Capsid mutations for AAV production

WO2026193218A1PCT designated stage Publication Date: 2026-09-17SHAPE THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2026/018802
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-08-21
Filing Date
2026-03-11
Publication Date
2026-09-17

Smart Images

  • Figure IMGF000046_0001_TABLE
    Figure IMGF000046_0001_TABLE
  • Figure IMGF000047_0001_TABLE
    Figure IMGF000047_0001_TABLE
  • Figure IMGF000068_0001_TABLE
    Figure IMGF000068_0001_TABLE
Patent Text Reader

Abstract

Provided are polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods for improving recombinant adeno-associated virus (rAAV) production. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods include a polynucleotide that includes one or more modified AAV Cap splice sites. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to produce rAAV. Production of AAV using provided systems with one or more modified AAV Cap splice sites may increase production of rAAV over polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods in which the one or more AAV Cap splice sites are not modified
Need to check novelty before this filing date? Find Prior Art

Description

324632001440CAPSID MUTATIONS FOR AAV PRODUCTIONCROSS-REFERENCE TO REEATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application No. 63 / 770,970 filed March 12, 2025, and U.S. Provisional Application No. 63 / 868,202 filed August 21, 2025, the disclosures of which are herein incorporated by reference in their entireties.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The content of the electronic sequence listing (324632001440seqlist.xml; Size: 2,443,816 bytes; and Date of Creation: March 11, 2026) is herein incorporated by reference in its entirety.FIELD

[0003] The present disclosure provides polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods for improving recombinant adeno-associated virus (rAAV) production. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods include a polynucleotide that includes one or more modified AAV Cap splice sites.INTRODUCTION

[0004] Adeno-associated virus (AAV) belongs to the Parvoviridae family and Dependovirus genus, of which some members require co-infection with a helper virus such as adenovirus to promote replication. AAV establishes a latent infection in the absence of a helper virus. AAV virions are composed of a 25 nm icosahedral capsid encompassing a 4.7 kb single-stranded DNA genome with two open reading frames: rep and cap. The non-structural rep gene encodes four AAV Rep proteins that are regulatory proteins essential for viral replication, whereas cap encodes three structural AAV Capsid proteins (Virion proteins 1-3 “VP1-3”) that assemble into a 60-mer capsid shell. This viral capsid mediates the ability of AAV vectors to overcome many of the biological barriers of viral transduction, including cell surface receptor binding, endocytosis, intracellular trafficking, and unpackaging in the nucleus.

[0005] There is a need in the art for better methods of recombinant AAV (rAAV) production that enhance AAV packaging efficiency to provide for delivery of a payload of interest by a rAAV virion to a cell.MF-367351030 1324632001440SUMMARY

[0006] Provided are polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods for improving recombinant adeno-associated virus (rAAV) production. In certain aspects, among the provided embodiments are polynucleotides, vectors, and systems of vectors or polynucleotides that include a polynucleotide that includes a modified AAV Cap open reading frame. In some embodiments, the modified Cap open reading frame comprises modified Cap splice sites. In some embodiments, the Cap splice sites include a splice donor site and a splice acceptor site in which at least one is modified. In some embodiments, the splice donor site is a modified splice donor site that comprises the sequence caggtangt (SEQ ID NO: 275), wherein n is an A or a C. In some embodiments, the splice donor site is a modified splice donor site that comprises the sequence cagacaggtangtaa (SEQ ID NO: 10), wherein n is an A or a C. In some embodiments, the splice donor site comprises the sequence cagacaggtaagtaa (SEQ ID NO: 3). In some embodiments, the splice donor site comprises the sequence cagacaggtacgtaa (SEQ ID NO: 2). In some embodiments, the splice acceptor site comprises the sequence CTGCTGATGGTTATCTTCCAG (SEQ ID NO: 8). In some embodiments, the splice acceptor site comprises the sequence CTGCCGATTCTTATCTTCCAG (SEQ ID NO: 9).

[0007] The provided embodiments also include use of these polynucleotides, vectors, and systems of vectors or polynucleotides, in connection with making and using cells used to produce rAAV, as well as methods that may be used to produce rAAV. Production of AAV using provided systems with a modified AAV Cap open reading frame may increase production of rAAV over polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods in which the AAV Cap open reading frame is not modified.

[0008] In some aspects, provided herein is a polynucleotide comprising an adeno-associated virus (AAV) Cap expression cassette that comprises an inducible promoter, a splice donor site, a first splice acceptor site, a second splice acceptor site, and a Cap open reading frame, wherein the splice donor site comprises the sequence CAGACAGGTANGTAA (SEQ ID NO: 10), wherein N is an A or a C.

[0009] In some aspects, provided herein is a polynucleotide comprising an adeno-associated virus (AAV) Cap expression cassette that comprises a first promoter, a splice donor site, a first splice acceptor site, a second splice acceptor site, and a Cap open reading frame, wherein the second splice acceptor site comprises the sequence CTGCTGATGGTTATCTTCCAG (SEQ ID NO: 8) or the sequence CTGCCGATTCTTATCTTCCAG (SEQ ID NO: 9).

[0010] In some aspects, provided herein is a polynucleotide comprising an adeno-associated virus (AAV) Cap expression cassette that comprises a first promoter, a splice donor site, a first splice acceptor site, a second splice acceptor site, and a Cap open reading frame, wherein the splice donor site comprises the sequence CAGGTANGT (SEQ ID NO: 275), wherein N is an A or a C, and wherein the secondMF-367351030 2324632001440splice acceptor site comprises the sequence CTGCTGATGGTTATCTTCCAG (SEQ ID NO: 8) or the sequence CTGCCGATTCTTATCTTCCAG (SEQ ID NO: 9).

[0011] In some aspects, provided herein is a polynucleotide comprising (a) an adeno-associated virus (AAV) Cap expression cassette that comprises a first promoter, a splice donor site, a first splice acceptor site, a second splice acceptor site, and a Cap open reading frame, wherein the splice donor site comprises the sequence CAGACAGGTANGTAA (SEQ ID NO: 10), wherein N is an A or a C, and (b) an AAV Rep expression cassette that comprises a second promoter and a Rep open reading frame.

[0012] In some of any of the provided embodiments, the first promoter is a native p40 promoter, a constitutive promoter, or an inducible promoter. In some of any of the provided embodiments, the first promoter is an inducible promoter.

[0013] In some of any of the provided embodiments, the splice donor site has a splice prediction score of at least or about 0.70, 0.75, 0.80, 0.85, 0.90, 0.95, 0.99, or 1.0, and / or the splice donor site is predicted to be involved in a splice event with a probability of at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%. In some of any of the provided embodiments, the splice donor site comprises the sequence CAGACAGGTAAGTAA (SEQ ID NO: 3) or the sequence CAGACAGGTACGTAA (SEQ ID NO: 2). In some of any of the provided embodiments, the splice donor site comprises the sequence CAGACAGGTAAGTAA (SEQ ID NO: 3).

[0014] In some of any of the provided embodiments, the second splice acceptor site comprises the sequence CTGCTGATGGTTATCTTCCAG (SEQ ID NO: 8) or the sequence CTGCCGATTCTTATCTTCCAG (SEQ ID NO: 9). In some of any of the provided embodiments, the second splice acceptor site comprises the sequence CTGCTGATGGTTATCTTCCAG (SEQ ID NO: 8). In some of any of the provided embodiments, the second splice acceptor site has a splice prediction score of at least or about 0.70, 0.75, 0.80, 0.85, 0.90, 0.95, 0.99, or 1.0, and / or the second splice acceptor site is predicted to be involved in a splice event with a probability of at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%.

[0015] In some of any of the provided embodiments, the inducible promoter comprises a tetracycline-responsive promoter element (TRE). In some of any of the provided embodiments, the TRE comprises Tet operator (tetO) sequence concatemers fused to a minimal promoter. In some of any of the provided embodiments, the tetO sequence concatamers comprise the sequence of SEQ ID NO: 27. In some of any of the provided embodiments, the minimal promoter is a human cytomegalovirus promoter. In some of any of the provided embodiments, the minimal promoter comprises the nucleotide sequence of SEQ ID NO: 28.

[0016] In some of any of the provided embodiments, the inducible promoter comprises the nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any of theMF-367351030 3324632001440provided embodiments, the inducible promoter comprises the nucleotide sequence of SEQ ID NO: 25. In some of any of the provided embodiments, the inducible promoter is activated in the presence of a first triggering agent. In some of any of the provided embodiments, the first triggering agent is doxycycline.

[0017] In some of any of the provided embodiments, the Cap open reading frame encodes one or more AAV capsid proteins. In some of any of the provided embodiments, the one more AAV capsid proteins comprise VP1, VP2, and VP3. In some of any of the provided embodiments, the splice donor site and the first splice acceptor site generate an mRNA transcript encoding the VP1 protein, and the splice donor site and the second splice acceptor site generate an mRNA transcript encoding the VP2 protein and an mRNA transcript encoding the VP3 protein.

[0018] In some of any of the provided embodiments, the AAV Cap expression cassette further comprises a polyA signal sequence downstream of the Cap open reading frame, wherein the polyA signal sequence is stronger than a native AAV Cap polyA signal sequence. In some of any of the provided embodiments, the polyA signal sequence comprises a SV40 polyA signal sequence. In some of any of the provided embodiments, the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 46, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0019] In some of any of the provided embodiments, the Cap open reading frame encodes one or more AAV capsid proteins selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV13, AAV 14, AAV 15 and AAV 16, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16 or AAVhu68. In some of any of the provided embodiments, the Cap open reading frame encodes one or more AAV capsid proteins selected from AAV1, AAV2, AAV6, AAV7, AAV8, AAAV9.

[0020] In some of any of the provided embodiments, the Cap open reading frame encodes one or more AAV capsid proteins from AAV9. In some of any of the provided embodiments, the Cap open reading frame comprises the nucleotide sequence of SEQ ID NO: 66, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof. In some of any of the provided embodiments, the Cap open reading frame has a nucleotide sequence comprising a C9T mutation with reference to SEQ ID NO: 66. In some of any of the provided embodiments, the AAV Cap expression cassette comprises the nucleotide sequence of SEQ ID NO: 68 or SEQ ID NO: 69, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.MF-367351030 4324632001440

[0021] In some of any of the provided embodiments, the Cap open reading frame encodes one or more AAV capsid proteins from AAV2. In some of any of the provided embodiments, the Cap open reading frame comprises the nucleotide sequence of SEQ ID NO: 58, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof. In some of any of the provided embodiments, the Cap open reading frame has a nucleotide sequence comprising a C9T mutation with reference to SEQ ID NO: 58.

[0022] In some of any of the provided embodiments, the Cap open reading frame encodes one or more AAV capsid proteins that are a chimera of capsid proteins from two or more serotypes selected from AAV1, AAV2, rAAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV13, AAV 14, AAV 15 and AAV 16, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, and AAV.HSC16. In some of any of the provided embodiments, the Cap open reading frame encodes one or more AAV capsid proteins that are a chimera of capsid proteins from AAV9 and AAV5.

[0023] In some of any of the provided embodiments, the one or more AAV capsid proteins further comprise one or more amino acid substitutions that confers tropism for a tissue of interest. In some of any of the provided embodiments, the tissue of interest is a central nervous system (CNS) tissue, a muscle tissue, or eye tissue. In some of any of the provided embodiments, the Cap open reading frame comprises the nucleotide sequence of SEQ ID NO: 440 or SEQ ID NO: 445, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0024] In some of any of the provided embodiments, the polynucleotide further comprises an AAV Rep expression cassette that comprises, from 5’ to 3’, a second promoter and a Rep open reading frame. In some of any of the provided embodiments, the AAV Rep expression cassette is in an opposite orientation relative to the AAV Cap expression cassette. In some of any of the provided embodiments, the AAV Rep expression cassette is oriented 3 ’ to 5 ’ and the AAV Cap expression cassette is oriented 5 ’ to 3’, or the AAV Rep expression cassette is oriented 5’ to 3’ and the AAV Cap expression cassette is oriented 3 ’ to 5 ’ .

[0025] In some of any of the provided embodiments, the AAV Rep expression cassette is separated from the AAV Cap expression cassette by an intervening sequence. In some of any of the provided embodiments, the intervening sequence comprises a transcriptional blocking element (TBE). In some of any of the provided embodiments, the TBE comprises the sequence of SEQ ID NO: 33 or a nucleotideMF-367351030 5324632001440sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0026] In some of any of the provided embodiments, the Rep open reading frame comprises a large Rep coding sequence operably linked to the second promoter, and wherein the large Rep coding sequence comprises a small Rep coding sequence. In some of any of the provided embodiments, the large Rep coding sequence encodes one or more large Rep proteins and the small Rep coding sequence encodes one or more small Rep proteins. In some of any of the provided embodiments, the large Rep coding sequence further comprises a pl9 promoter upstream of the small Rep coding sequence. In some of any of the provided embodiments, the small Rep coding sequence is operably linked to the pl9 promoter. In some of any of the provided embodiments, the one or more large Rep proteins comprises Rep78 and the one or more small Rep protein comprises Rep52, or the one or more large Rep proteins comprises Rep78 and Rep68 and the one or more small Rep protein comprises Rep52 and Rep40.

[0027] In some of any of the provided embodiments, the Rep open reading frame comprises from 5 ’ to 3 ’ the large Rep coding sequence, an intron comprising a third promoter and a first excisable element that comprises a coding sequence comprising a stop signaling sequence flanked by a first recombination site and a second recombination site, and the small Rep coding sequence. In some of any of the provided embodiments, the intron is a synthetic intron comprising from 5’ to 3’ a 5’ splice donor site, the third promoter, the first excisable element further comprising a first 3 ’ splice acceptor site upstream of the coding sequence comprising a stop signaling sequence, and a second 3’ splice acceptor site, wherein the splice donor and the first and second acceptor sites are compatible with a cell used for expressing a large Rep protein. In some of any of the provided embodiments, the third promoter is operably linked to the small Rep coding sequence following a recombination event between the first recombination site and the second recombination site.

[0028] In some of any of the provided embodiments, the Rep coding sequence comprises from 5’ to 3’ the large Rep coding sequence, the p 19 promoter, a first part of the small Rep coding sequence, an intron comprising a first excisable element that comprises a coding sequence comprising a stop signaling sequence flanked by a first recombination site and a second recombination site, and a second part of the small Rep coding sequence, wherein the first part and second part of the small Rep coding sequence form the small Rep coding sequence. In some of any of the provided embodiments, the intron is a synthetic intron comprising from 5 ’ to 3 ’ a 5 ’ splice donor site, the first excisable element further comprising a first 3’ splice acceptor site upstream of the coding sequence comprising a stop signaling sequence, and a second 3’ splice acceptor site, wherein the splice donor and first and second acceptor sites are compatible with a cell used for expressing a large Rep protein. In some of any of the provided embodiments, the first 3 ’ splice site and the coding sequence comprising a stop signaling sequence in the second excisableMF-367351030 6324632001440element are excised following a recombination event between the first recombination site and the second recombination site.

[0029] In some of any of the provided embodiments, the first and second recombination sites comprise Lox sites or flippase recognition target (FRT) sites. In some of any of the provided embodiments, the first and second recombination sites comprise Lox sites. In some of any of the provided embodiments, the coding sequence comprising a stop signaling sequence is a detectable marker. In some of any of the provided embodiments, the detectable marker is a luminescent marker, a radiolabel or a fluorescent marker. In some of any of the provided embodiments, the detectable marker comprises the nucleotide sequence of SEQ ID NO: 30, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any of the provided embodiments, the first excisable element comprises the nucleotide sequence of SEQ ID NO: 31 or SEQ ID NO: 32, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0030] In some of any of the provided embodiments, the recombination event between the first recombination site and the second recombination site is induced in the presence of a recombinase. In some of any of the provided embodiments, the recombinase is an inducible recombinase. In some of any of the provided embodiments, the inducible recombinase comprises a Cre recombinase. In some of any of the provided embodiments, the inducible recombinase is a Cre-ERT2 protein fusion. In some of any of the provided embodiments, the third promoter is heterologous to the small Rep coding sequence. In some of any of the provided embodiments, the third promoter has higher promoter activity compared to the second promoter. In some of any of the provided embodiments, the second promoter is a p5 promoter. In some of any of the provided embodiments, the second promoter is heterologous to the large Rep coding sequence.

[0031] In some of any of the provided embodiments, the p 19 promoter is mutated to substantially reduce promoter activity. In some of any of the provided embodiments, the p 19 promoter activity is reduced by at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or is undetectable as compared to the native pl9 promoter activity.

[0032] In some of any of the provided embodiments, the second and / or third promoter is an inducible promoter or the second and / or third promoter is a constitutive promoter. In some of any of the provided embodiments, the second promoter and the third promoter are independently selected from a ubiquitin C (UBC) promoter, a Rous sarcoma virus long terminal repeat (RSV) promoter, a chicken beta actin promoter, a cytomegalovirus (CMV) promoter, a CMV enhancer / chicken beta actin (CAG) promoter, and a phosphoglycerate kinase (PGK) promoter. In some of any of the provided embodiments, the second promoter and the third promoter independently comprise a nucleotide sequence selected from any one of SEQ ID NOs: 34-42, 338, 339, 355, and 356 or a nucleotide sequence that has at least 70%,MF-367351030 732463200144080%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In some of any of the provided embodiments, the second promoter is a UBC promoter and the third promoter is a CAG promoter. In some of any of the provided embodiments, the second promoter comprises a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 34 or SEQ ID NO: 37 and the third promoter comprises a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of SEQ ID NOs: 36, 39, 339, and 356.

[0033] In some of any of the provided embodiments, the AAV Rep expression cassette further comprises a polyadenylation (poly A) signal sequence downstream of the Rep open reading frame. In some of any of the provided embodiments, the polyA signal sequence is a native AAV Rep polyA signal sequence. In some of any of the provided embodiments, the polyA signal sequence is a heterologous polyA signal sequence. In some of any of the provided embodiments, the heterologous polyA signal sequence is selected from the group consisting of a bovine growth hormone (bGH) polyA signal sequence, a human growth hormone (hGH) polyA signal sequence, a Simian Virus 40 (SV40) polyA signal sequence, a Chinese hamster growth hormone polyA signal sequence, a human neurophilin-1 polyA signal sequence, a nopaline synthase polyA signal sequence, an alpha globulin polyA signal sequence, and a rabbit globin polyA signal sequence. In some of any of the provided embodiments, the heterologous polyA signal sequence comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 43-51, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the foregoing. In some of any of the provided embodiments, the heterologous polyA signal sequence is a bGH polyA signal sequence. In some of any of the provided embodiments, the heterologous polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 43, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof.

[0034] In some of any of the provided embodiments, the AAV Rep expression cassette further comprises an enhancer sequence downstream of the polyA signal sequence. In some of any of the provided embodiments, the enhancer is selected from a transcriptional enhancer, a translational enhancer, and a transcriptional and translational enhancer. In some of any of the provided embodiments, the enhancer comprises one or more sequences selected from the group consisting of SEQ ID NOs: 40, 52-56, and 98-201. In some of any of the provided embodiments, the enhancer comprises one or more of a human telomerase reverse transcriptase (hTERT), a Simian virus 40 (SV40), or a CMV enhancer. In some of any of the provided embodiments, the enhancer comprises the nucleotide sequence of one or more of SEQ ID NOs: 52-54, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the foregoing. In some of any of the provided embodiments, the enhancer is a double enhancer comprising a Simian virus 40 (SV40)MF-367351030 8324632001440and a CMV enhancer. In some of any of the provided embodiments, the double enhancer comprises the nucleotide sequence of SEQ ID NO: 55, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof. In some of any of the provided embodiments, the enhancer is a triple enhancer comprising a telomerase reverse transcriptase (hTERT), a Simian virus 40 (SV40), and a CMV promoter / enhancer. In some of any of the provided embodiments, the enhancer comprises the nucleotide sequence of SEQ ID NO: 56, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof.

[0035] In some of any of the provided embodiments, the AAV Rep expression cassette further comprises a second excisable element downstream of the Rep open reading frame and upstream of the polyA signal sequence, wherein the second excisable element comprises a sequence encoding a ribozyme flanked by a third recombination site and a fourth recombination site, and wherein the ribozyme mediates degradation of an RNA encoding the ribozyme. In some of any of the provided embodiments, the sequence encoding the ribozyme is excised following a recombination event between the third recombination site and the fourth recombination site. In some of any of the provided embodiments, the third and fourth recombination sites comprise Lox sites or flippase recognition target (FRT) sites. In some of any of the provided embodiments, the third and fourth recombination sites comprise Lox sites. In some of any of the provided embodiments, the first and second recombination sites comprise LoxP sequences and the third and fourth recombination sites comprise LoxN sequences, or the first and second recombination sites comprise LoxN sequences and the third and fourth recombination sites comprise LoxP sequences. In some of any of the provided embodiments, the ribozyme is a self-cleaving ribozyme. In some of any of the provided embodiments, the ribozyme is a Hammerhead ribozyme. In some of any of the provided embodiments, the ribozyme is selected from the group consisting of a Hammerhead ribozyme Type I, a Hammerhead ribozyme Type II, a Hammerhead ribozyme Type III, a Hammerhead ribozyme HH9, a Hammerhead ribozyme HH10, and a RAGATH-1 -hammerhead ribozyme. In some of any of the provided embodiments, the sequence encoding the ribozyme comprises the nucleotide sequence of SEQ ID NO: 20, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof.

[0036] In some of any of the provided embodiments, the Rep open reading frame encodes Rep proteins selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV13, AAV 14, AAV 15 and AAV 16, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16 or AAVhu68. InMF-367351030 9324632001440some of any of the provided embodiments, the Rep open reading frame encodes Rep proteins from AAV2.

[0037] In some of any of the provided embodiments, the large Rep coding sequence comprises a Rep78 and / or Rep68 coding sequence comprising the nucleotide sequence of SEQ ID NO: 70 or SEQ ID NO: 71, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In some of any of the provided embodiments, the small Rep coding sequence comprises a Rep52 coding sequence comprising the nucleotide sequence of SEQ ID NO: 72, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any of the provided embodiments, the first part of the small Rep coding sequence comprises the nucleotide sequence of SEQ ID NO: 73 and the second part of the small Rep coding sequence comprises the nucleotide sequence of SEQ ID NO: 74. In some of any of the provided embodiments, the small Rep coding sequence further comprises a Rep40 coding sequence comprising the nucleotide sequence of SEQ ID NO: 75, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0038] In some of any of the provided embodiments, the AAV Rep expression cassette comprises the nucleotide sequence of any one of SEQ ID NOs: 76, 77, 82, 308, 309, 334, 456-458, 463, and 468, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0039] In some of any of the provided embodiments, the polynucleotide further comprises a first selection cassette, wherein the first selection cassette comprises, from 5’ to 3’, a first constitutive promoter operably linked to a nucleotide sequence encoding a first selectable marker. In some of any of the provided embodiments, the first selection cassette is located downstream of the AAV Cap expression cassette and is in the same orientation as the AAV Cap expression cassette. In some of any of the provided embodiments, the first constitutive promoter is an EFla promoter. In some of any of the provided embodiments, the EFla promoter has a TATA box mutation. In some of any of the provided embodiments, the first constitutive promoter comprises the nucleotide sequence of SEQ ID NO: 438, SEQ ID NO: 78 or SEQ ID NO: 79, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0040] In some of any of the provided embodiments, the first selectable marker is an antibiotic resistance gene. In some of any of the provided embodiments, the antibiotic resistance gene is selected from the group consisting of a blasticidin resistance gene, a hygromycin resistance gene, a puromycin resistance gene, and an ampicillin resistance gene. In some of any of the provided embodiments, the first selectable marker is a split selectable marker comprising a first part of a blasticidin resistance gene linked to an N-intein, or a C-intein linked to a second part of a blasticidin resistance gene. In some of any of theMF-367351030 10324632001440provided embodiments, the first selectable marker comprises the nucleotide sequence of SEQ ID NO: 80 or SEQ ID NO: 84, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0041] In some aspects, provided herein is a polynucleotide comprising an AAV Cap expression cassette, wherein the AAV Cap expression cassette comprises the nucleotide sequence of any one of SEQ ID NOs: 68, 69, 326, 327, 480 and 482 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0042] In some aspects, provided herein is a polynucleotide comprising an AAV Cap expression cassette comprising the nucleotide sequence of any one of SEQ ID NOs: 68, 69, 326, 327, 480 and 482, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing, an AAV Rep expression cassette comprising the nucleotide sequence of any one of SEQ ID NOs: 76, 77, 82, 308, 309, 334, 456-458, 463, and 468, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing, and a selection cassette comprising the nucleotide sequence of SEQ ID NO: 81, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0043] In some aspects, provided herein is a polynucleotide comprising the nucleotide sequence of any of SEQ ID NOs: 13, 18, 22, 24, 329330, 452-455, and 464-465, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0044] In some aspects, provided herein is a polynucleotide comprising the nucleotide sequence of any of SEQ ID NOs: 13, 18, 22, 24, 329, 330, 452-455, and 464-465.

[0045] In some aspects, provided herein is a system of polynucleotides comprising a first polynucleotide comprising any of the polynucleotides provided herein and a second polynucleotide comprising a first expression cassette, wherein the first expression cassette comprises a nucleotide sequence encoding one or more AAV helper proteins.

[0046] In some of any of the provided embodiments, the first expression cassette further comprises an inducible promoter. In some of any of the provided embodiments, the first expression cassette comprises, from 5’ to 3’, an inducible promoter, a self-excising element that comprises a sequence encoding a recombinase that is flanked by a fifth recombination site and a sixth recombination site, and a nucleotide sequence encoding one or more helper proteins, wherein the recombinase is operably linked to the inducible promoter.

[0047] In some of any of the provided embodiments, the inducible promoter comprises a tetracycline response element (TRE). In some of any of the provided embodiments, the TRE comprises Tet operator (tetO) sequence concatemers fused to a minimal promoter. In some of any of the providedMF-367351030 11324632001440embodiments, the tetO sequence concatamers comprise the sequence of SEQ ID NO: 27. In some of any of the provided embodiments, the minimal promoter is a human cytomegalovirus promoter. In some of any of the provided embodiments, the minimal promoter comprises the nucleotide sequence of SEQ ID NO: 28. In some of any of the provided embodiments, the inducible promoter comprises the nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any of the provided embodiments, the inducible promoter comprises the nucleotide sequence of SEQ ID NO: 25.

[0048] In some of any of the provided embodiments, the inducible promoter of the second polynucleotide is the same as the inducible promoter of the first polynucleotide. In some of any of the provided embodiments, the inducible promoter is activated in the presence of a first triggering agent. In some of any of the provided embodiments, the first triggering agent is doxycycline.

[0049] In some of any of the provided embodiments, the sequence encoding the recombinase in the self-excising element is excised following a recombination event between the fifth recombination site and the sixth recombination site. In some of any of the provided embodiments, the inducible promoter is operably linked to the sequence encoding one or more AAV helper proteins following a recombination event between the fifth recombination site and the sixth recombination site. In some of any of the provided embodiments, the recombinase is a Cre recombinase or a flippase (FLP) recombinase. In some of any of the provided embodiments, the recombinase is a Cre recombinase. In some of any of the provided embodiments, the fifth recombination and sixth recombination sites comprise Lox sequences. In some of any of the provided embodiments, the recombinase is an inducible recombinase. In some of any of the provided embodiments, the inducible recombinase is a Cre recombinase fused to an estrogen receptor ligand binding domain. In some of any of the provided embodiments, the inducible recombinase is a Cre-ERT2 fusion protein. In some of any of the provided embodiments, the inducible recombinase translocates to the nucleus in the presence of a second triggering agent. In some of any of the provided embodiments, the second triggering agent is an estrogen receptor ligand. In some of any of the provided embodiments, the second triggering agent is a selective estrogen receptor modulator (SERM). In some of any of the provided embodiments, the second triggering agent is tamoxifen. In some of any of the provided embodiments, the inducible recombinase comprises the nucleotide sequence of SEQ ID NO: 225, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any of the provided embodiments, the recombination event between the fifth recombination site and the sixth recombination site is induced in the presence of the first and second triggering agents.

[0050] In some of any of the provided embodiments, the sequence encoding the one or more AAV helper proteins is a bistronic open reading frame encoding at least two AAV helper proteins. In some of any of the provided embodiments, the one or more helper proteins comprise E2A and E4. In some of anyMF-367351030 12324632001440of the provided embodiments, the E2A protein is encoded by a nucleotide sequence comprising SEQ ID NO: 226 and SEQ ID NO: 227, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any of the provided embodiments, the E4 protein is encoded by a nucleotide sequence comprising SEQ ID NO: 228, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any of the provided embodiments, the sequence coding for E2A and the sequence coding for E4 are separated by an internal ribosome entry site (IRES) or by a cleavable linker. In some of any of the provided embodiments, the cleavable linker is a 2A peptide, optionally wherein the 2A peptide is P2A, T2A, F2A, or E2A. In some of any of the provided embodiments, the sequence coding for E2A and the sequence coding for E4 are separated by an internal ribosome entry site (IRES). In some of any of the provided embodiments, the IRES comprises the nucleotide sequence of SEQ ID NO: 229, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any of the provided embodiments, the first expression cassette comprises the nucleotide sequence of SEQ ID NO: 230, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0051] In some of any of the provided embodiments, the second polynucleotide further comprises a second expression cassette comprising a second constitutive promoter operably linked to a nucleotide sequence encoding an activator. In some of any of the provided embodiments, the second expression cassette is in an opposite orientation relative to the first expression cassette. In some of any of the provided embodiments, the first expression cassette is oriented 3’ to 5’ and the second expression cassette is oriented 5’ to 3’, or the first expression cassette is oriented 5’ to 3’ and the second expression cassette is oriented 3 ’ to 5 ’ . In some of any of the provided embodiments, the first expression cassette is separated from the second expression cassette by an intervening sequence. In some of any of the provided embodiments, the intervening sequence comprises a transcriptional blocking element (TBE). In some of any of the provided embodiments, the TBE element comprises the sequence of SEQ ID NO: 33 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0052] In some of any of the provided embodiments, the activator activates transcription from the inducible promoter of the first polynucleotide and / or the second polynucleotide in the presence of a first triggering agent. In some of any of the provided embodiments, the first triggering agent is doxycycline. In some of any of the provided embodiments, the activator is Tet-on3G. In some of any of the provided embodiments, the activator comprises the nucleotide sequence of SEQ ID NO: 232 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any of the provided embodiments, the second constitutive promoterMF-367351030 13324632001440is an EFla promoter. In some of any of the provided embodiments, the EFla promoter has a TATA box mutation. In some of any of the provided embodiments, the second constitutive promoter comprises the nucleotide sequence of SEQ ID NO: 438, SEQ ID NO: 78 or SEQ ID NO: 79, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any of the provided embodiments, the second expression cassette comprises the nucleotide sequence of SEQ ID NO: 233, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0053] In some of any of the provided embodiments, the second polynucleotide further comprises a third expression cassette comprising a first part of a third constitutive promoter, a third excisable element, a second part of a third constitutive promoter and a sequence encoding VA RNA. In some of any of the provided embodiments, the third expression cassette is downstream of the second expression cassette and is in the same orientation as the second expression cassette. In some of any of the provided embodiments, the third excisable element is in an opposite orientation relative to the third constitutive promoter. In some of any of the provided embodiments, the third excisable element comprises a second selection cassette flanked by a seventh recombination site and an eighth recombination site. In some of any of the provided embodiments, the second selection cassette is excised following a recombination event between the seventh recombination site and the eighth recombination site thereby generating a functionally complete third constitutive promoter operably linked to the sequence encoding VA RNA. In some of any of the provided embodiments, the first part of the third constitutive promoter comprises a U6 promoter distal sequence element (DSE) and the second part of the third constitutive promoter comprises a U6 promoter proximal sequence element (PSE). In some of any of the provided embodiments, the U6 promoter DSE comprises the nucleotide sequence of SEQ ID NO: 234, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any of the provided embodiments, the U6 promoter PSE comprises the nucleotide sequence of SEQ ID NO: 235, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0054] In some of any of the provided embodiments, the sequence encoding VA RNA is a transcriptionally dead sequence. In some of any of the provided embodiments, the sequence encoding VA RNA comprises at least two mutations in an internal promoter. In some of any of the provided embodiments, the at least two mutations comprise a G16A mutation and a G60A mutation with reference to SEQ ID NO: 236. In some of any of the provided embodiments, the sequence encoding VA RNA comprises the nucleotide sequence of SEQ ID NO: 237 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any of the provided embodiments, the second selection cassette comprises a fourth constitutive promoter operably linked to a nucleotide sequence encoding a second selectable marker. In some of anyMF-367351030 14324632001440of the provided embodiments, the second selectable marker is a puromycin resistance gene. In some of any of the provided embodiments, the puromycin resistance gene comprises the nucleotide sequence of SEQ ID NO: 238, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any of the provided embodiments, the fourth constitutive promoter is a CMV promoter. In some of any of the provided embodiments, the second selection cassette comprises the nucleotide sequence of SEQ ID NO: 357, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any of the provided embodiments, the third expression cassette comprises the nucleotide sequence of SEQ ID NO: 239, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any of the provided embodiments, the second polynucleotide comprises the sequence of SEQ ID NO: 240 or SEQ ID NO: 241, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0055] In some of any of the provided embodiments, the system further comprises a third polynucleotide comprising a payload expression cassette flanked by AAV ITR sequences, wherein the payload expression cassette comprises a fifth constitutive promoter operably linked to a nucleotide sequence encoding a payload. In some of any of the provided embodiments, the fifth constitutive promoter is an RSV promoter. In some of any of the provided embodiments, the RSV promoter comprises the nucleotide sequence of SEQ ID NO: 41, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0056] In some of any of the provided embodiments, the sequence of the payload comprises a polynucleotide sequence coding for a gene. In some of any of the provided embodiments, the gene codes for a selectable marker or detectable marker. In some of any of the provided embodiments, the gene codes for a therapeutic polypeptide or transgene. In some of any of the provided embodiments, the sequence of the payload comprises a polynucleotide sequence coding for a therapeutic polynucleotide. In some of any of the provided embodiments, the therapeutic polynucleotide is a tRNA suppressor or a guide RNA. In some of any of the provided embodiments, the guide RNA is a polyribonucleotide capable of binding to a protein. In some of any of the provided embodiments, the protein is a nuclease. In some of any of the provided embodiments, the protein is a Cas protein, an ADAR protein, or an AD AT protein. In some of any of the provided embodiments, the Cas protein is a catalytically inactive Cas protein.

