCUUUUAGGC or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0073] In some embodiments of this application, the sense strand and / or the antisense strand comprises at least one modified nucleotide, each of which is independently selected from at least one of the following:
[0074] Reverse debasing nucleotide (InvB), deoxynucleotide, reverse deoxynucleotide, reverse deoxydebasing ribose, 2'-fluorinated nucleotide, 2'-amino nucleotide, 2'-O-allyl nucleotide, 2'-C 1~25 Alkyl-modified nucleotides, 2'-methoxyethoxy-modified nucleotides, 2'-OC 1~25 Alkyl-modified nucleotides, locked nucleotides, configuration-restricted nucleotides, 2'-allyl-modified nucleotides, base-free nucleotides, morpholinyl nucleotides, tetrahydropyran-modified nucleotides, 1,5-dehydrohexyl alcohol-modified nucleotides, cyclohexenyl-modified nucleotides, PEG-modified nucleotides, 5'-aminophosphate-modified nucleotides, thiophosphate-modified nucleotides, 5'-methylphosphonate-modified nucleotides, 5'-phosphate mimic-modified nucleotides, 5'-methylcytosine-modified nucleotides, non-natural base nucleotides, and nucleic acid analogs.
[0075] In some alternative embodiments of this application, the 2'-C 1~25 Alkyl-modified nucleotides include 2'-methoxy-modified nucleotides and 2'-methoxyethyl-modified nucleotides.
[0076] In some embodiments of this application, the modified nucleotide is independently selected from at least one of InvB, InvdA, InvdT, i, If, 2'-methoxy-modified nucleotides, 2'-methoxyethoxy-modified nucleotides, 5'-methylcytosine-modified nucleotides, 2'-fluoro-modified nucleotides, 5'-(E)-VP-modified nucleic acids, and phosphate thioester-modified nucleotides. It should be noted that in this invention, v represents 5'-(E)-VP modification.
[0077] In some embodiments, the 5'-(E)-VP modified nucleic acid is located at the 5' end of the sense strand or the 5' end of the antisense strand; preferably, the 5'-(E)-VP modified nucleic acid is located at the 5' end of the antisense strand.
[0078] In some embodiments of this application, all nucleotides of the sense strand are modified nucleotides; and / or, all nucleotides of the antisense strand are modified nucleotides.
[0079] In some embodiments of this application, the antisense strand comprises two thiosclerotic modifications between the three terminal nucleotides at the 3' and 5' ends, respectively.
[0080] In this document, the term "thioscaffold modification" refers to modification via a thiophosphate group. Specifically, the term "two thioscaffold modifications between the three terminal nucleotides at the 3' and 5' ends" refers to two thioscaffold modifications between the three terminal nucleotides at the 3' end and two thioscaffold modifications between the three terminal nucleotides at the 5' end. For example, "two thioscaffold modifications between the three terminal nucleotides at the 3' end" means a modification between the first and second nucleotides starting from the 3' end via a thiophosphate group (i.e., a thiophosphate bond modification), and a modification between the second and third nucleotides via a thiophosphate group.
[0081] In some embodiments of this application, the positive chain comprises two thiosclerotic modifications (i.e., thiophosphate modifications) between the three terminal nucleotides at the 3' and 5' ends.
[0082] In some embodiments of this application, the positive chain includes a thiosclerosis modification between the two terminal nucleotides at the 3' and 5' ends.
[0083] In some embodiments of this application, the positive chain includes a thiosclerosis modification between the two terminal nucleotides at the 5' end and two thiosclerosis modifications between the three terminal nucleotides at the 3' end.
[0084] In some embodiments of this application, the positive chain includes two thiosclerotic modifications between the three terminal nucleotides at the 5' end and one thiosclerotic modification between the two terminal nucleotides at the 3' end.
[0085] In some embodiments of this application, the nucleotide at the 3' end of the positive strand is InvdA or InvdT.
[0086] In some embodiments of this application, the A at the end of the justice chain 3' is InvdA, or the T at the end of the justice chain 3' is InvdT.
[0087] In some embodiments of this application, G in the justice chain is i or If.
[0088] In an optional embodiment of this application, the nucleotide at the 3' end of the positive strand is i at the second position of the start point. For example, the positive strand is GGGACAGUAUUCUCAGUGA, and after the nucleotide at the 5' end is i at the second position of the start point, the positive strand becomes GGGACAGUAUUCUCAGUiA.
[0089] In an optional embodiment of this application, the 5' terminal nucleotide of the positive strand is G=If at the 9th or 11th position of the start point. For example, the positive strand is GCCUAAAAGGGACAGUAUUCU, and after G=If at the 11th position of the start point at its 5' terminal nucleotide, the positive strand becomes GCCUAAAAGGIfACAGUAUUCU; the positive strand is CUAAAAGGGACAGUAUUCU, and after G=If at the 9th position of the start point at its 5' terminal nucleotide, the positive strand becomes CUAAAAGGIfACAGUAUUCU.
[0090] In some embodiments of this application, the siRNA comprises (R)- and (S)-enantiomers, diastereomers, and / or racemic mixtures thereof.
[0091] In some embodiments of this application, the phosphothiophosphate groups in the siRNA include (R)- and (S)-enantiomers, diastereomers, and / or racemic mixtures thereof.
[0092] In some embodiments of this application, the 2'-fluorinated nucleotide is present at the following positions:
[0093] The 5' terminal nucleotide of the sense strand is at least one of the following positions: position 1, position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 10, position 11, position 12, position 13, position 14, position 15, position 16, position 17, position 18, position 19, position 20, and position 21 of the start point; and / or, the 5' terminal nucleotide of the antisense strand is at least one of the following positions: position 1, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10, position 11, position 12, position 13, position 15, position 16, position 17, position 18, position 19, position 20, position 21, position 22, position 23, and position 24 of the start point.
[0094] In some embodiments of this application, the 2'-fluorinated nucleotide is present at the following positions:
[0095] The 5' terminal nucleotide of the sense strand is at least one of the 5th, 6th, 7th, 8th, 9th, 10th, and 11th positions of the start point; and / or, the 5' terminal nucleotide of the antisense strand is at least one of the 1st, 2nd, 3rd, 4th, 6th, 7th, 8th, 9th, 10th, 12th, 14th, 16th, 18th, and 20th positions of the start point.
[0096] In some embodiments of this application, the 2'-methoxy modified nucleotide is present at the following positions:
[0097] The 5' terminal nucleotide of the sense strand is at least one of the following positions: position 1, position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 10, position 11, position 12, position 13, position 14, position 15, position 16, position 17, position 18, position 19, position 20, and position 21 of the start point; and / or, the 5' terminal nucleotide of the antisense strand is at least one of the following positions: position 1, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10, position 11, position 12, position 13, position 15, position 16, position 17, position 18, position 19, position 20, position 21, position 22, position 23, and position 24 of the start point.
[0098] In some embodiments of this application, the 2'-methoxyethyl modified nucleotide is present at the following positions:
[0099] The 5' terminal nucleotide of the sense strand is at least one of the following positions: position 1, position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 10, position 11, position 12, position 13, position 14, position 15, position 16, position 17, position 18, position 19, position 20, and position 21 of the start point; and / or, the 5' terminal nucleotide of the antisense strand is at least one of the following positions: position 1, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10, position 11, position 12, position 13, position 15, position 16, position 17, position 18, position 19, position 20, position 21, position 22, position 23, and position 24 of the start point.
[0100] In some embodiments of this application, the 2'-methoxyethyl modified nucleotide is present at the following positions:
[0101] The nucleotide at the 5' end of the sense strand is at least one of the first and second positions of the start point, and / or the nucleotide at the 3' end of the sense strand is the first position of the start point; and / or the nucleotide at the 5' end of the antisense strand is the first position of the start point.
[0102] In some embodiments of this application, the nucleotide modified with a thiophosphate group is present at the following positions:
[0103] The 5' terminal nucleotide of the positive strand is at least one of the following: between positions 1 and 2, 2 and 3, 3 and 4, 4 and 5, 5 and 6, 6 and 7, 7 and 8, 8 and 9, 9 and 10, 10 and 11, 11 and 12, 12 and 13, 13 and 14, 14 and 15, 15 and 16, 17 and 18, 18 and 19, 19 and 20, and 20 and 21; and / or, the 5' terminal nucleotide of the antisense strand is... At least one of the following: between the 1st and 2nd positions, between the 2nd and 3rd positions, between the 3rd and 4th positions, between the 4th and 5th positions, between the 5th and 6th positions, between the 6th and 7th positions, between the 7th and 8th positions, between the 8th and 9th positions, between the 9th and 10th positions, between the 10th and 11th positions, between the 11th and 12th positions, between the 12th and 13th positions, between the 13th and 14th positions, between the 14th and 15th positions, between the 15th and 16th positions, between the 17th and 18th positions, between the 18th and 19th positions, between the 19th and 20th positions, between the 20th and 21st positions, between the 21st and 22nd positions, between the 22nd and 23rd positions, and between the 23rd and 24th positions.
[0104] In some embodiments of this application, the nucleotide modified with a thiophosphate group is present at the following positions:
[0105] The 5' terminal nucleotide of the sense strand is at least one of the positions between the 1st and 2nd positions and between the 2nd and 3rd positions of the start point, and / or the 3' terminal nucleotide of the antisense strand is at least one of the positions between the 1st and 2nd positions and between the 2nd and 3rd positions of the start point; and / or the 5' terminal nucleotide of the antisense strand is at least one of the positions between the 1st and 2nd positions and between the 2nd and 3rd positions of the start point, and / or the 3' terminal nucleotide of the antisense strand is at least one of the positions between the 1st and 2nd positions and between the 2nd and 3rd positions of the start point.
[0106] In some embodiments of this application, the modified nucleotides of the sense strand and the antisense strand are as follows:
[0107] 1-1) 2'-Fluorinated nucleotides are present at the following positions:
[0108] The nucleotides at the 5' end of the sense strand are the 7th, 9th, 10th, and 11th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 6th, 14th, and 16th positions of the start point.
[0109] 2'-methoxy modified nucleotides are present at the following positions:
[0110] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 15, 16, 17, 18, and 19 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 of the start point.
[0111] Nucleotides modified with thiophosphate groups are located at the following positions:
[0112] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point;
[0113] 1-2) 2'-Fluorinated nucleotides are present at the following positions:
[0114] The nucleotides at the 5' end of the sense strand are the 7th, 9th, 10th, and 11th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 6th, 14th, and 16th positions of the start point.
[0115] 2'-methoxy modified nucleotides are present at the following positions:
[0116] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 15, 16, 17, 18, and 19 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 of the start point.
[0117] Nucleotides modified with thiophosphate groups are located at the following positions:
[0118] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions, and between the second and third positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point.
[0119] In some embodiments of this application, the modified nucleotides of the sense strand and the antisense strand are as follows:
[0120] 2-1) 2'-Fluorinated nucleotides are present at the following positions:
[0121] The nucleotides at the 5' end of the sense strand are the 9th, 10th, and 11th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 4th, 6th, 12th, 14th, 16th, 18th, and 20th positions of the start point.
[0122] 2'-methoxy modified nucleotides are present at the following positions:
[0123] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 7, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 3, 5, 7, 8, 9, 10, 11, 13, 15, 17, 19, and 21 of the start point.
[0124] Nucleotides modified with thiophosphate groups are located at the following positions:
[0125] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point;
[0126] 2-2) 2'-Fluorinated nucleotides are present at the following positions:
[0127] The nucleotides at the 5' end of the sense strand are the 9th, 10th, and 11th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 4th, 6th, 12th, 14th, 16th, 18th, and 20th positions of the start point.
[0128] 2'-methoxy modified nucleotides are present at the following positions:
[0129] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 7, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 3, 5, 7, 8, 9, 10, 11, 13, 15, 17, 19, and 21 of the start point.
[0130] Nucleotides modified with thiophosphate groups are located at the following positions:
[0131] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions, and between the second and third positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point.
[0132] In some embodiments of this application, the modified nucleotides of the sense strand and the antisense strand are as follows:
[0133] 3-1) 2'-Fluorinated nucleotides are present at the following positions:
[0134] The nucleotides at the 5' end of the sense strand are the 7th, 8th, and 9th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 4th, 6th, 12th, 14th, 16th, 18th, and 20th positions of the start point.
[0135] 2'-methoxy modified nucleotides are present at the following positions:
[0136] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 3, 5, 7, 8, 9, 10, 11, 13, 15, 17, 19, and 21 of the start point.
[0137] Nucleotides modified with thiophosphate groups are located at the following positions:
[0138] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point;
[0139] 3-2) 2'-Fluorinated nucleotides are present at the following positions:
[0140] The nucleotides at the 5' end of the sense strand are the 7th, 8th, and 9th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 4th, 6th, 12th, 14th, 16th, 18th, and 20th positions of the start point.
[0141] 2'-methoxy modified nucleotides are present at the following positions:
[0142] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 3, 5, 7, 8, 9, 10, 11, 13, 15, 17, 19, and 21 of the start point.
[0143] Nucleotides modified with thiophosphate groups are located at the following positions:
[0144] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions, and between the second and third positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point.
[0145] In some embodiments of this application, the modified nucleotides of the sense strand and the antisense strand are as follows:
[0146] 4-1) 2'-Fluorinated nucleotides are present at the following positions:
[0147] The nucleotides at the 5' end of the sense strand are the 7th, 8th, and 9th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 6th, 12th, 14th, and 16th positions of the start point.
[0148] 2'-methoxy modified nucleotides are present at the following positions:
[0149] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 13, 15, 17, 18, 19, 20, and 21 of the start point.
[0150] Nucleotides modified with thiophosphate groups are located at the following positions:
[0151] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point;
[0152] 4-2) 2'-Fluorinated nucleotides are present at the following positions:
[0153] The nucleotides at the 5' end of the sense strand are the 7th, 8th, and 9th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 6th, 12th, 14th, and 16th positions of the start point.
[0154] 2'-methoxy modified nucleotides are present at the following positions:
[0155] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 13, 15, 17, 18, 19, 20, and 21 of the start point.
[0156] Nucleotides modified with thiophosphate groups are located at the following positions:
[0157] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions, and between the second and third positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point.
[0158] In some embodiments of this application, the modified nucleotides of the sense strand and the antisense strand are as follows:
[0159] 5-1) 2'-Fluorinated nucleotides are present at the following positions:
[0160] The nucleotides at the 5' end of the sense strand are the 7th, 8th, and 9th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd and 14th positions of the start point.
[0161] 2'-methoxy modified nucleotides are present at the following positions:
[0162] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19, 20, and 21 of the start point.
[0163] Nucleotides modified with thiophosphate groups are located at the following positions:
[0164] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point;
[0165] 5-2) 2'-Fluorinated nucleotides are present at the following positions:
[0166] The nucleotides at the 5' end of the sense strand are the 7th, 8th, and 9th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd and 14th positions of the start point.
[0167] 2'-methoxy modified nucleotides are present at the following positions:
[0168] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19, 20, and 21 of the start point.
[0169] Nucleotides modified with thiophosphate groups are located at the following positions:
[0170] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions, and between the second and third positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point.
[0171] In some embodiments of this application, the modified nucleotides of the sense strand and the antisense strand are as follows:
[0172] 6-1) 2'-Fluorinated nucleotides are present at the following positions:
[0173] The nucleotides at the 5' end of the sense strand are the 7th and 9th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd and 14th positions of the start point.
[0174] 2'-methoxy modified nucleotides are present at the following positions:
[0175] The nucleotides at the 5' end of the sense strand are the 1st, 2nd, 3rd, 4th, 5th, 6th, 8th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, and 19th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 1st, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 16th, 17th, 18th, 19th, 20th, and 21st positions of the start point;
[0176] Nucleotides modified with thiophosphate groups are located at the following positions:
[0177] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point;
[0178] 6-2) The 2'-fluorinated nucleotide is present at the following positions:
[0179] The nucleotides at the 5' end of the sense strand are the 7th and 9th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd and 14th positions of the start point.
[0180] 2'-methoxy modified nucleotides are present at the following positions:
[0181] The nucleotides at the 5' end of the sense strand are the 1st, 2nd, 3rd, 4th, 5th, 6th, 8th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, and 19th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 1st, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 16th, 17th, 18th, 19th, 20th, and 21st positions of the start point;
[0182] Nucleotides modified with thiophosphate groups are located at the following positions:
[0183] The nucleotides at the 5' end of the sense strand are between the first and second positions of the starting point, and between the first and second positions, and between the second and third positions of the 3' end of the sense strand; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, and between the second and third positions of the starting point, and between the first and second positions, and between the second and third positions of the 3' end of the antisense strand.
[0184] In some embodiments of this application, the modified nucleotides of the sense strand and the antisense strand are as follows:
[0185] 7-1) 2'-Fluorinated nucleotides are present at the following positions:
[0186] The nucleotides at the 5' end of the sense strand are the 9th and 11th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd and 14th positions of the start point.
[0187] 2'-methoxy modified nucleotides are present at the following positions:
[0188] The nucleotides at the 5' end of the sense strand are the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 10th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, and 19th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 1st, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 16th, 17th, 18th, 19th, 20th, and 21st positions of the start point;
[0189] Nucleotides modified with thiophosphate groups are located at the following positions:
[0190] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point;
[0191] 7-2) 2'-Fluorinated nucleotides are present at the following positions:
[0192] The nucleotides at the 5' end of the sense strand are the 9th and 11th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd and 14th positions of the start point.
[0193] 2'-methoxy modified nucleotides are present at the following positions:
[0194] The nucleotides at the 5' end of the sense strand are the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 10th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, and 19th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 1st, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 16th, 17th, 18th, 19th, 20th, and 21st positions of the start point;
[0195] Nucleotides modified with thiophosphate groups are located at the following positions:
[0196] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions, and between the second and third positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point.
[0197] In some embodiments of this application, the modified nucleotides of the sense strand and the antisense strand are as follows:
[0198] 8-1) 2'-Fluorinated nucleotides are present at the following positions:
[0199] The nucleotides at the 5' end of the sense strand are the 7th and 9th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 3rd, 6th, 12th, 14th and 16th positions of the start point;
[0200] 2'-methoxy modified nucleotides are present at the following positions:
[0201] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 4, 5, 7, 8, 9, 10, 11, 13, 15, 17, 18, 19, 20, and 21 of the start point.
[0202] Nucleotides modified with thiophosphate groups are located at the following positions:
[0203] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point;
[0204] 8-2) The 2'-fluorinated nucleotide is present at the following positions:
[0205] The nucleotides at the 5' end of the sense strand are the 7th and 9th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 3rd, 6th, 12th, 14th and 16th positions of the start point;
[0206] 2'-methoxy modified nucleotides are present at the following positions:
[0207] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 4, 5, 7, 8, 9, 10, 11, 13, 15, 17, 18, 19, 20, and 21 of the start point.
[0208] Nucleotides modified with thiophosphate groups are located at the following positions:
[0209] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions, and between the second and third positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point.
[0210] In some embodiments of this application, the modified nucleotides of the sense strand and the antisense strand are as follows:
[0211] 9-1) 2'-Fluorinated nucleotides are present at the following positions:
[0212] The nucleotides at the 5' end of the sense strand are the 9th and 11th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 3rd, 6th, 12th, 14th and 16th positions of the start point.
[0213] 2'-methoxy modified nucleotides are present at the following positions:
[0214] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 13, 14, 15, 16, 17, 18, and 19 of the start site; and the 5' terminal nucleotides of the antisense strand are at positions 1, 4, 5, 7, 8, 9, 10, 11, 13, 15, 17, 18, 19, 20, and 21 of the start site.
[0215] Nucleotides modified with thiophosphate groups are located at the following positions:
[0216] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point;
[0217] 9-2) 2'-Fluorinated nucleotides are present at the following positions:
[0218] The nucleotides at the 5' end of the sense strand are the 9th and 11th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 3rd, 6th, 12th, 14th and 16th positions of the start point.
