A detection method

WO2026190348A1PCT designated stage Publication Date: 2026-09-17BELGIAN VOLITION SRL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2026/057128
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-03-13
Filing Date
2026-03-13
Publication Date
2026-09-17

Smart Images

  • Figure EP2026057128_17092026_PF_FP_ABST
    Figure EP2026057128_17092026_PF_FP_ABST
Patent Text Reader

Abstract

The invention relates to methods for assessing the performance of an assay which detects a nucleosome, a histone associated with a nucleosome or DNA associated with a nucleosome, using a control material that comprises a polynucleosome comprising four or more repeating units. The present invention also relates to recombinant polynucleosomes, particularly but not exclusively for use in the methods of the invention, and also to kits containing such polynucleosomes.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] VOL-C-P3866PCT

[0002] A DETECTION METHOD

[0003] TECHNICAL FIELD

[0004] The present invention relates to a method for assessing the performance of an assay which detects a nucleosome or a histone or DNA associated with a nucleosome. The present invention also relates to a method for quantifying the amount of a nucleosome or a histone or DNA associated with a nucleosome. The present invention also relates to a polynucleosome, particularly but not exclusively for use in the methods of the invention, and also to kits containing such polynucleosomes.

[0005] BACKGROUND OF THE INVENTION

[0006] The DNA of eukaryotic organisms is packaged as chromatin such that it can be contained within the nucleus and facilitate epigenetic regulation. The nucleosome is the basic repeating unit of chromatin structure. Nucleosomes play a key role in dictating the accessibility of the eukaryotic genome and are involved in the regulation of DNA transcription, replication and repair. A nucleosome consists of a protein complex of eight highly conserved core histones (comprising of a pair of each of the histones H2A, H2B, H3, and H4). Around this complex is wrapped approximately 147 base pairs (bp) of DNA. Another histone, H1 or H5, acts as a linker and is involved in chromatin compaction. The DNA is wound around consecutive nucleosomes connected by additional linker DNA, or regions of nucleosome depletion, in a structure often said to resemble “beads on a string” and this forms the basic structure of open or euchromatin. In compacted or heterochromatin this string is coiled and super coiled into a closed and complex structure.

[0007] Changes in chromatin structure and function regulate diverse cellular activities include gene expression, DNA repair, chromosome transmission and cellular differentiation. These processes are mediated in part by reversible histone post-translational modifications (PTMs), such as lysine or arginine methylation or acetylation.

[0008] Several methods have been developed for the detection of nucleosomes and histone PTMs from biological samples most of which rely on the use of antibodies (e.g. Chromatin ImmunoPrecipitation - ChIP, or ELISA) to quantify histone or DNA modification from biological samples, with specific assays developed to directly quantify modifications on histones of nucleosomes using various antibody capture approaches.VOL-C-P3866PCT

[0009] When cancer is present, nucleosomes originating from cancer cells enter the bloodstream. They can be captured using antibodies tailored specifically to detect nucleosomes. Such tests quantify these circulating nucleosome levels in the blood.

[0010] Nucleosome-based detection can be superior to histone-based because nucleosome-based methods do not require acid-extraction steps, which are laborious and introduce variability. Nucleosome-based assays also allow quantification of combinatorial modification in trans (e.g. histone-histone, DNA-DNA or histone-DNA combinations) which is impossible to monitor using histone subunits or DNA alone.

[0011] Despite significant advantages, conventional nucleosome-based assays lack proper controls which match the natural environment. The use of purified exogenous chromatin preparations can introduce a range of problems, as these regents are poorly defined (at the PTM-specific level) and show batch variability, limiting their use for assay normalization (across experiment or even laboratories). In addition, it is difficult to determine if combinations of marks are really present on the same nucleosome rather than just present in the total pool.

[0012] Recombinant mononucleosome preparations consist of a single homogeneous nucleosome species comprising a combination of 4 pairs of histone molecules, with an identical histone isoform and histone PTM composition, bound to an oligonucleotide of defined base pair sequence and length (for example 147 base pairs). Atypical recombinant mononucleosome contains no histone PTMs if used as a calibrant in immunoassays for unmodified nucleosomes or a single PTM if used as a calibrant for nucleosome immunoassays containing that PTM. They typically contain no further chromatin proteins. In principle recombinant mononucleosomes could be ideal calibrant materials for use in comparative assays for nucleosomes containing a particular epigenetic structure or feature, such as a particular histone PTM or isoform, because they are a known single moiety containing the epigenetic structure of interest. However, there have been reports of recombinant mononucleosome preparations not reflecting the natural situation.

[0013] Thus, there is a need for improved controls for nucleosome-based assays in biological samples.VOL-C-P3866PCT

[0014] SUMMARY OF INVENTION

[0015] According to a first aspect of the invention, there is provided a method for assessing the performance of an assay which detects a nucleosome, a histone associated with a nucleosome or DNA associated with a nucleosome, comprising the steps of:

[0016] a) preparing a sample containing a known concentration of a control material, wherein the control material comprises a polynucleosome comprising four or more repeating units;

[0017] b) performing the assay on the sample prepared in step (a); and

[0018] c) assessing the performance of the assay by comparing the results obtained by performing step (b) against the known concentration of the control material.

[0019] According to a further aspect of the invention, there is provided a method for quantifying the amount of a nucleosome, a histone associated with a nucleosome or DNA associated with a nucleosome, in a sample, comprising the steps of:

[0020] a) performing an assay which detects a nucleosome, a histone associated with a nucleosome or DNA associated with a nucleosome; and

[0021] b) quantifying the amount of nucleosome, histone associated with the nucleosome or DNA associated with the nucleosome in the sample by comparing the result obtained in step (a) against the result obtained from performing the assay on a sample containing a known concentration of a control material, wherein the control material comprises a polynucleosome comprising four or more repeating units.

[0022] According to a further aspect of the invention, there is provided a method for quantifying the amount of a nucleosome, a histone associated with a nucleosome or DNA associated with a nucleosome, in a sample, the method comprising:

[0023] a) providing a control material at various concentrations to create a reference standard, wherein the control material comprises a polynucleosome comprising four or more repeating units;

[0024] b) adding a binding agent to a sample to perform an assay to measure the amount of nucleosome, histone associated with the nucleosome or DNA associated with the nucleosome, in the sample; and

[0025] c) quantifying the amount of nucleosome, or histone associated with the nucleosome or DNA associated with the nucleosome in the sample by measuring the amount of binding agent in the sample and comparing the amount to the reference standard.VOL-C-P3866PCT

[0026] According to a further aspect of the invention, there is provided a method for the measurement of the amount or concentration of nucleosomes, a histone associated with a nucleosome or DNA associated with a nucleosome, in a sample, the method comprising:

[0027] a) contacting a sample with a binding agent to the nucleosomes, histone or DNA; b) measuring a parameter or degree of binding of the binding agent to the nucleosome, histone or DNA, using an instrument adapted for conducting the measurement;

[0028] c) comparing the parameter or degree of binding obtained in step (b) with standardisation data and;

[0029] d) using the comparison in step (c) to convert the parameter or degree of binding measured in step (b) into an amount or concentration of nucleosomes, histone or DNA present in the sample based on a known amount or concentration of a control material, wherein the control material comprises a polynucleosome comprising four or more repeating units.

[0030] According to a further aspect of the invention, there is provided a method for assessing the performance of a DNA sequencing assay which detects a target endogenous nucleotide sequence, comprising the steps of:

[0031] a) preparing a sample comprising a known concentration of a control material, wherein the control material comprises a polynucleosome having four or more repeating units, wherein the polynucleosome comprises the target endogenous nucleotide sequence or a fragment thereof;

[0032] b) performing the DNA sequencing assay on the sample prepared in step (a); and c) assessing the performance of the DNA sequencing assay by comparing the results obtained by performing step (b) against the known concentration of the control material.

[0033] According to a further aspect of the invention, there is provided a method for the analysis of DNA in a sample, wherein said analysis is calibrated using a control material comprising a polynucleosome comprising four or more repeating units, wherein the polynucleosome comprises a target endogenous nucleotide sequence, optionally wherein the target endogenous nucleotide sequence comprises a mutation associated with increased risk of cancer.

[0034] According to a further aspect of the invention, there is provided a method of screening for an agent suitable for modifying the epigenetic status of one or more nucleosome modifications from a biological sample of a subject, the method comprising determining the quantity orVOL-C-P3866PCT

[0035] concentration of one or more nucleosome modifications in the presence and absence of the agent, wherein determining the quantity or concentration of the one or more nucleosome modifications comprises:

[0036] a) providing a sample, such as an isolated biological sample from a subject, comprising nucleosomes;

[0037] b) providing a control material at various concentrations to create a polynucleosome reference standard, wherein the control material comprises a polynucleosome comprising four or more repeating units and the one or more nucleosome modifications to be quantified;

[0038] c) adding one or more binding agents to the sample and the polynucleosome reference standard, wherein the binding agent targets the one or more nucleosome modifications;

[0039] d) performing an affinity reagent-based assay to measure the quantity or concentration of the one or more nucleosome modifications in the sample and the polynucleosome reference standard; and

[0040] e) quantifying the abundance of the one or more nucleosome modifications by comparing the relative abundance in the sample to the polynucleosome reference standard; wherein a change in quantity or concentration of the one or more nucleosome modifications in the presence and absence of the agent identifies an agent that modifies the epigenetic status.

[0041] According to a further aspect of the invention, there is provided a method of determining the specificity of a detection reagent for a core histone and / or DNA modification target epitope, comprising using a control material comprising a polynucleosome comprising four or more repeating units and comprising the core histone and / or DNA modification target epitope.

[0042] BRIEF DESCRIPTION OF DRAWINGS

[0043] FIGURE 1 is (A) a chromatogram graph obtained after Anion exchange chromatography low NaCL gradient 0.5mM / mL and flow rate 0.25mL / min. Two separated completely peaks were observed. (B) Agarose gel electrophoresis picture obtained after Anion exchange chromatography using low NaCL gradient 0.5mM / mL and flow rate 0.25mL / min. The control line (CTL) is a double digest of the pGEMT-TETRA-DNA vector. The 1st peak contains the TETRA DNA and 2nd one the plasmid.

[0044] FIGURE 2 is (A) TBE gel electrophoresis showing tetranucleosomes conformation and (B) Functional assay results on H3.1 ChLIA i10 assay.VOL-C-P3866PCT

[0045] FIGURE 3 is a tetranucleosomes freeze-dried standard curve obtained from an accelerated stability study (A) at 2-8°C, (B) at 25°C and (C) at 37°C.