[0057] In some of any of the provided embodiments, the third polynucleotide further comprises a third selection cassette, wherein the third selection cassette comprises a sixth constitutive promoter operably linked to a sequence encoding a third selectable marker. In some of any of the provided embodiments, the third selectable marker is an antibiotic resistance gene. In some of any of the provided embodiments, the third selectable marker comprises a second part of a split blasticidin resistance gene. InMF-367351030 15324632001440some of any of the provided embodiments, the third selectable marker comprises the nucleotide sequence of SEQ ID NO: 84 or SEQ ID NO: 80, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In some of any of the provided embodiments, the sixth constitutive promoter is an EFla promoter. In some of any of the provided embodiments, the EFla promoter has a TATA box mutation. In some of any of the provided embodiments, the sixth constitutive promoter comprises the nucleotide sequence of SEQ ID NO: 439 or SEQ ID NO: 282, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any of the provided embodiments, the third selection cassette comprises the nucleotide sequence of SEQ ID NO: 210, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of any of the provided embodiments, the third polynucleotide comprises the sequence of SEQ ID NO: 337 or SEQ ID NO: 248, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0058] In some of any of the provided embodiments, the system further comprises a fourth polynucleotide comprising a late-stage gene expression cassette, wherein the late-stage gene expression cassette comprises a fourth promoter operably linked to an L4 coding sequence. In some of any of the provided embodiments, the fourth promoter is an inducible promoter. In some of any of the provided embodiments, the L4 coding sequence comprises one or both of a 22K-L4 sequence and a 33K-L4 sequence. In some of any of the provided embodiments, the L4 coding sequence comprises a 22K-L4 sequence. In some of any of the provided embodiments, the 22K-L4 comprises a nucleotide sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO: 224. In some of any of the provided embodiments, the 22K-L4 comprises the nucleotide sequence of SEQ ID NO: 224. In some of any of the provided embodiments, the 22K-L4 sequence encodes an 22K-L4 protein comprising an amino acid sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO: 223. In some of any of the provided embodiments, the 22K-L4 sequence encodes an 22K-L4 protein comprising the amino acid sequence of SEQ ID NO: 223. In some of any of the provided embodiments, the 33K-L4 sequence comprises a nucleotide sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO: 222. In some of any of the provided embodiments, the 33K-L4 sequence comprises the nucleotide sequence of SEQ ID NO: 222. In some of any of the provided embodiments, the 33K-L4 sequence encodes an 33K-L4 protein comprising an amino acid sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO: 221. In some of any of the provided embodiments, the 33K-L4 sequence encodes an 33K-L4 protein comprising the amino acid sequence of SEQ ID NO: 221. In some of any of the provided embodiments, the L4 coding sequence encodes the L422K and L433K proteins. In some ofMF-367351030 16324632001440any of the provided embodiments, the L4 coding sequence comprises a nucleotide sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO: 220. In some of any of the provided embodiments, the L4 coding sequence comprises the nucleotide sequence of SEQ ID NO: 220.

[0059] In some of any of the provided embodiments, the inducible promoter comprises a tetracycline response element (TRE). In some of any of the provided embodiments, the TRE comprises Tet operator (tetO) sequence concatemers fused to a minimal promoter. In some of any of the provided embodiments, the tetO sequence concatamers comprise the sequence of SEQ ID NO: 27. In some of any of the provided embodiments, the minimal promoter is a human cytomegalovirus promoter. In some of any of the provided embodiments, the minimal promoter comprises the sequence of SEQ ID NO: 28. In some of any of the provided embodiments, the inducible promoter comprises a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO: 25. In some of any of the provided embodiments, the inducible promoter comprises the sequence of SEQ ID NO: 25.

[0060] In some of any of the provided embodiments, the inducible promoter of the fourth polynucleotide is the same as the inducible promoter of the first and / or second polynucleotides. In some of any of the provided embodiments, the inducible promoter of the fourth polynucleotide and the first polynucleotide are the same, the inducible promoter of the fourth polynucleotide and the second polynucleotide are the same, the inducible promoter of the first polynucleotide and the second polynucleotide are the same, or the inducible promoter of the fourth polynucleotide, the first polynucleotide, and the second polynucleotide are the same. In some of any of the provided embodiments, transcription of the L4 coding sequence is activated from the inducible promoter upon binding of an activator. In some of any of the provided embodiments, the activator binds to the inducible promoter in the presence of a first triggering agent.

[0061] In some of any of the provided embodiments, the fourth polynucleotide further comprises a fourth selection cassette, wherein the fourth selection cassette comprises a fourth constitutive promoter operably linked to a sequence encoding a fourth selectable marker. In some of any of the provided embodiments, the fourth constitutive promoter is an EFla promoter. In some of any of the provided embodiments, the fourth selectable marker is an antibiotic resistance protein. In some of any of the provided embodiments, the antibiotic resistance protein is selected from a hygromycin resistance protein, a puromycin resistance protein, and an ampicillin resistance protein. In some of any of the provided embodiments, the antibiotic resistance protein is a hygromycin resistance protein. In some of any of the provided embodiments, the sequence of the fourth selectable marker comprises a sequence identity with at least 70%, 80%, 90%, 95%, 99%, or 100% to SEQ ID NO: 219, optionally wherein the selectable marker comprises the sequence of SEQ ID NO: 219. In some of any of the provided embodiments, the fourth selectable marker is a split selectable marker, wherein the fourth polynucleotide comprises a firstMF-367351030 17324632001440part of the selectable marker sequence fused to a first reassembly module and wherein a second polynucleotide provides the second part of the selectable marker sequence fused to a second reassembly module. In some of any of the provided embodiments, the first and second reassembly modules are selected from two complementary halves of a split intein (N-intein and C-intein) or leucine zippers. In some of any of the provided embodiments, the fourth selectable marker is a split selectable marker that is a split antibiotic resistance protein and the fourth polynucleotide comprises a sequence selected from a split intein linked to an N-terminus of the first part of the antibiotic resistance protein or a split intein linked to a C-terminus of the first part of the antibiotic resistance protein, and a leucine zipper linked to an N-terminus of the first part of the antibiotic resistance protein or leucine zipper linked to a C-terminus of the first part of the antibiotic resistance protein. In some of any of the provided embodiments, the fourth selectable marker is a first part of a split blasticidin resistance gene intein. In some of any of the provided embodiments, the fourth selectable marker is a first part of a split hygromycin resistance gene intein. In some of any of the provided embodiments, the fourth selectable marker is a mammalian cell selection element, optionally wherein the mammalian cell selection element is an auxotrophic selection element, optionally wherein the auxotrophic selection element codes for an active protein, and optionally wherein the active protein is DHFR.

[0062] In some of any of the provided embodiments, the fourth polynucleotide further comprises a sequence for integration into the genome of a cell, optionally wherein the sequence comprises a 5’ sequence and a 3’ sequence. In some of any of the provided embodiments, the integration is by transposon system integration, wherein the sequence for integration comprises a transposon 5’ inverted terminal repeat and a transposon 3’ inverted terminal repeat that are able to be recognized by a transposase. In some of any of the provided embodiments, the fourth polynucleotide comprises a 5’ inverted terminal repeat upstream of the late-stage gene cassette and a 3’ inverted terminal repeat downstream of the late-stage gene cassette, wherein the 5’ inverted terminal repeat and 3’ inverted terminal repeat are for integration of the late-stage gene cassette into the genome of a cell by a transposon system. In some of any of the provided embodiments, the transposon system is a Piggybac system. In some of any of the provided embodiments, the integration is by homology directed repair into a target loci, wherein the sequence for integration comprises 5 ’ and 3 ’ homology arms that are each independently complementary to a sequence of the target loci flanking the site of integration. In some of any of the provided embodiments, the fourth polynucleotide comprises a 5 ’ homology arm upstream of the late-stage gene cassette and a 3’ homology arm downstream of the late-stage gene cassette, wherein the 5 ’ and 3 ’ homology arms are for targeted knock-in of the late-stage gene cassette by homology directed repair into a target loci and are each independently complementary to a sequence of the target loci flanking a site of integration. In some of any of the provided embodiments, the target loci is a safe harbor locus, optionally wherein the safe harbor locus is Rogi-1. In some of any of the providedMF-367351030 18324632001440embodiments, the late-stage gene expression cassette comprises a nucleotide sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO: 360. In some of any of the provided embodiments, the fourth polynucleotide comprises a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO: 214. In some of any of the provided embodiments, the fourth polynucleotide comprises the sequence of SEQ ID NO: 214. In some of any of the provided embodiments, the fourth polynucleotide comprises a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO: 215. In some of any of the provided embodiments, the fourth polynucleotide comprises the sequence of SEQ ID NO: 215.

[0063] In some aspects, provided herein is a vector comprising any of the polynucleotides provided herein. In some aspects, provided herein is a vector comprising a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of any one of SEQ ID NOs: 87, 92, 95, 97, 332, 333, 459-462, and 466-467. In some aspects, provided herein is a vector comprising a sequence of any one of SEQ ID NOs: 87, 92, 95, 97, 332, 333, 459-462, and 466-467.

[0064] In some aspects, provided herein is a vector system for inducible production of recombinant adeno-associated virus (rAAV) comprising a first vector comprising any of the first polynucleotides provided herein, a second vector comprising any of the second polynucleotides provided herein, and a third vector comprising any of the third polynucleotides provided herein.

[0065] In some aspects, provided herein is a vector system for inducible production of recombinant adeno-associated virus (rAAV) comprising a first vector comprising any of the first polynucleotides provided herein, a second vector comprising any of the second polynucleotides provided herein, a third vector comprising any of the third polynucleotides provided herein, and a fourth vector comprising any of the fourth polynucleotides provided herein.

[0066] In some aspects, provided herein is a cell comprising any of the polynucleotides provided herein. In some of any of the provided embodiments, the polynucleotide is integrated into the genome of the cell.

[0067] In some aspects, provided herein is a cell comprising any of the systems of polynucleotides provided herein. In some aspects, provided herein is a cell comprising any of the vectors provided herein or any of the vector systems provided herein. In some aspects, provided herein is a cell for inducible production of recombinant adeno-associated virus (rAAV) comprising any of the systems of polynucleotides provided herein or any of the vector systems provided herein.

[0068] In some of any of the provided embodiments, one or more of the polynucleotides of the system are stably integrated into the cell. In some of any of the provided embodiments, rAAV production is induced in the presence of a first triggering agent and a second triggering agent. In some of any of the provided embodiments, the first triggering agent activates the inducible promoters and the second triggering agent activates the inducible recombinase. In some of any of the provided embodiments, uponMF-367351030 19324632001440induction, the cell is capable of producing increased rAAV titer relative to a comparable cell where the Cap expression cassette comprises a native splice donor site sequence. In some of any of the provided embodiments, the first polynucleotide is stably integrated into the cell. In some of any of the provided embodiments, the second polynucleotide is stably integrated into the cell. In some of any of the provided embodiments, the third polynucleotide is stably integrated into the cell. In some of any of the provided embodiments, the fourth polynucleotide is stably integrated into the cell. In some of any of the provided embodiments, each of the first, second, and third polynucleotides are stably integrated into the cell. In some of any of the provided embodiments, the first, second, third, and fourth polynucleotides are stably integrated into the cell.

[0069] In some of any of the provided embodiments, the cell is a mammalian cell. In some of any of the provided embodiments, the mammalian cell is a HEK293 cell. In some of any of the provided embodiments, the HEK293 cell expresses AAV helper proteins E1A and E1B.

[0070] In some of any of the provided embodiments, the cell further comprises a knockout of one or more genes encoding a protein involved in programmed cell death. In some of any of the provided embodiments, the protein involved in programmed cell death comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or fourteen of CASP3, CASP6, CASP7, AIF1, BAK1, BAX, IFNAR1, MYD88, TICAM1, TIRAP, RIGI, CGAS, STING, AIM2, DFFB, and IFI16. In some of any of the provided embodiments, the protein involved in programmed cell death comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or eight of CASP3, CGAS, STING1, IFNAR1, MYD88, BAK, BAK1, and DFFB. In some of any of the provided embodiments, the protein involved in programmed cell death comprises CASP3. In some of any of the provided embodiments, the knockout comprises a deletion in an exon within each of the one or more genes. In some of any of the provided embodiments, the knockout is performed using a CRISPR system. In some of any of the provided embodiments, the CRISPR system comprises a nuclease and at least one guide RNA.

[0071] In some aspects, provided herein is a method for inducible production of recombinant adeno-associated virus (rAAV) comprising contacting any of the cells provided herein with a first triggering agent and a second triggering agent, wherein the first triggering agent activates transcription of the inducible promoters in the first and second polynucleotides or activates transcription of the inducible promoters in the first, second and fourth polynucleotides, and wherein the second triggering agent activates translocation of the inducible recombinase to the nucleus of the cell to induce recombination between the recombination sites flanking each excisable element in the first and second polynucleotides, thereby inducing rAAV production.

[0072] In some of any of the provided embodiments, the first triggering agent is doxycycline and the second triggering agent is tamoxifen. In some of any of the provided embodiments, the method furtherMF-367351030 20324632001440comprises contacting the cell with an apoptosis inhibitor. In some of any of the provided embodiments, the apoptosis inhibitor is zV AD. fink.

[0073] In some aspects, provided herein is a method of generating a cell for inducibly producing rAAV comprising introducing into a cell any of the systems of polynucleotides provided herein or any of the vector systems provided herein. In some of any of the provided embodiments, the method further comprises performing a knockout of one or more genes encoding a protein involved in programmed cell death. In some of any of the provided embodiments, the protein involved in programmed cell death comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or fourteen of CASP3, CASP6, CASP7, AIF1, BAK1, BAX, IFNAR1, MYD88, TICAM1, TIRAP, RIGI, CGAS, STING, AIM2, DFFB, and IFI16. In some of any of the provided embodiments, the protein involved in programmed cell death comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or eight of CASP3, CGAS, STING1, IFNAR1, MYD88, BAK, BAK1, and DFFB. In some of any of the provided embodiments, the protein involved in programmed cell death comprises CASP3. In some of any of the provided embodiments, the knockout comprises a deletion in an exon within each of the one or more genes. In some of any of the provided embodiments, performing the knockout comprises using a CRISPR system. In some of any of the provided embodiments, performing the knockout comprises contacting the cell with a nuclease and at least one guide RNA. In some of any of the provided embodiments, the nuclease is Cas9. In some of any of the provided embodiments, the nuclease and at least one guide RNA are introduced into the cell by delivering a ribonucleoprotein (RNP) complex by electroporation.BRIEF DESCRIPTION OF THE DRAWINGS

[0074] FIG. 1A shows exemplary schematic of constructs of a vl .4 system for inducibly producing rAAV. In absence of the first triggering agent and the second triggering agent, the system is in an off state, in which rAAV is not produced.

[0075] FIG. IB shows the system of polynucleotides for inducibly producing rAAV depicted in FIG. 1A is shown in the post-triggered state, where rAAV is produced after induction by the first triggering agent and the second triggering agent.

[0076] FIG. 2 shows titer levels for rAAVs produced from cell lines expressing vl.4 system constructs for AAV5 or AAV9. Viral genome (Vg) production was measured using droplet digital PCR (ddPCR). Viral protein (Vp) capsid levels were measured by ELISA.

[0077] FIG. 3A shows a schematic illustrating the unspliced and spliced transcripts for Cap proteins, VP1, VP2, and VP3 and their corresponding splice sites.MF-367351030 21324632001440

[0078] FIG.3B shows a sequence alignment of the second splice acceptor site (SA2) in the Cap coding sequence across various serotypes and the corresponding splice score for each sequence.

[0079] FIG. 3C shows the sequence alignment of FIG. 3A with the predicted splice score for a C9T mutation in the SA2 site.

[0080] FIG. 4 shows a schematic for an exemplary Cap expression cassette.

[0081] FIG. 5A shows capsid titer levels for rAAVs produced from cell lines expressing AAV9 vl.4 system constructs with modified Cap splice sites. Viral protein (Vp) capsid levels were measured by ELISA.

[0082] FIG.5B shows genome titer levels for rAAVs produced from cell lines expressing AAV9 vl.4 system constructs with modified Cap splice sites. Viral genome (Vg) production was measured using droplet digital PCR (ddPCR).

[0083] FIG. 5C shows packaging efficiency (vg / vp (%)) for rAAVs produced from cell lines expressing AAV9 vl.4 system constructs with modified Cap splice sites.

[0084] FIG. 6A shows viability curves for cell lines expressing AAV9 vl.4 system constructs with modified Cap splice sites.

[0085] FIG.6B shows viability curves for cell lines expressing an L4 construct and AAV9 vl.4 system constructs with modified Cap splice sites.

[0086] FIG. 6C shows capsid titer levels for rAAVs produced from cell lines expressing AAV9 vl.4 system constructs with modified Cap splice sites with and without an L4 construct. Viral protein (Vp) capsid levels were measured by ELISA.

[0087] FIG.6D shows genome titer levels for rAAVs produced from cell lines expressing AAV9 vl.4 system constructs with modified Cap splice sites with and without an L4 construct. Viral genome (Vg) production was measured using droplet digital PCR (ddPCR).

[0088] FIG. 6E shows packaging efficiency (vg / vp (%)) for rAAVs produced from cell lines expressing AAV9 vl.4 system constructs with modified Cap splice sites with and without an L4 construct.

[0089] FIG. 6F shows another representation of titer levels for rAAVs produced from cell lines expressing AAV9 vl.4 system constructs with modified Cap splice sites with and without an L4 construct corresponding to FIG. 6C and FIG. 6D. Viral genome (Vg) production was measured using droplet digital PCR (ddPCR). Viral protein (Vp) capsid levels were measured by ELISA.

[0090] FIG. 6G shows an alternate representation for a subset of the data shown in FIG. 6F.

[0091] FIG. 7A shows an exemplary polynucleotide comprising expression cassettes for AAV Rep and AAV Cap. The polynucleotide illustrated in FIG. 7A differs from Construct 1 of FIG. 1A due to the inclusion of a ribozyme coding sequence flanked by recombination sites downstream of the Rep coding sequence.MF-367351030 22324632001440

[0092] FIG. 7B shows the polynucleotide of FIG. 7A after recombination between the recombination sites resulting in excision of the sequence encoding the ribozyme. After recombination, the polynucleotide of FIG. 7B is similar to Construct 1 of FIG. IB, differing by the inclusion of a single LoxN site that remains after excision of the ribozyme.

[0093] FIG. 8A shows viability curves for cell lines expressing AAV9 vl .4.1 system constructs with modified Cap splice sites.

[0094] FIG. 8B shows viability curves for cell lines expressing an L4 construct and AAV9 vl.4.1 system constructs with modified Cap splice sites.

[0095] FIG.8C shows capsid titer levels for rAAVs produced from cell lines expressing AAV9 vl.4.1 system constructs with modified Cap splice sites with and without an L4 construct. Viral protein (Vp) capsid levels were measured by ELISA.

[0096] FIG.8D shows genome titer levels for rAAVs produced from cell lines expressing AAV9 vl.4.1 system constructs with modified Cap splice sites with and without an L4 construct. Viral genome (Vg) production was measured using droplet digital PCR (ddPCR).

[0097] FIG. 8E shows packaging efficiency (vg / vp (%)) for rAAVs produced from cell lines expressing AAV9 vl.4.1 system constructs with modified Cap splice sites with and without an L4 construct.

[0098] FIG. 9A shows viability curves for cell lines expressing AAV2 vl.4.1 system constructs with modified Cap splice sites with (+L4) or without (-L4) an L4 construct.

[0099] FIG. 9B shows capsid titer levels for rAAVs produced from cell lines expressing AAV2 vl.4.1 system constructs with modified Cap splice sites with and without an L4 construct. Viral protein (Vp) capsid levels were measured by ELISA.

[0100] FIG. 9C shows genome titer levels for rAAVs produced from cell lines expressing AAV2 vl.4.1 system constructs with modified Cap splice sites with and without an L4 construct. Viral genome (Vg) production was measured using droplet digital PCR (ddPCR).

[0101] FIG. 9D shows packaging efficiency (vg / vp (%)) for rAAVs produced from cell lines expressing AAV2 vl.4.1 system constructs with modified Cap splice sites with and without an L4 construct.

[0102] FIG. 10. Plots indicating the percent cell viability of Pl cells (left), Pl cells containing knock-in of an L4 construct (Pl L4; middle), or P2 cells (right) with either 4 or 7 KOs, as compared to control P2 cells (P2 clone A or B), for 7 days following induction of recombinant AAV (rAAV) production.

[0103] FIG. 11. Plots indicating the percent cell viability of engineered P2 cell lines containing 1, 7, or 8 KOs, as compared to control P2 cells (P2 clone A or B) without addition of chemical pan-caspaseMF-367351030 23324632001440inhibitor zV AD. fink (left) or with addition of zVAD.fink (right) following induction of rAAV production.

[0104] FIG. 12A. Plots showing the rAAV titer from different engineered P2 cell lines derived from two clones (A; left or B; right) containing no KOs (WT), 1 KOs, 7 KOs, or 8 KOs with or without addition of chemical pan-caspase inhibitor zVAD.fink 4 or 6 days following induction. rAAV genome titer was measured by ddPCR.

[0105] FIG. 12B. Plots showing levels of human genomic DNA encapsidated in rAAVs, as measured by copies of Alu, from different engineered P2 cell lines derived from two clones (A; left or B; right) containing no KOs (WT), 1 KO, 7 KOs, or 8 KOs with or without addition of chemical pancaspase inhibitor zVAD.fink 4 or 6 days following induction.Alu copy number was measured by ddPCR.

[0106] FIG. 13A. Plots showing percent cell viability (left), total AAV titer (middle), and level of human genomic DNA from producer cells encapsidated in rAAVs (right) in either wild-type (WT) cells or an engineered cell line containing 7 KOs derived from two different clones of P2 cells. rAAV genome titer and Alu copy number were measured by ddPCR.

[0107] FIG. 13B. Plots showing percent cell viability (left), total AAV titer (middle), and level of human genomic DNA from producer cells encapsidated in rAAVs (right) in either wild-type (WT) cells, cells nucleofected with ribonucleic proteins (RNPs) containing a scrambled gRNA, or engineered cell line containing either: (a) a CASP3 single KO, (b) a IFNAR1 single KO, or (c) a BAX BAK1 double KO. rAAV genome titer and Alu copy number were measured by ddPCR.

[0108] FIG. 14A shows viability curves for L4(-) cell lines expressing Variant 1 Chimera v.1.4 and v 1.4.1 Rep / Cap constructs comprising modified Cap splice sites. An exemplary PGRN payload construct was co-transfected with each Rep / Cap construct.

[0109] FIG. 14B shows viability curves for L4(+) cell lines expressing Variant 1 Chimera v.1.4 and v 1.4.1 Rep / Cap constructs comprising modified Cap splice sites. An exemplary PGRN payload construct was co-transfected with each Rep / Cap construct.

[0110] FIG. 14C shows capsid titer levels for rAAVs produced from cell lines expressing Variant 1 Chimera v.1.4 and vl.4.1 Rep / Cap constructs comprising modified Cap splice sites, with and without an L4 construct. Viral protein (Vp) capsid levels were measured by ELISA.[oni] FIG. 14D shows genome titer levels for rAAVs produced from cell lines expressing Variant 1 Chimera v.1.4 and vl .4.1 Rep / Cap constructs with modified Cap splice sites with and without an L4 construct. Viral genome (Vg) production was measured using droplet digital PCR (ddPCR).

[0112] FIG. 14E shows packaging efficiency (vg / vp (%)) for rAAVs produced from cell lines expressing Variant 1 Chimera v.1.4 and vl.4.1 Rep / Cap constructs with modified Cap splice sites with and without an L4 construct.MF-367351030 24324632001440

[0113] FIG. 15A shows capsid titer levels for rAAVs produced from L4(+) cell lines expressing Variant 2 Chimera v.1.4 and vl .4.1 Rep / Cap constructs comprising modified Cap splice sites, v.1.4 and vl.4.1 Rep / Cap constructs encoding a Variant 2 AAV5 capsid (“no chim.”) are shown as controls. Viral protein (Vp) capsid levels were measured by ELISA.

[0114] FIG. 15B shows genome titer levels for rAAVs produced from L4(+) cell lines expressing Variant 2 Chimera v.1.4 and vl .4.1 Rep / Cap constructs with modified Cap splice sites, v.1.4 and vl .4.1 Rep / Cap constructs encoding a Variant 2 AAV5 capsid (“no chim.”) are shown as controls. Viral genome (Vg) production was measured using droplet digital PCR (ddPCR).

[0115] FIG. 16A shows viability curves for cell lines expressing Variant 1 Chimera and Variant 2 Chimera v.1.4 Rep / Cap constructs comprising modified Cap splice sites with and without an L4 construct. An L4(+) cell line expressing a WT AAV5 vl.4 Rep / Cap construct is shown as a control. An exemplary GFP payload construct was co-transfected with each Rep / Cap construct.

[0116] FIG. 16B shows capsid titer levels for rAAVs produced from cell lines expressing Variant 1 Chimera and Variant 2 Chimera v.1.4 Rep / Cap constructs comprising modified Cap splice sites, with and without an L4 construct. An L4(+) cell line expressing a WT AAV5 vl.4 Rep / Cap construct is shown as a control. Viral protein (Vp) capsid levels were measured by ELISA.

[0117] FIG. 16C shows genome titer levels for rAAVs produced from cell lines expressing Variant 1 Chimera and Variant 2 Chimera v.1.4 Rep / Cap constructs with modified Cap splice sites, with and without an L4 construct. An L4(+) cell line expressing a WT AAV5 vl.4 Rep / Cap construct is shown as a control. Viral genome (Vg) production was measured using droplet digital PCR (ddPCR).

[0118] FIG. 16D shows packaging efficiency (vg / vp (%)) for rAAVs produced from cell lines expressing Variant 1 Chimera and Variant 2 Chimera v.1.4 Rep / Cap constructs with modified Cap splice sites, with and without an L4 construct. An L4(+) cell line expressing a WT AAV5 vl.4 Rep / Cap construct is shown as a control.DETAILED DESCRIPTION

[0119] Polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods for improving recombinant adeno-associated virus (rAAV) production are provided. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods include a polynucleotide that includes one or more modified AAV Cap splice sites. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to produce rAAV. Production of AAV using provided systems with one or more modified AAV Cap splice sites may increase production of rAAV over polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods in which the one or more AAV Cap splice sites are not modified.MF-367351030 25324632001440

[0120] The gene therapy industry is an ever-growing therapeutic approach, and AAV is the dominant delivery vehicle. Yet, current approaches to rAAV manufacturing are inefficient. Many existing methods rely on transient expression systems, and in particular on triple transient transfection of a helper plasmid construct, a Rep / Cap construct, and a construct encoding a gene of interest (“payload”). The most widely used method for producing rAAV virions is based on the helper-virus-free transient transfection of multiple plasmids, typically a triple transfection, into adherent cell lines. Often transient transfections result in mixed populations of transfected cells where only some of the cells are actually transfected with all plasmid constructs. The system can result in a heterogenous viral product and / or result in a product that is severely limited due to low yield, high impurity, lack of consistent scalability and reproducibility, and unsustainable production costs. Moreover, these problems can lead to requiring high doses of rAAV for therapeutic applications, which can lead to toxic therapies.

[0121] Although there is ongoing investment to increase production capacity, current AAV manufacturing processes are inefficient and expensive. In addition, they result in variable product quality, with low levels of encapsidation of a payload, such as a therapeutic payload. Therefore, there is a need for new and improved methods to overcome these challenges while balancing the need for robust expression of the AAV proteins required for rAAV production with the toxicity of these proteins to the host production cell.

[0122] The provided embodiments address these problems. The provided embodiments provide a system in which cells are transfected with a modified adenovirus Cap polynucleotide for improved AAV production. Results herein show that the modifications in the splice donor and / or acceptor sites can increase the splice score of the splice donor and / or acceptor sites and boost capsid production. P40 is the natural cap promoter that regulates the Cap gene, and alternatively spliced P40-generated RNAs encode the three Cap proteins, VP1, VP2 and VP3. If there are low levels of splicing of p40-generated products then little capsid proteins would be produced. A boost in expression of a Cap protein expressed from modified Cap splice sites as described, as part of a system with Rep proteins and helper proteins, is useful in increasing packaged virions during the production of recombinant AAV. This can result in increasing both total virions and packaged virions during the production of recombinant AAV.

[0123] In particular, results herein show that there are predicted lower levels of splicing in certain AAV serotypes with the native AAV Cap splice sites. When Rep / Cap constructs were generated with different combinations of sequence variants with a modified Cap splice donor and / or acceptor site there was an improvement in the predicted splice score, as well as a substantial improvement in viral protein (Vp) production, viral genome (Vg) production, and packaging efficiency compared to cells that were transfected with a polynucleotide with a native Cap splice site sequence. In some embodiments, results showed an improvement in titer in methods for producing AAV using a polynucleotide encoding AAV Cap sequences comprising modified splice donor and / or acceptor sites, compared to when using anMF-367351030 26324632001440unmodified Cap splice site sequence, across different serotypes including AAV9. For example, results herein surprisingly found a 700-1000 fold higher genome titer of rAAV9 production in methods in which rAAV9 was generated encoding AAV9 Cap (Cap9) sequences comprising modified splice donor and / or acceptor sites.

[0124] In some embodiments, the systems also use a further polynucleotide, or vector comprising the same, encoding a late stage gene product. In particular embodiments, the late stage gene product is L4. It is found that L4 is an important viral helper factor for efficient capsid mRNA production in a number of AAV serotypes, including AAV9. As a result, integration of this helper factor can enable high-titer production of multiple AAV serotypes. In some embodiments, it is believed that the helper protein may be another mechanism to boost splicing of capsid mRNA, particularly for non-AAV5 serotypes. In such aspects, L4 is a helper protein that is spliced to generate an L4-22K and L4-33K protein that then can act as a splicing factor to activate splicing of mRNAs that contain weak 3 ’ splice sites. Results herein demonstrate substantial improvement in titer when L4 is expressed in AAV production cell lines compared to when it is absent, across different serotypes including AAV9. Further embodiments demonstrate the stable integration of L4 in cell lines that allow for efficient and consistent L4 expression in connection with AAV production systems.

[0125] In provided embodiments as described, the system also allows for stable integration of all genetic elements required for AAV production into host cells. As described, this can be achieved by using cell selections (e.g., antibiotic selection) for stable cell clones from polyclonal pools, allowing generation of a monoclonal cell line for each gene of interest (payload) system that expresses all plasmids for AAV production, such as following single cell seeding, outgrowth and expansion and screening for high expressing clones. Moreover, exquisite control of viral gene expression also is achieved using various inducible systems. This means that toxic elements can be kept fully silenced until peak cell density and fitness. In the uninduced or off state, viral genes that normally can be toxic to host cells, such as E2A and E4 helper proteins, Rep proteins and Cap proteins, are not expressed. However, in the induced state, the viral genes are allowed to be expressed resulting in highly efficient virion production. In provided aspects, the system allows high titer production of as much as 1.5e14vg / L or more including a titer of greater than 2e14vg / L, greater than 3e14vg / L, greater than 4e14vg / L, greater than 5e14vg / L and higher. In provided aspects, the system also allows an increase in filled capsids, withs a packaging efficiency of greater than 15%, greater than 20%, greater than 25%, greater than 30%, greater than 35%, greater than 40%, greater than 50%, greater than 60%, greater than 70% or more, even pre-purification. In some embodiments, such packaging efficiency (e.g., with as much as 70% packaging efficiency) can be achieved while maintaining the high Vg titers. As a result, the provided systems allow for manufacturing processes to produce rAAV more efficiently, in a shorter amount of time, more consistently and with a high robustness of titer and packaging, thereby allowing for decreased dose,MF-367351030 27324632001440decreased cost, lower toxicity / adverse effects, and / or consistent patient dosing. Compared to methods using transient transfection, the systems allow for as much as multiple-fold improvements in manufacturing productivity as determined by increased yield (e.g., titer (vg / mL) from cell lysates), increased quality (e.g., percent packaging efficiency pre-purification), and increased performance (e.g., high-yield payload expression of transduced cells). For example, the increased yield can be greater than 10-fold, greater than 20-fold, greater than 30-fold or more final product per production volume. The improvements can be seen across AAV serotypes, including AAV9, AAV5, AAV2 and other serotypes.

[0126] Before the present polynucleotides, vectors, systems, cells, and methods are described, it is to be understood that this invention is not limited to particular methods or components described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0127] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0128] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein may be used in the practice or testing of the present invention, some potential and preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. It is understood that the present disclosure supersedes any disclosure of an incorporated publication to the extent there is a contradiction.

[0129] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present invention. Any recited method may be carried out in the order of events recited or in any other order which is logically possible.MF-367351030 28324632001440

[0130] It must be noted that as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a cell" includes a plurality of such cells, and reference to "the vector" includes reference to one or more vectors and equivalents thereof, such as viral vectors, plasmids, constructs, and the like, known to those skilled in the art, and so forth.

[0131] It must be noted that as used herein and in the appended claims, references to numerical order — e.g., “first,” “second,” “third,” etc. — may be used for convenience to differentiate between similar components or features. Unless mandated by the text or context, such references to order should not be considered to force order on any such component.

[0132] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.I. DEFINITIONS

[0133] Unless defined otherwise, all terms of art, notations and other technical and scientific terms or terminology used herein are intended to have the same meaning as is commonly understood by one of ordinary skill in the art to which the claimed subject matter pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art

[0134] The term "about", particularly in reference to a given quantity, is meant to encompass deviations of up to plus or minus five percent.

[0135] "AAV" is an abbreviation for adeno-associated virus and may be used to refer to the virus itself or derivatives thereof. The term covers all subtypes and both naturally occurring and recombinant forms, except where required otherwise. The components of the AAV DNA genome consists of two open reading frames, Rep and Cap, flanked by two 145 base inverted terminal repeats (ITRs). Rep gene encodes multiple distinct proteins including Rep78, Rep68, Rep52, and Rep40. These proteins are also referred to herein as Rep proteins or Rep and may encompass one or more of Rep78, Rep68, Rep52, and Rep40 and functional variants thereof and homologs thereof. Rep78 and Rep68 and functional variants thereof and homologs thereof are referred to herein as large Rep. Rep52 and Rep40 and functional variants thereof and homologs thereof are referred to herein as small Rep. Rep proteins from an AAV of a particular serotype may also be referred to as Repl, Rep2, etc. where the Rep protein is derived from anMF-367351030 29324632001440AAV1 or an AAV2 serotype, respectively. Cap gene encodes capsid proteins VP1, VP2, and VP3 required for production of rAAV capsids. These proteins are also referred to herein as Cap proteins or Cap and may encompass one or more of VP1, VP2, and VP3 and functional variants thereof and homologs thereof. The terms “Cap proteins” and “capsid proteins” are used interchangeably in the present disclosure. Cap proteins from an AAV of a particular serotype may also be referred to as Capl, Cap2, Cap4, etc. where the Rep protein is derived from an AAV1, an AAV2, or an AAV5 serotype, respectively. In addition to Rep and Cap, AAV requires a helper plasmid containing genes from a helper virus such as adenovirus, including Ela, Elb, E4, E2a, and VA genes for AAV replication.

