Methods and compounds to address ageing

Abstract

The invention relates to the use of miR-22 inhibitors for achieving broad, multi-system improvements in organismal aging, including enhanced cognitive and physical performance, slowed aging-score progression, stabilized metabolic trajectories, and increased survival.

Description

[0001] P1798PC00

[0002] - 1 -

[0003] METHODS AND COMPOUNDS TO ADDRESS AGEING FIELD OF THE INVENTION

[0004] The present invention is focused on targeting a non-coding RNA to address ageing, wherein microRNA-22 is targeted using a modified antisense oligonucleotide compound.

[0005] BACKGROUND

[0006] MicroRNAs (miRNA or miR) are nucleic acid molecules that regulate the expression of target genes. MiRNAs are typically short (typically 18-24 nucleotides) and act as repressors of target mRNAs by promoting their degradation, when their sequences are perfectly complementary, and / or by inhibiting translation, when their sequences contain mismatches. Functional analyses of miRNAs have revealed that these small, non-coding RNAs contribute to different physiological and metabolic processes.

[0007] WO2006137941 describes a method and a composition for reducing or inhibiting the cell growth, a method for inducing or increasing the cell growth, a method for decreasing the cell survival rate, a method for increasing the cell survival rate, a method for increasing apoptosis of cells, and a method for inhibiting apoptosis of cells, which methods comprise the step of introducing an effective amount of a specific synthetic miRNA molecule to cells. More particularly, it is described that (hsa-)miR-22 is a miRNA which significantly decreases the number of livings A549 cells (human lung cancer cells) and significantly increases the percentage of apoptotic cells. Further, a method for treating cancer in a subject, which method uses such a function and comprises the step of ad ministration of an effective amount of a synthetic miRNA molecule corresponding to (hsa-)miR-22 to the subject, is described.

[0008] The mechanism and meaning of the induction of cellular senescence due to replication, including the relationship with aging of individuals, have been controversial for a long time. This is because cellular senescence is considered to be an important biological defense mechanism along with apoptosis, and a new application of cellular senescence to cancer therapy is therefore expected.

[0009] EP2518144 describes that the gene transcript of (hsa-)miR-22 is highly expressed in senescent human fibroblasts.

[0010] WO2019178411 and W02019178410 describe compositions comprising miR-22 inhibitors, among these LNA10 (SEQ ID NO: 8), and their use in treating metabolic disorders.

[0011] There are currently no approved or effective therapeutic approaches for treatment of senescence. Ageing is considered irreversible and the only few options available to slow down or revert this process are based on dietary intervention or pharmacological targeting of specificP1798PC00

[0012] -2-

[0013] proteins involved in the mTOR molecular pathway.

[0014] DESCRIPTION

[0015] It forms an object of the present invention a method to address senescence and ageing by targeting miR-22.

[0016] DESCRIPTION OF THE DRAWINGS

[0017] Figure 1: inhibition of miR-22 in BJ fibroblasts while reaching replicative senescence; (VHL= control; LNA10 = 0,5 pM LNA10).

[0018] Figure 2: LNA10 treatment effect of replicative senescence on middle (A) and late (B) passage BJ fibroblasts.

[0019] Figure 3: miR-22 and miR-22 direct targets expression fold change over time.

[0020] Figure 4: (A, B, C) senescence marker expression.

[0021] Figure 5: (A, B, C, D) inflammatory chemokines and cytokines expression.

[0022] Figure 6: (A, B, C, D) inflammatory chemokines and cytokines expression.

[0023] Figure 7: (A, B) chromatin modulators expression.

[0024] Figure 8: body weight over time in the senescence-accelerated SAMP8 mouse model.

[0025] Figure 9: pharmacodynamic effects of LNA10 in the senescence-accelerated SAMP8 mouse model. (A) cognitive performance assessed using the Novel Object Recognition (NOR) test at week 8; (B) aging scores.

[0026] Figure 10: body weight over time in wild-type mice.

[0027] Figure 11: long-term effect of LNA10 under caloric restriction in obese mice. (A) schematic representation of the experimental protocol; longitudinal analysis of (B) body weight and (C) body weight change (%) following treatment initiation; (D) Kaplan–Meier survival analysis and (E) food intake throughout the study. Data are shown as mean ± SEM.

[0028] Figure 12: chronic LNA10 treatment improves cognitive performance in aged obese mice. (A) schematic representation of the experimental protocol; behavioral assessment using the NOR test was performed after 48 weeks of treatment in initially obese mice subjected to calorie restriction alone (Gl: WHL, n = 7) or calorie restriction plus LNA10 (G2: RES-010, n = 9) (B) exploration of the novel object; (C) number of object explorations; and (D) recognition index. Data are shown asP1798PC00

[0029] -3 -individual values with mean ± SEM.

[0030] Figure 13: long-term effect of LNA10 on Chow Diet mice. (A) schematic representation of the experimental protocol; longitudinal analysis of (B) body weight and (C) body weight change (%) following treatment initiation.

[0031] Figure 14: long-term effects of LNA10 on physical performance and aging parameters in lean C57BL / 6J mice. Aging progression was monitored longitudinally using a composite aging score (A); physical performance was assessed using treadmill testing at day 78 relative to baseline (B). Data are presented as mean ± SEM.