[0219] 2'-methoxy modified nucleotides are present at the following positions:
[0220] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 13, 14, 15, 16, 17, 18, and 19 of the start site; and the 5' terminal nucleotides of the antisense strand are at positions 1, 4, 5, 7, 8, 9, 10, 11, 13, 15, 17, 18, 19, 20, and 21 of the start site.
[0221] Nucleotides modified with thiophosphate groups are located at the following positions:
[0222] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions, and between the second and third positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point.
[0223] In some embodiments of this application, the modified nucleotides of the sense strand and the antisense strand are as follows:
[0224] 10-1) 2'-fluorinated nucleotides are present at the following positions:
[0225] The nucleotides at the 5' end of the sense strand are the 9th, 10th, and 11th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 4th, 6th, 12th, 14th, 16th, 18th, and 20th positions of the start point.
[0226] 2'-methoxy modified nucleotides are present at the following positions:
[0227] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 7, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 3, 5, 7, 8, 9, 10, 11, 13, 15, 17, 19, 21, 22, and 23 of the start point.
[0228] Nucleotides modified with thiophosphate groups are located at the following positions:
[0229] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point;
[0230] 10-2)2'-fluorinated nucleotides are present at the following positions:
[0231] The nucleotides at the 5' end of the sense strand are the 9th, 10th, and 11th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 4th, 6th, 12th, 14th, 16th, 18th, and 20th positions of the start point.
[0232] 2'-methoxy modified nucleotides are present at the following positions:
[0233] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 7, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 3, 5, 7, 8, 9, 10, 11, 13, 15, 17, 19, 21, 22, and 23 of the start point.
[0234] Nucleotides modified with thiophosphate groups are located at the following positions:
[0235] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions, and between the second and third positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point.
[0236] In some embodiments of this application, the modified nucleotides of the sense strand and the antisense strand are as follows:
[0237] 11-1) The 2'-fluorinated nucleotide is present at the following positions:
[0238] The nucleotides at the 5' end of the sense strand are the 9th and 11th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 4th, 6th, 12th, 14th, 16th, 18th and 20th positions of the start point.
[0239] 2'-methoxy modified nucleotides are present at the following positions:
[0240] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 3, 5, 7, 8, 9, 10, 11, 13, 15, 17, 19, 21, 22, and 23 of the start point.
[0241] Nucleotides modified with thiophosphate groups are located at the following positions:
[0242] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point;
[0243] 11-2) The 2'-fluorinated nucleotide is present at the following positions:
[0244] The nucleotides at the 5' end of the sense strand are the 9th and 11th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 4th, 6th, 12th, 14th, 16th, 18th and 20th positions of the start point.
[0245] 2'-methoxy modified nucleotides are present at the following positions:
[0246] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 3, 5, 7, 8, 9, 10, 11, 13, 15, 17, 19, 21, 22, and 23 of the start point.
[0247] Nucleotides modified with thiophosphate groups are located at the following positions:
[0248] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions, and between the second and third positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point.
[0249] In some embodiments of this application, the modified nucleotides of the sense strand and the antisense strand are as follows:
[0250] 12-1) The 2'-fluorinated nucleotide is present at the following positions:
[0251] The nucleotides at the 5' end of the sense strand are the 9th, 10th, and 11th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 6th, 14th, and 16th positions of the start point.
[0252] 2'-methoxy modified nucleotides are present at the following positions:
[0253] The nucleotides at the 5' end of the sense strand are the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, and 21st positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th, 20th, 21st, 22nd, and 23rd positions of the start point;
[0254] Nucleotides modified with thiophosphate groups are located at the following positions:
[0255] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point;
[0256] 12-2) 2'-Fluorinated nucleotides are present at the following positions:
[0257] The nucleotides at the 5' end of the sense strand are the 9th, 10th, and 11th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 6th, 14th, and 16th positions of the start point.
[0258] 2'-methoxy modified nucleotides are present at the following positions:
[0259] The nucleotides at the 5' end of the sense strand are the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, and 21st positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th, 20th, 21st, 22nd, and 23rd positions of the start point;
[0260] Nucleotides modified with thiophosphate groups are located at the following positions:
[0261] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions, and between the second and third positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point.
[0262] In some embodiments of this application, the modified nucleotides of the sense strand and the antisense strand are as follows:
[0263] 13-1) The 2'-fluorinated nucleotide is present at the following positions:
[0264] The nucleotides at the 5' end of the sense strand are the 9th and 11th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 6th, 14th and 16th positions of the start point.
[0265] 2'-methoxy modified nucleotides are present at the following positions:
[0266] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, and 23 of the start point.
[0267] Nucleotides modified with thiophosphate groups are located at the following positions:
[0268] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point;
[0269] 13-2) The 2'-fluorinated nucleotide is present at the following positions:
[0270] The nucleotides at the 5' end of the sense strand are the 9th and 11th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 6th, 14th and 16th positions of the start point.
[0271] 2'-methoxy modified nucleotides are present at the following positions:
[0272] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, and 23 of the start point.
[0273] Nucleotides modified with thiophosphate groups are located at the following positions:
[0274] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions, and between the second and third positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point.
[0275] In some embodiments of this application, the modified nucleotides of the sense strand and the antisense strand are as follows:
[0276] 14-1) The 2'-fluorinated nucleotide is present at the following positions:
[0277] The nucleotides at the 5' end of the sense strand are the 9th, 10th, and 11th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 12th, and 14th positions of the start point.
[0278] 2'-methoxy modified nucleotides are present at the following positions:
[0279] The nucleotides at the 5' end of the sense strand are the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, and 21st positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 1st, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 13th, 15th, 16th, 17th, 18th, 19th, 20th, 21st, 22nd, and 23rd positions of the start point;
[0280] Nucleotides modified with thiophosphate groups are located at the following positions:
[0281] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point;
[0282] 14-2) 2'-Fluorinated nucleotides are present at the following positions:
[0283] The nucleotides at the 5' end of the sense strand are the 9th, 10th, and 11th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 12th, and 14th positions of the start point.
[0284] 2'-methoxy modified nucleotides are present at the following positions:
[0285] The nucleotides at the 5' end of the sense strand are the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, and 21st positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 1st, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 13th, 15th, 16th, 17th, 18th, 19th, 20th, 21st, 22nd, and 23rd positions of the start point;
[0286] Nucleotides modified with thiophosphate groups are located at the following positions:
[0287] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions, and between the second and third positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point.
[0288] In some embodiments of this application, the modified nucleotides of the sense strand and the antisense strand are as follows:
[0289] 15-1) The 2'-fluorinated nucleotide is present at the following positions:
[0290] The nucleotides at the 5' end of the sense strand are the 9th and 11th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 12th, and 14th positions of the start point;
[0291] 2'-methoxy modified nucleotides are present at the following positions:
[0292] The 5' terminal nucleotides of the sense strand are the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 10th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, and 21st positions of the start point; and the 5' terminal nucleotides of the antisense strand are the 1st, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 13th, 15th, 16th, 17th, 18th, 19th, 20th, 21st, 22nd, and 23rd positions of the start point;
[0293] Nucleotides modified with thiophosphate groups are located at the following positions:
[0294] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point;
[0295] 15-2) The 2'-fluorinated nucleotide is present at the following positions:
[0296] The nucleotides at the 5' end of the sense strand are the 9th and 11th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 12th, and 14th positions of the start point;
[0297] 2'-methoxy modified nucleotides are present at the following positions:
[0298] The 5' terminal nucleotides of the sense strand are the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 10th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, and 21st positions of the start point; and the 5' terminal nucleotides of the antisense strand are the 1st, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 13th, 15th, 16th, 17th, 18th, 19th, 20th, 21st, 22nd, and 23rd positions of the start point;
[0299] Nucleotides modified with thiophosphate groups are located at the following positions:
[0300] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions, and between the second and third positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point.
[0301] In some embodiments of this application, the modified nucleotides of the sense strand and the antisense strand are as follows:
[0302] 16-1) The 2'-fluorinated nucleotide is present at the following positions:
[0303] The nucleotides at the 5' end of the sense strand are the 9th, 10th, and 11th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 3rd, 6th, 14th, and 16th positions of the start point.
[0304] 2'-methoxy modified nucleotides are present at the following positions:
[0305] The nucleotides at the 5' end of the sense strand are the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, and 21st positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 1st, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th, 20th, 21st, 22nd, and 23rd positions of the start point;
[0306] Nucleotides modified with thiophosphate groups are located at the following positions:
[0307] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point;
[0308] 16-2) 2'-fluorinated nucleotides are present at the following positions:
[0309] The nucleotides at the 5' end of the sense strand are the 9th, 10th, and 11th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 3rd, 6th, 14th, and 16th positions of the start point.
[0310] 2'-methoxy modified nucleotides are present at the following positions:
[0311] The nucleotides at the 5' end of the sense strand are the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, and 21st positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 1st, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th, 20th, 21st, 22nd, and 23rd positions of the start point;
[0312] Nucleotides modified with thiophosphate groups are located at the following positions:
[0313] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions, and between the second and third positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point.
[0314] In some embodiments of this application, the modified nucleotides of the sense strand and the antisense strand are as follows:
[0315] 17-1) The 2'-fluorinated nucleotide is present at the following positions:
[0316] The nucleotides at the 5' end of the sense strand are the 9th and 11th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 3rd, 6th, 14th and 16th positions of the start point;
[0317] 2'-methoxy modified nucleotides are present at the following positions:
[0318] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, and 23 of the start point.
[0319] Nucleotides modified with thiophosphate groups are located at the following positions:
[0320] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point;
[0321] 17-2) The 2'-fluorinated nucleotide is present at the following positions:
[0322] The nucleotides at the 5' end of the sense strand are the 9th and 11th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 3rd, 6th, 14th and 16th positions of the start point;
[0323] 2'-methoxy modified nucleotides are present at the following positions:
[0324] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, and 23 of the start point.
[0325] Nucleotides modified with thiophosphate groups are located at the following positions:
[0326] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions, and between the second and third positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point.
[0327] In some embodiments of this application, the modified nucleotides of the sense strand and the antisense strand are as follows:
[0328] 18-1) 2'-fluorinated nucleotides are present at the following positions:
[0329] The nucleotides at the 5' end of the sense strand are the 9th and 10th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 3rd, 6th, 14th, and 16th positions of the start point;
[0330] 2'-methoxy modified nucleotides are present at the following positions:
[0331] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 7, 8, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, and 23 of the start point.
[0332] Nucleotides modified with thiophosphate groups are located at the following positions:
[0333] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point;
[0334] 18-2) 2'-fluorinated nucleotides are present at the following positions:
[0335] The nucleotides at the 5' end of the sense strand are the 9th and 10th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 3rd, 6th, 14th, and 16th positions of the start point;
[0336] 2'-methoxy modified nucleotides are present at the following positions:
[0337] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 7, 8, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, and 23 of the start point.
[0338] Nucleotides modified with thiophosphate groups are located at the following positions:
[0339] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions, and between the second and third positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point.
[0340] In some embodiments of this application, the modified nucleotides of the sense strand and the antisense strand are as follows:
[0341] 19-1) The 2'-fluorinated nucleotide is present at the following positions:
[0342] The nucleotides at the 5' end of the sense strand are the 7th and 9th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 3rd, 6th, 14th and 16th positions of the start point;
[0343] 2'-methoxy modified nucleotides are present at the following positions:
[0344] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 of the start point.
[0345] Nucleotides modified with thiophosphate groups are located at the following positions:
[0346] The 5' terminal nucleotide of the sense strand is between the first and second positions, and between the second and third positions, and the 3' terminal nucleotide of the sense strand is between the first and second positions; and the 5' terminal nucleotide of the antisense strand is between the first and second positions, and between the second and third positions, and the 3' terminal nucleotide of the antisense strand is between the first and second positions, and between the second and third positions.
[0347] 19-2) The 2'-fluorinated nucleotide is present at the following positions:
[0348] The nucleotides at the 5' end of the sense strand are the 7th and 9th positions of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 3rd, 6th, 14th and 16th positions of the start point;
[0349] 2'-methoxy modified nucleotides are present at the following positions:
[0350] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 of the start point.
[0351] Nucleotides modified with thiophosphate groups are located at the following positions:
[0352] The 5' terminal nucleotides of the positive strand are between positions 1 and 2, and between positions 2 and 3, and the 3' terminal nucleotides of the positive strand are between positions 1 and 2, and between positions 2 and 3; and the 5' terminal nucleotides of the antisense strand are between positions 1 and 2, and between positions 2 and 3, and the 3' terminal nucleotides of the antisense strand are between positions 1 and 2, and between positions 2 and 3.
[0353] In some embodiments of this application, the modified nucleotides of the sense strand and the antisense strand are as follows:
[0354] 20-1) The 2'-fluorinated nucleotide is present at the following positions:
[0355] The nucleotide at the 5' end of the sense strand is the 7th position of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 3rd, 6th, 14th, and 16th positions of the start point;
[0356] 2'-methoxy modified nucleotides are present at the following positions:
[0357] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 of the start point.
[0358] Nucleotides modified with thiophosphate groups are located at the following positions:
[0359] The 5' terminal nucleotide of the sense strand is between the first and second positions, and between the second and third positions, and the 3' terminal nucleotide of the sense strand is between the first and second positions; and the 5' terminal nucleotide of the antisense strand is between the first and second positions, and between the second and third positions, and the 3' terminal nucleotide of the antisense strand is between the first and second positions, and between the second and third positions.
[0360] 20-2) 2'-fluorinated nucleotides are present at the following positions:
[0361] The nucleotide at the 5' end of the sense strand is the 7th position of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 3rd, 6th, 14th, and 16th positions of the start point;
[0362] 2'-methoxy modified nucleotides are present at the following positions:
[0363] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 of the start point.
[0364] Nucleotides modified with thiophosphate groups are located at the following positions:
[0365] The 5' terminal nucleotides of the positive strand are between positions 1 and 2, and between positions 2 and 3, and the 3' terminal nucleotides of the positive strand are between positions 1 and 2, and between positions 2 and 3; and the 5' terminal nucleotides of the antisense strand are between positions 1 and 2, and between positions 2 and 3, and the 3' terminal nucleotides of the antisense strand are between positions 1 and 2, and between positions 2 and 3.
[0366] In some embodiments of this application, the modified nucleotides of the sense strand and the antisense strand are as follows:
[0367] 21-1) The 2'-fluorinated nucleotide is present at the following positions:
[0368] The nucleotide at the 5' end of the sense strand is the 9th position of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 3rd, 6th, 14th, and 16th positions of the start point;
[0369] 2'-methoxy modified nucleotides are present at the following positions:
[0370] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, and 23 of the start point.
[0371] Nucleotides modified with thiophosphate groups are located at the following positions:
[0372] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point;
[0373] 21-2) 2'-Fluorinated nucleotides are present at the following positions:
[0374] The nucleotide at the 5' end of the sense strand is the 9th position of the start point; and the nucleotides at the 5' end of the antisense strand are the 2nd, 3rd, 6th, 14th, and 16th positions of the start point;
[0375] 2'-methoxy modified nucleotides are present at the following positions:
[0376] The 5' terminal nucleotides of the sense strand are at positions 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 of the start point; and the 5' terminal nucleotides of the antisense strand are at positions 1, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, and 23 of the start point.
[0377] Nucleotides modified with thiophosphate groups are located at the following positions:
[0378] The nucleotides at the 5' end of the sense strand are between the first and second positions of the start point, and the nucleotides at the 3' end of the sense strand are between the first and second positions, and between the second and third positions of the start point; and the nucleotides at the 5' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point, and the nucleotides at the 3' end of the antisense strand are between the first and second positions, and between the second and third positions of the start point.
[0379] In some embodiments of this application, the 3' end and / or 5' end of the positive strand are connected to one or more reverse debasing nucleotides.
[0380] In some embodiments of this application, the reverse debased nucleotide is attached to the 3' end and / or 5' end of the positive strand via a thiophosphate group.
[0381] In some embodiments of this application, the 3' end and / or 5' end of the justice chain are connected to one or more InvBs.
[0382] In some embodiments of this application, the InvB is attached to the 3' end and / or 5' end of the positive chain via a thiophosphate group.
[0383] In some embodiments of this application, the 5' end of the positive strand is attached with a reverse debasing nucleotide.
[0384] In some embodiments of this application, the reverse debased nucleotide is linked to the first nucleotide at the 5' end of the positive strand via a thiophosphate group.
[0385] In some embodiments of this application, the 5' end of the justice chain is connected to an InvB.
[0386] In some embodiments of this application, the first nucleotide at the 5' end of the positive strand is linked to InvB via a thiophosphate group.
[0387] In some embodiments of this application, the siRNA includes the sense and antisense strands of any group in Table C-1, or has a difference of no more than 5 nucleotides from the sense and / or antisense strands, preferably having a difference of no more than 4, 3, 2 or 1 nucleotides.
[0388] Table C-1
[0389] In some embodiments of this application, the siRNA includes the sense and antisense strands of any one of C1-374, C1-418, C1-419, C1-420, C1-421, C1-422, C1-423, C1-424, C1-6, C1-12, C1-21, C1-50, C1-52, C1-359, and C1-157, or has a difference of no more than 5 nucleotides from the sense and / or antisense strands, preferably having a difference of no more than 4, 3, 2, or 1 nucleotides.
[0390] In some embodiments of this application, the siRNA includes the sense and antisense strands of any one of C1-374, C1-418, C1-419, C1-420, C1-421, C1-422, C1-423, C1-424, C1-6, C1-12, C1-21, C1-50, C1-52, C1-359, and C1-157.
[0391] In some embodiments of this application, the siRNA includes the sense and antisense strands of any one of C1-6, C1-12, C1-21, C1-50, C1-52, C1-359 and C1-374, or has a difference of no more than 5 nucleotides from the sense and / or antisense strands, preferably having a difference of no more than 4, 3, 2 or 1 nucleotides.
[0392] In some embodiments of this application, the siRNA includes the sense and antisense strands of any one of C1-12, C1-21, C1-359 and C1-374, or has a difference of no more than 5 nucleotides from the sense and / or antisense strands, preferably having a difference of no more than 4, 3, 2 or 1 nucleotides.
[0393] In some embodiments of this application, the siRNA includes the sense and antisense strands of any one of C1-374, C1-418, C1-419, C1-420, C1-421, C1-422, C1-423, and C1-424, or has a difference of no more than 5 nucleotides from the sense and / or antisense strands, preferably having a difference of no more than 4, 3, 2, or 1 nucleotide.
[0394] In some embodiments of this application, the siRNA includes the sense and antisense strands of any one of C1-374, C1-418, C1-419, C1-420, C1-421, C1-422, C1-423, and C1-424.