[0136] "Recombinant virus" is meant to describe a virus that has been genetically altered, e.g., by the addition or insertion of a heterologous nucleic acid construct into the virus.

[0137] The abbreviation "rAAV" refers to recombinant adeno-associated virus, also referred to as a recombinant AAV vector (or "rAAV vector"). The term “AAV” includes any AAV serotype as well as AAV vectors based on the combination of different serotypes (also referred to as "hybrid AAV vectors" or "pseudotype AAV vectors"). AAV serotype may be AAV type 1 (AAV-1), AAV type 2 (AAV-2), AAV type 3 (AAV-3), AAV type 4 (AAV-4), AAV type 5 (AAV-5), AAV type 6 (AAV-6), AAV type 7 (AAV-7), AAV type 8 (AAV-8), AAV type 9 (AAV-9), AAV type 10 (AAV- 10), AAV type 11 (AAV-11), avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, ovine AAV, AAV-7m8, AAV-6.2, AAV-Dj, AAV-DJ / 8, AAV2 -retro, AAV2-QuadYF and AAV2.7m8, AAV-PHP.B, AAV-PHP.B2, AAV-PHP.B3, AAV-PHP.A, AAV-PHP.eB, AAV-PHP.eS, evolved capsids that are less immunogenic to mice and humans, and variants thereof and combinations thereof. “Primate AAV” refers to AAV isolated from a primate, “non-primate AAV” refers to AAV isolated from a non-primate mammal, “bovine AAV” refers to AAV isolated from a bovine mammal (e.g., a cow), etc. An "rAAV vector" comprises a polynucleotide sequence not of AAV origin (i.e., a polynucleotide heterologous to AAV), typically a polynucleotide sequence of interest for introducing into a target cell. In general, the heterologous polynucleotide is flanked by at least one, and usually by two AAV inverted terminal repeat sequences (ITRs). The heterologous polynucleotide can also be referred to as a polynucleotide payload. The term rAAV vector encompasses both rAAV virions and rAAV vector plasmids.

[0138] An "AAV virus" or "AAV viral particle" or "rAAV vector particle" or “rAAV particle” refers to a viral particle composed of at least one AAV capsid protein (typically by all of the capsid proteins of a wild-type AAV) and an encapsidated polynucleotide rAAV vector. If the particle comprises a heterologous polynucleotide (i.e., a polynucleotide other than a wild-type AAV genome, such as a transgene to be delivered to a mammalian cell), it is typically referred to as an "rAAV vector particle" or simply an "rAAV vector". Thus, production of a rAAV particle necessarily includes production of a rAAV vector, as such a vector contained within an rAAV particle.MF-367351030 30324632001440

[0139] "Packaging" refers to a series of intracellular events that result in the assembly, encapsidation, and production of an AAV particle.

[0140] AAV "rep" and "cap" genes refer to polynucleotide sequences encoding replication and capsid proteins of adeno-associated virus. AAV rep and cap are referred to herein as AAV "packaging genes."

[0141] By "AAV Rep coding region" or “sequence encoding one or more Rep proteins” or “Rep encoding sequence” and grammatical equivalents thereof is meant the art-recognized region of the AAV genome which encodes the replication proteins of the virus which are required to replicate the viral genome and / or a payload flanked by ITRs. The rep coding region, as used herein, may be derived from any viral serotype, such as those described above. The region need not include all of the wild-type genes but may be altered, e.g., by the insertion, deletion or substitution of nucleotides, so long as the rep genes provide for expression Rep proteins. Rep coding sequences are further described below.

[0142] By "AAV cap coding region" or “sequence encoding one or more cap proteins,” or “Cap encoding sequence” and grammatical equivalents thereof it is meant the art-recognized region of the AAV genome which encodes the coat proteins of the virus which are required for the capsid that viral genome or a payload is packaged into by the Rep proteins. For a further description of the cap coding region, see, e.g., Muzyczka, N. (1992) Current Topics in Microbiol, and Immunol. 158, 97-129; Kotin, R. M. (1994) Human Gene Therapy 5, 793-801. The AAV cap coding region, as used herein, may be derived from any AAV serotype, as described above. The region need not include all of the wild-type cap genes but may be altered, e.g., by the insertion, deletion or substitution of nucleotides, so long as the genes provide for sufficient packaging functions. Cap coding sequences are further described below.

[0143] By "adeno-associated virus inverted terminal repeats" or "AAV ITRs" is meant the art-recognized regions found at each end of the AAV genome which function together in cis as origins of DNA replication and as packaging signals for the viral genome. The nucleotide sequences of AAV ITR regions are known. See, e.g., Kotin, R. M. (1994) Human Gene Therapy 5, 793-801; Berns, K. I."Parvoviridae and their Replication" in Fundamental Virology, 2d ed., (B. N. Fields and D. M. Knipe, eds.) for the AAV-2 ITRs sequence. As used herein, an "AAV ITR" need not have a wild-type nucleotide sequence, but may be altered, e.g., by the insertion, deletion or substitution of nucleotides. The AAV ITR may be derived from any of several AAV serotypes, including without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-7, etc. Furthermore, 5' and 3' ITRs which flank a selected nucleotide sequence in an AAV vector need not necessarily be identical or derived from the same AAV serotype or isolate. The ITRs may be single stranded (ssITRs) or self-complementary (scITRs).

[0144] A "helper virus" for AAV refers to a virus that allows AAV (e.g., wild-type AAV) to be replicated and packaged by a mammalian cell. A variety of such helper viruses for AAV are known in the art, including adenoviruses, herpesviruses and poxviruses such as vaccinia. The adenoviruses encompassMF-367351030 31324632001440a number of different subgroups, although Adenovirus type 5 of subgroup C is most commonly used. Numerous adenoviruses of human, non-human mammalian and avian origin are known and available from depositories such as the ATCC. Viruses of the herpes family include, for example, herpes simplex viruses (HSV) and Epstein-Barr viruses (EBV), as well as cytomegaloviruses (CMV) and pseudorabies viruses (PRV); which are also available from depositories such as ATCC.

[0145] "Helper virus fiinction(s)" refers to function(s) encoded in a helper virus genome which allow AAV replication and packaging (in conjunction with other requirements for replication and packaging described herein). As described herein, "helper virus function" may be provided in a number of ways, including by providing helper virus or providing, for example, polynucleotide sequences encoding the requisite function(s) to a producer cell in trans.

[0146] An "infectious" virus or viral particle is one that comprises a polynucleotide component which it is capable of delivering into a cell for which the viral species is tropic. The term does not necessarily imply any replication capacity of the virus. As used herein, an “infectious” virus or viral particle is one that may access a target cell, may infect a target cell, and may express a heterologous nucleic acid in a target cell. Thus, “infectivity” refers to the ability of a viral particle to access a target cell, infect a target cell, and express a heterologous nucleic acid in a target cell. Infectivity may refer to in vitro infectivity or in vivo infectivity. Assays for counting infectious viral particles are described elsewhere in this disclosure and in the art. Viral infectivity may be expressed as the ratio of infectious viral particles to total viral particles. Total viral particles may be expressed as the number of viral genome (vg) copies. The ability of a viral particle to express a heterologous nucleic acid in a cell may be referred to as “transduction.” The ability of a viral particle to express a heterologous nucleic acid in a cell may be assayed using a number of techniques, including assessment of a marker gene, such as a green fluorescent protein (GFP) assay (e.g., where the virus comprises a nucleotide sequence encoding GFP), where GFP is produced in a cell infected with the viral particle and is detected and / or measured; or the measurement of a produced protein, for example by an enzyme-linked immunosorbent assay (ELISA). Viral infectivity may be expressed as the ratio of infectious viral particles to total viral particles. Methods of determining the ratio of infectious viral particle to total viral particle are known in the art. See, e.g., Grainger et al. (2005) Mol. Ther. 1 ES337 (describing a TCID50 infectious titer assay); and Zolotukhin et al. (1999) Gene Ther. 6:973.

[0147] The term "polynucleotide" refers to a polymeric form of nucleotides of any length, including deoxyribonucleotides or ribonucleotides, or analogs thereof. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, and may be interrupted by nonnucleotide components. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The term polynucleotide, as used herein, refers interchangeably to double-and single -stranded molecules. Unless otherwise specified or required, any embodiment of the inventionMF-367351030 32324632001440described herein that is a polynucleotide encompasses both the double-stranded form and each of two complementary single-stranded forms known or predicted to make up the double -stranded form.

[0148] As used herein, the term “polynucleotide construct” refers to a DNA segment of any size that includes one or more sequences encoding an RNA or protein and at least one promoter for driving expression from the one or more sequences. A polynucleotide construct may be a circular DNA or a linear DNA. A polynucleotide construct may be single stranded or double stranded. As used herein, the term "vector" includes any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, artificial chromosome, virus, virion, etc., which is capable of replication when associated with the proper control elements and which may transfer gene sequences into and between cells. Thus, the term includes cloning and expression vehicles, as well as viral vectors. The use of the term "vector" throughout this specification encompasses plasmid or viral vectors, which permit the desired components to be transferred to the host cell via transfection or infection. For example, an adeno-associated viral (AAV) vector is a plasmid comprising a recombinant AAV genome. In some embodiments, useful vectors are contemplated to be those vectors in which the nucleic acid segment to be transcribed is positioned under the transcriptional control of a promoter. A vector may be linear or circular, single stranded or double stranded, DNA or RNA. In certain aspects, the vector may be circular, double stranded DNA.

[0149] As used herein, the term “vector system” refers to two or more vectors that are used together, e.g., by simultaneous or sequential introduction into a cell, to provide at least two different components into the cell. The two different components may then work together in the cell.

[0150] A polynucleotide or polypeptide has a certain percent "sequence identity" to another polynucleotide or polypeptide, meaning that, when aligned, that percentage of bases or amino acids are the same when comparing the two sequences. The term percent “sequence identity,” in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to persons of skill) or by visual inspection. Depending on the application, the percent “sequence identity” can exist over a region of the sequence being compared, e.g., over a functional domain, or, alternatively, exist over the full length of the two sequences to be compared.

[0151] For sequence comparison, typically one sequence acts as a reference sequence (also called the subject sequence) to which test sequences (also called query sequences) are compared. The percent sequence identity is defined as a test sequence’s percent identity to a reference sequence. For example, when stated “Sequence A having a sequence identity of 50% to Sequence B,” Sequence A is the test sequence and Sequence B is the reference sequence. When using a sequence comparison algorithm, test and reference sequences are input into a computer program, subsequence coordinates are designated, ifMF-367351030 33324632001440necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then aligns the sequences to achieve the maximum alignment, based on the designated program parameters, introducing gaps in the alignment if necessary. The percent sequence identity for the test sequence(s) relative to the reference sequence can then be determined from the alignment of the test sequence to the reference sequence. The equation for percent sequence identity from the aligned sequence is as follows:[(Number of Identical Positions) / (Total Number of Positions in the Test Sequence)] x 100%.For purposes herein, percent identity and sequence similarity calculations are performed using the BLAST algorithm for sequence alignment, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (www[dot]ncbi[dot]nlm[dot]mh[dot]gov / ). The BLAST algorithm uses a test sequence (also called a query sequence) and a reference sequence (also called a subject sequence) to search against, or in some cases, a database of multiple reference sequences to search against. The BLAST algorithm performs sequence alignment by finding high-scoring alignment regions between the test and the reference sequences by scoring alignment of short regions of the test sequence (termed “words”) to the reference sequence. The scoring of each alignment is determined by the BLAST algorithm and takes factors into account, such as the number of aligned positions, as well as whether introduction of gaps between the test and the reference sequences would improve the alignment. The alignment scores for nucleic acids can be scored by set match / mismatch scores. For protein sequences, the alignment scores can be scored using a substitution matrix to evaluate the significance of the sequence alignment, for example, the similarity between aligned amino acids based on their evolutionary probability of substitution. For purposes herein, the substitution matrix used is the BLOSUM62 matrix. For purposes herein, the public default values of April 6, 2023 are used when using the BLASTN and BLASTP algorithms. The BLASTN and BLASTP algorithms then output a “Percent Identity” output value and a “Query Coverage” output value. The overall percent sequence identity as used herein can then be calculated from the BLASTN or BLASTP output values as follows:Percent Sequence Identity = (“Percent Identity” output value) x (“Query Coverage” output value).

[0152] For purposes herein, reference to a polynucleotide sequence (e.g., a DNA sequence or an RNA sequence) also encompasses the reverse complement of the polynucleotide sequence.

[0153] A "gene" refers to a polynucleotide containing at least one open reading frame that is capable of encoding a particular protein after being transcribed and translated.

[0154] The term "host cell" denotes, for example, microorganisms, yeast cells, insect cells, and mammalian cells, that may be, or have been, used as recipients of an AAV vector system as described herein, or other transfer DNA. The term includes the progeny of the original cell which has been transfected. Thus, a "host cell" as used herein generally refers to a cell which has been transfected withMF-367351030 34324632001440an exogenous DNA sequence. It is understood that the progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complement to the original parent, due to natural, accidental, or deliberate mutation.

[0155] As used herein, the term "cell line" refers to a population of cells capable of continuous or prolonged growth and division in vitro. Often, cell lines are clonal populations derived from a single progenitor cell. It is further known in the art that spontaneous or induced changes may occur in karyotype during storage or transfer of such clonal populations. Therefore, cells derived from the cell line referred to may not be precisely identical to the ancestral cells or cultures, and the cell line referred to includes such variants.

[0156] The term "cell culture," refers to cells grown adherent or in suspension, bioreactors, roller bottles, hyperstacks, microspheres, macrospheres, flasks and the like, as well as the components of the supernatant or suspension itself, including but not limited to rAAV particles, cells, cell debris, cellular contaminants, colloidal particles, biomolecules, host cell proteins, nucleic acids, and lipids, and flocculants. Large scale approaches, such as bioreactors, including suspension cultures and adherent cells growing attached to microcarriers or macrocarriers in stirred bioreactors, are also encompassed by the term "cell culture." Cell culture procedures for both large and small-scale production of proteins are encompassed by the present disclosure.

[0157] The encapsidation ratio of a population of rAAV virions may be measured as the ratio of rAAV viral particle (VP) to viral genome (VG). The rAAV viral particle includes empty capsids, partially full capsids (e.g., comprising a partial viral genome), and full capsids (e.g., comprising a full viral genome).

[0158] The F:E ratio of a population of rAAV virions may be measured as the ratio of rAAV full capsids to empty capsids. The rAAV full capsid particle includes partially full capsids (e.g., comprising a partial viral genome) and full capsids (e.g., comprising a full viral genome). The empty capsids lack a viral genome.

[0159] The potency or infectivity of a population of rAAV virions may be measured as the percentage of target cells infected by the rAAV virions at a multiplicity of infection (MOI; viral genomes / target cell). Exemplary MOI values are 1 x I01, 1 x 102, 2 x 103, 5 x 104, or 1 x 105vg / target cell. An MOI may be a value chosen from the range of I x 101to I x 105vg / target cell.

[0160] The term “auxotrophic” or “auxotrophic selection marker” as used herein refers to the usage of a medium lacking a supplement, such as a medium lacking an essential nutrient such as the purine precursors hypoxanthine and thymidine (HT), or the like, for selection of a functional enzyme which allows for growth in the medium lacking the essential nutrient, e.g., a functional dihydrofolate reductase or the like.MF-367351030 35324632001440

[0161] The terms “tetracycline” is used generically herein to refer to all antibiotics that are structurally and functionally related to tetracycline, including tetracycline, doxycycline, demeclocycline, minocycline, sarecycline, oxytetracycline, omadacycline, or eravacycline.

[0162] The terms “constitutive” or “constitutive expression” are used interchangeably herein. They refer to genes that are transcribed in an ongoing manner. Such gene are driven by a constitutive promoter. In some embodiments, the terms refer to the expression of a therapeutic payload or a nucleic acid sequence that is not conditioned on addition of an expression triggering agent to the cell culture medium. A constitutive promoter is capable of directing continuous gene expression in a cell. Constitutive promoters regulate expression of basal genes, like housekeeping genes. In contrast, an inducible promoter directs gene expression in the presence of particular transcription activator(s) or absence of a transcription repressor(s). Thus, an inducible promoter can be controlled by controlling the level of the transcription activator(s) or transcription repressor(s).

[0163] As used herein, the term “polynucleotide payload” refers to a polynucleotide sequence that is packaged into a rAAV virion for delivery by the rAAV virion into a cell. A polynucleotide payload is flanked by AAV inverted terminal repeats (ITRs). Upon delivery to a cell, the polynucleotide payload may be available to the cell as a DNA (e.g., a homology region for homology-directed repair), transcribed into an RNA (e.g., a guide RNA (gRNA), a tRNA, a suppressor tRNA, a siRNA, a miRNA, an mRNA, a shRNA, a circular RNA, an antisense oligonucleotide (ASO)), or transcribed and translated into a polypeptide (e.g., an antibody, a hormone, a site-specific endonuclease, a reporter gene, a component of a CRISPR / Cas system, an adenosine deaminase acting on RNA (ADAR) enzyme, a transcriptional activator, a transcriptional repressor, a ribozyme, or a DNAzyme.

[0164] "Recombinant," as applied to a polynucleotide means that the polynucleotide is the product of various combinations of cloning, restriction or ligation steps, and other procedures that result in a construct that is distinct from a polynucleotide found in nature. A recombinant virus is a viral particle comprising a recombinant polynucleotide. The terms respectively include replicates of the original polynucleotide construct and progeny of the original virus construct.

[0165] A "control element" or "control sequence" is a nucleotide sequence involved in an interaction of molecules that contributes to the functional regulation of a polynucleotide, including replication, duplication, transcription, splicing, translation, or degradation of the polynucleotide. The regulation may affect the frequency, speed, or specificity of the process, and may be enhancing or inhibitory in nature. Control elements known in the art include, for example, transcriptional regulatory sequences such as promoters and enhancers. A promoter is a DNA region capable under certain conditions of binding RNA polymerase and initiating transcription of a coding region usually located downstream (in the 3' direction) from the promoter. A promoter is usually upstream of a gene whose expression is controlled by the promoter.MF-367351030 36324632001440

[0166] "Operatively linked" or "operably linked" refers to a juxtaposition of genetic elements, wherein the elements are in a relationship permitting them to operate in the expected manner. For instance, a promoter is operatively linked to a coding region if the promoter helps initiate transcription of the coding sequence. There may be intervening residues between the promoter and coding region so long as this functional relationship is maintained.

[0167] "Heterologous" means derived from a genotypically distinct entity from that of the rest of the entity to which it is being compared. For example, a polynucleotide introduced by genetic engineering techniques into a plasmid or vector derived from a different species is a heterologous polynucleotide. A promoter removed from its native coding sequence and operatively linked to a coding sequence with which it is not naturally found linked is a heterologous promoter. Thus, for example, an rAAV that includes a heterologous nucleic acid encoding a heterologous payload is an rAAV that includes a nucleic acid not normally included in a naturally-occurring, wild-type AAV, and the encoded heterologous payload is a payload not normally encoded by a naturally-occurring, wild-type AAV. As another example, a large Rep coding sequence operatively linked to a heterologous promoter refers to a large Rep coding sequence operatively linked to a non-native promoter.

[0168] A cell is said to be "stably" altered, transduced, genetically modified, or transformed with a genetic sequence if the sequence is available to perform its function during extended culture of the cell in vitro. Generally, such a cell is "heritably" altered (genetically modified) in that a genetic alteration is introduced which is also inheritable by progeny of the altered cell. For example, a gene integrated into the nuclear genome of the cell and is available to perform its function during extended culture of the cell in vitro. A gene integrated into the nuclear genome of the cell is inheritable by progeny of the cell.

[0169] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The terms also encompass an amino acid polymer that has been modified; for example, disulfide bond formation, glycosylation, lipidation, phosphorylation, or conjugation with a labeling component. Polypeptides such as anti -angiogenic polypeptides, neuroprotective polypeptides, and the like, when discussed in the context of delivering a payload to a mammalian subject, and compositions therefor, refer to the respective intact polypeptide, or any fragment or genetically engineered derivative thereof, which retains the desired biochemical function of the intact protein. Similarly, references to nucleic acids encoding anti-angiogenic polypeptides, nucleic acids encoding neuroprotective polypeptides, and other such nucleic acids for use in delivery of a payload to a mammalian subject (which may be referred to as "transgenes" to be delivered to a recipient cell), include polynucleotides encoding the intact polypeptide or any fragment or genetically engineered derivative possessing the desired biochemical function.

[0170] An "isolated" plasmid, nucleic acid, vector, virus, virion, host cell, or other substance refers to a preparation of the substance devoid of at least some of the other components that may also be presentMF-367351030 37324632001440where the substance or a similar substance naturally occurs or is initially prepared from. Thus, for example, an isolated substance may be prepared by using a purification technique to enrich it from a source mixture. Enrichment may be measured on an absolute basis, such as weight per volume of solution, or it may be measured in relation to a second, potentially interfering substance present in the source mixture. Increasing enrichments of the embodiments of this invention are increasingly more isolated. An isolated plasmid, nucleic acid, vector, virus, host cell, or other substance is in some cases purified, e.g., from about 80% to about 90% pure, at least about 90% pure, at least about 95% pure, at least about 98% pure, or at least about 99%, or more, pure.

[0171] The terms "treatment", "treating", "treat" and the like are used herein to generally refer to obtaining a desired pharmacologic and / or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom(s) thereof and / or may be therapeutic in terms of a partial or complete stabilization or cure for a disease and / or adverse effect attributable to the disease. The term “treatment" encompasses any treatment of a disease in a mammal, particularly a human, and includes: (a) preventing the disease and / or symptom(s) from occurring in a subject who may be predisposed to the disease or symptom(s) but has not yet been diagnosed as having it; (b) inhibiting the disease and / or symptom(s), i.e., arresting development of a disease and / or the associated symptoms; or (c) relieving the disease and the associated symptom(s), i.e., causing regression of the disease and / or symptom(s). Those in need of treatment may include those already afflicted (e.g., those with a neurological disorder) as well as those in which prevention is desired (e.g., those with increased susceptibility to a neurological disorder; those suspected of having a neurological disorder; those having one or more risk factors for a neurological disorder, etc.).

[0172] A "therapeutically effective amount" or "efficacious amount" means the amount of a compound that, when administered to a mammal or other subject for treating a disease, is sufficient, in combination with another agent, or alone in one or more doses, to effect such treatment for the disease. The "therapeutically effective amount" will vary depending on the compound, the disease and its severity and the age, weight, etc., of the subject to be treated.

[0173] The terms “individual,” “host,” “subject,” and “patient” are used interchangeably herein, and refer to a mammal, including, but not limited to, human and non-human primates, including simians and humans; mammalian sport animals (e.g., horses, camels, etc.); mammalian farm animals (e.g., sheep, goats, cows, etc.); mammalian pets (dogs, cats, etc.); and rodents (e.g., mice, rats, etc.). In some cases, the individual is a human.

[0174] The terms "hybridize" and "hybridization" refer to the formation of complexes between nucleotide sequences which are sufficiently complementary to form complexes via Watson Crick base pairing.MF-367351030 38324632001440

[0175] The term "homologous region" refers to a region of a nucleic acid with homology to another nucleic acid region. Thus, whether a "homologous region" is present in a nucleic acid molecule is determined with reference to another nucleic acid region in the same or a different molecule. Further, since a nucleic acid is often double-stranded, the term "homologous, region," as used herein, refers to the ability of nucleic acid molecules to hybridize to each other. For example, a single-stranded nucleic acid molecule may have two homologous regions which are capable of hybridizing to each other. Thus, the term "homologous region" includes nucleic acid segments with complementary sequences. Homologous regions may vary in length, but will typically be between 4 and 500 nucleotides (e.g., from about 4 to about 40, from about 40 to about 80, from about 80 to about 120, from about 120 to about 160, from about 160 to about 200, from about 200 to about 240, from about 240 to about 280, from about 280 to about 320, from about 320 to about 360, from about 360 to about 400, from about 400 to about 440, etc.).

[0176] As used herein, the terms "complementary" or "complementarity" refers to polynucleotides that are able to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in an anti-parallel orientation between polynucleotide strands. Complementary polynucleotide strands may base pair in a Watson-Crick manner (e.g., A to T, A to U, C to G), or in any other manner that allows for the formation of duplexes. As persons skilled in the art are aware, when using RNA as opposed to DNA, uracil (U) rather than thymine (T) is the base that is considered to be complementary to adenosine. However, when a uracil is denoted in the context of the present invention, the ability to substitute a thymine is implied, unless otherwise stated. "Complementarity" may exist between two RNA strands, two DNA strands, or between an RNA strand and a DNA strand. It is generally understood that two or more polynucleotides may be "complementary" and able to form a duplex despite having less than perfect or less than 100% complementarity. Two sequences are "perfectly complementary" or "100% complementary" if at least a contiguous portion of each polynucleotide sequence, comprising a region of complementarity, perfectly base pairs with the other polynucleotide without any mismatches or interruptions within such region. Two or more sequences are considered "perfectly complementary" or "100% complementary" even if either or both polynucleotides contain additional non-complementary sequences as long as the contiguous region of complementarity within each polynucleotide is able to perfectly hybridize with the other. "Less than perfect" complementarity refers to situations where less than all of the contiguous nucleotides within such region of complementarity are able to base pair with each other. Determining the percentage of complementarity between two polynucleotide sequences is a matter of ordinary skill in the art.

[0177] As used herein, the term “recombination site” denotes a region of a nucleic acid molecule comprising a binding site or sequence-specific motif recognized by a site-specific recombinase that binds at the target site and catalyzes recombination of specific sequences of DNA at the target site. Sitespecific recombinases catalyze recombination between two such target sites. The relative orientation ofMF-367351030 39324632001440the target sites determines the outcome of recombination. For example, translocation occurs if the recombination sites are on separate DNA molecules. DNA between two recombination sites oriented in the same direction on the same DNA molecule will be excised as a circular loop of DNA. DNA between two recombination sites that are orientated in the opposite direction on the same DNA molecule will be inverted.

[0178] As used herein, the term “enhancer” refers to a non-translated nucleic acid sequence that is contiguous with the coding sequence (in cis) and functions to increase expression of the transcript and / or protein from the coding sequence. Enhancers can include transcriptional enhancers or translational enhancers. Transcriptional enhancers are DNA sequences and influence the rate at which a nearby gene is transcribed into messenger RNA (mRNA) and, ultimately, translated into a functional protein. A translational enhancer is a specific sequence or structural element in messenger RNA (mRNA) that plays a role in regulating the process of translation. Translational enhancers can be involved in modulating the efficiency or specificity of translation.

[0179] The terms "antibody" and “immunoglobulin” include antibodies or immunoglobulins of any isotype, fragments of antibodies which retain specific binding to antigen, including, but not limited to, Fab, Fv, scFv, and Fc fragments, chimeric antibodies, humanized antibodies, single-chain antibodies, including antibodies comprising only heavy chains (e.g. VHH camelid antibodies), bispecific antibodies, and fusion proteins comprising an antigen-binding portion of an antibody and a non-antibody protein.

[0180] The term “ribozyme” refers to catalytically active nucleic acid molecules, including DNA, RNA, and combinations thereof. Ribozymes are capable of catalyzing cleavage, splicing, ligation, and other reactions. Certain ribozymes are trans-acting, such that they catalyze a reaction on the same molecule or cis-acting, such that they catalyze a reaction on a different molecule.II. POLYNUCLEOTIDES AND POLYNUCELOTIDE SYSTEMS

[0181] Various embodiments are directed to one or more polynucleotides, where each polynucleotide comprises a sequence encoding a component for rAAV production. A collection of polynucleotides may be considered a “polynucleotide system,” “a polynucleotide set,” and / or “a set of polynucleotides.”

[0182] Each polynucleotide comprises various components for which more than one of the same type of component (e.g., recombination sites) may be present. In some instances, these components may be referred to as the “first,” “second,” “third,” or “fourth” component and so forth. It is noted that use of the term first, second, third and the like is for purpose of distinguishing the components being referred to. It is understood that reference to such distinguishing terms is non-limiting and does not mean that such a number of components is necessarily present or present in any particular order.MF-367351030 40324632001440A. Polynucleotides for AAV Cap Protein Expression

[0183] Provided here in isa polynucleotide comprising a sequence encoding AAV Cap proteins, e.g., an AAV Cap expression cassette. In some instances, the polynucleotide comprising a sequence encoding AAV Cap proteins is located on a plasmid, vector, or construct by itself. AAV Cap proteins are encoded in a single open reading frame (e.g., a Cap coding sequence) that is alternatively spliced to produce the three capsid proteins, VP1, VP2, and VP3. In some embodiments, a polynucleotide comprises an AAV Cap expression cassette that comprises a Cap open reading frame. In some embodiments, the Cap expression cassette comprises an intron upstream of the Cap open reading frame. In some embodiments, the intron is a 5’ p40 intron. The 5’ p40 intron upstream of the Cap open reading frame includes a splice donor (SD) site and a first splice acceptor (SAI) site while a second splice acceptor site (SA2) is located with the exon for the Cap open reading frame. VP1 is spliced from the first splice acceptor site (SAI) while VP2 and VP3 are spliced from the second splice acceptor site (SA2). Modifications of any one of the splice sites could improve splicing of the capsid proteins, which in turn can improve rAAV titer production.

[0184] In some embodiments, a polynucleotide comprises an adeno-associated virus (AAV) Cap expression cassette that comprises a promoter, a 5’ p40 intron and a Cap open reading frame. In some embodiments, the 5’ p40 intron comprises a splice donor site and a first splice acceptor site. In some embodiments, the Cap open reading frame comprises a second splice acceptor site. In some embodiments, the AAV Cap expression cassette comprises a promoter, a splice donor site, a first splice acceptor site, a second splice acceptor site, and a Cap open reading frame. In some embodiments, one or more of the splice donor site, the first splice acceptor site, and the second splice acceptor site are modified. In some embodiments, splice donor site is modified. In some embodiments, first splice acceptor site is modified. In some embodiments, second splice acceptor site is modified. In some embodiments, splice donor site and the first splice acceptor site are modified. In some embodiments, splice donor site and the second splice acceptor site are modified. In some embodiments, first splice acceptor and the second splice acceptor site are modified. In some embodiments, splice donor site, first splice acceptor and the second splice acceptor site are modified.

[0185] In some embodiments, the splice donor site has a splice prediction score of at least or about 0.5, 0.55, 0.60, 0.65, 0.70, 0.75, 0.80, 0.85, 0.90, 0.95, 0.99. or 1.0; and / or the splice donor site is predicted to be involved in a splice event with a probability of at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%. In some embodiments, the first splice acceptor site has a splice prediction score of at least or about 0.5, 0.55, 0.60, 0.65, 0.70, 0.75, 0.80, 0.85, 0.90, 0.95, 0.99. or 1.0; and / or the splice donor site is predicted to be involved in a splice event with a probability of at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%. In some embodiments, the second splice acceptor site has a splice prediction score of at least or about 0.5, 0.55, 0.60, 0.65, 0.70, 0.75, 0.80, 0.85, 0.90, 0.95, 0.99. or 1.0; and / or the spliceMF-367351030 41324632001440donor site is predicted to be involved in a splice event with a probability of at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%. In some embodiments, the modified splice donor site has a higher splice prediction score than the native splice donor site. In some embodiments, the modified first splice acceptor site has a higher splice prediction score than the native first splice acceptor site. In some embodiments, the modified second splice acceptor site has a higher splice prediction score than the native second splice acceptor site.

[0186] In some embodiments, the splice donor site comprises the nucleotide sequence of any of SEQ ID NOs: 1-3. In some embodiments, the native splice donor site comprises the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the modified splice donor site comprises the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO:3. In some embodiments, the first splice acceptor site comprises the nucleotide sequence of any one of SEQ ID NOs: 4-6 and 340-345. In some embodiments, the native first splice acceptor site comprises the sequence of SEQ ID NO: 4 or SEQ ID NO: 340. In some embodiments, the modified splice acceptor site comprises the sequence of any one of SEQ ID NOs: 5, 6, and 341-345. In some embodiments, the second splice acceptor site comprises the nucleotide sequence of any of one SEQ ID NOs: 7-9 and 346-348. In some embodiments, the native second splice acceptor site comprises the nucleotide sequence of SEQ ID NO: 7 or SEQ ID NO: 346. In some embodiments, the modified second splice acceptor site comprises the nucleotide sequence of any one of SEQ ID NOs: 8, 9, 347, and 348.

[0187] In some embodiments, the splice donor site is a modified splice donor site that comprises the sequence CAGGTANGT (SEQ ID NO: 275), wherein N is an A or a C. In some embodiments, the modified splice donor site comprises the sequence CAGACAGGTANGTAA (SEQ ID NO: 10), wherein N is an A or a C. In some embodiments, the modified splice donor site comprises the sequence CAGACAGGTAAGTAA (SEQ ID NO: 3) or the sequence CAGACAGGTACGTAA (SEQ ID NO: 2). In some embodiments, the modified splice donor site comprises the sequence CAGACAGGTAAGTAA (SEQ ID NO: 3). In some embodiments, the modified second splice acceptor site comprises the sequence CTGCTGATGGTTATCTTCCAG (SEQ ID NO: 8) or the sequence CTGCCGATTCTTATCTTCCAG (SEQ ID NO: 9). In some embodiments, the modified second splice acceptor site comprises the sequence CTGCTGATGGTTATCTTCCAG (SEQ ID NO: 8). In some embodiments, the modified splice donor site comprises the sequence CAGACAGGTANGTAA (SEQ ID NO: 10), wherein N is an A or a C and the modified second splice acceptor site comprises the sequence CTGCTGATGGTTATCTTCCAG (SEQ ID NO: 8) or the sequence CTGCCGATTCTTATCTTCCAG (SEQ ID NO: 9). In some embodiments, the modified splice donor site comprises the sequence CAGACAGGTAAGTAA (SEQ ID NO: 3) and the modified second splice acceptor site comprises the sequence CTGCTGATGGTTATCTTCCAG (SEQ ID NO: 8).MF-367351030 42324632001440

[0188] In some embodiments, transcription of Cap open reading frame is driven by a native AAV Cap promoter. In certain embodiments, the native AAV Cap promoter is a native AAV p40 promoter. In some embodiments, the AAV Cap expression cassette comprises a promoter operably linked to the Cap open reading frame. The promoter can be selected from a native promoter, a heterologous promoter, an inducible promoter, and / or a constitutive promoter. In certain aspects, the promoter may be a native promoter. In certain aspects, the native promoter may be p40.