[0032] DETAILED DESCRIPTION

[0033] The approach here described targets miR-22 to treat senescence and ageing. Surprisingly, this approach revealed effective in modulating several genes implicated in molecular pathways that are associated with senescence. The experiments performed to evaluate tolerability and safety in rodents and non-human primates demonstrate this therapy is safe and well tolerated.

[0034] Without being bound by theory, mature miRNAs are believed to be generated by pol II or pol III and arise from initial transcripts termed pri-miRNAs. These pri-miRNAs are frequently several thousand bases long and are therefore processed to make much shorter mature miRNAs. These pri-miRNAs may be multicistronic and result from the transcription of several clustered sequences that organize what may develop into many miRNAs. The processing to yield miRNAs may be two-steps. First, pri-miRNAs may be processed in the nucleus by the RNase Drosha into about 70- to about 100-nucleotide hairpin-shaped precursors (pre-miRNAs). Second, after transposition to the cytoplasm, the hairpin pre-miRNAs may be further processed by the RNase Dicer to produce a double-stranded miRNA. The mature miRNA strand may then be incorporated into the RNA-induced silencing complex (RISC), where it may associate with its target mRNAs by base-pair complementarity and lead to suppression of protein expression. The other strand of the miRNA duplex that is not preferentially selected for entry into a RISC silencing complex is known as the passenger strand or minor miRNA or star (*) strand. This strand may be degraded. It is understood that, unless specified, as used herein a miRNA may refer to pri-and / or pre- and / or mature and / or minor (star) strand and / or duplex version of miRNA.

[0035] In some embodiments, miRNA genes may be located within introns of protein-coding genes or within introns or exons of noncoding transcriptional units. The expression of intronic miRNAs may coincide with that of the hosting transcriptional units because they are typically oriented in the same direction and are coordinately expressed with the pre-mRNAs in which they reside.

[0036] In some embodiments, miRNAs may bind to sequences within the 3' untranslated regionP1798PC00

[0037] -4 -

[0038] (3'UTR) of target gene transcripts. In some embodiments, miRNAs may bind to sequences outside of the 3'UTR of target gene transcripts. In some embodiments, miRNAs may bind to both within and outside the 3'UTR of target gene transcripts.

[0039] In some embodiments, nucleotide pairing between the second and seventh nucleotides of the miRNA (the miRNA seed sequence) and the corresponding sequence along the target 3'UTR (seed match) may occur for target recognition. Accordingly, the binding between miRNA and target may comprise about a 5-nucleotide base pairing. Additionally, the binding between miRNA and target may comprise more than a 5-nucleotide base pairing. In some embodiments, the binding between a miRNA and the gene that it regulates may be mediated by the miRNA binding up to 2, up to 4, up to 6, up to 8, or up to 10 sites of the target nucleic acid.

[0040] MiR-22 is highly conserved across many vertebrate species, including chimpanzee, mouse, rat, dog and horse. This level of conservation suggests functional importance. MiR-22 was previously identified as having a role in erythrocyte maturation and later as having a role in oncogenesis. MiR-22 directly targets phosphatase and tensin homolog (PTEN) and tet methyl cytosine dioxygenase (TET) to promote tumorigenesis, metastasis, and metabolic disorders. In some embodiments, the nucleic acids of the present invention increase the activity and / or expression of PTEN and / or TET2.

[0041] The predicted miR-22 hairpin precursor is contained entirely within exon 2 of a noncoding transcript, CI7orf91, and the splicing pattern is generally conserved in human and mouse, despite the lack of protein-coding potential. See Rodriguez et al., Identification of mammalian microRNA host genes and transcription units. Genome Res. 2004 Oct; 14(10A): 1902-10. Deletion of exon 2 of C17orf91 encompassing mir-22 in mouse models has revealed that miR-22 may play a role in cardiac hypertrophy and remodeling by targeting SIRT1 (NAD-dependent deacetylase sirtuin-1), HDAC4 (histone deacetylase 4), PURE (purine-rich element binding protein B) and PTEN. See Huang et al., MicroRNA-22 regulates cardiac hypertrophy and remodeling in response to stress. Circ Res. 2013 Apr 26; 112(9):1234-43.

[0042] In embodiments, an inhibitor of miRNA is a nucleic acid that acts as an antisense oligonucleotide. Nucleic acids of the present invention can include ribonucleotides or deoxyribonucleotides or a combination thereof. Nucleic acids of the present invention may have at least one chemical modification (non-limiting examples are sugar or backbone modifications, e.g., a Locked Nucleic Acid (LNA)).

[0043] In embodiments, the sequence of a nucleic acid that inhibits miR-22 is conserved across species. In embodiments, the sequence of the nucleic acid is complementary, in part, to the sequence of human miR-22. In embodiments, the inhibitor is selected to reduce the expression and / or activity of the target miR-22 in a cell or a subject.P1798PC00

[0044] -5- In embodiments, nucleic acids of the present invention inhibit human miR-22. In embodiments, human miR-22 comprises or consists of AAGCUGCCAGUUGAAGAACUGU (SEQ ID NO: 1).

[0045] In embodiments, the nucleic acids of the present invention are about 8 to about 20 residues in length (e.g., about 8-18, or about 8-16, or about 8-14, or about 8-12, or about 8-10, or about 10-18, or about 10-16, or about 10-14, or about 10-12 residues in length). In embodiments, the nucleic acids are about 8, or about 9, or about 10, or about 11, or about 12 residues in length.