[0395] In some embodiments of this application, the siRNA comprises one of the following groups:
[0396] C-1) The sense strand containing a nucleotide sequence as shown in InvBsAesaaaggGfaCfAfGfuauucucagsa or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand containing a nucleotide sequence as shown in TesCfsUfgagAfauacugUfcCfcuuususa or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides;
[0397] C-2) The sense strand contains a nucleotide sequence as shown in InvBsAesaaaggGfaCfAfGfuauucucagsa or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides; and the antisense strand contains a nucleotide sequence as shown in vusCfsUfgagAfauacugUfcCfcuuususa or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0398] C-3) The sense strand contains a nucleotide sequence as shown in InvBcsusaaaaGfgIfacaguauucsu or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in vasGfsAfauAfcugucccUfuUfuagsgsc or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0399] C-4) The sense strand contains a nucleotide sequence as shown in InvBsAesaagggAfcAfGfUfauucucagsa or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides; and the antisense strand contains a nucleotide sequence as shown in vusCfsugagAfauacugUfcCfcuususu or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0400] C-5) The sense strand contains a nucleotide sequence as shown in InvBsasagggaCfaGfUfAfuucucagsa or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in vusCfsugaGfaauacugUfcCfcuususu or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0401] C-6) The sense strand contains a nucleotide sequence as shown in InvBscsaguauUfcUfCfAfgugcucusa or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides; and the antisense strand contains a nucleotide sequence as shown in vusAfsgagCfacugagaAfuAfcugsusc or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0402] C-7) The sense strand contains a nucleotide sequence as shown in InvBsgsccuaaaaGfGfIfacaguauucsu or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides; and the antisense strand contains a nucleotide sequence as shown in vasGfsAfauAfcugucccUfuUfuagsgsc or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0403] C-8) The sense strand contains a nucleotide sequence as shown in InvBsgsggacaGfUfAfuucucaguisa or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in vusCfsacugagaauacUfgucccsgsu or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0404] C-9) The sense strand contains a nucleotide sequence as shown in InvBsgsccuaaaaGfGfIfacaguauucsu or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides; and the antisense strand contains a nucleotide sequence as shown in asGfsAfauAfcugucccUfuUfuagsgsc or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0405] C-10) The sense strand contains a nucleotide sequence as shown in InvBscsaguauUfcUfCfAfgugcucusa or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides; and the antisense strand contains a nucleotide sequence as shown in usAfsgagCfacugagaAfuAfcugsusc or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0406] C-11) A sense strand containing a nucleotide sequence as shown in InvBsasagggaCfaGfUfAfuucucagsa or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides, and an antisense strand containing a nucleotide sequence as shown in usCfsugaGfaauacugUfcCfcuususu or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0407] C-12) The sense strand contains a nucleotide sequence as shown in InvBcsusaaaaGfgIfacaguauucsu or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in asGfsAfauAfcugucccUfuUfuagsgsc or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0408] C-13) A sense strand containing a nucleotide sequence as shown in InvBsAesaagggAfcAfGfUfauucucagsa or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides; and an antisense strand containing a nucleotide sequence as shown in UfsCfsugagAfauacugUfcCfcuususu or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides; and
[0409] C-14) A sense strand containing a nucleotide sequence as shown in InvBsgsggacaGfUfAfuucucaguisa or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides, and an antisense strand containing a nucleotide sequence as shown in usCfsacugagaauacUfgucccsgsu or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0410] In some embodiments of this application, the siRNA includes the sense and antisense strands of any group in Table C-2, or has a difference of no more than 5 nucleotides from the sense and / or antisense strands, preferably having a difference of no more than 4, 3, 2 or 1 nucleotides.
[0411] Table C-2
[0412] In some embodiments of this application, the siRNA includes the sense and antisense strands of any one of C2-374, C2-418, C2-419, C2-420, C2-421, C2-422, C2-423, C2-424, C2-6, C2-12, C2-21, C2-50, C2-52, C2-359, and C2-157, or has a difference of no more than 5 nucleotides from the sense and / or antisense strands, preferably having a difference of no more than 4, 3, 2, or 1 nucleotides.
[0413] In some embodiments of this application, the siRNA includes the sense and antisense strands of any one of C2-374, C2-418, C2-419, C2-420, C2-421, C2-422, C2-423, C2-424, C2-6, C2-12, C2-21, C2-50, C2-52, C2-359, and C2-157.
[0414] In some embodiments of this application, the siRNA includes the sense and antisense strands of any one of C2-6, C2-12, C2-21, C2-50, C2-52, C2-359, and C2-374, or has a difference of no more than 5 nucleotides from the sense and / or antisense strands, preferably having a difference of no more than 4, 3, 2, or 1 nucleotides.
[0415] In some embodiments of this application, the siRNA includes the sense and antisense strands of any one of C2-374, C2-418, C2-419, C2-420, C2-421, C2-422, C2-423, and C2-424, or has a difference of no more than 5 nucleotides from the sense and / or antisense strands, preferably having a difference of no more than 4, 3, 2, or 1 nucleotide.
[0416] In some embodiments of this application, the siRNA includes the sense and antisense strands of any one of C2-374, C2-418, C2-419, C2-420, C2-421, C2-422, C2-423, and C2-424.
[0417] In some embodiments of this application, the siRNA includes the sense and antisense strands of any one of C2-12, C2-21, C2-359 and C2-374, or has a difference of no more than 5 nucleotides from the sense and / or antisense strands, preferably having a difference of no more than 4, 3, 2 or 1 nucleotides.
[0418] In a second aspect of this application, a siRNA conjugate or a salt thereof is provided. In some embodiments of this application, the siRNA conjugate or salt thereof comprises: the siRNA described in the first aspect, and a ligand conjugated to the siRNA. The siRNA conjugate described above can facilitate the targeting and delivery of nucleic acid drugs, enabling the siRNA to connect to desired cells and / or tissues in vivo to target and silence APOC3 inhibition in target cells and / or tissues, thereby effectively preventing and / or treating APOC3-related diseases.
[0419] In some embodiments of this application, the above-mentioned siRNA conjugate or its salt may further include at least one of the following technical features:
[0420] In some embodiments of this application, the ligand is one or more, the ligand being used to target any cell, preferably the ligand being selected from lipids, carbohydrates, aptamers, vitamins and / or peptides that specifically bind to cell membranes or cell surfaces.
[0421] In some embodiments of this application, the ligand is conjugated to the sense and / or antisense strands of the siRNA.
[0422] In some embodiments of this application, the ligand is conjugated to the 3' end of the sense strand and / or the 3' end of the antisense strand of the siRNA via a thiophosphate or phosphate ester.
[0423] In some embodiments of this application, the ligand is conjugated to the 5' end of the sense strand and / or the 5' end of the antisense strand of the siRNA via a thiophosphate or phosphate ester.
[0424] In some embodiments of this application, the ligand is conjugated to the 3' end of the sense strand and / or the 3' end of the antisense strand of the siRNA via a thiophosphate ester.
[0425] In some embodiments of this application, the ligand is DAW40007-4, L96, or NAG37, and their structures are shown below:
[0426] in, This indicates the junction point between the ligand and the siRNA.
[0427] In some embodiments of this application, the ligand is connected to the 3' or 5' end of the positive chain via a thiophosphate bond or a phosphate bond.
[0428] Unless otherwise specified herein, in the sense and / or antisense strands used for conjugating ligands, the end of the sense and / or antisense strand connected to the ligand contains a thiophosphate bond or phosphate bond, that is, the thiophosphate bond or phosphate bond is located at the 3' or 5' end of the sense and / or antisense strand, which is used for conjugation with the ligand.
[0429] In some embodiments of this application, the siRNA conjugate or its salt comprises (R)- and (S)-enantiomers, diastereomers, and / or racemic mixtures thereof.
[0430] In some embodiments of this application, the thiophosphate groups in the siRNA conjugate or its salt include (R)- and (S)-enantiomers, diastereomers, and / or racemic mixtures thereof.
[0431] In some embodiments of this application, the siRNA conjugate comprises the sense and antisense strands of any group in Table D, or differs from the sense and / or antisense strands by no more than 5, 4, 3, 2, or 1 nucleotides.
[0432] Table D
[0433] In some embodiments of this application, the siRNA conjugate or its salt comprises the sense and antisense strands of any one of D374, D418, D419, D420, D421, D422, D423, D424, D6, D12, D21, D50, D52, D359 and D157, or differs from the sense and / or antisense strands by no more than 5, 4, 3, 2, or 1 nucleotides.
[0434] In some embodiments of this application, the siRNA conjugate or its salt comprises the sense and antisense strands of any one of D374, D418, D419, D420, D421, D422, D423, D424, D6, D12, D21, D50, D52, D359 and D157.
[0435] In some embodiments of this application, the siRNA conjugate or its salt comprises the sense and antisense strands of any one of D374, D418, D419, D420, D421, D422, D423 and D424, or differs from the sense and / or antisense strands by no more than 5, 4, 3, 2, or 1 nucleotides.
[0436] In some embodiments of this application, the siRNA conjugate or its salt comprises the sense and antisense strands of any one of D374, D418, D419, D420, D421, D422, D423 and D424.
[0437] In some embodiments of this application, the siRNA conjugate or its salt comprises the sense and antisense strands of any one of D6, D12, D21, D50, D52, D359 and D374, or differs from the sense and / or antisense strands by no more than 5, 4, 3, 2, or 1 nucleotides.
[0438] In some embodiments of this application, the siRNA conjugate or its salt comprises the sense and antisense strands of any one of D12, D21, D359 and D374, or differs from the sense and / or antisense strands by no more than 5, 4, 3, 2, or 1 nucleotides.
[0439] In some embodiments of this application, the siRNA conjugate or its salt comprises one of the following:
[0440] D-1) The sense strand containing a nucleotide sequence as shown in InvBsAesaaaggGfaCfAfGfuauucucagsasL96 or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand containing a nucleotide sequence as shown in TesCfsUfgagAfauacugUfcCfcuuususa or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides;
[0441] D-2) The sense strand containing a nucleotide sequence as shown in InvBsAesaaaggGfaCfAfGfuauucucagsasL96 or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand containing a nucleotide sequence as shown in vusCfsUfgagAfauacugUfcCfcuuususa or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides;
[0442] D-3) The sense strand contains a nucleotide sequence as shown in InvBcsusaaaaGfgIfacaguauucsusL96 or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in vasGfsAfauAfcugucccUfuUfuagsgsc or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0443] D-4) A sense strand containing a nucleotide sequence as shown in InvBsAesaagggAfcAfGfUfauucucagsasL96 or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides, and an antisense strand containing a nucleotide sequence as shown in vusCfsugagAfauacugUfcCfcuususu or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0444] D-5) The sense strand containing the nucleotide sequence shown in InvBsasagggaCfaGfUfAfuucucagsasL96 or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand containing the nucleotide sequence shown in vusCfsugaGfaauacugUfcCfcuususu or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides;
[0445] D-6) The sense strand contains a nucleotide sequence as shown in InvBscsaguauUfcUfCfAfgugcucusasL96 or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in vusAfsgagCfacugagaAfuAfcugsusc or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0446] D-7) The sense strand contains a nucleotide sequence as shown in InvBsgsccuaaaaGfGfIfacaguauucsusL96 or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in vasGfsAfauAfcugucccUfuUfuagsgsc or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0447] D-8) The sense strand contains a nucleotide sequence as shown in InvBsgsggacaGfUfAfuucucaguisasL96 or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in vusCfsacugagaauacUfgucccsgsu or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0448] D-9) The sense strand contains a nucleotide sequence as shown in InvBsgsccuaaaaGfGfIfacaguauucsusL96 or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in asGfsAfauAfcugucccUfuUfuagsgsc or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0449] D-10) The sense strand contains a nucleotide sequence as shown in InvBscsaguauUfcUfCfAfgugcucusasL96 or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in usAfsgagCfacugagaAfuAfcugsusc or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0450] D-11) A sense strand containing a nucleotide sequence as shown in InvBsasagggaCfaGfUfAfuucucagsasL96 or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides, and an antisense strand containing a nucleotide sequence as shown in usCfsugaGfaauacugUfcCfcuususu or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0451] D-12) The sense strand contains a nucleotide sequence as shown in InvBcsusaaaaGfgIfacaguauucsusL96 or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in asGfsAfauAfcugucccUfuUfuagsgsc or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0452] D-13) A sense strand containing a nucleotide sequence as shown in InvBsAesaagggAfcAfGfUfauucucagsasL96 or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides; and an antisense strand containing a nucleotide sequence as shown in UfsCfsugagAfauacugUfcCfcuususu or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides; and
[0453] D-14) A sense strand containing a nucleotide sequence as shown in InvBsgsggacaGfUfAfuucucaguisasL96 or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides, and an antisense strand containing a nucleotide sequence as shown in usCfsacugagaauacUfgucccsgsu or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides.
[0454] In this document, the siRNAs in Tables B, C, and D below can have the same nucleotide sequence as the natural sequence in their corresponding Table A, or their positive and / or antisense sequences can have no more than 5 (preferably no more than 1 or 2, more preferably 1) nucleotide differences from the nucleotide sequence in Table A. The specific types are not limited.
[0455] In a third aspect of this application, a pharmaceutical composition is provided. In some embodiments of this application, the pharmaceutical composition comprises: the siRNA described in the first aspect, or the siRNA conjugate described in the second aspect, or a salt thereof. As previously mentioned, both the aforementioned siRNA and siRNA conjugate can degrade the mRNA encoding APOC3, inhibiting the expression or activity of the APOC3 gene. Therefore, the pharmaceutical composition of this application can effectively treat and prevent APOC3-related diseases.
[0456] In some embodiments of this application, the pharmaceutical composition further comprises: a pharmaceutically acceptable carrier or excipient.
[0457] In some optional embodiments of this application, the pharmaceutical composition described in this application may be an injection solution.
[0458] In some optional embodiments of this application, the injection solution described herein can be used for subcutaneous, intramuscular, or intravenous injection.
[0459] In a fourth aspect of this application, the use of the siRNA described in the first aspect, the siRNA conjugate described in the second aspect, or the pharmaceutical composition described in the third aspect is provided, the use including at least one of the following:
[0460] Inhibit the expression or activity of the APOC3 gene;
[0461] To prepare drugs for inhibiting the expression or activity of the APOC3 gene;
[0462] To prepare drugs for the prevention and / or treatment of APOC3-related diseases;
[0463] Prevention and / or treatment of APOC3-related diseases.
[0464] The method described in this application can be used to inhibit the expression or activity of the APOC3 gene. For example, it can inhibit the expression or activity of the APOC3 gene in animals; or it can inhibit the expression or activity of the APOC3 gene for non-disease treatment purposes, such as inhibiting the expression or activity of the APOC3 gene in vitro for subsequent research.
[0465] In some embodiments of this application, the APOC3-related diseases are hypertriglyceridemia, obesity, dyslipidemia, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, cardiovascular disease, coronary artery disease, hypertriglyceridemia-induced pancreatitis, metabolic syndrome, type II diabetes, familial chylomicronemia syndrome, chylomicronemia, multifactorial chylomicronemia, lipodystrophy syndrome, or familial partial lipodystrophy.
[0466] Additional aspects and advantages of this application will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of this application. Attached Figure Description
[0467] The above and / or additional aspects and advantages of this application will become apparent and readily understood from the description of the embodiments taken in conjunction with the following drawings, in which:
[0468] Figure 1 shows the experimental results of the first batch of siRNA conjugate groups (NO: PC, D6, D12, D21, D50, and D52) treating humanized APOC3 mice with the relative residual levels of APOC3 protein.
[0469] Figure 2 shows the experimental results of the inhibition of the relative residual level of mouse triglyceride (TG) protein by siRNA conjugate groups NO of PC, D6, D12, D21, D50 and D52 in Test Example 2.
[0470] Figure 3 shows the experimental results of the inhibition of the relative residual level of total cholesterol (TC) protein in mice by siRNA conjugate groups NO of PC, D6, D12, D21, D50 and D52 in Test Example 2.
[0471] Figure 4 shows the experimental results of the relative residual levels of APOC3 protein in humanized APOC3 mice treated with siRNA conjugates NO. PC, D359, and D374 in Test Example 2.
[0472] Figure 5 shows the experimental results of the siRNA conjugates NO. PC, D359 and D374 in Test Example 2 inhibiting the relative residual level of mouse triglyceride (TG) protein.
[0473] Figure 6 shows the experimental results of the siRNA conjugates NO. PC, D359 and D374 in Test Example 2 inhibiting the relative residual level of total cholesterol (TC) protein in mice.
[0474] Figure 7 shows the experimental results of the relative residual level of APOC3 protein in humanized APOC3 mice treated with siRNA conjugates NO. PC and D419 in Test Example 2.
[0475] Figure 8 shows the experimental results of treating healthy cynomolgus monkeys with APOC3 protein relative to the remaining level of the siRNA conjugate groups NO. PC, D21, and D374 in Test Example 3.
[0476] This application details
[0477] Definitions and general terms in this application
[0478] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. Therefore, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. Furthermore, in the description of this application, unless otherwise stated, "multiple" means two or more.
[0479] In this document, the terms “comprising” or “including” are open-ended expressions, meaning that they include the contents specified in this application but do not exclude other contents.
[0480] In this document, the terms “optionally,” “optionally,” or “optionally” generally refer to an event or condition that may, but may not, occur, and the description includes both cases in which the event or condition occurs and cases in which the event or condition does not occur.
[0481] In this paper, the term "small interfering RNA (siRNA)" refers to a double-stranded RNA consisting of a sense strand and an antisense strand. siRNA mediates targeted cleavage of RNA transcripts via the RISC pathway by forming an RNA-induced silencing complex (RISC). Specifically, siRNA directs the specific degradation of mRNA sequences through RNA interference (RNAi), inhibiting the translation of mRNA into amino acids and its conversion into proteins. For example, siRNA can suppress the expression of the APOC3 gene.
[0482] In this application, the double-stranded region of the siRNA can be 12-30 nucleotide pairs in length. For example, the double-stranded region can be 14-30 nucleotide pairs, 17-30 nucleotide pairs, 27-30 nucleotide pairs, 17-23 nucleotide pairs, 17-21 nucleotide pairs, 17-19 nucleotide pairs, 19-25 nucleotide pairs, 19-23 nucleotide pairs, 19-21 nucleotide pairs, 21-25 nucleotide pairs, or 21-23 nucleotide pairs. In another embodiment, the double-stranded region is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27 nucleotide pairs in length.
[0483] In this paper, the term "antisense strand (or guide strand)" includes a region substantially complementary to a target sequence, such as mRNA encoding APOC3. "Sense strand (or lagging strand)" refers to an iRNA strand containing a sequence substantially complementary to the antisense strand. The term "substantially complementary" means fully complementary or at least partially complementary, for example, the antisense strand being fully or at least partially complementary to the target sequence. In the case of partial complementarity, mismatches can exist within the molecule or in terminal regions, with the most tolerant mismatches occurring in terminal regions, such as within 5, 4, 3, or 2 nucleotides at the 5' and / or 3' ends of the iRNA.
[0484] It should be noted that "at least partially complementary," "substantially complementary," or "at least partially complementary" to the antisense strand and mRNA all refer to the antisense strand having a polynucleotide substantially complementary to a continuous portion of the mRNA of interest (e.g., the mRNA encoding APOC3). Alternatively, if a polynucleotide is substantially non-discontinuously complementary to a portion of the mRNA encoding APOC3, then the antisense strand is complementary to at least a portion of the mRNA encoding APOC3.
[0485] In this paper, the terms “target sequence” or “target marker sequence” refer to the continuous portion of the nucleotide sequence of the mRNA molecule formed during transcription of the APOC3 gene, including mRNA of the RNA processing product of the primary transcription product.
[0486] In this document, the term "inhibition of APOC3 gene expression" includes any level of inhibition of the APOC3 gene, such as at least partial inhibition of APOC3 gene expression, including inhibition of at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%. APOC3 gene expression can be evaluated based on the level of any variable associated with APOC3 gene expression, such as the mRNA level encoding APOC3 or the APOC3 level. Inhibition can be evaluated by a reduction in the absolute or relative level of one or more of these variables compared to a control level. The control level can be any type of control level used in the art, such as baseline level before administration, or level measured in similar subjects, cells, or samples that have never been treated or have been treated with a control (e.g., a control with only buffer or a control without active agent).
