Hypoxia-specific gene expression system comprising hypoxia response element and hypoxia stability region, cell therapeutic agent composition for preventing or treating solid tumors by using same, and combination therapy of cell therapeutic agent composition and adoptive cell transfer therapy

WO2026192134A1PCT designated stage Publication Date: 2026-09-17KOREA UNIV RES & BUSINESS FOUND
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/017101
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-08-13
Filing Date
2025-10-24
Publication Date
2026-09-17

Smart Images

  • Figure KR2025017101_17092026_PF_FP_ABST
    Figure KR2025017101_17092026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a hypoxia-specific gene expression control system comprising a hypoxia response element (HRE) and a hypoxia stability region (HSR), and a stem cell-based cell therapeutic agent composition for preventing or treating solid cancer by using same. The hypoxia-specific gene expression system according to the present invention enables a hypoxia-specific gene to be expressed at a desired level in a hypoxic environment, and can be effectively used in a cell therapeutic agent composition or a pharmaceutical composition that delivers a therapeutic substance at a desired level in a hypoxic microenvironment such as that of a solid tumor. In addition, the present invention can be used to obtain an improved therapeutic effect when used in combination with adoptive T-cell transfer therapy, which has been conventionally known to be limited by insufficient intratumoral infiltration.
Need to check novelty before this filing date? Find Prior Art

Description

A hypoxia-specific gene expression system comprising hypoxia response elements and hypoxia stable region sequences, a cell therapy composition for the prevention or treatment of solid tumors using the same, and a combination therapy of the cell therapy composition and adoptive cell delivery therapy.

[0001] The present invention relates to a hypoxia-specific gene expression regulation system comprising a Hypoxia Response Element (HRE) and a Hypoxia Stabiility Region (HSR), a stem cell-based cell therapy composition for the prevention or treatment of solid tumors using the same, and a combination therapy of said cell therapy composition and adoptive cell delivery therapy.

[0002] The Hypoxia Response Element (HRE) is an essential regulatory sequence that regulates the transcription of specific genes through the binding of Hypoxia-Inducible Factor-1 Alpha (HIF-1α) in a hypoxic environment. HIF-1α is a transcription factor regulated by oxygen concentration that stabilizes in a hypoxic environment (hypoxia) and induces hypoxia-specific gene expression by binding to the HRE sequence. Under normal oxygen concentrations (normoxia), HIF-1α undergoes hydroxylation of specific proline residues by the action of PHD (Prolyl Hydroxylase), is ubiquitinated by VHL (Von Hippel-Lindau) protein, and is degraded in a proteasome-dependent manner. However, in a hypoxic environment, PHD activity is inhibited, causing HIF-1α to stabilize. After forming a dimer with HIF-1β (ARNT), it moves into the nucleus, binds to the HRE sequence, and activates the transcription of target genes. Representative HIF-1α target genes include VEGFA (Vascular Endothelial Growth Factor A), which is involved in angiogenesis, and PGK1 (Phosphoglycerate Kinase 1) and ENO1 (Enolase 1), which are involved in glucose metabolism (glycolysis). Previous studies have reported that HRE contains a core sequence that mediates transcriptional activity through the binding of HIF-1α, and that simple multimerization of this sequence can amplify the expression of specific genes under hypoxic conditions. For example, it has been reported that repeating HRE sequences derived from VEGFA or the PGK1 gene increases HIF-1α binding rate, resulting in a significantly higher hypoxia-specific transcription level (Ref. Cell, Volume 174, June 2018, 72-87).

[0003] VEGFA is characterized by expression being regulated in hypoxic environments not only through transcriptional regulation of HIF-1α but also through post-transcriptional regulation of mRNA stability. In particular, the Hypoxia Stability Region (HSR) sequence located in the 3' UTR (Coding Sequence 3' region) of VEGFA mRNA forms a specific RNA secondary structure and acts as a riboswitch, functioning to inhibit mRNA degradation in hypoxic environments. While VEGFA mRNA is unstable and rapidly degraded in a normal oxygen environment (normoxia), in a hypoxic environment (hypoxia), the hnRNPL (Heterogeneous Nuclear Ribonucleoprotein L) protein binds to the HSR to stabilize the RNA structure, thereby increasing the mRNA half-life and enhancing protein expression through this mechanism.

[0004]

[0005] Meanwhile, the tumor microenvironment (TME) is a complex system composed of not only tumor cells but also blood vessels, immune cells, fibroblasts, and the extracellular matrix (ECM). Abnormal angiogenesis and rapid proliferation lead to localized oxygen supply imbalances and the formation of a hypoxic environment. This hypoxic environment accelerates the growth and metastasis of cancer cells by promoting the expression of genes such as VEGFA (Vascular Endothelial Growth Factor A), which is responsible for angiogenesis, as well as PGK1 (Phosphoglycerate Kinase 1) and ENO1 (Enolase 1), which are important for glucose metabolism and cell survival, through the stabilization of HIF-1α (Hypoxia-Inducible Factor-1 Alpha). At the same time, hypoxia and nutrient deficiency inhibit the activity of immune cells, including tumor-infiltrating T cells (TILs), induce the accumulation of myeloid-derived suppressor cells (MDSCs) or regulatory T cells (Tregs), and strengthen immune evasion mechanisms through increased immune checkpoint molecules such as PD-L1 expression. Furthermore, in a hypoxic environment, glycolysis is excessively activated, leading to the accumulation of lactate and a decrease in peripheral pH; this further suppresses T cell function, thereby weakening the anti-cancer immune response. Consequently, a hypoxic environment becomes a driving force that favors the survival and metastasis of tumors, and because it suppresses immune cells, it limits the effectiveness of advanced immunotherapies such as immune checkpoint blockers (ICBs) or Adoptive T Cell Transfer (ACT).

[0006] While hypoxic environments are factors utilized by cancer cells for survival and proliferation, they are also being studied in immunotherapy strategies as a mechanistic basis for regulating gene expression or promoting immune cell activation by leveraging them in reverse. The HIL2MSC (mesenchymal stem cells expressing IL-2 variant dimers) system presented in a previous study demonstrated anti-tumor immune effects while reducing systemic toxicity associated with conventional IL-2 therapy by enhancing local IL-2 signaling within the tumor microenvironment, based on single or multimerized HRE arrays.

[0007] Adoptive T Cell Transfer (ACT) therapy is a strategy that induces an anticancer response by activating and enlarging patient-derived T cells in vitro and then re-injecting them; it is garnering attention alongside Immune Checkpoint Blockers (ICBs). However, hypoxic conditions and immunosuppressive factors within the tumor microenvironment hinder the active proliferation and functionalization of injected T cells, while a deficiency in endogenous IL-2 inhibits the continuous proliferation and activation of T cells, thereby reducing therapeutic efficiency. Consequently, because this leads to T cell exhaustion and increases ICB resistance, a strategy capable of safely and continuously delivering sufficient IL-2 signaling to tumor tissue is crucial.

[0008] Furthermore, Chimeric Antigen Receptor T-cell (CAR-T) therapy is an adoptive cell therapy (ACT) technology in which a patient's own T-cells are genetically redesigned to recognize and destroy cancer cells more effectively. Unlike conventional T-cells, CAR T-cells express an artificial receptor called a CAR on their surface, allowing them to directly recognize and attack antigens on the surface of cancer cells independently of MHC. Consequently, CAR-T therapy is garnering attention for demonstrating high therapeutic efficacy in the field of hematological cancers. However, for solid tumors, it exhibits limitations in therapeutic efficacy due to poor penetration caused by the extracellular matrix and the immunosuppressive environment of the tumors. To overcome these limitations in solid tumors, strategies involving enhancing the signaling capabilities of CARs or co-administering cytokines are being attempted. However, excessive immune activation can induce systemic Cytokine Release Syndrome (CRS) and Immuno-Effective Cell-Associated Neurotoxicity Syndromes (ICANS). Furthermore, if antigens recognized by CAR T cells are expressed in normal organs, it can excessively induce "On-Target Off-Tumor" side effects, where CAR T cells recognize and attack normal cells, potentially leading to fatal organ damage. Consequently, a strategy of unconditionally enhancing CAR-T activity to improve the therapeutic effect on solid tumors carries a fundamental limitation in that it must accept severe toxicity that threatens the patient's life. Therefore, there is a need to develop a new strategy that can locally amplify the anticancer function of CAR-T cells only within the tumor microenvironment while minimizing systemic side effects and damage to normal tissues.

[0009] Against this backdrop, in order to solve the problems of the prior art and present an improved technology, the present invention constructed a multi-complex HRE array capable of maximizing gene expression under hypoxic conditions and fabricated a hypoxia-specific HRE-HSR system with added HSR. Furthermore, through this, the intratumoral expression of IL-2 variant dimers (such as SIL2Fc) was further enhanced, and by introducing a multi-HRE sequence combination that is more advanced than the simple HRE repeats presented in previous studies, it was made possible to respond more stably to the hypoxic environment of the tumor microenvironment. At the same time, the present invention was completed by presenting various injection methods and, furthermore, by presenting detailed combination strategies with therapies delivering adoptive cells such as ACT or CAR-T cells, confirming that both therapeutic efficacy and safety are maximized.

[0010] (Non-patent document 0001) Nature Cell Biology, Volume 24, December 2022, 1754-1765

[0011] One object of the present invention is to provide a hypoxia-specific gene expression system comprising: a Hypoxia Response Element (HRE) sequence isolated from each of one or more genes selected from the group consisting of VEGFA, PGK1, and ENO1; and a Hypoxia Stability Region (HSR) sequence derived from a VEGFA transcript.

[0012] In addition, another objective of the present invention is to provide a hypoxia-specific gene expression vector comprising the hypoxia-specific gene expression system.

[0013] In addition, another objective of the present invention is to provide mesenchymal stem cells transformed with the hypoxia-specific expression vector.

[0014] In addition, another objective of the present invention is to provide a cell therapy composition comprising the mesenchymal stem cells (MSCs).

[0015] In addition, another objective of the present invention is to provide a pharmaceutical composition for the prevention or treatment of cancer comprising the hypoxia-specific gene expression vector, mesenchymal stem cells, or a culture medium thereof.

[0016] In addition, another objective of the present invention is to provide a combination composition for anticancer use comprising the cell therapy composition or the pharmaceutical composition; and an anticancer agent or anticancer therapy.

[0017] In addition, another objective of the present invention is to provide a method for preventing or treating cancer comprising the step of administering the cell therapy composition, the pharmaceutical composition, or the combination composition to a cancer-bearing individual other than a human.

[0018] Each description and embodiment disclosed herein may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed herein fall within the scope of the invention. Furthermore, the scope of the invention is not to be limited by the specific descriptions provided below.

[0019] Furthermore, a person skilled in the art can recognize or identify a number of equivalents to the specific embodiments of the invention described in this application using only ordinary experiments. Furthermore, such equivalents are intended to be included in the invention.