[0046] In embodiments, nucleic acids of the present invention bind with complete homology to a portion of miR-22. For example, the nucleic acid of the present invention may be 18 residues in length and each of the 18 residues is complementary to a nucleotide of miR-22. Alternately, the nucleic acids of the present invention bind with complete homology to a portion of miR-22. For example, for a nucleic acid of the present invention may be 16 residues in length and only 15 or fewer of the residues are complementary to a nucleotide of miR-22.

[0047] In embodiments, a nucleic acid of the present invention differs from a portion of miR-22 at one position, at two positions, at three positions, at four positions, at five positions, or at more than five positions.

[0048] In embodiments, a nucleic acid of the present invention binds to miR-22 with sufficient affinity to inhibit it. In embodiments, the nucleic acids bind to miR-22 with a high affinity (e.g. nM affinity). Thus, the nucleic acid of the present invention binds to miR-22 with a high affinity even if it differs from a portion of miR-22 at one or more positions.

[0049] The nucleic acid of the present invention may have a sequence comprising tggcagct (SEQ ID NO: 2) and comprising at least one locked nucleic acid (LNA) modification.

[0050] In a locked nucleic acid (LNA) the nucleic acid's ribose moiety is modified with an extra bridge connecting the 2' oxygen and 4' carbon, which locks the ribose in the 3'-endo conformation.

[0051] Nucleic acids of the present invention, and comprising LNAs, provide cost-effective agents that can be delivered efficiently and possess sufficient bioavailability for the treatment and prevention of various disorders.

[0052] In embodiments, the nucleic acid of the present invention includes at least 2 LNA modifications towards its 3' end (e.g., about 2, or about 3, or about 4, or about 5 modifications towards its 3' end). In embodiments, the nucleic acid comprises tggcagct (SEQ ID NO: 2), and at least 6 LNA modifications or at least 8 LNA modifications.

[0053] For example, the nucleic acid comprises LNA modifications at positions 7 and 8 of tggcagct (SEQ ID NO: 2). In embodiments, a nucleic acid of the present invention includes no more than 4 sequential LNA modifications (e.g., only 2, or 3, or 4 sequential LNA modifications).P1798PC00

[0054] - 6 -

[0055] In embodiments, a nucleic acid of the present invention includes no more than 3 sequential unmodified residues (e.g., only 3, or 2, or 1 unmodified residue). In embodiments, nucleic acid of the present invention includes no less than 4 LNA modifications. In embodiments, the nucleic acid comprises about 8 to about 12 LNA modifications, e.g., about 8, or about 9, or about 10, or about 11, or about 12 LNA modifications.

[0056] In embodiments, the nucleic acid comprises or consists of a nucleic acid having a sequence selected from: tggcagct (SEQ ID NO: 2), cttcaactggcagct (SEQ ID NO: 3), tcttcaactggcagct (SEQ ID NO: 4), ttcttcaactggcagct (SEQ ID NO: 5), and gttcttcaactggcagct (SEQ ID NO: 6). In embodiments, the nucleic acid comprises a nucleic acid having a sequence selected from: tggcagct (SEQ ID NO: 2), cttcaactggcagct (SEQ ID NO: 3), tcttcaactggcagct (SEQ ID NO: 4), ttcttcaactggcagct (SEQ ID NO: 5), and gttcttcaactggcagct (SEQ ID NO: 6) and comprising about 8 to about 12 LNA modifications, e.g., about 8, or about 9, or about 10, or about 11, or about 12 LNA modifications.

[0057] In embodiments, the nucleic acid comprises or consists of cttcaactggcagct (SEQ ID NO: 3), and at least 6 LNA modifications, at least 8 LNA modifications, or at least 10 LNA modifications. In embodiments, the nucleic acid comprises or consists of cttcaactggcagct (SEQ ID NO: 3), and 8 LNA modifications, said modifications being at positions 1, 3, 6, 7, 10, 12, 14, and 15; for example, the nucleic acid comprises or consists of the sequence CtTcaACtgGcAgCT (SEQ ID NO: 7), where capital letters are LNA modified and lower case are unmodified. In embodiments, the nucleic acid comprises or consists cttcaactggcagct (SEQ ID NO: 3), and 10 LNA modifications, said modifications being at positions 1, 2, 3, 6, 7, 10, 11, 12, 14, and 15; for example, the nucleic acid comprises or consists of the sequence CTTcaACtgGCAgCT (SEQ ID NO: 8), where capital letters are LNA modified and lower case are unmodified.

[0058] In embodiments, the nucleic acid comprises or consists of tcttcaactggcagct (SEQ ID NO: 4), and at least 8 LNA modifications, at least 10 LNA modifications, or at least 11 LNA modifications. In embodiments, the nucleic acid comprises or consists of tcttcaactggcagct (SEQ ID NO: 4), and 10 LNA modifications, said modifications being at positions 1, 2, 4, 8, 10, 11, 12, 13, 15, and 16; for example, the nucleic acid comprises or consists of the sequence TCtTcaaCtGGCAgCT (SEQ ID NO: 10), where capital letters are LNA modified and lower case are unmodified. In embodiments, the nucleic acid comprises or consists of tcttcaactggcagct (SEQ ID NO: 4), and 11 LNA modifications, said modifications being at positions 1, 2, 4, 5, 6, 8, 11, 12, 13, 15, and 16; for example, the nucleic acid comprises or consists of the sequence TCtTCAaCtgGCAgCT (SEQ ID NO: 9), where capital letters are LNA modified and lower case are unmodified.

