Compositions and methods for modulation and splice redirection of MLH3
Patent Information
- Application Number
- PCT/US2026/018267
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-03-10
- Filing Date
- 2026-03-09
- Publication Date
- 2026-09-17
Smart Images

Figure US2026018267_17092026_PF_FP_ABST
Abstract
Description
[0001] Attorney Docket Number: T0833.70052WO00
[0002] COMPOSITIONS AND METHODS FOR MODULATION AND SPLICE REDIRECTION OF MLH3
[0003] RELATED APPLICATIONS
[0004] This application claims the benefit of U.S. Provisional Patent Application Serial No.
[0005] 63 / 769,502, filed March 10, 2025, entitled “Compositions and Methods for Modulation and Splice Redirection of MLH3,” incorporated herein by reference in its entirety.
[0006] FIELD
[0007] The invention relates to compositions (e.g., antisense oligonucleotides) for modulation of gene expression and splice redirection of MLH3.
[0008] REFERENCE TO AN ELECTRONIC SEQUENCE LISTING
[0009] The contents of the electronic sequence listing (T083370052WO00-SEQ-CBD.xml; Size: 86,350 bytes; and Date of Creation: February 26, 2026) is herein incorporated by reference in its entirety.
[0010] BACKGROUND DNA mismatch repair (MMR) is a pathway that normally recognizes and repairs DNA errors made during replication. However, when it comes to certain types of repetitive DNA, MMR can contribute to genome instability. For example, a contribution by the MMR pathway has been established in several repeat expansion diseases including myotonic dystrophy, Huntington's disease, and Friedreich ataxia. MMR requires the sequential action of the protein complexes MutS and then MutL. In humans there are four identified MutL homologues: MLH1, MLH3, PMS1 and PMS2. MLH1 combines with PMS2 to form MutLalpha, with PMS 1 to form MutLbeta and with MLH3 to form MutLgamma, respectively. MLH3 is currently considered to have a minor role in MMR processes, as it has mostly redundant functions. However, MLH3 has a major role in DNA repeat expansion due to its endonuclease activity required for repeat expansion. Currently there is no treatment and no cure for Friedreich ataxia or any of the many other DNA repeat expansion diseases.Attorney Docket Number: T0833.70052WO00
[0011] SUMMARY
[0012] Patients with repeat expansion diseases could benefit from MLH3 exon skipping and splice redirection of MLH3. There is a need for compositions and methods for treating repeat expansion diseases, e.g., by inhibiting endonuclease activity of MLH3 in a cell in a subject with a repeat expansion disease. The present disclosure, in some aspects, provides antisense oligonucleotides for splice redirection of MLH3.
[0013] The present disclosure, in some aspects, provides antisense oligonucleotides 18-23 nucleobases in length, comprising a nucleobase sequence of:
[0014] (i) CTGCAAACAGATCCTTACCA (SEQ ID NO: 1),
[0015] (ii) GCAAACAGATCCTTACCA (SEQ ID NO: 2),
[0016] (iii) TCCCACCTAGATGAGCAAGG (SEQ ID NO: 3), or
[0017] (iv) CCCACCTAGATGAGCAAGGAT (SEQ ID NO: 4).
[0018] In some embodiments, the antisense oligonucleotide modulates expression of MLH3. In some embodiments, the antisense oligonucleotide induces exon skipping of exon 7 of MLH3. In some embodiments, the antisense oligonucleotide comprises a nucleobase sequence that consists of any one of SEQ ID NOs: 1-4.
[0019] In some embodiments, the antisense oligonucleotide comprises one or more modified nucleosides. In some embodiments, the one or more modified nucleosides is a 2’-modified nucleoside. In some embodiments, the 2’-modified nucleoside comprises 2’-O-methyl, 2’-fluoro, 2’-0-methoxyethyl (MOE), 2’, 4’-bridged nucleoside, or combinations thereof. In some embodiments, the antisense oligonucleotide comprises one or more 2’ -MOE modified nucleosides and one or more locked nucleic acids (LNA). In some embodiments, each nucleoside of the antisense oligonucleotide is a 2’ -MOE modified nucleoside or an LNA, or combinations thereof. In some embodiments, each nucleoside of the antisense oligonucleotide is a 2’-MOE modified nucleoside.
[0020] In some embodiments, the antisense oligonucleotide comprises one or more modified intemucleoside linkages. In some embodiments, each intemucleoside linkage of the oligonucleotide is a modified intemucleoside linkage. In some embodiments, the modified intemucleoside linkage is a phosphorothioate linkage. In some embodiments, each intemucleoside linkage is a phosphorothioate linkage. In some embodiments, the antisense oligonucleotide comprises one or more morpholino nucleosides. In some embodiments, the antisense oligonucleotide is a phosphorodiamidate oligomer (PMO). In some embodiments, the antisense oligonucleotide comprises a structure as provided in Table 3. In someAttorney Docket Number: T0833.70052WO00
[0021] embodiments, the antisense oligonucleotide inhibits endonuclease activity of MLH3. In some embodiments, the antisense oligonucleotide decreases the rate of DNA repeat expansion.
[0022] Some aspects of the present disclosure provide antisense oligonucleotides 20 nucleobases in length, wherein the oligonucleotide has a nucleobase sequence comprising CTGCAAACAGATCCTTACCA (SEQ ID NO: 1). In some embodiments, the oligonucleotide has a nucleobase sequence consisting of CTGCAAACAGATCCTTACCA (SEQ ID NO: 1). In some embodiments, the oligonucleotide has a sequence comprising [iCs] [iTs] [iGs] [iCs] [iAs] [iAs] [iAs] [iCs] [iAs] [iGs] [iAs] [iTs] [iCs] [iCs] [iTs] [iTs] [iAs] [iCs] [iC s][iA] (SEQ ID NO: 5 ), wherein iA, iG, iC, and iT are 2’-0-methoxyethyl (2’ -MOE) modified adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate internucleoside linkage. In some embodiments, the oligonucleotide has a sequence consisting of
[0023] [iCs] [iTs] [iGs] [iCs] [iAs] [iAs] [iAs] [iCs] [iAs] [iGs] [iAs] [iTs] [iCs] [iCs] [iTs] [iTs] [iAs] [iCs] [iC s][iA] (SEQ ID NO: 5), wherein iA, iG, iC, and iT are 2’-0-methoxyethyl (2’-MOE) modified adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate internucleoside linkage. In some embodiments, the oligonucleotide has a sequence comprising
[0024] [ICs] [iTs] [iGs] [ICs] [iAs] [iAs] [iAs] [ICs] [iAs] [iGs] [iAs] [iTs] [iCs] [ICs] [iTs] [iTs] [iAs] [ICs] [iC s][iA] (SEQ ID NO: 6), wherein iA, iG, iC, and iT are 2’-0-methoxyethyl (2’-MOE) modified adenosine, guanosine, cytidine, and thymidine, respectively; IA, IG, IC, and IT are LNA adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate intemucleoside linkage. In some embodiments, the oligonucleotide has a sequence consisting of
[0025] [ICs] [iTs] [iGs] [ICs] [iAs] [iAs] [iAs] [ICs] [iAs] [iGs] [iAs] [iTs] [iCs] [ICs] [iTs] [iTs] [iAs] [ICs] [iC s][iA] (SEQ ID NO: 6), wherein iA, iG, iC, and iT are 2’-0-methoxyethyl (2’-MOE) modified adenosine, guanosine, cytidine, and thymidine, respectively; IA, IG, IC, and IT are LNA adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate intemucleoside linkage.
[0026] Some aspects of the present disclosure provide antisense oligonucleotides 18 nucleobases in length, wherein the oligonucleotide has a nucleobase sequence comprising GCAAACAGATCCTTACCA (SEQ ID NO: 2). In some embodiments, the oligonucleotide has a sequence comprising
[0027] [iGs] [iCs] [iAs] [iAs] [iAs] [iCs] [iAs] [iGs] [iAs] [iTs] [iCs] [iCs] [iTs] [iTs] [iAs] [iCs] [iCs] [iA] (SEQ ID NO: 7 ), wherein iA, iG, iC, and iT are 2’-0-methoxyethyl (2’ -MOE) modifiedAttorney Docket Number: T0833.70052WO00
[0028] adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate intemucleoside linkage. In some embodiments, the oligonucleotide has a nucleobase sequence consisting of GCAAACAGATCCTTACCA (SEQ ID NO: 2). In some embodiments, the oligonucleotide has a sequence consisting of
[0029] [iGs] [iCs] [iAs] [iAs] [iAs] [iCs] [iAs] [iGs] [iAs] [iTs] [iCs] [iCs] [iTs] [iTs] [iAs] [iCs] [iCs] [iA] (SEQ ID NO: 7), wherein iA, iG, iC, and iT are 2’-0-methoxyethyl (2’-MOE) modified adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate intemucleoside linkage.
[0030] Some aspects of the present disclosure provide antisense oligonucleotides 20 nucleobases in length, wherein the oligonucleotide has a nucleobase sequence comprising TCCCACCTAGATGAGCAAGG (SEQ ID NO: 3). In some embodiments, the oligonucleotide has a sequence comprising
[0031] [iTs] [iCs] [iCs] [iCs] [iAs] [iCs] [iCs] [iTs] [iAs] [iGs] [iAs] [iTs] [iGs] [iAs] [iGs] [iCs] [iAs] [iAs] [i Gs][iG] (SEQ ID NO: 8 ), wherein iA, iG, iC, and iT are 2’-0-methoxyethyl (2’ -MOE) modified adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate intemucleoside linkage. In some embodiments, the oligonucleotide has a nucleobase sequence consists of TCCCACCTAGATGAGCAAGG (SEQ ID NO: 3). In some embodiments, the oligonucleotide has a sequence consisting of
[0032] [iTs] [iCs] [iCs] [iCs] [iAs] [iCs] [iCs] [iTs] [iAs] [iGs] [iAs] [iTs] [iGs] [iAs] [iGs] [iCs] [iAs] [iAs] [i Gs][iG] (SEQ ID NO: 8 ), wherein iA, iG, iC, and iT are 2’-0-methoxyethyl (2’ -MOE) modified adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate intemucleoside linkage.
[0033] Some aspects of the present disclosure provide antisense oligonucleotides 22 nucleobases in length, wherein the oligonucleotide has a nucleobase sequence comprising CCCACCTAGATGAGCAAGGATT (SEQ ID NO: 4). In some embodiments, the oligonucleotide has a sequence comprising
[0034] [iCs] [iCs] [iCs] [iAs] [iCs] [iCs] [iTs] [iAs] [iGs] [iAs] [iTs] [iGs] [iAs] [iGs] [iCs] [iAs] [iAs] [iGs] [i Gs][iAs][iTs][iT] (SEQ ID NO: 9 ), wherein iA, iG, iC, and iT are 2’-0-methoxyethyl (2’-MOE) modified adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate intemucleoside linkage. In some embodiments, the oligonucleotide has a nucleobase sequence consisting of CCCACCTAGATGAGCAAGGATT (SEQ ID NO: 4). In some embodiments, the oligonucleotide has a sequence consisting ofAttorney Docket Number: T0833.70052WO00
[0035] [iCs] [iCs] [iCs] [iAs] [iCs] [iCs] [iTs] [iAs] [iGs] [iAs] [iTs] [iGs] [iAs] [iGs] [iCs] [iAs] [iAs] [iGs] [i Gs][iAs][iTs][iT] (SEQ ID NO: 9 ), wherein iA, iG, iC, and iT are 2’-0-methoxyethyl (2’-MOE) modified adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate internucleoside linkage.