[0046] FIGURE 4 is a standard curve depicting the tetranucleosomes similarity to a native nucleosome.

[0047] DETAILED DESCRIPTION OF THE INVENTION

[0048] Immunoassays typically function by measuring the degree of antibody binding to an analyte and using this as a measure of the amount of analyte present. The degree of antibody binding is typically determined by labelling either the antibody or the antigen with a detectable tracer including for example, without limitation, a radioactive, colorimetric, chemiluminescent or fluorescent moiety which will give an assay output signal in radioactive counts, optical density (OD), relative light units (RLU) or fluorescence intensity respectively.

[0049] However, the immunoassay output signal is not a direct measurement of the amount or concentration of the analyte present in a test sample. In order to transform the assay output signal into a measure of concentration, for example in g / L or mol / L units, the signal is compared to that of a calibrant, or a series of calibrants, of known analyte concentration. The concentration of any test sample can then be determined by comparing the assay output signal observed for the test sample, to that observed for a calibrant that produces the same assay output signal in the immunoassay. In most cases a calibration curve, also often called a standard curve, is produced and the concentration of the sample is interpolated from the calibration curve. Thus, in order to provide a quantitative result, an immunoassay requires a calibrant to be used as a comparator and quantitative immunoassay kits usually include such a calibrant or a series of calibrants.

[0050] The present invention relates to the use of polynucleosomes comprising four or more repeating units (also referred to for ease of reference in context as "polynucleosomes") as inter alia quantification standards for calibration. The polynucleosomes are used as part of a “control material” to prepare calibrants (or standards) which can be used to assess the performance of a nucleosome assay or quantify nucleosome analytes. In one embodiment the polynucleosomes carry one or more nucleosome modifications, such as histone and / or DNA modifications. In this embodiment, the control material is used to quantify the amount of one or more nucleosome modifications in a sample.VOL-C-P3866PCT

[0051] The polynucleosomes may be assayed to generate a standard curve for assay quantification, also referred to herein as a “reference standard” or “polynucleosome reference standard”. This standard curve can be used to determine the amount (e.g. quantity, level or concentration) of the nucleosome or histone or DNA associated with a nucleosome in a sample. References herein to “histone associated with a nucleosome” refer to histones and modifications thereof, as described herein (e.g. post-translational modifications, mutations, isoforms, variants and fragments of histones, such as clipped histones). Therefore, in one embodiment the standard curve can be used to determine the amount or concentration of one or more histone modifications, such as histone post-translational modifications, in the sample.

[0052] Thus, according to one aspect of the invention there is provided a method for assessing the performance of an assay which detects a nucleosome, a histone associated with a nucleosome or DNA associated with a nucleosome in a (e.g. biological) sample, comprising the steps of:

[0053] (a) preparing a sample containing a known concentration of a control material, wherein the control material comprises a polynucleosome comprising four or more repeating units;

[0054] (b) performing the assay on the sample prepared in step (a); and

[0055] (c) assessing the performance of the assay by comparing the results obtained by performing step (b) against the known concentration of the control material.

[0056] According to another aspect of the invention there is provided a method for quantifying the amount of a nucleosome, a histone associated with a nucleosome or DNA associated with a nucleosome in a (e.g. biological) sample, comprising the steps of:

[0057] (a) performing an assay which detects a nucleosome, a histone associated with a nucleosome or DNA associated with a nucleosome; and

[0058] (b) quantifying the amount of nucleosome, histone associated with the nucleosome or DNA associated with the nucleosome in the sample by comparing the result obtained in step (a) against the result obtained from performing the assay on a sample containing a known concentration of a control material, wherein the control material comprises a polynucleosome comprising four or more repeating units.

[0059] According to another aspect of the present invention there is provided a method for quantifying the amount of a nucleosome, a histone associated with a nucleosome or DNA associated with a nucleosome in a (e.g. biological) sample, the method comprising:

[0060] (a) providing a control material at various concentrations to create a reference standard, wherein the control material comprises a polynucleosome comprising four or more repeating units;VOL-C-P3866PCT

[0061] (b) adding a binding agent to a sample to perform an assay to measure the amount of nucleosome, histone associated with the nucleosome or DNA associated with the nucleosome, in the sample; and

[0062] (c) quantifying the amount of nucleosome, histone associated with the nucleosome or DNA associated with the nucleosome in the sample by measuring the amount of binding agent bound in the sample and comparing the amount to the reference standard.

[0063] According to another aspect of the invention there is provided a method for the measurement of the amount or concentration of nucleosomes, a histone associated with nucleosomes or DNA associated with nucleosomes in a sample, the method comprising:

[0064] (a) contacting a sample with a binding agent to the nucleosomes, histone or DNA; (b) measuring a parameter or degree of binding of the binding agent to the nucleosome, histone or DNA, using an instrument adapted for conducting the measurement;

[0065] (c) comparing the parameter or degree of binding obtained in step (b) with standardisation data; and

[0066] (d) using the comparison in step (c) to convert the parameter or degree of binding measured in step (b) into an amount or concentration of nucleosomes, histone or DNA present in the sample based on a known amount or concentration of a control material, wherein the control material comprises a polynucleosome comprising four or more repeating units.

[0067] In one embodiment, the method comprises:

[0068] (i) obtaining a sample of a biological fluid;

[0069] (ii) contacting the sample with a binding agent to the nucleosomes;

[0070] (iii) measuring a parameter or degree of nucleosome binding of the binding agent to the nucleosome using an instrument adapted for conducting the measurement; (iv) comparing the parameter or degree of nucleosome binding obtained in step (iii) with standardisation data; and

[0071] (v) using the comparison in step (iv) to convert the parameter or degree of nucleosome binding measured in step (iii) into an amount or concentration of nucleosome present in the sample based on a known amount or concentration of a control material which comprises a polynucleosome comprising for our more repeating units.

[0072] It will be understood that the standardisation data is obtained using the known amount or concentration of nucleosomes, histones or DNA present in the control material. For example, the standardisation data could comprise a reference standard, i.e. wherein the control material is provided at various concentrations to create the reference standard.VOL-C-P3866PCT

[0073] In one embodiment the polynucleosome useful in the methods of the invention may be a recombinant I semi-synthetic I designer polynucleosome (hereinafter referred to as a “recombinant polynucleosome”) carrying histone and / or DNA modifications. Recombinant polynucleosomes are formed by biotechnological methods (i.e. a result of human intervention), but may be a naturally occurring or non-naturally occurring (e.g. a variant, a mutant, etc.) polynucleosome.

[0074] According to a further aspect of the invention, there is provided an isolated polynucleosome comprising four or more repeating units. A polynucleosome is “isolated” when purified away from other cellular components or other contaminants, e.g., other cellular nucleic acids or proteins, by standard techniques.

[0075] According to one embodiment the recombinant polynucleosome comprises an endogenous nucleotide sequence, optionally wherein the endogenous nucleotide sequence comprises a mutation associated with increased risk of cancer. Although in another embodiment the polynucleosomes may comprise a model nucleotide sequence such as a Widom sequence. In another embodiment the polynucleosome may be a biologically derived polynucleosome.

[0076] The Nucleosome: The Unit of Chromatin

[0077] The basic repeating structural (and functional) unit of chromatin is the nucleosome, which contains eight histone proteins and about 146 base pairs of DNA. The observation by electron microscopists that chromatin appeared similar to beads on a string provided an early clue that nucleosomes exist (Olins and Olins, 1974; Woodcock et al., 1976). Another clue came from chemically cross-linking (i.e., joining) histones in chromatin (Thomas & Kornberg, 1975). This experiment demonstrated that H2A, H2B, H3, and H4 form a discrete protein octamer, which is fully consistent with the presence of a repeating histone-containing unit in the chromatin fiber.

[0078] Today, researchers know that nucleosomes are structured as follows: two of each of the histones H2A, H2B, H3, and H4 come together to form a histone octamer, which binds and wraps approximately 1.7 turns of DNA, or about 146 base pairs. The addition of one H1 protein wraps another 20 base pairs, i.e. giving 166 base pairs, resulting in two full turns around the octamer, and forming a structure called a chromatosome. Therefore, every chromosome contains hundreds of thousands of nucleosomes, and these nucleosomes are joined by the DNA that runs between them (an average of about 20 base pairs). This joiningVOL-C-P3866PCT

[0079] DNA is referred to as linker DNA. Histone H5 performs the same function as H1 and replaces histone H1 in certain cells. Each chromosome is thus a long chain of nucleosomes, which gives the appearance of a string of beads when viewed using an electron microscope.

[0080] The amount of DNA per nucleosome was determined by treating chromatin with an enzyme that cuts DNA (such enzymes are called DNases). One such enzyme, micrococcal nuclease (MNase), has the important property of preferentially cutting the linker DNA between nucleosomes well before it cuts the DNA that is wrapped around octamers. By regulating the amount of cutting that occurs after application of MNase, it is possible to stop the reaction before every linker DNA has been cleaved. At this point, the treated chromatin will consist of mononucleosomes, dinucleosomes (connected by linker DNA), trinucleosomes, tetranucleosomes, pentanucleosomes and so forth. In one embodiment this method can be used to prepare polynucleosomes of four or more repeating units according to the present invention. If DNA from MNase-treated chromatin is then separated on a gel, a number of bands will appear, each having a length that is a multiple of mononucleosomal DNA. The simplest explanation for this observation is that chromatin possesses a fundamental repeating structure. When this was considered together with data from electron microscopy and chemical cross-linking of histones, the "subunit theory" of chromatin (Kornberg, 1974; Van Holde et al., 1974) was adopted. The subunits were later named nucleosomes and were eventually crystallized. The present invention makes use of polynucleosomes having four or more of such repeating units, also known as “subunits”.

[0081] The repeating unit may be one which includes or excludes a linker histone such as H1 or H5. The repeating unit may be one which comprises about 146 base pairs of DNA or about 166 base pairs of DNA on average.

[0082] In one embodiment the polynucleosome of the present invention is a fragment of chromatin. In one embodiment the polynucleosome has 10 or from 4 up to 10 repeating units. In a further embodiment, the polynucleosome has between 3 and 10 repeating units, such as between 3 and 9, 3 and 8, 3 and 7, 3 and 6, 3 and 5, 3 and 4, 4 and 10, 4 and 9, 4 and 8, 4 and 7, 4 and 6 or 4 and 5 repeating units. In a particular embodiment, the polynucleosome has between 4 and 10 repeating units.