[0059] In embodiments, the nucleic acid comprises or consists of tcttcaactggcagct (SEQ ID NO: 4), and 11 LNA modifications, said modifications being at positions 1, 2, 4, 5, 6, 9, 11, 12, 13, 15, and 16; for example, the nucleic acid comprises or consists of the sequence TCtTCAacTgGCAgCTP1798PC00

[0060] -7- (SEQ ID NO: 11), where capital letters are LNA modified and lower case are unmodified.

[0061] In embodiments, the nucleic acid comprises or consists of ttcttcaactggcagct (SEQ ID NO: 5), and at least 10 LNA modifications or at least 11 LNA modifications. In embodiments, the nucleic acid comprises or consists of ttcttcaactggcagct (SEQ ID NO: 5), and 11 LNA modifications, said modifications being at positions 1, 2, 5, 6, 7, 10, 12, 13, 14, 16, and 17; for example, the nucleic acid comprises or consists of the sequence TTctTCAacTgGCAgCT (SEQ ID NO: 12), where capital letters are LNA modified and lower case are unmodified.

[0062] In embodiments, the nucleic acid comprises or consists of gttcttcaactggcagct (SEQ ID NO: 6), and at least 9 LNA modifications or at least 10 LNA modifications. In embodiments, the nucleic acid comprises or consists of gttcttcaactggcagct (SEQ ID NO: 6), and 9 LNA modifications, said modifications being at positions 1, 2, 6, 10, 13, 14, 16, 17, and 18; for example, the nucleic acid comprises or consists of the sequence GTtctTcaaCtgGCaGCT (SEQ ID NO: 13), where capital letters are LNA modified and lower case are unmodified.

[0063] In embodiments, the nucleic acid comprises or consists of a nucleic acid having a sequence selected from: tggcagct (SEQ ID NO: 2), gttcttcaactggcagct (SEQ ID NO: 6), and comprising about 8 to about 12 LNA modifications, e.g., about 8, or about 9, or about 10, or about 11, or about 12 LNA modifications.

[0064] In embodiments, the nucleic acid comprises or consists of gttcttcaactggcagct (SEQ ID NO: 6), and at least 9 LNA modifications, or at least 10 LNA modifications, or at least 11 LNA modifications, or at least 12 LNA modifications.

[0065] In an embodiment, the nucleic acid comprises at least 10, or at least 11, or at least 12 locked nucleic acid (LNA) modifications.

[0066] In an embodiment, the nucleic acid comprises 10 or 11 locked nucleic acid (LNA) modifications.

[0067] In an embodiment, the nucleic acid consists of gttcttcaactggcagct (SEQ ID NO: 6), and comprises 10 or 11 modifications, said modifications being at least at positions 1, 2, 6, 11, 17, 18.

[0068] In an embodiment, the nucleic acid consists of gttcttcaactggcagct (SEQ ID NO: 6), and comprises 11 modifications, said modifications being at least at positions 1, 2, 5, 6, 11, 14, 17, 18.

[0069] In an embodiment, the nucleic acid consists of gttcttcaactggcagct (SEQ ID NO: 6), and at least one PS (Phosphorothioate) linkage has been substituted with one PO (Phosphine Oxide) linkage.

[0070] In an embodiment, the nucleic acid consists of gttcttcaactggcagct (SEQ ID NO: 6) and one PS linkage has been substituted with one PO linkage.P1798PC00

[0071] -8 - In an embodiment said PO linkage is at least at positions 6, 8, 10, or 14.

[0072] In an embodiment, said PO linkage is only one and it is at position 6, 10, or 14.

[0073] For example, the nucleic acid comprises or consists of the sequence GTTctTcAAcTGgCAgCT (SEQ ID NO: 16), where capital letters are LNA modified and lower case are unmodified.

[0074] For example, the nucleic acid comprises or consists of the sequence GTtcTTCaAcTGgCagCT (SEQ ID NO: 17), where capital letters are LNA modified and lower case are unmodified.

[0075] For example, the nucleic acid comprises or consists of the sequence GTtcTTcAaCTGgCAgCT (SEQ ID NO: 18), where capital letters are LNA modified and lower case are unmodified.

[0076] For example, the nucleic acid comprises or consists of the sequence GTtCtTcAaCTggcAgCT (SEQ ID NO: 19), where capital letters are LNA modified and lower case are unmodified.

[0077] For example, the nucleic acid comprises or consists of the sequence GTtcTTcAaCtgGCAgCT (SEQ ID NO: 20), where capital letters are LNA modified and lower case are unmodified.

[0078] For example, the nucleic acid comprises or consists of the sequence G*T*t*c*T*TC*a*A*c*T*G*g*C*a*g*C*T (SEQ ID NO: 21), where capital letters are LNA modified and lower case are unmodified, the * symbol indicates PS linkages, while the absence of the * symbol indicates PO linkages.

[0079] For example, the nucleic acid comprises or consists of the sequence Q^*^* *^*c*^*a*( ' ’*g*g*c*jZy*g*( *y (SEQ ID NO: 22), where capital letters are LNA modified and lower case are unmodified, the * symbol indicates PS linkages, while the absence of the * symbol indicates PO linkages.

[0080] For example, the nucleic acid comprises or consists of the sequence Q^*^*c*y*y*c*^*a*Q*^*g*Q*(2j^*g*(2*' ’ (SEQ ID NO: 23), where capital letters are LNA modified and lower case are unmodified, the * symbol indicates PS linkages, while the absence of the * symbol indicates PO linkages.