[0189] In some instances, the polynucleotide comprising a sequence encoding AAV Cap proteins is comprised on a polynucleotide comprising a an AAV Rep open reading frame. In some such embodiments, the Rep open reading frame is 5’ to the Cap open reading frame. In certain embodiments, the Cap open reading frame is operably linked to an endogenous p40 promoter. In certain aspects, the p40 promoter may be present in the Rep open reading frame. In certain aspects, the p40 promoter may be present in the large Rep coding sequence that is common with the small Rep coding sequence. In some embodiments, the Cap coding open reading frame is operably linked to a heterologous promoter.In some embodiments, the Cap open reading frame is operably linked to an inducible promoter. The inducible promoter may be a promoter that is induced in response to exogenous or endogenous signals. For example, an inducible promoter may be induced in response to the production of a particular compound (e.g., protein, carbohydrate, lipid, etc.) within a cell or it may be induced by the addition of a triggering agent or inducer added exogenously, such as tetracycline, doxycycline, etc.

[0190] In some embodiments, the inducible promoter comprises a tetracycline-responsive promoter element (TRE). In some embodiments, the TRE comprises Tet operator (tetO) sequence concatemers fused to a minimal promoter. In some embodiments, the minimal promoter is a human cytomegalovirus promoter. In some embodiments, transcription from the inducible promoter is activated by binding of an activator. Activators are known in the art. In some embodiments, the activator is reverse tetracycline-controlled transactivator (rtTA) comprising a Tet Repressor binding protein (TetR) fused to a VP 16 transactivation domain. In some embodiments, the activator is selected from rtTa variants: rtTA, S2, M2, 2s-Sl, 2s-M2, VI, rtTa3, V10, and V16. See, e.g., Das AT, Tenenbaum L, Berkhout B. Tet-On Systems For Doxycycline-inducible Gene Expression. Curr Gene Ther. 2016; 16(3): 156-67. doi:10.2174 / 1566523216666160524144041.

[0191] In some embodiments, the activator binds the promoter in the presence of a first triggering agent. In some embodiments, the activator is Tet-On3G. In some embodiments, the activator comprises the sequence set forth in SEQ ID NO: 232 or SEQ ID NO: 292. In some embodiments, the inducible promoter is activated in the presence of a first triggering agent. In some embodiments, the first triggering agent is doxycycline or tetracycline. In some embodiments, the first triggering agent is doxycycline. In some embodiments, the inducible promoter comprises the nucleotide sequence of SEQ ID NO: 25, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,MF-367351030 4332463200144098%, or 99% sequence identity of any of the foregoing. In some embodiments the inducible promoter comprises the nucleotide sequence of SEQ ID NO: 25.

[0192] In some embodiments, the Cap expression cassette comprises an intron downstream of the inducible promoter and upstream of the Cap coding sequence. In some embodiments, the intron comprises one or more splice sites for alternative splicing of the Cap open reading frame. In some embodiments, the intron can be a 5’ intron. In some embodiments, the 5’ intron is from the p40 promoter. In some embodiments, the intron comprises the nucleotide sequence of SEQ ID NO: 276, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence thereto.

[0193] The Cap open reading frame can encode Cap proteins from any desired AAV serotype. Such Cap proteins may include one or more of VP1, VP2, and VP3. In some embodiments, the encoded Cap protein is drawn from the same serotype as the Rep protein. In some embodiments, the encoded Cap protein is drawn from a different serotype from the Rep protein. In particular embodiments, the encoded Cap protein includes, but is not limited to, a Cap protein from AAV serotypes AAV-1, AAV -2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10 and AAV-11, or chimeric combinations thereof.

[0194] In some embodiments, the Cap open reading frame encodes one or more AAV capsid proteins. In some aspects, the capsid protein is from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV13, AAV 14, AAV 15 and AAV 16, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16 or AAVhu68 (described in W02020 / 033842, incorporated herein by reference in its entirety). The hu68 capsid is described in PCT Pub. No. WO 2018 / 160582, incorporated herein by reference in its entirety. In some aspects, the capsid is an AAV5 capsid. In some aspects, the capsid is an AAV1 capsid. In some aspects, the capsid is an AAV2 capsid. In some aspects, the capsid is an AAV3 capsid. In some aspects, the capsid is an AAV4 capsid. In some aspects, the capsid is an AAV6 capsid. In some aspects, the capsid is an AAV7 capsid. In some aspects, the capsid is an AAV8 capsid. In some aspects, the capsid is an AAV9 capsid.

[0195] In some aspects, the capsid protein is a derivative, modification, or pseudotype capsid protein fromAAVl, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV 13, AAV 14, AAV 15 and AAV 16, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4,MF-367351030 44324632001440AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16 or AAVhu68.

[0196] In some aspects, the capsid protein is a chimera of capsid proteins from two or more serotypes selected from AAV1, AAV2, rAAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV13, AAV 14, AAV 15 and AAV 16, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, and AAV.HSC16 (described in W02020 / 033842, incorporated herein by reference in its entirety). In certain embodiments, the capsid is an rh32.33 capsid, described in US Pat. No. 8,999,678, incorporated herein by reference in its entirety. In some aspects, the capsid protein is a chimera of capsid proteins from AAV9 and AAV5.

[0197] In some embodiments, the Cap open reading frame encodes one or more engineered and / or chimeric capsid proteins, including, without limitation, those described in PCT Publication No. WO 2026 / 036118, which is hereby incorporated by reference herein in its entirety for all purposes.

[0198] In some embodiments, the Cap open reading frame encodes one or more AAV capsid proteins that are a chimera of capsid proteins from AAV9 and AAV5. In some embodiments, the Cap open reading frame encodes one or more chimeric AAV9 / AAV5 capsid proteins. In some such embodiments, the chimeric AAV9 / AAV5 capsid proteins comprise a first region derived from AAV9 and a second region derived from AAV5. In some embodiments, the first region comprises a VP1 unique region and the second region comprises a VP2 and VP3 region. In some embodiments, the encoded VP1 protein is an AAV9 / AAV5 chimera and the encoded VP2 and VP3 proteins are AAV5.

[0199] In some embodiments, the encoded capsid proteins further comprise one or more amino acid substitutions that confer tropism for a tissue of interest. In some embodiments, the tissue of interest is a central nervous system (CNS) tissue, a muscle tissue, or eye tissue. In some embodiments, the tissue of interest is a central nervous system (CNS) tissue. In some embodiments, the one or more amino acid substitutions are located at residues corresponding to amino acids 568-590 of wildtype AAV5 VP1(SEQ ID NO: 263). In some embodiments, the capsid proteins comprise the amino acid sequence of SEQ ID NO: 504 at residues corresponding to amino acids 568-590 of wildtype AAV5 VP1(SEQ ID NO: 263). In some embodiments, the capsid proteins comprise the amino acid sequence of SEQ ID NO: 505 at residues corresponding to amino acids 568-590 of wildtype AAV5 VP1(SEQ ID NO: 263).

[0200] The nucleotide sequences of the genomes of the AAV serotypes are known. For example, the complete genome of AAV-1 is provided in GenBank Accession No. NC_002077; the complete genome of AAV- 2 is provided in GenBank Accession No. NC_001401 and Srivastava et al., J. Virol, 45: 555-564 (1983); the complete genome of AAV- 3 is provided in GenBank Accession No. NC_1829; theMF-367351030 45324632001440complete genome of AAV-4 is provided in GenBank Accession No. NC_001829; the AAV-5 genome is provided in GenBank Accession No. AF085716; the complete genome of AAV-6 is provided in GenBank Accession No. NC_00 1862; at least portions of AAV-7 and AAV-8 genomes are provided in GenBank Accession Nos. AX753246 and AX753249, respectively (see also U.S. Patent Nos. 7,282,199 and 7,790,449 relating to AAV-8); the AAV-9 genome is provided in Gao et al. Virol, 78: 6381-6388 (2004); the AAV-10 genome is provided in Mol Ther, 13(1): 67-76 (2006); and the AAV-11 genome is provided in Virology, 330(2): 375-383 (2004).

[0201] In some embodiments, the Cap polypeptide is a wildtype Cap polypeptide. In other embodiments, the Cap polypeptide is a synthetic or mutant Cap polypeptide. In many embodiments, the Cap polypeptide is selected from any naturally occurring serotype or variant. Exemplary and nonlimiting, naturally occurring Cap polypeptides can be selected from one or more of SEQ ID NOS: 259-274. The table below (e.g., Table 1) provides a summary of which polypeptide sequences (SEQ ID NOS: 259-274) correlate to which AAV serotypes in the sequence listing arise from which AAV serotype and is not limiting on the scope of the present disclosure:Table 1. Summary of AAV Cap sequences from various serotypes.MF-367351030 46324632001440

[0202] In some embodiments, the Cap proteins encoded by the Cap expression cassette comprise an amino acid sequence having least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to one or more of SEQ ID NOs: 259-274. In some embodiments, the Cap proteins encoded by the Cap expression cassette comprise the amino acid sequence of SEQ ID NO: 267 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the sequence of SEQ ID NO: 267. In some embodiments, the Cap proteins encoded by the Cap expression casette comprise the amino acid sequence of SEQ ID NO: 260 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the sequence of SEQ ID NO: 260.

[0203] In some embodiments, the Cap open reading frame comprises the nucleotide sequence of any of one of SEQ ID NOs: 57-66, 288 and 302, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0204] In some embodiments, the Cap open reading frame encodes capsid proteins from AAV9. In some embodiments, the Cap open reading frame comprises the nucleotide sequence of SEQ ID NO: 66, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof. In some embodiments, the Cap open reading frame has a nucleotide sequence comprising a C9T mutation with reference to SEQ ID NO: 66.

[0205] In some embodiments, the Cap open reading frame encodes capsid proteins from AAV2. In some embodiments, the Cap open reading frame comprises the nucleotide sequence of SEQ ID NO: 58, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof. In some embodiments the Cap open reading frame has a nucleotide sequence comprising a C9T mutation with reference to SEQ ID NO: 58.

[0206] In some embodiments, the Cap open reading frame encodes chimeric AAV9 / AAV5 capsid proteins. In some embodiments, the Cap open reading frame comprises the nucleotide sequence of SEQ ID NO: 440 or SEQ ID NO: 445, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In some embodiments, the Cap open reading frame comprises the nucleotide sequence of SEQ ID NO: 440. In some embodiments, the Cap open reading frame comprises the nucleotide sequence of SEQ ID NO: 445.

[0207] Various embodiments may include one or more of an enhancer and a polyA signal sequence. Such polyA signal sequences can be heterologous to the AAV Cap protein. In some instances, the polyAMF-367351030 47324632001440signal sequence encodes a stronger polyA signal than a native AAV Cap polyadenylation signal sequence and is 3' of the Cap open reading frame. In some embodiments, the polyA signal sequence comprises a SV40 poly signal sequence. Enhancers can include one or more of enhancers described herein, including translational and / or transcriptional enhancers. Such enhancers can be 3’ and / or 5’ of the sequence encoding the AAV Cap proteins, depending on effect or purpose of the enhancer. In some instances, the polynucleotide comprises multiple enhancers, as described herein.

[0208] In certain aspects, the Cap coding sequence may be operably linked to a polyadenylation (polyA) signal sequence. The polyA signal sequence may be a polyA signal sequence functional in the cells used for producing the rAAV. In some instances, the polyA signal sequence may be a bovine Growth Hormone polyA (bGH-PolyA) signal sequence or a SV40 polyA signal sequence.

[0209] The bGH-PolyA signal sequence may include a nucleotide sequence that has at least 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity or 100% sequence identity to nucleotide sequence of SEQ ID NO: 43:

[0210] In certain cases, the SV40 polyA signal sequence may include a nucleotide sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity or 100% sequence identity to SEQ ID NO: 46 or SEQ ID NO: 279.

[0211] In some embodiments, the AAV Cap expression cassette comprises the nucleotide sequence of any one of SEQ ID NOs: 67-69 and 204-209, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In some embodiments, the AAV Cap expression cassette comprises the nucleotide sequence of SEQ ID NO: 68 or SEQ ID NO: 69, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In some embodiments, the AAV Cap expression cassette comprises the nucleotide sequence of any one of SEQ ID NOs 325-327, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In some embodiments, the AAV Cap expression cassette comprises the nucleotide sequence of SEQ ID NO: 326 or SEQ ID NO: 327, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0212] In some embodiments, the AAV Cap expression cassette comprises the nucleotide sequence of any one of SEQ ID NOs: 479-482 and 503, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In some embodiments, the AAV Cap expression cassette comprises the nucleotide sequence of SEQ ID NO: 480 or SEQ ID NO: 482, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.MF-367351030 48324632001440

[0213] In some embodiments, the polynucleotide comprising the AAV Cap expression cassette further comprises an AAV Rep expression cassette, such as any described in section II.B. below. In some such embodiments, the AAV Rep expression cassette is in an opposite orientation relative the AAV Cap expression cassette. In some embodiments, the AAV Rep expression cassette is oriented 3’ to 5’ and the AAV Cap expression cassette is oriented 5’ to 3’, or the AAV Rep expression cassette is oriented 5’ to 3 ’ and the AAV Cap expression cassette is oriented 3 ’ to 5 ’ .

[0214] In some embodiments, the polynucleotide comprising a sequence encoding AAV Cap proteins (e.g. a Cap expression cassette) and the polynucleotide comprising a sequence encoding AAV Rep proteins (e.g., a Rep expression cassette) are the same polynucleotide. For example, a polynucleotide construct comprises the sequence encoding AAV Rep proteins and the sequence encoding AAV Cap proteins. In various instances, the sequence encoding the AAV Rep proteins is 5’ of the sequence encoding the AAV Cap proteins. In some instances, the sequence encoding the AAV Rep proteins is downstream of the sequence encoding the AAV Cap proteins. In some instances, the sequence encoding the AAV Rep proteins and the sequence encoding the AAV Cap proteins are antiparallel to each other (e.g., on different coding strands). In various embodiments, the sequence encoding the AAV Rep proteins and the sequence encoding the AAV Cap proteins are separated by an intervening sequence.

[0215] In some embodiments, the AAV Rep expression cassette is separated from the AAV Cap expression cassette by an intervening sequence. In certain embodiments, the intervening sequence is a transcription blocking element (TBE). In some such embodiments, the promoter of the Cap expression cassette is adjacent to the promoter of the Rep expression cassette. In some embodiments, the TBE blocks cross-promotion of transcription between the promoter of the AAV Rep expression cassette and the promoter of the Cap expression cassette such that the promoter of the AAV Rep expression cassette cannot effect transcription of the Cap coding sequence and the promoter of the AAV Cap expression cassette cannot effect transcription of the Rep coding sequence. In some embodiments, the TBE comprises the sequence of SEQ ID NO: 33 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.B. Polynucleotides for AAV Rep Protein Expression

[0216] In some embodiments, provided herein is a polynucleotide comprising a sequence encoding AAV Rep proteins, e.g., an AAV Rep expression cassette. In some embodiments, the polynucleotide comprises a Rep open reading frame. In some embodiments, the Rep open reading frame comprises a large Rep coding sequence and a small Rep coding sequence. The large Rep coding sequence partially overlaps with the small Rep coding sequence such that the small Rep coding sequence is common within a portion of the large Rep coding sequence. The large Rep coding sequence encodes two large Rep proteins, Rep78 and Rep68. The large Rep coding sequence is transcribed into a precursor mRNA that isMF-367351030 49324632001440alternatively spliced to produce two types of mature mRNA, where one mature mRNA encodes the large Rep protein, Rep78 and the other mature mRNA encodes the large Rep protein, Rep68. The small Rep coding sequence encodes two small Rep proteins, Rep52 and Rep40. The small Rep coding sequence is transcribed into a precursor mRNA that is alternatively spliced to produce two types of mature mRNA, where one mature mRNA encodes the small Rep protein, Rep52 and the other mature mRNA encodes the small Rep protein, Rep40.

[0217] In some embodiments, the polynucleotide comprises an AAV Rep expression cassette. In some embodiments, the AAV Rep expression cassette comprises a promoter and a Rep open reading frame. The Rep open reading frame encodes four nonstructural proteins, Rep 78, Rep 68, Rep52, and Rep 40. Transcription of the sequence encoding the large Rep proteins, Rep 78 and Rep 68, is driven by the native p5 promoter. Alternative splicing generates separate transcripts for Rep78 and Rep 68.Transcription of the sequence encoding the small Rep proteins, Rep 52 and Rep 40, is driven by the native pl9 promoter. Alternative splicing generates separate transcripts for Rep52 and Rep 40.

[0218] In some embodiments, the Rep open reading frame comprises a large Rep coding sequence and a small coding sequence. In some embodiments, the large Rep coding sequence is operably linked to a first promoter. In some embodiments, the large Rep coding sequence comprises a small Rep coding sequence. In some embodiments, the large Rep coding sequence comprises a pl9 promoter upstream of the small Rep coding sequence. In some embodiments, the small Rep coding sequence is operably linked to the p 19 promoter.

[0219] In some embodiments, the large Rep coding sequence encodes one or more large Rep proteins and the small Rep coding sequence encodes one or more small Rep proteins. In some embodiments the Rep open reading frame comprises the coding sequences for Rep78, Rep68, Rep52 and Rep 40. In some such embodiments, the one or more large Rep proteins comprises Rep78 and Rep68 and the one or more small Rep protein comprises Rep52 and Rep40. In some embodiments, the Rep open reading frame does not include the Rep40 coding sequence. In some such embodiments, the one or more large Rep proteins comprises Rep78 and the one or more small Rep protein comprises Rep 52. In some such embodiments, transcripts for Rep68 and Rep40 are not expressed.

[0220] In some embodiments, the AAV Rep expression cassette comprises one or more promoters for driving transcription of the large and small Rep coding sequences encoded in the Rep open reading frame. In some embodiments, transcription of the large and small Rep coding sequences is driven by the native Rep promoters. In some embodiments, the one or more promoters comprise a p5 native AAV promoter and a pl9 native AAV promoter. In various embodiments, the Rep coding sequences are operably linked to an endogenous P5 promoter. In various embodiments, the Rep coding sequences are operably linked to an endogenous P19 promoter. In some embodiments, the one or more promoters comprise heterologous promoters. Heterologous promoters can include constitutive, inducible, and / or anyMF-367351030 50324632001440other type of heterologous promoter. Inducible promoters can be induced in response to exogenous or endogenous signals. For example, an inducible promoter may be induced in response to the production of a particular compound (e.g., protein, carbohydrate, lipid, etc.) within a cell or it may be induced by the addition of a triggering agent or inducer added exogenously, such as tetracycline, doxycycline, etc. In some embodiments, the Rep coding sequences are operably linked to an inducible promoter. In some embodiments, the inducible promoter comprises a tetracycline -inducible promoter, a cumate -inducible promoter, or a cumate -inducible promoter. In some embodiments, the Rep coding sequences are operably linked to a constitutive promoter. In some embodiments, the constitutive promoter is EFl alpha promoter or human cytomegalovirus promoter.

[0221] In some embodiments, the Rep expression cassette comprises a first promoter operably linked to a large Rep coding sequence. In some embodiments, the first promoter is heterologous to the large Rep coding sequence. The large Rep coding sequence includes a small Rep coding sequence. In some embodiments, a promoter is operably linked to the small Rep coding sequence. In some embodiments, the promoter operably linked to the small Rep coding sequence has higher promoter activity as compared to the first promoter. In some embodiments, the large Rep coding sequence includes an intron and a small Rep coding sequence. In some embodiments, the intron includes a second promoter operably linked to the small Rep coding sequence. In some embodiments, the second promoter has higher promoter activity as compared to the first promoter. In some embodiments, the second promoter is heterologous to the small Rep coding sequence and the second promoter has higher promoter activity as compared to the first promoter.

[0222] In certain aspects, the large Rep coding sequence comprises (i) a functional pl9 promoter operably linked to the small Rep coding sequence and (ii) the intron comprising the second promoter. In this aspect, the polynucleotide expresses two small Rep coding transcripts, one expressed under the control of the p 19 promoter and the other expressed under the control of the second promoter. Both transcripts encode the two small Rep proteins, Rep58 and Rep 40 when alternatively spliced. In certain aspects, the intron and hence the second promoter is located downstream of the p 19 promoter and upstream of the transcription start site of the small Rep coding sequence.

[0223] In certain aspects, the intron is a synthetic intron comprising a 5 ’ splice donor site, the second promoter sequence, and a 3’ splice acceptor site, wherein the splice donor and acceptor sites are compatible with a cell used for expressing the Rep proteins. The intron is positioned to allow for generation of mRNAs lacking the intron which can then be translated to produce the large Rep proteins, Rep78 and Rep68. In some embodiments, the intron is positioned to allow for generation of mRNAs lacking the intron which can then be translated to produce only the large Rep protein, Rep78. In some embodiments, the intron is positioned to allow for generation of mRNAs lacking the intron which can then be translated to produce only the large Rep proteins, Rep68.MF-367351030 51324632001440

[0224] In other aspects, the p 19 promoter is mutated to substantially reduce promoter activity. In some embodiments, the TATA box of the p 19 promoter is mutated. In certain aspects, the mutated pl9 promoter results in a reduction of expression of the small Rep to a level that is at least 30% less, at least 40% less, at least 50% less, at least 60% less, at least 70% less, at least 80% less, at least 90% less, or is undetectable as compared to the expression level of the small Rep under the control of the native pl9 promoter. In some aspects, the polynucleotide lacks a functional pl9 promoter.

[0225] In certain aspects, the first promoter operably linked to the large Rep coding sequence is the native p5 promoter and the expression from the large Rep coding sequence is controlled by the p5 promoter.

[0226] In certain aspects, the first promoter operably linked to the large Rep coding sequence is a not a p5 promoter and the polynucleotide includes the native p5 promoter and both the first promoter and the p5 promoter control expression from the large Rep coding sequence. In certain aspects, the first promoter is heterologous to the large Rep coding sequence.

[0227] In certain aspects, the p5 promoter present upstream of the AAV large Rep coding sequence is mutated to substantially reduce promoter activity. In certain aspects, the first promoter operably linked to the large Rep coding sequence is a not a p5 promoter and the polynucleotide includes the mutated p5 promoter and both the first promoter and the p5 promoter control expression from the large Rep coding sequence. In certain aspects, the first promoter is heterologous to the large Rep coding sequence.

[0228] In other aspects, the polynucleotide lacks a functional p5 promoter. In certain aspects, the first promoter operably linked to the large Rep coding sequence is a not a p5 promoter and the polynucleotide includes the first promoter and lacks a p5 promoter for controlling expression from the large Rep coding sequence. In certain aspects, the p5 promoter present upstream of the AAV Rep coding sequence is removed. In certain aspects, the p5 promoter present upstream of the AAV Rep coding sequence is replaced with the first promoter. In certain aspects, the first promoter is heterologous to the large Rep coding sequence.

[0229] In certain aspects, one or both of the first and second promoters for driving the expression of the large Rep proteins and small Rep proteins, respectively, are independently selected from constitutive promoters and / or inducible promoters. In certain aspects, the first promoter and the second promoter may be independently selected from the following promoters: ubiquitin C (UBC) promoter, Rous sarcoma virus long terminal repeat (RSV) promoter, chicken beta actin promoter, cytomegalovirus (CMV) promoter, CMV enhancer / chicken beta actin (CAG) promoter, ribosomal protein LI 3a (RPL13a) promoter, elongation factor 1-alpha (EFla or EFlalpha) promoter, simian virus 40 (SV40) early promoter, phosphoglycerate kinase (PGK) promoter, hypoxanthine-guanine phosphoribosyltransferase (Hprt) promoter, glyceraldehyde-3 -phosphate dehydrogenase (GAPDH) promoter, albumin promoter (ALB), muscle creatine kinase (MSC) promoter, sialophorin promoter (CD43), histone H4 promoter,MF-367351030 52324632001440prostaglandin synthase 2 (PGS2) promoter, activated leukocyte cell adhesion molecule (ALCAM) promoter, fragile X mental retardation 1 (FMRI) promoter, CD68 promoter keratin 14 (K14) promoter, Thyl promoter, pax6 paired box (P2) promoter, elongation factor 2 (EF2) promoter, platelet-derived growth factor beta (PDGF-B) promoter, vascular endothelial growth factor receptor 2 (Flk-1) promoter, glucocorticoid receptor promoter (GRP), Lek promoter, myosin light chain 2 (MLC-2) promoter, chromobox homolog 3 (Cbx3) promoter, Nanog promoter, pancreatic and duodenal homeobox 1 (PDX1) promoter, neuron-specific enolase (NSE) promoter, CCAAT / enhancer binding protein alpha (C / EBPa) promoter, Vavl promoter, Rosa26 promoter, peroxisome proliferator-activated receptor gamma coactivator 1 -alpha (hPGCla) promoter, cytokeratin 19 (Ckl9) promoter, myeloperoxidase (MPO) promoter, fatty acid binding protein 4 (FABP4) promoter, TATA box promoter, endothelial nitric oxide synthase (eNOS) promoter, vivmentin promoter, glial fibrillary acidic protein (GFAP) promoter, calcium / calmodulin-dependent protein kinase II alpha (CaMKIIa) promoter, y-actin promoter, plasminogen activator inhibitor-1 (PAI-1) promoter, and stromal cell-derived factor 1 (SDF-1) promoter.

[0230] In certain aspects, the first promoter and the second promoter may be independently selected from the following promoters: ubiquitin C (UBC) promoter, Rous sarcoma virus long terminal repeat (RSV) promoter, chicken beta actin promoter, cytomegalovirus (CMV) promoter, CMV enhancer / chicken beta actin (CAG) promoter, or a phosphoglycerate kinase (PGK) promoter. In certain aspects, the first promoter is a ubiquitin C (UBC) promoter and the second promoter is a Rous sarcoma virus long terminal repeat (RSV) promoter; (ii) the first promoter is a chicken beta actin promoter and the second promoter is a cytomegalovirus (CMV) promoter; (iii) the first promoter is a CMV enhancer / chicken beta actin (CAG) promoter and the second promoter is a RSV promoter; (iv) the first promoter is a chicken beta actin promoter and the second promoter is a RSV promoter, or (v) the first promoter is a herpes simplex virus (HSV) thymidine kinase (TK) HSVtk promoter and the second promoter is a murine leukemia virus-derived (MND) promoter.In some embodiments, the first promoter is a UBC promoter and the second promoter is a CAG promoter.

[0231] In some embodiments, the first promoter and the second promoter comprise a nucleotide sequence independently selected from any one of SEQ ID NOs: 34-42,338, 339, 355, and 356, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the foregoing. In some embodiments, the first promoter comprises the nucleotide sequence of SEQ ID NO: 34 or SEQ ID NO: 37, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the foregoing. In some embodiments, the second promoter comprises the nucleotide sequence of any one of SEQ ID NOs: 36, 39, 339, and 356 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the foregoing.MF-367351030 53324632001440

[0232] In certain aspects, the polynucleotide includes an excisable element that controls expression of large and small Rep proteins. In some embodiments, the excisable element is positioned in the small Rep coding sequence since the small Rep coding sequence is common with the large Rep coding sequence such that expression of both small and large Rep proteins can be controlled. The excisable element includes a sequence comprising a stop codon which prevents translation of the full-length Rep proteins, resulting in expression of truncated Rep proteins that are non-functional and lack toxicity associated with the full-length Rep proteins. The excisable element includes a first recombination site and a second recombination site flanking the sequence comprising the stop codon. The first recombination site and the second recombination site are oriented in the same direction and recombination between the first and second recombination sites by an inducible recombinase results in excision of the sequence comprising the stop codon allowing expression of full-length large Rep proteins and full-length small Rep proteins. In some embodiments, the excisable element is positioned upstream of the small Rep coding sequence. In some such embodiments, the stop codon in the excisable element results in truncated transcripts for large Rep proteins and transcripts for the small Rep proteins are not expressed. Following the excision of the sequence comprising the stop codon, full length large Rep proteins and small Rep proteins are expressed.

[0233] In certain embodiments, the Rep open reading frame comprises, from 5 ’ to 3 ’ : the large Rep coding sequence, an intron, and the small Rep coding sequence. In some embodiments, the intron comprises a promoter and an excisable element. In some embodiments, the excisable element comprises a coding sequence comprising a stop signaling sequence flanked by recombination sites. In some embodiments, the flanking recombination sites are oriented in the same direction. The stop signaling sequence in the excisable element prevents the expression of transcripts for small Rep proteins and results in truncated transcripts for large Rep proteins.

[0234] In some embodiments, the intron is a synthetic intron comprising from 5 ’ to 3 ’ : (i) a 5 ’ splice donor site, (ii) the promoter, (iii) the excisable element further comprising a first 3 ’ splice acceptor site upstream of the coding sequence comprising a stop signaling sequence, and (iv) a second 3 ’ acceptor site. In some such embodiments, the splice donor site and the first and second splice acceptor sites are compatible with a cell used for expressing Rep proteins. Upon exposure to a recombinase, the first 3’ splice acceptor site and the coding sequence comprising a stop signaling sequence are excised following a recombination event between the recombination sites of the excisable element. In some such embodiments, the promoter located in the intron is operably linked to the small Rep coding sequence. Following excision of the coding sequence comprising a stop signaling sequence, full length large Rep proteins and small Rep proteins are expressed.

[0235] In certain embodiments, the Rep open reading frame comprises from 5 ’ to 3 ’ : the large Rep coding sequence, the p 19 promoter, a first part of the small Rep coding sequence, an intron, and a secondMF-367351030 54324632001440part of the small Rep coding sequence. In some such embodiments, the first part and the second part of the small Rep coding sequence form the small Rep coding sequence. In some embodiments, the small Rep coding sequence is operably linked to the p 19 promoter. In some embodiments, the p 19 promoter is a native pl9 promoter. In some embodiments, the p 19 promoter is a mutant p 19 promoter. In some embodiments, the mutant pl9 promoter has reduced transcriptional activity compared to the native pl9 promoter. In some embodiments, the intron comprises an excisable element comprising a coding sequence comprising a stop signaling sequence flanked by recombination sites. In some embodiments, the flanking recombination sites are oriented in the same direction. The stop signaling sequence in the excisable element results in truncated transcripts for large and small Rep proteins.

[0236] In some embodiments, the intron is synthetic intron comprising, from 5’ to 3’: (i) a 5’ splice donor site, (ii) the excisable element further comprising a first 3’ splice acceptor site upstream of the coding sequence comprising a stop signaling sequence, and (iii) a second 3’ acceptor site. In some such embodiments, the splice donor site and the first and second splice acceptor sites are compatible with a cell used for expressing Rep proteins. Upon exposure to a recombinase, the first 3’ splice acceptor site and the coding sequence comprising a stop signaling sequence are excised following a recombination event between the recombination sites of the excisable element. Following excision of the coding sequence comprising a stop signaling sequence, full length large and small Rep proteins are expressed.

[0237] In certain aspects, the large Rep coding sequence encodes transcripts that include the intron. When expressed in a suitable cell, the intron is excised to generate processed transcripts that can be translated into Rep78 and Rep68. In certain aspects, the large Rep coding sequence also includes the excisable element. When present in a suitable cell that also includes a recombinase (e.g., an inducible recombinase) that recombines the first and second recombination sites, the excisable element is removed and the large Rep coding sequence is transcribed into transcripts that include the intron, which intron is excised to generate processed transcripts that can be translated into Rep78 and Rep68.

[0238] In certain aspects, the open reading frame of sequence encoding the small Rep proteins is present within the large Rep coding sequence and the second promoter drives the expression of transcripts that are translated into Rep52 and Rep40. In certain embodiments, the second promoter is located within an intron.

[0239] In some embodiments, the AAV Rep expression cassette comprises: (i) a first part of the Rep open reading frame, (ii) an excisable element comprising a first recombination site, a coding sequence encoding a stop signaling sequence, a second recombination site, wherein the first and second recombination sites flank the coding sequence encoding a stop signaling sequence and wherein the first recombination site and the second recombination site are oriented in the same direction, and (iii) a second part of the Rep open reading frame.MF-367351030 55324632001440

[0240] In some embodiments, the AAV Rep expression cassette comprises from 5' to 3': a first promoter operably linked to a first sequence comprising a first part of the Rep open reading frame, a 5' splice site, a first part of an intron, a first recombination site, a first 3' splice site, a coding sequence comprising a stop signaling sequence, a second recombination site, a second part of the intron, a second 3' splice site, and a second sequence comprising a second part of the Rep open reading frame. In certain embodiments, the first recombination site, the first 3' splice site, the coding sequence comprising the stop signaling sequence, and the second recombination site form an excisable element. In certain embodiments, the first recombination site and the second recombination site are oriented in the same direction. In certain embodiments, the first promoter is not operably linked to the second sequence comprising the second part of the Rep open reading frame. In certain embodiments, the first and second recombination sites are recombined by the inducible recombinase in the presence of a first triggering agent and a second triggering agent, resulting in excision of the excisable element. In certain embodiments, the first part of the Rep open reading frame and the first part of the intron are joined to the second part of the intron and the second part of the Rep open reading frame to form a complete Rep open reading frame, allowing expression of AAV Rep proteins.

[0241] In the exemplary embodiments, prior to the cell being contacted with the first triggering agent and the second triggering agent, the Rep coding sequence is interrupted by an excisable element. Addition of both the first triggering agent and the second triggering agent are required for excision of the excisable element. In some embodiments, the excisable element is inserted at CAG-G, CAG-A, AAG-G, AAG-A, wherein the dash (-) indicates the point of insertion of the excisable element, in the Rep coding sequence, and the excisable element is inserted downstream of the p 19 promoter. In some embodiments, the excisable element is inserted at CAG-G, CAG-A, AAG-G, AAG-A, wherein the dash (-) indicates the point of insertion of the excisable element, in the Rep coding sequence, and the excisable element is inserted downstream of the p 19 promoter and upstream of the p40 promoter.

[0242] In certain embodiments, the excisable element comprises, from 5’ to 3’, a first spacer segment, a second spacer segment, and a third spacer segment.