[0020] Furthermore, throughout the entire specification of this application, when a part is described as "including" a certain component, this means that, unless specifically stated otherwise, it does not exclude other components but may include additional components.

[0021]

[0022] The present invention is based on the novel discovery that a multiple complex HRE array capable of maximizing gene expression under hypoxic conditions is constructed, and a hypoxia-specific HRE-HSR system with added HSR is fabricated, thereby further enhancing the expression of IL-2 variant dimers (such as SIL2Fc) within the tumor through this, and by introducing a multiple HRE sequence combination that is more advanced than the existing simple HRE repeat, it responds more stably to the hypoxic environment of the tumor microenvironment, while simultaneously presenting detailed combination strategies with various injection methods and ACT therapy to maximize both therapeutic efficacy and safety.

[0023] Hereinafter, preferred embodiments of the present invention will be described in detail with reference to the attached embodiments and drawings.

[0024]

[0025] To achieve the above objective, the present invention provides, in one embodiment, a hypoxia-specific gene expression system comprising: a Hypoxia Response Element (HRE) sequence isolated from each of one or more genes selected from the group consisting of VEGFA, PGK1, and ENO1; and a Hypoxia Stability Region (HSR) sequence derived from a VEGFA transcript.

[0026] The term "Hypoxia Response Element (HRE) sequence" of the present invention refers to a core sequence in which stabilized HIF-1α (Hypoxia-Inducible Factor-1 Alpha) binds upon a decrease in oxygen concentration to activate the transcription of a specific gene. It is an essential regulatory sequence that regulates the transcription of a specific gene through the binding of Hypoxia-Inducible Factor-1 Alpha (HIF-1α) in a hypoxic environment. For example, the HRE sequence induces hypoxia-specific gene expression when HIF-1α is stabilized in a hypoxic environment and binds to the HRE sequence.

[0027] The above HRE sequence may be one or more HRE sequences isolated from each of the genes selected from the group consisting of VEGFA, PGK1, and ENO1 genes. For example, the above HRE sequence may be one or more selected from the group consisting of an HRE sequence isolated from the VEGFA gene, an HRE sequence isolated from the PGK1 gene, and an HRE sequence isolated from the ENO1 gene.

[0028] The above VEGFA (Vascular Endothelial Growth Factor A) is a gene that encodes a protein called Vascular Endothelial Growth Factor A (VEGF-A). This gene encodes a protein that is a member of the platelet-derived growth factor (PDGF) / vascular endothelial growth factor (VEGF) family and is often found as a disulfide bond homodimer. In the present invention, the above VEGFA may have the characteristic of being regulated in a hypoxic environment through transcriptional regulation of HIF-1α as well as post-transcriptional regulation of mRNA stability.

[0029] The HRE sequence isolated from the above VEGFA gene may be an HRE sequence isolated from a VEGFA gene, specifically a human-derived VEGFA gene, and may be used interchangeably with VEGFA HRE sequence, VEGFA-derived HRE sequence, VEGFA-derived HRE, etc., and more specifically, may be a nucleotide sequence containing SEQ ID NO. 2 (5'-tcgagccacagtgcatacgtgggctccaacaggtcctcttgtcgagccacagtgcatacgtgggctccaacaggctcctcttgtcgagccacagtgcatacgtgggctccaacaggtcctcttgtcgagccacagtgcatacgtgggctccaacaggtcctcttgtcg-3'), a nucleotide sequence composed thereof, or a nucleotide sequence containing or composed of a part or fragment thereof.

[0030] The above PGK1 (Phosphoglycerate kinase 1) gene is a gene that encodes an enzyme called phosphoglycerate kinase 1.

[0031] The HRE sequence isolated from the above PGK1 gene may be an HRE sequence isolated from the PGK1 gene, specifically from the human PGK1 gene, and may be used interchangeably with PGK1 HRE sequence, PGK1 derived HRE sequence, PGK1 derived HRE, etc., and more specifically, may be a nucleotide sequence containing SEQ ID NO. 3 (5'-cgagctctgtcacgtcctgcacgactctagttgtcacgtcctgcacgactctagttgtcacgtcctgcacgacgctagc-3'), a nucleotide sequence composed thereof, or a nucleotide sequence containing or composed of a part or fragment thereof.

[0032] The above ENO1 (Enolase 1) gene is a gene that encodes an enzyme known as alpha-enolase, and the enzyme enolase 1 (Enolase 1, ENO1) is a glycolytic enzyme expressed in most tissues and is one of the isozymes of enolase.

[0033] The HRE sequence isolated from the above ENO1 gene may be an HRE sequence isolated from the ENO1 gene, specifically from the human ENO1 gene, and may be used interchangeably with ENO1 HRE sequence, ENO1 derived HRE sequence, ENO1 derived HRE, etc., and more specifically, may be a nucleotide sequence containing SEQ ID NO. 4 (5'-agggccggacgtggggccccagagcgacgctgagtgcgtgcgggactcggagtacgtgacggagccc-3'), a nucleotide sequence composed thereof, or a nucleotide sequence containing or composed of a part or fragment thereof.

[0034] The gene sequences of VEGFA, PGK1, and ENO1 mentioned above can be obtained from the known database, NCBI GenBank. Furthermore, the gene sequence may be 100% identical to a human-derived sequence obtained from the known NCBI GenBank, or it may include a sequence having 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% or more homology with it, and may also include, without limitation, any sequence encoding an amino acid sequence that has the same activity as the protein encoded by each gene. It is also obvious that any sequence having such homology, in which some sequences are deleted, modified, substituted, or added, is included within the scope of the present invention, and a sequence optimally codonized thereof may also be included.

[0035] The above HRE sequence may be derived from each of the above VEGFA, PGK1, and ENO1 genes or a combination thereof, and each of the said genes may be of human origin.

[0036] The above HRE sequence may include a core sequence in which HIF-1α binds to mediate transcriptional activity, and may be included as a simple multimerization array. The multimerization array may be in the form of a sequence that is repeated multiple times or several times, and specifically, it may be repeated within 1 to 10 times, but is not limited thereto, and may be repeated to optimize the difference in expression and clinical benefit under hypoxic and normal oxygen conditions.

[0037] The term “Hypoxia Stability Region (HSR) sequence” in the present invention refers to a structural region found in specific gene mRNA that inhibits the degradation of mRNA in a hypoxic environment, thereby increasing protein expression. Specifically, it may be an HSR sequence derived from the VEGFA gene.

[0038] The above VEGFA gene may have the characteristic of being regulated in expression through post-transcriptional regulation of mRNA stability under hypoxic conditions.

[0039] The hypoxic stable region sequence derived from the VEGFA gene can be located at the 3' UTR (Coding Sequence 3' region) of VEGFA mRNA, and the HSR sequence can function as a riboswitch by forming a specific RNA secondary structure and can have the function of inhibiting the degradation of mRNA in a hypoxic environment. In a normal oxygen environment (normoxia), VEGFA mRNA is unstable and rapidly degraded, but in a hypoxic environment (hypoxia), hnRNPL (Heterogeneous Nuclear Ribonucleoprotein L) protein binds to the HSR and stabilizes the RNA structure, thereby increasing the half-life of the mRNA and increasing protein expression.

[0040] In the present invention, the VEGFA gene-derived HSR sequence may be used interchangeably with the VEGFA HSR sequence and VEGFA HSR, wherein the VEGFA HSR sequence may include, for example, the nucleotide sequence of SEQ ID NO. 5 (5'-tagacacacccacccacatacatacatacatttatatatatatatattatatatatataaaaataaatatctcttttatatatatattctttttttaaattaacagtgctaatgtt-3'), be a nucleotide sequence composed thereof, or include or be a sequence composed thereof, or include or consist of a fragment or part thereof.

[0041] The term “hypoxia-specific gene expression system” of the present invention refers to a system that specifically expresses or increases the expression of hypoxia-specific genes under hypoxic conditions. In this specification, it may be used interchangeably with “HRE-HSR system.”

[0042] The above HRE-HSR system can increase gene expression in a hypoxic environment by combining the HRE sequence of a specific gene, such as VEGFA, in a specific order with the HSR sequence to a promoter-based gene expression sequence.

[0043] The above promoter-based gene expression sequence is an expression sequence based on a promoter sequence, and specifically, it may include an SV40 promoter-based gene expression sequence, although it is not particularly limited.

[0044] The above SV40 promoter is a hypoxia-specific gene S IL2Fc can be combined. Specifically, the above-mentioned SV40 promoter and S The sequences linked with IL2Fc sequences are not particularly limited, but may include, for example, the nucleotide sequence of SEQ ID NO. 1. Additionally, it may include the nucleotide sequence of SEQ ID NO. 1, a fragment thereof, or a case in which some nucleotide sequences are added or modified thereto.

[0045]

[0046] The above low oxygen may include, without limitation, a state with little or no oxygen, or containing less than 2% oxygen.

[0047] The above hypoxia-specific gene refers to a gene that is specifically expressed or has increased expression under hypoxic conditions having an oxygen concentration lower than normal oxygen conditions. Unlike genes that are not expressed, are expressed only minimally, or do not show increased expression under normal oxygen conditions, this gene is specifically expressed or has increased expression only under hypoxic conditions compared to normal oxygen conditions. Therefore, the hypoxia-specific gene of the present invention may include, without limitation, any gene known to be expressed under hypoxic conditions—that is, under conditions of low or no oxygen levels, rather than the oxygen levels under normal conditions. For example, it may be a mutant IL-2 (SIL2Fc), but is not limited thereto.

[0048] In this specification, “ S"IL2Fc" refers to a protein fused with the Fc (antibody crystallization site) domain, which is a variant of human IL2 (Interleukin-2) featuring specific amino acid substitutions. It is characterized by a higher binding preference for IL2Rβ than IL2Rα, thereby reducing systemic toxicity while inducing T cell proliferation.

[0049] The above mutant IL-2 ( S The IL2Fc gene is a protein with a human IgG heavy chain fused to a 5-amino acid sequence of the human IL2 protein, which has a higher binding preference to IL2Rβ than IL2Rα, and can be used interchangeably with SIL-Fc.

[0050] The above mutant IL-2 ( S The IL2Fc gene is a mutated form of Interleukin-2 (IL-2), where IL-2 refers to an interleukin, a type of signaling molecule and cytokine that forms part of the immune system. IL-2 binds to IL-2 receptors expressed by lymphocytes to mediate its effects. The primary sources of IL-2 are activated CD4+ T cells and activated CD8+ T cells, and the function of IL-2 is to stimulate the growth of helper T cells, cytotoxic T cells, and regulatory T cells.

[0051] The above-mentioned mutant IL2 gene has a partial sequence mutation in the IL-2 gene wild type, resulting in a higher binding preference to IL2Rβ than IL2Rα; it is a protein fused with a human IgG heavy chain, but it can essentially retain the functions of IL2.