[0036] Some aspects of the present disclosure provide pharmaceutical compositions comprising the antisense oligonucleotide provided herein. In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.
[0037] Some aspects of the present disclosure provide pharmaceutical compositions comprising a first antisense oligonucleotide 18-23 nucleobases in length comprising a region of complementarity to a first target region near exon 7 of a MLH3 sequence and a second antisense oligonucleotide 18-23 nucleobases in length, comprising a region of complementarity to a second target region near exon 7 of a MLH3 sequence, wherein the region of complementarity is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length, wherein the first antisense oligonucleotide and the second antisense oligonucleotide modulate expression of MLH3, wherein the first antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 1 or 2 and the second antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 3 or 4.
[0038] In some embodiments, the first antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 1 and the second antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 3. In some embodiments, the first antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 1 and the second antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 4. In some embodiments, the first antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 2 and the second antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 3. In some embodiments, the first antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 2 and the second antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 4. In some embodiments, the first antisense oligonucleotide or the second antisense oligonucleotide comprises one or more modified nucleosides are 2’-modified nucleosides selected from the group consisting of: 2’-O-methyl, 2’-fluoro, 2’-0-methoxyethyl (MOE), and 2’, 4’-bridged nucleoside or combinations thereof. In some embodiments, the first antisense oligonucleotide and the second antisense oligonucleotide comprise a structure as provided in Table 3.Attorney Docket Number: T0833.70052WO00
[0039] Some aspects of the present disclosure provide methods of inhibiting endonuclease activity of MLH3 in a cell, comprising contacting the cell with an antisense oligonucleotide provided herein, or a pharmaceutical composition provided herein.
[0040] Some aspects of the present disclosure provide methods of inhibiting endonuclease activity of MLH3 in a cell of a subject, comprising administering to the subject an antisense oligonucleotide provided herein, or a pharmaceutical composition provided herein.
[0041] Some aspects of the present disclosure provide methods of treating a repeat expansion disease in a subject, comprising administering to the subject an antisense oligonucleotide provided herein, or a pharmaceutical composition provided herein.
[0042] Some aspects of the present disclosure provide methods of treating Friedreich ataxia in a subject, comprising administering to the subject an antisense oligonucleotide provided herein, or a pharmaceutical composition provided herein.
[0043] BRIEF DESCRIPTION OF DRAWINGS
[0044] The foregoing and other features and advantages of the present invention, as well as the invention itself, will be more fully understood from the following description of embodiments when read together with the accompanying drawings, in which:
[0045] FIGs. 1A-1D are gel images showing the hMLH3 isoform 1 (top band) and hMLH3 isoform 2 (lower band) in mouse tissues including cerebral cortex (FIG. 1A), brain stem (FIG. IB), cerebellum (FIG. 1C), and striatum (FIG. ID) from 24 BAC mice treated with the indicated antisense oligonucleotides. “M” represents male and “F” represents female.
[0046] DETAILED DESCRIPTION
[0047] Generally, nomenclatures used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. Certain methods and techniques provided herein are generally performed according to methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated.
[0048] Enzymatic reactions and purification techniques are performed according to manufacturer’ s specifications, as commonly accomplished in the art or as otherwise described herein. The nomenclatures, laboratory procedures and techniques of analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Standard techniques are used for chemicalAttorney Docket Number: T0833.70052WO00
[0049] syntheses, chemical analyses, pharmaceutical preparation, formulation, delivery, and treatment of patients.
[0050] Any of the methods for gene therapy available in the art can be used in the methods provided herein. For general reviews of the methods of gene therapy, see Goldspiel et al. (1993) Clin. Pharmacy 12:488-505; Wu and Wu (1991) Biotherapy 3:87-95; Tolstoshev (1993) Ann. Rev. Pharmacol. Toxicol. 32:573-596; Mulligan (1993) Science 260:926- 932; Morgan and Anderson (1993) Ann. Rev. Biochem. 62:191-217; and May (1993) TIBTECH 11(5): 155-215. Methods commonly known in the art of recombinant DNA technology which can be used are described in Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley &Sons, NY (1993); and Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990). Detailed description of various methods of gene therapy are disclosed in US Patent Publication No. US20050042664.
[0051] Definitions
[0052] In order that the present disclosure may be more readily understood, certain terms are first defined. Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. The meaning and scope of the terms should be clear, however, in the event of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. The use of “or” means “and / or” unless stated otherwise. The use of the term “including”, as well as other forms of the term, is not limiting.
[0053] In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also part of this disclosure.
[0054] As used herein, the singular forms “a”, “an” and “the” include plural referents unless the context clearly dictates otherwise. “And” as used herein is interchangeably used with “or” unless expressly stated otherwise. The terms “comprising, “having,” “including,” and “containing” are to be construed as open-ended terms (i.e., meaning “including, but not limited to”) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value recited or falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited.Attorney Docket Number: T0833.70052WO00
[0055] The term “about” or “approximately,” as applied to one or more values provided herein, refers to a value that is similar to a stated reference value. In some embodiments, the term “about” or “approximately” refers to a range of values that fall within and include 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context. In some embodiments, “about” or “approximately” can be understood as about 2 standard deviations from the mean. In some embodiments, “about” or “approximately” means up to and including +10% (e.g., +10%, +9%, +8%, +7%, +6%, +5%, +4%, +3%, +2%, +1%, or less). In some embodiments, “about” or “approximately” means +5%. When “about” or “approximately” is present before a series of numbers or a range, it is understood that it can modify each of the numbers in the series or range.
[0056] The term “administering” or “administration of,” as used herein, means to provide an agent, e.g., antisense oligonucleotide to a subject. In some embodiments, “administering” or “administration of ” means to provide an antisense oligonucleotide to a subject in a manner that is physiologically and / or pharmacologically useful (e.g., to treat a condition in the subject). Non-limiting examples of routes of administration include intravenous, intramuscular, intraperitoneal, intracerebrospinal, subcutaneous, intra-articular, intrasynovial, or intrathecal routes. In some embodiments, the route of administration is subcutaneous.
[0057] The term “antisense oligonucleotide (ASO),” as used herein, refers to a singlestranded oligonucleotide which comprises a complementary base sequence capable of hybridizing with at least a part, for example, any target region, of a target nucleotide sequence (e.g., gene sequence, pre-mRNA sequence, or mRNA sequence), and which can modulate the processing of the transcription product of a target gene and / or the expression (e.g., mRNA and / or protein level) of the target gene. In some embodiments, a target region of a target nucleotide sequence can have a length of at least 16 bases, for example, a length of 16, 17, 18, 19, 20, 21, 22, or 23 nucleosides.
[0058] The term “antisense oligonucleotide (ASO),” as used herein, refers to a singlestranded oligonucleotide which comprises a region of complementarity capable of hybridizing with at least a part, for example, a target region of a target sequence (e.g., gene sequence, pre-mRNA sequence, or mRNA sequence), and which can modulate the processing of the transcription product of a target gene and / or the expression (e.g., mRNA and / or protein level) of the target gene. In some embodiments, a target region of a target nucleotide sequence can have a length of at least 16 nucleosides, for example, a length of 16, 17, 18, 19, 20, 21, 22, or 23 nucleosides.Attorney Docket Number: T0833.70052WO00
[0059] In some embodiments, an antisense oligonucleotide disclosed herein redirects splicing of an MLH3 pre-mRNA. In some embodiments, an antisense oligonucleotide disclosed herein induces exon skipping of exon 7 of MLH3. In some embodiments, an antisense oligonucleotide disclosed herein inhibits endonuclease activity of MLH3. In some embodiments, an antisense oligonucleotide disclosed herein decreases the rate of DNA repeat expansion.
[0060] The term “at least” prior to a number or series of numbers is understood to include the number adjacent to the term “at least”, and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides or nucleosides in a nucleic acid molecule must be an integer. For example, “at least 19 nucleosides of a 21 nucleoside nucleic acid molecule” means that 19, 20, or 21 nucleosides have the indicated property. When at least is present before a series of numbers or a range, it is understood that “at least” can modify each of the numbers in the series or range.
[0061] The term “biological activity” means any biological property of a molecule, whether present naturally in vivo, or provided or enabled by recombinant means. Biological activities include, but are not limited to, binding to a receptor, inducing cell proliferation, inhibiting cell growth, inducing other cytokines, inducing apoptosis, and enzymatic activity.
[0062] The term “complementary,” as used herein, refers to the capacity for base pairing between two nucleobases or two nucleobase sequences. In particular, complementary is a term that characterizes an extent of hydrogen bond pairing that brings about binding between two nucleobases or two nucleobase sequences. For example, if a base at one position of a nucleobase sequence (e.g., of an antisense oligonucleotide described herein) is capable of hydrogen bonding with a base at the corresponding position of another nucleobase sequence (e.g., target gene sequence, pre-mRNA sequence, or mRNA sequence), then the bases are considered to be complementary to each other at that position. The nucleic acid molecules (e.g., antisense oligonucleotide) whose nucleobase sequence is complementary may comprise one or more modified nucleosides and modified internucleoside linkages, which do not affect the capacity of base paring between the nucleobases and do not affect the “complementarity” between two nucleobase sequences. The nucleic acid molecules (e.g., antisense oligonucleotide and target sequence) whose nucleobase sequence is complementary may also comprise nucleobase analogous that result in bases at certain positions not being complementary, but the nucleobase sequences of the two molecules must be sufficiently complementary over the entire length to result in a desired biological activity (e.g., modulation of gene expression).Attorney Docket Number: T0833.70052WO00
[0063] Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs (e.g., Wobble base pairs and Hoogsteen base pairs) and may include natural or modified nucleosides or nucleoside mimics. For example, in some embodiments, for complementary base pairings, adenosine-type bases (A) are complementary to thymidine-type bases (T) or uracil-type bases (U), that cytosine-type bases (C) are complementary to guano sine-type bases (G), and that universal bases such as 3-nitropyrrole or 5-nitroindole can hybridize to and are considered complementary to any A, C, U, or T. Inosine (I) has also been considered in the art to be a universal base and is considered complementary to any A, C, U or T.
[0064] Complementarity is independent of modifications in the sugar of a nucleoside. For example, 2 ’-modified A, as defined herein, are complementary to U (or T) and identical to A for the purposes of determining identity or complementarity.