[0487] The term "nucleotide overhang" or "protrusion" refers to at least one unpaired nucleotide that dangles from the double-stranded structure of siRNA. For example, a nucleotide overhang exists when the 3' end of one strand of the siRNA double helix extends beyond the 5' end of the other strand, and vice versa. siRNA may include at least one nucleotide overhang; alternatively, the overhang may include at least two, three, four, five, or more nucleotides. The nucleotide overhang may include or consist of nucleotide / nucleoside analogs (including deoxynucleotides / nucleosides). One or more overhangs may be located on the sense strand, antisense strand, or any combination thereof. Additionally, one or more nucleotides of the overhang may be present at the 5' end, 3' end, or both ends of the antisense or sense strand of the siRNA.
[0488] In this article, the terms "nucleotide" and "nucleic acid" refer to A, T / U, C, and G; the terms "nucleotide analog" and "nucleic acid analog" refer to structures that are chemically similar to nucleotides (A, T / U, C, and G).
[0489] In this paper, the term "blunt end" refers to a siRNA whose sense or antisense strand has no unpaired nucleotides at its ends, i.e., no nucleotide overhangs. "Blunt end" siRNA refers to siRNA whose entire length is a double-stranded region, meaning that neither the 3' nor the 5' ends of the sense or antisense strands of the siRNA have nucleotide overhangs.
[0490] In this paper, the term "a sense strand or antisense strand containing at least one nucleotide overhang" means that one end of the sense strand or antisense strand is a nucleotide overhang and the other end is a blunt end, or that both ends of the sense strand or antisense strand are nucleotide overhangs.
[0491] In this article, the term “one of the chains of justice or antisense, the other chain…” includes two cases: 1) one chain is a justice chain and the other chain is an antisense chain, or 2) one chain is an antisense chain and the other chain is a justice chain.
[0492] In this article, "length of the justice chain" refers to the total length of the justice chain; when the justice chain has a protruding end, "length of the justice chain" = length of the double-chain region + length of the protruding end; when the justice chain has no protruding end, "length of the justice chain" = length of the double-chain region. "Length of the antisense chain" refers to the total length of the antisense chain; when the antisense chain has a protruding end, "length of the antisense chain" = length of the double-chain region + length of the protruding end; when the antisense chain has no protruding end, "length of the antisense chain" = length of the double-chain region.
[0493] As will be known to those skilled in the art, ribonucleotides (hereinafter referred to as nucleotides) are composed of phosphate, ribose, and bases. In this document, a "modified nucleotide" refers to a nucleotide that, compared to an A, U, C, or G nucleotide, has a change in the group attached to a different C atom on the ribose, a change in the phosphate group, or a deletion of a base. In this document, "modified nucleotide" and "modified nucleotide" are synonymous.
[0494] As can be seen from the above, nucleotides are composed of phosphate, ribose, and a base. "Natural nucleotide" or "nucleotide with a natural base" refers to a nucleotide whose base is adenine (A), uracil (U), guanine (G), or cytosine (C). In some optional embodiments of this application, the modified nucleotide has one or more modifications.
[0495] In this document, the term "salt of siRNA" refers to both organic and inorganic salts of the compounds of this application. Pharmaceutically acceptable salts are well known to us in the relevant field.
[0496] In this document, "pharmaceutical composition" can refer to a drug used for the treatment of a disease or for use in in vitro cell culture experiments. When used for the treatment of a disease, the term "pharmaceutical composition" generally refers to a drug in unit dose form and can be prepared by any method well known in the pharmaceutical industry. All methods involve the step of combining the active ingredient with excipients that constitute one or more adjunct components. Typically, the composition is prepared by uniformly and adequately combining active siRNA with liquid excipients, finely pulverized solid excipients, or both.
[0497] In this document, the term "pharmaceutical acceptable" means that a substance or composition must be chemically and / or toxicologically compatible with other components of the formulation and / or the mammals to which it is treated. Preferably, "pharmaceutical acceptable" as used herein means approved by a federal regulatory agency or national government, or listed in the United States Pharmacopeia or other generally recognized pharmacopoeia for use in animals, particularly in humans.
[0498] In this document, the term "pharmaceuticalally acceptable excipient" may include any solvent, diluent, or other liquid excipient, etc., suitable for the specific target dosage form. The use of any conventional excipients that are incompatible with the siRNA of this application, such as any adverse biological effects they may produce or interactions that may occur in a harmful manner with any other component of the pharmaceutically acceptable composition, is also within the scope of this application.
[0499] In some embodiments, the pharmaceutical composition according to this application may include a pharmaceutically acceptable carrier that can be a variety of carriers conventionally used in the art, for example, at least one of a pH buffer, a protectant, and an osmotic pressure regulator. The pH buffer may be acetate, citrate, prolamin, carbonate, or phosphate, or any combination thereof. The pH buffer may be a tris(hydroxymethyl)aminomethane hydrochloride buffer with a pH of 7.5-8.5 and / or a phosphate buffer with a pH of 5.5-8.5, preferably a phosphate buffer with a pH of 5.5-8.5. The protectant may be at least one of inositol, sorbitol, and sucrose. Based on the total weight of the pharmaceutical composition, the content of the protectant may be 0.01-30% by weight (e.g., 0.01% by weight, 0.05% by weight, 0.1% by weight, 0.5% by weight, 1% by weight, 5% by weight, 10% by weight, 15% by weight, 20% by weight, 25% by weight, 30% by weight, or any value between any two of the above). The osmotic pressure regulator may be sodium chloride and / or potassium chloride. The content of the osmotic pressure regulator is such that the osmotic pressure of the pharmaceutical composition is 200-700 milliohms / kg. The content of the osmotic pressure regulator can be determined by those skilled in the art based on the desired osmotic pressure.
[0500] In this document, the term "treatment" refers to the administration of a drug or siRNA to an individual to achieve a desired pharmacological and / or physiological effect. This effect may be preventative in terms of complete or partial prevention of a disease or its symptoms, and / or therapeutic in terms of partial or complete cure of a disease and / or adverse effects caused by the disease. As used herein, "treatment" encompasses diseases in mammals, particularly humans, including: (a) prevention of disease or the onset of a disease in individuals who are susceptible but have not yet been diagnosed with the disease; (b) inhibition of disease, such as blocking disease progression; or (c) relief of disease, such as reducing disease-related symptoms. As used herein, "treatment" encompasses any administration of a drug or siRNA to an individual to treat, cure, alleviate, improve, reduce, or inhibit the individual's disease, including but not limited to administration of a drug containing the siRNA or siRNA conjugate described herein to an individual in need.
[0501] The term "RNAi reagent" or "RNAi agent" as used in this application refers to a reagent containing RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules capable of degrading or inhibiting the transcription and translation of target messenger RNA (mRNA) in a sequence-specific manner. The RNAi reagent in this application may act through an RNA interference mechanism (i.e., by inducing RNA interference through interaction with the RNA interference pathway constitutive mechanism in mammalian cells (RNA-induced silencing complex or RISC)) or through any other mechanism or pathway.
[0502] Unless otherwise specified, in the context of this application, uppercase letters C, G, U, A, and T represent the bases of natural nucleotides; lowercase letters c, g, u, and a represent nucleotides with a methoxy group modified at the 2-position of the ribose, such as c, g, u, and a representing 2'-OMe(2'-O-methyl)C, 2'-OMe G, 2'-OMe U, and 2'-OMe A, respectively; lowercase letter v represents 5'-(E)-VP modification (i.e., 5'-E-vinyl phosphate bond modification of the ribose), such as vu at the 5' end of the antisense chain representing a uracil nucleotide with 5'-(E)-VP modification and 2'-OMe modification, the structure of which is... In the structure, U represents uracil; the uppercase letter f to the right indicates that the nucleotide ribose at position 2 is fluorinated, such as Cf, Gf, Uf, and Af representing 2'-F(2'-fluoro)C, 2'-FG, 2'-FU, and 2'-FA, respectively; "s" indicates that the two nucleotide residues adjacent to "s" are linked by a thiophosphate group (also called a thiophosphate bond), for example, "gsu" indicates that the g and u residues are linked by a thiophosphate group; mC represents a cytosine nucleoside with a methyl substitution at position 5; the uppercase letter e to the right indicates that the nucleotide ribose at position 2 is modified by a methoxyethoxy group (2'-methoxyethoxy), such as mCe, Ge, Ue, Ae, and Te representing 5-CH3-2'-O-MOE (i.e., cytosine nucleoside with a methyl substitution at position 5 and 2'-methoxyethoxy modification of the ribose) C, 2'-O-MOE G, 2'-O-MOE U, and 2'-O-MOE, respectively. A, and 2'-O-MOE T; Tgn represents thymine diol nucleotide residues, with the following structure: i represents If means
[0503] The capitalized "Invd" indicates a reverse deoxyribonucleotide, such as InvdA as described in this application. (i.e., reverse deoxyadenosine); when attached to the 3' end, InvdA represents a reverse deoxypurine nucleotide residue, and its structure is as follows: When connected to the 5' terminal, InvdA represents...
[0504] Similarly, InvdT represents the reverse deoxythymidine nucleotide residue.
[0505] In this application, "invB" and "invAb" represent reverse debasing deoxyribose. When attached to the 3' end, InvB is represented as... When connected to the 5' terminal, InvB represents...
[0506] The nucleoside (UNA) structure for unlocking nucleic acid modifications described in this application is as follows: The structure of the ethylene glycol-modified nucleic acid (GNA) nucleoside is as follows: B is a base (including natural bases (A, U, G, C or T) or modified bases).
[0507] In this application, A, U, G, C, or T are bases or nucleosides containing bases. Whether they are bases or nucleosides containing bases should be understood based on common knowledge in the art. For example, "this application..." In this context, "B is a base (A, U, G, C or T) or a modified base" should be understood as a sugar-free base A, U, G, C or T; similarly, "A, U, G, C or T" in Table 1 of this application should be understood as a nucleoside containing the bases A, U, G, C or T.
[0508] In this application, the terms "phosphate ester group," "phosphate ester group," "phosphate ester bond," and "phosphate bond" are used interchangeably, including monophosphate, diephosphate, or triphosphate esters. The term "phosphate ester group" in "thiophosphate ester group" has the same meaning. Unless otherwise specified, the internucleotide phosphate ester group in natural nucleotides is a diephosphate ester group.
[0509] In this invention, "deoxynucleotide" refers to a nucleotide after the hydroxyl group in the pentose nucleotide is deoxygenated, and the deoxygenation position can be 2'-OH or 3'-OH.
[0510] In this article, the term "5' end" refers to the position of the first nucleotide at the 5' end of a nucleotide sequence. The term "3' end" refers to the position of the first nucleotide at the 3' end of a nucleotide sequence.
[0511] In this article, the term "5' terminal nucleotide" or "5' terminal nucleotide" refers to the first nucleotide at the 5' end of a nucleotide sequence. The term "3' terminal nucleotide" or "3' terminal nucleotide" refers to the first nucleotide at the 3' end of a nucleotide sequence.
[0512] In this paper, "the nucleotide at the 5' end of the positive strand as the starting point" means the first nucleotide at the 5' end of the positive strand as the starting site, and "the Xth position of the nucleotide at the 5' end of the positive strand as the starting point" means the position of the Xth nucleotide counted from the first nucleotide at the 5' end of the positive strand as the starting site.
[0513] In this paper, "the nucleotide at the 3' end of the positive strand as the starting point" means that the first nucleotide at the 3' end of the positive strand is the starting site, and "the Xth position of the nucleotide at the 3' end of the positive strand as the starting point" means the position of the Xth nucleotide counted from the first nucleotide at the 3' end of the positive strand as the starting site.
[0514] In this paper, "the nucleotide at the 5' end of the antisense strand as the starting point" means that the first nucleotide at the 5' end of the antisense strand is the starting site, and "the Xth position of the nucleotide at the 5' end of the antisense strand as the starting point" means the position of the Xth nucleotide counted from the first nucleotide at the 5' end of the antisense strand as the starting site.
[0515] In this paper, "the nucleotide at the 3' end of the antisense strand as the starting point" means that the first nucleotide at the 3' end of the antisense strand is the starting site, and "the Xth position of the nucleotide at the 3' end of the antisense strand as the starting point" means the position of the Xth nucleotide counted from the first nucleotide at the 3' end of the antisense strand as the starting site.
[0516] In some alternative embodiments of this application, the modified nucleotide is selected from 2'-C 1~25 Alkyl-modified nucleotides or 2'-OC 1~25 Alkyl-modified nucleotides.
[0517] In this article, the term "C" 1~25 "Alkyl" includes alkyl groups containing 1, 2, 3, 4...24 or 25 carbon atoms. For example, it can be C... 1~20 Alkyl, C 1~19 Alkyl, C 1~18 Alkyl, C 1~17 Alkyl, C 1~16 Alkyl, C 1~15 Alkyl, C 1~10 Alkyl, C 1~5 Alkyl or C 1~3 Alkyl group. Exemplarily, C 1~3 Alkyl groups include methyl, ethyl, n-propyl, and isopropyl. 2'-C 1~25 Alkyl-modified nucleotides can be 2'-C 1~20 Alkyl-modified nucleotides, 2'-C 1~16 Alkyl-modified nucleotides, 2'-C 1~10 Alkyl-modified nucleotides, 2'-C 1~5 Alkyl-modified nucleotides or 2'-C 1~3 Alkyl-modified nucleotides. Exemplarily, they may be 2'-methyl-modified nucleotides, 2'-ethyl-modified nucleotides, 2'-n-propyl-modified nucleotides, or 2'-isopropyl-modified nucleotides.
[0518] 2'-OC 1~25 Alkyl-modified nucleotides can be 2'-OC 1~20 Alkyl-modified nucleotides, 2'-OC 1~16 Alkyl-modified nucleotides, 2'-OC 1~10 Alkyl-modified nucleotides, 2'-OC 1~5Alkyl-modified nucleotides or 2'-OC 1~3 Alkyl-modified nucleotides. Exemplarily, they may be 2'-O-methyl-modified nucleotides, 2'-O-ethyl-modified nucleotides, 2'-O-n-propyl-modified nucleotides, or 2'-O-isopropyl-modified nucleotides.
[0519] In some alternative embodiments of this application, the deoxynucleotide includes 3'-deoxy modified nucleotides and 2'-deoxy modified nucleotides.
[0520] In this application, "2'-deoxygenation modification" refers to the deoxygenation of the hydroxyl group (2'-OH) in the pentose of a nucleotide to hydrogen (2'-H), and "3'-deoxygenation modification" refers to the deoxygenation of the hydroxyl group (3'-OH) in the pentose of a nucleotide to hydrogen (3'-H).
[0521] In this application, "2'-X modification" refers to the substitution of the hydroxyl group (2'-OH) in the pentose of a nucleotide by X (2'-X). For example, "2'-fluorination modification" refers to the substitution of the hydroxyl group (2'-OH) in the pentose of a nucleotide by fluorine (2'-F); "2'-amino modification" refers to the substitution of the hydroxyl group (2'-OH) in the pentose of a nucleotide by amino group (2'-NH2); "2'-O-allyl modification" refers to the substitution of the hydroxyl group (2'-OH) in the pentose of a nucleotide by allyloxy group (2'-OCH2CH=CH2); "2'-alkyl modification" refers to the substitution of the hydroxyl group (2'-OH) in the pentose of a nucleotide by an alkyl group (2'-alkyl), wherein the alkyl group can be substituted by a suitable substituent, such as an alkoxy group. The 2'-substituted alkyl-modified nucleotide can be a 2'-alkoxyalkyl-modified nucleotide (such as a 2'-methoxyethyl-modified nucleotide), wherein the hydroxyl group in the pentose of the nucleotide... (2'-OH) is replaced by alkoxyalkyl (2'-alkoxyalkyl); "2'-O-alkyl modification" means that the hydroxyl group (2'-OH) in the pentose of the nucleotide is replaced by an alkoxy group (2'-alkoxy), wherein the alkoxy group can be replaced by a suitable substituent, such as an alkoxy group. The 2'-substituted alkoxy modified nucleotide can be a 2'-alkoxyalkoxy modified nucleotide (such as a 2'-methoxyethoxy modified nucleotide). "2'-methoxy modification" means that the hydroxyl group (2'-OH) in the pentose of the nucleotide is replaced by a methoxy group (2'-OCH3). "2'-O-methoxyethyl modification" means that the hydroxyl group (2'-OH) in the pentose of the nucleotide is replaced by a methoxyethoxy group (2'-MOE, 2'-O-CH2CH2OCH3).
[0522] In this application, "locked nucleotide" refers to a nucleotide obtained by modifying the 2' and 4' carbons of the pentose sugar of a nucleotide by linking them together.
[0523] In this application, "5'-X modification" refers to the substitution of the phosphate group (5'-PO(OH)2) in the pentose sugar of a nucleotide by X (5'-X). For example, "5'-aminophosphate modification" means that the phosphate group (5'-PO(OH)2) in the pentose sugar of a nucleotide is replaced by an aminophosphate group; "5'-thiophosphate modification" means that the phosphate group (5'-PO(OH)2) in the pentose sugar of a nucleotide is replaced by a thiophosphate group; "5'-methylphosphonate modification" means that the phosphate group (5'-PO(OH)2) in the pentose sugar of a nucleotide is replaced by a methylphosphate group; and "5'-phosphate mimicry modification" means that the phosphate group (5'-PO(OH)2) in the pentose sugar of a nucleotide is replaced by a phosphate mimicry.
[0524] In this application, "5'-methylated cytosine modification" or "5-methylcytosine modification" refers to the methylation of the carbon atom at the 5th position of cytosine; "5'-methylated uracil modification" or "5-methyluracil modification" refers to the methylation of the carbon atom at the 5th position of uracil.
[0525] In this application, the "2'" in 2'-fluorinated nucleotides, 2'-amino nucleotides, 2'-O-allyl nucleotides, 2'-alkyl nucleotides, 2'-O-alkyl nucleotides, 2'-O-alkoxyalkyl nucleotides, 2'-methoxyethyl nucleotides, and 2'-allyl nucleotides refers to the group at the 2-position of the ribose being modified (replaced) by the corresponding group. "2'" and "2'" are interchangeable. Similarly, based on the understanding of the art, "5'" and "5'" are interchangeable, and "3'" and "3'" are interchangeable in this application.
[0526] In this document, "conformationally restricted nucleotides" (CRNs) refer to nucleotide analogs, specifically nucleotide analogs with linkers attached to the C2' and C4' carbons or the C3' and C5' carbons of the ribose, which position the oxygen in an optimal position for stability and affinity, thereby reducing ribose ring wrinkling. CRNs lock the ribose ring in a stable conformation and increase hybridization affinity with mRNA. Methods for preparing certain CRNs include, but are not limited to, US Patent Publication No. US2013 / 0190383 and PCT Publication No. WO 2013 / 036868. It should be noted that the entire contents of US2013 / 0190383 and WO 2013 / 036868 are incorporated herein by reference.
[0527] As used in this application, "chemical modification" or "modification" means a structure that is chemically different from its naturally occurring counterpart, including all alterations made by chemical means, such as the addition or removal of a chemical part, or the substitution of one chemical part for another.
[0528] The compounds described in this application may be asymmetric, for example, having one or more stereoisomers. Unless otherwise stated, all stereoisomers, such as enantiomers and diastereomers, are included in this application. Compounds containing asymmetric carbon atoms described in this application can be isolated in optically active pure form or in racemic form. Optically active pure form can be resolved from racemic mixtures or synthesized using chiral starting materials or chiral reagents.
[0529] Additionally, it should be noted that unless otherwise explicitly stated, the descriptive terms “each…independently”, “…each independently”, and “…independently” used in this application are interchangeable and should be interpreted broadly. They can mean either that the specific options expressed by the same symbols in different modification options do not affect each other, or that the specific options expressed by the same symbols in the same modification option do not affect each other.