[0052] In a specific embodiment of the present invention, an SV40 promoter and SThe gene expression system may be prepared by adding one or more HRE sequences selected from the group consisting of VEGFA, PGK1, and ENO1 of the present invention and a VEGFA-derived HSR sequence to a sequence combined with IL2Fc (Sequence No. 1). For example, a sequence (Sequence No. 1) combined with SV40 sIL2Fc to a VEGFA-derived HER sequence and a PGK1-derived HRE sequence may be represented as VEGFA PGK1 sV40 sIL2Fc, and when a VEGFA-derived HSR sequence is combined thereto, it may be represented as VEGFA PGK1 sV40 sIL2Fc or VEGFA PGK1 SV40 sIL2Fc.

[0053]

[0054] The genes or proteins described in this specification may include fragments, variants, or similar molecular forms without limitation.

[0055] The terms “fragment,” “variant,” and “analog” mentioned above broadly encompass substances that are structurally and functionally similar or have the same activity as the core sequences (HRE, HSR, etc.) or expressed proteins (SIL2Fc, etc.) presented in the present invention, and refer to all forms in which the essential function is maintained even with partial sequence substitutions, deletions, or additions.

[0056] In the present invention, such fragments, variants, and similar molecules can be represented in the following forms:

[0057] (1) A fragment that repeats a portion of the core region of a different HRE sequence in succession or expands and contracts the binding site.

[0058] (2) A form in which only the fragment of the HSR sequence that maintains mRNA stabilization function in a hypoxic environment is connected to another gene

[0059] (3) A form that allows for selective expression under hypoxic conditions by utilizing only specific binding sites within the HRE and HSR complex sequence.

[0060] These fragments, variants, and similar molecules may all be included within the scope of the present invention.

[0061]

[0062] The hypoxia-specific gene expression system of the present invention may be characterized by a combination of HRE and HSR sequences that selectively induces the expression of a mutant IL-2 (SIL2Fc) gene bound to human IgG under hypoxic conditions.

[0063] In addition, the hypoxia-specific gene expression system of the present invention may be characterized by the addition of an HSR sequence, which increases RNA transcription and protein expression compared to a system that does not include an HSR sequence, and improves the safety of mRNA transcribed under hypoxic conditions.

[0064] In addition, the hypoxia-specific gene expression system of the present invention may be configured without limitation in the number of repeats and the sequence of arrangement of HRE and HSR sequences to optimize the difference in expression and clinical benefits under hypoxic and normal oxygen conditions.

[0065] In addition, the number of repeats and the sequence order of the above HRE and HSR sequences are configured to follow a specific arrangement, so that the regulation of gene transcription and protein expression to a desired level under hypoxic conditions may be possible.

[0066] In a specific embodiment of the present invention, the sequences of hypoxic response elements (HRE) derived from human VEGFA, PGK1, and ENO1 were arranged in a repeat sequence, and the sequence of a hypoxic stable region (HSR) present in the VEGFA transcript was included together, thereby confirming that the expression of the mutant IL-2 (SIL2Fc) gene is selectively induced under hypoxic conditions by the combination of the HRE and HSR.

[0067] In another specific embodiment of the present invention, it was confirmed that among combinations of various HRE sequences, the sequential combination of VEGFA and ENO1 sequences (VEGFA-ENO1) induces the highest RNA transcription and protein expression compared to other HRE sequence combinations. In particular, under hypoxic conditions, it was confirmed that the HRE system of the present invention shows a significant increase in expression of about 2 times compared to the conventionally used ENO1 single sequence-based HRE system. In addition, it was confirmed that when a VEGFA-derived HSR sequence was added, an increase in RNA transcription of about 2 times and an increase in protein expression of 1.5 times occurred compared to the condition without the HSR sequence.

[0068]

[0069] Another embodiment of the present invention provides a hypoxia-specific gene expression vector comprising the hypoxia-specific gene expression system.

[0070] The above terms, “hypoxia-specific gene expression system,” “hypoxia-specific gene,” etc., are as described above.

[0071] In the present invention, the term “expression vector” refers to a gene construct comprising an essential regulatory element operably linked to express a gene insert, which is a vector capable of expressing a target protein in a suitable host cell.

[0072] The above vector may include a virus vector, a plasmid vector, a cosmid vector, a bacteriophage vector, etc., and specifically may be a virus vector, and more specifically may be a lentivirus vector, but is not limited thereto.

[0073] Expression vectors suitable for the present invention include, in addition to expression regulatory elements such as a promoter, operator, start codon, stop codon, polyadenylation signal, and enhancer, signal sequences or leader sequences for membrane targeting or secretion, and can be prepared in various ways depending on the purpose. The promoter of the vector may be constitutive or inducible. As an example, an SV40 promoter may be used, but is not limited thereto.

[0074] In addition, the expression vector includes a selection marker for selecting a host cell containing the vector, and if it is a replicable expression vector, it may include a replication origin, and other components that may be included when manufacturing the expression vector may be included without limitation.

[0075] In addition, the expression vector of the present invention can be configured without limitation to include all sequences including the number of repeats of HRE and HSR sequences and the promoter and mutant IL2 gene, as well as sequences that optimize the difference in expression and clinical benefits under hypoxic and normal oxygen conditions.

[0076] In a specific embodiment of the present invention, a gene expression vector was constructed to configure the hypoxia-specific gene expression system using a third-generation lentivirus vector containing an SV40 promoter.

[0077]

[0078] Another embodiment of the present invention provides mesenchymal stem cells transformed with the hypoxia-specific gene expression vector.

[0079] The above terms, “hypoxia-specific gene expression system,” “hypoxia-specific gene expression vector,” etc., are as described above.

[0080] The above-mentioned transformed mesenchymal stem cells can be easily produced by introducing an expression vector containing the above genes into any host cell, which is a mesenchymal stem cell.

[0081] In the present invention, the term “transformation” includes any method of introducing nucleic acid into an organism, cell, tissue, or organ, and can be performed by selecting a standard technique suitable for the host cell as known in the art. Such methods include, but are not limited to, electroporation, protoplasmic fusion, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, stirring using silicon carbide fibers, Agrobacterium-mediated transformation, PEG, dextran sulfate, lipofectamine, etc.

[0082] In addition, in the present invention, "stem cells" are cells capable of differentiating into various tissues, i.e., undifferentiated cells. The stem cells may be of human or animal origin, and may be derived from the umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerve, skin, amniotic membrane, or placenta. For example, they may be mesenchymal stem cells.

[0083] "Mesenchymal stem cell" refers to a heterogeneous population of stem cells capable of self-renewal and differentiation into mesodermal lineages, as well as other embryonic lineages such as endoderm and ectoderm. Mesenchymal stem cells can be used interchangeably with multipotent undifferentiated cells and are adult stem cells capable of differentiating into various mesodermal cells, including adipocytes, osteoblasts, chondrocytes, cardiac cells, or muscle cells, or into ectoderm cells, such as neurons. Specifically, the mesenchymal stem cells of the present invention may be bone marrow-derived mesenchymal stem cells.

[0084] In one embodiment, the process of obtaining mesenchymal stem cells is described as follows: Mesenchymal stem cells are isolated from a mesenchymal stem cell source, such as bone marrow, of a mammal including a human or mouse, preferably a human, and then said cells are cultured in a suitable medium, and during the culture process, suspended cells are removed and the cells attached to the culture plate are subcultured to finally obtain established mesenchymal stem cells.

[0085] Mesenchymal stem cells can be isolated from bone marrow according to methods known in the art. The isolation of said mesenchymal stem cells can be achieved by any previously known isolation method. Examples include density gradient fractionation, immunoselection, and differential adhesion separation. Any previously used method can be used to isolate and culture mesenchymal stem cells from bone marrow.

[0086] The culture of the mesenchymal stem cells isolated above can be carried out in cell culture media known in the art, for example, but not limited to DMEM medium, McCoys 5A medium, Eagle's basal medium, CMRL medium, Glasgow minimal essential medium, Ham's F-12 medium, Iscove's modified Dulbecco's medium, Liebovitz' L-15 medium, RPMI 1640 medium, KSB-3 basal media, etc.

[0087] In addition, in the present invention, one or more auxiliary components may be added to the cell culture medium as needed, including fetal bovine serum, serum of horses or humans, as well as antibiotics and antifungal agents to prevent microbial contamination.

[0088] Isolated or cultured stem cells may be stored by methods known in the art until use. Generally, stem cells may be frozen and stored after cryoprotection treatment. The cryoprotection treatment may be performed using cryoprotectants known in the art, such as DMSO, glycerol, polyvinylpyrrolidone, polyethylene glycol, albumin, dextran, sucrose, ethylene glycol, i-erythritol, D-ribitol, D-mannitol, D-sorbitol, i-inositol, D-lactose, or choline chloride.

[0089] In a specific embodiment of the present invention, the gene expression system was introduced by a third-generation lentivirus vector containing an SV40 promoter, and the vector was introduced into bone marrow-derived mesenchymal stem cells (MSCs) to produce transformed mesenchymal stem cells.

[0090] In addition, in another embodiment of the present invention, a lentivirus vector that expresses the SIL2Fc protein through the gene expression system was introduced into bone marrow-derived mesenchymal stem cells.

[0091]

[0092] Another embodiment of the present invention provides a cell therapy composition comprising the transformed mesenchymal stem cells (MSCs).

[0093] The above terms, such as “transformed mesenchymal stem cells,” are as described above.

[0094] In this document, the term “cell therapy” refers to a pharmaceutical product used for therapeutic, diagnostic, and preventive purposes by employing a series of methods, such as proliferating or selecting living autologous, allogenic, or xenogenic cells in vitro or altering the biological characteristics of cells by other means, in order to restore the function of cells and tissues. The United States has managed cell therapy products as pharmaceutical products since 1993, and Korea since 2002. Such cell therapy products include, but are not limited to, stem cell therapies for tissue regeneration or the recovery of organ function. The term “therapeutic effective amount” refers to the amount of an active ingredient or pharmaceutical composition that induces a biological or medical response in a tissue system, animal, or human as conceived by a researcher, veterinarian, physician, or other clinician, and includes an amount that induces the alleviation of symptoms of the disease or disorder being treated. It is obvious to those skilled in the art that the mesenchymal stem cells, which are the active ingredients included in the pharmaceutical composition of the present invention, will be modified according to the desired effect.

[0095] Therefore, the optimal content of the active ingredient can be easily determined by a person skilled in the art and can be adjusted according to various factors including the type of disease, the severity of the disease, the content of other ingredients contained in the composition, the type of formulation, and the patient's age, weight, general health condition, gender and diet, the time of administration, the route of administration and the secretion rate of the composition, the duration of treatment, and drugs used concurrently.

[0096] The above cell therapy composition may be for anticancer use.

[0097] In the above, the term “anticancer” means that the cell therapy composition containing the transformed mesenchymal stem cells described above has the function of treating cancer. Since MSCs naturally possess tumor tropism, the HIL2MSC of the present invention can induce selective secretion of SIL2Fc by activating the system in areas where oxygen supply is limited, such as the tumor microenvironment, after administration into the body. Accordingly, the anticancer cell therapy composition according to the present invention can exhibit an antitumor effect through local immune activation while minimizing systemic side effects through administration methods such as direct injection into the tumor and / or injection into the peritumoral region.