[0065] The term “control” or “reference,” when referring to a substance, means a composition used as a standard or a point of comparison against which other test results are measured. In some embodiments, a “control” or “reference” is a composition known to not contain analyte (“negative control”) or to contain analyte (“positive control”). A positive control can comprise a known concentration of analyte. “Control,” and “positive control,” may be used to refer to a composition comprising a known concentration of analyte. A “positive control” can be used to establish assay performance characteristics and is a useful indicator of the integrity of reagents (e.g., analytes). In some embodiments, an appropriate “control” or “reference” is where only one element is changed in order to determine the effect of the one element. In some embodiments, a control is a level of a target gene (e.g., in a cell or in a subject) before treatment (e.g., with an antisense oligonucleotide described herein).
[0066] The term “perfectly complementary” or “fully complementary” means that all (100%) of the nucleobases, nucleosides, or nucleotides in a contiguous sequence of a first nucleotide sequence (e.g., an antisense oligonucleotide) will hybridize with the same number of nucleobases, nucleosides, or nucleotides in a contiguous sequence of second nucleotide sequence (e.g., a target sequence such as an MLH3 pre-mRNA). The contiguous sequence may comprise all or a part of a first or second nucleotide sequence. The term “partially complementary” means that in a hybridized pair of nucleobase, nucleosides, or nucleotide sequences, at least 70%, but not all, of the bases in a contiguous sequence of a first nucleotide sequence (e.g., an antisense oligonucleotide) will hybridize with the same number of bases in a contiguous sequence of a second nucleotide sequence (e.g., a target sequence such as anAttorney Docket Number: T0833.70052WO00
[0067] MLH3 pre-mRNA). The term “sufficiently complementary” or “substantially complementary” means that in a hybridized pair of nucleobase, nucleosides, or nucleotide sequences, at least 85%, but not all, of the bases in a contiguous sequence of a first nucleotide sequence (e.g., an antisense oligonucleotide) will hybridize with the same number of bases in a contiguous sequence of a second nucleotide sequence (e.g., a target sequence such as an MLH3 pre-mRNA). The terms “complementary,” “fully complementary,” “partially complementary,” and “sufficiently / substantially complementary” herein are used with respect to the nucleobase, nucleosides, or nucleotide matching between an antisense oligonucleotide and a target sequence (e.g., an MLH3 pre-mRNA).
[0068] The term “control” or “reference,” when referring to a substance, means a composition used as a standard or a point of comparison against which other test results are measured. In some embodiments, a “control” or “reference” is a composition known to not contain analyte (“negative control”) or to contain analyte (“positive control”). A positive control can comprise a known concentration of analyte. “Control,” and “positive control,” may be used to refer to a composition comprising a known concentration of analyte. A “positive control” can be used to establish assay performance characteristics and is a useful indicator of the integrity of reagents (e.g., analytes). In some embodiments, an appropriate “control” or “reference” is where only one element is changed in order to determine the effect of the one element. In some embodiments, a control is a level of a target gene (e.g., in a cell or in a subject) before treatment (e.g., with an antisense oligonucleotide described herein).
[0069] The term “reference” may also be used in “reference sequence.” The term “reference sequence” refers to a sequence, e.g., a nucleic acid sequence or an amino acid sequence, used as a basis for sequence comparison. In certain embodiments, a reference sequence is an RNA sequence, e.g., human MLH3 pre-mRNA sequence, upon which the design of the antisense oligonucleotide is based.
[0070] The term “cross-reactive” means the ability of a binding molecule (e.g., an antisense oligonucleotide) to bind a target molecule (e.g., gene sequence, pre-mRNA sequence, or mRNA sequence) other than that against which it was designed or generated. For example, the binding molecule is capable of specifically binding to more than one target molecule of a similar type or class (e.g., mRNA variants or mRNA homologous from closely related species) with similar affinity. Generally, a binding molecule will bind its target molecule with an appropriately high affinity but can bind to the same target molecule of another species or display a low affinity for non-target molecules. In some embodiments, an antisenseAttorney Docket Number: T0833.70052WO00
[0071] oligonucleotide that is cross-reactive against human and non-human primate MLH3 comprises a region of complementarity to human and non-human primate MLH3 gene sequence, pre-mRNA sequence, or mRNA sequence. Individual binding molecules are generally selected to meet two criteria: (1) tissue staining appropriate for the known expression of the target or (2) similar staining pattern between human and toxicology species (mouse and cynomolgus monkey) tissues from the same organ. These and other methods of assessing cross-reactivity are known to one skilled in the art.
[0072] The term “effective amount” or “therapeutically effective amount,” as used herein, refers to that amount of an antisense oligonucleotide to produce a molecular (e.g., inhibiting endonuclease activity of MLH3 in a subject), biological, pharmacological, therapeutic (e.g., treatment of a repeat expansion disease), or preventive result. The amount administered will likely depend on such variables as the overall health status of the patient, the relative biological efficacy of the compound delivered, the formulation of the drug, the presence and types of excipients in the formulation, and the route of administration. Also, it is to be understood that the initial dosage administered can, in some instances, be increased beyond the above upper level to rapidly achieve the desired blood-level or tissue level, or the initial dosage can, in some instances, be smaller than the optimum.
[0073] The terms “hybridize” and “hybridization” refer to the pairing of complementary compounds (e.g., an antisense oligonucleotide and its target nucleic acid). While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Wobble, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
[0074] The term “intemucleoside linkage,” as used herein, means a covalent linkage between adjacent nucleosides in an oligonucleotide (e.g., antisense oligonucleotide described herein). An internucleoside linkage may be a natural phosphodiester internucleoside linkage, or may be a modified (non-natural) internucleoside linkage. Modified internucleoside that may be used in an antisense oligonucleotide disclosed herein include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising 3 ’alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates comprising 3 ’-amino phosphoramidate and aminoalkylphosphoramidates, mesyl phosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3’-5’ linkages, 2’-5’ linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3’-5’ to 5’-Attorney Docket Number: T0833.70052WO00
[0075] 3’ or 2’-5’ to 5’-2’; see US patent nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5, 177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455, 233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563, 253; 5,571,799; 5,587,361; and 5,625,050. In some embodiments, in any one of the antisense oligonucleotides disclosed herein, all of the intemucleoside linkages are stereorandom.
[0076] The term, “nucleoside,” as used herein, refers to a compound comprising a nucleobase moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (as found in DNA and RNA) and modified nucleosides. Nucleosides may be linked to a phosphate moiety. The term “nucleoside” encompasses a natural nucleoside and chemically modified nucleosides (e.g., with modifications in the base and / or sugar moiety).
[0077] The term “nucleotide,” as used herein, refers to a compound comprising a nucleoside linked to a phosphate group. As used herein, “linked nucleosides” may or may not be linked by phosphate linkages and thus includes but is not limited to “linked nucleotides.” As used herein, “linked nucleosides” are nucleosides that are connected in a continuous sequence (i.e., no additional nucleosides are present between those that are linked). The term “nucleotide” encompasses a natural nucleotide and chemically modified nucleotides (e.g., with modifications in the base, sugar moiety, and / or phosphate group).
[0078] The term “nucleobase,” as used herein, refers to nitrogen-containing compounds that can be linked to a sugar moiety to create a nucleoside that is capable of incorporation into an oligonucleotide, and wherein the compound is capable of bonding with a complementary naturally occurring nucleobase of another oligonucleotide or nucleic acid. Nucleobases may be naturally occurring or may be modified. As used herein a “naturally occurring nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). The term “nucleobase” encompasses 5 ’-methylated bases (e.g., 5 ’-methyl cytosine or 5 ’-methyl guanine).
[0079] The term “modified internucleoside linkage” refers to a linkage between two nucleosides (e.g., in an oligonucleotide) that is not the natural phosphodiester linkage. Nonlimiting examples of modified intemucleoside linkages include phosphorothioates, phosphorodiamidates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages.
[0080] The term “nucleoside modification” or “modified nucleoside” means a nucleoside that has one or more modifications to the nucleoside, including modifications to the nucleobase moiety and / or the sugar moiety. Any of the modified chemistries or formats of nucleosidesAttorney Docket Number: T0833.70052WO00
[0081] described herein can be combined with each other. Non-limiting examples of modified nucleosides includes 2’-fluoro (2’-F), 2’-O-methyl (2’-O-Me), 2’-0-methoxyethyl (2’-MOE), 2’-0-aminopropyl (2’-O-AP), 2’-0-dimethylaminoethyl (2’-O-DMAOE), 2’-O-dimethylaminopropyl (2’-O-DMAP), 2’-0-dimethylaminoethyloxyethyl (2’-O-DMAEOE), or 2’-0-N-methylacetamido (2’-O-NMA), locked nucleic acid (LNA, methylene-bridged nucleic acid), unlocked nucleic acid (UNA), ethylene-bridged nucleic acid (ENA), and (S)-constrained ethyl-bridged nucleic acid (cEt) modified nucleosides. Further non-limiting examples of modified nucleosides include a conformationally restricted nucleoside, an abasic nucleoside, a 2’-amino-modified nucleoside, a morpholino nucleoside, a phosphoramidate, a non-natural base comprising nucleoside, a tetrahydropyran modified nucleoside, a 1,5-anhydrohexitol modified nucleoside (HNA), a cyclohexenyl modified nucleoside (CeNA), a nucleoside comprising a phosphorothioate group, a nucleoside comprising a methylphosphonate group, a nucleoside comprising a 5 ’-phosphate, a nucleoside comprising a 5 ’-phosphate mimic, a thermally destabilizing nucleoside, a glycol modified nucleoside (GNA).
[0082] The term “2’ -modified nucleoside” refers to a nucleoside having a sugar moiety modified at the 2’ position, meaning the sugar moiety comprises at least one 2’ -substituent group other than H or OH. Non-limiting examples of 2’ -modified nucleosides include: 2’-O-methoxyethyl (2’-MOE), 2’-O-Methyl (2’-O-Me), 2’-fluoro (2’-F), LNA (2’-4’ methylene bridge), ENA (2’-4’ ethylene bridge), or cET (2’-4’ ethylene bridge), 2’-deoxy, 2’-O-aminopropyl (2’-O-AP), 2’-0-dimethylaminoethyl (2’-O-DMAOE), 2’-O-dimethylaminopropyl (2’-O-DMAP), 2’-0-dimethylaminoethyloxyethyl (2’-O-DMAEOE), or 2’-0-N-methylacetamido (2’-O-NMA) modified nucleosides. In some embodiments, any one of the 2’-modified nucleosides described herein are high-affinity modified nucleosides and a modified antisense oligonucleotide has increased affinity to target sequences, relative to an unmodified antisense oligonucleotide. In some embodiments, at least one modified nucleoside is a 2’ modified nucleoside. In some embodiments, the 2’ modified nucleoside is a 2 ’-MOE modified nucleoside or an LNA (2 ’-4’ methylene bridge) or combinations thereof. In some embodiments, the 2’ modified nucleoside is a 2’-MOE modified nucleoside.