[0530] Optically active (R)- and (S)- isomers, as well as D- and L- isomers, can be prepared by chiral synthesis, chiral reagents, or other conventional techniques. To obtain an enantiomer of a compound of this application, it can be prepared by asymmetric synthesis or derivatization with a chiral auxiliary, wherein the resulting diastereomeric mixture is separated and the auxiliary group is cleaved to provide the desired enantiomer in pure form. Alternatively, when the molecule contains a basic functional group (such as an amino group) or an acidic functional group (such as a carboxyl group), a salt of the diastereomeric isomer is formed with a suitable optically active acid or base, followed by diastereomeric resolution using conventional methods known in the art, and then the pure enantiomer is recovered. Furthermore, the separation of enantiomers and diastereomeric isomers is typically accomplished by using chromatography employing a chiral stationary phase and optionally combined with chemical derivatization (e.g., from amines to carbamates).
[0531] This application also includes compounds with the same structure as those described in this application, but with one or more atoms replaced by isotopes of atoms having atomic weights or mass numbers different from those commonly found in nature. Examples of isotopes that can be incorporated into the compounds of this application include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, iodine, and chlorine, such as... 2 H, 3 H, 11 C, 13C, 14 C 13 N、 15 N、15 O、 17 O、 18 O、 31 P, 32 P, 35 S, 18 F, 123 I, 125 I and 36 Cl, etc.
[0532] Unless otherwise stated, when a position is specifically designated as deuterium (D), that position should be understood as having a deuterium abundance of at least 1000 times greater than the natural abundance of deuterium (which is 0.015%) (i.e., at least 10% deuterium incorporation). In the examples, a natural abundance of deuterium greater than deuterium can be at least 1000 times, at least 2000 times, at least 3000 times, at least 4000 times, at least 5000 times, at least 6000 times, or even higher. This application also includes various deuterated forms of compounds of formula (I). Each available hydrogen atom bonded to a carbon atom can be independently replaced by a deuterium atom. Those skilled in the art can synthesize the deuterated forms of the compounds of this application by referring to relevant literature. Commercially available deuterated starting materials can be used to prepare the deuterated form of the compounds of this application, or conventional techniques can be used to synthesize them using deuterated reagents, including but not limited to deuterated borane, trideuterated borane tetrahydrofuran solution, deuterated lithium aluminum hydride, deuterated iodoethane, and deuterated iodomethane.
[0533] The conjugation groups described in this application can enhance the delivery of therapeutic agents to specific target sites (e.g., specific organs or tissues) within an object, such as a human or animal. In some embodiments of this application, the conjugation groups can enhance the targeted delivery of expressed repressive double-stranded siRNA. In some embodiments of this application, the conjugation groups can enhance the delivery of expressed repressive double-stranded siRNA to the liver.
[0534] The conjugating groups described in this application can be directly or indirectly attached to compounds, such as therapeutic agents, for example, expressing repressive double-stranded siRNA, for example, expressing the 3' or 5' end of the repressive double-stranded siRNA. In some embodiments of this application, the conjugating group is attached to the 3' end of the positive strand of the double-stranded siRNA. In some embodiments of this application, the conjugating group is attached to the positive strand of the double-stranded siRNA at the 5' end of the positive strand of the double-stranded siRNA. In some embodiments, the conjugating groups disclosed in this application are linked to the repressive double-stranded siRNA at the 3' end of the positive strand of the double-stranded siRNA via phosphate ester, thiophosphate, or phosphonate groups.
[0535] The term "composition" refers to a mixture of a drug containing one or more of the compounds described in this application (such as the double-stranded siRNA or its conjugates) or their physiologically pharmaceutically acceptable salts or prodrugs, along with other components, including but not limited to pharmaceutically acceptable carriers and / or excipients. The purpose of the composition is to facilitate administration to a living organism, thereby promoting the absorption of the active ingredient and the exertion of its biological activity.
[0536] The terms “pharmaceutical-grade carrier” or “pharmaceutical-acceptable carrier” include, but are not limited to, any adjuvant, excipient, glidant, sweetener, diluent, preservative, dye / colorant, flavoring agent, surfactant, wetting agent, dispersant, suspending agent, stabilizer, isotonic agent, solvent, or emulsifier that has been approved for use in humans or livestock.
[0537] Unless otherwise specified, the terms "compound," "nucleic acid conjugate," "double-stranded siRNA conjugate," "double-stranded siRNA," and "nucleic acid" in this application may exist independently as salts, mixed salts, or non-salts (e.g., free acids or free bases). When present as salts or mixed salts, they may be pharmaceutically acceptable salts.
[0538] The term "hydroxyl protecting group" refers to an unstable chemical moiety that protects the hydroxyl group from unwanted reactions during one or more synthetic procedures. The hydroxyl protecting group can be selectively removed after the one or more synthetic procedures. Hydroxyl protecting groups known in the art are generally described in TH Greene and PGM Wuts, Protective Groups in Organic Synthesis, 3rd Edition, John Wiley & Sons, New York (1999). Examples of hydroxyl protecting groups in this application include, but are not limited to, C 1-10 Alkylmethyl, benzyloxycarbonyl, 4-nitrobenzyloxycarbonyl, 4-bromobenzyloxycarbonyl, 4-methoxybenzyloxycarbonyl, methoxycarbonyl, tert-butoxycarbonyl, isopropoxycarbonyl, biphenylmethoxycarbonyl, 2,2,2-trichloroethoxycarbonyl, 2-(trimethylsilyl)ethoxycarbonyl, 2-furfuryloxycarbonyl, allyloxycarbonyl, acetyl (Ac or -C(O)CH3), formyl, chloroacetyl, trifluoroacetyl, methoxyacetyl, phenoxyacetyl, benzoyl (Bz or -C(O)C6H5), C 1-10 Alkyl (methyl, tert-butyl, etc.), 2,2,2-trichloroethyl, 2-trimethylsilylethyl, 1,1-dimethyl-2-propenyl, 3-methyl-3-butenyl, allyl, C 6-10 Aryl C 1-4Alkyl groups (such as benzyl, phenethyl, etc.), p-methoxybenzyl diphenylmethyl, triphenylmethyl (triphenylmethyl or trirityl), tetrahydrofuranyl, methoxymethyl, methylthiomethyl, benzyloxymethyl, 2,2,2-trichloroethoxymethyl, 2-(trimethylsilyl)ethoxymethyl, methanesulfonyl, p-toluenesulfonyl, C 1-10 Alkyl silyl groups (such as trimethylsilyl (TMS or -Si(CH3)3), triethylsilyl, triisopropylsilyl, MMTr, DMTr, or 4',4',4'-trimethoxytriphenylmethyl, etc.).
[0539] The term "amino protecting group" refers to an unstable chemical component that protects an amino group from unwanted reactions during a synthetic procedure. Following one or more synthetic procedures, the amino protecting group, as described herein, can be selectively removed. Amino protecting groups known in the art are generally described in TH Greene and PGM Wuts, Protective Groups in Organic Synthesis, 3rd Edition, John Wiley & Sons, New York (1999). Examples of amino protecting groups include, but are not limited to, acetyl, tert-butoxycarbonyl, 9-fluorenylmethoxycarbonyl, and benzyloxycarbonyl.
[0540] The term "solid support" specifically refers to any particle, bead, or surface on which oligonucleotide synthesis can occur. Both inorganic and organic solid supports are optional for use in the embodiments of this application. Inorganic solid supports are preferably selected from silica gel and controlled-pore glass (CPG). Organic solid supports are resins, preferably macroporous resins, more preferably highly cross-linked polystyrene, Tentagel (a graft copolymer of a low-crosslinked polystyrene matrix with polyethylene glycol (PEG or POE) grafted onto it), polyvinyl acetate (PVA), Poros-polystyrene / divinylbenzene copolymers, amino polyethylene glycol, and cellulose, etc. Preferred embodiments of this application utilize CPG-based solid supports. Many other commercially available solid supports are also applicable to this application.
[0541] Unless otherwise stated, in the event of any conflict or inconsistency between the sequence information in this application specification and the sequence information in the sequence list (ST.26 sequence list), the sequence information described in the specification shall prevail.
[0542] This application provides a detailed description of siRNA, siRNA conjugates or their salts, pharmaceutical compositions, and their uses.
[0543] The embodiments of this application are described in detail below. The embodiments described below are exemplary and are only used to explain this application, and should not be construed as limiting this application.
[0544] This application discloses a method for inhibiting APOC3 expression or activity, a method for preventing and / or treating APOC3-related diseases, including siRNA, siRNA conjugates or their salts, pharmaceutical compositions, and methods for preventing and / or treating APOC3-related diseases, which will be described in detail below.
[0545] siRNA
[0546] In a first aspect of this application, an siRNA is proposed. In some embodiments of this application, the siRNA comprises a sense strand and an antisense strand, wherein the antisense strand has a double-stranded region with at least partial base pairing with the sense strand; wherein the sense strand comprises a nucleotide sequence as shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:23, SEQ ID NO:54, SEQ ID NO:1~SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9~SEQ ID NO:11, SEQ ID NO:13~SEQ ID NO:22, SEQ ID NO:24~SEQ ID NO:53, SEQ ID NO:56 and SEQ ID NO:58~SEQ ID NO:62, or a nucleotide sequence containing at least 15 consecutive nucleotides thereof; the antisense strand comprises a double-stranded region as shown in SEQ ID NO:119, SEQ ID NO:117, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:74, SEQ ID NO:85, SEQ ID NO:62, SEQ ID NO:76, SEQ ID NO:85, SEQ ID NO:62, SEQ ID NO:57, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:74, SEQ ID NO:85, SEQ ID NO:62, SEQ ID NO:57, SEQ ID NO:68, SEQ ID NO:79, SEQ ID NO:62, SEQ ID NO:62, SEQ ID NO:7 ...62, SEQ ID NO:62, SEQ ID NO:62, The siRNA according to any one of SEQ ID NO:116, SEQ ID NO:63-67, SEQ ID NO:69, SEQ ID NO:71-73, SEQ ID NO:75-84, SEQ ID NO:86-115, SEQ ID NO:118, and SEQ ID NO:120-124, or a nucleotide sequence containing at least 15 consecutive nucleotides thereof; each nucleotide in the sense strand and / or antisense strand is independently modified or unmodified. The siRNA according to embodiments of this application can inhibit APOC3 expression, thereby effectively preventing and / or treating APOC3-related diseases.
[0547] In some embodiments of this application, the siRNA comprises a sense strand and an antisense strand, wherein the antisense strand has a double-stranded region with at least partial base pairing with the sense strand; wherein the sense strand comprises a nucleotide sequence as shown in any one of SEQ ID NO:57, SEQ ID NO:6, SEQ ID NO:12, SEQ ID NO:17, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:54, and SEQ ID NO:55, or a nucleotide sequence comprising at least 15 consecutive nucleotides thereof; the antisense strand comprises a nucleotide sequence as shown in any one of SEQ ID NO:119, SEQ ID NO:68, SEQ ID NO:74, SEQ ID NO:79, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:116, and SEQ ID NO:117, or a nucleotide sequence comprising at least 15 consecutive nucleotides thereof; each nucleotide in the sense strand and / or the antisense strand is independently a modified or unmodified nucleotide. According to the embodiments of this application, siRNA can inhibit the expression of APOC3, thereby effectively preventing and / or treating APOC3-related diseases.
[0548] This application proposes an siRNA. In some embodiments of this application, the siRNA comprises a sense strand and an antisense strand, wherein the antisense strand has a double-stranded region with at least partial base pairing with the sense strand; wherein the sense strand comprises a nucleotide sequence as shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:23, SEQ ID NO:54, SEQ ID NO:1~SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9~SEQ ID NO:11, SEQ ID NO:13~SEQ ID NO:22, SEQ ID NO:24~SEQ ID NO:53, SEQ ID NO:56 and SEQ ID NO:58~SEQ ID NO:62, or a nucleotide sequence containing at least 10 consecutive nucleotides thereof; the antisense strand comprises a double-stranded region as shown in SEQ ID NO:119, SEQ ID NO:117, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:74, SEQ ID NO:85, SEQ ID NO:62, SEQ ID NO:76, SEQ ID NO:85, SEQ ID NO:62, SEQ ID NO:57, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:74, SEQ ID NO:85, SEQ ID NO:62, SEQ ID NO:57, SEQ ID NO:68, SEQ ID NO:79, SEQ ID NO:62, SEQ ID NO:62, SEQ ID NO:7 ...62, SEQ ID NO:62, SEQ ID NO:62, The nucleotide sequence shown in any one of SEQ ID NO:116, SEQ ID NO:63~SEQ ID NO:67, SEQ ID NO:69, SEQ ID NO:71~SEQ ID NO:73, SEQ ID NO:75~SEQ ID NO:84, SEQ ID NO:86~SEQ ID NO:115, SEQ ID NO:118 and SEQ ID NO:120~SEQ ID NO:124, or a nucleotide sequence containing at least 10 consecutive nucleotides thereof; each nucleotide in the sense strand and / or antisense strand is independently a modified or unmodified nucleotide.
[0549] In some embodiments of this application, the siRNA comprises a sense strand and an antisense strand, wherein the antisense strand has a double-stranded region with at least partial base pairing with the sense strand; wherein the sense strand comprises a nucleotide sequence as shown in any one of SEQ ID NO:57, SEQ ID NO:6, SEQ ID NO:12, SEQ ID NO:17, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:54, and SEQ ID NO:55, or a nucleotide sequence comprising at least 10 consecutive nucleotides thereof; the antisense strand comprises a nucleotide sequence as shown in any one of SEQ ID NO:119, SEQ ID NO:68, SEQ ID NO:74, SEQ ID NO:79, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:116, and SEQ ID NO:117, or a nucleotide sequence comprising at least 10 consecutive nucleotides thereof; each nucleotide in the sense strand and / or the antisense strand is independently a modified or unmodified nucleotide. According to the embodiments of this application, siRNA can inhibit the expression of APOC3, thereby effectively preventing and / or treating APOC3-related diseases.
[0550] Through experimental design, the inventors obtained the above-mentioned suitable small interfering RNA (siRNA), which forms an RNA-induced silencing complex (RISC) that pairs complementaryly with the mRNA sequence of the target gene (APOC3 gene), causing the mRNA encoding APOC3 to degrade and inhibiting the expression of APOC3. This can effectively prevent and / or treat APOC3-related diseases.
[0551] In this document, the "it" in the terms "or at least 15 consecutive nucleotides thereof" and "or at least 10 consecutive nucleotides thereof" refers to the aforementioned nucleotide sequence. For example, "the positive chain comprises the nucleotide sequence shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:23, SEQ ID NO:54, SEQ ID NO:1~SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9~SEQ ID NO:11, SEQ ID NO:13~SEQ ID NO:22, SEQ ID NO:24~SEQ ID NO:53, SEQ ID NO:56 and SEQ ID NO:58~SEQ ID NO:62, or at least 15 consecutive nucleotides thereof" means that the positive chain comprises the nucleotide sequence shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:23, SEQ ID NO:54, SEQ ID NO:1~SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9~SEQ ID NO:11, SEQ ID NO:13~SEQ ID NO:22, SEQ ID NO:53, SEQ ID NO:56 and SEQ ID NO:58~SEQ ID NO:62, or at least 15 consecutive nucleotides thereof. The nucleotide sequence shown in any one of SEQ ID NO:24 to SEQ ID NO:53, SEQ ID NO:56 and SEQ ID NO:58 to SEQ ID NO:62, or the nucleotide sequence shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:23, SEQ ID NO:54, SEQ ID NO:1 to SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 to SEQ ID NO:11, SEQ ID NO:13 to SEQ ID NO:22, SEQ ID NO:24 to SEQ ID NO:53, SEQ ID NO:56 and SEQ ID NO:58 to SEQ ID NO:62, contains at least 15 consecutive nucleotides.For example, "the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NO:119, SEQ ID NO:117, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:74, SEQ ID NO:85, SEQ ID NO:116, SEQ ID NO:63~SEQ ID NO:67, SEQ ID NO:69, SEQ ID NO:71~SEQ ID NO:73, SEQ ID NO:75~SEQ ID NO:84, SEQ ID NO:86~SEQ ID NO:115, SEQ ID NO:118 and SEQ ID NO:120~SEQ ID NO:124, or at least 10 consecutive nucleotides thereof" means that the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NO:119, SEQ ID NO:117, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:74, SEQ ID NO:85, SEQ ID NO:116, SEQ ID NO:63~SEQ ID NO:67, SEQ ID NO:69, SEQ ID NO:119, SEQ ID NO:117, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:74, SEQ ID NO:85, SEQ ID NO:116, SEQ ID NO:63~SEQ ID NO:67, SEQ ID NO:69, SEQ ID NO:120~SEQ ID NO:124, or at least 10 consecutive nucleotides thereof. The nucleotide sequence shown in any one of SEQ ID NO:71~SEQ ID NO:73, SEQ ID NO:75~SEQ ID NO:84, SEQ ID NO:86~SEQ ID NO:115, SEQ ID NO:118 and SEQ ID NO:120~SEQ ID NO:124, or the nucleotide sequence shown in any one of SEQ ID NO:119, SEQ ID NO:117, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:74, SEQ ID NO:85, SEQ ID NO:116, SEQ ID NO:63~SEQ ID NO:67, SEQ ID NO:69, SEQ ID NO:71~SEQ ID NO:73, SEQ ID NO:75~SEQ ID NO:84, SEQ ID NO:86~SEQ ID NO:115, SEQ ID NO:118 and SEQ ID NO:120~SEQ ID NO:124, contains at least 10 consecutive nucleotides.
[0552] In this article, the terms "distinguishing by no more than 5 nucleotides" or "having a difference of no more than 5 nucleotides" refer to differences of 0, 1, 2, 3, 4, or 5 nucleotides compared to the target nucleotide sequence (mRNA encoding the APOC3 gene). These differences include, but are not limited to, nucleotide deletions, nucleotide insertions (which may be inserted at the 3' end, 5' end, or between any two nucleotides in the nucleotide sequence), and nucleotide substitutions. The phrase "the positive chain includes the nucleotide sequence shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:23, SEQ ID NO:54, SEQ ID NO:1~SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9~SEQ ID NO:11, SEQ ID NO:13~SEQ ID NO:22, SEQ ID NO:24~SEQ ID NO:53, SEQ ID NO:56 and SEQ ID NO:58~SEQ ID NO:62, or differs from it by no more than 5 nucleotides" refers to the nucleotide sequence shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:23, SEQ ID NO:54, SEQ ID NO:1~SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9~SEQ ID NO:11, SEQ ID NO:13~SEQ ID NO:22, SEQ ID NO:24~SEQ ID NO:53, SEQ ID NO:56 and SEQ ID NO:58~SEQ ID NO:62. One of the nucleotide sequences shown in NO:22, SEQ ID NO:24~SEQ ID NO:53, SEQ ID NO:56 and SEQ ID NO:58~SEQ ID NO:62;The phrase “the antisense strand comprises, or differs from, any of the nucleotide sequences shown in SEQ ID NO:119, SEQ ID NO:117, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:74, SEQ ID NO:85, SEQ ID NO:116, SEQ ID NO:63~SEQ ID NO:67, SEQ ID NO:69, SEQ ID NO:71~SEQ ID NO:73, SEQ ID NO:75~SEQ ID NO:84, SEQ ID NO:86~SEQ ID NO:115, SEQ ID NO:118 and SEQ ID NO:120~SEQ ID NO:124” refers to the nucleotide sequences shown in any of SEQ ID NO:119, SEQ ID NO:117, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:74, SEQ ID NO:85, SEQ ID NO:116, SEQ ID NO:63~SEQ ID NO:67, SEQ ID NO:69, SEQ ID NO:71~SEQ ID NO:73, SEQ ID NO:75~SEQ ID NO:84, SEQ ID NO:86~SEQ ID NO:115, SEQ ID NO:118 and SEQ ID NO:120~SEQ ID NO:124, or having a difference of no more than 5 nucleotides from them”. One of the nucleotide sequences shown in SEQ ID NO:71~SEQ ID NO:73, SEQ ID NO:75~SEQ ID NO:84, SEQ ID NO:86~SEQ ID NO:115, SEQ ID NO:118, and SEQ ID NO:120~SEQ ID NO:124.