[0098] The above cancer is not specifically limited but may be a solid tumor.

[0099] The term “solid tumor” above refers to cancers occurring in body tissues, such as glioblastoma, glioblastoma, meningioma, neuroblastoma, oral cancer, laryngeal cancer, pharyngeal cancer, non-small cell lung cancer, small cell lung cancer, breast cancer, esophageal cancer, stomach cancer, colorectal cancer, liver cancer, pancreatic cancer, bladder cancer, prostate cancer, cervical cancer, endometrial cancer, ovarian cancer, melanoma, basal cell carcinoma, squamous cell carcinoma, osteosarcoma, and sarcoma; compared to blood cancers, the immune response is weak, so the effectiveness of immunotherapy is limited.

[0100] The above cell therapy composition may be characterized by inducing the selective secretion of SIL2Fc within the tumor microenvironment.

[0101] The above cell therapy composition may be for administration to the tumor peritumoral region. The term "administration to the tumor peritumoral region" does not refer to administration directly to the tumor, but rather to an area peritumoral region, such as the tumor margin, which includes the tumor margin but is not within the tumor parenchyma, and may be a region corresponding to one or more of the following:

[0102] 1) A portion within surrounding normal tissue or stroma located at a certain distance (e.g., 0.1 cm to 5 cm, preferably 0.5 cm to 2 cm) from the boundary of the tumor identified by imaging diagnosis or palpation;

[0103] 2) an area including an invasive front where tumor cells are actively infiltrating and / or the surrounding peritumoral stroma; or

[0104] 3) The site where the injection is administered in a manner that surrounds the tumor mass at least one point.

[0105]

[0106] In addition, the cell therapy composition may be characterized by reducing systemic toxicity and side effects.

[0107] By injecting the above-mentioned SIL2Fc-expressing MSC cell therapy agent or a composition containing it into the peritumoral region, the local immune response within the tumor can be significantly enhanced while minimizing systemic toxicity.

[0108] In a specific embodiment of the present invention, it was confirmed that, compared to systemic administration (IV injection) or direct injection into the tumor (IT), peripheral injection provides an environment favorable for cell engraftment, thereby increasing treatment efficiency while simultaneously reducing unnecessary inflammation or tissue damage.

[0109]

[0110] Another embodiment of the present invention provides a pharmaceutical composition for the prevention or treatment of cancer comprising the hypoxia-specific gene expression vector, transformed mesenchymal stem cells, or a culture medium thereof.

[0111] The above terms, “hypoxia-specific gene expression vector,” “transformed mesenchymal stem cell,” “cancer,” etc., are as described above.

[0112] In the present invention, the term “culture thereof” refers to a culture of the mesenchymal stem cells of the present invention, and refers to a culture product obtained by culturing the mesenchymal stem cells of the present invention in a culture medium. Additionally, it may include a filtrate of the culture of the mesenchymal stem cells of the present invention or a culture supernatant obtained by centrifuging the culture.

[0113] In the present invention, the term "prevention" refers to any act of suppressing or delaying the onset of cancer by administering the above composition, and the term "treatment" refers to any act of improving or benefiting from the symptoms of cancer by administering the above composition.

[0114] The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier.

[0115] The term "pharmaceuticalally acceptable carrier" above may refer to a carrier or diluent that does not irritate living organisms and does not impair the biological activity and properties of the injected compound. The types of carriers usable in the present invention are not particularly limited, and any carrier that is commonly used and pharmaceutically acceptable in the relevant technical field may be used. Non-limiting examples of carriers include saline solution, sterile water, Ringer's solution, buffered saline solution, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, etc. These may be used alone or in a mixture of two or more. Additionally, diluents, dispersants, surfactants, binders, and lubricants may be added to formulate the mixture into injectable formulations such as aqueous solutions, suspensions, and emulsions, as well as pills, capsules, granules, or tablets.

[0116] The above pharmaceutical composition may have any one dosage form selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, liquids, emulsions, syrups, sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories, and may be various dosage forms for oral or parenteral administration. When formulating, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid dosage forms for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid dosage forms are prepared by mixing at least one excipient, for example, starch, calcium carbonate, sucrose or lactose, gelatin, etc., with one or more compounds. In addition, lubricants such as magnesium stearate and talc are also used in addition to simple excipients. Liquid preparations for oral administration include suspensions, oral liquids, emulsions, and syrups; in addition to commonly used simple diluents such as water and liquid paraffin, they may contain various excipients, such as humectants, sweeteners, flavorings, and preservatives. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspension solvents. Witepsol, Macrogol, Tween 61, cocoa paste, laurin paste, and glycerogelatin may be used as bases for suppositories.

[0117] In addition, the pharmaceutical composition of the present invention can be administered in a pharmaceutically effective amount.

[0118] In the present invention, the term "pharmaceuticalally effective amount" refers to an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level may be determined based on factors including individual type and severity, age, gender, type of disease, drug activity, sensitivity to the drug, time of administration, route of administration and elimination rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. It may also be administered as a single or multiple doses. It is important to administer an amount that obtains maximum effect with a minimum amount without side effects by considering all of the above factors, and this can be easily determined by a person skilled in the art.

[0119] In addition, the above pharmaceutical composition may be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally, or topically) depending on the intended method. As an example, it may be administered parenterally.

[0120]

[0121] Another embodiment of the present invention provides a combination composition for anticancer use comprising: the cell therapy composition or the pharmaceutical composition; and an anticancer agent or anticancer therapy.

[0122] The above terms, “cell therapy composition,” “pharmaceutical composition,” “anticancer,” etc., are as described above.

[0123] The cell therapy composition or pharmaceutical composition of the present invention may be administered as an individual therapeutic agent, but may also be administered together with other active ingredients exhibiting preventive or therapeutic effects against cancer, or used in conjunction with other therapeutic regimens. When the cell therapy composition or pharmaceutical composition of the present invention is administered together with other active ingredients, this may be referred to as "combined administration" or "complex administration." In this case, the antibody or its antigen-binding fragment effective for cancer treatment according to the present invention and other active ingredients may be administered as a single mixture or in separate forms.

[0124] In the present invention, "concurrent administration," "concurrently administered," or "concurrently administered" should be understood to indicate simultaneous, individual, sequential, or reverse administration, with the order being unlimited. That is, concurrent administration is not limited merely to simultaneous administration but may be a form of administration in which each substance acts together with the individual to perform a level equivalent to or greater than its inherent function. Accordingly, when the term "concurrent administration" is used herein, if the administration is sequential, reverse, or individual, the order of administration is not particularly limited, and the interval between the administration of the secondary component may be such that the beneficial effects of the concurrent administration are not lost.

[0125] The term “anticancer agent” in this invention refers to a therapeutic agent capable of treating cancer, specifically a therapeutic agent capable of treating solid tumors.

[0126] In the present invention, the term “therapeutic therapy” means anticancer therapy, and said anticancer therapy may be immunotherapy, and more specifically may be adoptive cell delivery therapy, or in other words, adoptive cell delivery therapy.

[0127] The above adoptive cell transfer therapy may be, for example, adoptive T cell transfer therapy (ACT) and / or chimeric antigen receptor T cell therapy (CAR T Cell Therapy).

[0128] The aforementioned Adoptive T Cell Transfer (ACT) therapy is a type of immunotherapy that targets cancer by extracting a patient's white blood cells, modifying and amplifying them, and then re-injecting them. The core of this adoptive cell delivery method involves collecting the patient's white blood cells, manipulating them to possess stronger immune functions, amplifying them, and re-injecting them into the body. This enhances the cancer-eliminating ability of each individual white blood cell and provides a numerical advantage. While checkpoint inhibitors in immuno-oncology activate suppressed white blood cells, their effectiveness may be limited if only small amounts of these cells exist in the body. In comparison, adoptive cell transfer therapy can induce a much more direct attack on cancer.

[0129] The aforementioned chimeric antigen receptor T-cell therapy refers to a type of adoptive cell therapy that uses live cells customized for the individual patient as a drug. This involves a comprehensive process of treating cancer by genetically enhancing the patient's own immune cells outside the body to grant them the ability to attack cancer cells, and then re-injecting them into the body.

[0130] The term chimeric antigen receptor (CAR) is an artificial receptor that combines the antigen-binding specificity of antibodies with the cytotoxic function of T cells within a single molecule. Its structure generally includes an extracellular single-chain variable fragment (scFv) that recognizes a specific antigen, a hinge region that provides structural flexibility, a transmembrane domain that anchors the receptor to the cell membrane, and an intracellular domain that transmits T cell activation signals. In particular, the intracellular domain can be configured in various ways, such as a first generation (CD3ζ alone) that provides an initial activation signal to T cells, a second generation (CD3ζ and a single co-stimulatory domain) that enhances T cell proliferation and survival, and a third generation (CD3ζ and multiple co-stimulatory domains) that induces a more sustained response. It is obvious to those skilled in the art that the anticancer efficacy of T cells can be optimized for therapeutic purposes through such structural modifications.

[0131]

[0132] The above anticancer cell therapy composition may include a combination therapy with adoptive T-cell delivery therapy, in which case the two therapies act complementarily to induce a stronger anticancer immune response in the treatment of solid tumors.

[0133] In a specific embodiment of the present invention, it was confirmed that the HIL2MSC cell therapy composition of the present invention induces an immune response within the tumor more efficiently than conventional simple MSCs, thereby enhancing the anticancer therapeutic effect, and that when combined with other T cell therapies, it can achieve a therapeutic synergy effect by maximizing the accumulation efficiency of tumor-specific T cells.

[0134]

[0135] Another embodiment of the present invention provides a method for preventing or treating cancer, comprising the step of administering the cell therapy composition, the pharmaceutical composition, or the combination composition to a cancer-bearing individual other than a human.

[0136] The above terms, “cell therapy composition,” “pharmaceutical composition,” “combination composition,” “cancer,” “prevention,” “treatment,” etc., are as described above.

[0137] In the present invention, the term "individual" may be used interchangeably with "subject" and refers to mammals including cattle, dogs, pigs, chickens, sheep, horses, and humans, but is not limited thereto.

[0138] It is important that the above “administration” includes an amount that can obtain the maximum effect with the minimum amount without side effects, taking into account all of the above factors. However, the dosage may vary depending on factors such as the formulation method, method of administration, patient's age, weight, gender, pathological condition, food, time of administration, route of administration, excretion rate, and response sensitivity, and a person skilled in the art can appropriately adjust the dosage by considering these factors. The number of administrations may be one or two or more within the range of clinically acceptable side effects, and regarding the administration site, it may be administered to one site or two or more sites.