[0083] The term “modified oligonucleotide” or “modified antisense oligonucleotide” refers to oligonucleotides or antisense oligonucleotides that comprise one or more modified nucleosides and / or one or more modified internucleoside linkages. In some embodiments, a “modified oligonucleotide” or “modified antisense oligonucleotide” comprises a mix of modified nucleosides and unmodified nucleosides and / or a mix of modified intemucleosideAttorney Docket Number: T0833.70052WO00
[0084] linkages and unmodified modified intemucleoside linkages. In some embodiments, each nucleoside of a modified oligonucleotide” or “modified antisense oligonucleotide” is a modified nucleoside, and / or each intemucleoside linkage of a modified oligonucleotide” or “modified antisense oligonucleotide” is a modified intemucleoside linkage.
[0085] The term “region of complementarity,” as used herein, refers to a nucleobase sequence, e.g., of an antisense oligonucleotide, that is sufficiently complementary to a cognate nucleobase sequence, e.g., of a target nucleic acid, such that the two nucleobase sequences are capable of annealing to one another under physiological conditions (e.g., in a cell). In some embodiments, a region of complementarity is fully complementary (e.g., 100% complementarity) to a cognate nucleobase sequence of target nucleic acid. In some embodiments, a region of complementarity is partially complementary to a cognate nucleobase sequence of target nucleic acid (e.g., at least 80%, 90%, 95% or 99% complementarity). In some embodiments, a region of complementarity contains 1, 2, 3, 4, or 5 mismatches compared with a cognate nucleobase sequence of a target nucleic acid.
[0086] The term “repeat expansion disease,” as used herein, is a group of over 40 diseases which primarily affect the nervous system and are caused by expansions of simple sequence repeats dispersed throughout the human genome. Non-limiting examples of repeat expansion diseases include Myotonic dystrophy, Amyotrophic lateral sclerosis, Frontotemporal dementia, Huntington disease, and Friedreich ataxia.
[0087] The term “Friedreich ataxia,” as used herein, is the most common inherited ataxia, is a progressive neurodegenerative disorder caused by GAA-TTC repeat expansion in the first intron of the frataxin (FXN) gene. Currently there is no treatment and no cure for Friedreich ataxia or any of the many other DNA repeat expansion diseases.
[0088] The term “sequence identity,” as used herein, refers to the extent that sequences are identical (independent of chemical modification) on a nucleobase-by- nucleobase basis or an amino acid-by-amino acid basis over a window of comparison. Thus, a “percentage of sequence identity” may be calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, I) or the identical amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Vai, Leu, He, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gin, Cys and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. Optimal alignment of sequences for aligning a comparison window may be conducted byAttorney Docket Number: T0833.70052WO00
[0089] computerized implementations of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, Wis., USA) or by inspection and the best alignment (i.e., resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected. Reference also may be made to the BLAST family of programs as for example disclosed by Altschul et al., Nucl. Acids Res. 25:3389, 1997.
[0090] The term “subject,” as used herein, refers to a mammal. In some embodiments, a subject is non-human primate, or rodent. In some embodiments, a subject is a human. In some embodiments, a subject is a patient, e.g., a human patient that has or is suspected of having a disease. In some embodiments, the subject is a human patient who has or is suspected of having a repeat expansion disease in a subject. In some embodiments, the repeat expansion disease is Friedreich ataxia).
[0091] The term “specificity” means the ability to inhibit the target RNA without manifest effects on other genes of the cell. The consequences of inhibition can be confirmed by examination of the outward properties of the cell or organism or by biochemical techniques such as RNA solution hybridization, nuclease protection, Northern hybridization, reverse transcription, gene expression monitoring with a microarray, antibody binding, enzyme linked immunosorbent assay (ELISA), Western blotting, radioimmunoassay (RIA), other immunoassays, and fluorescence activated cell analysis (FACS).
[0092] The term “target sequence,” as used herein, refers to a nucleoside sequence whose expression or activity is to be modulated. In some embodiments, the target sequence is a contiguous portion of the nucleoside sequence of a gene, a cDNA, or an mRNA molecule formed during the transcription of a target gene, e.g., MLH3 gene, including an unprocessed pre-mRNA transcript and mRNA that is a product of RNA processing of a primary transcription product. In some embodiments, the target sequence is within a pre-mRNA MLH3 sequence. In some embodiments, the target sequence is near exon 7 of MLH3 pre-mRNA.
[0093] The term “treat,” “treatment,” as used herein, mean the methods or steps taken to provide relief from or alleviation of the number, severity, and / or frequency of one or more symptoms of a disease (e.g., repeat expansion disease) in a subject. As used herein, “treat” and treatment” may include the prevention, management, prophylactic treatment, and / or inhibition of the number, severity, and / or frequency of one or more symptoms of a disease (e.g., repeat expansion disease) in a subject.Attorney Docket Number: T0833.70052WO00
[0094] The term “variant” means a molecule (e.g., nucleic acid or polypeptide) that differs from a given molecule (e.g., a reference nucleic acid or polypeptide) in sequence (nucleic acid or amino acid respectively) by the addition (e.g., insertion), deletion, or conservative substitution of nucleic acids or amino acids, respectively, but that retains the biological activity of the given molecule. Changes in the reference nucleic acid sequence of the variant may be silent. That is, they may not alter the amino acid sequence encoded by the nucleic acid. Alternatively, changes in the nucleoside sequence of the variant may alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide. Such nucleoside changes may result in amino acid substitutions, additions, deletions, fusions, and truncations in the polypeptide encoded by the reference sequence. The term “variant” encompasses fragments of a variant unless otherwise defined. A variant may be 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, or 75% identical to the reference sequence. The degree of homology (percent identity) between a native and a variant sequence can be determined, for example, by comparing the two sequences using freely available computer programs commonly employed for this purpose on the world wide web (e.g., BLASTn with default settings).
[0095] Definitions of specific functional groups and chemical terms are described in more detail below. The chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75thEd., inside cover, and specific functional groups are generally defined as described therein. Additionally, general principles of organic chemistry, as well as specific functional moieties and reactivity, are described in Organic Chemistry, Thomas Sorrell, University Science Books, Sausalito, 1999; Smith and March, March ’s Advanced Organic Chemistry, 5thEdition, John Wiley & Sons, Inc., New York, 2001; Larock, Comprehensive Organic Transformations, VCH Publishers, Inc., New York, 1989; and Carruthers, Some Modem Methods of Organic Synthesis, 3rdEdition, Cambridge University Press, Cambridge, 1987.
[0096] It is also to be understood that compounds that have the same molecular formula but differ in the nature or sequence of bonding of their atoms or the arrangement of their atoms in space are termed “isomers”. Isomers that differ in the arrangement of their atoms in space are termed “stereoisomers”.
[0097] Stereoisomers that are not mirror images of one another are termed “diastereomers” and those that are non-superimposable mirror images of each other are termed “enantiomers”. When a compound has an asymmetric center, for example, it is bonded to four different groups, a pair of enantiomers is possible. An enantiomer can be characterized by the absoluteAttorney Docket Number: T0833.70052WO00
[0098] configuration of its asymmetric center and is described by the R- and S-sequencing rules of Cahn and Prelog, or by the manner in which the molecule rotates the plane of polarized light and designated as dextrorotatory or levorotatory (i.e., as (+) or (-)-isomers respectively). A chiral compound can exist as either individual enantiomer or as a mixture thereof. A mixture containing equal proportions of the enantiomers is called a “racemic mixture”.
[0099] The term “MLH3,” as used herein, is a MutL homologue that makes up the MutLgamma subunit involved in the DNA mismatch repair (MMR). MLH3 is expressed in humans as two isoforms, MLH3 isoform 1 and MLH3 isoform 2, resulting from alternative splicing. MLH3 isoform 1 that includes exon 7, which contains a highly conserved portion of an endonuclease domain, while MLH3 isoform 2 lacks exon 7. MLH3 is involved in DNA repeat expansion and only isoform 1 is required. MLH3 expression is essential to GAA*TTC expansion in human cells. As MLH3 isoform 2 lacks exon 7, which contains part of its endonuclease domain, forced expression of this isoform may serve such a purpose. In some embodiments, an antisense oligonucleotide disclosed herein targets a region near MLH3 exon 7, inducing skipping of exon 7 and the consequent production of MLH3 isoform 2. Forcing exclusion of exon 7 may approximate a functional knockout of the endonuclease activity of MLH3, which is critical for DNA repeat expansion. Skipping exon 7 leaves MLH3 isoform 2 intact. Manipulation of MLH3 may limit DNA repeat expansion in patients with repeat expansion diseases such as Friedreich ataxia.
[0100] The term “MLH3” includes human (Homo sapiens) MLH3, the amino acid and nucleotide sequences of which may be found in, for example, GenBank Accession No.
[0101] NG_008649.1: 5001-42769 (SEQ ID NO: 10). Sequence information related to human MLH3 (isoform 1) is accessible in public databases by GenBank Accession numbers NP_001035197.1 (protein) (SEQ ID NO: 11) and NM_001040108.2 (nucleic acid) (SEQ ID NO: 12). Sequence information related to human MLH3 (isoform 2) is accessible in public databases by GenBank Accession numbers NP_055196.2 (protein) (SEQ ID NO: 13) and NM_014381.3 (nucleic acid) (SEQ ID NO: 14).
[0102] The term “MLH3,” as used herein, also refers to naturally occurring DNA sequence variations of the MLH3 gene. Numerous sequence variations within the MLH3 gene have been identified and may be found at, for example, NCBI dbSNP and UniProt (see, e.g., ncbi.nlm.nih.gov / snp).
[0103] Further information on MLH3 can be found, for example, at ncbi.nlm.nih.gov / gene / 23025. The entire contents of each of the foregoing AccessionAttorney Docket Number: T0833.70052WO00
[0104] numbers and the Gene database numbers are incorporated herein by reference as of the date of filing this application.
[0105] Table 1 below summarizes exemplary sequences of MLH3.
[0106] Table 1: Exemplary Amino Acid and DNA Sequences of MLH3
[0107]
[0108] Attorney Docket Number: T0833.70052WO00
[0109]
[0110] Attorney Docket Number: T0833.70052WO00
[0111]
[0112] Attorney Docket Number: T0833.70052WO00
[0113]
[0114] Attorney Docket Number: T0833.70052WO00
[0115]
[0116] Attorney Docket Number: T0833.70052WO00
[0117]
[0118] Attorney Docket Number: T0833.70052WO00
[0119]
[0120] Attorney Docket Number: T0833.70052WO00
[0121]
[0122] As used herein, “exon 7” of MLH3 refers to an exon that is included in isoform 1 of MLH3 and contains a highly conserved portion of an endonuclease domain. Exon 7 is notAttorney Docket Number: T0833.70052WO00
[0123] included in isoform 2. MLH3 is involved in DNA repeat expansion and only isoform 1 is required. MLH3 expression is essential to GAA*TTC expansion in human cells. Inducing skipping of exon 7 and forcing the consequent production of MLH3 isoform 2, results in knockout of the endonuclease activity of MLH3, which is critical for DNA repeat expansion. In some embodiments, exon 7 of MLH3 corresponds to positions 18043-18114 of MLH3 gene sequence as set forth in GenBank accession number: NG_008649.1: 5001-42769 (SEQ ID NO: 10). In some embodiments, exon 7 of MLH3 is 72 nucleosides in length and comprises the nucleotide sequence of SEQ ID NO: 15. One skilled in the art would understand that in an MLH3 pre-mRNA, the exon 7 sequence is SEQ ID NO: 15 with each thymine replaced with uracil (see SEQ ID NO: 16).