[0083] In a preferred embodiment the present invention employs a tetranucleosome (i.e. four repeating units). In other embodiments the present invention employs a polynucleosome comprising 5, 6, 7, 8, 9, 10 or more repeating units of a nucleosome.VOL-C-P3866PCT

[0084] The packaging of genomic DNA into chromatin plays a critical role in gene regulation. The tetranucleosome-on-a-string appears as a stable secondary structure during hierarchical organisation of chromatin fibers. The stability of the tetranucleosomal unit is attenuated by the histone chaperone, FACT (facilitates chromatin transcription), in vitro. Consistent with in vitro observations, genome-wide analysis further shows that FACT facilitates gene transcription by destabilising the tetranucleosomal unit of chromatin fibers in yeast. Additionally, it was found that the linker histone H1 not only enhances the stability but also facilitates the folding and unfolding kinetics of the outer nucleosomal wrap. It has been demonstrated that the tetranucleosome is a regulatory structural unit of chromatin fibers beyond the nucleosome.

[0085] Tetranucleosomes are proposed to be functional and structural units that regulate gene expression. They have been crystallizable at nucleosome repeat unit lengths of 157 and 167 bp and observed in longer chromatin fibers of 12 tandem repeats of 177 and 187 bp. Structural analysis of tetranucleosomes from cell lines have shown that they can adopt different stacking configurations which are dependent on DNA linker length.

[0086] Recombinant nucleosomes

[0087] As stated above the present invention may employ recombinant polynucleosomes of 4 or more repeating units, or a combination of polynucleosomes each with 4 or more repeating units. Recombinant polynucleosomes are chemically synthesised nucleoproteins. Methods for the preparation of recombinant polynucleosomes are known in the art and typically, involve the production of the individual recombinant core histones, chemically assembling the individual histones into histone octamers and binding the octamers to suitable lengths of DNA to form recombinant polynucleosomes (Dyer et al., 2004). Typically, recombinant polynucleosomes are pure single molecular complexes comprising a single histone isoform combination and are also uniform in terms of their post-translational histone modification composition. Thus, in one embodiment, the present invention relates to the use of recombinant / semi-synthetic polynucleosomes carrying one or more histone and / or DNA modifications. Such polynucleosomes may be used as standards for assay quantification as described herein, optionally in a pre-calibration step.

[0088] As used herein, a recombinant nucleosome (also called a designer nucleosome (dNuc)) is one that has been prepared by bringing together histones (including the core histones H2A, H2B, H3, and H4, and optionally linker histone H1), DNA, and optionally other factors to form the nucleosome. The polynucleosome is formed by connecting four or more recombinantVOL-C-P3866PCT

[0089] nucleosomes (i.e. repeating units). In other words, a recombinant polynucleosome is one that is synthesized, not isolated from cells or chromatin. Each histone in the polynucleosome may be independently fully synthetic, semi-synthetic (e.g., recombinantly produced and ligated to a synthetic peptide), or recombinantly produced. One or more histones in the nucleosome may be a histone variant (e.g. H3.1, H3.2, H3.3, H3t, H2A.Bbd, H2A.Z.1, H2A.Z.2, H2A.X, mH2A1.1, mH2A1.2, mH2A2, orTH2B). In one embodiment the histone variant is H3.1. The term recombinant polynucleosome encompasses semi-synthetic polynucleosomes and synthetic polynucleosomes.

[0090] The recombinant polynucleosome may comprise a synthetic DNA sequence. An advantage of a synthetic DNA sequence is that it may be designed to include the desired properties. For example, the synthetic sequence may include a barcode sequence, a Widom nucleosome positioning sequence and / or a DNA sequence containing a disease specific single nucleotide polymorphism (SNP) (e.g. a KRAS). The length of the synthetic DNA sequence may be selected to provide the polynucleosome with discrete DNA length e.g. repeating units of 147 base pairs (bp), 167 bp or 187 bp of double stranded DNA. Overall the synthetic DNA sequence will be one which allows for a polynucleosome of 4 or more repeating units to be synthesised. The synthetic DNA sequence can include a unique SNP or combination of SNPs to act as a barcode for identification. The synthetic DNA sequence can be blunt ended or selected to have a specific overhang whereby the overhang could represent a sequence specific to a physiological cleavage site enriched in a particular disease state e.g. cancer.

[0091] For most applications of recombinant nucleosomes, the nucleotide sequence of the DNA contained within the nucleosome is not critical. For this reason, most workers use a nonnatural DNA sequence referred to as the Widom 601 sequence.

[0092] Widom used Fourier transform calculations to identify a special significance for nucleosome positioning of a motif consisting of about 10 bp periodic placement of TA dinucleotide steps. The original Widom 601 sequence is shown below. The nucleosome octamer core particle occupies the 147 bp span shown in upper case and flanking linker DNA at each end in lowercase.

[0093] Original Widom 601 sequence: cgggatcctaatgaccaaggaaagcatgattcttcacaccgagttcatcccttatgtgatggaccctatacgcggccgccCTGG AGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAAC GCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGVOL-C-P3866PCT

[0094] GCACGTGTCAGATATATACATCCTGTgcatgtattgaacagcgaccttgccggtgccagtcggatagtgttccga gctccc (SEQ ID NO: 1)

[0095] Further amended Widom 601 sequences are known, as well as other strong nucleosome binding DNA sequences including the 5S rRNA and MMTV LTR sequences (see for example the sequences listed in Flaus, 2011).

[0096] The Widom 601 sequence has a high affinity for binding to histone octamers and therefore holds the octamer in a single nucleosome position. Moreover, its use facilitates nucleosome assembly and leads to more stable recombinant nucleosomes (Bouazoune et al., 2009). Widom 601 sequences are therefore used for the DNA fragment component of almost all recombinant nucleosomes regardless of the length of the component DNA fragment including nucleosomes comprising 147 bp DNA fragments.

[0097] As discussed above, recombinant nucleosomes comprising Widom 601 or other strong nucleosome positioning DNA sequences are useful for many purposes. However, other novel purposes require an endogenous mammalian or human DNA sequence. An ideal reference material for use in the standardisation of an assay should comprise known quantities of single defined molecules that are as similar as possible to the test material of the assay. In the case of cfDNA this would be defined nucleosomes in defined quantities that comprise DNA fragments of endogenous (human or other) sequences that may also include known cancer associated mutations.

[0098] Therefore, according to one aspect of the invention, there is provided a recombinant polynucleosome of four or more repeating units comprising an endogenous nucleotide sequence, optionally wherein the endogenous nucleotide sequence comprises a mutation associated with increased risk of cancer.

[0099] In one embodiment, the endogenous nucleotide sequence is a mammalian nucleotide sequence. In one embodiment, the endogenous nucleotide sequence is (or is derived from) an oncogene. In one embodiment, the endogenous nucleotide sequence comprises a mutation associated with an increased risk with cancer.

[0100] Therefore, according to a particular embodiment of the invention, there is provided a method for assessing the performance of a DNA sequencing assay which detects a mutation associated with an increased risk of cancer, comprising the steps of:VOL-C-P3866PCT

[0101] (a) preparing a sample comprising a known concentration of a control material, wherein the control material comprises a polynucleosome having four or more repeating units, wherein the polynucleosome comprises an endogenous nucleotide sequence, wherein the endogenous nucleotide sequence comprises the mutation associated with an increased risk of cancer;

[0102] (b) performing the DNA sequencing assay on the sample prepared in step (a); and (c) assessing the performance of the DNA sequencing assay by comparing the results obtained by performing step (b) against the known concentration of the control material.

[0103] Acquired gene mutation is a major cause of cancer development and progression. BRAF, EGFR and KRAS are well known proto-oncogenes and have been major foci of oncology research. They are diagnostic and prognostic markers and are also specific targets in targeted therapies. Therefore, in one embodiment, the endogenous nucleotide sequence is derived from an oncogene. Examples of oncogenes include, without limitation, BRAF, KRAS, EGFR, SEPTIN-9, APC, DAPK, GSTP1, MGMT, P16, RASSF1A, T1G1, BRCA1, ERa, PRB, TMS1, MLH1, HLTF, CDKN2A, SOCS1, SOCS2, PAX5, PGR, PTGS2 and RAR 2.

[0104] These oncogenes present multiple mutations. Some example common mutations, without limitation, include:

[0105] • BRAF V600E 1799 T>A: This mutation is the most common genetic alteration in melanoma, colorectal and papillary thyroid cancer. It is associated with aggressive disease and poor survival.

[0106] • EGFR T790M 2369C>T: This mutation is used as a predictive biomarker for selection of non-small cell lung cancer (NSCLC) patients for treatment with EGFR-tyrosine kinase inhibitors (TKIs). TKI treatment has shown improved progression-free survival of patients with EGFR-mutated NSCLC. Examples include gefitinib, erlotinib, afatinib and dacomitinib.

[0107] • KRAS G12D 35 G>A: This mutation is present in a variety of cancers including >30% of pancreatic cancer and 10% of colorectal cancer cases. Encouraging results have recently, been obtained for KRAS (G12C) inhibitors, such as AMG510 (sotorasib) and MRTX849 (adagrasib) in clinical trials (Huang et al., 2021).

[0108] In one embodiment, the recombinant polynucleosome additionally comprises a sequence that is not endogenous to a human, animal or other species. For example, a barcode nucleotide and / or a nucleotide sequence related to increased histone binding affinity.VOL-C-P3866PCT

[0109] Barcodes are useful in DNA sequencing based methods to facilitate the parallel simultaneous sequencing of DNA from multiple samples or sources. The DNA from different samples is labelled by attaching a short sample specific nucleotide sequence, or barcode, to each DNA molecule prior to pooling them into a mix containing a number of libraries to be sequenced simultaneously. After sequencing, the samples are binned by identifying the barcode sequence within each sequence read. Thus, the DNA from multiple patients may be sequenced in a multiplex manner where each patient is identified by a unique barcode sequence.

[0110] The DNA barcode may be any length and sequence that is suitable to uniquely identify the recombinant nucleosome.

[0111] In one embodiment, a mixture of recombinant polynucleosomes of the invention is provided that includes a range of DNA sizes to more closely mimic the range of sizes (rather than a single size) that occurs naturally.