[0081] In addition to the in vitro activity, the inventors evaluated the systemic activity of miR-22 inhibition in multiple in vivo models of physiological, accelerated, and in long term treatment on a diet-induced aging model. Surprisingly, chronic administration of anti-mR22 demonstrated robust beneficial effects on organism-level parameters classically associated with aging,P1798PC00

[0082] -9-including body-weight trajectories, cognitive performance, senescence progression, physical function, and survivorship. These results confirm that miR-22 inhibition not only modulates cellular senescence pathways in vitro but also delays functional decline and mitigates health span deterioration in vivo.

[0083] The SAMP8 mouse strain represents a spontaneously derived model of accelerated physiological aging. SAMP8 mice display a constellation of age-associated phenotypes, including early cognitive decline, impaired learning and memory, neuroinflammatory activation, and progressive neuropathological alterations characteristic of sporadic neurodegenerative processes. These attributes render the SAMP8 model particularly suitable for evaluating pharmacological interventions targeting aging, senescence, and age-related functional deterioration. The here claimed approach to address senescence has been therefore tested in vivo in the SAMP8 mouse model.

[0084] SAMP8 animals subjected to vehicle treatment exhibited the characteristic progressive weight loss associated with their accelerated aging phenotype. In contrast, mice receiving a miR-22 inhibitor showed stabilization of body weight and reduced decline over time. This pattern indicates that miR-22 inhibition mitigates the pathological metabolic deterioration normally observed in this model and contributes to preservation of systemic homeostasis.

[0085] In the same model, cognitive performance was tested via the well-known Novel Object Recognition (NOR) test at week 8, with treated animals demonstrating increased exploration of the novel object and higher discrimination indices relative to controls. This finding demonstrates a reduction in the rate of organism-level senescence and confirms a beneficial effect of miR-22 inhibition on functional aging in an accelerated-aging model.

[0086] To assess long term effects induced by exposure to anti-miR-22, a preliminary safety test has been performed on wild type mice, where body-weight was measured during anti-miR-22 chronic treatment. No deviations from normal weight maintenance were detected, indicating that miR-22 inhibition does not induce metabolic dysregulation in healthy animals.

[0087] Confirmed the safety and tolerability of long-term administration of miR-22 inhibitors, long-term experiments were performed on mice.

[0088] Anti-miR-22 treated animals initially obese maintained a more pronounced and sustained reduction in body weight and weight-change percentage compared to calorie-restricted controls. Anti-miR-22 treated animals remained alive throughout the 54-week observation period, despite extensive weight loss, demonstrating preserved physiological resilience. Food intake remained comparable between groups, indicating that the metabolic benefits of anti-miR-22 do not result from reduced caloric consumption. Overall, these findings indicate that miR-22 inhibition supports metabolic stability and survival under prolonged caloric restriction.P1798PC00

[0089] - 10 - A cognitive test after 48 weeks of treatment in aged obese mice undergoing caloric restriction was performed. Anti-miR-22 treatment improved exploration of the novel object, increased total object interactions, and significantly enhanced the recognition index. These results demonstrate that chronic inhibition of miR-22 restores cognitive performance in aged animals with a history of obesity, further supporting a beneficial effect on brain aging.

[0090] Body-weight analyses were then performed in lean chow-fed mice chronically treated with anti-miR-22. " Lean chow-fed mice" are mice maintained on a standard, nutritionally balanced rodent chow diet composed of natural grain-based ingredients and vitamin / mineral supplements. This diet supports normal physiological weight and metabolic stability, and does not induce obesity, thereby defining these animals as metabolically lean. No significant differences were detected between treatment and control groups, indicating that anti-miR-22 does not alter energy balance in non-metabolically stressed conditions. These data further confirm the favorable safety and tolerability profile of miR-22 inhibition.

[0091] In the same mice, the composite aging score increased more slowly in anti-miR-22-treated animals, reflecting attenuated progression of functional aging. Anti-miR-22-treated mice maintained exercise time and distance close to baseline, whereas vehicle-treated animals showed the expected aging-related decline. These findings indicate that miR-22 inhibition slows the deterioration of physical capacity and contributes to maintenance of healthspan.

[0092] In one embodiment, an expression vector for expressing a nucleic acid of the present invention comprises a promoter operably linked to a polynucleotide encoding the nucleic acid of the present invention. The phrase "operably linked" or "under transcriptional control" as used herein means that the promoter is in the correct location and orientation in relation to a polynucleotide to control the initiation of transcription by RNA polymerase and expression of the polynucleotide.

[0093] As used herein, a promoter refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a gene. Suitable promoters include, but are not limited to, RNA pol I, pol II, pol III, and viral promoters (e.g., human cytomegalovirus (CMV) immediate early gene promoter, the SV40 early promoter, and the Rous sarcoma virus long terminal repeat).

[0094] In certain embodiments, the promoter operably linked to a polynucleotide encoding a nucleic acid of the present invention can be an inducible promoter. Inducible promoters are known in the art and include, but are not limited to, the tetracycline promoter, the metallothionein II A promoter, the heat shock promoter, the steroid / thyroid hormone / retinoic acid response elements, the adenovirus late promoter, and the inducible mouse mammary tumor virus LTR.P1798PC00

[0095] - 11 -

[0096] Methods of delivering expression constructs and nucleic acids to cells are known in the art and can include, by way of non-limiting example, calcium phosphate co-precipitation, electroporation, microinjection, DEAE-dextran, lipofection, transfection employing polyamine transfection reagents, cell sonication, gene bombardment using high velocity microprojectiles, and receptor-mediated transfection.