[0139] For animals other than humans, the above dosage may be administered at the same dose per kg as for humans, or calculated based on, for example, the volume ratio of ischemic organs (heart, etc.) between the target animal and humans (e.g., average value).

[0140] Examples of animals or target animals for treatment according to the present invention include humans and other mammals for such purposes, and specifically, may include humans, monkeys, mice, rats, rabbits, sheep, cattle, dogs, horses, pigs, etc.

[0141] According to the hypoxia-specific gene expression system of the present invention, hypoxia-specific genes can be expressed to a desired level in a hypoxic environment. This can be usefully applied to cell therapy compositions or pharmaceutical compositions that deliver therapeutic substances to a desired level in a hypoxic microenvironment, such as solid tumors. Furthermore, it can be used to obtain enhanced therapeutic effects when combined with adoptive T-cell delivery therapy or chimeric antigen receptor T-cell therapy (CAR T-cell Therapy), which are known to have limitations due to insufficient tumor penetration rates.

[0142] Figure 1 shows data on human-derived hypoxic response element sequences and hypoxic stable region sequences. The core sequence of the hypoxic response element to which HIF1a binds is shown in red. Specifically, (A) shows the hypoxic response element sequences derived from human genes VEGFA, PGK1, and ENO1, where VEGFA and PGK1 represent sequences in which the respective hypoxic response element is repeated 5 times (VEGFA HREx5) and 3 times (PGK1 HREx3), and (B) shows the hypoxic stable region sequence derived from human VEGFA mRNA.

[0143] Figures 2a and 2b show the structure of a third-generation lentivirus vector in which a mutant IL2 (SIL2Fc) fused with Human IgG was expressed by an SV40 promoter and a hypoxic response element to determine the degree of specific gene expression according to each number and order in a hypoxic environment.

[0144] Figure 3 is a figure comparing the amount of RNA expressed and the induction rate over 24 hours in cells into which human gene-derived hypoxic response elements were introduced, using RT-qPCR, with vectors constructed with different numbers and combination orders. Specifically, (A) shows the combination of hypoxic response elements used in the experiment, (B) shows the RNA expression level of cells after culturing the cells into which these elements were introduced under normal and hypoxic conditions for 24 hours, respectively, and calculated relatively based on the SV40 normal condition, indicating that all cells into which hypoxic response elements were introduced showed significantly increased expression under hypoxic conditions, and (C) shows that VEGFA ENO1 had a significantly higher induction rate compared to other combinations by comparing the gene induction rates under hypoxic conditions relative to normal conditions according to each combination of hypoxic response elements.

[0145] Figure 4 is a figure comparing the RNA transcription induction rates over time for each combination of hypoxia response elements measured via RT-qPCR. Specifically, (A) shows the transcription induction rates over time for single hypoxia response elements, indicating that VEGFA, ENO1, and PGK1 all induced significant expression up to 72 hours. (B) shows the transcription induction rates over time for complex hypoxia response elements, indicating that the VEGFA ENO1 combination maintained a significantly higher gene transcription induction rate up to 72 hours compared to other combinations. (C) shows the amount of protein expression at 72 hours compared to 24 hours under normal conditions for each combination of hypoxia response elements measured via ELISA, indicating that the VEGFA ENO1 combination induced significantly higher protein expression compared to other combinations of hypoxia response elements.

[0146] Figure 5 shows the effect of adding HSR to VEGFA ENO1, which had the highest RNA transcription induction rate under hypoxic conditions, measured via RT-qPCR and compared. Specifically, (A) indicates the position of HSR in the gene sequence. (B) indicates that under normal conditions, the amount of RNA expression is similar regardless of the presence or absence of HSR, but under hypoxic conditions, RNA is expressed approximately 1.7 times more when HSR is present. (C) indicates that when the protein induction rate according to the presence or absence of HSR was measured by ELISA, a larger amount was expressed at the protein level when HSR was present.

[0147] Figure 6 is a figure confirming whether the RNA transcription effect induced by hypoxia disappears when returning to normal oxygen conditions after exposure to hypoxic conditions. Specifically, it was confirmed that the amount of transcription significantly induced by HRE when exposed to hypoxic conditions for 24 hours decreased when returning to normal oxygen conditions for 24 hours.

[0148] Figure 7 confirms that the growth of T cells can be promoted in a hypoxic environment after introducing a hypoxia-specific SIL2 expression vector into mesenchymal stem cells. Specifically, (A) shows that when 1.5 x 10⁴ T cells were cultured for 24 hours, IL2 was secreted by HRE and HSR only under hypoxic conditions, resulting in an increase in the number of T cells. (B) shows the results of measuring the amount of IFNr secreted by activated T cells under the above experimental conditions.

[0149] Figure 8 is a figure showing that the representative cell surface protein phenotype of mesenchymal stem cells is maintained even when SIL2Fc containing a hypoxic response factor sequence is introduced using a lentivirus vector.

[0150] Figure 9 shows the results of confirming tumor growth curves according to the method of administration of SIL2Fc-secreting mesenchymal stem cells to a solid tumor animal model, indicating that when SIL2Fc is introduced, it shows an anti-tumor effect, and that the method of administration to the peritumoral region shows a better effect than the method of administration to the tumor.

[0151] Figure 10 shows the evaluation of side effects according to the delivery and administration methods of the SIL2Fc immunotherapy agent. Specifically, (A) shows the results of measuring the amount of SIL2Fc in serum, indicating that when the protein is delivered directly, there is significant leakage into the serum, whereas when delivered via mesenchymal stem cells, there is less leakage of SIL2Fc into the serum. (B) shows the results of measuring the amount of IFNγ in serum, indicating that serum IFNγ increased due to leakage in the SIL2Fc protein direct delivery group. (C) shows the results of measuring the body weight of solid tumor animal models according to the delivery and administration methods, indicating that in the mesenchymal stem cell delivery group, there was no systemic toxicity, and there was no significant difference in body weight change compared to normal conditions.

[0152] Figure 11 shows the results of combination therapy with OT-I T cells in mice carrying melanoma solid tumors (B16-OVA) derived from OVA-overexpressing mice to investigate the combination effect, which is one of the cell therapy methods. Specifically, (A) is an experimental overview of the B16 tumor model, in which B16-OVA tumor cells were inoculated, and then CTX (Cyclophosphamide) was administered to eliminate immune cells within the tumor at a certain point in time, followed by the administration of an MSC cell therapy composition and OVA antigen-specific T cells (OT-I) in high and low ratios. The figure then indicates the time at which cytokine levels in the serum were measured. (B) is a graph showing the change in tumor volume over time after inoculation, comparing the degree of tumor growth inhibition in different treatment groups treated with EMSC, ACT(High)+EMSC, ACT(Low)+EMSC, HIL2MSC, and ACT(Low)+HIL2MSC. It was confirmed that the combination therapy of HIL2MSC and ACT(Low) demonstrated an enhanced anti-tumor effect with only a small number of T cells, thereby inhibiting tumor growth. (C) shows the change in survival rates in each group as a Kaplan-Meier curve, confirming that combining HIL2MSC with a small number of ACT therapy regimens resulted in improved survival rates. (D) is a graph showing the concentrations of IFN-γ and TNFα measured in mouse serum in the group treated with the cell therapy composition, representing the results of comparing the degree of toxicity caused by serum and systemic immune activation between the experimental groups. It was confirmed that while the therapeutic effect was enhanced in the group treated with the combination of HIL2MSC and ACT(Low), serum cytokine levels did not rise, demonstrating a therapeutic effect without side effects.

[0153] Figure 12 shows the results of an experiment in which (A) CD45.2+ OT-1 T cells were adopted into CD45.1+ C57BL / 6 mice carrying B16-OVA tumors, MSCs or HIL2MSCs were administered at a certain time, and the degree of T cell infiltration in the tumor and adjacent lymph nodes (dLN) was analyzed on day 20. (B) shows the results of measuring the proportion of CD45.1+ endogenous CD8+ T cells in the tumor tissue by flow cytometry. The results indicate that the HIL2MSC administration group showed a significantly higher CD8+ T cell infiltration rate compared to the MSC-alone administration group. (C) is a figure showing the results of measuring the ratio of CD45.2+ OT-I T cells delivered via ACT into tumor tissue in the same way, and indicating that CD45.2+ T cells significantly increased in the HIL2MSC administration group, showing that the tumor infiltration efficiency of tumor-specific T cells was improved as a result of combination therapy with ACT and HIL2MSC cell therapy composition.

[0154] Figure 13 shows the results when a certain number of Anti-hCD19 CAR T cells targeting the hCD19 antigen were administered alone or in combination after administering the cell therapy composition HIL2MSC or a control MSC of the present invention. Specifically, (A) shows the results of an experiment in which Anti-hCD19 CAR T cells were adopted into mice carrying B16-hCD19 tumors, MSC or HIL2MSC was administered at a certain time, and the degree of T cell infiltration in the tumor and lungs was analyzed on day 14. (B) shows the results of a graph showing the change in tumor volume over time after tumor inoculation, comparing the degree of tumor growth inhibition in different treatment groups treated with MSC and HIL2MSC along with Anti-hCD19 CAR T cells, and confirming that small tumor growth was inhibited by the combined therapeutic effect of HIL2MSC and CAR T cells. (C) shows the results of measuring the ratio of Anti-hCD19 CAR T cells in tumor tissue by flow cytometry, demonstrating that the HIL2-MSC group significantly improved the infiltration rate of Anti-hCD19 CAR T cells compared to the MSC group. (D) shows the results of measuring the ratio of Anti-hCD19 CAR T cells in normal lung tissue by flow cytometry, demonstrating that the HIL2-MSC group, like the MSC group, did not affect the infiltration of Anti-hCD19 CAR T in the lungs. Finally, (E) compares the number of Anti-hCD19-CAR T cells infiltrated into the lungs and tumor tissues of the same mouse, showing that only in the HIL2-MSC group did the number of Anti-hCD19 CAR T cells selectively increase significantly in the tumor.

[0155] Figure 14 shows the results of confirming the On-Target Off-Tumor side effects when the cell therapy composition of the present invention is used in combination with CAR T cells. Specifically, (A) shows the results of an experiment in which B cell ratios in lymph nodes and spleen were analyzed on day 16 after treating mice with B16-mCD19 tumors with CTX at a certain time to eliminate lymphocytes within the tumor, followed by adoptive transfer of Anti-mCD19 CAR T cells and administration of MSC or HIL2MSC. (B) and (C) are the results of measuring B cell ratios in tumor-draining lymph node tissues by flow cytometry. The sumIL2Fc group showed a significant decrease in B cell ratios and numbers, but the HIL2-MSC group showed no significant difference from the control group, indicating that despite the promotion of immune cell activation by IL2, the On-Target Off-Tumor effect was not intensified in the tumor-draining lymph nodes. (D) and (E) are the results of measuring the proportion of B cells in tumor-draining lymph node tissues by flow cytometry; the sumIL2Fc group showed a significant decrease in the proportion of B cells, while the HIL2-MSC group showed no significant difference from the control group.