[0243] In particular embodiments, the first spacer segment comprises a 5’ splice site (5’SS) 5’ to the first spacer element. In some embodiments, the first spacer segment comprises a nucleic acid sequence having at least 80% identity to SEQ ID NO: 361. In some embodiments, the first spacer segment comprises a nucleic acid sequence having at least 90% identity to SEQ ID NO: 361. In some embodiments, the first spacer segment comprises a nucleic acid sequence having at least 95% identity to SEQ ID NO: 361. In some embodiments, the first spacer segment comprises a nucleic acid sequence having at least 98% identity to SEQ ID NO: 361. In some embodiments, the first spacer segment comprises a nucleic acid sequence having at least 99% identity to SEQ ID NO: 361. In some embodiments, the first spacer segment comprises a nucleic acid sequence of SEQ ID NO: 361.MF-367351030 56324632001440

[0244] In some embodiments, the second spacer segment comprises a polynucleotide encoding a detectable protein marker flanked by lox sites. In certain embodiments, the detectable protein marker is a fluorescent protein. In particular embodiments, the fluorescent protein is a green or blue fluorescent protein (GFP of BFP). In specific embodiments, the GFP is EGFP. In particular embodiments, the fluorescent protein is a blue fluorescent protein (BFP). Screening for the fluorescent marker can be used to confirm integration of the construct into the cell genome and can subsequently be used to confirm excision of the intervening spacer segment. In some embodiments, the second spacer segment further comprises a polyA signal sequence. In certain embodiments, the poly A signal sequence comprises a rabbit beta globin (RBG) polyA signal sequence. In some embodiments, the second spacer segment further comprises a first 3’ splice site (3’SS) between the first lox site and the polynucleotide encoding the protein marker.

[0245] In some embodiments, the second spacer segment comprises a nucleic acid sequence having at least 80% identity to SEQ ID NO: 364. In some embodiments, the second spacer segment comprises a nucleic acid sequence having at least 90% identity to SEQ ID NO: 364. In some embodiments, the second spacer segment comprises a nucleic acid sequence having at least 95% identity to SEQ ID NO: 364. In some embodiments, the second spacer segment comprises a nucleic acid sequence having at least 98% identity to SEQ ID NO: 364. In some embodiments, the second spacer segment comprises a nucleic acid sequence having at least 99% identity to SEQ ID NO: 364. In some embodiments, the second spacer segment comprises a nucleic acid sequence of SEQ ID NO: 364.

[0246] In some embodiments, the third spacer segment further comprises a second 3’ splice site (3’SS). In particular embodiments, the second 3’ splice site is positioned 3’ to the second lox site.

[0247] In some embodiments, the third spacer segment comprises a nucleic acid sequence having at least 80% identity to SEQ ID NO: 363. In some embodiments, the third spacer segment comprises a nucleic acid sequence having at least 90% identity to SEQ ID NO: 363. In some embodiments, the third spacer segment comprises a nucleic acid sequence having at least 95% identity to SEQ ID NO: 363. In some embodiments, the third spacer segment comprises a nucleic acid sequence having at least 98% identity to SEQ ID NO: 363. In some embodiments, the third spacer segment comprises a nucleic acid sequence having at least 99% identity to SEQ ID NO: 363. In some embodiments, the third spacer segment comprises a nucleic acid sequence of SEQ ID NO: 363.

[0248] In certain aspects, the small Rep coding sequence may include a first spacer segment and a second spacer segment flanking the excisable element, wherein the first spacer segment comprises a 5 ’ splice site (5’SS) at the 5’ end of the first spacer segment followed by a first intron and the second spacer segment comprises a second intron followed by a first 3’ end of the second spacer segment, wherein the excisable element comprises from 5’ end to 3’ end: the first recombination site, a second 3’ splice site (3’SS), the stop signaling sequence (e.g., a stop codon), and the second recombination site.MF-367351030 57324632001440

[0249] In certain aspects, the excisable element is flanked by a split intron to prevent read-through from the stop signaling sequence. For example, the polynucleotide construct comprises from 5’ to 3’: one or more native AAV Rep promoters operably linked to a first part of an AAV Rep coding sequence, a 5 ’ splice site (SS), a first part of an intron, a first recombination site, a first 3’ SS, a coding sequence comprising a stop signaling sequence, a second recombination site, a second part of the intron, a second 3’ SS, and a second part of the AAV Rep coding sequence, wherein the first recombination site, the first 3’ splice site, the coding sequence comprising the stop signaling sequence, and the second recombination site form an excisable element, wherein the first recombination site and the second recombination site are oriented in the same direction, and wherein the one or more promoters are not operably linked to the second part of the AAV Rep coding sequence. The first and second recombination sites are recombined by an inducible recombinase resulting in excision of the excisable element which results in a polynucleotide in which the first part of the AAV Rep coding sequence and the first part of the intron are joined to the second part of the intron and the second part of the AAV Rep coding sequence to form a complete AAV Rep coding sequence comprising the intron. Upon transcription, the intron is spliced out by the endogenous cellular machinery to generate a mature mRNA which is translated to produce AAV Rep proteins.

[0250] In certain aspects, the excisable element is flanked by a split intron to prevent read-through from the stop signaling sequence. For example, the polynucleotide construct comprises from 5’ to 3’: one or more native AAV Rep promoters operably linked to a first part of an AAV Rep coding sequence, a 5 ’ splice site (SS), a first part of an intron, a first recombination site, a first 3’ SS, a coding sequence comprising a stop signaling sequence, a second recombination site, a second part of the intron, a second 3’ SS, and a second part of the AAV Rep coding sequence, wherein the first recombination site, the first 3’ splice site, the coding sequence comprising the stop signaling sequence, and the second recombination site form an excisable element, wherein the first recombination site and the second recombination site are oriented in opposite directions, and wherein the one or more promoters are not operably linked to the second part of the AAV Rep coding sequence. The first and second recombination sites are recombined by an inducible recombinase resulting in excision of the excisable element which results in a polynucleotide in which the first part of the AAV Rep coding sequence and the first part of the intron are joined to the second part of the intron and the second part of the AAV Rep coding sequence to form a complete AAV Rep coding sequence comprising the intron. Upon transcription, the intron is spliced out by the endogenous cellular machinery to generate a mature mRNA which is translated to produce AAV Rep proteins: Rep78, Rep68, Rep52, and Rep40. In some embodiments, upon transcription, the intron is spliced out by the endogenous cellular machinery to generate a mature mRNA which is translated to produce only AAV Rep proteins: Rep78 and Rep52.MF-367351030 58324632001440

[0251] In some embodiments, the recombination sites flanking the coding sequence comprising the stop signaling sequence comprise Lox sites. In some embodiments, the recombination sites flanking the coding sequence comprising the stop signaling sequence comprise LoxP, LoxN, Lox2272, or Lox511 sequences. In some embodiments the recombination sites flanking the coding sequence comprising the stop signaling sequence comprise LoxP sequences. In some embodiments, the recombination sites flanking the coding sequence comprising the stop signaling sequence comprise LoxN sequences.

[0252] In some embodiments, the recombinase is a Cre recombinase. In some embodiments, the recombinase is an inducible recombinase. In some embodiments, the inducible recombinase is a Cre recombinase fused to the ligand binding domain of an estrogen receptor. In some embodiments, the inducible recombinase is a Cre-ERT2 fusion protein.

[0253] In some embodiments, the recombination sites flanking the coding sequence comprising the stop signaling sequence comprise flippase recognition target (FRT) sites. In some such embodiments, the recombinase is a flippase (FRP) recombinase. In some embodiments, the recombinase is an inducible recombinase. In some embodiments, the inducible recombinase is a FRP recombinase fused to the ligand binding domain of an estrogen receptor. In some embodiments, the inducible recombinase is a FRP-ERT2 fusion protein.

[0254] In some embodiments, the coding sequence encoding the stop signaling sequence comprised in the excisable element encodes, from 5' to 3', an exon and the stop signaling sequence. In some embodiments, the coding sequence comprises a sequence encoding a protein marker. In certain embodiments, the sequence encoding the protein marker is in-frame with the stop signaling sequence.

[0255] In certain aspects, the excisable element includes a sequence encoding a marker protein (e.g., a detectable marker) in frame with the stop codon such that the marker protein is expressed when the excisable element is present. For example, detectable markers contemplated herein include luminescent markers, fluorescent markers, or radiolabels. Fluorescent markers include, but are not limited to, EGFP, GFP, BFP, RFP, or any combination thereof.

[0256] In some embodiments, the coding sequence comprising a stop signaling sequences is a detectable protein marker. In some embodiments, the detectable protein marker is a luminescent marker, a radiolabel, or a fluorescent marker. In some embodiments, the detectable protein marker is a fluorescent protein. In particular embodiments, the fluorescent protein is a blue fluorescent protein (BFP). In some embodiments, the detectable marker comprises the nucleotide sequence of SEQ ID NO: 30 or SEQ ID NO: 242, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0257] In certain aspects, the 5’ splice site is a rabbit beta globin 5’ splice site. In certain aspects, both of the first and second 3’ splice sites are rabbit beta globin 3’ splice sites. In certain aspects, theMF-367351030 59324632001440vector may include an excisable element as described in US20220145328A1, e.g., paragraphs 10, 30, and 31, which are incorporated herein by reference.

[0258] In some embodiments, the excisable element comprises the nucleotide sequence of SEQ ID NO: 31, 32, or 231, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0259] In some embodiments, a polynucleotide comprising an AAV Rep expression cassette sequence further comprises a sequence encoding a cis -acting ribozyme. In certain instances, the ribozyme catalyzes a reaction on the mRNA encoding the large and / or small Rep proteins to lead to degradation and / or silencing of the large and / or small Rep proteins. Such activity can limit cellular toxicity caused by leaky large and / or small Rep protein expression.

[0260] In some embodiments, the sequence encoding a ribozyme is located downstream (e.g., 3’ of) a sequence encoding the Rep proteins and upstream of (e.g., 5’ of) apolyA signal sequence. In some embodiments, the sequence encoding the ribozyme is located upstream of the small Rep coding sequence. In some embodiments, the sequence encoding the ribozyme is located downstream of the small Rep coding sequence. In some embodiments, the sequence encoding the ribozyme is located downstream of the large Rep coding sequence and the small Rep coding sequence.

[0261] In some embodiments, the ribozyme is a self-cleaving ribozyme — in such embodiments, the ribozyme in the mRNA cleaves itself from the mRNA molecule, thus separating the polyA sequence from the coding sequence. By performing this reaction, the mRNA molecule is no longer functional and subject to degradation, leading to silencing of the encoded protein. In some embodiments, the ribozyme mediates degradation of an RNA encoding the ribozyme. In some instances, the self-cleaving ribozyme is part of a Ribo-off system.

[0262] In some instances, the encoded ribozyme is a Hammerhead ribozyme. In their natural state, Hammerhead ribozymes are class of ribozymes that perform self-cleavage reactions and do not catalyze multiple reactions or turnovers. In certain embodiments the encoded ribozyme is selected from one or more of a Hammerhead ribozyme Type I, a Hammerhead ribozyme Type II, a Hammerhead ribozyme Type III, a Hammerhead ribozyme HH9, a Hammerhead ribozyme HH10, and a RAGATH-1-hammerhead.

[0263] In various embodiments, the ribozyme comprises the nucleotide sequence of SEQ ID NO: 20, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof. In some embodiments, the sequence encoding a ribozyme comprises SEQ ID NO: 20.

[0264] In some embodiments, the sequence encoding a ribozyme is flanked by recombination sites to allow for inducible excision of the sequence encoding a ribozyme. In certain embodiments, the sequence encoding a ribozyme is flanked by recombination sites that are oriented in the same directionMF-367351030 60324632001440and wherein recombination between the recombination sites flanking the sequence encoding a ribozyme by a recombinase, e.g., an inducible recombinase, results in excision of the sequence encoding the ribozyme. In certain instances, the recombination sites flanking the sequence encoding a ribozyme comprise Lox sequences (or Lox sites). Lox sequences are part of a Cre-Lox recombination system that allows for recombination between Lox sites using a Cre recombinase. In various embodiments, a Cre recombinase can be added exogenously. In certain embodiments, a Cre recombinase is expressed within the cell. In certain instances, the Cre recombinase is inducible (e.g., operably linked to an inducible promoter).

[0265] In some embodiments, the AAV Rep expression cassette further comprises an excisable element, downstream of the Rep open reading frame and upstream of the polyA signal sequence, comprising a sequence encoding a ribozyme flanked by recombination sites. In some such embodiments, the ribozyme mediates degradation of an RNA encoding the ribozyme. In some embodiments, the sequence encoding the ribozyme is excised following a recombination event between the recombination sites flanking the sequence encoding the ribozyme

[0266] In some embodiments, the AAV Rep expression cassette comprises, from 5’ to 3’, a promoter, a Rep open reading frame, an excisable element comprising a sequence encoding a ribozyme flanked by recombination sites, and a polyadenylation (polyA) signal sequence. In some embodiments, an mRNA transcript encoding a Rep protein comprises a sequence encoding a ribozyme. In some such embodiments, the ribozyme mediates degradation of the mRNA transcript encoding a Rep protein. In some embodiments, the mRNA transcript encodes Rep 78, Rep 68, Rep 52, or Rep40. Upon exposure to a recombinase, a recombination event between the flanking recombination sites results in the excision of the sequence encoding the ribozyme. Following excision of the sequence encoding the ribozyme, a stable mRNA transcript encoding a Rep protein is produced, thus allowing Rep protein expression.

[0267] In some embodiments, the recombination sites flanking the sequence encoding the ribozyme comprise Lox sites. In some embodiments, the recombination sites flanking the sequence encoding the ribozyme comprise LoxP, LoxN, Lox2272, or Lox511 sequences. In some embodiments the recombination sites flanking the sequence encoding the ribozyme comprise LoxP sequences. In some embodiments, the recombination sites flanking the sequence encoding the ribozyme comprise LoxN sequences.

[0268] In some embodiments, the recombination sites flanking the sequence encoding the ribozyme comprise flippase recognition target (FRT) sites. In some embodiments, the recombination sites flanking the coding sequence comprising the stop signaling sequence comprise flippase recognition target (FRT) sites. In some such embodiments, the recombinase is a flippase (FRP) recombinase. In some embodiments, the recombinase is an inducible recombinase. In some embodiments, the inducibleMF-367351030 61324632001440recombinase is a FRP recombinase fused to the ligand binding domain of an estrogen receptor. In some embodiments, the inducible recombinase is a FRP-ERT2 fusion protein.

[0269] In some embodiments, the recombination sites flanking the sequence encoding the ribozyme and the recombination sites flanking the coding sequence comprising the stop signaling sequence are different. In some embodiments, the recombination sites flanking the sequence encoding the ribozyme comprise LoxP sequences and the recombination sites flanking the coding sequence comprising the stop signaling sequence comprise LoxN sequences. In some embodiments, the recombination sites flanking the sequence encoding the ribozyme comprise LoxN sequences and the recombination sites flanking the coding sequence comprising the stop signaling sequence comprise LoxP sequences.

[0270] In certain aspects, the polynucleotide includes a tag encoding sequence present in frame with the large Rep coding sequence and the small Rep coding sequence such that the large Rep and the small Rep each are expressed as a fusion protein comprising the tag. Any suitable tag may be used. In certain aspects, the tag is a purification tag and / or a detectable tag. In certain aspects, the tag may be a poly-Histidine tag, a Flag tag, a MYC tag, a GST tag, a MBP tag, a strep tag, etc.

[0271] In certain aspects, the polynucleotide is configured to provide for an expression of the large Rep transcripts at a level that is lower than the expression level of the large Rep transcripts from a polynucleotide not having the first promoter. In certain aspects, the polynucleotide is configured to provide for an expression of the large Rep transcripts at a level that is lower than the expression level of the large Rep transcripts from a polynucleotide having a p5 promoter for driving large Rep expression. In certain aspects, the first promoter is weaker than the p5 promoter. In certain aspects, the first promoter is stronger than the p5 promoter but weaker than the second promoter driving expression of the small Rep transcripts. In certain aspects, the polynucleotide is configured to provide for an expression of the large Rep proteins at a level that is lower than the expression level of the large Rep proteins from a polynucleotide not having the first promoter. In certain aspects, the polynucleotide is configured to provide for an expression of the large Rep proteins at a level that is lower than the expression level of the large Rep proteins from a polynucleotide r having a p5 promoter for driving large Rep expression. In certain aspects, the first promoter is weaker than the p5 promoter. In certain aspects, the first promoter is stronger than the p5 promoter but weaker than the second promoter driving expression of the small Rep proteins.

[0272] In certain aspects, the polynucleotide is configured to provide for an expression of the small Rep transcripts at a level that is higher than the expression of the small Rep transcripts from a polynucleotide not having the second promoter. In certain aspects, the polynucleotide is configured to provide for an expression of the small Rep transcripts at a level that is higher than the expression of the small Rep transcripts from a polynucleotide having a pl9 promoter. In certain aspects, the second promoter is stronger than the p 19 promoter. In certain aspects, the second promoter is weaker than theMF-367351030 62324632001440p 19 promoter. In certain aspects, the second promoter is weaker than the p 19 promoter and stronger than the first promoter driving expression of the large Rep transcripts. In certain aspects, the polynucleotide is configured to provide for an expression of the small Rep proteins at a level that is higher than the expression of the small Rep proteins from a polynucleotide not having the second promoter. In certain aspects, the polynucleotide is configured to provide for an expression of the small Rep proteins at a level that is higher than the expression of the small Rep proteins from a polynucleotide having a pl9 promoter. In certain aspects, the second promoter is stronger than the pl9 promoter. In certain aspects, the second promoter is weaker than the p 19 promoter. In certain aspects, the second promoter is weaker than the p 19 promoter and stronger than the first promoter driving expression of the large Rep proteins.

[0273] In certain aspects, the polynucleotide is configured to provide for an expression of the large Rep transcripts at a level that is lower than the expression level of the small Rep transcripts. In certain aspects, the polynucleotide is configured to provide for an expression of the large Rep proteins at a level that is lower than the expression level of the small Rep proteins. In certain aspects, the first promoter is weaker than the second promoter.

[0274] In certain aspects, a ratio of the expression level of the small Rep transcripts to the expression level of the large Rep transcripts using the polynucleotide is higher than the ratio of the small Rep transcripts to large Rep transcripts ratio produced using a polynucleotide that includes a p5 promoter instead of the first promoter for driving large Rep transcripts expression and includes a pl9 promoter instead of the second promoter for driving small Rep transcripts expression. In certain aspects, a ratio of the expression level of the small Rep proteins to the expression level of the large Rep proteins using the polynucleotide is higher than the ratio of the small Rep proteins to large Rep proteins ratio produced using a polynucleotide that includes a p5 promoter instead of the first promoter for driving large Rep proteins expression and includes a pl9 promoter instead of the second promoter for driving small Rep proteins expression.

[0275] In certain aspects, a ratio of the expression level of the small Rep transcripts to the expression level of the large Rep transcripts ranges from 1.5: 1 to 10,000: 1, including 1.5: 1; 1.8:1; 2:1; 2.3:1; 2.5:1; 2.8:1; 3:1; 3.5:1; 4:1; 4.5:1; 5:1; 5.5:1; 6:1; 6.5:1; 7:1; 7.5:1; 8:1; 8.5:1; 9:1; 9.5:1; 10:1; 50: 1; 100: 1; 300:1; 500: 1; 1000: 1; 3000: 1; 5000: 1; or 10,000: 1. In certain aspects, a ratio of the expression level of the small Rep proteins to the expression level of the large Rep proteins ranges from 1.5:1 to 10,000:1, including 1.5:1; 1.8:1; 2:1; 2.3:1; 2.5:1; 2.8:1; 3:1; 3.5:1; 4:1; 4.5:1; 5:1; 5.5:1; 6:1; 6.5:1; 7:1; 7.5:1; 8:1; 8.5:1; 9:1; 9.5:1; 10:1; 50:1; 100:1; 300:1; 500:1; 1000:1; 3000:1; 5000:1; or 10,000:1.

[0276] In many embodiments, the polynucleotide includes an upstream heterologous promoter (e.g., a first promoter) that replaces the native p5 (“P5”) promoter for AAV large Rep. In some embodiments, the native p!9 (“Pl 9”) promoter is mutated to reduce expression of the small Rep (e.g., comprises aMF-367351030 63324632001440TATA box mutation). The open reading frame (ORF) of the large Rep partially overlap with the ORF for the small Rep since large and small Rep genes share the same ORF in the 3 ’-end. In some embodiments, the first (e.g., upstream) half of a Rep coding sequence refers to the portion of the large Rep coding sequence that encodes the large Rep sequences that does not overlap with the small Rep coding sequence. In some embodiments, the second (e.g., downstream) half of a Rep coding sequence refers to the small Rep coding sequence which also includes the ORF that is part of the 3 ’end of the large Rep coding sequence. In some embodiments, an intron is inserted in between the upstream half and downstream half of a Rep coding sequence and upstream of the small Rep coding sequence. However, in certain aspects, the intron may be positioned further downstream within the small Rep coding sequence with respect to the transcription start site for the small Rep, closer to the start site. In certain aspects, the intron may be positioned further upstream with respect to the transcription start site for the small Rep, closer to the p 19 promoter (e.g., within 10 nucleotides (nt), within 25 nt, within 50 nt, within 100 nt, within 250 nt, or within 500 nt). By placing the split intron and excisable element configuration proximally to the native pl9 promoter, or heterologous promoter, minimizes the transcript length, and potentially the associated polypeptide, which may further minimize the likelihood of a functional polypeptide. The intron may include a multiple cloning site to facilitate introduction of the second promoter for driving expression of the small Rep. The second promoter may be heterologous to the small Rep coding sequence. The polynucleotide construct also may include an optional ORF encoding a tag that is in-frame with the large Rep and small Rep ORFs which results in production of tagged large and small Rep proteins. The pl9 (“Pl 9”) promoter may not include any mutations that decrease promoter activity. Additionally, the 5’ splice site and 3 ’splice sites should be in an intron-exon context, such as one or more of: CAG-G, CAG-A, AAG-G, or AAG-A, where the hyphen denotes site of insertion.

[0277] In some embodiments, a polynucleotide for expression of AAV large Rep transcripts and small Rep transcripts and subsequent expression of AAV large Rep proteins and small Rep proteins from these transcripts is provided. In some embodiments, an intron is inserted upstream of the small Rep coding sequence, which is within the coding sequence for large Rep. In some embodiments, the p5 (“P5”) promoter is replaced with a heterologous promoter that is operably connected to the large Rep coding sequence and the TATA box of the p 19 (“Pl 9”) promoter is mutated to decrease promoter activity.

[0278] In some embodiments, a polynucleotide comprises an internal heterologous promoter (e.g., a second promoter) introduced into the intron for driving transcription from the small Rep coding sequence. In some embodiments, the p5 (“P5”) promoter is replaced with a heterologous promoter (e.g., a first promoter) that is operably connected to the large Rep coding sequence and the p 19 (“Pl 9”) promoter is not modified to decrease promoter activity.MF-367351030 64324632001440

[0279] In some embodiments, a polynucleotide for expression of AAV large Rep and small Rep transcripts and subsequent expression of AAV large Rep proteins and small Rep proteins from these transcripts is provided. In some embodiments, an intron is inserted upstream of the small Rep coding sequence and in the coding sequence for large Rep. In some embodiments, a heterologous promoter (e.g., a second promoter) is inserted into the intron and operably connected to the small Rep coding sequence. In some embodiments, the p5 (“P5”) promoter is replaced with a heterologous promoter (e.g., a first promoter) that is operably connected to the large Rep coding sequence and the TATA box of the P19 promoter is mutated to decrease promoter activity.

[0280] Such polynucleotides may produce three types of transcripts. Transcript 1 is produced under the control of the upstream heterologous promoter (e.g., first promoter) and initially includes the intron. Upon splicing out of the intron, large Rep proteins are translated from the processed transcripts.Transcript 2 is produced under the control of the internal heterologous promoter (e.g., second promoter) and is translated into small Rep proteins. Transcript 3 is produced under the control of the p 19 promoter and is similar to Transcript 2.

[0281] In some embodiments, a polynucleotide comprises an excisable element inserted at a position that encodes a sequence common to large and small Rep proteins. The excisable element includes a stop codon flanked by recombination sites. Presence of this excisable element prevents expression of both full-length large Rep proteins and full-length small Rep proteins. In the presence of a recombinase, the recombination sites are joined and the stop codon is removed, allowing for expression of full-length large Rep proteins and full-length small Rep proteins.

[0282] Such polynucleotides are capable of producing three types of transcripts. Transcript 1 is produced under the control of the upstream heterologous promoter (e.g., first promoter) and initially includes the intron and is not translated into large Rep proteins due the presence of the stop codon in the excisable element. Transcript 2 is produced under the control of the internal heterologous promoter (e.g., second promoter) and is not translated into small Rep proteins due the presence of the stop codon in the excisable element. Transcript 3 is produced under the control of the p 19 promoter and initially includes the intron and is not translated due the presence of the stop codon in the excisable element. In some embodiments, the AAV Rep expression cassette further comprises a polyadenylation (poly A) signal sequence downstream of the Rep open reading frame. In some embodiments, the AAV Rep expression cassette further comprises an enhancer downstream of the polyA signal sequence. In some embodiments, the AAV Rep expression cassette comprises a first promoter, the Rep open reading frame, a polyA signal sequence, and an enhancer.

[0283] In certain embodiments, the AAV Rep expression cassette comprises an AAV Rep coding sequence operably linked to native Rep promoters, a PolyA signal sequence, and an enhancer downstream of the PolyA signal sequence. In certain embodiments the AAV Rep expression cassetteMF-367351030 65324632001440comprises an AAV Rep coding sequence operably linked to heterologous promoters, a PolyA signal sequence, and an enhancer downstream of the PolyA signal sequence

[0284] A suitable polyA signal sequence may be a signal sequence that increases the length of polyA added to Rep mRNAs and / or the amount of Rep mRNAs with a long polyA as compared to a coding sequence not including the PolyA signal sequence. In certain cases, the polyA signal sequence may be an AAV Rep polyA signal sequence. In certain cases, the polyA signal sequence may be a native AAV Rep polyA signal sequence. In certain cases, the polyA signal sequence may be a polyA signal sequence that is stronger than AAV Rep polyA signal sequence. A PolyA signal sequence that is stronger than AAV Rep PolyA signal sequence provides for an expression level of the Rep proteins that is higher than the expression level of the Rep proteins using the AAV Rep PolyA signal sequence, e.g., at least 5%, 10%, 20%, 30%, 40%, 50% higher, or more. Polyadenylation (polyA) signal sequences generally include a short sequence that triggers polyadenylation of an mRNA. In certain instances, RNA stability, expression, and / or function can be enhanced with additional sequences surrounding a shorter sequence. Various PolyA signal sequences can be used for the coding sequences of various embodiments. In certain embodiments, a polyA signal sequence that is stronger than AAV Rep polyA signal sequence may be bGH-polyA signal sequence or a SV40 polyA signal sequence as described herein. Additional suitable polyA signal sequences are described below in Section II.G.2.

[0285] In some embodiments, the polyA signal sequence is a native AAV Rep polyA signal sequence. In some embodiments, the polyA signal sequence is a heterologous polyA signal sequence. In some embodiments, the heterologous polyA signal sequence is selected from the group consisting of: a bovine growth hormone (bGH) polyA signal sequence, a human growth hormone (hGH) polyA signal sequence, a Simian Virus 40 (SV40) polyA signal sequence, a Chinese hamster growth hormone polyA signal sequence, a human neurophilin-1 polyA signal sequence, a nopaline synthase polyA signal sequence, an alpha globulin polyA signal sequence, and a rabbit globin polyA signal sequence. In some embodiments, the heterologous polyA signal sequence comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 43-51, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the foregoing. In some embodiments, the heterologous polyA signal sequence is a bGH polyA signal sequence. In some embodiments, the heterologous polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 43, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof.

[0286] A suitable enhancer may be a translational enhancer and / or a transcriptional enhancer. The enhancer increases the expression of the Rep proteins as compared to expression from a polynucleotide lacking the enhancer. In some embodiments, the enhancer comprises one or more sequences selected from the group consisting of SEQ ID NOs: 40, 52-56, and 98-201. In some embodiments, the enhancerMF-367351030 66324632001440comprises one or more of a human telomerase reverse transcriptase (hTERT), a Simian virus 40 (SV40), or a CMV enhancer. In some embodiments, the enhancer comprises the nucleotide sequence of one or more of SEQ ID NOs: 52-54, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the foregoing. In some embodiments, the enhancer is a double enhancer comprising a Simian virus 40 (SV40) and a CMV enhancer. In some embodiments, the double enhancer comprises the nucleotide sequence of SEQ ID NO: 55, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof. In some embodiments, the enhancer is a triple enhancer comprising a telomerase reverse transcriptase (hTERT), a Simian virus 40 (SV40), and a CMV promoter / enhancer. In some embodiments, the enhancer comprises the nucleotide sequence of SEQ ID NO: 56, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof. Additional suitable enhancers are described below in Section. II.G.1

[0287] The Rep sequence can encode Rep proteins from any desired AAV serotype. In some embodiments, the encoded Rep protein is drawn from the same serotype as the Cap protein. In some embodiments, the encoded Rep protein is drawn from a different serotype from the Cap protein. In particular embodiments, the encoded Rep protein includes, but is not limited to, a Rep protein from AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10 ,AAV-11, or chimeric combinations thereof.

[0288] The nucleotide sequences of the genomes of the AAV serotypes are known. For example, the complete genome of AAV-1 is provided in GenBank Accession No. NC_002077; the complete genome of AAV- 2 is provided in GenBank Accession No. NC_001401 and Srivastava et al., J. Virol, 45: 555-564 (1983); the complete genome of AAV- 3 is provided in GenBank Accession No. NC_1829; the complete genome of AAV-4 is provided in GenBank Accession No. NC_001829; the AAV-5 genome is provided in GenBank Accession No. AF085716; the complete genome of AAV-6 is provided in GenBank Accession No. NC_00 1862; at least portions of AAV-7 and AAV-8 genomes are provided in GenBank Accession Nos. AX753246 and AX753249, respectively (see also U.S. Patent Nos. 7,282,199 and 7,790,449 relating to AAV-8); the AAV-9 genome is provided in Gao et al. Virol, 78: 6381-6388 (2004); the AAV-10 genome is provided in Mol Ther, 13(1): 67-76 (2006); and the AAV-11 genome is provided in Virology, 330(2): 375-383 (2004).

[0289] In some embodiments, the Rep polypeptide is a wildtype Rep polypeptide. In other embodiments, the Rep polypeptide is a synthetic or mutant Rep polypeptide. In many embodiments, the Rep polypeptide is selected from any naturally occurring serotype or variant. Exemplary and non-limiting wild type Rep polypeptides include one or more of SEQ ID NOS: 249-258. The table below (e.g., TableMF-367351030 673246320014402) provides a summary of which polypeptide sequences (SEQ ID NOS: 249-258) in the sequence listing arise from which AAV serotype and is not limiting on the scope of the present disclosure:

[0290] In particular embodiments, the encoded Rep proteins, are large and small Rep proteins from AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10 and AAV-11, or chimeric combinations thereof. In particular embodiments, the encoded Rep proteins are large Rep proteins and small Rep proteins from AAV serotype 2.

[0291] In some embodiments, the Rep proteins encoded by the Rep expression cassette comprise an amino acid sequence having least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to one or more of SEQ ID NOs: 249-258. In some embodiments, the Rep proteins comprise the amino acid sequence of SEQ ID NO: 250, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the sequence of SEQ ID NO: 250. In some embodiments, the Rep proteins comprise the amino acid sequence of SEQ ID NO: 250.

[0292] In some embodiments, the Rep open reading frame is from AAV2. In some embodiments, the large Rep coding sequence comprises a Rep78 and / or Rep 68 coding sequence comprising the nucleotide sequence of SEQ ID NO: 70 or SEQ ID NO:71, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In some embodiments, the small Rep coding sequence comprises a Rep52 coding sequence comprising the nucleotide sequence of SEQ ID NO: 72, or a nucleotide sequence that has atMF-367351030 68324632001440least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the first part of the small Rep coding sequence comprises the nucleotide sequence of SEQ ID NO: 73 and the second part of the small Rep coding sequence comprises the nucleotide sequence of SEQ ID NO: 74. In some embodiments, the small Rep coding sequence further comprises a Rep40 coding sequence comprising the nucleotide sequence of SEQ ID NO 75, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto

[0293] In some embodiments, the AAV Rep expression cassette comprises the nucleotide sequence of any one of SEQ ID NOs: 76, 77, 82, 308, 309, and 334, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In some embodiments, the Rep expression cassette comprises the nucleotide sequence of SEQ ID NO: 309. In some embodiments, the Rep expression cassette comprises the nucleotide sequence of SEQ ID NO: 76. In some embodiments, the Rep expression cassette comprises the nucleotide sequence of any one of SEQ ID NOs: 77, 82, 308, and 334.

[0294] In some embodiments, the AAV Rep expression cassette comprises a WT pl9 promoter and comprises the nucleotide sequence of any one of SEQ ID NOs: 456-458, 463, and 468, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0295] In certain aspects, the polynucleotide comprising an AAV Cap and / or AAV Rep expression cassette also includes a coding sequence for a selectable marker, e.g. a selection cassette. The coding sequence for the selectable marker may be operatively linked to a constitutive promoter. In some embodiments, the selectable marker is a mammalian cell selection element. In some embodiments, the selectable marker is an auxotrophic selection element. In some embodiments, the auxotrophic selection element codes for an active protein. In some embodiments, the active protein is glutamine synthetase (GS), thymidylate synthase (TYMS), phenylalanine hydroxylase (PAH), or dihydrofolate reductase (DHFR).

[0296] In some embodiments, the polynucleotide comprising an AAV Cap and / or AAV Rep expression cassette further comprises a selection cassette. In some embodiments, the selection cassette comprises, from 5’ to 3’, a constitutive promoter operably linked to a nucleotide sequence encoding a selectable marker. In some embodiments, the selection cassette is located downstream of the AAV Cap expression cassette. In some embodiments, the selection cassette is in the same orientation as the AAV Cap expression cassette. In some embodiments, the selection cassette is located downstream of the AAV Rep expression cassette. In some embodiments, the selection cassette is in the same orientation as the AAV Rep expression cassette.MF-367351030 69324632001440

[0297] In some embodiments, the constitutive promoter is an EFla promoter. In some embodiments, the EFla promoter has a TATA box mutation. A TATA box mutation reduces the activity of the EFla promoter resulting in decreased expression of the selectable marker. This promoter is useful for increasing copy number of the polynucleotide when present in a cell that is cultured under a selection pressure (e.g., antibiotic and for preventing cellular toxicity due to leaky Rep protein expression). In some embodiments, the constitutive promoter comprises the nucleotide sequence of SEQ ID NO: 438, SEQ ID NO: 78 or SEQ ID NO: 79, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 438, SEQ ID NO: 78 or SEQ ID NO: 79

[0298] In some embodiments, the selectable marker is an antibiotic resistance gene. In some embodiments, the antibiotic resistance gene is selected from the group consisting of: a blasticidin resistance gene, a hygromycin resistance gene, a puromycin resistance gene, and an ampicillin resistance gene. In some embodiments, the resistance gene is a blasticidin resistance gene. In some embodiments, the selectable marker is a split selectable marker comprising: a) a first part of a resistance gene linked to an N-intein, or b) a C-intein linked to a second part of a resistance gene. In some embodiments, the selectable marker is a split selectable marker comprising: a) a first part of a blasticidin resistance gene linked to an N-intein, or b) a C-intein linked to a second part of a blasticidin resistance gene.