[0553] It should be noted that in this application, the nucleotide sequences shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:23, SEQ ID NO:54, SEQ ID NO:1~SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9~SEQ ID NO:11, SEQ ID NO:13~SEQ ID NO:22, SEQ ID NO:24~SEQ ID NO:53, SEQ ID NO:56 and SEQ ID NO:58~SEQ ID NO:62, and / or the nucleotide sequences shown in any one of SEQ ID NO:119, SEQ ID NO:117, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:74, SEQ ID NO:85, SEQ ID NO:116, SEQ ID NO:63~SEQ ID NO:67, SEQ ID NO:69, SEQ ID NO:71~SEQ ID NO:73, SEQ ID NO:75 ... The nucleotide sequences shown in any one of SEQ ID NO:84, SEQ ID NO:86 to SEQ ID NO:115, SEQ ID NO:118 and SEQ ID NO:120 to SEQ ID NO:124 are all located in the double-stranded region of the siRNA.
[0554] In some alternative embodiments of this application, the antisense strand and the sense strand have a double-stranded region with at least 85%, or at least 90%, or at least 95% base pairing.
[0555] In some alternative embodiments of this application, one or more inverted abasic residues (invAbs) are added to the 3' and / or 5' ends of the sense and / or antisense strands. In some alternative embodiments of this application, one or more inverted abasic residues (invAbs) are added to the 3' and 5' ends of the sense strand. In some alternative embodiments of this application, one or more inverted abasic residues (invAbs) are added to the 5' end of the sense strand. In some alternative embodiments of this application, one or more inverted abasic residues are inserted between the ligand and the nucleotide sequence of the sense and / or antisense strands. In some alternative embodiments of this application, the inverted abasic residues may be linked via phosphate esters, phosphate thioesters, or other nucleoside bonds.
[0556] This application presents a preferred siRNA agent obtained by the inventors through extensive experimentation and inventive effort. In a preferred embodiment of this application, the 3' end of the positive strand of the siRNA or its conjugate has two thiosclerotic modifications, which are beneficial for improving drug stability. When a ligand is attached to the 3' and / or 5' ends of the siRNA, and the ligand is linked to the 3' and / or 5' ends via a thiophosphate ester (as shown in Table D, the ligand is linked to the 3' end via a thiophosphate ester), the thiophosphate ester between the ligand and the nucleotide is considered one of the thiosclerotic modifications. According to common knowledge in the art (and verified by the inventors in the pharmacological experiments described herein), when the 3' end of the positive strand of the siRNA in Table C-2 is linked to a ligand via a thiophosphate ester to obtain the siRNA conjugate in Table D, it (the siRNA in Table D) has the same stability as the corresponding siRNA conjugate in Table 2. Good in vitro activities, such as the knockdown activity of siRNA group NO:C2-1 on mRNA, are essentially the same as the knockdown activity of siRNA group NO:D1 obtained by ligand attachment. To save on sequence synthesis costs, the inventors used siRNA without ligand attachment (such as L96) (Table C-2) for in vitro screening. Therefore, those skilled in the art can select suitable ligands for the siRNAs in Table C-2, such as GalNAc or its derivatives like L96 and DAW40007-4, to obtain ligate-containing siRNA conjugates with similar activities. It should also be noted that when the 3' end of the positive strand in Table C-2 is attached to a ligand, the second thiophosphate ester at the 3' end that was previously without ligand attachment is replaced with a phosphate ester. This is to ensure that only two thiosclerotic backbone modifications are present at the 3' end of the positive strand. In addition, the siRNA conjugates obtained by ligand attachment at the 3' end of the positive strand of Table C-2 are all shown in Table D.
[0557] siRNA conjugates or their salts
[0558] In a second aspect of this application, a siRNA conjugate or a salt thereof is provided. According to embodiments of this application, the siRNA conjugate or a salt thereof comprises: the siRNA described in the first aspect, and a ligand conjugated to the siRNA. The siRNA conjugate described above can facilitate the targeting and delivery of nucleic acid drugs, enabling the siRNA to connect to desired cells and / or tissues in vivo to target and silence APOC3 inhibition in target cells and / or tissues, thereby effectively preventing and / or treating APOC3-related diseases.
[0559] In this document, the term "ligand" or "carrier" refers to a class of substances that can alter the distribution, targeting, or lifespan of siRNA. For example, the ligand provides enhanced affinity for a selected target (e.g., molecule, cell or cell type, compartment (e.g., cellular or organ compartment, body tissue, organ, or region)) compared to a species where no ligand is present. The ligand can be a natural protein (e.g., human serum albumin (HSA), etc.), a carbohydrate (e.g., dextran and chitosan), or a lipid; it can also be a recombinant or synthetic molecule, such as a synthetic polymer. Preferably, the ligand does not participate in the pairing of the sense and antisense strands in the siRNA.
[0560] In one alternative embodiment of this application, the ligand is directly or indirectly conjugated to the siRNA via a linker.
[0561] There are no particular limitations on the ligand structure; any ligand capable of delivering siRNA into cells or tissues can be used, with ligands that can target liver cells and / or tissues being preferred.
[0562] There are no particular restrictions on the way the ligand is connected to the siRNA. The ligand can be directly connected to the siRNA without using a separate adapter / connector group, or it can be indirectly connected to the siRNA through an adapter.
[0563] There are no particular restrictions on the manner in which the ligand is linked to the sense and / or antisense strands of the siRNA. Preferably, the ligand is linked to the siRNA via a thiophosphate bond or a phosphate bond. Preferably, the ligand is linked to the 5' or 3' end of the sense strand. More preferably, the ligand is linked to the 5' or 3' end of the antisense strand.
[0564] In an alternative embodiment of this application, the ligand is attached to the 5' end of the justice chain.
[0565] In some alternative embodiments of this application, the ligand comprises at least one N-acetylgalactosamine.
[0566] In some alternative embodiments of this application, the ligand is a GalNAC compound.
[0567] In some optional embodiments of this application, the GalNAC compound includes at least one of the following: L96 or its isomers (e.g., stereoisomers), DAW4007-4 or its isomers (e.g., stereoisomers), and NAG37 or its isomers (e.g., stereoisomers).
[0568] Therefore, the use of the above-mentioned ligands can promote the targeting and delivery of oligonucleotides, enabling the oligonucleotides to be linked to desired cells and / or tissues in the body, so as to target and silence target genes in target cells and / or tissues, thereby effectively preventing and / or treating related diseases.
[0569] Pharmaceutical Composition
[0570] In a third aspect of this application, a pharmaceutical composition is provided. In some embodiments of this application, the pharmaceutical composition comprises: the siRNA described in the first aspect, or the siRNA conjugate described in the third aspect, or a salt thereof. As previously mentioned, both the aforementioned siRNA and siRNA conjugate can degrade the mRNA encoding APOC3, inhibiting the expression or activity of the APOC3 gene. Therefore, the pharmaceutical composition of this application can effectively treat and prevent APOC3-related diseases.
[0571] The effective amount of the nucleic acid conjugates described in this application (such as the siRNA conjugates or their salts, or pharmaceutical compositions described in this application) may vary depending on the administration method and the severity of the disease to be treated. A preferred effective amount can be determined by those skilled in the art based on various factors (e.g., through clinical trials). These factors include, but are not limited to: pharmacokinetic parameters of the active ingredient, such as bioavailability, metabolism, and half-life; the severity of the disease to be treated, the patient's weight, the patient's immune status, and the route of administration.
[0572] The pharmaceutical composition or drug described in this application comprises a pharmacologically effective amount of at least one APOC3 double-stranded siRNA agent and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient is a substance intentionally included in a drug delivery system, other than the active pharmaceutical ingredient (API, therapeutic product, such as the APOC3 double-stranded siRNA agent of this application). The excipient does not exert or is not intended to exert a therapeutic effect at the intended dosage. The excipient may function to a) assist in the processing of the drug delivery system during manufacturing, b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the API, c) assist in product identification, and / or d) enhance any other property of the overall safety and effectiveness of API delivery during storage or use. Pharmaceutically acceptable excipients may or may not be inert substances.
[0573] Excipients may include, but are not limited to: absorption enhancers, anti-adhesion agents, defoamers, antioxidants, adhesives, buffers, carriers, coatings, colorants, delivery enhancers, delivery polymers, dextran, dextran, diluents, disintegrants, emulsifiers, extenders, fillers, flavoring agents, flow aids, lubricants, oils, polymers, preservatives, brine, salt, solvents, sugars, suspending agents, sustained-release matrices, sweeteners, thickeners, tensioning agents, mediators, waterproofing agents, and wetting agents.
[0574] Pharmaceutical compositions suitable for injection include sterile aqueous solutions (water-soluble). For subcutaneous or intravenous administration, suitable carriers may include physiological saline, antibacterial water, etc. ELTM (BASF, Parsippany, NJ) or phosphate-buffered saline (PBS). It should be stable under production and storage conditions and should be protected against contamination by microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol) and suitable mixtures thereof.
[0575] Sterile injectable solutions can be prepared by incorporating the desired amount of the active compound with one or a combination of the ingredients listed above (as needed) into a suitable solvent, followed by filtration and sterilization. Typically, dispersions are prepared by incorporating the active compound into a sterile medium containing a basic dispersion medium and other desired ingredients from the list above.
[0576] APOC3 RNAi agents can be formulated into dosage unit compositions to facilitate administration and dosage uniformity. A dosage unit refers to a physically discrete unit suitable as a unit dose for use in a subject to be treated; each unit contains a predetermined amount of active compound calculated to produce the desired therapeutic effect, along with the desired drug carrier. In some embodiments, the dosage unit is about 1 mg to about 100 mg of APOC3 nucleic acid conjugate drug substance. In some embodiments, the dosage unit is about 10 mg to about 100 mg of APOC3 nucleic acid conjugate drug substance. In some embodiments, the dosage unit is about 10 mg to about 50 mg of APOC3 RNAi drug substance. In some embodiments, the dosage unit is about 10 mg of APOC3 nucleic acid conjugate drug substance. In some embodiments, the dosage unit is about 25 mg of APOC3 RNAi drug substance. In some embodiments, the dosage unit is about 50 mg of APOC3 nucleic acid conjugate drug substance. In some embodiments, the dosage unit is about 100 mg of APOC3 RNAi drug substance. In some implementations, the dosage units are approximately 1, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94. 96 or 98 mg of approximately 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, or 100 mg of APOC3 nucleic acid conjugate drug substance.
[0577] It should be understood that in some cases, the initial dose may be increased beyond the aforementioned upper limit to rapidly achieve the desired blood or tissue levels, or in some cases, the initial dose may be less than the optimal value. For example, in some embodiments, an initial dose or first dose of about 1 mg to about 100 mg of the APOC3 nucleic acid conjugate drug substance is administered, followed by a second dose of about 1 to 100 mg of the APOC3 nucleic acid conjugate drug substance after about one month, and thereafter an additional dose is administered every three months (e.g., once per calendar quarter or once every 12 weeks (q12w)).
[0578] The medication may be administered to the subject via any suitable route known in the art, including but not limited to: oral or parenteral routes, including intravenous administration, intramuscular administration, subcutaneous administration, transdermal administration, airway administration (aerosol), pulmonary administration, nasal administration, rectal administration, and local administration (including oral administration and sublingual administration), preferably subcutaneous administration and intravenous administration.
[0579] In some embodiments, the pharmaceutical composition may be administered via intravenous infusion over a period of time, such as within time intervals of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 and 21, 22, 23, 24 or approximately 25 minutes. For example, it may be administered regularly, such as weekly, bi-weekly (i.e., every two weeks), for one month, two months, three months, four months or longer. After the initial treatment regimen, treatment may be given at a lower frequency. For example, after three months of weekly or bi-weekly administration, administration may be repeated monthly for six months or one year or longer.
[0580] In some embodiments, the pharmaceutical composition may be administered subcutaneously. The pharmaceutical composition may be administered once daily, or the nucleic acid conjugate may be administered as two, three, or more sub-dose at appropriate intervals throughout the day, or even delivered using continuous infusion or a controlled-release formulation. In this case, each sub-dose must contain a correspondingly smaller amount of nucleic acid conjugate to obtain the total daily dose. Combined dose units may also be used for delivery over several days, for example, using conventional sustained-release formulations that provide sustained release of the nucleic acid conjugate over a period of several days. Sustained-release formulations are well known in the art and are particularly useful for delivering pharmaceutical agents in specific portions, as can be used with the pharmaceutical agents of this application. In this embodiment, the dose unit contains a corresponding multiple daily doses. A higher dose (i.e., a loading dose) may be administered initially, followed by lower doses over a duration.
[0581] In some embodiments, a single dose of the pharmaceutical composition may be long-acting, such that subsequent doses are administered at intervals not exceeding 3, 4, or 5 days, or at intervals not exceeding 1, 2, 3, or 4 weeks. In some embodiments of this application, a single dose of the pharmaceutical composition of this application is administered once weekly. In other embodiments of this application, a single dose of the pharmaceutical composition of this application is administered every two months. In specific embodiments, the nucleic acid conjugate is administered about once a month to about once a quarter (i.e., about once every three months).
[0582] The pharmaceutical compositions of this application include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions can be derived from a variety of components, including but not limited to preformed liquids, self-emulsifying solids, and self-emulsifying semi-solids. Particularly preferred are formulations targeting the liver when treating liver conditions (e.g., liver cancer).
[0583] The pharmaceutical formulations of this application (which can be conveniently present in unit dosage forms) can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include steps such as combining these active ingredients with the drug carrier or excipient(s). Generally, these formulations are prepared by the following steps: uniformly and finely combining these active ingredients with a liquid carrier or a finely dispersed solid carrier, or both, and, if necessary, shaping the product.
[0584] The compositions of this application can be formulated into any of a number of possible dosage forms, such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft capsules, suppositories, and enemas. The compositions of this application can also be formulated as suspensions in aqueous, non-aqueous, or mixed media. Aqueous suspensions may further contain substances that increase the viscosity of the suspension, such substances including, for example, sodium carboxymethyl cellulose, sorbitol, and / or dextran. The suspension may also contain stabilizers.
[0585] The pharmaceutical compositions disclosed in this application include formulations suitable for parenteral administration. The formulations can be conveniently present in unit dosage form and can be prepared by any method known in the pharmaceutical field. The amount of active ingredient that can be combined with excipients to prepare a single-dose form is generally the amount of siRNA that produces the therapeutic effect. Generally, this amount, expressed in percent, is from about 1% to about 99% of the active ingredient, preferably from about 5% to about 70%, and most preferably from about 10% to about 30%.
[0586] This application describes siRNA conjugates or pharmaceutical compositions thereof that provide significant TG-lowering effects for the treatment of APOC3-related diseases and conditions, such as hypertriglyceridemia-induced pancreatitis, metabolic syndrome, type II diabetes, familial chylomicronemia syndrome (FCS), chylomicronemia, multifactorial chylomicronemia, lipodystrophy syndromes including familial partial lipodystrophy, obesity, dyslipidemia, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, hyperlipidemia, hypertriglyceridemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, cardiovascular disease, coronary artery disease, and other dyslipidemia and metabolic-related conditions and diseases. In some embodiments, the disclosed method can treat APOC3-related diseases or conditions by significantly reducing TG levels and thereby reducing the risk of developing hypertriglyceridemia-induced pancreatitis, metabolic syndrome, type II diabetes, familial chylomicronemia syndrome (FCS), chylomicronemia, multifactorial chylomicronemia, lipodystrophy syndrome including familial partial lipodystrophy, obesity, dyslipidemia, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, hyperlipidemia, hypertriglyceridemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, cardiovascular disease, coronary artery disease, or other dyslipidemia or metabolic-related conditions and diseases. In this application, "pharmaceutical composition" can refer to something used for the treatment of a disease or for use in in vitro cell culture experiments.
[0587] The formulation, administration, and method of treating diseases of the siRNA drug described in this application.
[0588] This application includes siRNA pharmaceuticals, siRNA conjugates, or combinations thereof.
[0589] Methods to inhibit APOC3 gene expression or activity
[0590] This application discloses a method for inhibiting the expression or activity of the APOC3 gene. In some embodiments of this application, the method includes administering a pharmaceutically acceptable dose of the aforementioned siRNA, or the aforementioned siRNA conjugate or its salt, to a subject and contacting the cells. As previously stated, the aforementioned siRNA and siRNA conjugate or its salt can degrade APOC3 mRNA, inhibiting APOC3 expression and replication. Therefore, the method of this application can be used to inhibit the expression or activity of APOC3. For example, it can inhibit the expression or activity of APOC3 in vivo in animals; or it can inhibit the expression or activity of APOC3 for non-disease treatment purposes, such as inhibiting the expression or activity of APOC3 in vitro for subsequent studies.
[0591] Methods to inhibit APOC3 gene expression in patients
[0592] This application discloses a method for inhibiting the expression of the APOC3 gene in a patient. According to embodiments of this application, the method includes administering the aforementioned siRNA, the aforementioned siRNA conjugate or its salt, or the aforementioned pharmaceutical composition to the patient, wherein the siRNA, siRNA conjugate or its salt, or pharmaceutical composition may be in a therapeutically effective amount.
[0593] In some alternative embodiments of this application, siRNA, siRNA conjugates or their salts, or pharmaceutical compositions are administered at doses of 0.01 mg / kg to 10 mg / kg or 0.5 mg / kg to 50 mg / kg, or at doses of 10 mg / kg to 30 mg / kg, or at doses of 3 mg / kg, or at doses of 10 mg / kg.
[0594] In some alternative embodiments of this application, siRNA, siRNA conjugates or their salts, or pharmaceutical compositions are administered twice weekly at a dose of 0.5 mg / kg, or every other week at a dose of 10 mg / kg, or once weekly at a dose of 0.5-1 mg / kg.
[0595] In some alternative embodiments of this application, siRNA, siRNA conjugates or their salts, or pharmaceutical compositions are administered subcutaneously or intravenously.
[0596] In some alternative embodiments of this application, siRNA, siRNA conjugates or their salts, or pharmaceutical compositions are administered in two or more doses.
[0597] Methods for preventing and / or treating APOC3-related diseases
[0598] This application discloses a method for preventing and / or treating APOC3-related diseases. According to embodiments of this application, the method includes administering to a subject a pharmaceutically acceptable dose of the aforementioned siRNA, the aforementioned siRNA conjugate or its salt, or the aforementioned pharmaceutical composition. According to embodiments of this application, this method is an effective way to prevent and / or treat APOC3-related diseases.
[0599] The effective amount of the siRNA, siRNA conjugate or its salt, or pharmaceutical composition described in this application may vary depending on the administration method and the severity of the disease to be treated. A preferred effective amount can be determined by those skilled in the art based on various factors (e.g., through clinical trials). These factors include, but are not limited to: pharmacokinetic parameters of the active ingredient, such as bioavailability, metabolism, and half-life; the severity of the disease to be treated, the patient's weight, the patient's immune status, and the route of administration.
[0600] According to embodiments of this application, the APOC3-related diseases include hypertriglyceridemia, obesity, dyslipidemia, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, cardiovascular disease, coronary artery disease, hypertriglyceridemia-induced pancreatitis, metabolic syndrome, type II diabetes, familial chylomicronemia syndrome, chylomicronemia, multifactorial chylomicronemia, lipodystrophy syndrome, or familial partial lipodystrophy. Detailed Implementation
[0601] The following will explain the scheme of this application with reference to the embodiments. Those skilled in the art will understand that the following embodiments are only for illustrating this application and should not be regarded as limiting the scope of this application. In particular, the synthesis of small nucleic acids and double-stranded siRNA agents can be obtained by adjusting the synthesis according to the embodiments of this invention or conventional methods in the art. Where specific techniques, reagent concentrations, reagent dosages, etc. are not specified in the embodiments, they are carried out according to the techniques or conditions described in the literature in the art, or according to the product instructions, or adjusted according to the technical knowledge in the art. For the synthesis of double-stranded siRNA agents, even if the dosage and concentration are specified, they can be appropriately adjusted according to the technical knowledge in the art and the synthesis needs. The reagents or instruments used, unless otherwise specified by the manufacturer, are all conventional products that can be obtained commercially, and their quality / purity standards are suitable for molecular biology.