[0156] The present invention will be explained in more detail below through examples. These examples are intended to explain the invention more specifically, and the scope of the invention is not limited by these examples.

[0157]

[0158] Experimental Example 1: Construction of a hypoxia-specific gene expression system combining hypoxia-responsive element (HRE) and hypoxia-stable region (HSR) sequences

[0159] To prepare the hypoxia-specific HRE-HSR SIL2Fc expression vector of the present invention, a hypoxia-responsive element sequence derived from human ENO1 (ENO1 HRE) and a hypoxia-stable region sequence derived from VEGFA (VEGFA HSR) were synthesized. In addition, human PGK1 and VEGFA hypoxia-responsive element sequences were synthesized using pGL4.22-VEGF-HRE::dLUC and pGL4.22-PGK1-HRE::dLUC (Addgene), respectively. The synthesized HRE sequences were connected in the order of VEGFA-PGK1, VEGFA-ENO1, PGK1-ENO1, and VEGFA-PGK1-ENO1 by alternating their sequences. Next, the SIL2Fc sequence was synthesized according to the published paper (Reference: Nature Cell Biology, Volume 24, December 2022, 1754-1765 / Sun, Z., Ren, Z., Yang, K. et al. A next-generation tumor-targeting IL-2 preferentially promotes tumor-infiltrating CD8+ T-cell response and effective tumor control / Nat Commun 10, 3874 (2019). https: / doi.org / 10.1038 / s41467-019-11782-w) to generate the SIL2 structure. Subsequently, the hypoxia response element, SV40 promoter, SIL2Fc, and HSR synthesized above were linked in sequence and inserted into an FUW (Addgene) vector to prepare a hypoxia-specific gene expression vector. The schematic diagram of the gene sequence used above is shown in Fig. 2.

[0160]

[0161] Experimental Example 2: Production and Transduction of Hypoxia-Specific Expression Lentivirus Vector

[0162] To prepare recombinant lentiviruses for SIL2Fc expression using a hypoxia-specific HRE-HSR system, the HEK293FT cell line (Invitrogen) was prepared by the following method. First, complete cell culture medium was prepared by adding 10% FBS and 1X Penicillin-Streptomycin (Welgene) to DMEM (Welgene) and mixing uniformly through up-and-down induction, and this medium was preheated to 37°C for use. Additionally, the frozen HEK293FT cell stock was rapidly thawed in a 37°C water bath for 1 minute and 30 seconds, inoculated into 5 mL of complete medium, and cultured under conditions of 37°C and 5% CO₂. Subsequently, once the cells reached 80% of the culture dish's surface area, they were maintained through subculture.

[0163] Next, for lentivirus transfection, 1-2 × 10⁶ HEK293FT cells were placed in a 10 cm diameter culture dish. 6Cells were inoculated into 9 mL of complete medium and cultured for 16 hours, after which transfection was performed. The transfection was carried out using Lipofectamine 3000 (Invitrogen). Specifically, 4 μg of an expression vector prepared to express SIL2Fc via the HRE-HSR system, along with 1.3 μg each of pRSV-Rev, pMDLg / pRRE, and pMD2.G packaging vectors, were mixed with 10 μL of P3000 in 100 μL of Opti-MEM (Invitrogen). Separately, 10 μL of Lipofectamine 3000 was diluted in 100 μL of Opti-MEM, and the two solutions were mixed and reacted at room temperature for 20 minutes. The resulting complex solution was added to the prepared HEK293FT cells, mixed uniformly, and cultured for 16 hours. Subsequently, the complete medium was replaced with 9 mL, and culture was continued for an additional 32 hours. After the culture was completed, the supernatant was collected and stored at 4°C, and 9 mL of fresh complete medium was added to the cells. After 24 hours, all collected supernatants were aggregated and filtered through a 0.45 μm filter to remove cell residues. Then, Lenti-X Concentrator (Takara), equivalent to 1 / 3 of the total supernatant volume, was added, and the mixture was reacted at 4°C for at least 16 hours. The reaction-completed solution was centrifuged at 1500 g for 45 minutes to concentrate the lentivirus; the concentrated lentivirus was dissolved in Phosphate Buffered Saline (PBS) and stored at -80°C until use.

[0164] Next, to produce mesenchymal stem cells expressing SIL2Fc via a hypoxia-specific HRE-HSR system, the recombinant lentivirus prepared above was transfected into each cell line. More specifically, recombinant lentiviruses at 0.1 to 10 MOI were inoculated into complete medium supplemented with 8 μg / mL of polybrene (Merk) and mixed uniformly. Then, 1 mL of the virus mixture was added to each cell line prepared in a 6-well plate, followed by the addition of complete medium to make the total volume 4 mL. The cells were then centrifuged at 1,000 g for 60 minutes and cultured in a 37 ℃, 5% CO2 incubator for 24 hours. After 24 hours, the culture medium was replaced with fresh medium. Subsequently, the transfected cells were selectively cultured in complete medium supplemented with 20 μg / ml of Blasticidin.

[0165]

[0166] Experimental Example 3: Isolation and Culture of Bone Marrow-Derived Mesenchymal Stem Cells

[0167] Bone marrow cells were isolated from 6-8 week old female C57BL / 6J mice, and MesenCult Expansion Media (STEMCELL Technologies) was added to a single 10 cm tissue culture dish along with 1 μM GW2580. The cells were then cultured under 1% oxygen conditions (hypoxic conditions). After 24 hours of culture, the medium was replaced to remove non-adherent cells, and the medium was subsequently replaced every 3 days. When the cells reached 60% of the dish area, they were subcultured at a 1:3 ratio. During subculture, adherent cells were washed with PBS, collected, and subcultured in the same medium. MSCs were identified by the positive and negative expression of surface markers. After 5 subcultures, MSCs were immortalized by retroviral transfection using the SSR#69 vector, and subsequent transduction was performed according to Experimental Example 2 above.

[0168] Subsequently, for hypoxia-specific gene expression, a hypoxic condition of 1% O2 was established using a Hypoxia Incubator Chamber (Stemcell), and 0.5 × 10⁶ were placed in a 6-well plate. 5 MSCs were cultured in 2 ml of complete medium for 24, 48, and 72 hours. Subsequently, the cell culture supernatant was analyzed using ELISA, and RNA was extracted from the cells using Trizol for RT-qPCR analysis. MSCs under normal oxygen conditions were 0.5 × 10⁶ 5 MSCs were analyzed after being cultured in 2 ml of complete medium for 24 hours.

[0169]

[0170] Experimental Example 4: Preparation of Cell Line and Reagents

[0171] The HEK293FT cell line was purchased from ThermoFisher Scientific (Invitrogen), and the MC38, CT26, B16, and 4T1 cell lines were purchased from the American Type Culture Collection (ATCC). The MC38-OVA and B16-OVA cell lines were produced by lentivirus transfection with the chicken OVA gene, and the B16-hCD19 and B16-mCD19 cell lines were produced by lentivirus transfection with the human CD19 (hCD19) and mouse CD19 (mCD19) genes, respectively. Additionally, all cells were cultured under 5% CO₂ conditions in complete medium (DMEM) supplemented with 10% heat-inactivated FBS, 100 U / mL penicillin, and 100 μg / mL streptomycin.

[0172]

[0173] Experimental Example 5: Real-Time qPCR Analysis

[0174] Real-time qPCR was performed on RNA extracted from cells to quantify SIL2Fc mRNA expression levels. First, cultured cells were collected, and total RNA was extracted using Trizol (MRC). Then, Trizol was added to the cell solution and homogenized; 1 / 5 of the total volume of Chloroform (Merck) was added and mixed, and the mixture was centrifuged to separate the supernatant. Subsequently, the supernatant was extracted, and an equal volume of Isopropanol (Merk) was added to precipitate the RNA; after centrifugation, the precipitated RNA was washed with Ethanol (Merk). Finally, the RNA was dissolved in DEPC-treated water (Invitrogen) at 65°C for 5 minutes and stored at -80°C.

[0175] The extracted RNA was converted into cDNA via reverse transcription using the PrimeScript™ RT-PCR Kit (TAKARA), and a Real Time qPCR reaction mixture was prepared using TAKARA Applied Biosystems™ SYBR™ Green Universal Master Mix. The qPCR reaction was performed on the Applied Biosystems™ StepOne™ Real-Time PCR System and amplified SIL2Fc and the internal control gene Rplp0. The qPCR reaction conditions involved initial thermal activation at 95°C for 10 minutes, followed by 40 cycles of amplification at 95°C for 15 seconds and 60°C for 1 minute. Finally, the relative expression level of SIL2Fc mRNA was calculated through Ct value analysis of each sample.

[0176]

[0177] Experimental Example 6: ELISA Analysis

[0178] Anti-Human IgG (Fc specific) antibody produced in goat (Sigma) at a concentration of 2 μg / mL was coated onto an SPL microplate and stored at 4°C for 18 hours to ensure stable attachment of the antibody to the plate. After coating, the plate was washed and blocked using 2% BSA DPBS. Then, diluted serum or tissue lysate was added to each well and reacted at room temperature for 90 minutes to allow the target antigen to bind to the capture antibody. Subsequently, the plate was washed again, and Anti-Human IgG (Fc specific)-Peroxidase antibody produced in goat (Sigma) diluted to a concentration of 2 μg / mL in 2% BSA DPBS was added and reacted at room temperature for 1 hour to allow the secondary antibody to bind to the antibody-antigen complex. In the final step, 100 μL of 1-Step™ TMB ELISA Substrate Solution (Thermo) was added to induce an enzymatic reaction, and 100 μL of 3M HCl was added to stop the reaction. The results were then read by measuring the absorbance at 405 nm using a Hidex Sense Plate Reader.

[0179]

[0180] Experimental Example 7: Flow Cytometry

[0181] Single-cell suspensions were first incubated with anti-FcγIII / II receptor (clone 2.4G2) for 15 minutes to block non-specific binding, and then stained with antibodies for 30 minutes in a dark room at 4°C. Fixable viability Dye eFluor™ 506 (Invitrogen) was used to exclude already dead cells from the analysis, and activated caspase 3 and Tcf1 cells were intracellularly stained with True-Nuclear™ transcription factor buffer set (Biolegend) according to the manufacturer's instructions. Additionally, cytokines were measured in mouse serum and tumors using the BD™ Cytometric Bead Array (CBA) Mouse Th1 / Th2 / Th17 Kit from BD Biosciences, and data were collected via a Novocyte Advanteon (Agilent) flow cytometer and analyzed using NovoEpress or FlowJo software.