[0097] An aspect of the present invention provides a host cell comprising any herein-described nucleic acid of the present invention.

[0098] In another aspect, the present invention provides a pharmaceutical composition comprising any herein-described nucleic acid of the present invention and a pharmaceutically acceptable excipient or carrier.

[0099] Where clinical applications are contemplated, pharmaceutical compositions may be prepared in a form appropriate for the intended application. Generally, this will entail preparing compositions that are essentially free of pyrogens, as well as other impurities that could be harmful to humans or animals.

[0100] In one embodiment, a pharmaceutical composition comprises an effective dose of any herein-described nucleic acid of the present invention. An effective dose is an amount sufficient to affect a beneficial or desired clinical result. An effective dose may be from about 1 mg / kg to about 100 mg / kg, about 2.5 mg / kg to about 50 mg / kg, or about 5 mg / kg to about 25 mg / kg. The precise determination of what would be considered an effective dose may be based on factors individual to each patient, including their size, age, type of metabolic disorder, and nature of inhibitor or agonist (non-limiting examples include antagomir, expression construct, antisense oligonucleotide, polynucleotide duplex, etc.). Therefore, dosages can be readily ascertained by those of ordinary skill in the art from this disclosure and the knowledge in the art. For example, doses may be determined with reference Physicians' Desk Reference, 66th Edition, PDR Network; 2012 Edition (December 27, 2011), the contents of which are incorporated by reference in its entirety.

[0101] Surprisingly, the inventors have here established that inhibition of miR-22 gives rise to a broad, integrated, and previously unrecognized set of beneficial effects on organismal aging. Prior publications addressing miR-22 focus narrowly on cardiometabolic contexts, such as cardiac recovery in aged animals following myocardial infarction or attenuation of adipocyte senescence under high-fat diet conditions, and do not suggest any role for miR-22 in modulating functional decline associated with physiological aging. None of the existing disclosures provides any indication that targeting miR-22 could influence the progression of cognitive aging, physical frailty, systemic resilience to chronic metabolic stress, or global healthspan parameters. In stark contrast to the limited and compartmentalized effects described in the prior art, the inventors have demonstrated that miR-22 inhibition exerts wide-ranging, multi-system benefits thatP1798PC00

[0102] - 12 -

[0103] redefine the biological relevance of this microRNA in aging.

[0104] In senescence-accelerated SAMP8 mice, chronic administration of miR-22 inhibitor produced clear and reproducible improvements across multiple independent aging endpoints. Treated animals exhibited a marked attenuation of aging-score progression, indicating a slower deterioration of composite physiological functions. Body-weight trajectories, which typically decline rapidly in this model, were stabilized in treated mice, pointing to preservation of metabolic homeostasis during early and mid-life senescence. Cognitive performance, assessed through the Novel Object Recognition (NOR) test, showed robust enhancement: animals receiving the inhibitor displayed increased exploration of the novel object, higher recognition indices, and overall superior discrimination abilities relative to vehicle-treated controls. These findings demonstrate that miR-22 inhibition modulates brain aging and cognitive decline, effects that were entirely unexpected given the absence of any prior association between miR-22 and cognitive impairment in aging models. Notably, these benefits occurred despite the known complexity of the SAMP8 phenotype, which includes progressive neuroinflammation, synaptic dysfunction, and multi- organ senescence.

[0105] A similarly unexpected pattern emerged in the model of obese mice undergoing long-term caloric restriction. In this setting, miR-22 inhibition resulted in sustained body-weight reduction with preservation of overall physiological resilience, culminating in a significant survival advantage compared to calorie-restricted controls. The ability of miR-22 inhibitors to enhance survival under chronic energetic stress was unforeseen, as prior work had never linked miR-22 to stress tolerance, starvation resilience, or long-term systemic adaptation. Importantly, chronic treatment also improved cognitive performance after 48 weeks, again measured via NOR, revealing that benefits extend to aged animals with a history of metabolic dysregulation. These findings collectively indicate that miR-22 inhibition promotes a unique, coordinated improvement in both metabolic and neurocognitive dimensions of aging, far beyond the restricted metabolic or adipocyte-specific effects reported previously.

[0106] Further evidence of the breadth and robustness of the effect emerged in naturally aging lean chow-fed mice. In this model, long-term treatment with a miR-22 inhibitor led to preserved physical performance, as shown by maintenance of treadmill running time and distance relative to vehicle controls. Treated animals also displayed a slower increase in aging scores, confirming that the intervention exerts broad protective effects even in the context of natural, unmanipulated aging.

[0107] Across these three independent in vivo studies, spanning accelerated aging (SAMP8), metabolically stressed aging (obese calorie-restricted mice), and natural aging (lean chow-fed mice), the inventors observed a consistent and coherent pattern: miR-22 inhibition preserves cognitive function, maintains physical performance, stabilizes metabolic trajectories, slowsP1798PC00

[0108] - 13 -aging-score progression, and enhances survival under stress. These observations establish a previously unrecognized therapeutic paradigm and positions miR-22 inhibition as a unique strategy for integrated, organism- level improvement of aging trajectories.