[0112] It will be clear that DNA sequences of use in the methods of the invention may include other sequences, for example sequences that are similar, but not identical to, known sequences endogenous to humans or other species. Therefore, in a further aspect of the invention there is a provided a recombinant nucleosome comprising a DNA sequence that is similar to a sequence endogenous to humans or another species. For example, the DNA sequence may have greater than 50%, such as greater than 60%, 70%, 80%, 90%, 95%, 97% or 99% identity with a sequence endogenous to humans or another species.

[0113] Biologically derived polynucleosomes

[0114] As stated above the present invention may employ biologically derived polynucleosomes of 4 or more repeating units, or a combination of such polynucleosomes each with 4 or more repeating units.

[0115] A biologically derived polynucleosome is a polynucleosome that is not synthesised by chemically assembling recombinant histone and DNA components, but is a natural, cell derived polynucleosome produced by a living cell. Therefore, a biologically derived polynucleosome used as a calibrant, as described herein, is not a recombinant polynucleosome. The terms “biologically derived polynucleosome”, “cell derived polynucleosome” and “natural polynucleosome” are used interchangeably herein.VOL-C-P3866PCT

[0116] Biologically derived, or cell derived polynucleosomes may be used in a raw form, but in embodiments of the invention the chromatin originating from cells is isolated, purified and fragmented (for example by sonication or nuclease digestion) to produce chromatin fragments of at least 4 repeating units, including, e.g., tetranucleosomes and pentanucleosomes, from larger cell derived chromatin fragments. In a further embodiment the biologically derived polynucleosomes are cell free nucleosomes present in a body fluid, for example without limitation, lymph, cerebrospinal fluid, bronchoalveolar lavage fluid, blood, plasma or serum, wherein the cell free polynucleosomes originate from (and were produced by) cells in the body. In another embodiment the biologically derived polynucleosomes are cell free polynucleosomes present in a cell culture supernatant, which cell free nucleosomes originate from (and were produced by) cells in culture. In one embodiment, the biologically derived polynucleosomes are cell free polynucleosomes present in extracellular trap (ET) material. Neutrophil extracellular trap (NET) or other ET material may be harvested from a number of sources including ex vivo culture of white blood cells stimulated to NETosis, or from body fluids such as blood, serum, plasma or other body fluids.

[0117] The biologically derived cell free polynucleosome material for use as a calibrant may be produced from any biological material comprising chromatin. Common sources include chicken erythrocyte nucleosomes, circulating cell nucleosomes in blood, NETs and cell culture derived nucleosomes. Chicken erythrocyte derived and cell culture derived nucleosomes are also available commercially, for example from Tebu-bio. Another potential source of nucleosomes includes heterophils, which are a type of granulocyte found in most avian species (e.g. chickens). Similar to neutrophils, heterophils can form heterophil extracellular traps (HETs). HETs released from chicken heterophils are structurally similar to NETs found in mammalian and fish neutrophils.

[0118] Many or most types of cells, particularly vertebrate cells, may be used as a source of chromatin material for the preparation of a biologically derived polynucleosome calibrant. This is because most cells contain chromatin, and histone and nucleosome structures are highly conserved across species. This means that polynucleosomes derived from any convenient animal source may be used as a nucleosome calibrant material for the absolute quantitation of nucleosomes in body fluid samples obtained from individuals of that species, or other species. For example, polynucleosomes derived from any convenient animal source may be used as calibrant material for the absolute quantitation of nucleosomes in human body fluid samples. In one embodiment, the biologically derived polynucleosomes are derived from calf thymus.VOL-C-P3866PCT

[0119] In one embodiment the nucleosomes may be provided diluted into the body fluid to be analysed. For example, animal derived polynucleosomes may be provided in a matrix of human plasma.

[0120] In preferred embodiments, the biologically derived polynucleosome material is produced from cells in cell culture (i.e. cultured cells). Methods for deriving cell free nucleosome material from cells in culture are well known (see for example Sadeh et al., 2016). In a typical method the chromatin material in the nucleus is isolated from the cells. This can be done using a nuclear isolation buffer or a commercially available nuclear isolation kit (for example the Merck, Nuclei PURE Prep kit). The chromatin material is then fragmented, typically by sonication to physically disrupt the chromatin, or by digestion using a nuclease (usually a micrococcal nuclease [MNase]). The chromatin fragments may be prepared to include polynucleosomes of 4 or more repeating units. Optionally the chromatin may be cross-linked prior to preparation of fragmented chromatin by treating the cells with formaldehyde prior to isolation of the nuclear material. Cross-linking stabilises the fragmented chromatin and thus provides a more stable calibrant material. Alternatively, pre-prepared cross-linked fragmented chromatin materials produced from a variety of different cell types are available commercially including from Hela cervical cancer cells, HepG2 liver cancer cells, K562 leukaemia cells and 3T3 embryonic fibroblast cells. Any tissue or cultured cells may be used as a source of fragmented chromatin.

[0121] Therefore, in one embodiment, the biologically derived polynucleosomes are obtained from nuclease digests of cells grown in culture, said cells being immortalised human or animal cells or primary human or animal cells with native DNA, DNA modifications, histone variants and / or post translational modifications.

[0122] In one embodiment, a biologically derived polynucleosome preparation enriched for polynucleosomes containing a particular (low abundance) histone modification is prepared by isolation of, or purification for, the desired polynucleosomes. For example, in a positive enrichment embodiment this is achieved by chromatin immunoprecipitation of polynucleosomes containing the histone modification of interest. Methods for chromatin immunoprecipitation are well known in the art. In a typical method, an antibody that binds selectively to the histone modification of interest is immobilised on a solid phase support (for example, without limitation, agarose or sepharose or other particulate materials) and contacted with the source nucleosome material. Polynucleosomes containing the histone modification of interest are isolated from other nucleosomes on the solid phase. The solid phase polynucleosomes may be used in suspension as a calibrant (i.e. as the biologically derived polynucleosome preparation). Alternatively, the purified polynucleosomes may beVOL-C-P3866PCT

[0123] removed from the solid phase for use as a liquid phase calibrant. Such an enrichment process may be applied to a polynucleosome preparation derived from any natural source.

[0124] As a biologically derived polynucleosome preparation contains a multiplicity of nucleosome types that comprise a wide variety of epigenetic features and combinations thereof, it will be understood that polynucleosomes containing any particular epigenetic feature or features will form a subgroup of polynucleosomes within the overall nucleosome composition of the biologically derived preparation.

[0125] Methods of detecting a (poly)nucleosome

[0126] The present invention in one embodiment involves the detection of a nucleosome, such as a cell free nucleosome. Such methods can be used to detect nucleosomes of a range of lengths, such as mononucleosomes, polynucleosomes of say at least 2 or more repeating units, and combinations thereof, such as may exist in a biological sample. In the context of the analyte to be detected, these are referred to generically as a nucleosome(s) or analyte nucleosome.

[0127] It will be understood that the analyte nucleosome, or polynucleosome of the present invention, may be detected by binding to a component thereof. The term “component thereof” as used herein refers to a part of the nucleosome, i.e. the whole nucleosome does not need to be detected. The component of the nucleosomes may be selected from the group consisting of: a histone protein (i.e. histone H1, H2A, H2B, H3 or H4), a histone post-translational modification, a histone isoform (also referred to herein as a histone variant), a protein bound to the nucleosome (i.e. a nucleosome-protein adduct), a DNA fragment associated with the nucleosome and / or a modified nucleotide associated with the nucleosome. For example, the component thereof may be histone (isoform) H3.1, histone H1 or DNA.

[0128] Methods and uses of the invention may measure the level of (cell free) analyte nucleosomes perse or polynucleosomes of the present invention perse. References to “nucleosomes per se” refers to the total nucleosome level or concentration present in the sample, regardless of any epigenetic features the nucleosomes may or may not include. Detection of the total nucleosome level typically involves detecting a histone protein common to all nucleosomes, such as histone H4. Therefore, nucleosomes per se may be measured by detecting a core histone protein, such as histone H4. In one embodiment, the measuring of nucleosomes per se comprises detecting a core histone protein, such as detecting histone H4. As describedVOL-C-P3866PCT

[0129] herein, histone proteins form structural units known as nucleosomes which are used to package DNA in eukaryotic cells.

[0130] Normal cell turnover in adult humans involves the creation by cell division of a huge number of cells daily and the death of a similar number, mainly by apoptosis. During the process of apoptosis chromatin is broken down into mononucleosomes and polynucleosomes some of which may be released into the circulation. Under normal conditions the levels of circulating nucleosomes found in healthy subjects is reported to be low. Elevated levels are found in subjects with a variety of conditions including many cancers, auto-immune diseases, inflammatory conditions, stroke and myocardial infarction (Holdenrieder and Stieber, 2009).

[0131] A common application for immunoassays for cell free nucleosomes containing particular epigenetic structures or features, including histone PTMs or histone variants is the measurement of circulating cell free nucleosomes. Circulating nucleosomes are not a homogeneous group of protein-nucleic acid complexes. Rather, they are a heterogeneous group of chromatin fragments originating from the digestion of chromatin on cell death and include an immense variety of epigenetic structures including particular histone isoforms (or variants), post-translational histone modifications, nucleotides or modified nucleotides, and protein adducts. It will be clear to those skilled in the art that an elevation in circulating nucleosome levels will be associated with elevations in circulating nucleosome subsets. Assays for these types of chromatin fragments are known in the art, including for example, those described in WO 2005 / 019826, WO 2013 / 030579, WO 2013 / 030578 and WO 2013 / 084002.

[0132] The test samples to be measured may be any sample comprising nucleosomes. The test sample to be assayed by a comparative analytical method employing a polynucleosome calibrant of the present invention, or in a method of the invention, is a human or animal body fluid sample including for example a blood, serum, plasma, cerebrospinal fluid, urine, faeces, sputum or saliva sample. Blood, serum or plasma samples are of particular interest. Therefore, in one embodiment, the polynucleosome reference standard is used as a calibrant in a comparative analytical procedure which measures the level of histone post translational modifications in a blood, serum or plasma sample. Test samples may be prepared, for example where appropriate diluted or concentrated, and stored in the usual manner.