[0602] Preparation Example 1: Synthesis of Ligands
[0603] 1. Compound L96-DMTr-CPG was prepared according to the method described in patent application WO2014025805A1.
[0604] 2. Compound 19 was prepared according to the method described in patent application CN109462981B.
[0605] The conjugation groups of this application can be linked (conjugated) to siRNA molecules according to methods known in the art. For example, compounds DAW40007-3, L96-DMTr-CPG and compound 19 are linked to siRNA and deprotected to form conjugation groups with structures of DAW40007-4, L96 and NAG37, respectively.
[0606] Example 1: Synthesis of double-stranded siRNA and double-stranded siRNA conjugates
[0607] 1. Synthesis of double-stranded siRNA without conjugated groups
[0608] The synthesis steps of the siRNA sense and antisense strands described in this application are as follows:
[0609] The siRNA nucleotide sequences were prepared according to Tables A, B, C-1, and C-2 of this application. The synthesis was performed to a theoretical yield of 0.5 μmol. 0.5 μmol of solid-phase support CPG, all phosphoramide monomers, and auxiliary reagents (all commercially available) were weighed. All phosphoramide monomers were provided in 0.05 M anhydrous acetonitrile solution. For thiolated oligonucleotides with a phosphate backbone, 0.06 M hydrogenated xanthanin solution was used as the thioating agent. 5-Ethylthio-1H-tetrazole acetonitrile solution (0.25 M) was used as the activator, 0.02 M iodine in pyridine / water solution as the oxidant, and 3% trichloroacetic acid in dichloromethane solution as the deprotection agent. These were placed in the designated reagent positions on the 48-channel automated nucleic acid synthesizer. The synthesis program was set, and the specified oligonucleotide base sequence was entered. After verification, the oligonucleotide synthesis was started in cycles. Each coupling step took 6 minutes, and the thiolation time was 8 minutes. After automatic recycling, oligonucleotides containing solid-phase support CPG were obtained.
[0610] After synthesis, the nucleotides containing the solid-phase support CPG were transferred to a 2 mL EP tube, and 0.5 mL of 28% ammonia solution was added. The mixture was heated at 60 °C for 5–18 hours. After filtration and concentration under reduced pressure, a white or yellow gelatinous solid was obtained. 0.3 mL of 0.5 M NaOAc solution and 1.2 mL of anhydrous ethanol were added, followed by shaking and high-speed centrifugation. The supernatant was discarded, and the solid was dissolved in nuclease-free water to obtain oligonucleotides. The concentration of the obtained oligonucleotides was determined using a micro-ultraviolet spectrophotometer (SPECTRO stat Nano). Mass spectrometry analysis was performed on an Agilent 6530LC-MS Q-Tof system. The molecular weight of the nucleic acid was calculated after a single-stage scan and deconvolution.
[0611] Annealing steps:
[0612] The sense strand of the double-stranded siRNA synthesized above was mixed with the antisense strand synthesized above in an equimolar amount, heated to 95°C, and held at that temperature for 10 min before being slowly cooled to room temperature. The resulting double-stranded siRNA was then lyophilized to obtain the target double-stranded siRNAs listed in Tables A, B, C-1, and C-2.
[0613] 2. Synthesis of siRNA conjugates:
[0614] The antisense strand was synthesized by referring to the above-described methods for synthesizing the sense and antisense strands without GalNac, and was obtained through reverse-phase preparation and purification.
[0615] Synthesis of the sense strand: The general solid support CPG was replaced with the GalNAc solid support prepared in this invention (such as compound L96-DMTr-CPG), and the sense strand of the double-stranded siRNA agent of this invention was obtained by reverse-phase preparation and purification, referring to the antisense strand synthesis method.
[0616] Annealing steps:
[0617] The sense strand of the double-stranded siRNA synthesized above was mixed with the antisense strand synthesized above in an equimolar amount, heated to 95°C, and held at that temperature for 10 min before being slowly cooled to room temperature. The resulting siRNA conjugate was then lyophilized.
[0618] The double-stranded siRNA conjugates obtained by the above synthesis are detailed in Table D of the above invention description.
[0619] Test Example 1: Cell viability and cytotoxicity assay of siRNA and its conjugates
[0620] (I) Drug efficacy in human liver cancer cell lines
[0621] 1. Digest HepG2 cells in good growth condition, resuspend them in culture medium, count them, and seed them in 96-well plates at a density of about 20,000 cells / well. Incubate overnight at 37°C and 5% CO2.
[0622] 2. The siRNA to be tested was serially diluted. Each siRNA was transfected at two concentrations (10 nM and 0.4 nM) using Lipo-fectamine RNAiMAX (Thermo Fisher) and cultured for another 24 hours.
[0623] 3. RNA was extracted from the samples using the QuickEasy™ Cell Direct RT-qPCR Kit–Taqman (Foregene). The extracted product was reverse transcribed to obtain cDNA. Using the cDNA obtained from the reverse transcription as a template, the transcription level of the target gene was detected by qPCR. The GAPDH forward primer was 5'-AGCCTCAAGATCATCAGCAAT-3' (SEQ ID NO:860), the reverse primer was 5'-GTCATGAGTCCTTCCACGAT-3' (SEQ ID NO:861), and the probe was 5'-VIC-CCACCAACTGCTTAGCACCCCTGGCC-BHQ1-3' (SEQ ID NO:862). The APOC3 forward primer was 5'-GTTACATGAAGCACGCCAC-3' (SEQ ID NO:863), and the reverse primer was 5'-GTCTTTCAGGGAACTGAAGC-3' (SEQ ID NO:863). NO:864), the probe is 5'-FAM-AGACCGCCAAGGATGCACTGAGCAGC-BHQ1-3' (SEQ ID NO:865).
[0624] 4. By comparing the relative expression levels of APOC3 mRNA in each group with the internal reference gene, the data were normalized using the expression levels of the untreated group.
[0625] Experimental results show that the siRNA or its conjugates described in this application have good inhibitory activity against APOC3. The experimental results of APOC3 inhibition by partially modified siRNA are shown in Table 1.
[0626] Table 1: Experimental results of partial modification of siRNA APOC3 inhibition in this application nd indicates that it was not detected.
[0627] Test Example 2: Efficacy of humanized APOC3 mice:
[0628] (I) In vivo drug efficacy screening:
[0629] Male, 6-8 week old humanized APOC3 C57BL / 6 mice were selected for in vivo efficacy testing using the siRNA conjugates shown in Table D. The specific experimental steps are as follows: The mice were divided into an experimental group containing the siRNA conjugates of this invention, a positive control group (PC in the attached figure represents the APOC3 siRNA positive control; DAW30346 (Plozasiran) was used as the positive control in this test), and a placebo group (physiological saline). Each group received a single subcutaneous injection of 1 mg / kg. Before administration and on days 8, 15, 22, 29, 36, and 43 after administration, 100 μL of blood was collected from the orbital sinus after a 4-hour fast. Serum was collected, and the levels of APOC3 protein, total cholesterol (TC), and triglycerides (TG) in the serum were detected using a Cobas C311 fully automated biochemical analyzer (Roche Diagnostics). For standardization, the APOC3 protein level and blood lipid content of mice at each time point were divided by the average pre-treatment expression level of the group of animals (the average value of the corresponding indicators in the pre-experiment samples of the group).
[0630] Experimental results show that the siRNA or its conjugates described in this application have good inhibitory activity against APOC3 protein expression. Specifically, in the first batch of tests, the results of treating humanized APOC3 mice with siRNA conjugates NO. D6, D12, D21, D50, and D52 are shown in Figure 1. The results of inhibiting the relative residual levels of mouse triglyceride (TG) protein and total cholesterol (TC) protein are shown in Figures 2 and 3, respectively. In the second batch of tests, the results of treating humanized APOC3 mice with siRNA conjugates NO. D359 and D374 are shown in Figure 4. The results of inhibiting the relative residual levels of mouse triglyceride (TG) protein and total cholesterol (TC) protein are shown in Figures 5 and 6, respectively. The results of treating humanized APOC3 mice with siRNA conjugate NO. D419 are shown in Figure 7.
[0631] PC (DAW30346) in all the figures is for comparison. The sequence information of DAW30346 (i.e. PC) is: positive chain (5'-3') (NAG37)s(invAb)sacgggacaGfUfAfuucucaguias(invAb) (SEQ ID NO:858); negative chain: usCfsasCfuGfagaauAfcUfgUfcCfcGfsu (SEQ ID NO:859).
[0632] (II) Drug Dosage Exploration:
[0633] Male humanized APOC3 C57BL / 6 mice were selected. The APOC3 siRNA candidate drugs shown in the preliminary screening table D were serially diluted to concentrations of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, and 3 mg / kg. The mice were divided into the following groups: two screening experimental groups, a positive control group (APOC3 siRNA positive drug, DAW30346 was used as a positive control in this test), and a placebo group (physiological saline). The mice were given a single subcutaneous injection of APOC3 siRNA reagent at concentrations of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, and 3 mg / kg. One day before administration (-1 day), and on days 8, 15, 22, 29, 36, and 43 after administration, 100 μL of blood was collected from the orbital sinus after a 4-hour fast. Serum was collected and the levels of APOC3 protein, total cholesterol (TC), triglycerides (TG), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) in the serum were measured using a Cobas C311 fully automated biochemical analyzer (Roche Diagnostics). For standardization, the APOC3 protein level and blood lipid levels of each mouse at each time point were divided by the mean pre-treatment expression level of the group (the mean of the corresponding indicators in the pre-experimental samples of that group).
[0634] Test Example 3: Drug Efficacy Experiment in Crab-Eating Monkeys:
[0635] Healthy, washed cynomolgus macaques of similar age were randomly divided into three groups of three, each receiving one of three different drugs. On the day of administration (D1), the macaques received a single subcutaneous injection of the test drug (Table D) at a dose of 3 mg / kg, according to their group. The control group received an equal volume of physiological saline. Serum samples were collected on days -7 (before administration), -1 (before administration), and on days 7, 14, 21, 28, 35, 42, 49, 56, 63, 70, 77, 84, 91, and 98 after administration. Animals were fasted overnight before each blood collection. Serum APOC3 protein levels were measured using a Cobas C311 fully automated biochemical analyzer (Roche Diagnostics). For standardization, the APOC3 protein level and blood lipid content of each macaque at each time point were divided by the mean pre-treatment expression level of the corresponding indicators in the group (the mean of the corresponding indicators in the pre-experimental samples of that group). Figure 8 shows the results of treating healthy cynomolgus monkeys with siRNA conjugates NO. PC, D21, and D374 to obtain the relative residual levels of APOC3 protein. PC (DAW30346) in the figure is the control. The sequence information of DAW30346 (i.e., PC) is: sense strand (5'-3') (NAG37)s(invAb)sacgggacaGfUfAfuucucaguias(invAb); antisense strand: usCfsasCfuGfagaauAfcUfgUfcCfcGfsu.
[0636] Test Example 4: Drug PK Experiment:
[0637] Animal drug administration and sample collection: Male C57BL / 6 mice aged 6-8 weeks were randomly divided into groups of 24 animals each. Mice were fasted for at least 12 hours before weighing and drug administration, and water was withheld for 1 hour before and after drug administration. Mice were given a single subcutaneous injection of the siRNA drug to be screened as shown in Table D at a dose of 3 mg / kg. Feeding was resumed 4-5 hours after drug administration. Mice were euthanized at 0.25, 0.5, 1, 3, 5, 7, 24, 48, 96, 144, 192, and 240 hours after drug administration (2 animals at each time point). At least 0.5 mL of blood was collected to prepare plasma, and corresponding liver and kidney tissues were collected to prepare tissue homogenates.
[0638] Sample processing and analysis: Take 50 μL of plasma or 30 μL of liver homogenate, add 50 μL of internal standard (concentration 5000 ng / mL) and mix well. Then add 200 μL of 10% ammonia solution (freshly prepared) and vortex to mix well. Next, add 100 μL of phenol:chloroform = 1:1, vortex to mix well, and centrifuge to collect the supernatant. Transfer 240 μL of the supernatant to a new EP tube, add 100 μL of dichloromethane, vortex to mix well, and centrifuge to collect the supernatant. Finally, analyze the sample using LC-MS / MS.
[0639] As is known in the art, the siRNA conjugate of this application is obtained by linking siRNA with a conjugate group of GalNAc or its derivative. The main function of the conjugate group is delivery. When siRNA has good activity, its corresponding siRNA conjugate can be expected to have similar activity. Those skilled in the art can select appropriate conjugate groups based on their knowledge in the art, such as GalNAc or its derivatives, such as L96 and DAW40007-4.
[0640] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of this application. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.
[0641] Although embodiments of this application have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting this application. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of this application.
Claims
1. A siRNA, characterized in that, a double-stranded region having at least partial base pairing between the sense strand and the antisense strand; wherein the antisense strand comprises a nucleotide sequence as set forth in any one of SEQ ID NO: 119, SEQ ID NO: 117, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 74, SEQ ID NO: 85, SEQ ID NO: 116, SEQ ID NO: 63 to SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71 to SEQ ID NO: 73, SEQ ID NO: 75 to SEQ ID NO: 84, SEQ ID NO: 86 to SEQ ID NO: 115, SEQ ID NO: 118, and SEQ ID NO: 120 to SEQ ID NO: 124, or a nucleotide sequence comprising at least 10 consecutive nucleotides thereof; optionally, the antisense strand comprises a nucleotide sequence as set forth in any one of SEQ ID NO: 119, SEQ ID NO: 117, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 74, SEQ ID NO: 79, SEQ ID NO: 84, SEQ ID NO: 85, and SEQ ID NO: 116, or a nucleotide sequence comprising at least 10 consecutive nucleotides thereof; optionally, the antisense strand comprises a nucleotide sequence as set forth in any one of SEQ ID NO: 119, SEQ ID NO: 117, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 74, SEQ ID NO: 84, SEQ ID NO: 85, and SEQ ID NO: 116, or a nucleotide sequence comprising at least 10 consecutive nucleotides thereof; preferably, the antisense strand comprises a nucleotide sequence as set forth in any one of SEQ ID NO: 119, SEQ ID NO: 117, SEQ ID NO: 74, SEQ ID NO: 79, SEQ ID NO: 84, and SEQ ID NO: 116, or a nucleotide sequence comprising at least 10 consecutive nucleotides thereof; Optionally, the positive chain comprises a nucleotide sequence as shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:23, SEQ ID NO:54, SEQ ID NO:1 to SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 to SEQ ID NO:11, SEQ ID NO:13 to SEQ ID NO:22, SEQ ID NO:24 to SEQ ID NO:53, SEQ ID NO:56 and SEQ ID NO:58 to SEQ ID NO:62, or a nucleotide sequence containing at least 10 consecutive nucleotides thereof; Optionally, the positive chain comprises a nucleotide sequence as shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:17, SEQ ID NO:22, SEQ ID NO:23 and SEQ ID NO:54, or a nucleotide sequence containing at least 10 consecutive nucleotides thereof; Optionally, the positive chain comprises the nucleotide sequence shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:23 and SEQ ID NO:54, or a nucleotide sequence containing at least 10 consecutive nucleotides thereof; Preferably, the positive chain comprises a nucleotide sequence as shown in any one of SEQ ID NO:57, SEQ ID NO:55, SEQ ID NO:12, SEQ ID NO:17, SEQ ID NO:22 and SEQ ID NO:54, or a nucleotide sequence containing at least 10 consecutive nucleotides thereof; Optionally, each nucleotide in the sense strand and / or antisense strand is independently a modified or unmodified nucleotide.
2. The siRNA of claim 1, wherein The siRNA also includes one or more of the following conditions: a) The double-stranded region has a length of 17-23 nucleotides, preferably 18-21 nucleotides; b) The siRNA includes the sense strand and antisense strand of any group in Table A, or differs from the sense strand and / or antisense strand by no more than 5, 4, 3, 2, or 1 nucleotides, respectively. Optionally, the siRNA comprises one of the following groups: A-1) a sense strand comprising a nucleotide sequence as shown in AAAAGGGACAGUAUUCUCAGA or a nucleotide sequence differing not more than 5, 4, 3, 2, 1 nucleotide(s) from the same and an antisense strand comprising a nucleotide sequence as shown in TCUGAGAAUACUGUCCCUUUU or a nucleotide sequence differing not more than 5, 4, 3, 2, 1 nucleotide(s) from the same; A-2) a sense strand comprising a nucleotide sequence as shown in AAAAGGGACAGUAUUCUCAGA or a nucleotide sequence differing not more than 5, 4, 3, 2, 1 nucleotide(s) from the same and an antisense strand comprising a nucleotide sequence as shown in UCUGAGAAUACUGUCCCUUUU or a nucleotide sequence differing not more than 5, 4, 3, 2, 1 nucleotide(s) from the same; A-3) a sense strand comprising a nucleotide sequence as shown in CUAAAAGGGACAGUAUUCU or a nucleotide sequence differing not more than 5, 4, 3, 2, 1 nucleotide(s) from the same and an antisense strand comprising a nucleotide sequence as shown in AGAAUACUGUCCCUUUUAG or a nucleotide sequence differing not more than 5, 4, 3, 2, 1 nucleotide(s) from the same; A-4) a sense strand comprising a nucleotide sequence as shown in AAAGGGACAGUAUUCUCAGA or a nucleotide sequence differing not more than 5, 4, 3, 2, 1 nucleotide(s) from the same and an antisense strand comprising a nucleotide sequence as shown in UCUGAGAAUACUGUCCCUUU or a nucleotide sequence differing not more than 5, 4, 3, 2, 1 nucleotide(s) from the same; A-5) a sense strand comprising a nucleotide sequence as shown in AAGGGACAGUAUUCUCAGA or a nucleotide sequence differing not more than 5, 4, 3, 2, 1 nucleotide(s) from the same and an antisense strand comprising a nucleotide sequence as shown in UCUGAGAAUACUGUCCCUU or a nucleotide sequence differing not more than 5, 4, 3, 2, 1 nucleotide(s) from the same; A-6) a sense strand comprising a nucleotide sequence as shown in CAGUAUUCUCAGUGCUCUA or a nucleotide sequence differing not more than 5, 4, 3, 2, 1 nucleotide(s) from the same and an antisense strand comprising a nucleotide sequence as shown in UAGAGCACUGAGAAUACUG or a nucleotide sequence differing not more than 5, 4, 3, 2, 1 nucleotide(s) from the same; A-7) a sense strand comprising a nucleotide sequence as shown in GCCUAAAAGGGACAGUAUUCU or a nucleotide sequence differing not more than 5, 4, 3, 2, 1 nucleotide(s) from the same and an antisense strand comprising a nucleotide sequence as shown in AGAAUACUGUCCCUUUUAGGC or a nucleotide sequence differing not more than 5, 4, 3, 2, 1 nucleotide(s) from the same; A-8) A sense strand containing a nucleotide sequence as shown in GGGACAGUAUUCUCAGUGA or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides; and an antisense strand containing a nucleotide sequence as shown in UCACUGAGAAUACUGUCCC or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides; and A-9) A sense strand containing a nucleotide sequence as shown in GGGACAGUAUUCUCAGUAA or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides, and an antisense strand containing a nucleotide sequence as shown in UUACUGAGAAUACUGUCCC or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides.