[0299] In some embodiments, the selectable marker comprises the nucleotide sequence of SEQ ID NO: 80 or SEQ ID NO: 84, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 80 or SEQ ID NO: 84.

[0300] In some embodiments, the selection cassette comprises a 3 ’ UTR downstream of the selectable marker. In some embodiments, the 3’ UTR comprises the nucleotide sequence of SEQ ID NO: 307, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 307.

[0301] In some embodiments, the selection cassette comprises a polyA sequence downstream of the selectable marker. In some embodiments, the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 336, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 336.

[0302] In some embodiments, the selection cassette comprises the nucleotide sequence of SEQ ID NO: 81, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 81.

[0303] In some embodiments, the polynucleotide comprises: i) an AAV Cap expression cassette comprising the nucleotide sequence of any one of SEQ ID NOs: 68, 69, 326 and 327, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%MF-367351030 70324632001440sequence identity to any of the foregoing, ii) an AAV Rep expression cassette, and iii) a selection cassette.

[0304] In some embodiments, the polynucleotide is a Rep / Cap construct and comprises the nucleotide sequence of any of SEQ ID NOs: 13, 18, 22, 24, 329 and 330, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In some embodiments, the polynucleotide comprises the nucleotide sequence of any of SEQ ID NOs: 13, 18, 22, 24, 329, or 330. In some embodiments, the Rep / Cap construct is encoded in a plasmid comprising the sequence of any one of SEQ ID NOs: 87, 92, 95, 97, 332, and 333, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0305] In some embodiments, the Rep / Cap construct comprises a WT pl9 promoter in the Rep expression cassette and comprises the nucleotide sequence of any of SEQ ID NOs: 452-455 and 464-465, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In some embodiments, the Rep / Cap construct is encoded in a plasmid comprising the sequence of any one of SEQ ID NOs: 459-462 and 466-467, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0306] In some embodiments, the polynucleotide is a Rep / Cap construct and comprises the nucleotide sequence of any of SEQ ID NOs: 441-444 and 446-451, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In some embodiments, the Rep / Cap construct is encoded in a plasmid comprising the sequence of any one of SEQ ID NOs: 483-492, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0307] In some embodiments, the Rep / Cap construct comprises a WT pl9 promoter in the Rep expression cassette and comprises the nucleotide sequence of any of SEQ ID NOs: 469-478, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In some embodiments, the Rep / Cap construct is encoded in a plasmid comprising the sequence of any one of SEQ ID NOs: 493-502 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0308] In some embodiments, the polynucleotide is a Rep / Cap construct and comprises the nucleotide sequence of any of SEQ ID NOs: 443, 444, 448, and 449, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In some embodiments, the Rep / Cap construct is encoded in a plasmid comprisingMF-367351030 71324632001440the sequence of any one of SEQ ID NOs: 485, 486, 489, and 490, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0309] In some embodiments, the Rep / Cap construct comprises a WT pl9 promoter in the Rep expression cassette and comprises the nucleotide sequence of any of SEQ ID NOs: 471, 472, 475, and 476, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In some embodiments, the Rep / Cap construct is encoded in a plasmid comprising the sequence of any one of SEQ ID NOs: 495, 496, 499 and 500, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0310] The polynucleotide described herein may be used in a vector. The vector comprising the polynucleotide may be used in conjunction with one or more additional vectors for producing rAAV. Such vector systems are provided in Section IV.C. Polynucleotides for AAV Helper Protein Expression

[0311] Provided herein, in some embodiments, is a polynucleotide comprising a sequence encoding one or more AAV helper proteins. In some embodiments, the polynucleotide comprises an AAV helper expression cassette comprising a sequence encoding one or more helper proteins operably linked to a promoter. In some embodiments, the AAV helper expression cassette is a first expression cassette, wherein the first expression cassette comprises a nucleotide sequence encoding one or more AAV helper proteins.

[0312] In some embodiments, the polynucleotide, in some instances referred to as a second polynucleotide, further comprises a second expression cassette, e.g., an activator expression cassette, comprising a second constitutive promoter operably linked to a nucleotide sequence encoding an activator. In some embodiments, the polynucleotide further comprises a third expression cassette, e.g., a VA-RNA expression cassette, comprising a first part of a third constitutive promoter, a third excisable element, a second part of a third constitutive promoter and a sequence encoding VA RNA.

[0313] In some embodiments, the first expression cassette further comprises an inducible promoter. In some embodiments, the first expression cassette comprises, from 5’ to 3’: a) an inducible promoter, b) a self-excising element that comprises a sequence encoding a recombinase that is flanked by a fifth recombination site and a sixth recombination site, and c) a nucleotide sequence encoding one or more helper proteins, wherein the recombinase is operably linked to the inducible promoter.

[0314] In some embodiments, the inducible promoter of the polynucleotide comprising a sequence encoding one or more AAV helper proteins is the same as the inducible promoter of the polynucleotide comprising a sequence encoding AAV Cap proteins. In some embodiments, the inducible promoter of theMF-367351030 72324632001440helper expression cassete is the same as the inducible promoter of the AAV Cap expression cassete. In some embodiments, the inducible promoter that is operably linked to the recombinase is the same as the inducible promoter that is operably linked to the Cap open reading frame.

[0315] In some embodiments, transcription from the inducible promoter is activated by the binding of an activator. In some embodiments, the activator activates transcription from the inducible promoter operably linked to the recombinase and the inducible promoter operably linked to the Cap open reading frame. In some embodiments, the activator binds the inducible promoter in the presence of a first triggering agent. In some embodiments, the activator is Tet-On3G. In some embodiments, the inducible promoter is activated in the presence of a first triggering agent. In some embodiments, the first triggering agent is doxycycline or tetracycline.

[0316] In some embodiments, the recombinase is an inducible recombinase. In some embodiments, the inducible recombinase is a Cre recombinase fused to an estrogen receptor ligand binding domain. In some embodiments, the inducible recombinase is a Cre-ERT2 fusion protein. In some embodiments, the inducible recombinase translocates to the nucleus in the presence of a second triggering agent. In some embodiments, the second triggering agent is tamoxifen.

[0317] In some embodiments, in the off state, such as depicted in Construct 2 FIG. 1A, the selfexcising element, comprising the sequence encoding the recombinase (e.g., a Cre recombinase), of the first expression cassete prevents operable linkage of the inducible promoter to the sequence encoding the one or more AAV helper proteins. In the on state, such as depicted in Construct 2 FIG. IB, in the presence of a first triggering agent, e.g., doxycycline, expression of the recombinase is activated by binding of the first triggering agent to an activator. In the presence of a second triggering agent, e.g., tamoxifen, the inducible recombinase translocates to the nuclues and the self-excising element is excised by the recombinase, thereby resulting in operable linkage of the inducible promoter to the one or more AAV helper proteins and allowing the expression of the one or more AAV helper proteins. Self-excision of the sequence encoding the Cre recombinase limits the duration of Cre expression in the cells thus limiting Cre related toxicity and promiscuous recombination events. In some embodiments, the activator, such as TetON3G, is expressed from a second expression cassete and can only bind to an inducible promoter, e.g.,atet-inducible promoter, in the presence of a triggering agent, such as doxycycline. In some embodiments, such as depicted in Construct 2 of FIG. IB, when expression of the recombinase is activated, e.g., in the presence of a first triggering agent, and the inducible recombinase translocates to the nucleus, e.g., in the presence of a second triggering agent, the third excisable element is excised, thereby reconstituting the constitutive promoter by operably linking the first part with the second part of the constitutive promoter, which results in expression of the VA RNA.

[0318] In certain embodiments, this helper construct comprises: an inducible promoter operably linked to a self-excising element; the self-excising element comprising a third recombination site and aMF-367351030 73324632001440fourth recombination site flanking a sequence encoding an inducible recombinase; a constitutive promoter operably linked to a sequence encoding an activator. In some embodiments, the third recombination site and the fourth recombination site are oriented in the same direction. In some embodiments, the second inducible promoter is not operably linked to the sequence encoding the one or more adenoviral helper proteins. In some embodiments, the polynucleotide comprising a sequence encoding adenovirus helper proteins constitutively expresses the activator and the activator is unable to activate the first inducible promoter or the second inducible promoter in absence of a first triggering agent. In some embodiments, in absence of activation of the first inducible promoter and the second inducible promoter, detectable levels of the Rep proteins from the polynucleotide comprising a sequence encoding AAV Rep proteins or if present the Cap proteins, the Cap proteins from the polynucleotide comprising a sequence encoding AAV Cap proteins, the inducible recombinase, and the one or more adenoviral helper proteins are not expressed, and wherein the inducible recombinase is activated in the presence of a second triggering agent. In some embodiments, a polynucleotide comprising a sequence encoding adenovirus helper proteins is comprised within a construct, where the construct further comprises a polynucleotide comprising a sequence encoding VA-RNA as described herein.

[0319] In some embodiments, the polynucleotide comprising the sequence encoding one or more adenoviral helper proteins comprises: (i) a first sequence comprising from 5' to 3': a second inducible promoter operably linked to a sequence encoding a recombinase, e.g., an inducible recombinase; a selfexcising element comprising a fifth recombination site, the sequence encoding the recombinase, and a sixth recombination site; and a sequence encoding one or more adenoviral helper proteins, wherein the second inducible promoter is not operably linked to the sequence encoding the one or more adenoviral helper proteins; (ii) a second sequence comprising a first constitutive promoter operably linked to a sequence encoding an activator. In some embodiments, the third recombination site and the fourth recombination site are oriented in the same direction. In some embodiments, the cell constitutively expresses the activator, and the activator is unable to activate the second inducible promoter in absence of a first triggering agent. In some embodiments, in the presence of the first triggering agent, the activator activates the second inducible promoter resulting in expression of the inducible recombinase, and the inducible recombinase is expressed. In some embodiments, in the presence of a second triggering agent, the inducible recombinase translocates to a nucleus of the cell and causes recombination between the third recombination site and the fourth recombination site resulting in excision of the self-excising element, thereby operably linking the second inducible promoter to the sequence encoding the one or more adenoviral helper proteins and allowing expression of the one or more adenoviral helper proteins.

[0320] In some embodiments, the one or more adenoviral helper proteins comprise one or more of adenovirus E1A protein, E1B protein, E2A protein, and E4 protein. In certain embodiments, the one or more adenoviral helper proteins comprises E2A protein and E4 protein.MF-367351030 74324632001440

[0321] In some embodiments, the polynucleotide comprising the sequence encoding one or more AAV helper proteins comprises a bicistronic open reading frame encoding two AAV helper proteins. In some embodiments, the sequence encoding one or more helper proteins comprises the nucleotide sequence of SEQ ID NO: 287.

[0322] In some embodiments, the one or more adenoviral helper proteins are separated by a bicistronic open reading frame. In certain embodiments, the bicistronic open reading frame comprises an internal ribosome entry site (IRES) or a peptide 2A (P2A) sequence. In some embodiments, the sequence encoding the one or more AAV helper proteins is a bistronic open reading frame encoding at least two AAV helper proteins. In some embodiments, the one or more helper proteins comprise E2A and E4. In some embodiments, the E2A protein is encoded by a nucleotide sequence comprising SEQ ID NO: 226 and SEQ ID NO: 227, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the E2A protein is encoded by a nucleotide sequence comprising SEQ ID NO: 226 and SEQ ID NO: 227. In some embodiments, the E4 protein is encoded by a nucleotide sequence comprising SEQ ID NO: 228, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the E4 protein is encoded by a nucleotide sequence comprising SEQ ID NO: 228.

[0323] In some embodiments, the sequence coding for E2A and the sequence coding for E4 are separated by an internal ribosome entry site (IRES) or by a cleavable linker. In some embodiments, the sequence coding for E2A and the sequence coding for E4 are separated by an IRES. In some embodiments, the IRES comprises that nucleotide sequence of SEQ ID NO: 229, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the IRES comprises that nucleotide sequence of SEQ ID NO: 229.

[0324] In some embodiments, the sequence coding for E2A and the sequence coding for E4 are separated by a cleavable linker. In some embodiments, the cleavable linker is a 2A peptide, optionally wherein the 2A peptide is P2A, T2A, F2A, or E2A. In some embodiments, the 2A peptide is P2A, T2A, F2A, or E2A.

[0325] In some embodiments, the second inducible promoter operably linked to the self-excising element in the polynucleotide is a tetracycline-inducible promoter, an ecdysone-inducible promoter, or a cumate-inducible promoter.

[0326] In some embodiments, the first inducible promoter and the second inducible promoter are the same. In some embodiments, the first inducible promoter and the second inducible promoter are a tetracycline -inducible promoter. In some embodiments, the inducible promoter of the second polynucleotide is the same as the inducible promoter of the first polynucleotide.MF-367351030 75324632001440

[0327] In certain embodiments, the inducible promoter comprises a tetracycline-responsive promoter element (TRE). In certain embodiments, the TRE comprises Tet operator (tetO) sequence concatemers fused to a minimal promoter. In some embodiments, the tetO sequence concatamers comprises the sequence of SEQ ID NO: 27. In certain embodiments, the minimal promoter is a human cytomegalovirus promoter. In some embodiments, the minimal promoter comprises the nucleotide sequence of SEQ ID NO: 28.

[0328] In some embodiments, the inducible promoter comprises the nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the inducible promoter comprises the nucleotide sequence of SEQ ID NO: 25.

[0329] In some embodiments, the first constitutive promoter is EFl alpha promoter or human cytomegalovirus promoter.

[0330] In some embodiments, the activator is reverse tetracycline -controlled transactivator (rTA) comprising a Tet Repressor binding protein (TetR) fused to a VP 16 transactivation domain.

[0331] In some embodiments, the inducible promoter is activated in the presence of a triggering agent, e.g., a first triggering agent. For instance, as shown in FIG. 1A, in the absence of a triggering agent, the inducible promoter is not activated, thereby resulting in a lack of expression of helper proteins E2A and E4 from Construct 2, whereas in the presence of a triggering agent, e.g., doxycycline, there is activation of the inducible promoter, thereby resulting in expression of helper proteins E2A and E4 from Construct 2, as shown in FIG. IB. In some embodiments, a triggering agent, e.g., first triggering agent, for inducing the inducible promoter, e.g., the tetracycline -inducible promoter, is tetracycline. In other embodiments, a triggering agent, e.g., a first triggering agent, for inducing the inducible promoter, e.g., the tetracycline -inducible promoter, is doxycycline. Accordingly, in some embodiments, the triggering agent is doxycycline. In some embodiments, the first triggering agent is doxycycline.

[0332] In some embodiments, the inducible recombinase is fused to an estrogen response element (ER) and translocates to the nucleus in the presence of a second triggering agent, such as tamoxifen. As used herein, an estrogen response element can refer to an estrogen receptor.

[0333] In some embodiments, the sequence encoding the recombinase in the self-excising element is excised following a recombination event between the fifth recombination site and the sixth recombination site. In some embodiments, the second inducible promoter is operably linked to the sequence encoding one or more AAV helper proteins following a recombination event between the fifth recombination site and the sixth recombination site, as depicted in FIG. IB.

[0334] In some embodiments, the recombinase is a Cre recombinase or a flippase (FLP) recombinase.MF-367351030 76324632001440

[0335] In some embodiments, the recombination sites in the polynucleotide comprising a sequence encoding AAV Rep proteins and / or the polynucleotide comprising a sequence encoding helper proteins are lox sites and the inducible recombinase is a Cre recombinase. In some embodiments, the fifth recombination and sixth recombination sites comprise Lox sequences. In some embodiments, the recombinase is a Cre recombinase. In some embodiments, the fifth recombination and sixth recombination sites comprise Lox sequences, and the recombinase is a Cre recombinase. In some embodiments, the recombinase is an inducible recombinase. In some embodiments, the inducible recombinase is a Cre recombinase fused to an estrogen receptor ligand binding domain. In some embodiments, the inducible recombinase is a Cre-ERT2 fusion protein. In some embodiments, the inducible recombinase translocates to the nucleus in the presence of a second triggering agent. In some embodiments, the second triggering agent is an estrogen receptor ligand. In some embodiments, the second triggering agent is a selective estrogen receptor modulator (SERM). In some embodiments, the second triggering agent is tamoxifen.

[0336] In some embodiments, the inducible recombinase comprises the nucleotide sequence of SEQ ID NO: 225, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the recombination event between the fifth recombination site and the sixth recombination site is induced in the presence of the first and second triggering agents. In some embodiments, the first triggering agent is doxycycline and the second triggering agent is tamoxifen.

[0337] In other embodiments, the recombination sites in the polynucleotide comprising a sequence encoding AAV Rep proteins and / or the polynucleotide comprising a sequence encoding helper proteins are flippase recognition target (FRT) sites and the inducible recombinase is a flippase (Flp) recombinase. In some embodiments, the fifth recombination and sixth recombination sites comprise FRT sequences. In some embodiments, the recombinase is a Flp recombinase. In some embodiments, the fifth recombination and sixth recombination sites comprise FRT sequences, and the recombinase is a Flp recombinase.

[0338] In some embodiments, presence of the triggering agent activates the activator for activation of an inducible promoter to express AAV Cap proteins from the polynucleotide encoding the AAV Cap proteins.

[0339] In some embodiments, presence of the triggering agent activates the activator for activation of an inducible promoter to express AAV helper proteins from the polynucleotide encoding the AAV helper proteins.

[0340] In some embodiments, presence of the triggering agent activates the activator for activation of an inducible promoter to express the Rep proteins of the polynucleotide comprising a sequence encoding AAV Rep proteins; if present, the Cap proteins, the inducible recombinase, and the one or more adenoviral helper proteins.MF-367351030 77324632001440

[0341] In some embodiments, upon expression of the inducible recombinase, recombination between the first recombination site and the second recombination site in the polynucleotide comprising a sequence encoding AAV Rep proteins results in excision of the excisable element, and the first part of the AAV Rep proteins coding sequence and the second part of the AAV Rep proteins coding sequence are joined to form a complete AAV Rep proteins coding sequence, wherein the one or more promoters are operably linked to the complete AAV Rep coding sequence to allow expression of an AAV Rep protein of the polynucleotide comprising a sequence encoding AAV Rep proteins and, if present, the Cap Proteins; and recombination between the third recombination site and the fourth recombination site in a polynucleotide comprising a sequence encoding VA-RNA (as described herein) results in excision of the self-excising element comprising the sequence encoding the inducible recombinase, wherein the inducible promoter becomes operably linked to the sequence encoding the one or more adenoviral helper proteins to allow expression of the one or more adenoviral helper proteins.

[0342] In some embodiments, the polynucleotide further comprises a selectable marker operably linked to a third promoter.

[0343] In some embodiments, the first expression cassette comprises the nucleotide sequence of SEQ ID NO: 230, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto In some embodiments, In some embodiments, the first expression cassette comprises the nucleotide sequence of SEQ ID NO: 230.

[0344] In some embodiments, the second polynucleotide further comprises a second expression cassette comprising a second constitutive promoter operably linked to a nucleotide sequence encoding an activator.

[0345] In some embodiments, the activator is Tet-on3G. In some embodiments, the activator comprises the nucleotide sequence of SEQ ID NO: 232 or SEQ ID NO: 292 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the activator comprises the nucleotide sequence of SEQ ID NO: 232 or SEQ ID NO: 292.

[0346] In some embodiments, the second expression cassette is in an opposite orientation relative to the first expression cassette. In some embodiments, the first expression cassette is oriented 3’ to 5’ and the second expression cassette is oriented 5’ to 3’, or the first expression cassette is oriented 5’ to 3’ and the second expression cassette is oriented 3’ to 5’. In some embodiments, the first expression cassette is separated from the second expression cassette by an intervening sequence. In some embodiments, the intervening sequence comprises a transcriptional blocking element (TBE). In some embodiments, the TBE element comprises the sequence of SEQ ID NO: 33 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the TBE element comprises the sequence of SEQ ID NO: 33.MF-367351030 78324632001440

[0347] In some embodiments, the activator activates transcription from the inducible promoter of the first polynucleotide and / or the second polynucleotide in the presence of a first triggering agent. In some embodiments, the first triggering agent is doxycycline.

[0348] In some embodiments, the second constitutive promoter is an EFla promoter. In some embodiments, the EFla promoter has a TATA box mutation. In some embodiments, the second constitutive promoter comprises the nucleotide sequence of SEQ ID NO: 438, SEQ ID NO: 78 or SEQ ID NO: 79, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the second constitutive promoter comprises the nucleotide sequence of SEQ ID NO: 438, SEQ ID NO: 78 or SEQ ID NO: 79.

[0349] In some embodiments, the second expression cassette comprises the nucleotide sequence of SEQ ID NO: 233, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the second expression cassette comprises the nucleotide sequence of SEQ ID NO: 233.

[0350] In some embodiments, the polynucleotide comprising a sequence encoding adenovirus helper proteins has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 240, 241, 320, and 321. In some embodiments, the second polynucleotide comprises the sequence of SEQ ID NO: 240 or SEQ ID NO: 241, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In some embodiments, the second polynucleotide comprises the sequence of SEQ ID NO: 240 or SEQ ID NO: 241. In some embodiments, the second polynucleotide is a helper construct comprising a helper expression cassette comprising the nucleotide sequence of SEQ ID NO: 230, an activator expression cassette comprising the sequence of SEQ ID NO: 233, and a VA-RNA expression cassette comprising the nucleotide sequence of SEQ ID NO: 239. In some embodiments, the helper construct comprises the sequence of SEQ ID NO: 240. In some embodiments, helper construct sequence further comprises 5’ and 3’ ITRs for genome integration by a transposase. In some embodiments, the helper construct sequence is set forth in SEQ ID NO: 241 (pre -induction) and SEQ ID NO:320 (post-induction). In some embodiments, the helper construct is encoded in a plasmid comprising the nucleotide sequence of SEQ ID NO: 321.

[0351] An exemplary helper construct, which is shown in Table E2, encodes adenoviral helper proteins and a selection cassette to select cells with integrated helper construct(s). An excisable CRE is also encoded.MF-367351030 793246320014401. Polynucleotide Encoding VA-RNA

[0352] Provided herein, in some embodiments, is a polynucleotide comprising a VA-RNA expression cassette comprising a first part of a third constitutive promoter, a third excisable element, a second part of a constitutive promoter and a sequence encoding a viral associated RNA (VA-RNA).

[0353] In some embodiments, the second polynucleotide further comprises a third expression cassette, e.g., a VA-RNA expression cassette, comprising a first part of a third constitutive promoter, a third excisable element, a second part of a third constitutive promoter and a sequence encoding VA RNA.

[0354] Provided herein, in some embodiments, is a second polynucleotide comprising a first expression cassette, wherein the first expression cassette comprises a nucleotide sequence encoding one or more AAV helper proteins, such as described herein; a second expression cassette comprising a second constitutive promoter operably linked to a nucleotide sequence encoding an activator, as described herein; and a third expression cassette comprising a first part of a third constitutive promoter, a third excisable element, a second part of a constitutive promoter and a sequence encoding VA RNA.

[0355] In some embodiments, the third expression cassette is downstream of the second expression cassette and is in the same orientation as the second expression cassette. In some embodiments, the third excisable element is in an opposite orientation relative to the third constitutive promoter. In some embodiments, the third excisable element comprises a second selection cassette flanked by a seventh recombination site and an eighth recombination site. In some embodiments, the second selection cassette is excised following a recombination event between the seventh recombination site and the eighth recombination site thereby generating a functionally complete third constitutive promoter operably linked to the sequence encoding VA RNA.

[0356] In some embodiments, the first part of third the constitutive promoter comprises a U6 promoter distal sequence element (DSE) and the second part of the third constitutive promoter comprises a U6 promoter proximal sequence element (PSE). In some embodiments, the U6 promoter DSE comprises the nucleotide sequence of SEQ ID NO: 234 or SEQ ID NO: 293, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the U6 promoter DSE comprises the nucleotide sequence of SEQ ID NO: 234 or SEQ ID NO: 293. In some embodiments, the U6 promoter PSE comprises the nucleotide sequence of SEQ ID NO: 235, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the U6 promoter PSE comprises the nucleotide sequence of SEQ ID NO: 235. In some embodiments, the functionally complete U6 promoter comprises the nucleotide sequence of SEQ ID NO: 354.

[0357] In some embodiments, the sequence encoding VA-RNA comprises the nucleotide sequence of any one of SEQ ID NOs: 236, 237, 349, and 350. In some embodiments, the sequence encoding VA RNA is a transcriptionally dead sequence. In some embodiments, the sequence encoding VA RNAMF-367351030 80324632001440comprises a 10 nt deletion. In some embodiments, the sequence encoding VA-RNA comprises the nucleotide sequence of SEQ ID NO: 349. In some embodiments, the sequence encoding VA RNA comprises at least one mutation in an internal promoter. In some embodiments, the at least one mutation comprises a G16A mutation with reference to SEQ ID NO: 350. In some embodiments, the sequence encoding VA RNA comprises at least two mutations in an internal promoter. In some embodiments, the at least two mutations comprise a G16A mutation and a G60A mutation with reference to SEQ ID NO: 236. In some embodiments, the sequence encoding VA RNA comprises the nucleotide sequence of SEQ ID NO: 237 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the sequence encoding VA RNA comprises the nucleotide sequence of SEQ ID NO: 237.

[0358] In some embodiments, the second selection cassette comprises a fourth constitutive promoter operably linked to a nucleotide sequence encoding second selectable marker. In some embodiments, the second selectable marker is an antibiotic resistance gene, such as a puromycin resistance gene. In some embodiments, the second selectable marker is a puromycin resistance gene. In some embodiments, the puromycin resistance gene comprises the nucleotide sequence of SEQ ID NO: 238, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the puromycin resistance gene comprises the nucleotide sequence of SEQ ID NO: 238.

[0359] In some embodiments, the fourth constitutive promoter is a CMV promoter.

[0360] In some embodiments, the second selection cassette comprises the nucleotide sequence of SEQ ID NO: 357, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the second selection cassette comprises the nucleotide sequence of SEQ ID NO: 357.

[0361] In some embodiments, the third expression cassette comprises the nucleotide sequence of SEQ ID NO: 239, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the third expression cassette comprises the nucleotide sequence of SEQ ID NO: 239.

[0362] In certain embodiments, the VA-RNA is a mutated VA-RNA. In some embodiments, the VA-RNA is wild-type VA-RNA. In other embodiments, VA-RNA comprises one or more mutations in the VA-RNA internal promoter.

[0363] In some embodiments, the sequence encoding the VA-RNA is operably linked to an inactive promoter comprising a first part of a second constitutive promoter and a second part of the second constitutive promoter separated by a second excisable element comprising a fifth recombination site and a sixth recombination site flanking a staffer sequence, and excision of the second excisable element by the inducible recombinase generates a functional complete second constitutive promoter operably linkedMF-367351030 81324632001440to the VA-RNA coding sequence to allow expression of the VA-RNA. In some embodiments, the fifth and sixth recombination sites are oriented in the same direction.

[0364] In some embodiments, the first part of the second constitutive promoter comprises a distal sequence element (DSE) of an RNA polymerase III promoter, and the second part of the second constitutive promoter comprises a proximal sequence element (PSE) of an RNA polymerase III promoter. In other embodiments, the first part of the second constitutive promoter comprises a distal sequence element (DSE) of a U6 promoter, and the second part of the second constitutive promoter comprises a proximal sequence element (PSE) of a U6 promoter. In still other embodiments, the first part of the second constitutive promoter comprises a distal sequence element (DSE) of a U7 promoter, and the second part of the second constitutive promoter comprises a proximal sequence element (PSE) of a U7 promoter.

[0365] In some embodiments, the expression of VA-RNA is constitutive. In some embodiments, the expression of VA-RNA is inducible. In some embodiments, the constitutive promoter is EFl alpha promoter or human cytomegalovirus promoter. In some embodiments, the inducible promoter is a tetracycline -inducible promoter, an ecdysone -inducible promoter, or a cumate -inducible promoter. In some embodiments, a polynucleotide encoding a VA-RNA comprises a sequence coding for a transcriptionally dead (e.g., transcriptionally inactive) VA-RNA. In some embodiments, the sequence coding for the VA-RNA comprises a deletion of from about 5-10 nucleotides in the promoter region. In some embodiments, the sequence coding for the VA-RNA comprises at least one mutation. In some embodiments, the at least one mutation is in the A Box promoter region. In some embodiments, the at least one mutation is in the B Box promoter region. In some embodiments, the at least one mutation is G16A mutation or a G60A mutation, or a combination thereof. In some embodiments, the VA-RNA comprises a G16A mutation or a G60A mutation, or a combination thereof.

[0366] In some embodiments, the expression of the VA-RNA is under the control of an RNA polymerase III promoter. In some embodiments, the expression of VA-RNA is driven by a EFlalpha promoter. In some embodiments, the expression of the VA-RNA is under the control of an interrupted RNA polymerase III promoter. In some embodiments, the expression of the VA-RNA is under the control of a U6 or U7 promoter. In some embodiments, the expression of the VA-RNA is under the control of an interrupted U6 or U7 promoter. In some embodiments, the expression of VA-RNA is driven by a U6 promoter or a U7 promoter. In some embodiments, the U6 promoter or the U7 promoter comprises a) a first part of a U6 or U7 promoter sequence, b) a stuffer sequence, and c) a second part of a U6 or U7 promoter sequence. In some embodiments, the stuffer sequence is excisable by a recombinase. In some embodiments, the stuffer sequence is excisable by a Cre recombinase. In some embodiments, the stuffer sequence comprises a sequence encoding a gene. In some embodiments, the stuffer sequence comprises a promoter. In some embodiments, the promoter is a constitutive promoter. In someMF-367351030 82324632001440embodiments, the promoter is a CMV promoter. In some embodiments, the polynucleotide construct comprises upstream of the VA-RNA gene sequence, from 5’ to 3’: a) a first part of a U6 or U7 promoter sequence; b) a first recombination site; c) a stuffer sequence; d) a second recombination site; e) a second part of a U6 or U7 promoter sequence.

[0367] In some embodiments, the gene encodes a detectable marker or a selectable marker. In some embodiments, the selectable marker is a mammalian cell selection element. In some embodiments, the selectable marker is an auxotrophic selection element. In some embodiments, the auxotrophic selection element codes for an active protein. In some embodiments, the active protein is glutamine synthetase (GS), thymidylate synthase (TYMS), phenylalanine hydroxylase (PAH), or dihydrofolate reductase (DHFR). In some embodiments, PAH comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 365. In some embodiments, GS comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 366. In some embodiments, TYMS comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 367. In some embodiments, the auxotrophic selection element codes for an inactive protein that requires expression of a second auxotrophic selection element for activity. In some embodiments, the auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein Z-Cter and the second auxotrophic selection element codes for N-terminal fragment of an auxotrophic protein Z-Nter, or vice a versa. In some embodiments, the auxotrophic selection element codes for DHFR Z-Cter or DHFR Z-Nter. In some embodiments, the selectable marker is DHFR Z-Nter or DHFR Z-Cter. In some embodiments, the DHFR Z-Nter comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 368. In some embodiments, the DHFR Z-Cter comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 369. In some embodiments, the auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein fused to a C-terminal intein of a split intein and the second auxotrophic selection element codes for an N-terminal fragment of an auxotrophic protein fused to an N-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for an N-terminal fragment of an auxotrophic protein fused to an N-terminal intein of a split intein and the second auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein fused to a C-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for C-terminal fragment of PAH, GS, TYMS, or DHFR fused to a C-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for an N-terminal fragment of PAH, GS, TYMS, or DHFR fused to a N-terminal intein of a split intein. In some embodiments, the selectable marker is an antibiotic resistance protein. In some embodiments, the selectable marker is a split intein linked to an N-terminus of the antibiotic resistance protein or split intein linked to a C-terminus of the antibiotic resistance protein. In some embodiments, the selectable marker is a leucine zipper linked to an N-terminus of the antibioticMF-367351030 83324632001440resistance protein or leucine zipper linked to a C-terminus of the antibiotic resistance protein. In some embodiments, the antibiotic resistance protein is for puromycin resistance or blasticidin resistance. In some embodiments, the split intein is derived from the Nostoc punctiforme (Npu) DnaE intein, the Synechocystis species, strain PCC6803 (Ssp) DnaE intein, or the consensus DnaE intein (Cfa). In some embodiments, an N-terminal intein comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 370. In some embodiments, a C-terminal intein comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 371.

[0368] In some embodiments, the staffer sequence further comprises a sequence coding for a selectable marker and a helper enzyme, wherein expression of the helper enzyme facilitates growth of the cell in conjunction with the selectable marker. In certain embodiments, the helper enzyme is an enzyme that facilitates production of a molecule required for cell growth. For example, the helper enzyme may be required for production of a cofactor utilized by the functional enzyme to generate the molecule required for cell growth. In certain embodiments, the cell may produce the helper enzyme at low levels and the expression of the helper enzyme from the helper construct can increase helper enzyme levels thereby increasing production of the molecule required for cell growth, by, e.g., increasing levels of a co-factor required for enzyme activity. In some embodiments, the staffer sequence further encodes a helper enzyme involved in production of tyrosine from phenylalanine. In some embodiments, the helper enzyme facilitates PAH-mediated production of tyrosine from phenylalanine. In some embodiments, the helper enzyme catalyzes production a co-factor required by PAH for converting phenylalanine to tyrosine. In some embodiments, the helper enzyme is GTP cyclohydrolase I (GTP-CH1). In some embodiments, the helper enzyme comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 372. In some embodiments, the GT — CHI produces the cofactor (6R)-5, 6,7,8-tetrahydrobiopterin (BH4) that is required for conversion of phenylalanine to tyrosine. In some embodiments, expression of GTP-CH1 facilitates growth of the host cell in conjunction with functional PAH upon application of the single selective pressure.