[0133] It will be understood that more than one epigenetic feature of cell free nucleosomes may be detected by immunoassay or other comparative analytical methods. Multiple biomarkers are often used in medicine, for example to determine the disease status of a subject. Therefore,VOL-C-P3866PCT

[0134] in one embodiment, the polynucleosome reference standard contains a combination of multiple different polynucleosomes, and optionally other chromatin fragments, comprising multiple epigenetic features as a combined calibrant. In one embodiment, a combination of polynucleosomes of different repeating unit lengths is used (e.g. a combination of tetranucleosomes and pentanucleosomes). In one embodiment the calibrant is a so-called universal, or near-universal, chromatin fragment calibrant that is suitable for use in all or most nucleosome or chromatin fragment assays. The epigenetic features useful in a calibrant may be of the same type (e.g. multiple PTM types, multiple histone isoforms, multiple nucleotides or multiple protein adducts) or different types (e.g. a PTM in combination with a histone isoform). One advantage of a biologically derived calibrant is that it comprises a mixture of a large number of different nucleosome types so a single biologically derived calibrant may be used as a combined calibrant for a large number of different nucleosome assays either separately or in a multiplex format.

[0135] The structure of a nucleosome may vary by the inclusion of alternative histone isoforms or variants which are different gene or splice products and have different amino acid sequences. In one embodiment, the epigenetic feature of the nucleosome, such as of one or more of the multiplicity of nucleosome types, comprises a histone variant or isoform. Many histone isoforms are known in the art. Histone isoforms can be classed into a number of families which are subdivided into individual types. The sequences of a large number of histone isoforms are known and publicly available for example in the National Human Genome Research Institute NHGRI Histone Database (Marino-Ramirez et al., 2011 and https: / / histdb.intbio.org / )), the GenBank (NIH genetic sequence) Database, the EM BL Nucleotide Sequence Database and the DNA Data Bank of Japan (DDBJ). For example, isoforms of histone H2 include H2A1, H2A2, mH2A1, mH2A2, H2AX and H2AZ. In another example, histone isoforms of H3 include H3.1, H3.2 and H3t. In one embodiment, the histone isoform is H3.1.

[0136] The structure of nucleosomes can vary by post translational modification (PTM) of histone proteins. PTM of histone proteins typically occurs on the tails of the core histones and common modifications include acetylation, methylation or ubiquitination of lysine residues as well as citrullination or methylation of arginine residues and phosphorylation of serine residues and many others. It will be understood that a histone PTM may occur on different isoforms (variants) of the histone. For example, the lysine residues that occur on the tail of histone H3 isoforms H3.1, H3.2 and H3.3 may be modified by acetylation or methylation. Many histone modifications are known in the art and the number is increasing as new modifications are identified (Zhao and Garcia, 2015). Therefore, in one embodiment, the epigenetic feature of the cell free nucleosome may be a histone post translational modification (PTM). The histoneVOL-C-P3866PCT

[0137] PTM may be present on a core nucleosome histone (e.g. H2A, H2B, H3 or H4), or a linker histone (e.g. H1 or H5). Examples of PTMs are described in WO 2005 / 019826 and WO 2017 / 068359.

[0138] In more detail, in one embodiment, the polynucleosome reference standard may contain particular histone PTMs including acetylation, methylation (which may be mono-, di- or trimethylation), phosphorylation, ribosylation, citrullination, ubiquitination, hydroxylation, glycosylation, nitrosylation, glutamination and / or isomerisation. This may then be used to determine the level of histone post translational modification in a sample (e.g. a blood, serum or plasma sample from a patient). In one embodiment, the histone PTM is methylation of a lysine residue. In a further embodiment, the methylation is of a histone 3 lysine residue. In a yet further embodiment, the histone PTM is selected from H3K27Me3, H3KMe2, H3K4Me2 or H3K36Me3. In one embodiment, the histone PTM is acetylation of a lysine residue. In a further embodiment, the acetylation is of a histone 3 lysine residue. In a yet further embodiment, the histone PTM is selected from H3K9Ac, H3K14Ac, or H3K27Ac. In another embodiment, the histone PTM is H4PanAc. In one embodiment, the histone PTM is phosphorylation of a serine residue. In a further embodiment, the phosphorylation is of an isoform X of histone 2A (H2AX) serine residue or phosphorylation of a histone 3 serine residue. In a yet further embodiment, the histone PTM is selected from pH2AX or H3S10Ph. In one embodiment, the histone PTM is selected from citrullination or ribosylation. In a further embodiment, the histone PTM is citrullinated H3 (H3cit) or citrullinated H4 (H4cit). In a further embodiment, the histone PTM is citrullination of a histone 3 arginine residue. In a yet further embodiment, the histone PTM is H3R8Cit. In one embodiment, the histone PTM is selected from the group consisting of: H3K27Me3, H3KMe2, H3K4Me2, H3K36Me3, H3K9Ac, H3K14AC, H3K27Ac, H4PanAc, pH2AX, H3S10Ph and H3R8Cit.

[0139] A group or class of related histone post translational modifications (rather than a single modification) may also be detected. A typical example, without limitation, would involve a 2-site immunoassay employing one antibody or other selective binder directed to bind to nucleosomes and one antibody or other selective binder directed to bind the group of histone modifications in question. Examples of such antibodies directed to bind to a group of histone modifications would include, for illustrative purposes and without limitation, anti-pan-acetylation antibodies (e.g. a Pan-acetyl H4 antibody [H4panAc]), anti-citrullination antibodies or anti-ubiquitin antibodies.

[0140] In one embodiment, the epigenetic feature is a DNA modification, thus the epigenetic feature of the polynucleosome calibrant with a defined mass or concentration comprises one or moreVOL-C-P3866PCT

[0141] DNA modifications. In addition to the epigenetic signalling mediated by nucleosome histone isoform and PTM composition, nucleosomes also differ in their nucleotide and modified nucleotide composition. Some nucleosomes may comprise more 5-methylcytosine residues, or 5-hydroxymethylcytosine residues or other nucleotides or modified nucleotides, than other nucleosomes. In one embodiment, the epigenetic feature is a DNA modification selected from 5-methylcytosine or 5-hydroxymethylcytosine. Thus, in some embodiments, the defined calibrated DNA modification is 5-methylcytosine or 5-hydroxymethylcytosine.

[0142] A further type of circulating nucleosome subset is nucleosome protein adducts. It has been known for many years that chromatin comprises a large number of non-histone proteins bound to its constituent DNA and / or histones. These chromatin associated proteins are of a wide variety of types and have a variety of functions including transcription factors, transcription enhancement factors, transcription repression factors, histone modifying enzymes, DNA damage repair proteins and many more. These chromatin fragments including nucleosomes and other non-histone chromatin proteins or DNA and other non-histone chromatin proteins are described in the art. Therefore, in one embodiment, the epigenetic feature comprises one or more protein-nucleosome adducts or complexes. In a further embodiment, the epigenetic feature of the calibrant with a defined mass or concentration is one or more proteinnucleosome adducts or complexes.

[0143] Assays

[0144] Methods of the invention may be used for assessing the performance of an assay. For example, the assay may be a comparative analytical procedure in which the nucleosomes present in an unknown test sample may be measured using a binding agent that binds specifically to nucleosomes and the degree of binding is compared to the binding that occurs in a known calibrant or standard sample. Therefore, according to a further aspect of the invention there is provided an assay method for the measurement of nucleosomes in a test sample, wherein said assay is calibrated using a polynucleosome reference standard of the present invention which can be assigned, or defined by, values expressed in absolute units of mass or concentration.

[0145] In one embodiment, the assay is an immunoassay. The immunoassays described herein include any method employing one or more antibodies or other specific binders directed to bind to the biomarkers defined herein. Immunoassays include 2-site immunoassays or immunometric assays employing enzyme detection methods (for example ELISA), fluorescence labelled immunometric assays, time-resolved fluorescence labelledVOL-C-P3866PCT

[0146] immunometric assays, chemiluminescent immunometric assays, immunoturbidimetric assays, particulate labelled immunometric assays and immunoradiometric assays as well as singlesite immunoassays, reagent limited immunoassays, competitive immunoassay methods including labelled antigen and labelled antibody single antibody immunoassay methods with a variety of label types including radioactive, enzyme, fluorescent, time-resolved fluorescent and particulate labels. All of said immunoassay methods are well known in the art, see for example Salgame et al., 1997 and van Nieuwenhuijze et al., 2003.

[0147] In one embodiment, the binding agent is a chromatin protein. In preferred embodiments, the binding agent is an antibody. In one embodiment, the assay employs a single binding agent. In another embodiment, the immunoassay is a 2-site immunometric (or sandwich) assay employing two binding agents, such as antibodies. The antibodies or other binding agents may be directed to bind to any epitope present in a nucleosome including without limitation binding to a histone, nucleosome core or DNA epitope. In some embodiments in which nucleosome adducts are measured, one or more antibodies may be directed to bind to a protein adducted to a nucleosome. In one embodiment, the binding agent is directed to a post-translational modification of a histone.

[0148] However, identifying, detecting and / or quantifying can be performed by any method suitable to identify the presence and / or amount of a specific protein in a biological sample from a subject or a purification or extract of a biological sample or a dilution thereof. In particular, quantifying may be performed by measuring the concentration of the target in the sample or samples. Biological samples that may be tested in a method of the invention include those as defined hereinbefore. The samples can be prepared, for example where appropriate diluted or concentrated, and stored in the usual manner. The present invention finds particular use in plasma samples which may be obtained from the subject.

[0149] According to another aspect of the invention, there is provided a method for the measurement of the level of nucleosomes or histone associated with nucleosomes in a biological sample, the method comprising:

[0150] (i) obtaining a sample of a biological fluid;

[0151] (ii) contacting the sample with a binding agent to the nucleosomes;

[0152] (iii) measuring a parameter or degree of nucleosome binding of the binding agent to the nucleosome using an instrument adapted for conducting the assay;

[0153] (iv) comparing the parameter or degree of nucleosome binding obtained in step (iii) with standardisation data obtainable using a polynucleosome of 4 or more repeating units; andVOL-C-P3866PCT

[0154] (v) using the comparison in step (iv) to convert the parameter or degree of nucleosome binding measured in step (iii) into an amount or concentration of nucleosome present in the sample.

[0155] In one embodiment, the standardisation data is stored in the instrument or retrieved from a remote location (i.e. a location separate to the instrument). Preferably, the standardisation data is retrieved electronically from the remote location. For example, the standardisation data (which may also be referred to as the calibration data) may be provided on a storage device. Such storage devices include, but are not limited to, a USB flash drive, hard-drive, memory card, DVD or CD-ROM. Alternatively, the standardisation data may be downloaded from a remote location via a communication network (for example, the internet).

[0156] In one embodiment, the control material is used at various concentrations to create a reference standard. The reference standard may optionally be created separately from the assay / sample. For the avoidance of doubt, the terms “standards” and “calibrators” are used herein interchangeably.