[0124] GTGGGAACCTGCTCGTGCTGGTGGATCAGCACGCTGCCCATGAGCGTATACGTCT GGAGCAGCTTATCATTG (SEQ ID NO: 15)
[0125] GUGGGAACCUGCUCGUGCUGGUGGAUCAGCACGCUGCCCAUGAGCGUAUACGU CUGGAGCAGCUUAUCAUUG (SEQ ID NO: 16)
[0126] Compositions
[0127] MLH3 Antisense Oligonucleotides
[0128] Some aspects of the present disclosure provide antisense oligonucleotides for splice redirection and modulation of expression of MLH3. In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementary to a target region of an MLH3 sequence (e.g., MLH3 gene sequence or pre-mRNA sequence). In some embodiments, an antisense oligonucleotide disclosed herein induces exon skipping of exon 7 of MLH3. In some embodiments, an antisense oligonucleotide disclosed herein inhibits endonuclease activity of MLH3. In some embodiments, an antisense oligonucleotide disclosed herein decreases the rate of DNA repeat expansion.
[0129] In some embodiments, an antisense oligonucleotide disclosed herein comprise a region of complementary to a target region near exon 7 (e.g., exon 7 as set forth in SEQ ID NO: 15) of an MLH3 sequence (e.g., MLH3 gene sequence or pre-mRNA sequence). “Near” a position or a sequence, as used herein, means within 30 (e.g., 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1) nucleosides upstream (5’ end) or downstream (3’ end) of the position or sequence. “Upstream” of a position or a sequence, as used herein, means at the 5’ side of the position or sequence.Attorney Docket Number: T0833.70052WO00
[0130] “Downstream” of a position or sequence, as used herein, means at the 3’ side of the position or sequence. For example, a target region “near” exon 7 of an MLH3 sequence means the target region is within 30 (e.g., 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1) upstream (e.g., counting towards the 5’ end from the 5’ terminal nucleotide of exon 7) or downstream (e.g., counting towards the 3’ end from the 3’ terminal nucleotide of the exon 7 of an MLH3 sequence.
[0131] In some embodiments, an antisense oligonucleotide disclosed herein is 18-23 nucleosides (e.g., 18, 19, 20, 21, 22, or 23 nucleosides) in length and comprises a region of complementarity to a target region of an MLH3 sequence, wherein the region of complementarity is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the MLH3 sequence is set forth in SEQ ID NO: 10.
[0132] For the purposes of the present disclosure, a region of complementary need not be 100% complementary to that of its target to be specifically hybridizable or specific for an MLH3 sequence. In some embodiments, the region of complementarity is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementary to a target region in a MLH3 sequence. In some embodiments, the target region is a region of consecutive nucleosides (e.g., 16, 17, 18, 19, 20, 21, 22, or 23 consecutive nucleosides) in the MLH3 sequence. In some embodiments, the region of complementarity comprises a nucleoside sequence that contains no more than 1, 2, 3, 4, or 5 base mismatches compared to the complementary portion of a MLH3 sequence. In some embodiments, the region of complementarity comprises a nucleoside sequence that has up to 3 mismatches over 15 nucleosides, or up to 2 mismatches over 10 nucleosides.
[0133] In some embodiments, an antisense oligonucleotide disclosed herein is 18-23 nucleosides (e.g., 18, 19, 20, 21, 22, or 23 nucleosides) in length, and comprises a nucleobase sequence of:
[0134] (i) CTGCAAACAGATCCTTACCA (SEQ ID NO: 1),
[0135] (ii) GCAAACAGATCCTTACCA (SEQ ID NO: 2),
[0136] (iii) TCCCACCTAGATGAGCAAGG (SEQ ID NO: 3), or
[0137] (iv) CCCACCTAGATGAGCAAGGAT (SEQ ID NO: 4).
[0138] In some embodiments, an antisense oligonucleotide disclosed herein comprises a nucleobase sequence of SEQ ID NO: 1. In some embodiments, an antisense oligonucleotide disclosed herein comprises a nucleobase sequence of SEQ ID NO: 2. In some embodiments, an antisense oligonucleotide disclosed herein comprises a nucleobase sequence of SEQ IDAttorney Docket Number: T0833.70052WO00
[0139] NO: 3. In some embodiments, an antisense oligonucleotide disclosed herein comprises a nucleobase sequence of SEQ ID NO: 4.
[0140] In some embodiments, antisense oligonucleotide disclosed herein consists of the nucleobase sequence of any one of SEQ ID NOs: 1-4. In some embodiments, an antisense oligonucleotide disclosed herein consists of the nucleobase sequence of SEQ ID NO: 1. In some embodiments, an antisense oligonucleotide disclosed herein consists of the nucleobase sequence of SEQ ID NO: 2. In some embodiments, an antisense oligonucleotide disclosed herein consists of the nucleobase sequence of SEQ ID NO: 3. In some embodiments, an antisense oligonucleotide disclosed herein consists of the nucleobase sequence of SEQ ID NO: 4. In some embodiments, any one or more of the thymine bases (T’s) in any one of the antisense oligonucleotides provided herein may independently and optionally be uracil bases (U’s).
[0141] It is to be understood that, for the purposes of the present disclosure, an antisense oligonucleotide comprising nucleobase sequences of any one of SEQ ID NOs: 1-4 encompasses antisense oligonucleotides comprising such nucleobase sequences and comprising no chemical modifications (e.g., modified nucleosides and / or modified intemucleoside linkages), and an antisense oligonucleotide comprising such nucleobase sequences and comprising chemical modifications (e.g., one or more modified nucleosides and / or one or more modified intemucleoside linkages; e.g., those provided in Table 3), and encompasses such modified or unmodified antisense oligonucleotides unconjugated or conjugated to a targeting moiety.
[0142] Modified antisense oligonucleotides
[0143] Some aspects of the present disclosure provide modified (e.g., chemically modified) antisense oligonucleotides. For example, any one of the antisense oligonucleotides provided herein (e.g., an antisense oligonucleotide comprising the nucleobase sequence of any one of SEQ ID NOs: 1-4) may comprise one or more modified nucleosides and / or one or more modified intemucleoside linkages.
[0144] In some embodiments, an antisense oligonucleotide described herein comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or more) modified nucleosides and / or one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or more) modified intemucleoside linkages. In some embodiments, a modified nucleoside comprises a modification at the 2’ position of the sugar (referred to herein as a “2’ -modified nucleoside”). In some embodiments, all modified nucleosides in an antisense oligonucleotide are 2’-Attorney Docket Number: T0833.70052WO00
[0145] modified nucleosides. In some embodiments, the 2’-modified nucleoside comprises 2’-O-methyl, 2’-fluoro, 2’-0-methoxyethyl (MOE), 2’, 4’-bridged nucleoside, or combinations thereof.
[0146] In some embodiments, the 2’-4’ bridged nucleoside is a locked nucleic acid (LNA), an ethylene-bridged nucleic acid (ENA) or a constrained ethyl nucleic acid (cET). In some embodiments, the 2’-4’ bridged nucleoside is an LNA. In some embodiments, an antisense oligonucleotide described herein comprises one or more 2’-MOE modified nucleosides. In some embodiments, an antisense oligonucleotide described herein comprises one or more LNA. In some embodiments, an antisense oligonucleotide described herein comprises one or more 2’-MOE modified nucleosides and one or more LNA. In some embodiments, nucleosides at one or more (e.g., 1, 2, 3, 4, 5 or more) positions of the antisense oligonucleotide are LNA. In some embodiments, nucleosides at positions 1, 4, 8, 14, 18 of the antisense oligonucleotide are LNA. In some embodiments, each nucleoside of the antisense oligonucleotide is a 2’ -MOE modified nucleoside or an LNA, or combinations thereof. In some embodiments, each nucleoside of the antisense oligonucleotide is a 2’-MOE modified nucleoside.
[0147] In some embodiments, an antisense oligonucleotide described herein comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or more) modified intemucleoside linkages. In some embodiments, each internucleoside linkage of the antisense oligonucleotide is a modified intemucleoside linkage. Non limiting examples of intemucleoside linkages include phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising 3 ’alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates comprising 3 ’-amino phosphoramidate and aminoalkylphosphoramidates, mesyl phosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates. In some embodiments, the modified intemucleoside linkage is a phosphorothioate linkage. In some embodiments, an antisense oligonucleotide described herein comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or more) phosphorothioate intemucleoside linkages. It is to be understood that, in any one of the antisense oligonucleotides described herein, the rest of intemucleoside linkages, unless otherwise specified, are all phosphodiester intemucleoside linkages.
[0148] In some embodiments, each intemucleoside linkage of the antisense oligonucleotide is a phosphorothioate linkage. In some embodiments, the antisense oligonucleotide comprises a mix of phosphodiester linkages and phosphorothioate linkages.Attorney Docket Number: T0833.70052WO00
[0149] In some embodiments, an antisense oligonucleotide described herein comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or more) morpholino nucleosides. In some embodiments, the antisense oligonucleotide comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or more) phosphorodiamidate morpholinos. In some embodiments, the antisense oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO).
[0150] Table 2 lists various exemplary nucleosides with 3 ’-phosphate or 3’-phosphorothioate
[0151] and the structures thereof.
[0152] Table 2. Exemplary nucleosides with 3 ’-phosphate or 3’-phosphorothioate structures
[0153]
[0154] Attorney Docket Number: T0833.70052WO00
[0155]
[0156] Attorney Docket Number: T0833.70052WO00
[0157]
[0158] Attorney Docket Number: T0833.70052WO00
[0159]
[0160] Attorney Docket Number: T0833.70052WO00
[0161]
[0162] Attorney Docket Number: T0833.70052WO00
[0163]
[0164] In some embodiments, an antisense oligonucleotide disclosed herein is 18-23 nucleosides (e.g., 18, 19, 20, 21, 22, or 23 nucleosides) in length, wherein nucleosides at oneAttorney Docket Number: T0833.70052WO00
[0165] or more (e.g., 1, 2, 3, 4, 5 or more) positions are LNAs and all of the nucleosides that are not LNAs are 2’-MOE modified nucleosides. In some embodiments, nucleosides at positions 1, 4, 8, 14, 18 are LNAs and all of the nucleosides that are not LNAs are 2’-MOE modified nucleosides.