[0369] In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 365-267, or 373-398. In some embodiments, the selectable marker and helper enzyme comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 399-407.

[0370] In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 80 or 84. In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 80. In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 84.MF-367351030 84324632001440

[0371] In some embodiments, the detectable marker comprises a luminescent marker or a fluorescent marker. In some embodiments, the fluorescent marker is GFP, EGFP, RFP, CFP, BFP, YFP, or mCherry. In some embodiments, an inducible helper construct comprises a polynucleotide construct coding for a VA-RNA or the VA-RNA construct further comprising a sequence coding for a recombinase. In some embodiments, the recombinase is exogenously provided. In some embodiments, the recombinase is a site-specific recombinase. In some embodiments, the recombinase is a Cre polypeptide or a Flippase polypeptide. In some embodiments, the Cre polypeptide is fused to a ligand binding domain. In some embodiments, the ligand binding domain is a hormone receptor. In some embodiments, the hormone receptor is an estrogen receptor. In some embodiments, the estrogen receptor comprises a point mutation. In some embodiments, the estrogen receptor is ERT2. In some embodiments, the recombinase is a Cre-ERT2 polypeptide. In some embodiments, the first recombination site is a first lox sequence and the second recombination site is a second lox sequence. In some embodiments, the first lox sequence is a first loxP site and the second lox sequence is a second loxP site. In some embodiments, the first recombination site is a first FRT site and the second recombination site is a second FRT site.

[0372] In some embodiments, the construct comprising the VA-RNA as described herein further comprises a sequence coding for a selectable marker. In some embodiments, the selectable marker is a mammalian cell selection element. In some embodiments, the selectable marker is an auxotrophic selection element. In some embodiments, the auxotrophic selection element codes for an active protein. In some embodiments, the active protein is glutamine synthetase (GS), thymidylate synthase (TYMS), phenylalanine hydroxylase (PAH), or dihydrofolate reductase (DHFR). In some embodiments, PAH comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 365. In some embodiments, GS comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 366. In some embodiments, TYMS comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 367. In some embodiments, the auxotrophic selection element codes for an inactive protein that requires expression of a second auxotrophic selection element for activity. In some embodiments, the auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein Z-Cter and the second auxotrophic selection element codes for N-terminal fragment of an auxotrophic protein Z-Nter, or vice a versa. In some embodiments, the auxotrophic selection element codes for DHFR Z-Cter or DHFR Z-Nter. In some embodiments, the selectable marker is DHFR Z-Nter or DHFR Z-Cter. In some embodiments, the DHFR Z-Nter comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 368. In some embodiments, the DHFR Z-Cter comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 369. In some embodiments, the auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein fused to a C-terminal intein of a split intein and the second auxotrophic selection element codes for an N-terminal fragment of an auxotrophic protein fused to an N-MF-367351030 85324632001440terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for an N-terminal fragment of an auxotrophic protein fused to an N-terminal intein of a split intein and the second auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein fused to a C-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for C-terminal fragment of PAH, GS, TYMS, or DHFR fused to a C-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for an N-terminal fragment of PAH, GS, TYMS, or DHFR fused to a N-terminal intein of a split intein. In some embodiments, the selectable marker is an antibiotic resistance protein. In some embodiments, the selectable marker is a split intein linked to an N-terminus of the antibiotic resistance protein or split intein linked to a C-terminus of the antibiotic resistance protein. In some embodiments, the selectable marker is a leucine zipper linked to an N-terminus of the antibiotic resistance protein or leucine zipper linked to a C-terminus of the antibiotic resistance protein. In some embodiments, the antibiotic resistance protein is for puromycin resistance or blasticidin resistance. In some embodiments, the split intein is derived from the Nostoc punctiforme (Npu) DnaE intein, the Synechocystis species, strain PCC6803 (Ssp) DnaE intein, or the consensus DnaE intein (Cfa). In some embodiments, an N-terminal intein comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 370. In some embodiments, a C-terminal intein comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 371.

[0373] In some embodiments, the polynucleotide comprising a sequence encoding VA-RNA further comprises a sequence coding for a selectable marker and a helper enzyme, wherein expression of the helper enzyme facilitates growth of the cell in conjunction with the selectable marker. In certain embodiments, the helper enzyme is an enzyme that facilitates production of a molecule required for cell growth. For example, the helper enzyme may be required for production of a cofactor utilized by the functional enzyme to generate the molecule required for cell growth. In certain embodiments, the cell may produce the helper enzyme at low levels and the expression of the helper enzyme from the helper construct can increase helper enzyme levels thereby increasing production of the molecule required for cell growth, by, e.g., increasing levels of a co-factor required for enzyme activity. In some embodiments, the construct comprising the VA-RNA further encodes a helper enzyme involved in production of tyrosine from phenylalanine. In some embodiments, the helper enzyme facilitates PAH-mediated production of tyrosine from phenylalanine. In some embodiments, the helper enzyme catalyzes production a co-factor required by PAH for converting phenylalanine to tyrosine. In some embodiments, the helper enzyme is GTP cyclohydrolase I (GTP-CH1). ). In some embodiments, the helper enzyme comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 372.1n some embodiments, the GTP-CH1 produces the cofactor (6R)-5,6,7,8-tetrahydrobiopterin (BH4) that is required for conversion of phenylalanine to tyrosine. In some embodiments, expression of GTP-CH1MF-367351030 86324632001440facilitates growth of the host cell in conjunction with functional PAH upon application of the single selective pressure.

[0374] In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 365-267, or 373-398. In some embodiments, the selectable marker and helper enzyme comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 399-407.

[0375] In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 80 or 84. In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 80. In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 84.

[0376] In some embodiments, the polynucleotide comprising a sequence encoding VA-RNA has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NOS: 236, 237, 349, and 350 . In certain embodiments, the polynucleotide comprising a sequence encoding VA-RNA has sequence of SEQ ID NOS: 236, 237, 349, and 350. In some embodiments, the polynucleotide comprising a sequence encoding VA-RNA has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 236 or 237. In some embodiments, the polynucleotide comprising a sequence encoding VA-RNA comprises the sequence set forth in SEQ ID NO: 236 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the sequence set forth in SEQ ID NO: 236. In some embodiments, the polynucleotide comprising a sequence encoding VA-RNA comprises the sequence set forth in SEQ ID NO: 237 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the sequence set forth in SEQ ID NO: 237. In some embodiments, the polynucleotide comprising a sequence encoding VA-RNA has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 351-352.D. Polynucleotides for Payload Expression

[0377] Also provided herein, in some embodiments, is a polynucleotide comprising a payload expression cassette flanked by AAV ITR sequences. Also provided, in some embodiments, is a polynucleotide comprising a payload expression cassette comprising a constitutive promoter operably linked to a nucleotide sequence encoding a payload. In some embodiments, the polynucleotide comprises a payload expression cassette flanked by AAV ITR sequences, wherein the payload expression cassette comprises a fifth constitutive promoter operably linked to a nucleotide sequence encoding a payload.MF-367351030 87324632001440

[0378] The payload can be any payload of interest. In some embodiments, a polynucleotide encoding a payload comprises a reporter gene, a therapeutic gene, or a transgene encoding a protein of interest. In certain embodiments, the payload of the polynucleotide is progranulin. In some embodiments, the polynucleotide encoding adenoviral helper genes comprises the polynucleotide encoding a payload as described herein.

[0379] In some embodiments, the sequence encoding the payload of the polynucleotide comprises a sequence encoding a reporter gene, a therapeutic gene, or a transgene encoding a protein of interest. In some embodiments, the sequence encoding the payload of the fourth polynucleotide is a sequence encoding progranulin. In some embodiments, the sequence encoding the payload comprises the nucleotide sequence of SEQ ID NO: 243 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the payload expression cassette comprises the nucleotide sequence of SEQ ID NO: 244, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the payload expression cassette comprises the nucleotide sequence of SEQ ID NO: 297, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0380] In some embodiments, the sequence encoding the payload comprises a sequence encoding a suppressor tRNA, a guide RNA, or a homology region for homology-directed repair.

[0381] In some embodiments, the polynucleotide comprising the sequence encoding the payload comprises the sequence encoding the payload flanked by a 5' AAV inverted terminal repeat (5' ITR) and a 3' AAV inverted terminal repeat (3' ITR).

[0382] In some embodiments, the sequence encoding the payload is flanked by a 5' AAV inverted terminal repeat (5' ITR) and a 3' AAV inverted terminal repeat (3' ITR) has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 297. In certain embodiments, the sequence encoding the payload is flanked by a 5' AAV inverted terminal repeat (5' ITR) and a 3' AAV inverted terminal repeat (3' ITR) has the sequence of SEQ ID NO: 297.

[0383] In some embodiments, the sequence encoding the payload has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 248. In certain embodiments, the sequence encoding the payload has sequence of SEQ ID NO: 248.

[0384] In some embodiments, the sequence encoding the payload has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 322. In certain embodiments, the sequence encoding the payload has sequence of SEQ ID NO: 322.MF-367351030 88324632001440

[0385] In some embodiments, the sequence encoding the payload has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 323. In certain embodiments, the sequence encoding the payload has sequence of SEQ ID NO: 323.

[0386] In some embodiments, the sequence encoding the payload has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 324. In certain embodiments, the sequence encoding the payload has sequence of SEQ ID NO: 324.

[0387] In some embodiments, the polynucleotide comprises a coding sequence for an expressible payload and a mammalian cell selection element. In an exemplary embodiment, the expressible payload is under the control of a constitutive promoter. This construct can be referred to as a payload construct.

[0388] In some embodiments, the expressible payload encodes a guide RNA. In certain embodiments, the guide RNA directs RNA editing. In some embodiments, the guide RNA directs Cas-mediated DNA editing. In some embodiments, the guide RNA directs ADAR-mediated RNA editing. In some embodiments, the fourth integrated synthetic construct comprises a sequence encoding for any of the expressible payloads disclosed herein. For example, said sequence can encode for any therapeutic. For example, the therapeutic may be a transgene, a guide RNA, an antisense RNA, an oligonucleotide, an mRNA, a miRNA, a shRNA, a tRNA suppressor, a CRISPR-Cas protein, any gene editing enzyme, or any combination thereof. In some embodiments, the transgene encodes for progranulin. In some embodiments, the tRNA suppressor is capable of suppressing an opal stop codon. In some embodiments, the tRNA suppressor is capable of suppressing an ochre stop codon. In some embodiments, the tRNA suppressor is capable of suppressing an amber stop codon. In some embodiments, the fourth integrated synthetic construct comprises sequences encoding for more than one of the expressible payloads disclosed herein. For example, the fourth integrated synthetic construct comprises 2 gRNA, 3 gRNA, 4 gRNA, 5 gRNA, 6 gRNA, 7 gRNA, 8 gRNA, 9 gRNA, or 10 gRNA. These gRNAs can all be the same, all be different, or any combination of the same and different. For example, the fourth integrated synthetic construct comprises 2 suppressor tRNAs, 3 suppressor tRNAs, 4 suppressor tRNAs, 5 suppressor tRNAs, 6 suppressor tRNAs, 7 suppressor tRNAs, 8 suppressor tRNAs, 9 suppressor tRNAs, or 10 suppressor tRNAs. These suppressor tRNAs can all be the same, all be different, or any combination of the same and different.

[0389] In some embodiments, the expressible payload encodes a protein. In certain embodiments, the expressible payload is an enzyme, useful for replacement gene therapy. In some embodiments, the protein is a therapeutic antibody. In some embodiments, the protein is a vaccine immunogen. In particular embodiments, the vaccine immunogen is a viral protein.MF-367351030 89324632001440

[0390] In some embodiments, the expressible payload is a homology construct for homologous recombination.

[0391] In various embodiments, the third mammalian cell selection element is an auxotrophic selection element.

[0392] In some embodiments, the payload construct comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 408 or SEQ ID NO: 410. In some embodiments, the payload construct comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 408 or SEQ ID NO: 410, wherein SEQ ID NO: 409 in SEQ ID NO: 408 or SEQ ID NO: 410 is replaced with a sequence of the payload of interest. In some embodiments, the payload construct comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to one or more of SEQ ID NOS: 244, 248, 323 or 297. In some embodiments, a plasmid comprising the payload construct has at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 322 or SEQ ID NO: 324.

[0393] In some embodiments, the payload construct comprises a sequence of a payload flanked by AAV ITR sequences. In some embodiments, expression of the sequence of the payload is driven by a constitutive promoter or an inducible promoter. In some embodiments, the constitutive promoter is an RSV promoter. In some embodiments, the RSV promoter comprises a nucleotide sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 41 or SEQ ID NO: 299. In some embodiments, the promoter and sequence of the payload are flanked by AAV ITR sequences. In some embodiments, the payload construct flanked by AAV ITRs comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 297.

[0394] In some embodiments, the sequence of the payload comprises a polynucleotide sequence coding for a gene. In some embodiments, the gene codes for a selectable marker or detectable marker. In some embodiments, the gene codes for a therapeutic polypeptide or transgene. In some embodiments, the therapeutic polypeptide or transgene is progranulin. In some embodiments, the sequence of the payload comprises a polynucleotide sequence coding for a therapeutic polynucleotide. In some embodiments, the therapeutic polynucleotide is a tRNA suppressor or a guide RNA. In some embodiments, the tRNA suppressor is capable of suppressing an opal stop codon. In some embodiments, the tRNA suppressor is capable of suppressing an ochre stop codon. In some embodiments, the tRNA suppressor is capable of suppressing an amber stop codon. In some embodiments, the guide RNA is a polyribonucleotide capable of binding to a protein. In some embodiments, the protein is nuclease. In some embodiments, the protein is a Cas protein, an ADAR protein, or an AD AT protein. In some embodiments, the guide RNA, when bound to a target RNA, recruits an ADAR protein for editing of the target RNA. In some embodiments, the Cas protein is catalytically inactive Cas protein. In some embodiments, the payload construct is stably integrated into the genome of the cell. In some embodiments, a plurality of the payload construct areMF-367351030 90324632001440stably integrated into the genome of the cell. In some embodiments, the plurality of the payload constructs are separately stably integrated into the genome of the cell.

[0395] In some embodiments, the third polynucleotide further comprises a third selection cassette, where in the third selection cassette comprises a sixth constitutive promoter operably linked to a sequence encoding a third selectable marker. In some embodiments, the third selectable marker is an antibiotic resistance gene. In some embodiments, the third selectable marker comprises a second part of an antibiotic resistance gene. In some embodiments, the third selectable marker comprises a second part of a split blasticidin resistance gene.

[0396] In some embodiments, the third polynucleotide comprises a second part of a split antibiotic resistance gene, and the first polynucleotide comprising an expression cassette for expressing Cap and / or Rep proteins comprises the first part of the split antibiotic resistance gene. As such, a cell that includes both the first polynucleotide and the second polynucleotide is capable of containing both parts of the split antibiotic resistance gene, e.g., a blasticidin resistance gene.

[0397] In some embodiments, the third selectable marker comprises the nucleotide sequence of SEQ ID NO: 84 or SEQ ID NO: 80, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0398] In some embodiments, the selection cassette comprises a 3 ’ UTR downstream of the selectable marker. In some embodiments, the 3’ UTR comprises the nucleotide sequence of SEQ ID NO: 307, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 307.

[0399] In some embodiments, the selection cassette comprises a polyA sequence downstream of the selectable marker. In some embodiments, the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 336, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 336.

[0400] In some embodiments, the sixth constitutive promoter is an EFla promoter. In some embodiments, the sixth constitutive promoter comprises the nucleotide sequence of SEQ ID NO: 439 or SEQ ID NO: 282, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the EFla promoter has a TATA box mutation. In some embodiments, the sixth constitutive promoter comprises the nucleotide sequence of SEQ ID NO: 438, SEQ ID NO: 78 or SEQ ID NO: 79, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the third selection cassette comprises the nucleotide sequence of SEQ ID NO:210, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the third polynucleotide comprises the sequence of any one of SEQ ID NOs: 247, SEQ ID NO: 248, and 337, or a nucleotideMF-367351030 91324632001440sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0401] In some embodiments, the third polynucleotide is a payload construct. In some embodiments, the payload construct comprises the nucleotide sequence of SEQ ID NO: 337. In some embodiments, the payload construct comprises a payload cassette comprising the nucleotide sequence of SEQ ID NO: 297 and a selection cassette comprising the nucleotide sequence SEQ ID NO: 210. In some embodiments, the payload construct further comprises transposon-specific ITR sequences for genome integration of the polynucleotide by atransposase. In some embodiments, the payload construct comprises the nucleotide sequence of SEQ ID NO: 248.

[0402] In some embodiments, the payload construct further comprises a sequence coding for a selectable marker or detectable marker outside of the AAV ITR sequences. In some embodiments, expression of the selectable marker or detectable marker outside of the ITR sequences is driven by a promoter. The promoter can be a constitutive promoter or an inducible promoter. In some embodiments, the constitutive promoter is EFla (or EFl alpha) promoter or human cytomegalovirus promoter. In some embodiments, the inducible promoter is a tetracycline-inducible promoter, an ecdysone-inducible promoter, or a cumate -inducible promoter. In some embodiments, the selectable marker is a mammalian cell selection element (e.g., a third mammalian cell selection element). In some embodiments, the selectable marker is a mammalian cell selection element. In some embodiments, the selectable marker is an auxotrophic selection element. In some embodiments, the auxotrophic selection element codes for an active protein. In some embodiments, the active protein is glutamine synthetase (GS), thymidylate synthase (TYMS), phenylalanine hydroxylase (PAH), or dihydrofolate reductase (DHFR). In some embodiments, PAH comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 365. In some embodiments, GS comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 366. In some embodiments, TYMS comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 367. In some embodiments, the auxotrophic selection element codes for an inactive protein that requires expression of a second auxotrophic selection element for activity. In some embodiments, the auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein Z-Cter and the second auxotrophic selection element codes for N-terminal fragment of an auxotrophic protein Z-Nter, or vice a versa. In some embodiments, the auxotrophic selection element codes for DHFR Z-Cter or DHFR Z-Nter. In some embodiments, the selectable marker is DHFR Z-Nter or DHFR Z-Cter. In some embodiments, the DHFR Z-Nter comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 368. In some embodiments, the DHFR Z-Cter comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 369. In some embodiments, the auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein fused to a C-MF-367351030 92324632001440terminal intein of a split intein and the second auxotrophic selection element codes for an N-terminal fragment of an auxotrophic protein fused to an N-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for an N-terminal fragment of an auxotrophic protein fused to an N-terminal intein of a split intein and the second auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein fused to a C-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for C-terminal fragment of PAH, GS, TYMS, or DHFR fused to a C-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for an N-terminal fragment of PAH, GS, TYMS, or DHFR fused to a N-terminal intein of a split intein. In some embodiments, the selectable marker is an antibiotic resistance protein. In some embodiments, the selectable marker is a split intein linked to an N-terminus of the antibiotic resistance protein or split intein linked to a C-terminus of the antibiotic resistance protein. In some embodiments, the selectable marker is a leucine zipper linked to an N-terminus of the antibiotic resistance protein or leucine zipper linked to a C-terminus of the antibiotic resistance protein. In some embodiments, the antibiotic resistance protein is for puromycin resistance or blasticidin resistance. In some embodiments, the split intein is derived from the Nostoc punctiforme (Npu) DnaE intein, the Synechocystis species, strain PCC6803 (Ssp) DnaE intein, or the consensus DnaE intein (Cfa). In some embodiments, an N-terminal intein comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 370. In some embodiments, a C-terminal intein comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 371.

[0403] In some embodiments, the payload construct further comprises a sequence coding for a selectable marker and a helper enzyme, wherein expression of the helper enzyme facilitates growth of the cell in conjunction with the selectable marker. In certain embodiments, the helper enzyme is an enzyme that facilitates production of a molecule required for cell growth. For example, the helper enzyme may be required for production of a cofactor utilized by the functional enzyme to generate the molecule required for cell growth. In certain embodiments, the cell may produce the helper enzyme at low levels and the expression of the helper enzyme from the helper construct can increase helper enzyme levels thereby increasing production of the molecule required for cell growth, by, e.g., increasing levels of a co-factor required for enzyme activity. In some embodiments, the payload construct further encodes a helper enzyme involved in production of tyrosine from phenylalanine. In some embodiments, the helper enzyme facilitates PAH-mediated production of tyrosine from phenylalanine. In some embodiments, the helper enzyme catalyzes production a co-factor required by PAH for converting phenylalanine to tyrosine. In some embodiments, the helper enzyme is GTP cyclohydrolase I (GTP-CH1). In some embodiments, the helper enzyme comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 372. In some embodiments, the GTP-CH1 produces the cofactor (6R)-5,6,7,8-tetrahydrobiopterin (BH4) that is required for conversion of phenylalanine to tyrosine. In some embodiments, expression ofMF-367351030 93324632001440GTP-CH1 facilitates growth of the host cell in conjunction with functional PAH upon application of the single selective pressure.

[0404] In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 365-267, or 373-398. In some embodiments, the selectable marker and helper enzyme comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 399-407.

[0405] In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 80 or 84. In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 80. In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 84.

[0406] In some embodiments, the selectable marker is outside of the ITR sequences on the payload construct. In some embodiments, the selectable marker outside of the ITR sequences is a split intein linked to an N-terminus of the auxotrophic protein or split intein linked to a C-terminus of the auxotrophic protein. In some embodiments, the selectable marker outside of the ITR sequences is a leucine zipper linked to an N-terminus of the auxotrophic or leucine zipper linked to a C-terminus of the auxotrophic. In some embodiments, the selectable marker outside of the ITR sequences is a split intein linked to an N-terminus of the antibiotic resistance protein or split intein linked to a C-terminus of the antibiotic resistance protein. In some embodiments, the selectable marker outside of the ITR sequences is a leucine zipper linked to an N-terminus of the antibiotic resistance protein or leucine zipper linked to a C-terminus of the antibiotic resistance protein. In some embodiments, the antibiotic resistance protein is for puromycin resistance or blasticidin resistance. In some embodiments, the payload construct further comprises a spacer between the 5’ ITR and the promoter / selectable marker or promoter / detectable marker outside of the ITR sequences. In some embodiments, the payload construct further comprises a spacer between the 3 ’ ITR and the promoter / selectable marker or promoter / detectable marker outside of the ITR sequences. In some embodiments, the spacer ranges in length from 500 base pairs to 5000 base pairs, including any length within this range such as 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, 800, 825, 850, 875, 900, 925, 950, 975, 1000, 1250, 1500, 1750, 2000, 2225, 2500, 2750, 3000, 3250, 3500, 3750, 4000, 4250, 4500, 4750, or 5000 base pairs. In some embodiments, the spacer length is a sufficient length for decreasing reverse packaging of the selectable marker or detectable marker that is outside the ITR sequences.

[0407] In some embodiments, the polynucleotide comprising a sequence encoding a payload is further engineered to remove locations having the potential for Rep-mediated nicking. For example, a location having the potential for Rep-mediated nicking is a location having the sequence CAGTGAGCGAGCGAGCGCGCAG (SEQ ID NO: 411); a sequence comprising GAGC (SEQ ID NO:MF-367351030 94324632001440412) repeats; or the sequence GATGGAGTTGGCCACTCCCTC (SEQ ID NO: 413). These sequences can be engineered to prevent binding of Rep proteins for Rep-mediated nicking. In some embodiments, the location having the potential for Rep-mediated nicking that is engineered to prevent binding of Rep proteins for Rep-mediated nicking is in a region within 100 nucleotides of an ITR sequence. In some embodiments, the location having the potential for Rep-mediated nicking that is engineered to prevent binding of Rep proteins for Rep-mediated nicking is in a region within 200 nucleotides of an ITR sequence. In some embodiments, the location having the potential for Rep-med...

Claims

324632001440CLAIMS1. A polynucleotide comprising an adeno-associated vims (AAV) Cap expression cassette that comprises an inducible promoter, a splice donor site, a first splice acceptor site, a second splice acceptor site, and a Cap open reading frame,wherein the splice donor site comprises the sequence CAGACAGGTANGTAA (SEQ ID NO: 10), wherein N is an A or a C.

2. A polynucleotide comprising an adeno-associated vims (AAV) Cap expression cassette that comprises a first promoter, a splice donor site, a first splice acceptor site, a second splice acceptor site, and a Cap open reading frame,wherein the second splice acceptor site comprises the sequence CTGCTGATGGTTATCTTCCAG (SEQ ID NO: 8) or the sequence CTGCCGATTCTTATCTTCCAG (SEQ ID NO: 9).

3. A polynucleotide comprising an adeno-associated vims (AAV) Cap expression cassette that comprises a first promoter, a splice donor site, a first splice acceptor site, a second splice acceptor site, and a Cap open reading frame, wherein:the splice donor site comprises the sequence CAGGTANGT (SEQ ID NO: 275), wherein N is an A or a C; andthe second splice acceptor site comprises the sequence CTGCTGATGGTTATCTTCCAG (SEQ ID NO: 8) or the sequence CTGCCGATTCTTATCTTCCAG (SEQ ID NO: 9).

4. A polynucleotide comprising:a) an adeno-associated vims (AAV) Cap expression cassette that comprises a first promoter, a splice donor site, a first splice acceptor site, a second splice acceptor site, and a Cap open reading frame,wherein the splice donor site comprises the sequence CAGACAGGTANGTAA (SEQ ID NO: 10), wherein N is an A or a C; andb) an AAV Rep expression cassette that comprises a second promoter and a Rep open reading frame.

5. The polynucleotide of any of claims 2-4, wherein the first promoter is a native p40 promoter, a constitutive promoter, or an inducible promoter.

6. The polynucleotide of any one of claims 2-5, wherein the first promoter is an inducible promoter.MF-367351030 2603246320014407. The polynucleotide of any of claims 1-6, wherein the splice donor site has a splice prediction score of at least or about 0.70, 0.75, 0.80, 0.85, 0.90, 0.95, 0.

99. or 1.0; and / orthe splice donor site is predicted to be involved in a splice event with a probability of at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%.

8. The polynucleotide of any of claims 1-7, wherein the splice donor site comprises the sequence CAGACAGGTAAGTAA (SEQ ID NO: 3) or the sequence CAGACAGGTACGTAA (SEQ ID NO: 2).

9. The polynucleotide of any of claims 1-8, wherein the splice donor site comprises the sequence CAGACAGGTAAGTAA (SEQ ID NO: 3).

10. The polynucleotide of any of claims 1 and 3-9, wherein the second splice acceptor site comprises the sequence CTGCTGATGGTTATCTTCCAG (SEQ ID NO: 8) or the sequence CTGCCGATTCTTATCTTCCAG (SEQ ID NO: 9).

11. The polynucleotide of any one of claims 1-10, wherein the second splice acceptor site comprises the sequence CTGCTGATGGTTATCTTCCAG (SEQ ID NO: 8).

12. The polynucleotide of any one of claims 1-11, wherein the second splice acceptor sites has a splice prediction score of at least or about 0.70, 0.75, 0.80, 0.85, 0.90, 0.95, 0.

99. or 1.0; and / or the second splice acceptor predicted to be involved in a splice event with a probability of at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%.

13. The polynucleotide of any of claims 1 and 5-12, wherein the inducible promoter comprises a tetracycline-responsive promoter element (TRE).

14. The polynucleotide of claim 13, wherein the TRE comprises Tet operator (tetO) sequence concatemers fused to a minimal promoter.

15. The polynucleotide of claim 14, wherein the tetO sequence concatamers comprises the sequence of SEQ ID NO: 27.MF-367351030 26132463200144016. The polynucleotide of claim 14 or 15, wherein the minimal promoter is a human cytomegalovirus promoter.

17. The polynucleotide of claim 16, wherein the minimal promoter comprises the nucleotide sequence of SEQ ID NO: 28.

18. The polynucleotide of any of claims 1, and 5-17, wherein the inducible promoter comprises the nucleotide sequence of any of SEQ ID NO: 25, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity of any of the foregoing.

19. The polynucleotide of any of claims 1, and 5-18, wherein the inducible promoter comprises the nucleotide sequence of SEQ ID NO: 25.

20. The polynucleotide of any of claims 1, and 5-19, wherein the inducible promoter is activated in the presence of a first triggering agent.

21. The polynucleotide of claim 20, wherein the first triggering agent is doxycycline.

22. The polynucleotide of any of claims 1-21, wherein the Cap open reading frame encodes one or more AAV capsid proteins.

23. The polynucleotide of claim 22, wherein the one more AAV capsid proteins comprise VP1, VP2, and VP3.

24. The polynucleotide of claim 23, wherein:a) the splice donor site and the first splice acceptor site generate an mRNA transcript encoding the VP 1 protein, andb) the splice donor site and the second splice acceptor site generate an mRNA transcript encoding the VP2 protein and an mRNA transcript encoding the VP3 protein.

25. The polynucleotide of any one of claims 1-24, wherein the AAV Cap expression cassette further comprises a polyA signal sequence downstream of the Cap open reading frame, wherein the polyA signal sequence is stronger than a native AAV Cap polyA signal sequence.MF-367351030 26232463200144026. The polynucleotide of claim 25, wherein the polyA signal sequence comprises a SV40 polyA signal sequence.

27. The polynucleotide of claim 25 or claim 26, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 46, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

28. The polynucleotide of any of claims 1-27, wherein the Cap open reading frame encodes one or more AAV capsid proteins selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV13, AAV 14, AAV 15 and AAV 16, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16 or AAVhu68.

29. The polynucleotide of any of claims 1-28, wherein the Cap open reading frame encodes one or more AAV capsid proteins selected from AAV1, AAV2, AAV6, AAV7, AAV8, AAAV9.

30. The polynucleotide of any of claims 1-29, wherein the Cap open reading frame encodes one or more AAV capsid proteins from AAV9.

31. The polynucleotide of any of claims 1-30, wherein the Cap open reading frame comprises the nucleotide sequence of SEQ ID NO: 66, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof.

32. The polynucleotide of any of claims 1-31, wherein the Cap open reading frame has a nucleotide sequence comprising a C9T mutation with reference to SEQ ID NO: 66.

33. The polynucleotide of any of claims 1-33, wherein the AAV Cap expression cassette comprises the nucleotide sequence of SEQ ID NO: 68 or SEQ ID NO: 69, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.MF-367351030 26332463200144034. The polynucleotide of any of claims 1-29, wherein the Cap open reading frame encodes one or more AAV capsid proteins from AAV2.

35. The polynucleotide of any of claims 1-29 and 34, wherein the Cap open reading frame comprises the nucleotide sequence of SEQ ID NO: 58, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof.

36. The polynucleotide of any of claims 1-29 and 34-35, wherein the Cap open reading frame has a nucleotide sequence comprising a C9T mutation with reference to SEQ ID NO: 58.

37. The polynucleotide of any of claims 1-28, wherein the Cap open reading frame encodes one or more AAV capsid proteins that are a chimera of capsid proteins from two or more serotypes selected from AAV1, AAV2, rAAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV13, AAV 14, AAV 15 and AAV 16, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, and AAV.HSC16.

38. The polynucleotide of claim any of claims 1-28 and 37, wherein the Cap open reading frame encodes one or more AAV capsid proteins that are a chimera of capsid proteins from AAV9 and AAV5.

39. The polynucleotide of any of claims 1-38, wherein the one or more AAV capsid proteins further comprise one or more amino acid substitutions that confers tropism for a tissue of interest.

40. The polynucleotide of claim 39, wherein the tissue of interest is a central nervous system (CNS) tissue, a muscle tissue, or eye tissue41. The polynucleotide of any of claims 1-28 and 47-40, wherein the Cap open reading frame comprises the nucleotide sequence of SEQ ID NO: 440 or SEQ ID NO: 445, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.MF-367351030 26432463200144042. The polynucleotide of any of claims 1-3 and 5-41, further comprising an AAV Rep expression cassette that comprises, from 5’ to 3’, a second promoter and a Rep open reading frame.

43. The polynucleotide of any of claims 4-42, wherein the AAV Rep expression cassette is in an opposite orientation relative the AAV Cap expression cassette.

44. The polynucleotide of claim 43, wherein the AAV Rep expression cassette is oriented 3’ to 5’ and the AAV Cap expression cassette is oriented 5’ to 3’, or the AAV Rep expression cassette is oriented 5’ to 3’ and the AAV Cap expression cassette is oriented 3’ to 5’.

45. The polynucleotide of any one of claims 4-44, wherein the AAV Rep expression cassette is separated from the AAV Cap expression cassette by an intervening sequence.

46. The polynucleotide of claim 45, wherein the intervening sequence comprises a transcriptional blocking element (TBE).

47. The polynucleotide of claim 46, wherein the TBE comprises the sequence of SEQ ID NO: 33 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

48. The polynucleotide of any one of claims 4-47, wherein the Rep open reading frame comprises a large Rep coding sequence operably linked to the second promoter, andwherein the large Rep coding sequence comprises a small Rep coding sequence.

49. The polynucleotide of claim 48, wherein the large Rep coding sequence encodes one or more large Rep proteins and the small Rep coding sequence encodes one or more small Rep proteins.

50. The polynucleotide of claim 48 or claim 49, wherein the large Rep coding sequence further comprises a pl9 promoter upstream of the small Rep coding sequence.

51. The polynucleotide of claim 50, wherein the small Rep coding sequence is operably linked to the p 19 promoter.

52. The polynucleotide of any one of claims 49-51, wherein:MF-367351030 265324632001440a) the one or more large Rep proteins comprises Rep78 and the one or more small Rep protein comprises Rep 52, orb) the one or more large Rep proteins comprises Rep78 and Rep68 and the one or more small Rep protein comprises Rep52 and Rep40.

53. The polynucleotide of any one of claims 4-52, where in the Rep open reading frame comprises from 5’ to 3’:a) the large Rep coding sequence,b) an intron comprising:i) a third promoter, andii) a first excisable element that comprises a coding sequence comprising a stop signaling sequence flanked by a first recombination site and a second recombination site, andc) the small Rep coding sequence.

54. The polynucleotide of claim 53, wherein the intron is a synthetic intron comprising from 5’ to 3’:i) a 5 ’ splice donor site,ii) the third promoteriii) the first excisable element further comprising a first 3 ’ splice acceptor site upstream of the coding sequence comprising a stop signaling sequence, andiv) a second 3’ splice acceptor site,wherein the splice donor and the first and second acceptor sites are compatible with a cell used for expressing a large Rep protein.

55. The polynucleotide of claim 53 or claim 54, wherein the third promoter is operably linked to the small Rep coding sequence following a recombination event between the first recombination site and the second recombination site.