[0157] The reference standard may be presented as a standard curve. In one embodiment, the standard curve may be produced on another instrument which may be located anywhere in the world. For example, the standard curve may be produced remotely by the manufacturer of the reagents at the factory and communicated automatically, usually through an internet connection, to the instrument used for unknown sample analysis. In one embodiment the manufacturing batch of any reagents used to analyse an unknown sample is recognised automatically by the instrument used, for example using a barcode system. The instrument then calls up the appropriate standard curve from a stored list of such curves or from a remote list provided by the manufacturer.

[0158] In one embodiment, the reference standard is created in a pre-calibration step. In a further embodiment, the pre-calibration by factory calibration. Factory calibration refers to generating a standard curve during a calibration operation performed at a manufacturing facility or other factory stage before shipping to an end user.

[0159] In one embodiment, the instrument adapted for conducting the assay is an automated analyser, such as an automated fluorescence analyser. The automated analyser may be capable of performing either one, or multiple types of assay. The automated analyser may be supplied with one or more test receptacles, e.g. a cuvette, a microtiter plate or a test cartridge, which are factory calibrated. The one or more test receptacles are supplied with theVOL-C-P3866PCT

[0160] standardisation data (which may also be referred to as the calibration data). The standardisation data may be provided on a storage device (for example a USB flash drive, hard-drive, memory card, DVD or CD-ROM) or may be downloaded from a remote location via a communication network (for example, the internet).

[0161] By way of example, one embodiment of the present invention may employ the LightDeck MINI System (hereafter referred to as “LightDeck MINI”) which is used in conjunction with LightDeck test cartridges. The LightDeck MINI and test cartridges are manufactured by MBio Diagnostics, Inc., based in Boulder, CO, USA.

[0162] As another example, one embodiment of the present invention may employ the IDS-iSYS which is a multiple-discipline automated analyser. Individual assays may be carried out in disposable cuvettes which are automatically loaded onto a carousel. Results are calculated in comparison to a calibration curve that is provided on a CD accompanying the test cartridge. This information is registered in the analyser’s database when the CD is introduced on the controlling computer. The IDS-iSYS is supplied by Immunodiagnostic Systems Holdings Ltd, a PerkinElmer company, based in Tyne & Wear, UK.

[0163] References to “subject” or “patient” are used interchangeably herein. The subject may be a human or an animal subject. In one embodiment, the subject is a human. In one embodiment, the subject is a (non-human) animal. In one embodiment, the subject is a non-human mammal, such as a dog, mouse, rat or horse, in particular a dog. The methods described herein may be performed in vitro, in vivo or ex vivo.

[0164] Additional biomarkers

[0165] The level of (cell free) nucleosomes may be detected or measured as one of a panel of measurements. The panel may comprise different epigenetic features of the nucleosome as described hereinbefore (e.g. a histone isoform and a PTM). In one embodiment, the panel comprises one or more cytokines, such as one or more interleukins.

[0166] Diagnostic and Screening Methods

[0167] The identification of biomarkers for a disease state permits integration of diagnostic procedures and therapeutic regimes. The biomarkers provide the means to indicate therapeutic response, failure to respond, unfavourable side-effect profile, degree of medication compliance and achievement of adeguate serum drug levels. The biomarkers mayVOL-C-P3866PCT

[0168] be used to provide warning of adverse drug response. Biomarkers are useful in development of personalized therapies, as assessment of response can be used to fine-tune dosage, minimise the number of prescribed medications, reduce the delay in attaining effective therapy and avoid adverse drug reactions. Thus by monitoring a biomarker using a method of the invention, subject care can be tailored precisely to match the needs determined by the disorder and the pharmacogenomic profile of the subject, the biomarker can thus be used to titrate the optimal dose, predict a positive therapeutic response and identify those subjects at high risk of severe side effects.

[0169] Biomarker-based tests provide a first line assessment of ‘new’ subjects, and provide objective measures for accurate and rapid diagnosis, not achievable using the current measures.

[0170] Biomarker monitoring methods, biosensors and kits are also vital as subject monitoring tools, to enable the physician to determine whether relapse is due to worsening of the disorder. If pharmacological treatment is assessed to be inadequate, then therapy can be reinstated or increased; a change in therapy can be given if appropriate. As the biomarkers are sensitive to the state of the disorder, they provide an indication of the impact of drug therapy.

[0171] In one embodiment, the method is a clinical diagnostic test for a human or animal subject.

[0172] The term “detecting” or “diagnosing” as used herein encompasses identification, confirmation, and / or characterisation of a disease state. Methods of detecting, monitoring and of diagnosis according to the invention are useful to confirm the existence of a disease, to monitor development of the disease by assessing onset and progression, or to assess amelioration or regression of the disease. Methods of detecting, monitoring and of diagnosis are also useful in methods for assessment of clinical screening, prognosis, choice of therapy, evaluation of therapeutic benefit, i.e. for drug screening and drug development.

[0173] The method may be used to monitor a patient. Therefore, in one embodiment, the method described herein is repeated on multiple occasions. This embodiment provides the advantage of allowing the detection results to be monitored over a time period. Such an arrangement will provide the benefit of monitoring or assessing the efficacy of treatment of a disease state. Such monitoring methods of the invention can be used to monitor onset, progression, stabilisation, amelioration, relapse and / or remission. Therefore, in one embodiment the method is repeated on one or more occasions and any changes in the level of cell free nucleosomes or component thereof is used to monitor the progression of a disease in the patient.VOL-C-P3866PCT

[0174] According to a further aspect of the invention, there is provided a method of screening for an agent suitable for modifying the epigenetic status of one or more nucleosome modifications from a biological sample of a subject, the method comprising determining the quantity or concentration of one or more nucleosome modifications in the presence and absence of the agent, wherein determining the quantity or concentration of the one or more nucleosome modifications comprises:

[0175] (a) providing a sample, such as an isolated biological sample from a subject, comprising nucleosomes;

[0176] (b) providing a control material at various concentrations to create a polynucleosome reference standard, wherein the control material comprises a polynucleosome comprising four or more repeating units and the one or more nucleosome modifications to be quantified;

[0177] (c) adding one or more binding agents to the sample and the polynucleosome reference standard, wherein the binding agent targets the one or more nucleosome modifications;

[0178] (d) performing an affinity reagent-based assay to measure the quantity or concentration of the one or more nucleosome modifications in the sample and the polynucleosome reference standard; and

[0179] (e) quantifying the abundance of the one or more nucleosome modifications by comparing the relative abundance in the sample to the polynucleosome reference standard;

[0180] wherein a change in quantity or concentration of the one or more nucleosome modifications in the presence and absence of the agent identifies an agent that modifies the epigenetic status.

[0181] According to a further aspect of the invention, there is provided a method of determining the specificity of a detection reagent for a core histone and / or DNA modification target epitope, comprising using a control material comprising a polynucleosome comprising four or more repeating units and comprising the core histone and / or DNA modification target epitope.

[0182] Kits

[0183] Kits (or panels) are provided for performing methods of the invention. Such kits will suitably comprise one or more ligands for detection and / or quantification of a target biomarker, optionally together with instructions for use of the kit.

[0184] According to a further embodiment, there is provided a kit for quantifying the amount of a nucleosome, a histone associated with a nucleosome or DNA associated with a nucleosomeVOL-C-P3866PCT

[0185] in a biological sample, wherein the kit comprises an automated immunoassay analyser, a nucleosome binding agent and electronically accessible standardisation data, wherein the standardisation data comprises data obtained from the assessment of a control material, wherein the control material comprises a polynucleosome comprising four or more repeating units. In one embodiment, the control material is assessed at various concentrations to create a polynucleosome reference standard. In one embodiment, the kit additionally comprises a polynucleosome reference standard. In an alternative embodiment, the kit does not comprise the polynucleosome reference standard. It will be understood in this embodiment, that the polynucleosome reference standard is already included in the electronically accessible standardisation data, and therefore the reference standard itself does not need to be included as part of the kit.

[0186] According to a further embodiment, there is provided a kit for measuring the level of nucleosomes or histone associated with nucleosomes in a biological sample, wherein the kit comprises an automated immunoassay analyser, a nucleosome binder and electronically accessible standardisation data and does not comprise a polynucleosome standard or calibrant.

[0187] According to a further aspect of the invention, there is provided a kit for use in a method of the invention, the kit comprising a control material comprising a polynucleosome comprising four or more repeating units.

[0188] DNA Assay Calibrants

[0189] According to a further aspect of the invention, there is provided a method for the analysis of DNA in a sample, wherein said analysis is calibrated using a polynucleosome comprising four or more repeating units, wherein the polynucleosome comprises a target endogenous nucleotide sequence, optionally wherein the target endogenous nucleotide sequence comprises a mutation associated with increased risk of cancer.

[0190] In one embodiment, the analysis of DNA is to assess the content of circulating tumour DNA (ctDNA) present in the sample. Therefore, in this context the polynucleosome of four or more repeating units is used as a calibrant to measure the presence and / or concentration of the target ctDNA.

[0191] CLAUSES

[0192] A set of clauses defining the invention and its preferred aspects is as follows:VOL-C-P3866PCT

[0193] Clause 1. A method for assessing the performance of an assay which detects a nucleosome, a histone associated with a nucleosome or DNA associated with a nucleosome, comprising the steps of:

[0194] (a) preparing a sample containing a known concentration of a control material, wherein the control material comprises a polynucleosome comprising four or more repeating units;

[0195] (b) performing the assay on the sample prepared in step (a); and

[0196] (c) assessing the performance of the assay by comparing the results obtained by performing step (b) against the known concentration of the control material.

[0197] Clause 2. A method for quantifying the amount of a nucleosome, a histone associated with a nucleosome or DNA associated with a nucleosome, in a sample, comprising the steps of:

[0198] (a) performing an assay which detects a nucleosome, a histone associated with a nucleosome or DNA associated with a nucleosome; and

[0199] (b) quantifying the amount of nucleosome, histone associated with the nucleosome or DNA associated with the nucleosome in the sample by comparing the result obtained in step (a) against the result obtained from performing the assay on a sample containing a known concentration of a control material, wherein the control material comprises a polynucleosome comprising four or more repeating units.

[0200] Clause 3. A method for quantifying the amount of a nucleosome, a histone associated with a nucleosome or DNA associated with a nucleosome, in a sample, the method comprising:

[0201] (a) providing a control material at various concentrations to create a reference standard, wherein the control material comprises a polynucleosome comprising four or more repeating units;

[0202] (b) adding a binding agent to a sample to perform an assay to measure the amount of nucleosome, histone associated with the nucleosome or DNA associated with the nucleosome, in the sample; and

[0203] (c) quantifying the amount of nucleosome, or histone associated with the nucleosome or DNA associated with the nucleosome in the sample by measuring the amount of binding agent bound in the sample and comparing the amount to the reference standard.