[0182]

[0183] Experimental Example 8: Animal Model

[0184] The 6–8 week old female C57BL / 6J, BALB / c mice used in this application were purchased from Orientbio (Korea) or Jackson Laboratory (USA). Then, to establish a solid tumor animal model, MC38 (1×10⁶) was injected subcutaneously into the right lateral side of the experimental mice. 6 ), CT26 (5×10 5 ), B16 (3×10), MC38-OVA (1×10 6 ), B16-OVA (1×10 6 Tumors were induced by inoculating each individual with ) cells. After tumors were formed, the mice were randomly grouped and the following treatment was administered. At designated times, the dose of SIL2, 1×10⁻⁶ indicated in the diagram was administered. 6 MSCs or 1×10 6SIL2-MSCs were administered via tail vein, subcutaneous (in this case, subcutaneous on the left side opposite the formed tumor), intratumoral, and peritumoral inoculation methods. After administration, tumor volume was calculated by measuring the length (a), width (b), and height (h) of the tumor and using the formula Volume = (a × b × h) / 2. For survival criteria, animals were sacrificed if any side of the tumor was 2 cm or larger, the total volume exceeded 2000 mm³, or the body weight decreased by more than 20% from the start of treatment.

[0185]

[0186] Experimental Example 9: Tissue Homogeneity

[0187] In this application, 20 μg SIL2 or 1×10⁶ was administered to mice carrying a CT26 tumor on day 9. 6 HIL2MSCs were administered via intratumoral injection (it) or peritumoral injection (pt). After treatment, tumors were collected 1, 3, and 5 days after treatment, respectively; additionally, major organs such as the spleen, liver, kidney, heart, and lungs were collected 5 days later. The collected tissues were homogenized using a FastPrep-24 5G Homogenizer with 170 ng / ml PMSF (Sigma) and a protease inhibitor (Selleckchem). The homogenized samples were centrifuged at 13,000 rpm for 20 minutes, and the supernatant was recovered. The recovered supernatant was stored at -80 ℃ for subsequent analysis.

[0188]

[0189] Experimental Example 10: Tumor Cell Isolation

[0190] In the present application, tumor tissue was first cut into small pieces, and then enzymatic reaction was carried out by treating it with a digestion solution containing 1 mg / mL Collagenase I (Sigma) and 0.5 mg / mL DNase I (Roche) at 37°C for 45 minutes. Afterward, the separated tumor cell suspension was passed through a 70 μm cell strainer to remove large tissue fragments that were not digested, and finally, the tumor-infiltrating cells were washed twice with PBS containing 2 mM EDTA to remove residues and then used for subsequent analysis.

[0191]

[0192] Experimental Example 11: Mouse T cell lentivirus transduction

[0193] To prepare Mouse T cells for lentivirus transduction, 2 x 10⁶ Mouse T cells were coated with anti-Mouse CD3ε (BD) at 2 μg / ml and then placed in a medium supplemented with anti-Mouse CD28 2 μg / ml (Biolegend) and human IL2 (Peprotech) 100 U / ml. 6 Suspended at 1 / ml at 37℃, 5% CO2 The cells were cultured in the medium for 2 days. For viral transduction, retronectin 12 μg / ml was coated onto a 24-well plate at 4 ℃ for one day, followed by blocking with 2% BSA in PBS at room temperature for 30 minutes. Subsequently, anti-human CD19 CAR T and anti-mouse CD19 CAR T lentiviruses were applied to 2 x 10⁶ activated mouse T cells. 6 After transferring to virus-coated wells at 1 / ml, the cells were rotated at 2000g for 1 hour and 30 minutes to adhere to the bottom. Subsequently, the virus suspension was removed, and 2x10 T cells were formed. 6After transferring / ml to virus-coated wells, the wells were rotated at 1200g for 1 hour and 30 minutes to adhere to the bottom. After 1 day, the media was replaced with one containing 100 U / ml of human IL2. Finally, CAR expression was confirmed by flow cytometry 2 days after transduction to determine the injection number.

[0194] Example 1: In vitro evaluation of a hypoxia-specific gene expression system

[0195] As described in the above experimental example, a lentiviral vector was constructed by configuring hypoxic response factor (HRE) sequences (SEQ Nos. 2, 3, 4) extracted from human-derived genes such as VEGFA, PGK1, and ENO1, and hypoxic stable region (HSR) sequences (SEQ No. 5) present in the VEGFA transcript in various repeat arrangements and combination sequences (see FIG. 1, FIG. 2, FIG. 3 and SEQ Nos. 6 to 13). Subsequently, the constructed vector was transduced into mesenchymal stem cells, and the cells were cultured for 72 hours each under normal oxygen conditions and hypoxic conditions. SIL2Fc RNA transcription activity was quantitatively confirmed via RT-qPCR, and the expression level of the SIL2Fc fusion protein was quantitatively confirmed via ELISA analysis (Fig. 3, FIG. 4, FIG. 5 and FIG. 6).

[0196] As a result, as can be seen in Fig. 3, it was confirmed that differential expression is induced depending on the sequence of HRE sequence repeats and combinations (Fig. 3). In particular, as can be seen in Figs. 3 and 4, it was confirmed that the sequential combination of VEGFA and ENO1 sequences (VEGFA-ENO1) induces the highest RNA transcription and protein expression. In particular, under hypoxic conditions, it was confirmed that the system of the present invention showed a significant increase in expression of about twofold compared to the conventionally used ENO1 single sequence-based HRE system (Figs. 3 and 4). These results indicate that the binding efficiency of HIF-1α is enhanced in a hypoxic environment through HRE sequence combinations.

[0197] In addition, as can be seen in Figure 5, it was confirmed that when the HSR sequence was added, there was an approximately 2-fold increase in RNA transcription and a 1.5-fold increase in protein expression compared to the condition without HSR. These results suggest that the improvement in the stability of mRNA transcribed under hypoxic conditions by the HSR sequence contributes to increased expression efficiency (Figure 5).

[0198] In summary, it can be seen that differential gene transcription can be induced by varying the repetitive sequences and combination sequences of human gene-derived HREs, and that by introducing HSR sequences to effectively increase mRNA stability, a hypoxia-specific gene expression system (hypoxia-specific HRE-HSR system) based on multiple hypoxia response elements and hypoxia stable region sequences can be effectively constructed.

[0199]

[0200] Example 2: Evaluation of the functionality of a gene expression system introduced into mesenchymal stem cells (MSCs)

[0201] In this embodiment, a lentivirus vector loaded with a hypoxia-specific HRE-HSR system was introduced into mesenchymal stem cells to produce MSCs (HIL2MSCs) containing a hypoxia-specific SIL2Fc expression vector, and then cultured under normal oxygen and hypoxia conditions, respectively, to confirm the SIL2Fc RNA transcription level using reverse transcription quantification PCR (RT-qPCR).

[0202] As a result of comparison by culture environment, as can be seen in Figure 6, the expression level of SIL2Fc in HIL2MSCs cultured for 24 hours under hypoxic conditions was significantly increased by approximately 8 times when the hypoxic expression system was absent or compared to normal oxygen conditions, and it was confirmed that the expression level returned to the baseline level when normal oxygen conditions were restored (Figure 6). These results directly indicate that the introduced HRE-HSR system is specifically activated only in a hypoxic environment and regulates SIL2Fc expression.

[0203] In addition, to determine whether the intrinsic function of MSCs is impaired after vector introduction, major cell surface markers of HIL2 MSCs into which the lentiviral vector was introduced were identified by flow cytometry. As a result, as can be seen in Figure 7, it was confirmed that the MSC-specific surface markers remained intact (Figure 7). This increases the likelihood that the tumor tropism and intrinsic function of MSCs will be preserved, and supports their safety when used as a cell therapy agent.

[0204] Meanwhile, to verify whether HIL2MSCs produced under hypoxic conditions could actually activate immune cells, the growth and activity of T cells were checked by treating them with the supernatant of HIL2MSC culture. As a result, as shown in Figure 8A, T cells treated with the supernatant of HIL2MSCs cultured under hypoxia with the HRE-HSR system introduced showed a proliferation capacity approximately 1.6 times higher compared to conditions without the HRE-HSR system or cultured under normal oxygen (Figure 8A). In addition, as shown in Figure 8B, the amount of IFN-γ secreted as an indicator of T cell activation was measured and showed a concentration 1.6 times higher under the same conditions (Figure 8B), which proves that SIL2Fc secreted from HIL2MSCs under hypoxic conditions induces T cell activation.

[0205] Synthesizing these results, it is demonstrated that HIL2MSCs produced using the hypoxia-specific HRE-HSR system presented in this invention effectively promote T-cell growth and activation by selectively secreting SIL2Fc in a hypoxic environment while maintaining the biological characteristics of MSCs. This serves as evidence supporting the fact that HIL2MSCs produced using the hypoxia-specific HRE-HSR system of this invention can simultaneously ensure both safety and efficacy as a cell therapy composition.

[0206]

[0207] Example 3: Evaluation of anticancer effect in a solid tumor animal model according to the delivery method of the cell therapy composition

[0208] In this embodiment, to evaluate the anticancer efficacy of a mesenchymal stem cell-derived cell therapy composition (HIL2MSC) into which a hypoxia-specific SIL2Fc expression gene was introduced, changes in tumor volume were tracked after administering the cell therapy to a mouse model induced with B16 solid tumors. The cell therapy composition was administered via intravenous injection (iv), subcutaneous injection opposite the tumor site (sc), and intratumoral injection (it), respectively. As a result, as can be seen in Fig. 9A, it was confirmed that intratumoral injection (it) showed a statistically significant antitumor effect compared to other injection methods (Fig. 9A).

[0209] In addition, considering the characteristic of MSCs to spontaneously migrate to the tumor site in response to inflammatory substances, direct intratumoral injection and peritumoral injection were compared. As a result, as can be seen in Fig. 9B, the peritumoral injection group inhibited tumor growth more effectively than the direct intratumoral injection group (Fig. 9B). To quantitatively analyze this, flow cytometry was performed to determine the MSC engraftment rate within the tumor tissue. As shown in Fig. 9C, it was confirmed that peritumoral injection resulted in a 9.6-fold higher cell engraftment rate compared to direct intratumoral injection (Fig. 9C). This high engraftment rate is attributed to a decrease in the expression of Caspase 3, a cell death marker protein. This confirms that peritumoral injection provides a more favorable environment for the survival of the injected cell therapy compared to direct intratumoral injection, thereby increasing engraftment (Fig. 9D).

[0210] Furthermore, as shown in Fig. 9E, when MSCs loaded with a hypoxia-induced expression system were injected into the peritumoral region, it was confirmed that more SIL2Fc was produced and secreted within the tumor in response to hypoxic stimulation in the tumor microenvironment when the concentration of SIL2Fc in the tumor tissue was measured by enzyme immunoassay (ELISA).

[0211] In summary, the present embodiment suggests that peritumoral injection can effectively inhibit the growth of solid tumors by increasing the survival and engraftment rates of MSC-based hypoxia-specific cell therapy agents (HIL2MSCs), thereby maximizing the local secretion of SIL2Fc protein.

[0212]

[0213] Example 4: Evaluation of Safety and Systemic Side Effects of Hypoxia-Specific Cell Therapy Composition

[0214] In this example, the systemic toxicity and side effects of two delivery methods were compared to evaluate whether systemic toxicity is reduced when IL2, known to cause systemic toxicity upon direct protein injection, is delivered via an MSC-mediated hypoxia-specific delivery method.