[0109] EXAMPLES

[0110] In order that the invention disclosed herein may be more efficiently understood, examples are provided below. These examples are for illustrative purposes only and are not to be construed as limiting the invention in any manner.

[0111] Example 1: Design of LNA-modified anti-miR-22 oligonucleotides

[0112] The oligonucleotides were designed to cover the seed sequence, contain between 8 nt and 20 nt in length, have a length-specific fraction of LNAs allowed and as high a binding affinity to miR-22 as possible.

[0113] Design elements included at least 8 LNA modifications in the construct. Further design elements included no more than 4 LNA modifications in a row. Further still design elements included no more than 3 unmodified residues in a row.

[0114] The oligonucleotides were designed to bind to miR-22 with sufficient affinity to inhibit it. Also, the oligonucleotides were designed to have limited or no self-binding affinity (e.g. no or limited duplex or fold structures).

[0115] In the below sequences (comparative), capital letters are LNA-modified and lower-case letters are unmodified; the orientations for the miR-22 (SEQ ID NO: 1) and for the anti-miR-22 oligonucleotides (SEQ ID NO: 2 and SEQ ID NO: 7 to SEQ ID NO: 13) are orientated 5' to 3'. The oligonucleotides of SEQ ID NO: 14 and SEQ ID NO: 15, orientated 5' to 3', are scrambled sequences and do not hybridize to the miR-22 (SEQ ID NO: 1).

[0116] Table 1

[0117] (hsa-) miR-22 AAGCUGCCAGUUGAAGAACUGU (SEQ ID NO: 1)

[0118] CRM0008 TGGCAGCT (SEQ ID NO: 2)

[0119] CRM0009 CtTcaACtgGcAgCT (SEQ ID NO: 7)

[0120] CRM0010 (LNA10) CTTcaACtgGCAgCT (SEQ ID NO: 8)

[0121] CRM0011 TCtTCAaCtgGCAgCT (SEQ ID NO: 9)

[0122]

[0123] P1798PC00

[0124] - 14 -

[0125] CRM0012 TCtTcaaCtGGCAgCT (SEQ ID NO: 10)

[0126] CRM0013 TCtTCAacTgGCAgCT (SEQ ID NO: 11)

[0127] CRM0014 TTctTCAacTgGCAgCT (SEQ ID NO: 12)

[0128] CRM0015 GTtctTcaaCtgGCaGCT (SEQ ID NO: 13)

[0129] CRM0016 CGaATAgTtaGTAgCG (SEQ ID NO: 14)

[0130] CRM0017 FAM labelled-CGaATAgTtaGTAgCG (SEQ ID NO: 15)

[0131] NRC0131 G*T*t*c*T*TC*a*A*c*T*G*g*C*a*g*C*T (SEQ ID NO: 21)

[0132] NRC0133 G*T*t*C*t*T*c*A*a*CT*g*g*c*A*g*C*T (SEQ ID NO: 22)

[0133] NRC0134 G*T*t*c*T*T*c*A*a*C*t*g*G*CA*g*C*T (SEQ ID NO: 23)

[0134]

[0135] In Table 1, capital letters are LNA-modified and lower-case letters are unmodified. To note: in SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 19 the * symbol indicates PS (phosphorothioate) linkages, while the absence of the * symbol indicates PO (phosphodiester) linkages.

[0136] Example 2: Assessment of invitro effect of anti-miR-22 oligonucleotide compounds A human fibroblasts cell lines, BJ, has been used for the experiments. Cells were plated at a density of 17.800 cell / cm2. Cells were treated as follows:

[0137] 1) Vehicle only;

[0138] 2) 0,5 pM scramble LNA;

[0139] 3) 0,5 pM LNA10

[0140] After 96h in colture, a p-gal assay was performed to assess cell viability.

[0141] The expression of miR-22 and of miR-22 targets PPARGC1A, SIRT1, TET2A has been evaluated at early passage (P10), middle passage (P34) and late passage (P50). Results are reported in graph of Figure 1 and show that LNA10 almost completely inhibit miR-22. Moreover, expression of direct targets of miR-22 remains upregulated in fibroblasts from early to late passages.

[0142] BJ fibroblasts were then cultured in 10 cm dish, splitted and 106cells / dish seeded every 4 days. Cells were cultured in complete growth media from P2 to P20. From P21 (62 days), cellsP1798PC00

[0143] -15 -were split in three culture conditions:

[0144] 1) Vehicle only (VHL);

[0145] 2) 0,5 pM scramble LNA (SCR);

[0146] 3) 0,5 pM LNA10 (LNA10).

[0147] P-gal staining of LNA treated and non-treated BJ cells with a fluorescent substrate for the enzyme at different cell passages was performed, demonstrating a progressive increase in the number of senescent cells that correlates with a flattening of the growth curve. LNA10 treatment is more efficacious in slowing aging at intermediate cell passages.

[0148] The graph in Figure 2A shows that on middle passage cells fluorescence is reduced for cells treated with LNA10 that are entering senescence compared to the non-treated controls. This is indicative of the fact that LNA10 may slow aging in skin fibroblasts.

[0149] The same experiment, performed on late passage cells, demonstrated that LNA10 does not revert senescence in fibroblasts, wherein senescent BJ fibroblasts do not show difference in fluorescence between treatment and controls, see Figure 2B.