[0166] In some embodiments, an antisense oligonucleotide disclosed herein is 18-23, wherein nucleosides (e.g., 18, 19, 20, 21, 22, or 23 nucleosides) in length, nucleosides at one or more (e.g., 1, 2, 3, 4, 5 or more) positions are LNAs, all of the nucleosides that are not LNAs are 2’-MOE modified nucleosides, and each internucleoside linkage of the antisense oligonucleotide is a phosphorothioate linkage. In some embodiments, nucleosides at positions 1, 4, 8, 14, and 18 (counting 5’-> 3’) are LNAs, all of the nucleosides that are not LNAs are 2’-MOE modified nucleosides, and each internucleoside linkage of the antisense oligonucleotide is a phosphorothioate linkage. In some embodiments, each nucleoside of the antisense oligonucleotide is a 2’ -MOE modified nucleoside and each intemucleoside linkage of the antisense oligonucleotide is a phosphorothioate linkage.
[0167] In some embodiments, an antisense oligonucleotide disclosed herein comprises a nucleobase sequence of SEQ ID NO: 1 and comprises chemical modifications, wherein each nucleoside of the antisense oligonucleotide is a 2’ -MOE modified nucleoside and each intemucleoside linkage of the antisense oligonucleotide is a phosphorothioate linkage.
[0168] In some embodiments, an antisense oligonucleotide disclosed herein comprises a nucleobase sequence of SEQ ID NO: 1 and comprises chemical modifications, wherein the nucleosides at positions 1, 4, 8, 14, and 18 (counting 5’-> 3’) of the antisense oligonucleotide are LNAs and all of the remaining nucleosides are 2’-MOE modified nucleosides.
[0169] In some embodiments, an antisense oligonucleotide disclosed herein comprises a nucleobase sequence of SEQ ID NO: 2 and comprises chemical modifications, wherein each nucleoside of the antisense oligonucleotide is a 2’ -MOE modified nucleoside.
[0170] In some embodiments, an antisense oligonucleotide disclosed herein comprises a nucleobase sequence of SEQ ID NO: 3 and comprises chemical modifications, wherein each nucleoside of the antisense oligonucleotide is a 2’ -MOE modified nucleoside.
[0171] In some embodiments, an antisense oligonucleotide disclosed herein comprises a nucleobase sequence of SEQ ID NO: 4 and comprises chemical modifications, wherein each nucleoside of the antisense oligonucleotide is a 2’ -MOE modified nucleoside.
[0172] In some embodiments, an antisense oligonucleotide disclosed herein comprises chemical modifications (e.g., one or more modified nucleosides and / or one or more modified intemucleoside linkages). In some embodiments, the antisense oligonucleotide comprises aAttorney Docket Number: T0833.70052WO00
[0173] structure provided in Table 3.
[0174] Table 3. Exemplary antisense oligonucleotides
[0175]
[0176] iA, iG, iC, and iT are 2 '-O-methox ethyl (2' -MOE) modified adenosine, guanosine, cytidine, and thymidine, respectively; IA, IG, IC, and IT are 2' -4' methylene bridge (LN A) adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate internucleoside linkage.
[0177] iEach thymine base (T) in any one of the oligonucleotide sequences provided in Table 3 may independently and optionally be replaced with a uracil base (U).
[0178] In some embodiments, in any one of the antisense oligonucleotides disclosed herein comprises the nucleobase sequence of SEQ ID NO: 1 and a structure of (5’
[0179]
[0180] 3’)
[0181] [iCs] [iTs] [iGs] [iCs] [iAs] [iAs] [iAs] [iCs] [iAs] [iGs] [iAs] [iTs] [iCs] [iCs] [iTs] [iTs] [iAs] [iCs] [iC s] [iA] (SEQ ID NO: 5), wherein iA, iG, iC, and iT are 2’-0-methoxyethyl (2’-M0E)
[0182] modified adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate internucleoside linkage.
[0183] In some embodiments, in any one of the antisense oligonucleotides disclosed herein comprises the nucleobase sequence of SEQ ID NO: 1 and a structure of (5’
[0184]
[0185] 3’)
[0186] [ICs] [iTs] [iGs] [ICs] [iAs] [iAs] [iAs] [ICs] [iAs] [iGs] [iAs] [iTs] [iCs] [ICs] [iTs] [iTs] [iAs] [ICs] [iC s][iA] (SEQ ID NO: 6), wherein iA, iG, iC, and iT are 2’-0-methoxyethyl (2’-M0E)
[0187] modified adenosine, guanosine, cytidine, and thymidine, respectively; IA, IG, IC, and IT are LNA adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate intemucleoside linkage.
[0188] In some embodiments, any one of the antisense oligonucleotides disclosed herein comprises the nucleobase sequence of SEQ ID NO: 2 and a structure of (5’
[0189]
[0190] 3’)
[0191] [iGs] [iCs] [iAs] [iAs] [iAs] [iCs] [iAs] [iGs] [iAs] [iTs] [iCs] [iCs] [iTs] [iTs] [iAs] [iCs] [iCs] [iA]
[0192] (SEQ ID NO: 7), wherein iA, iG, iC, and iT are 2 ’-O-methoxy ethyl (2’-M0E) modified adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate intemucleoside linkage.
[0193] In some embodiments, any one of the antisense oligonucleotides disclosed hereinAttorney Docket Number: T0833.70052WO00
[0194] comprises the nucleobase sequence of SEQ ID NO: 3 and a structure of (5’ 3’)
[0195] [iTs] [iCs] [iCs] [iCs] [iAs] [iCs] [iCs] [iTs] [iAs] [iGs] [iAs] [iTs] [iGs] [iAs] [iGs] [iCs] [iAs] [iAs] [i Gs][iG] (SEQ ID NO: 8), wherein iA, iG, iC, and iT are 2’-0-methoxyethyl (2’-MOE) modified adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate internucleoside linkage.
[0196] In some embodiments, any one of the antisense oligonucleotides disclosed herein comprises the nucleobase sequence of SEQ ID NO: 4 and a structure of (5’
[0197]
[0198] 3’)
[0199] [iCs] [iCs] [iCs] [iAs] [iCs] [iCs] [iTs] [iAs] [iGs] [iAs] [iTs] [iGs] [iAs] [iGs] [iCs] [iAs] [iAs] [iGs] [i Gs][iAs][iTs][iT] (SEQ ID NO: 9), wherein iA, iG, iC, and iT are 2’-0-methoxyethyl (2’-MOE) modified adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate internucleoside linkage.
[0200] In some embodiments, any one of the antisense oligonucleotides disclosed herein consists of the nucleobase sequence of SEQ ID NO: 1 and a structure of (5’ -> 3’)
[0201] [iCs] [iTs] [iGs] [iCs] [iAs] [iAs] [iAs] [iCs] [iAs] [iGs] [iAs] [iTs] [iCs] [iCs] [iTs] [iTs] [iAs] [iCs] [iC s][iA] (SEQ ID NO: 5), wherein iA, iG, iC, and iT are 2’-0-methoxyethyl (2’-MOE) modified adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate internucleoside linkage.
[0202] In some embodiments, any one of the antisense oligonucleotides disclosed herein consists of the nucleobase sequence of SEQ ID NO: 1 and a structure of (5’ -> 3’)
[0203] [ICs] [iTs] [iGs] [ICs] [iAs] [iAs] [iAs] [ICs] [iAs] [iGs] [iAs] [iTs] [iCs] [ICs] [iTs] [iTs] [iAs] [ICs] [iC s][iA] (SEQ ID NO: 6), wherein iA, iG, iC, and iT are 2’-0-methoxyethyl (2’-MOE) modified adenosine, guanosine, cytidine, and thymidine, respectively; IA, IG, IC, and IT are LNA adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate intemucleoside linkage.
[0204] In some embodiments, any one of the antisense oligonucleotides disclosed herein consists of the nucleobase sequence of SEQ ID NO: 2 and a structure of (5’ -> 3’)
[0205] [iGs] [iCs] [iAs] [iAs] [iAs] [iCs] [iAs] [iGs] [iAs] [iTs] [iCs] [iCs] [iTs] [iTs] [iAs] [iCs] [iCs] [iA] (SEQ ID NO: 7), wherein iA, iG, iC, and iT are 2’-0-methoxyethyl (2’-MOE) modified adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate intemucleoside linkage.
[0206] In some embodiments, any one of the antisense oligonucleotides disclosed herein consists of the nucleobase sequence of SEQ ID NO: 3 and a structure of (5’ -> 3’)
[0207] [iTs] [iCs] [iCs] [iCs] [iAs] [iCs] [iCs] [iTs] [iAs] [iGs] [iAs] [iTs] [iGs] [iAs] [iGs] [iCs] [iAs] [iAs] [i Gs][iG] (SEQ ID NO: 8), wherein iA, iG, iC, and iT are 2’-0-methoxyethyl (2’-MOE)Attorney Docket Number: T0833.70052WO00
[0208] modified adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate internucleoside linkage.
[0209] In some embodiments, any one of the antisense oligonucleotides disclosed herein consists of the nucleobase sequence of SEQ ID NO: 4 and a structure of (5’ -> 3’)
[0210] [iCs] [iCs] [iCs] [iAs] [iCs] [iCs] [iTs] [iAs] [iGs] [iAs] [iTs] [iGs] [iAs] [iGs] [iCs] [iAs] [iAs] [iGs] [i Gs][iAs][iTs][iT] (SEQ ID NO: 9), wherein iA, iG, iC, and iT are 2’-0-methoxyethyl (2’-MOE) modified adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate internucleoside linkage.
[0211] Pharmaceutical Compositions
[0212] An aspect of the disclosure includes pharmaceutical compositions comprising any one of the antisense oligonucleotides described herein. In some embodiments, the pharmaceutical composition comprises any one of the antisense oligonucleotides described herein and a pharmaceutically acceptable carrier. The pharmaceutical compositions described herein are formulated for administration to a subject.
[0213] Pharmaceutical compositions comprising one or more antisense oligonucleotides disclosed herein, either alone or in combination with prophylactic agents, therapeutic agents, and / or pharmaceutically acceptable carriers are provided. The pharmaceutical compositions comprising antisense oligonucleotides provided herein are for use in, but not limited to, diagnosing, detecting, or monitoring a disease, in preventing, treating, managing, or ameliorating a disease or one or more symptoms thereof, and / or in research.
[0214] In some embodiments, provided herein are pharmaceutical compositions comprising a first antisense oligonucleotide targeting a first target region and a second antisense oligonucleotide targeting a second target region, wherein the first target region and the second target region each comprises an MLH3 sequence. In some embodiments the first antisense oligonucleotide is 18-23 (e.g., 18, 19, 20, 21, 22, or 23) nucleobases in length and comprises a region of complementarity to a first target region near exon 7 of an MLH3 sequence. In some embodiments, the region of complementarity is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments the second antisense oligonucleotide is 18-23 (e.g., 18, 19, 20, 21, 22, or 23) nucleobases in length and comprises a region of complementarity to a second target region near of exon 7 of an MLH3 sequence. In some embodiments, the region of complementarity is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.