[0215] First, the concentrations of SIL2Fc and major immune-related cytokines (e.g., IFN-γ) were measured in serum collected on day 1 after administering the HIL2MSC cell therapy to an animal model. As shown in Fig. 10A, while SIL2Fc leaked out of the tumor under the direct protein administration method, the gene expression system via MSCs effectively suppressed SIL2Fc leakage within the serum (Fig. 10A). Additionally, as shown in Fig. 10B, IFN-γ, an indicator of extratumor immune cell activity, was not detected in the serum, confirming that systemic toxicity caused by excessive immune activation was significantly reduced (Fig. 10B). Based on these results, as shown in Fig. 10C, it was confirmed that no signs of systemic side effects, such as body weight loss, were observed during the 15-day long-term evaluation period (Fig. 10C).

[0216] Overall, the HIL2MSC cell therapy composition was shown to reduce side effects, including systemic toxicity, by secreting SIL2Fc in response to hypoxia in the tumor microenvironment and minimizing efflux into the bloodstream.

[0217]

[0218] Example 5: Combination therapy of a hypoxia-specific cell therapy composition and adaptive cell therapy

[0219] In this embodiment, a melanoma solid tumor mouse model (B16-OVA) was used to evaluate the synergistic effect of the combined administration of a hypoxia-specific cell therapy composition (HIL2MSC) and adaptive cell therapy.

[0220] First, B16-OVA tumor cells were subcutaneously inoculated into C57BL / 6 mice, and after the tumors reached a certain size, Cyclophosphamide (CTX) was pre-administered to eliminate immune cells within the tumor or to reorganize the immune microenvironment. Subsequently, HIL2MSC, which is the cell therapy composition of the present invention, or control MSCs were administered via an appropriate route, and OT-I T cells targeting OVA peptides were administered in a certain number (High or Low) either alone or in combination. As a result, as can be seen in Fig. 11, analysis of changes in tumor volume revealed a significant tumor growth inhibitory effect in the group administered HIL2MSC and a low number of OT-I T cells in combination (Fig. 11B), and in the survival rate evaluation, the combination administration group showed an improved survival rate compared to the monotherapy group (Fig. 11C). In addition, when the concentrations of cytokines such as IFN-γ and TNFα in the serum were measured, no excessive increase in cytokines was observed in the group combined with HIL2MSC and a low number of T cells, confirming that the antitumor effect was enhanced without an overreaction of the systemic immune system (Fig. 11D).

[0221] Additionally, to evaluate whether HIL2MSC enhances T cell infiltration into the tumor microenvironment, B16-OVA tumor cells were subcutaneously inoculated into CD45.1+ phenotyped C57BL / 6 mice, followed by the introduction of CD45.2+ OT-I T cells via ACT. After administering MSC or HIL2MSC at a certain time, the degree of T cell infiltration in the tumor and adjacent lymph nodes (TdLN) was compared by flow cytometry. As a result, as shown in Figures 11 and 12, it was confirmed that tumor-specific OT-I T cells (CD45.2+) also significantly increased in the HIL2MSC administration group, along with the tumor infiltration rate of endogenous CD45.1+ CD8+ T cells (Figures 11B and 12C). This is interpreted as a result of HIL2MSC simultaneously promoting the tumor infiltration and activation of endogenous and exogenous T cells by selectively secreting IL2 (Fc fusion protein) within the tumor microenvironment.

[0222]

[0223] Example 6: Confirmation of combination therapy with a hypoxia-specific cell therapy composition and chimeric antigen receptor T-cell therapy and reduction of on-target off-tumor side effects

[0224] In this embodiment, to confirm the synergistic effect of the combined administration of the hypoxia-specific cell therapy composition (HIL2MSC) of the present invention and chimeric one receptor T cell therapy, an hCD19 antigen overexpressing melanoma solid tumor mouse model (B16-hCD19) was used.

[0225] First, B16-hCD19 tumor cells were subcutaneously inoculated into C57BL / 6 mice, and after the tumor reached a certain size, HIL2MSC, which is the cell therapy composition of the present invention, or a control MSC was administered to the peritumoral region, and a certain number of Anti-hCD19 CAR T cells targeting the hCD19 antigen were administered alone or in combination (Fig. 13A). As a result, as can be seen in Fig. 13, analysis of changes in tumor volume revealed a significant tumor growth inhibitory effect in the group administered HIL2MSC and Anti-hCD19 CAR T cells in combination (Fig. 13B).

[0226] Additionally, to determine whether this antitumor effect was due to HIL2MSCs enhancing T cell infiltration into the tumor microenvironment, the number of Anti-CD19 CAR T cells within the tumor was examined. As shown in Fig. 13C, a significant increase relative to MSCs was observed. At this time, to determine whether the increase in Anti-CD19 CAR T cells induced by HIL2MSCs was a local tumor effect, the ratio of Anti-CD19 CAR T cells in the lungs was examined. As shown in Fig. 13D, there was no significant difference in the ratio or number of Anti-hCD19 CAR T cells in the lungs. For a more accurate comparison, the number of Anti-hCD19 CAR T cells in the lungs and tumors was compared between when HIL2MSCs were injected and when only MSCs were injected. The results showed a significant increase in the number of Anti-hCD19 CAR T cells only in the lungs (Fig. 13E). In summary, the HIL2-MSC of the present invention was shown to exhibit an enhanced anti-tumor effect by locally increasing the number of Anti-hCD19 CAR T cells only within the tumor without having a significant effect on normal organs.

[0227]

[0228] IL2 cytokine therapy can cause side effects due to systemic immune activation. Additionally, CAR T cells are known to exhibit On-Target Off-Tumor side effects, which involve recognizing and attacking antigens of normal organs that are distinct from solid tumors. Therefore, there is concern about serious On-Target Off-Tumor side effects in normal organs when cytokine anticancer therapy is combined with CAR T cells. Accordingly, to confirm the On-Target Off-Tumor side effects of HIL2-MSCs, an mCD19 overexpressing melanoma solid tumor mouse model (B16-mCD19) was used, which expresses mouse CD19, an antigen that can recognize both melanoma solid tumors and normal B cells.

[0229] First, B16-mCD19 tumor cells were subcutaneously inoculated into C57BL / 6 mice. Once the tumors reached a certain size, Cyclophosphamide (CTX) was pre-administered to eliminate immune cells within the tumor or to reorganize the immune microenvironment. Subsequently, HIL2MSC, the cell therapy composition of the present invention, or sumIL2Fc in combination with control MSCs were administered to the peritumoral region. After co-administering a certain number of Anti-mCD19 CAR T cells targeting the mouse CD19 (mCD19) antigen, the ratio and number of B cells in the tumor-draining lymph nodes and spleen were examined (Fig. 14A). As shown in Fig. 14, a significant decrease in B cells was observed in both normal organs when sumIL2Fc was co-administered. In contrast, no significant decrease in B cells was observed in the case of HIL2-MSC of the present invention compared to the control MSCs (Figs. 14B, C, D, and E). This suggests that, unlike sumIL2Fc which showed severe on-target off-tumor effects by inducing excessive proliferation and activity of Anti-mCD19 CAR T cells even in normal organs, the HIL2-MSC of the present invention does not induce excessive activity of CAR T cells in normal organs.

[0230]

[0231] In summary, it was confirmed that the HIL2MSC cell therapy composition of the present invention induces an immune response within the tumor more efficiently than conventional simple MSCs, thereby enhancing the anticancer therapeutic effect, and can achieve a therapeutic synergy effect by maximizing the accumulation efficiency of tumor-specific T cells when combined with other T cell therapies.

[0232]

[0233] From the foregoing description, those skilled in the art to which the present invention pertains will understand that the present invention may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.

[0234] The present invention can express hypoxia-specific genes to a desired level in a hypoxic environment, and can be usefully applied in the field of solid tumor treatments.

Claims

1. A hypoxia-specific gene expression system comprising: a Hypoxia Response Element (HRE) sequence isolated from each of one or more genes selected from the group consisting of VEGFA, PGK1, and ENO1; and a Hypoxia Stability Region (HSR) sequence derived from a VEGFA transcript.

2. In Paragraph 1, A hypoxia-specific gene expression system characterized in that the above hypoxia response element sequence is a repetitive arrangement.

3. In Paragraph 1, The above VEGFA, PGK1, and ENO1 are human-derived hypoxia-specific gene expression systems.

4. In Paragraph 1, A hypoxia-specific gene expression system in which the above hypoxia-specific gene is a mutant IL-2 (SIL2Fc).

5. In Paragraph 1, A hypoxia-specific gene expression system characterized by the above HRE and HSR sequences being a combination thereof, which selectively induces the expression of a mutant IL-2 (SIL2Fc) gene bound to human IgG under hypoxic conditions.

6. In Paragraph 1, The above hypoxia-specific gene expression system is characterized by the addition of an HSR sequence, which increases RNA transcription and protein expression compared to a system that does not include an HSR sequence, and improves the stability of mRNA transcribed under hypoxic conditions.

7. A hypoxia-specific gene expression vector comprising the hypoxia-specific gene expression system of claim 1.

8. Mesenchymal stem cells transformed with the hypoxia-specific expression vector of claim 7.

9. In Paragraph 8, The above mesenchymal stem cells are mesenchymal stem cells of bone marrow origin.

10. A cell therapy composition comprising the mesenchymal stem cells (MSCs) of claim 8.

11. In Paragraph 10, The above cell therapy composition is a cell therapy composition for anticancer use.

12. In Paragraph 11, A cell therapy composition in which the above cancer is a solid tumor.

13. In Paragraph 11, The above cell therapy composition is characterized by inducing the selective secretion of SIL2Fc within the tumor microenvironment.

14. In Paragraph 11, The above cell therapy composition is a cell therapy composition intended for administration to a tumor periphery.

15. In Paragraph 11, The above cell therapy composition is characterized by reducing systemic toxicity and side effects.

16. A pharmaceutical composition for the prevention or treatment of cancer comprising the expression vector of claim 7, the mesenchymal stem cells of claim 8, or a culture medium thereof.

17. A combination composition for anticancer use comprising the cell therapy composition of claim 11 or the pharmaceutical composition of claim 16; and an anticancer agent or anticancer therapy.

18. In Paragraph 17, An anticancer combination composition wherein the above anticancer therapy is adoptive T cell transfer (ACT) therapy or chimeric antigen receptor T cell (CAR-T) therapy.

19. A method for preventing or treating cancer comprising the step of administering the cell therapy composition of claim 11, the pharmaceutical composition of claim 16, or the combination composition of claim 14 to a cancer-bearing individual excluding humans.

20. In Paragraph 19, The above method is a method that is used in combination with adoptive T cell transfer (ACT) therapy or chimeric antigen receptor T cell (CAR-T) therapy.