[0150] The levels of miR-22 and its direct targets were evaluated over time, at PIO, P34 and P50. MiR-22 levels double in cells approaching the senescence plateau (Figure 3). Some of miR-22 direct targets, SIRT-1 and TET2, are downregulated in senescent cells compared to early passages.

[0151] The expression levels of known senescence markers of the extracellular matrix were evaluated. Data, reported in Figure 4, shows that miR-22 inhibition mitigates and reverts the senescence-induced downregulation of collagen genes COL1A1 (Figure 4A), COL3A1 (Figure 4B), while miR-22 inhibition negatively modulates metalloproteases to slow the establishment of a senescent phenotype (Figure 4C).

[0152] Senescence associated secretory phenotype (SASP) comprises a large group of inflammatory chemokines and cytokines, among them CCL2, CXCL1, IL-1B, IL-8. The levels of them were evaluated on BJ fibroblasts, treated or untreated with LNA10. Data are shown in Figure 5A (CCL2), B (CXCL1), C (IL-1B), D (IL-8). This panel shows that all of them are negatively modulated by LNA10, especially in middle passage cells. The establishment of the senescence phenotype is delayed in treated cells compared to control. Other senescence markers, namely PAM, REV1, SOD2 and SIRT1, have been evaluated following the same protocol. The results are in Figure 6A-D.

[0153] The impact on chromatin modulators DMT3A and TET2 has then been evaluated. Data, reported in Figure 7A (DMT3A) and B (TET2) shows an increase in their expression when BJ fibroblasts are treated with LNA10.

[0154] Example 3: Assessment of in vivo effect of anti-miR-22 oligonucleotide compoundsP1798PC00

[0155] - 16 - Pharmacodynamic evaluation in SAMP8 mice

[0156] The Senescence-Accelerated Mouse Prone 8 (SAMP8) is a naturally occurring inbred mouse line that exhibits accelerated aging, originally derived from AKR / J mice through selective inbreeding of animals showing premature senescence phenotypes. This strain develops early-onset age-associated deficits despite normal development in youth, making it a robust model for studying accelerated aging and neurodegeneration.

[0157] SAMP8 mice show progressive cognitive decline, including impaired learning and memory performance detectable as early as 16 weeks of age. They also display several classical physical and behavioral hallmarks of premature aging, such as reduced activity, hair loss, lordokyphosis, disrupted circadian rhythms, and shortened lifespan. Their brains exhibit multiple neuropathological features relevant to age-associated diseases, including increased amyloid-p accumulation, glial activation, hippocampal and brain-stem degeneration, and compromised synaptic plasticity.

[0158] SAMP8 mice were treated with LNA10 or vehicle starting at 4 months of age for 16 weeks. Body- weight trajectories were monitored weekly (Figure 8). Cognitive performance was evaluated using the NOR test at week 8 (Figure 9A). Aging scores were calculated longitudinally (Figure 9B). LNA10 improved cognitive performance and reduced the rate of senescence progression.

[0159] Example 4: Long-term assessment of in vitro effect of anti-miR-22 oligonucleotide compounds

[0160] Wild-type mice were treated chronically with LNA10, and body-weight changes were monitored over time (Figure 10). No treatment-related alterations in weight maintenance were observed, confirming safety in healthy animals.

[0161] Obese mice (>55 g) were assigned to caloric-restriction regimens with or without LNA10. Body weight, body-weight change and food intake were monitored for 54 weeks (Figures 11B-D). Survival was evaluated by Kaplan-Meier analysis (Figure 11E). Cognitive performance was assessed after 48 weeks using the NOR test (Figure 12B-D). LNA10 improved metabolic parameters, preserved survival under chronic caloric restriction, and enhanced cognitive outcomes.

[0162] Lean C57BL / 6J mice on a regular chow diet were treated with vehicle or LNA10 for up to 24 months. Body-weight trajectories were recorded (Figure 13B, C). Aging scores were quantified longitudinally (Figure 14A). Physical performance was assessed at day 78 using a treadmill test (Figure 14B). LNA10 reduced aging-score progression and preserved physical performance relative to controls.

Claims

P1798PC00- 17-CLAIMS1. Use of an inhibitor of miR-22 for improving one or more functional parameters of aging in a mammalian subject, the parameters being selected from cognitive performance, physical performance, aging-score progression and survival under metabolic stress.

2. The use according to claim 1, wherein said subject is a non-geriatric subject.

3. The use according to one of the claims 1, 2, wherein said inhibitor is a nucleic acid having a sequence comprising tggcagct (SEQ ID NO: 2), wherein the nucleic acid comprises at least one locked nucleic acid (LNA) modification.

4. The use according to one of the claims from 1 to 3, wherein the nucleic acid comprises LNA modifications at positions 7 and 8 of tggcagct (SEQ ID NO: 2).

5. The use according to one of the claims from 1 to 4, wherein the nucleic acid is CTTcaACtgGCAgCT (SEQ ID NO: 8), where capital letters are LNA modified and lower case are unmodified.

6. A pharmaceutical composition for use in improving one or more aging- associated functional parameters selected from cognitive performance, physical performance, aging-score progression and survival under metabolic stress, comprising an inhibitor of miR-22 and a pharmaceutically acceptable carrier.

7. The use of an inhibitor of miR-22 in a subject identified as having elevated miR-22-associated senescence biomarkers selected from collagen loss, inflammatory chemokine elevation or chromatin-modulator downregulation.

8. The inhibitor of miR-22 for use in extending healthspan in a mammalian subject.

Images