[0204] Clause 4. A method for the measurement of the amount or concentration of nucleosomes, a histone associated with nucleosomes or DNA associated with nucleosomes, in a sample, the method comprising:VOL-C-P3866PCT

[0205] (a) contacting a sample with a binding agent to the nucleosomes, histone or DNA; (b) measuring a parameter or degree of binding of the binding agent to the nucleosome, histone or DNA, using an instrument adapted for conducting the measurement;

[0206] (c) comparing the parameter or degree of binding obtained in step (b) with standardisation data; and

[0207] (d) using the comparison in step (c) to convert the parameter or degree of binding measured in step (b) into an amount or concentration of nucleosomes, histone or DNA present in the sample based on a known amount or concentration of a control material, wherein the control material comprises a polynucleosome comprising four or more repeating units.

[0208] Clause 5. The method according to clause 4, wherein the standardisation data is retrieved electronically from the remote location.

[0209] Clause 6. The method according to any preceding clause, wherein the polynucleosome is a tetranucleosome.

[0210] Clause 7. The method according to any one of clauses 1-5, wherein the polynucleosome is a pentanucleosome.

[0211] Clause 8. The method according to any preceding clause, wherein the control material is used at various concentrations to create a reference standard, which optionally is created separately from the sample.

[0212] Clause 9. The method according to any preceding clause, wherein the polynucleosome is a recombinant polynucleosome or a biologically derived polynucleosome.

[0213] Clause 10. The method according to clause 9, wherein the polynucleosome is a recombinant polynucleosome.

[0214] Clause 11. The method according to clause 9 or clause 10, wherein the recombinant polynucleosome is prepared by associating core histones of two or more nucleosomes, and optionally a linker histone and / or nucleic acid.

[0215] Clause 12. The method according to clause 9, wherein the control material is a biologically derived nucleosome reference sample.VOL-C-P3866PCT

[0216] Clause 13. The method according to clause 12, wherein the control material is produced from cells in cell culture.

[0217] Clause 14. The method according to clause 12 or clause 13, wherein the control material is prepared by (i) isolation or purification of a nucleosome preparation containing the desired nucleosomes; (ii) exposure of source nucleosome material to histone modifying enzymes; (iii) modification of cultured cells to over-express histone modifying enzymes; and / or (iv) treatment of cultured cells with a compound that modulates histone modifying enzyme activity.

[0218] Clause 15. The method according to any preceding clause, wherein the polynucleosome contains a specified histone variant.

[0219] Clause 16. The method according to clause 15, wherein the histone variant is H3.1 or H3.3.

[0220] Clause 17. The method according to any preceding clause, wherein the method involves quantifying the abundance of a nucleosome modification in a biological sample.

[0221] Clause 18. The method according to clause 17, wherein the nucleosome modification is a histone post translational modification, a nucleotide modification, a modified nucleotide or a protein-nucleosome adduct.

[0222] Clause 19. The method according to clause 17 or clause 18, wherein the histone post translational modification is selected from: acetylation, methylation or ubiquitination of lysine residues; citrullination or methylation of arginine residues; and phosphorylation of serine residues.

[0223] Clause 20. The method according to clause 19, wherein the histone post translational modification is methylation of a lysine residue, such as methylation of a histone 3 lysine residue, in particular H3K27Me3, H3KMe2, H3K4Me2 or H3K36Me3.

[0224] Clause 21. The method according to clause 19, wherein the histone post translational modification is acetylation of a lysine residue, such as acetylation of a histone 3 lysine residue, in particular H3K9Ac, H3K14AC or H3K27AC.

[0225] Clause 22. The method according to clause 19, wherein the histone post translational modification is phosphorylation of a serine residue, such a phosphorylation of an isoform X ofVOL-C-P3866PCT

[0226] histone 2A serine residue, in particular pH2AX or phosphorylation of a histone 3 serine residue, such as H3S10Ph.

[0227] Clause 23. The method according to clause 19, wherein the histone post translational modification is citrullination of an arginine residue, such as citrullination of a histone 3 arginine residue, in particular H3R8Cit.

[0228] Clause 24. The method according to any one of clauses 1 to 23, wherein a histone is mutated, including a mutation in histone 3, such as a mutation in H3 in which lysine 27 is replaced by a methionine (H3K27M).

[0229] Clause 25. The method according to any preceding clause, wherein the assay is an immunoassay.

[0230] Clause 26. The method according to any preceding clause, wherein the assay employs a single binding agent.

[0231] Clause 27. The method according to clause 25, wherein the assay is a 2-site immunometric assay employing two binding agents.

[0232] Clause 28. The method according to any preceding clause, wherein a binding agent is directed to a histone, nucleosome core, DNA epitope or a protein adducted to a nucleosome.

[0233] Clause 29. The method according to any preceding clause, wherein a binding agent is directed to a post-translational modification of a histone.

[0234] Clause 30. The method according to any preceding clause, wherein the binding agent is a chromatin protein or an antibody.

[0235] Clause 31. The method according to any preceding clause, wherein the method is a clinical diagnostic test for a human or animal subject.

[0236] Clause 32. The method according to any preceding clause, wherein the sample is a biological sample such as a human or animal body fluid sample, for example a blood, serum, plasma, cerebrospinal fluid, urine, faeces, sputum or saliva sample.VOL-C-P3866PCT

[0237] Clause 33. The method according to any one of clauses 3 and 4 and clauses dependent thereon, wherein the reference standard is created in a pre-calibration step.

[0238] Clause 34. The method according to clause 33, wherein the pre-calibration is factory calibration.

[0239] Clause 35. A method for assessing the performance of a DNA sequencing assay which detects a target endogenous nucleotide sequence, comprising the steps of:

[0240] (a) preparing a sample comprising a known concentration of a control material, wherein the control material comprises a polynucleosome having four or more repeating units, wherein the polynucleosome comprises the target endogenous nucleotide sequence or a fragment thereof;

[0241] (b) performing the DNA sequencing assay on the sample prepared in step (a); and (c) assessing the performance of the DNA sequencing assay by comparing the results obtained by performing step (b) against the known concentration of the control material.

[0242] Clause 36. A method for the analysis of DNA in a sample, wherein said analysis is calibrated using a control material comprising a polynucleosome comprising four or more repeating units, wherein the polynucleosome comprises a target endogenous nucleotide sequence, optionally wherein the target endogenous nucleotide sequence comprises a mutation associated with increased risk of cancer.

[0243] Clause 37. A method of screening for an agent suitable for modifying the epigenetic status of one or more nucleosome modifications from a biological sample of a subject, the method comprising determining the quantity or concentration of one or more nucleosome modifications in the presence and absence of the agent, wherein determining the quantity or concentration of the one or more nucleosome modifications comprises:

[0244] (a) providing a sample, such as an isolated biological sample from a subject, comprising nucleosomes;

[0245] (b) providing a control material at various concentrations to create a polynucleosome reference standard, wherein the control material comprises a polynucleosome comprising four or more repeating units and the one or more nucleosome modifications to be quantified;

[0246] (c) adding one or more binding agents to the sample and the polynucleosome reference standard, wherein the binding agent targets the one or more nucleosome modifications;VOL-C-P3866PCT

[0247] (d) performing an affinity reagent-based assay to measure the quantity or concentration of the one or more nucleosome modifications in the sample and the polynucleosome reference standard; and

[0248] (e) quantifying the abundance of the one or more nucleosome modifications by comparing the relative abundance in the sample to the polynucleosome reference standard;

[0249] wherein a change in quantity or concentration of the one or more nucleosome modifications in the presence and absence of the agent identifies an agent that modifies the epigenetic status.

[0250] Clause 38. A method of determining the specificity of a detection reagent for a core histone and / or DNA modification target epitope, comprising using a control material comprising a polynucleosome comprising four or more repeating units and comprising the core histone and / or DNA modification target epitope.

[0251] Clause 39. The method according to clause 37, wherein the one or more nucleosome modifications are associated with a disease or disorder.

[0252] Clause 40. The method according to any preceding clause, wherein a combination of polynucleosomes of different repeating unit lengths is used.

[0253] Clause 41. A recombinant polynucleosome comprising an endogenous nucleotide sequence and wherein the recombinant polynucleosome comprises four or more repeating units, optionally wherein the endogenous nucleotide sequence comprises a mutation associated with increased risk of cancer.

[0254] Clause 42. An isolated polynucleosome comprising four or more repeating units.

[0255] Clause 43. A kit for use in a method according to any one of clauses 1 to 40, the kit comprising a control material comprising a polynucleosome comprising four or more repeating units.

[0256] It will be understood that all embodiments described herein may be applied to all aspects of the invention.

[0257] Other features and advantages of the present invention will be apparent from the description provided herein. It should be understood, however, that the description and the specific examples while indicating preferred embodiments of the invention are given by way ofVOL-C-P3866PCT

[0258] illustration only, since various changes and modifications will become apparent to those skilled in the art.

[0259] The present invention will now be illustrated by the following examples.

[0260] EXAMPLES

[0261] Example 1 - Preparation of a polynucleosome

[0262] Recombinant H3.1 tetranucleosomes were prepared by the assembly of recombinant octamers, composed by two copies of the recombinant histone proteins H2A, H2B, H3.1 and H4, together with Tetra-DNA by salt dialysis. Tetra-DNA is a 780bp sequence in which 4 replicates of a 147bp sequence are used (wherein each 147bp sequence wraps around a recombinant octamer), spaced by linker sequences.

[0263] Tetra-DNA was joined to pGEM®-T Easy vector and transformed into DH5alpha bacteria to be amplified. Once purified, plasmids were double digested using EcorV-HF (high-fidelity) restriction enzyme and Tetra-DNA was separated from the vector by anion exchange chromatography using a low NaCI gradient slot.

[0264] The chromatogram showed 2 separated peaks in the slow NaCI window, the first one (containing the Tetra-DNA) is of interest, whereas the second peak is the plasmid back bone (Figure 1A). The agarose gel results showed a perfect insert / plasmid separation and purifications (Figure 1B).

[0265] Tetra-DNA produced once validated was used for nucleosome assembly. Tetranucleosome confirmation was analysed by native electrophoresis using TBE gel (Figure 2A).