3. The siRNA according to claim 1 or 2, characterized in that, The siRNA also includes one or more of the following conditions: 1) The length of the positive strand does not exceed 23 nucleotides, preferably not more than 21 nucleotides; 2) The length of the antisense strand does not exceed 25 nucleotides, preferably not exceeding 24 nucleotides; 3) The justice chain has a 3' protruding end and / or a 5' protruding end; and / or the antisense chain has a 3' protruding end and / or a 5' protruding end; Preferably, the 3' protrusion and / or 5' protrusion comprises one or two nucleotides or analogues thereof, wherein the nucleotides of the 3' protrusion and / or 5' protrusion are each independently selected from A, U, C, G, T, dA, dU, dC, dG or dT; 4) The siRNA includes any one of the sense and antisense strands in Table B, or differs from the sense and / or antisense strands by no more than 5, 4, 3, 2, or 1 nucleotides, respectively. Optionally, the siRNA comprises one of the following groups: B-1) The sense strand contains a nucleotide sequence as shown in AAAAGGGACAGUAUUCUCAGA or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in TCUGAGAAUACUGUCCCUUUUA or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides. B-2) The sense strand contains a nucleotide sequence as shown in AAAAGGGACAGUAUUCUCAGA or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in UCUGAGAAUACUGUCCCUUUUA or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides. B-3) The sense strand contains a nucleotide sequence as shown in CUAAAAGGGACAGUAUUCU or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in AGAAUACUGUCCCUUUUAGGC or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides. B-4) The sense strand contains a nucleotide sequence as shown in AAAGGGACAGUAUUCUCAGA or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in UCUGAGAAUACUGUCCCUUUU or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides. B-5) The sense strand contains a nucleotide sequence as shown in AAGGGACAGUAUUCUCAGA or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in UCUGAGAAUACUGUCCCUUUU or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides. B-6) The sense strand contains a nucleotide sequence as shown in CAGUAUUCUCAGUGCUCUA or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in UAGAGCACUGAGAAUACUGUC or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides. B-7) The sense strand containing a nucleotide sequence as shown in GGGACAGUAUUCUCAGUGA or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides; and the antisense strand containing a nucleotide sequence as shown in UCACUGAGAAUACUGUCCCGU or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides; and B-8) A sense strand containing a nucleotide sequence as shown in GCCUAAAAGGGACAGUAUUCU or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides, and an antisense strand containing a nucleotide sequence as shown in AGAAUACUGUCCCUUUUAGGC or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides.
4. The siRNA according to any one of claims 1 to 3, wherein The siRNA includes one or more of the following conditions: 1) The sense strand and / or the antisense strand comprises at least one modified nucleotide, each of which is independently selected from at least one of the following: inverted deoxyribonucleotides, 2'-fluoro modified nucleotides, 2'-amino modified nucleotides, 2'-0-allyl modified nucleotides, 2'-C 1~25 alkyl modified nucleotides, 2'-methoxyethoxy modified nucleotides, 2'-0-C 1~25 alkyl modified nucleotides, locked nucleotides, conformationally restricted nucleotides, 2'-allyl modified nucleotides, abasic nucleotides, morpholino nucleotides, tetrahydropyranyl modified nucleotides, 1,5-anhydrohexitol modified nucleotides, cyclohexenyl modified nucleotides, PEG modified nucleotides, 5'-aminophosphoramidate modified nucleotides, phosphorothioato modified nucleotides, 5'-methylphosphonate modified nucleotides, 5'-phosphate mimic modified nucleotides, 5'-methylated cytosine modified nucleotides, non-natural base nucleotides, nucleic acid analogs; Preferably, the modified nucleotide is independently selected from at least one of InvB, InvdA, InvdT, i, If, 2'-methoxy modified nucleotide, 2'-methoxyethoxy modified nucleotide, 5'-methylcytosine modified nucleotide, 2'-fluoro modified nucleotide, 5'-(E)-VP modified nucleic acid and thiophosphate modified nucleotide; 2) The siRNA comprises (R)- and (S)-enantiomers, diastereomers, and / or racemic mixtures thereof; 3) All nucleotides in the positive strand are modified nucleotides; 4) All nucleotides in the antisense strand are modified nucleotides.
5. The siRNA according to any one of claims 1 to 4, wherein The siRNA includes one of the following conditions: 1) 2'-fluorinated nucleotides are present at the following positions: The nucleotide at the 5' end of the positive strand is at least one of the following positions: position 1, position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 10, position 11, position 12, position 13, position 14, position 15, position 16, position 17, position 18, position 19, position 20, and position 21 of the start point. And / or, the nucleotide at the 5' end of the antisense strand is at least one of the following positions: position 1, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10, position 11, position 12, position 13, position 15, position 16, position 17, position 18, position 19, position 20, position 21, position 22, position 23, and position 24 of the start site; Preferably, the 2'-fluoromodified nucleotide is located at the following position: The 5' terminal nucleotide of the sense strand is at least one of the 5th, 6th, 7th, 8th, 9th, 10th, and 11th positions of the start site; and / or, the 5' terminal nucleotide of the antisense strand is at least one of the 1st, 2nd, 3rd, 4th, 6th, 7th, 8th, 9th, 10th, 12th, 14th, 16th, 18th, and 20th positions of the start site; 2) 2'-methoxy modified nucleotides are present at the following positions: The nucleotide at the 5' end of the positive strand is at least one of the following positions: position 1, position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 10, position 11, position 12, position 13, position 14, position 15, position 16, position 17, position 18, position 19, position 20, and position 21 of the start point. And / or, the nucleotide at the 5' end of the antisense strand is at least one of the following positions: position 1, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10, position 11, position 12, position 13, position 15, position 16, position 17, position 18, position 19, position 20, position 21, position 22, position 23, and position 24 of the start site; 3) 2'-methoxyethyl modified nucleotides are present at the following positions: The nucleotide at the 5' end of the positive strand is at least one of the following positions: position 1, position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 10, position 11, position 12, position 13, position 14, position 15, position 16, position 17, position 18, position 19, position 20, and position 21 of the start point. And / or, the nucleotide at the 5' end of the antisense strand is at least one of the following positions: position 1, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10, position 11, position 12, position 13, position 15, position 16, position 17, position 18, position 19, position 20, position 21, position 22, position 23, and position 24 of the start site; Preferably, the 2'-methoxyethyl modified nucleotide is present at the following position: The nucleotide at the 5' end of the sense strand is at least one of the first and second positions of the start point, and / or the nucleotide at the 3' end of the sense strand is the first position of the start point; and / or the nucleotide at the 5' end of the antisense strand is the first position of the start point; 4) Nucleotides modified with thiophosphate groups are present at the following positions: The nucleotide at the 5' end of the positive strand is at least one of the following: between position 1 and position 2, between position 2 and position 3, between position 3 and position 4, between position 4 and position 5, between position 5 and position 6, between position 6 and position 7, between position 7 and position 8, between position 8 and position 9, between position 9 and position 10, between position 10 and position 11, between position 11 and position 12, between position 12 and position 13, between position 13 and position 14, between position 14 and position 15, between position 15 and position 16, between position 17 and position 18, between position 18 and position 19, between position 19 and position 20, and between position 20 and position 21. And / or, the 5' terminal nucleotide of the antisense strand is at least one of the following: between position 1 and position 2, between position 2 and position 3, between position 3 and position 4, between position 4 and position 5, between position 5 and position 6, between position 6 and position 7, between position 7 and position 8, between position 8 and position 9, between position 9 and position 10, between position 10 and position 11, between position 11 and position 12, between position 12 and position 13, between position 13 and position 14, between position 14 and position 15, between position 15 and position 16, between position 17 and position 18, between position 18 and position 19, between position 19 and position 20, between position 20 and position 21, between position 21 and position 22, between position 22 and position 23, and between position 23 and position 24. Preferably, the nucleotide modified with a thiophosphate group is present at the following position: The nucleotide at the 5' end of the positive strand is at least one of the following: between the first and second positions of the start point, and between the second and third positions. And / or, the nucleotide at the 3' end of the antisense strand is at least one of the positions between the 1st and 2nd positions and between the 2nd and 3rd positions of the start point; And / or, the nucleotide at the 5' end of the antisense strand is at least one of the positions between the 1st and 2nd positions and between the 2nd and 3rd positions of the start point, and / or the nucleotide at the 3' end of the antisense strand is at least one of the positions between the 1st and 2nd positions and between the 2nd and 3rd positions of the start point; 5) The 3' end and / or 5' end of the justice chain are connected to one or more InvBs; Preferably, the InvB is attached to the 3' end and / or 5' end of the positive chain via a thiophosphate group; 6) The nucleotide at the 3' end of the sense strand is InvdA, or the nucleotide at the 3' end of the sense strand is InvdT; 7) The thiophosphate groups in the siRNA include (R)- and (S)-enantiomers, diastereomers, and / or racemic mixtures thereof; 8) The 5'-(E)-VP modified nucleic acid is located at the 5' end of the sense strand or the 5' end of the antisense strand; preferably, the 5'-(E)-VP modified nucleic acid is located at the 5' end of the antisense strand.
6. The siRNA according to any one of claims 1 to 5, wherein The siRNA includes the sense and antisense strands of any group in Table C-1 or Table C-2, or differs from the sense and / or antisense strands by no more than 5, 4, 3, 2, or 1 nucleotides. Optionally, the siRNA comprises one of the following groups: C-1) The sense strand containing a nucleotide sequence as shown in InvBsAesaaaggGfaCfAfGfuauucucagsa or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand containing a nucleotide sequence as shown in TesCfsUfgagAfauacugUfcCfcuuususa or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides; C-2) The sense strand contains a nucleotide sequence as shown in InvBsAesaaaggGfaCfAfGfuauucucagsa or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides; and the antisense strand contains a nucleotide sequence as shown in vusCfsUfgagAfauacugUfcCfcuuususa or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides. C-3) The sense strand contains a nucleotide sequence as shown in InvBcsusaaaaGfgIfacaguauucsu or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in vasGfsAfauAfcugucccUfuUfuagsgsc or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides. C-4) The sense strand contains a nucleotide sequence as shown in InvBsAesaagggAfcAfGfUfauucucagsa or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides; and the antisense strand contains a nucleotide sequence as shown in vusCfsugagAfauacugUfcCfcuususu or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides. C-5) The sense strand contains a nucleotide sequence as shown in InvBsasagggaCfaGfUfAfuucucagsa or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in vusCfsugaGfaauacugUfcCfcuususu or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides. C-6) The sense strand contains a nucleotide sequence as shown in InvBscsaguauUfcUfCfAfgugcucusa or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides; and the antisense strand contains a nucleotide sequence as shown in vusAfsgagCfacugagaAfuAfcugsusc or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides. C-7) The sense strand contains a nucleotide sequence as shown in InvBsgsccuaaaaGfGfIfacaguauucsu or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides; and the antisense strand contains a nucleotide sequence as shown in vasGfsAfauAfcugucccUfuUfuagsgsc or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides. C-8) The sense strand contains a nucleotide sequence as shown in InvBsgsggacaGfUfAfuucucaguisa or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in vusCfsacugagaauacUfgucccsgsu or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides. C-9) The sense strand contains a nucleotide sequence as shown in InvBsgsccuaaaaGfGfIfacaguauucsu or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides; and the antisense strand contains a nucleotide sequence as shown in asGfsAfauAfcugucccUfuUfuagsgsc or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides. C-10) The sense strand contains a nucleotide sequence as shown in InvBscsaguauUfcUfCfAfgugcucusa or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides; and the antisense strand contains a nucleotide sequence as shown in usAfsgagCfacugagaAfuAfcugsusc or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides. C-11) A sense strand containing a nucleotide sequence as shown in InvBsasagggaCfaGfUfAfuucucagsa or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides, and an antisense strand containing a nucleotide sequence as shown in usCfsugaGfaauacugUfcCfcuususu or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides. C-12) The sense strand contains a nucleotide sequence as shown in InvBcsusaaaaGfgIfacaguauucsu or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in asGfsAfauAfcugucccUfuUfuagsgsc or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides. C-13) A sense strand containing a nucleotide sequence as shown in InvBsAesaagggAfcAfGfUfauucucagsa or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides; and an antisense strand containing a nucleotide sequence as shown in UfsCfsugagAfauacugUfcCfcuususu or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides; and C-14) A sense strand containing a nucleotide sequence as shown in InvBsgsggacaGfUfAfuucucaguisa or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides, and an antisense strand containing a nucleotide sequence as shown in usCfsacugagaauacUfgucccsgsu or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides.
7. An siRNA conjugate or a salt thereof, characterized by include: The siRNA according to any one of claims 1 to 6, and the ligand conjugated to the siRNA.
8. The siRNA conjugate or salt thereof according to claim 7, characterized by One or more of the following conditions must be met: 1) The ligand may be one or more; 2) The ligand is conjugated to the sense and / or antisense strands of the siRNA; 3) The ligand is conjugated to the 3' end of the sense strand and / or the 3' end of the antisense strand of the siRNA via a thiophosphate or phosphate ester, or the ligand is conjugated to the 5' end of the sense strand and / or the 5' end of the antisense strand of the siRNA via a thiophosphate or phosphate ester; preferably, the ligand is conjugated to the 3' end of the sense strand and / or the 3' end of the antisense strand of the siRNA via a thiophosphate ester. 4) the ligand has one or more of the following structures: wherein This indicates the junction point between the ligand and the siRNA; 5) The siRNA conjugate or its salts include (R)- and (S)-enantiomers, diastereomers, and / or racemic mixtures thereof.
9. The siRNA conjugate or salt thereof according to claim 7, characterized by One or more of the following conditions must be met: 1) The thiophosphate groups in the siRNA conjugate or its salt include (R)- and (S)-enantiomers, diastereomers, and / or racemic mixtures thereof; 2) The siRNA conjugate includes the sense strand and antisense strand of any group in Table D, or differs from the sense strand and / or antisense strand by no more than 5, 4, 3, 2, or 1 nucleotides; Optionally, the siRNA conjugate or its salt comprises one of the following: D-1) The sense strand containing a nucleotide sequence as shown in InvBsAesaaaggGfaCfAfGfuauucucagsasL96 or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand containing a nucleotide sequence as shown in TesCfsUfgagAfauacugUfcCfcuuususa or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides; D-2) The sense strand containing a nucleotide sequence as shown in InvBsAesaaaggGfaCfAfGfuauucucagsasL96 or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand containing a nucleotide sequence as shown in vusCfsUfgagAfauacugUfcCfcuuususa or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides; D-3) The sense strand contains a nucleotide sequence as shown in InvBcsusaaaaGfgIfacaguauucsusL96 or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in vasGfsAfauAfcugucccUfuUfuagsgsc or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides. D-4) A sense strand containing a nucleotide sequence as shown in InvBsAesaagggAfcAfGfUfauucucagsasL96 or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides, and an antisense strand containing a nucleotide sequence as shown in vusCfsugagAfauacugUfcCfcuususu or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides. D-5) The sense strand containing the nucleotide sequence shown in InvBsasagggaCfaGfUfAfuucucagsasL96 or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand containing the nucleotide sequence shown in vusCfsugaGfaauacugUfcCfcuususu or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides; D-6) The sense strand contains a nucleotide sequence as shown in InvBscsaguauUfcUfCfAfgugcucusasL96 or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in vusAfsgagCfacugagaAfuAfcugsusc or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides. D-7) The sense strand contains a nucleotide sequence as shown in InvBsgsccuaaaaGfGfIfacaguauucsusL96 or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in vasGfsAfauAfcugucccUfuUfuagsgsc or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides. D-8) The sense strand contains a nucleotide sequence as shown in InvBsgsggacaGfUfAfuucucaguisasL96 or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in vusCfsacugagaauacUfgucccsgsu or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides. D-9) The sense strand contains a nucleotide sequence as shown in InvBsgsccuaaaaGfGfIfacaguauucsusL96 or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in asGfsAfauAfcugucccUfuUfuagsgsc or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides. D-10) The sense strand contains a nucleotide sequence as shown in InvBscsaguauUfcUfCfAfgugcucusasL96 or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in usAfsgagCfacugagaAfuAfcugsusc or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides. D-11) A sense strand containing a nucleotide sequence as shown in InvBsasagggaCfaGfUfAfuucucagsasL96 or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides, and an antisense strand containing a nucleotide sequence as shown in usCfsugaGfaauacugUfcCfcuususu or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides. D-12) The sense strand contains a nucleotide sequence as shown in InvBcsusaaaaGfgIfacaguauucsusL96 or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides, and the antisense strand contains a nucleotide sequence as shown in asGfsAfauAfcugucccUfuUfuagsgsc or a nucleotide sequence that differs from it by no more than 5, 4, 3, 2, or 1 nucleotides. D-13) A sense strand containing a nucleotide sequence as shown in InvBsAesaagggAfcAfGfUfauucucagsasL96 or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides; and an antisense strand containing a nucleotide sequence as shown in UfsCfsugagAfauacugUfcCfcuususu or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides; and D-14) A sense strand containing a nucleotide sequence as shown in InvBsgsggacaGfUfAfuucucaguisasL96 or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides, and an antisense strand containing a nucleotide sequence as shown in usCfsacugagaauacUfgucccsgsu or a nucleotide sequence differing from it by no more than 5, 4, 3, 2, or 1 nucleotides.
10. A pharmaceutical composition, characterized by, include: The siRNA according to any one of claims 1 to 6 or the siRNA conjugate or salt thereof according to any one of claims 7 to 9; as well as Optional pharmaceutically acceptable carrier.
11. Use of the siRNA according to any one of claims 1 to 6, the siRNA conjugate or salt thereof according to any one of claims 7 to 9, or the pharmaceutical composition according to claim 10, wherein the use includes at least one of the following: Inhibit the expression or activity of the APOC3 gene; To prepare drugs for inhibiting the expression or activity of the APOC3 gene; To prepare drugs for the prevention and / or treatment of APOC3-related diseases; Prevention and / or treatment of APOC3-related diseases.
12. Use according to claim 11, characterized in that, The APOC3-related diseases are hypertriglyceridemia, obesity, dyslipidemia, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, cardiovascular disease, coronary artery disease, hypertriglyceridemia-induced pancreatitis, metabolic syndrome, type II diabetes, familial chylomicronemia syndrome, chylomicronemia, multifactorial chylomicronemia, lipodystrophy syndrome, or familial partial lipodystrophy.
13. A method for preventing and / or treating APOC3-related diseases, the method comprising using the siRNA of any one of claims 1 to 6, the siRNA conjugate of any one of claims 7 to 9 or a salt thereof, or the pharmaceutical composition of claim 10.
14. The method according to claim 13, wherein the APOC3-related disease is hypertriglyceridemia, obesity, dyslipidemia, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, cardiovascular disease, coronary artery disease, hypertriglyceridemia-induced pancreatitis, metabolic syndrome, type II diabetes, familial chylomicronemia syndrome, chylomicronemia, multifactorial chylomicronemia, lipodystrophy syndrome, or familial partial lipodystrophy.
15. The siRNA according to any one of claims 1 to 6, the siRNA conjugate or salt thereof according to any one of claims 7 to 9, or the pharmaceutical composition according to claim 10, for the prevention and / or treatment of APOC3-related diseases.
16. The siRNA, conjugate or salt thereof, or pharmaceutical composition according to claim 15, wherein the APOC3-related disease is hypertriglyceridemia, obesity, dyslipidemia, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, cardiovascular disease, coronary artery disease, hypertriglyceridemia-induced pancreatitis, metabolic syndrome, type II diabetes, familial chylomicronemia syndrome, chylomicronemia, multifactorial chylomicronemia, lipodystrophy syndrome, or familial partial lipodystrophy.