[0215] In some embodiments, a pharmaceutical composition disclosed herein comprises aAttorney Docket Number: T0833.70052WO00
[0216] first antisense oligonucleotide targeting a first target region and a second antisense oligonucleotide targeting a second target region, wherein the first target region and the second target region each comprises an MLH3 sequence (e.g., MLH3 pre-mRNA sequence). In some embodiments the first antisense oligonucleotide is 18-23 (e.g., 18, 19, 20, 21, 22, or 23) nucleobases in length and comprises a region of complementarity to a first target region near exon 7 of an MLH3 sequence (e.g., MLH3 pre-mRNA sequence) and the second antisense oligonucleotide is 18-23 (e.g., 18, 19, 20, 21, 22, or 23) nucleobases in length and comprises a region of complementarity to a second target region near exon 7 of an MLH3 sequence (e.g., MLH3 pre-mRNA sequence). In some embodiments, each of the first antisense sequence and the second antisense sequence comprises a region of complementary to an MLH3 pre-mRNA sequence of SEQ ID NO: 10. In some embodiments, the region of complementarity is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the first antisense oligonucleotide and the second antisense oligonucleotide modulate expression of MLH3. In some embodiments, the first antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 1 or 2 and the second antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 3 or 4.
[0217] In some embodiments, a pharmaceutical composition disclosed herein comprises a first antisense oligonucleotide and a second antisense oligonucleotide, wherein the first antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 1 and the second antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 3. In some embodiments, in a pharmaceutical composition provided herein, the first antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 1 and the second antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 4. In some embodiments, in a pharmaceutical composition provided herein, the first antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 2 and the second antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 3. In some embodiments, the first antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 2 and the second antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 4. In some embodiments, the first antisense oligonucleotide and / or the second antisense oligonucleotide comprises one or more modified nucleosides are 2’ -modified nucleosides selected from the group consisting of: 2’-O-methyl, 2’-fluoro, 2’-0-methoxyethyl (MOE), and 2’, 4’-bridged nucleoside (LNA, ENA, or cET) or combinations thereof. In some embodiments, the 2’ -4’ bridged nucleoside is an LNA.
[0218] In some embodiments, a pharmaceutical composition disclosed herein comprises aAttorney Docket Number: T0833.70052WO00
[0219] first antisense oligonucleotide and a second antisense oligonucleotide, wherein the first antisense oligonucleotide or the second antisense oligonucleotide comprises one or more 2’-MOE modified nucleosides. In some embodiments, the first antisense oligonucleotide or the second antisense oligonucleotide comprises one or more LNA. In some embodiments, the first antisense oligonucleotide or the second antisense oligonucleotide comprises one or more 2’-MOE modified nucleosides and one or more LNA. In some embodiments, nucleosides at one or more (e.g., 1, 2, 3, 4, 5 or more) positions of the first antisense oligonucleotide or the second antisense oligonucleotide are an LNA. In some embodiments, nucleosides at positions 1, 4, 8, 14, 18 of the first antisense oligonucleotide or the second antisense oligonucleotide are an LNA. In some embodiments, each nucleoside of the first antisense oligonucleotide or the second antisense oligonucleotide is a 2’-MOE modified nucleoside or an LNA, or combinations thereof. In some embodiments, each nucleoside of the first antisense oligonucleotide or the second antisense oligonucleotide is a 2’-MOE modified nucleoside.
[0220] In some embodiments, a pharmaceutical composition disclosed herein comprises a first antisense oligonucleotide and a second antisense oligonucleotide, wherein the first antisense oligonucleotide or the second antisense oligonucleotide comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or more) modified intemucleoside linkages. In some embodiments, each internucleoside linkage of the antisense oligonucleotide is a modified intemucleoside linkage. In some embodiments, the modified internucleoside linkage is a phosphorothioate linkage. In some embodiments, the first antisense oligonucleotide or the second antisense oligonucleotide comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or more) phosphorothioate intemucleoside linkages. In some embodiments, each intemucleoside linkage of the first antisense oligonucleotide or the second antisense oligonucleotide is a phosphorothioate linkage. In some embodiments, the first antisense oligonucleotide or the second antisense oligonucleotide comprises a mix of phosphodiester linkages and phosphorothioate linkages.
[0221] In some embodiments, a pharmaceutical composition disclosed herein comprises a first antisense oligonucleotide and a second antisense oligonucleotide, wherein the first antisense oligonucleotide or the second antisense oligonucleotide comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or more) morpholino nucleosides. In some embodiments, the first antisense oligonucleotide or the second antisense oligonucleotide comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or more) phosphorodiamidate morpholinos. In some embodiments, the first antisense oligonucleotide or the second antisense oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO).Attorney Docket Number: T0833.70052WO00
[0222] In some embodiments, a pharmaceutical composition disclosed herein comprises a first antisense oligonucleotide and a second antisense oligonucleotide, wherein the first antisense oligonucleotide and the second antisense oligonucleotide comprise a structure as provided in Table 3.
[0223] In some embodiments, a pharmaceutical composition may further comprise any other suitable therapeutic agent for treatment of a subject, e.g., a human subject having a DNA repeat expansion disease. In some embodiments, the other therapeutic agents may enhance or supplement the effectiveness of the complexes described herein.
[0224] In some embodiments, formulations as disclosed herein comprise an excipient. In some embodiments, an excipient confers to a composition improved stability, improved absorption, improved solubility and / or (e.g., and) therapeutic enhancement of the active ingredient. In some embodiments, an excipient is a buffering agent (e.g., sodium citrate, sodium phosphate, a tris base, or sodium hydroxide) or a vehicle (e.g., a buffered solution, petrolatum, dimethyl sulfoxide, or mineral oil). Any one of the described antisense oligonucleotides, when added to pharmaceutically acceptable excipients, can be packaged into kits, containers, packs, or dispensers. The pharmaceutical compositions described herein can be packaged in pre-filled syringes or vials.
[0225] In some embodiments, the delivery vehicle can be used to deliver an antisense oligonucleotide to a cell or tissue. A delivery vehicle is a compound that improves delivery of an antisense oligonucleotide to a cell or tissue. A delivery vehicle can include, or consist of, but is not limited to a polymer, such as an amphipathic polymer, a membrane active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane active polyamine. In some embodiments, any one of the antisense oligonucleotides or pharmaceutical compositions described herein can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs or other delivery systems available in the art. The antisense oligonucleotides can also be chemically conjugated to targeting moiety, lipids (including, but not limited to cholesterol and cholesteryl derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, for example US2004171044, US8137695, US8313772, US8501930, US8932572, US8933047, US2016015824, US9750819, and US9561286, each of which is incorporated herein by reference), or other delivery systems available in the art.
[0226] In some embodiments, a pharmaceutical composition is formulated to be compatible with its intended route of administration. Non-limiting examples of routes of administration include intravenous, intramuscular, intraperitoneal, intracerebrospinal, subcutaneous, intra-Attorney Docket Number: T0833.70052WO00
[0227] articular, intrasynovial, or intrathecal routes. In some embodiments, the route of administration is subcutaneous.
[0228] Kits
[0229] An aspect of the disclosure includes kits comprising any one of the antisense oligonucleotides described herein or a pharmaceutical composition described herein. In some embodiments, the kit is for treating a repeat expansion described herein. In some embodiments, the kit further comprises an additional agent described herein.
[0230] Methods
[0231] Some aspects of the present disclosure provide methods for inhibiting endonuclease activity of MLH3 in a cell, comprising contacting the cell with any one of the antisense oligonucleotides described herein or any one of the pharmaceutical compositions described herein, thereby inhibiting endonuclease activity of MLH3 in the cell.
[0232] Some aspects of the present disclosure provide methods for inhibiting endonuclease activity of MLH3 in a cell of a subject, comprising administering to the subject any one of the antisense oligonucleotides described herein or any one of the pharmaceutical compositions described herein, thereby inhibiting endonuclease activity of MLH3 in the cell of the subject.
[0233] In some embodiments, in any one of the methods described herein, a subject is nonhuman primate, or rodent. In some embodiments, a subject is a human. In some embodiments, a subject is a patient, e.g., a human patient that has or is suspected of having a disease. In some embodiments, the subject is a human patient who has or is suspected of having a repeat expansion disease. In some embodiments, the repeat expansion disease is Friedreich ataxia.
[0234] An aspect of the disclosure includes a method of treating a subject having a repeat expansion disease. In some embodiments, the method comprises administering to the subject any one of the antisense oligonucleotides disclosed herein, or a pharmaceutical composition disclosed herein.
[0235] An aspect of the disclosure includes a method of treating Friedreich ataxia in a subject. In some embodiments, the method comprises administering to the subject any one of the antisense oligonucleotides disclosed herein, or a pharmaceutical composition disclosed herein.Attorney Docket Number: T0833.70052WO00
[0236] In some embodiments, the above-described methods further comprise administering an additional agent for the treatment of a repeat expansion disease.
[0237] Having now described some embodiments in detail, practice of the invention will be more fully understood from the following examples, which are presented herein for illustration only and should not be construed as limiting the invention in any way.
[0238] EXAMPLES
[0239] Example 1: Splice redirection bv antisense oligonucleotides in BAC mouse tissues
[0240] A mouse model was created with a human MLH3 transgene carried on a bacterial artificial chromosome (BAC mouse). Humanized BAC mice were intracerebroventricularly injected with 500 pg test antisense oligonucleotides. Test antisense oligonucleotides correspond to ASOs 1-5 in Table 3. Mice were euthanized at 14 days post-antisense oligonucleotides injection. Mouse tissues including cerebral cortex (FIG. 1A), brain stem (FIG. IB), cerebellum (FIG. 1C), and striatum (FIG. ID) were dissected and analyzed for splice redirection. Results in FIGs. 1A-1D show robust splice redirection in BAC mouse tissues by the test antisense oligonucleotides.
[0241] Isolation of mouse tissues
[0242] Mouse tissues were dissected, equilibrated with RNAlater (Thermo-Fisher) then frozen. Tissues were thawed from -80°C storage and RNAlater was pipetted off. The tissue was rinsed twice with 1 mL of PBS to remove residual RNAlater, which was found to inhibit downstream RNA and DNA isolation. Tissue homogenization for RNA isolation was done in a 1.5 mL microcentrifuge tube containing one 1 / 8” and five 1 / 16” stainless steel ball bearings (BC Precision, Chattanooga, TN), 500 pL TRIzol® Reagent (Thermo Fisher Scientific), and 1 pL Linear Acrylamide (5 mg / mL; Amresco). Tissues were then homogenized in a Next Advance Bullet Blender Blue Bead Mill tissue homogenizer (Next Advance, BBX24B). Brain tissue was processed at speed 6 for 3 minutes. Following tissue homogenization, ball bearings were removed and the RNA was purified according to the TRIzol manufacturer’s protocol.