[0266] Tetranucleosome functionality was tested on IDS-i10 (an automated immunoanalyser provided by Immunodiagnostic Systems (IDS), UK) using the Nu.Q® H3.1 assay (Belgian Volition SRL, Belgium) (Figure 2B).

[0267]

[0268] 2 - Stability of standards

[0269] Tetranucleosomes were used to generate standard curves. As for mononucleosomes, tetranucleosomes were diluted in lyophilization buffer at different concentrations and freeze-dried. The tetranucleosome standard curve was tested on IDS-i10 using the Nu.Q® H3.1 assay.VOL-C-P3866PCT

[0270] The tetranucleosome standard curve was then tested in an accelerated stability study for 4 weeks at varying temperatures, the results of which are depicted in Figures 3A-3C.

[0271] Based on the Arrhenius Equation, the results indicate that the tetranucleosome standard curve was stable for around 6 months at 4°C.

[0272] Example 3 - Polynucleosome behaves as native nucleosome in canine and human plasma Tetranucleosomes were diluted at different concentrations in lyophilisation buffer and in plasma to generate a recombinant H3.1 tetranucleosome standard curve. Their concentration was based on DNA concentration and not functional concentration. Several EDTA plasma were tested on I DS-i10 using Nu.Q® H3.1 Canine ChLIA assay. Plasma EDTA concentration was determined using a recombinant H3.1 mononucleosome standard. The results are presented in Figure 4 and show that the tetranucleosome standard is behaving equivalently to the circulating native human nucleosomes in plasma.

[0273] REFERENCES

[0274] Bouazoune et al, Nucleic Acids Research, 37(16): 5279-5294, (2009). doi:10.1093 / nar / gkp524

[0275] Dyer et al, Methods in Enzymology, 375: 23-44, (2004). doi: 10.1016 / s0076-6879(03)75002-2.

[0276] Flaus and Owen-Hughes, The FEBS Journal, 278(19): 3579-3595, (2011). doi: 10.1111 / j.1742-4658.2011.08281.x.

[0277] Holdenrieder and Stieber, Critical Reviews in Clinical Laboratory Sciences, 46(1): 1-24, 2009. doi: 10.1080 / 10408360802485875

[0278] Huang et al, 2021 Huang et al, Signal Transduction and Target Therapy. 6: 386 (2021). doi: 10.1038 / S41392-021 -00780-4

[0279] Kornberg, Science, 184(4139): 868-871, (1974). doi: 10.1126 / science.184.4139.868 Van Holde et al, Nucleic Acids Research, 1(11): 1579-1586, (1974). doi: 10.1093 / nar / 1.11.1579

[0280] Marino-Ramirez et al, Database, 2011. doi: 10.1093 / database / bar048 http: / / genome.nhgri.nih.gov / histones / complete.shtml

[0281] Olins and Olins, Science, 183(4122): 330-332, (1974). doi: 10.1126 / science.183.4122.330 Sadeh et al, Molecular Cell, 63(6): 1080-1088, (2016). doi: 10.1016 / j.molcel.2016.07.023 Salgame et al, Nucleic Acids Research, 25(3): 680-681, (1997). doi: 10.1093 / nar / 25.3.680 Thomas & Kornberg, Proceedings of the National Academy of Sciences USA, 72(7): 2626-2630, (1975). doi: 10.1073 / pnas.72.7.2626VOL-C-P3866PCT

[0282] van Nieuwenhuijze et al, Annals of the Rheumatic Diseases, 62(1): 10-14, (2003). doi: 10.1136 / ard.62.1.10

[0283] Woodcock et al, Experimental Cell Research, 97(1): 101-110, (1976). doi: 10.1016 / 0014-4827(76)90659-5

[0284] Zhao and Garcia, Cold Spring Harbor Perspectives in Biology, 7(9), (2015). doi: 10.1101 / cshperspect.a025064

Claims

VOL-C-P3866PCTCLAIMS1. A method for assessing the performance of an assay which detects a nucleosome, a histone associated with a nucleosome or DNA associated with a nucleosome, comprising the steps of:(a) preparing a sample containing a known concentration of a control material, wherein the control material comprises a polynucleosome comprising four or more repeating units;(b) performing the assay on the sample prepared in step (a); and(c) assessing the performance of the assay by comparing the results obtained by performing step (b) against the known concentration of the control material.

2. A method for quantifying the amount of a nucleosome, a histone associated with a nucleosome or DNA associated with a nucleosome, in a sample, comprising the steps of:(a) performing an assay which detects a nucleosome, a histone associated with a nucleosome or DNA associated with a nucleosome; and(b) quantifying the amount of nucleosome, histone associated with the nucleosome or DNA associated with the nucleosome in the sample by comparing the result obtained in step (a) against the result obtained from performing the assay on a sample containing a known concentration of a control material, wherein the control material comprises a polynucleosome comprising four or more repeating units.

3. A method for quantifying the amount of a nucleosome, a histone associated with a nucleosome or DNA associated with a nucleosome, in a sample, the method comprising:(a) providing a control material at various concentrations to create a reference standard, wherein the control material comprises a polynucleosome comprising four or more repeating units;(b) adding a binding agent to a sample to perform an assay to measure the amount of nucleosome, histone associated with the nucleosome or DNA associated with the nucleosome, in the sample; and(c) quantifying the amount of nucleosome, or histone associated with the nucleosome or DNA associated with the nucleosome in the sample by measuring the amount of binding agent bound in the sample and comparing the amount to the reference standard.

4. A method for the measurement of the amount or concentration of nucleosomes, a histone associated with nucleosomes or DNA associated with nucleosomes, in a sample, the method comprising:(a) contacting a sample with a binding agent to the nucleosomes, histone or DNA;38VOL-C-P3866PCT(b) measuring a parameter or degree of binding of the binding agent to the nucleosome, histone or DNA, using an instrument adapted for conducting the measurement;(c) comparing the parameter or degree of binding obtained in step (b) with standardisation data; and(d) using the comparison in step (c) to convert the parameter or degree of binding measured in step (b) into an amount or concentration of nucleosomes, histone or DNA present in the sample based on a known amount or concentration of a control material, wherein the control material comprises a polynucleosome comprising four or more repeating units.

5. The method according to claim 4, wherein the standardisation data is retrieved electronically from the remote location.

6. The method according to any preceding claim, wherein the polynucleosome is a tetranucleosome or a pentanucleosome.

7. The method according to any preceding claim, wherein the control material is used at various concentrations to create a reference standard, which optionally is created separately from the sample.

8. The method according to any preceding claim, wherein the polynucleosome is a recombinant polynucleosome or a biologically derived polynucleosome.

9. The method according to claim 8, wherein the recombinant polynucleosome is prepared by associating core histones of two or more nucleosomes, and optionally a linker histone and / or nucleic acid.

10. The method according to any preceding claim, wherein the polynucleosome contains a specified histone variant, optionally wherein the histone variant is H3.1 or H3.3.

11. The method according to any preceding claim, wherein the method involves quantifying the abundance of a nucleosome modification in a biological sample.

12. The method according to claim 11, wherein the nucleosome modification is a histone post translational modification, a nucleotide modification, a modified nucleotide or a proteinnucleosome adduct.

13. The method according to any preceding claim, wherein the assay is an immunoassay.39VOL-C-P3866PCT14. The method according to claim 13, wherein the assay employs a single binding agent or wherein the assay is a 2-site immunometric assay employing two binding agents.

15. The method according to any preceding claim, wherein the sample is a biological sample such as a human or animal body fluid sample, for example a blood, serum, plasma, cerebrospinal fluid, urine, faeces, sputum or saliva sample.

16. The method according to any one of claims 3 and 4 and claims dependent thereon, wherein the reference standard is created in a pre-calibration step, optionally wherein the precalibration is factory calibration.

17. A method for assessing the performance of a DNA sequencing assay which detects a target endogenous nucleotide sequence, comprising the steps of:(a) preparing a sample comprising a known concentration of a control material, wherein the control material comprises a polynucleosome having four or more repeating units, wherein the polynucleosome comprises the target endogenous nucleotide sequence or a fragment thereof;(b) performing the DNA sequencing assay on the sample prepared in step (a); and (c) assessing the performance of the DNA sequencing assay by comparing the results obtained by performing step (b) against the known concentration of the control material.

18. A method for the analysis of DNA in a sample, wherein said analysis is calibrated using a control material comprising a polynucleosome comprising four or more repeating units, wherein the polynucleosome comprises a target endogenous nucleotide sequence, optionally wherein the target endogenous nucleotide sequence comprises a mutation associated with increased risk of cancer.

19. A method of screening for an agent suitable for modifying the epigenetic status of one or more nucleosome modifications from a biological sample of a subject, the method comprising determining the quantity or concentration of one or more nucleosome modifications in the presence and absence of the agent, wherein determining the quantity or concentration of the one or more nucleosome modifications comprises:(a) providing a sample, such as an isolated biological sample from a subject, comprising nucleosomes;(b) providing a control material at various concentrations to create a polynucleosome reference standard, wherein the control material comprises a polynucleosome comprising four or more repeating units and the one or more nucleosome modifications to be quantified;40VOL-C-P3866PCT(c) adding one or more binding agents to the sample and the polynucleosome reference standard, wherein the binding agent targets the one or more nucleosome modifications;(d) performing an affinity reagent-based assay to measure the quantity or concentration of the one or more nucleosome modifications in the sample and the polynucleosome reference standard; and(e) quantifying the abundance of the one or more nucleosome modifications by comparing the relative abundance in the sample to the polynucleosome reference standard;wherein a change in quantity or concentration of the one or more nucleosome modifications in the presence and absence of the agent identifies an agent that modifies the epigenetic status.

20. The method according to claim 19, wherein the one or more nucleosome modifications are associated with a disease or disorder.

21. A method of determining the specificity of a detection reagent for a core histone and / or DNA modification target epitope, comprising using a control material comprising a polynucleosome comprising four or more repeating units and comprising the core histone and / or DNA modification target epitope.

22. The method according to any preceding claim, wherein a combination of polynucleosomes of different repeating unit lengths is used.

23. A recombinant polynucleosome comprising an endogenous nucleotide sequence and wherein the recombinant polynucleosome comprises four or more repeating units, optionally wherein the endogenous nucleotide sequence comprises a mutation associated with increased risk of cancer.

24. An isolated polynucleosome comprising four or more repeating units.

25. A kit for use in a method according to any one of claims 1 to 22, the kit comprising a control material comprising a polynucleosome comprising four or more repeating units.