[0243] Synthesis of cDNA and mMLH3 isoform detection
[0244] RNA (250 ng) was used as a template to generate cDNA with the High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) following manufacturersAttorney Docket Number: T0833.70052WO00
[0245] protocol. Human MLH3 splice variants were characterized by Reverse Transcription PCR (RT-PCR). The primers used flanked hMLH3 exon 7 and were MLH3X7L3324 (5’-TCCTTTCCTTCCGAGAGCTC-3’) (SEQ ID NO: 17) and MLH3X7R3757 (5’-TTTTCCGACCAGAGCCTTGT-3’) (SEQ ID NO: 18) which produced 434 and 362 bp products from MLH3 isoform 1 and isoform 2, respectively. The PCR reaction was 32 cycles of denaturation at 94°C for 30 seconds, primer annealing at 60°C for 15 seconds, and extension at 68°C for 60 seconds. Products were resolved by electrophoresis on 1.4% agarose gels with 1KB Plus DNA Ladder (Invitrogen) as a marker. DNA was visualized with ethidium bromide and images were obtained using a Kodak Gel Logic 440 Imaging System.
[0246] EQUIVALENTS
[0247] The disclosure may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The foregoing embodiments are therefore to be considered in all respects illustrative rather than limiting of the disclosure. Scope of the disclosure is thus indicated by the appended claims rather than by the foregoing description, and all changes that come within the meaning and range of equivalency of the claims are therefore intended to be embraced herein.
Claims
Attorney Docket Number: T0833.70052WO00CLAIMSWhat is claimed is:
1. An antisense oligonucleotide 18-23 nucleobases in length, comprising a nucleobase sequence of:(i) CTGCAAACAGATCCTTACCA (SEQ ID NO: 1),(ii) GCAAACAGATCCTTACCA (SEQ ID NO: 2),(iii) TCCCACCTAGATGAGCAAGG (SEQ ID NO: 3), or(iv) CCCACCTAGATGAGCAAGGAT (SEQ ID NO: 4).
2. The antisense oligonucleotide of claim 1, wherein the antisense oligonucleotide modulates expression of MLH3.
3. The antisense oligonucleotide of claim 1 or claim 2, wherein the antisense oligonucleotide induces exon skipping of exon 7 of MLH3.
4. The antisense oligonucleotide of any one of claims 1-3, consisting of the nucleobase sequence of any one of SEQ ID NOs: 1-4.
5. The antisense oligonucleotide of any one of claims 1-4, comprising one or more modified nucleosides.
6. The antisense oligonucleotide of claim 5, wherein the one or more modified nucleosides is a 2’ -modified nucleoside.
7. The antisense oligonucleotide of claim 6, where the 2’ -modified nucleoside comprises 2’-O-methyl, 2’-fluoro, 2’-0-methoxyethyl (MOE), 2’, 4’-bridged nucleoside, or combinations thereof.
8. The antisense oligonucleotide of any one of claims 1-7, wherein the antisense oligonucleotide comprises one or more 2’ -MOE modified nucleosides and one or more locked nucleic acids (LN A).Attorney Docket Number: T0833.70052WO009. The antisense oligonucleotide of any one of claims 1-8, wherein each nucleoside of the antisense oligonucleotide is a 2’-M0E modified nucleoside or an LNA, or combinations thereof.
10. The antisense oligonucleotide of any one of claims 1-9, wherein each nucleoside of the antisense oligonucleotide is a 2’-MOE modified nucleoside.
11. The antisense oligonucleotide of any one of claims 1-10, wherein the antisense oligonucleotide comprises one or more modified intemucleoside linkages.
12. The antisense oligonucleotide of any one of claims 1-11, wherein each intemucleoside linkage of the oligonucleotide is a modified intemucleoside linkage.
13. The antisense oligonucleotide of claim 11 or claim 12, wherein the modified intemucleoside linkage is a phosphorothioate linkage.
14. The antisense oligonucleotide of any one of claims 1-13, wherein each intemucleoside linkage is a phosphorothioate linkage.
15. The antisense oligonucleotide of any one of claims 1-12, wherein the antisense oligonucleotide comprises one or more morpholino nucleosides.
16. The antisense oligonucleotide of claim 15, wherein the antisense oligonucleotide is a phosphorodiamidate oligomer (PMO).
17. The antisense oligonucleotide of any one of claims 1-14, wherein the antisense oligonucleotide comprises a stmcture as provided in Table 3.
18. The antisense oligonucleotide of any one of claims 1-17, wherein the antisense oligonucleotide inhibits endonuclease activity of MLH3.
19. The antisense oligonucleotide of any one of claims 1-18, wherein the antisense oligonucleotide decreases the rate of DNA repeat expansion.Attorney Docket Number: T0833.70052WO0020. An antisense oligonucleotide 20 nucleobases in length, wherein the oligonucleotide has a nucleobase sequence consisting of CTGCAAACAGATCCTTACCA (SEQ ID NO: 1).
21. The antisense oligonucleotide of claim 20, wherein the oligonucleotide has a sequence consisting of[iCs] [iTs] [iGs] [iCs] [iAs] [iAs] [iAs] [iCs] [iAs] [iGs] [iAs] [iTs] [iCs] [iCs] [iTs] [iTs] [iAs] [iCs] [iCs ][iA] (SEQ ID NO: 5), wherein iA, iG, iC, and iT are 2’-0-methoxyethyl (2’ -MOE) modified adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate intemucleoside linkage.
22. The antisense oligonucleotide of claim 20, wherein the oligonucleotide has a sequence consisting of[ICs] [iTs] [iGs] [ICs] [iAs] [iAs] [iAs] [ICs] [iAs] [iGs] [iAs] [iTs] [iCs] [ICs] [iTs] [iTs] [iAs] [ICs] [iCs ][iA] (SEQ ID NO: 6), wherein iA, iG, iC, and iT are 2’-0-methoxyethyl (2’ -MOE) modified adenosine, guanosine, cytidine, and thymidine, respectively; IA, IG, IC, and IT are LNA adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate intemucleoside linkage.
23. An antisense oligonucleotide 18 nucleobases in length, wherein the oligonucleotide has a nucleobase sequence consisting of GCAAACAGATCCTTACCA (SEQ ID NO: 2).
24. An antisense oligonucleotide of claim 23, wherein the oligonucleotide has a sequence consisting of[iGs] [iCs] [iAs] [iAs] [iAs] [iCs] [iAs] [iGs] [iAs] [iTs] [iCs] [iCs] [iTs] [iTs] [iAs] [iCs] [iCs] [iA] (SEQ ID NO: 7), wherein iA, iG, iC, and iT are 2’-0-methoxyethyl (2’-MOE) modified adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate intemucleoside linkage.
25. An antisense oligonucleotide 20 nucleobases in length, wherein the oligonucleotide has a nucleobase sequence consisting of TCCCACCTAGATGAGCAAGG (SEQ ID NO: 3).
26. An antisense oligonucleotide of claim 25, wherein the oligonucleotide has a sequence consisting of[iTs] [iCs] [iCs] [iCs] [iAs] [iCs] [iCs] [iTs] [iAs] [iGs] [iAs] [iTs] [iGs] [iAs] [iGs] [iCs] [iAs] [iAs] [iGAttorney Docket Number: T0833.70052WO00s][iG] (SEQ ID NO: 8), wherein iA, iG, iC, and iT are 2’-0-methoxyethyl (2’-MOE) modified adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate internucleoside linkage.
27. An antisense oligonucleotide 22 nucleobases in length, wherein the oligonucleotide has a nucleobase sequence consisting of CCCACCTAGATGAGCAAGGATT (SEQ ID NO: 4).
28. An antisense oligonucleotide of claim 27, wherein the oligonucleotide has a sequence consisting of[iCs] [iCs] [iCs] [iAs] [iCs] [iCs] [iTs] [iAs] [iGs] [iAs] [iTs] [iGs] [iAs] [iGs] [iCs] [iAs] [iAs] [iGs] [i Gs][iAs][iTs][iT] (SEQ ID NO: 9), wherein iA, iG, iC, and iT are 2’-0-methoxyethyl (2’-MOE) modified adenosine, guanosine, cytidine, and thymidine, respectively; and s is a phosphorothioate internucleoside linkage.
29. A pharmaceutical composition comprising the antisense oligonucleotide of any one of claims 1-28.
30. The pharmaceutical composition of claim 29, further comprising a pharmaceutically acceptable carrier.
31. A pharmaceutical composition comprising a first antisense oligonucleotide 18-23 nucleobases in length comprising a region of complementarity to a first target region of a MLH3 sequence and a second antisense oligonucleotide 18-23 nucleobases in length, comprising a region of complementarity to a second target region of a MLH3 sequence, wherein the region of complementarity is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length, wherein the first antisense oligonucleotide and the second antisense oligonucleotide modulate expression of MLH3,wherein the first antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 1 or 2 and the second antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 3 or 4.Attorney Docket Number: T0833.70052WO0032. The pharmaceutical composition of claim 31, wherein the first antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 1 and the second antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 3.
33. The pharmaceutical composition of claim 31, wherein the first antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 1 and the second antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 4.
34. The pharmaceutical composition of claim 31, wherein the first antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 2 and the second antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 3.
35. The pharmaceutical composition of claim 31, wherein the first antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 2 and the second antisense oligonucleotide comprises a nucleobase sequence of SEQ ID NO: 4.
36. The pharmaceutical composition of any one of claims 31-35, wherein the first antisense oligonucleotide or the second antisense oligonucleotide comprises one or more modified nucleosides are 2’-modified nucleosides selected from the group consisting of: 2’-O-methyl, 2’-fluoro, 2’-0-methoxyethyl (MOE), and 2’, 4’-bridged nucleoside or combinations thereof.
37. The pharmaceutical composition of any one of claims 31-36, wherein the first antisense oligonucleotide and the second antisense oligonucleotide comprise a structure as provided in Table 3.
38. A method of inhibiting endonuclease activity of MLH3 in a cell, comprising contacting the cell with the antisense oligonucleotide of any one of claims 1-28, or the pharmaceutical composition of any one of claims 29-37.
39. A method of inhibiting endonuclease activity of MLH3 in a cell of a subject, comprising administering to the subject the antisense oligonucleotide of any one of claims 1-28, or the pharmaceutical composition of any one of claims 29-37.Attorney Docket Number: T0833.70052WO0040. A method of treating a repeat expansion disease in a subject, comprising administering to the subject the antisense oligonucleotide of any one of claims 1-28, or the pharmaceutical composition of any one of claims 29-37.
41. A method of treating Friedreich ataxia in a subject, comprising administering to the subject the antisense oligonucleotide of any one of claims 1-28, or the pharmaceutical composition of any one of claims 29-37.