56. The polynucleotide of any one of claims 4-52, where in the Rep coding sequence comprises from 5’ to 3’:a) the large Rep coding sequence,b) the p 19 promoter,c) a first part of the small Rep coding sequence,d) an intron comprising a first excisable element that comprises a coding sequence comprising a stop signaling sequence flanked by a first recombination site and a second recombination site, andMF-367351030 266324632001440e) a second part of the small Rep coding sequence,wherein the first part and second part of the small Rep coding sequence form the small Rep coding sequence.

57. The polynucleotide of claim 56, wherein the intron is a synthetic intron comprising from 5’ to 3’:i) a 5 ’ splice donor site,ii) the first excisable element further comprising a first 3 ’ splice acceptor site upstream of the coding sequence comprising a stop signaling sequence, andiii) a second 3’ splice acceptor site,wherein the splice donor and first and second acceptor sites are compatible with a cell used for expressing a large Rep protein.

58. The polynucleotide of any one of claims 54-57, wherein the first 3’ splice site and the coding sequence comprising a stop signaling sequence in the second excisable element are excised following a recombination event between the first recombination site and the second recombination site.

59. The polynucleotide of any one of claims 53-58, where the first and second recombination sites comprise Lox sites or flippase recognition target (FRT) sites.

60. The polynucleotide of any of claims 53-59, wherein the first and second recombination sites comprise Lox sites.

61. The polynucleotide of any one of claims 53-60, wherein the coding sequence comprising a stop signaling sequence is a detectable marker, optionally wherein the detectable maker is luminescent marker, a radiolabel or a fluorescent marker.

62. The polynucleotide of claim 61, wherein the detectable maker comprises the nucleotide sequence of SEQ ID NO: 30, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

63. The polynucleotide of any one of claims 53-62, wherein the first excisable element comprises the nucleotide sequence of SEQ ID NO: 31 or SEQ ID NO: 32, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.MF-367351030 26732463200144064. The polynucleotide of any one of claims 55-63, wherein the recombination event between the first recombination site and the second recombination site is induced in the presence of a recombinase.

65. The polynucleotide of claim 64, wherein the recombinase is an inducible recombinase.

66. The polynucleotide of claim 65, wherein the inducible recombinase comprises a Cre recombinase.

67. The polynucleotide of claim 65 or claim 66, wherein the inducible recombinase is a Cre-ERT2 protein fusion.

68. The polynucleotide of any one of claims 53-55 and58-67, wherein the third promoter is heterologous to the small Rep coding sequence.

69. The polynucleotide of claim 68, wherein the third promoter has higher promoter activity compared to the second promoter.

70. The polynucleotide of any one of claims 42-69, where in the second promoter is a p5 promoter.

71. The polynucleotide of any one of claims 42-69, where in the second promoter is heterologous to the large Rep coding sequence.

72. The polynucleotide of any of claims 50-55and 58-71, wherein the pl9 promoter is mutated to substantially reduce promoter activity.

73. The polynucleotide of claim 72, wherein the pl9 promoter activity is reduced by at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or is undetectable as compared to the native pl9 promoter activity.

74. The polynucleotide of any of claims 53-73, wherein the second and / or third promoter is an inducible promoter or the second and / or third promoter is a constitutive promoter.MF-367351030 26832463200144075. The polynucleotide of any of claims 53-74, wherein the second promoter and the third promoter are independently selected from a ubiquitin C (UBC) promoter, a Rous sarcoma virus long terminal repeat (RSV) promoter, a chicken beta actin promoter, a cytomegalovirus (CMV) promoter, a CMV enhancer / chicken beta actin (CAG) promoter, and a phosphoglycerate kinase (PGK) promoter.

76. The polynucleotide of any of claims 53-75, wherein the second promoter and the third promoter independently comprise a nucleotide sequence selected from any one of SEQ ID NOs: 34-42,338, 339, 355, and 356 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing77. The polynucleotide of any of claims 53-76, wherein the second promoter is a UBC promoter and the third promoter is a CAG promoter.

78. The polynucleotide of any of claims 53-77, wherein the second promoter comprises nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 34 or SEQ ID NO: 37 and the third promoter comprises a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of SEQ ID NOs: 36, 39, 339, and 356.

79. The polynucleotide of any one of claims 42-78, wherein the AAV Rep expression cassette further comprises a polyadenylation (poly A) signal sequence downstream of the Rep open reading frame.

80. The polynucleotide of claim 79, wherein the polyA signal sequence is a native AAV Rep polyA signal sequence.

81. The polynucleotide of claim 79, wherein the polyA signal sequence is a heterologous polyA signal sequence.

82. The polynucleotide of claim 81, wherein the heterologous polyA signal sequence is selected from the group consisting of: a bovine growth hormone (bGH) polyA signal sequence, a human growth hormone (hGH) polyA signal sequence, a Simian Virus 40 (SV40) polyA signal sequence, a Chinese hamster growth hormone polyA signal sequence, a human neurophilin- 1 polyA signal sequence, a nopaline synthase polyA signal sequence, an alpha globulin polyA signal sequence, and a rabbit globin polyA signal sequence.MF-367351030 26932463200144083. The polynucleotide of claim 81 or claim 82, wherein the heterologous polyA signal sequence comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 43-51, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the foregoing.

84. The polynucleotide of any of claims 81-83, wherein the heterologous polyA signal sequence is a bGH polyA signal sequence.

85. The polynucleotide of any of claims 81-84, wherein the heterologous polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 43, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof.

86. The polynucleotide of any of claims 79-85, where the AAV Rep expression cassette further comprises an enhancer sequence downstream of the polyA signal sequence.

87. The polynucleotide of claim 86, wherein the enhancer is selected from a transcriptional enhancer, a translational enhancer, and a transcriptional and translational enhancer.

88. The polynucleotide of claim 86 or claim 87, wherein the enhancer comprises one or more sequences selected from the group consisting of SEQ ID NOs: 40, 52-56, and 98-201.

89. The polynucleotide of claim 86 or claim 87, comprises one or more of a human telomerase reverse transcriptase (hTERT), a Simian virus 40 (SV40), or a CMV enhancer.

90. The polynucleotide of any one of claims 86-89, wherein the enhancer comprises the nucleotide sequence of one or more of SEQ ID NOs: 52-54, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the foregoing.

91. The polynucleotide of any one of claims 86-89, wherein the enhancer is a double enhancer comprising a Simian virus 40 (SV40) and a CMV enhancer.MF-367351030 27032463200144092. The polynucleotide of claim 91, wherein the double enhancer comprises the nucleotide sequence of SEQ ID NO: 55, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof.

93. The polynucleotide of any one of claims 86-89, wherein the enhancer is a triple enhancer comprising a telomerase reverse transcriptase (hTERT), a Simian virus 40 (SV40), and a CMV promoter / enhancer.

94. The polynucleotide of any of claims 86-93, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 56, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof.

95. The polynucleotide of any of claims 79-94, wherein the AAV Rep expression cassette further comprises a second excisable element downstream of the Rep open reading frame and upstream of the polyA signal sequence,wherein the second excisable element comprises a sequence encoding a ribozyme flanked by a third recombination site and a fourth recombination site, andwherein the ribozyme mediates degradation of an RNA encoding the ribozyme.

96. The polynucleotide of claim 95, wherein the sequence encoding the ribozyme is excised following a recombination event between the third recombination site and the fourth recombination site97. The polynucleotide of claim 95 or claim 96, where the third and fourth recombination sites comprise Lox sites or flippase recognition target (FRT) sites.

98. The polynucleotide of any of claims 95-97, wherein the third and fourth recombination sites comprise Lox sites.

99. The polynucleotide of any of claims 95-98, wherein:the first and second recombination sites comprise LoxP sequences and the third and fourth recombination sites comprise LoxN sequences, orthe first and second recombination sites comprise LoxN sequences and the third and fourth recombination sites comprise LoxP sequences.MF-367351030 271324632001440100. The polynucleotide of any one of claims 95-99, wherein the ribozyme is a self-cleaving ribozyme.

101. The polynucleotide of any one of claims 95-100, wherein the ribozyme is a Hammerhead ribozyme.

102. The polynucleotide of any of claims 95-101, wherein the ribozyme is selected from the group consisting of: a Hammerhead ribozyme Type I, a Hammerhead ribozyme Type II, a Hammerhead ribozyme Type III, a Hammerhead ribozyme HH9, a Hammerhead ribozyme HH10, and a RAGATH-1-hammerhead ribozyme.

103. The polynucleotide of any one of claims 95-102, wherein the sequence encoding the ribozyme comprises the nucleotide sequence of SEQ ID NO: 20, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof.

104. The polynucleotide of any one of claims 42-103, wherein the Rep open reading frame encodes Rep proteins from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV13, AAV 14, AAV 15 and AAV 16, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV. PHP. B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16 or AAVhu68.

105. The polynucleotide of any one of claims 42-104, wherein the Rep open reading frame encodes Rep proteins from AAV2.

106. The polynucleotide of any one of claims 48-105, wherein the large Rep coding sequence comprises a Rep78 and / or Rep 68 coding sequence comprising the nucleotide sequence of SEQ ID NO: 70 or SEQ ID NO:71, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

107. The polynucleotide of any one of claims 48-106, wherein the small Rep coding sequence comprises a Rep52 coding sequence comprising the nucleotide sequence of SEQ ID NO: 72, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.MF-367351030 272324632001440108. The polynucleotide of claims 56-107, wherein the first part of the small Rep coding sequence comprises the nucleotide sequence of SEQ ID NO: 73 and the second part of the small Rep coding sequence comprises the nucleotide sequence of SEQ ID NO: 74.

109. The polynucleotide of any one of claims 48-108, wherein the small Rep coding sequence further comprises a Rep40 coding sequence comprising the nucleotide sequence of SEQ ID NO 75, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

110. The polynucleotide of any one of claims 1-109, wherein the AAV Rep expression cassette comprises the nucleotide sequence of any one of SEQ ID NOs: 76, 77, 82, 308, 309, 334, 456-458, 463, and 468, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

111. The polynucleotide of any one of claims 1-110, further comprising a first selection cassette, wherein the first selection cassette comprises, from 5’ to 3’, a first constitutive promoter operably linked to a nucleotide sequence encoding a first selectable marker.

112. The polynucleotide of claim 111, wherein the first selection cassette is located downstream of the AAV Cap selection cassette and is in the same orientation as the AAV Cap selection cassette.

113. The polynucleotide of claim 111 or claim 112, wherein the first constitutive promoter is an EFla promoter.

114. The polynucleotide of claim 113, wherein the EFla promoter has a TATA box mutation.

115. The polynucleotide of claim 113 or claim 114, wherein the first constitutive promoter comprises the nucleotide sequence of SEQ ID NO: 438, SEQ ID NO: 78 or SEQ ID NO:79, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

116. The polynucleotide of any of claims 111-115, wherein the first selectable marker is an antibiotic resistance gene.MF-367351030 273324632001440117. The polynucleotide of claim 116, wherein the antibiotic resistance gene is selected from the group consisting of: a blasticidin resistance gene, a hygromycin resistance gene, a puromycin resistance gene, and an ampicillin resistance gene.

118. The polynucleotide of any of claims 111-117, wherein the first selectable marker is a split selectable marker comprising: a) a first part of a blasticidin resistance gene linked to an N-intein, or b) a C-intein linked to a second part of a blasticidin resistance gene.

119. The polynucleotide of claim 118, wherein the first selectable marker comprises the nucleotide sequence of SEQ ID NO: 80 or SEQ ID NO: 84, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

120. A polynucleotide comprising an AAV Cap expression cassette, wherein the AAV Cap expression cassette comprises the nucleotide sequence of any one of SEQ ID NOs: 68, 69, 326, 327, 480 and 482 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

121. A polynucleotide comprising:i) an AAV Cap expression cassette comprising the nucleotide sequence of any one of SEQ ID NOs: 68, 69, 326327, 480, and 482, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing,ii) an AAV Rep expression cassette comprising the nucleotide sequence of any one of SEQ ID NOs: 76,77, 82, 308, 309, 334, 456-458, 463, and 468, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing, andiii) a selection cassette comprising the nucleotide sequence of SEQ ID NO: 81, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

122. A polynucleotide comprising the nucleotide sequence of any of SEQ ID NOs: 13, 18, 22, 24, 329 330, 452-455, and 464-465, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.MF-367351030 274324632001440123. A polynucleotide comprising the nucleotide sequence of any of SEQ ID NOs: 13, 18, 22, 24, 329, 330, 452-455, and 464-465.

124. A system of polynucleotides comprising:a) a first polynucleotide comprising the polynucleotide of any one of claims 1-123 ; and b) a second polynucleotide comprising a first expression cassette,wherein the first expression cassette comprises a nucleotide sequence encoding one or more AAV helper proteins.

125. The system of polynucleotides of claim 124, wherein the first expression cassette further comprises an inducible promoter.

126. The system of polynucleotides of claim 124 or claim 125, wherein the first expression cassette comprises, from 5’ to 3’:a) an inducible promoter,b) a self-excising element that comprises a sequence encoding a recombinase that is flanked by a fifth recombination site and a sixth recombination site, andc) a nucleotide sequence encoding one or more helper proteins,wherein the recombinase is operably linked to the inducible promoter.

127. The system of polynucleotides of any of claims 124-126, wherein the inducible promoter comprises a tetracycline response element (TRE).

128. The system of polynucleotides of claim 127, wherein the TRE comprises Tet operator (tetO) sequence concatemers fused to a minimal promoter.

129. The system of polynucleotides of claim 128, wherein the tetO sequence concatamers comprises the sequence of SEQ ID NO: 27.

130. The system of polynucleotides of claim 128 or claim 129, wherein the minimal promoter is a human cytomegalovirus promoter.

131. The system of polynucleotides of claim 130, wherein the minimal promoter comprises the nucleotide sequence of SEQ ID NO: 28.MF-367351030 275324632001440132. The system of polynucleotides of any of claims 125-131, wherein the inducible promoter comprises the nucleotide sequence of SEQ ID NO: 25 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

133. The system of polynucleotides of any of claims 125 -132, wherein the inducible promoter comprises the nucleotide sequence of SEQ ID NO: 25.

134. The system of polynucleotides of any of claims 125-133, where in the inducible promoter of the second polynucleotide is the same as the inducible promoter of the first polynucleotide.

135. The system of polynucleotides of any of claims 125-134, wherein the inducible promoter is activated in the presence of a first triggering agent.

136. The system of polynucleotides of claim 135, wherein the first triggering agent is doxycycline.

137. The system of polynucleotides of claim 126-136, wherein the sequence encoding the recombinase in the self-excising element is excised following a recombination event between the fifth recombination site and the sixth recombination site.

138. The system of polynucleotides of any one of claims 126-137, wherein the inducible promoter is operably linked to the sequence encoding one or more AAV helper proteins following a recombination event between the fifth recombination site and the sixth recombination site.

139. The system of polynucleotides of any one of claims 126-138, wherein the recombinase is a Cre recombinase or a flippase (FLP) recombinase.

140. The system of polynucleotides of any one of claims 126-139, wherein the recombinase is a Cre recombinase.

141. The system of polynucleotides of any one of claims 126-140, wherein the fifth recombination and sixth recombination sites comprise Lox sequences.

142. The system of polynucleotides of any one of claims 126-141, wherein the recombinase is an inducible recombinase.MF-367351030 276324632001440143. The system of polynucleotides of claim 142, wherein the inducible recombinase is a Cre recombinase fused to an estrogen receptor ligand binding domain.

144. The system of polynucleotides of claim 142 or claim 143, wherein the inducible recombinase is a Cre-ERT2 fusion protein.

145. The system of polynucleotides of any one of claims 142-144, wherein the inducible recombinase translocates to the nucleus in the presence of a second triggering agent.

146. The system of polynucleotides of claim 145, wherein the second triggering agent is an estrogen receptor ligand.

147. The system of polynucleotides of any one of claims 145 or 146, wherein the second triggering agent is a selective estrogen receptor modulator (SERM).

148. The system of polynucleotides of claim 147, wherein the second triggering agent is tamoxifen.

149. The system of polynucleotides of any one of claims 142-148, wherein the inducible recombinase comprises the nucleotide sequence of SEQ ID NO: 225, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

150. The system of polynucleotides of any one of claims 145-149, wherein the recombination event between the fifth recombination site and the sixth recombination site is induced in the presence of the first and second triggering agents.

151. The system of polynucleotides of any of claims 124-150, wherein the sequence encoding the one or more AAV helper proteins is a bistronic open reading frame encoding at least two AAV helper proteins.

152. The system of polynucleotides of any of claims 124-151, wherein the one or more helper proteins comprise E2A and E4.MF-367351030 277324632001440153. The system of polynucleotides of claim 152, wherein the E2A protein is encoded by a nucleotide sequence comprising SEQ ID NO: 226 and SEQ ID NO: 227, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

154. The system of polynucleotides of claim 152 or claim 153, wherein the E4 protein is encoded by a nucleotide sequence comprising SEQ ID NO: 228, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

155. The system of polynucleotides of any one of claims 152-154, wherein the sequence coding for E2A and the sequence coding for E4 are separated by an internal ribosome entry site (IRES) or by a cleavable linker.

156. The system of polynucleotides of claim 155, wherein the cleavable linker is a 2A peptide, optionally wherein the 2A peptide is P2A, T2A, F2A, or E2A.

157. The system of polynucleotides of any one of claims 152-155, wherein the sequence coding for E2A and the sequence coding for E4 are separated by an internal ribosome entry site (IRES).

158. The system of polynucleotides of claim 157, wherein the IRES comprises the nucleotide sequence of SEQ ID NO: 229, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

159. The system of polynucleotides of any of claims 124-158, wherein the first expression cassette comprises the nucleotide sequence of SEQ ID NO: 230, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

160. The system of polynucleotides of any of claims 124-159, wherein the second polynucleotide further comprises a second expression cassette comprising a second constitutive promoter operably linked to a nucleotide sequence encoding an activator.

161. The system of polynucleotides of claim 160, wherein the second expression cassette is in an opposite orientation relative to the first expression cassette.MF-367351030 278324632001440162. The system of polynucleotides of claim 160 or claim 161, wherein the first expression cassette is oriented 3’ to 5’ and the second expression cassette is oriented 5’ to 3’, or the first expression cassette is oriented 5 ’ to 3 ’ and the second expression cassette is oriented 3 ’ to 5 ’ .

163. The system of polynucleotides of any of claims 160-162, wherein the first expression cassette is separated from the second expression cassette by an intervening sequence.

164. The system of polynucleotides of claim 163, wherein the intervening sequence comprises a transcriptional blocking element (TBE).

165. The system of polynucleotides of claim 164, wherein the TBE element comprises the sequence of SEQ ID NO: 33 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

166. The system of polynucleotides of any of claims 160-165, wherein the activator activates transcription from the inducible promoter of the first polynucleotide and / or the second polynucleotide in the presence of a first triggering agent.

167. The system of polynucleotides of claims 166, wherein the first triggering agent is doxycycline.

168. The system of polynucleotides of any one of claims 160-167, wherein the activator is Tet-on3G.

169. The system of polynucleotides of any of claims 160-168, wherein the activator comprises the nucleotide sequence of SEQ ID NO: 232 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

170. The system of polynucleotides of any one of claims 160-169, wherein the second constitutive promoter is an EFla promoter.

171. The system of polynucleotides of claim 170, wherein the EFla promoter has a TATA box mutation.MF-367351030 279324632001440172. The system of polynucleotides of any one of claims 160-171, wherein the second constitutive promoter comprises the nucleotide sequence of SEQ ID NO: 438, SEQ ID NO: 78 or SEQ ID NO: 79, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

173. The system of polynucleotides of any of claims 160-172, wherein the second expression cassette comprises the nucleotide sequence of SEQ ID NO: 233, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

174. The system of polynucleotides of any of claims 124-173, wherein the second polynucleotide further comprises a third expression cassette comprising a first part of a third constitutive promoter, a third excisable element, a second part of a third constitutive promoter and a sequence encoding VA RNA.

175. The system of polynucleotides of claim 174, wherein the third expression cassette is downstream of the second expression cassette and is in the same orientation as the second expression cassette.

176. The system of polynucleotides of claim 174 or claim 175, wherein the third excisable element is in an opposite orientation relative to the third constitutive promoter.

177. The system of polynucleotides of any one of claims 174-176 , wherein the third excisable element comprises a second selection cassette flanked by a seventh recombination site and an eighth recombination site.

178. The system of polynucleotides of claim 177, wherein the second selection cassette is excised following a recombination event between the seventh recombination site and the eighth recombination site thereby generating a functionally complete third constitutive promoter operably linked to the sequence encoding VA RNA.

179. The system of polynucleotides of any of claims 174-178, wherein the first part of third the constitutive promoter comprises a U6 promoter distal sequence element (DSE) and the second part of the third constitutive promoter comprises a U6 promoter proximal sequence element (PSE).MF-367351030 280324632001440180. The system of polynucleotides of claim 179, wherein the U6 promoter DSE comprises the nucleotide sequence of SEQ ID NO: 234, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

181. The system of polynucleotides of claim 179 or claim 180, wherein the U6 promoter PSE comprises the nucleotide sequence of SEQ ID NO: 235, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

182. The system of polynucleotides of any of claims 174-181, wherein the sequence encoding VA RNA is a transcriptionally dead sequence.

183. The system of polynucleotides of any of claims 174-182, wherein the sequence encoding VA RNA comprises at least two mutations in an internal promoter.

184. The system of polynucleotides of claim 183, wherein the at least two mutations comprise a G16A mutation and a G60A mutation with reference to SEQ ID NO: 236.

185. The system of polynucleotides of any of claims 174-184, wherein the sequence encoding VA RNA comprises the nucleotide sequence of SEQ ID NO: 237 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

186. The system of polynucleotides of any of claims 177-185, wherein the second selection cassette comprises a fourth constitutive promoter operably linked to a nucleotide sequence encoding second selectable marker.

187. The system of polynucleotides of claim 186, wherein the second selectable marker is a puromycin resistance gene.

188. The system of polynucleotides of claim 187, wherein the puromycin resistance gene comprises the nucleotide sequence of SEQ ID NO: 238, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

189. The system of polynucleotides of any of claims 186-188, wherein the fourth constitutive promoter is a CMV promoter.MF-367351030 281324632001440190. The system of polynucleotides of any of claims 177-189, wherein the second selection cassette comprises the nucleotide sequence of SEQ ID NO: 357, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

191. The system of polynucleotides of any of claims 174-190, wherein the third expression cassette comprises the nucleotide sequence of SEQ ID NO: 239, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

192. The system of polynucleotides of any of claims 124-191, wherein the second polynucleotide comprises the sequence of SEQ ID NO: 240 or SEQ ID NO: 241, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

193. The system of polynucleotides of any of claims 124-192, further comprising a third polynucleotide comprising a payload expression cassette flanked by AAV ITR sequences, wherein the payload expression cassette comprises a fifth constitutive promoter operably linked to a nucleotide sequence encoding a payload.

194. The system of polynucleotides of claim 193, wherein the fifth constitutive promoter is an RSV promoter.

195. The system of polynucleotides of claim 194, wherein the RSV promoter comprises the nucleotide sequence of SEQ ID NO: 41, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

196. The system of polynucleotides of any one of claims 193-195, wherein the sequence of the payload comprises a polynucleotide sequence coding for a gene.

197. The system of polynucleotides of claim 196, wherein the gene codes for a selectable marker or detectable marker.

198. The system of polynucleotides of claim 196 or claim 197, wherein the gene codes for a therapeutic polypeptide or transgene.MF-367351030 282324632001440199. The system of polynucleotides of any one of claims 193-198, wherein the sequence of the payload comprises a polynucleotide sequence coding for a therapeutic polynucleotide.

200. The system of polynucleotides of claim 199, wherein the therapeutic polynucleotide is a tRNA suppressor or a guide RNA.

201. The system of polynucleotides of claim 200, wherein the guide RNA is a polyribonucleotide capable of binding to a protein.

202. The system of polynucleotides of claim 201, wherein the protein is nuclease.

203. The system of polynucleotides of claim 201 or claim 202, wherein the protein is a Cas protein, an ADAR protein, or an AD AT protein.

204. The system of polynucleotides of claim 203, wherein the Cas protein is catalytically inactive Cas protein.

205. The system of polynucleotides of any of claims 193-204, wherein the third polynucleotide further comprises a third selection cassette, where in the third selection cassette comprises a sixth constitutive promoter operably linked to a sequence encoding a third selectable marker.

206. The system of polynucleotides of claim 205, wherein the third selectable marker is an antibiotic resistance gene.

207. The system of polynucleotides of claim 205 or claim 206, wherein the third selectable marker comprises a second part of a split blasticidin resistance gene.

208. The system of polynucleotides of any one of claims 205-207 wherein the third selectable marker comprises the nucleotide sequence of SEQ ID NO: 84 or SEQ ID NO: 80, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

209. The system of polynucleotides of any one of claims 205-208, wherein the sixth constitutive promoter is an EFla promoter.MF-367351030 283324632001440210. The system of polynucleotides of claim 209, wherein the EFla promoter has a TATA box mutation.

211. The system of polynucleotides of any one of claims 205-209, wherein the sixth constitutive promoter comprises the nucleotide sequence of SEQ ID NO: 439 or SEQ ID NO:282, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

212. The system of polynucleotides of any of claims 205-211, wherein the third selection cassette comprises the nucleotide sequence of SEQ ID NO: 210, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

213. The system of polynucleotides of any of claims 193-212, wherein the third polynucleotide comprises the sequence of SEQ ID NO: 337 or SEQ ID NO: 248, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

214. The system of polynucleotides of any of claims 193-213, further comprising a fourth polynucleotide comprising a late-stage gene expression cassette,wherein the late stage gene expression cassette comprises a fourth promoter operably linked to an L4 coding sequence.

215. The system of polynucleotides of claim 214, wherein the fourth promoter is an inducible promoter.

216. The system of polynucleotides of claim 214 or claim 215, wherein the L4 coding sequence comprises one or both of a 22K-L4 sequence and a 33K-L4 sequence.

217. The system of polynucleotides of any of claims 214-216, wherein the L4 coding sequence comprises a 22K-L4 sequence.

218. The system of polynucleotides of claim 216 or claim 217, wherein the 22K-L4 comprises a nucleotide sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO: 224.MF-367351030 284324632001440219. The system of polynucleotides of any one of claims 216-218, wherein the 22K-L4 comprises the nucleotide sequence of SEQ ID NO: 224.

220. The system of polynucleotides of any one of claims 216-219, wherein the 22K-L4 sequence encodes an 22K-L4 protein comprising an amino acid sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO: 223.

221. The system of polynucleotides of any one of claims 216-220, wherein the 22K-L4 sequence encodes an 22K-L4 protein comprising the amino acid sequence of SEQ ID NO: 223.

222. The system of polynucleotides of any one of claims 216 and 218-221, wherein the 33K-L4 sequence comprises a nucleotide sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO: 222.

223. The system of polynucleotides of claims 216 and 218-222, wherein the 33K-L4 sequence comprises the nucleotide sequence of SEQ ID NO: 222.

224. The system of polynucleotides of any one of claims 216 and 218-223, wherein the 33K-L4 sequence encodes an 33K-L4 protein comprising an amino acid sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO: 221.

225. The system of polynucleotides of any one of claims 216 and 213-219, wherein the 33K-L4 sequence encodes an 33K-L4 protein comprising the amino acid sequence of SEQ ID NO: 221.

226. The system of polynucleotides of any one of claims 214-225, wherein the L4 coding sequence encodes the L422K and L433K proteins.

227. The system of polynucleotides of any one of claims 214-226, wherein the L4 coding sequence comprises a nucleotide sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO: 220.

228. The system of polynucleotides of any one of claims 214-227, wherein the L4 coding sequence comprises the nucleotide sequence of SEQ ID NO: 220.MF-367351030 28532463200144019. The system of polynucleotides of any of claims 214-228, wherein the inducible promoter comprises a tetracycline response element (TRE).

230. The system of polynucleotides of claim 229, wherein the TRE comprises Tet operator (tetO) sequence concatemers fused to a minimal promoter.

231. The system of polynucleotides of claim 230, wherein the tetO sequence concatamers comprises the sequence of SEQ ID NO: 27.

232. The system of polynucleotides of claim 230 or claim 231, wherein the minimal promoter is a human cytomegalovirus promoter.

233. The system of polynucleotides any one of claims 230-232, wherein the minimal promoter comprises the sequence of SEQ ID NO: 28.

234. The system of polynucleotides of any one of claims 215-233, wherein the inducible promoter comprises a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO: 25.

235. The system of polynucleotides of any one of claims 215-234, wherein the inducible promoter comprises a sequence of SEQ ID NO: 25.

236. The system of polynucleotides of any of claims 215-235, wherein the inducible promoter of the fourth polynucleotide is the same as the inducible promoter of the first and / or second polynucleotides.

237. The system of polynucleotides of any one of claims 215-236, wherein:the inducible promoter of the fourth polynucleotide and the first polynucleotide are the same; the inducible promoter of the fourth polynucleotide and the second polynucleotide are the same; the inducible promoter of the first polynucleotide and the second polynucleotide are the same; or the inducible promoter of the fourth polynucleotide, the first polynucleotide, and the second polynucleotide are the same.

238. The system of polynucleotides of any one of claims 215-237, wherein transcription of the L4 coding sequence is activated from the inducible promoter upon binding of an activator.MF-367351030 286324632001440239. The system of polynucleotides of claim 238, wherein the activator binds to the inducible promoter in the presence of a first triggering agent.

240. The system of polynucleotides of any of claims 214-239, wherein the fourth polynucleotide further comprises a fourth selection cassette, wherein the fourth selection cassette comprises a fourth constitutive promoter operably linked to a sequence encoding a fourth selectable marker.

241. The system of polynucleotides of claim 240, wherein the fourth constitutive promoter is an EFla promoter.

242. The system of polynucleotides of claim 240 or claim 241, wherein fourth selectable marker is an antibiotic resistance protein.

243. The system of polynucleotides of claim 242, wherein the antibiotic resistance protein is selected from a hygromycin resistance protein, a puromycin resistance protein, and an ampicillin resistance protein.

244. The system of polynucleotides of claim 242 or claim 243, wherein the antibiotic resistance protein is a hygromycin resistance protein.

245. The system of polynucleotides of claim 244, wherein the sequence of the fourth selectable marker comprises a sequence identity with at least 70%, 80%, 90%, 95%, 99%, or 100% to SEQ ID NO: 219, optionally wherein the selectable marker comprises the sequence of SEQ ID NO: 219.

246. The system of polynucleotides of any one of claims 240-245, wherein the fourth selectable marker is a split selectable marker, wherein the polynucleotide comprises a first part of the selectable marker sequence fused to a first reassembly module and wherein a second polynucleotide provides the second part of the selectable marker sequence fused to a second reassembly module.

247. The system of polynucleotides of claim 246, wherein the first and second reassembly modules are selected from two complementary halves of a split intein (N-intein and C-intein) or leucine zippers.MF-367351030 287324632001440248. The system of polynucleotides of any one of claims 246 and 247, wherein the fourth selectable marker is a split selectable marker that is a split antibiotic resistance protein and the polynucleotide comprises a sequence selected from:a split intein linked to an N-terminus of the first part of the antibiotic resistance protein or a split intein linked to a C-terminus of the first part of the antibiotic resistance protein; and a leucine zipper linked to an N-terminus of the first part of the antibiotic resistance protein or leucine zipper linked to a C-terminus of the first part of the antibiotic resistance protein.

249. The system of polynucleotides of any one of claims 242-248, wherein the fourth selectable marker is a first part of a split blasticidin resistance gene intein.

250. The system of polynucleotides of any one of claims 242-248, wherein the fourth selectable marker is a first part of a split hygromycin resistance gene intein.

251. The system of polynucleotides of any one of claims 240-250, wherein the fourth selectable marker is a mammalian cell selection element;optionally, wherein the mammalian cell selection element is an auxotrophic selection element;optionally, wherein the auxotrophic selection element codes for an active protein; and optionally, wherein the active protein is DHFR.

252. The system of polynucleotides of any one of claims 214-251, wherein the fourth polynucleotide further comprises a sequence for integration into the genome of a cells, optionally wherein the sequence comprises a 5’ sequence and a 3’ sequence.

253. The system of polynucleotides of claim 252, wherein the integration is by transposon system integration, wherein the sequence for integration comprises a transposon 5 ’ inverted terminal repeat and a transposon 3’ inverted terminal repeat that are able to be recognized by a transposase.

254. The system of polynucleotides of any of claims 214-253, wherein the polynucleotide comprises a 5’ inverted terminal repeat (ITR) upstream of the late-stage gene cassette and a 3’ITR downstream of the late-stage gene cassette, wherein the 5’ ITR and 3’ ITR are for integration of the latestage gene cassette into the genome of a cell by a transposon system.MF-367351030 288324632001440255. The system of polynucleotides of claim 253 or claim 254, wherein the transposon system is a Piggybac system.

256. The system of polynucleotides of claim 252, wherein the integration is by homology directed repair (HDR) into a target loci, wherein the sequence for integration comprises 5’ and 3’ homology arms that are each independently complementary to a sequence of the target loci flanking the site of integration.

257. The system of polynucleotides of any of claims 214-252 and 256, wherein the polynucleotide comprises a 5’ homology arm upstream of the late-stage gene cassette and a 3’ homology arm downstream of the late-stage gene cassette, wherein the 5’ and 3’ homology arms are for targeted knock-in of the late-stage gene cassette by homology directed repair (HDR) into a target loci and are each independently complementary to a sequence of the target loci flanking a site of integration.

258. The system of polynucleotides of claim 256 and claim 257, wherein the target loci is a safe harbor locus, optionally wherein the safe harbor locus is Rogi-1.

259. The system of polynucleotides of any one of claims 214-258, wherein the late stage-gene expression cassette comprises a nucleotide sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO:360.

260. The system of polynucleotides of any one of claims 214-259, wherein the fourth polynucleotide comprises a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO: 214.

261. The system of polynucleotides of any one of claims 214-260, wherein the fourth polynucleotide comprises the sequence of SEQ ID NO: 214.

262. The system of polynucleotides of any one of claims 214-261, wherein the fourth polynucleotide comprises a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO: 215.

263. The system of polynucleotides of any one of claims214-262, wherein the fourth polynucleotide comprises the sequence of SEQ ID NO: 215.MF-367351030 289324632001440264. A vector comprising the polynucleotide of any of claims 1-123.

265. A vector comprising a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of any one of SEQ ID NOs: 87, 92, 95,97, 332, 333, 459-462, and 466-467.

266. A vector comprising a sequence of any one of SEQ ID NOs: 87, 92, 95,97, 332, 333, 459-462, and 466-467.

267. A vector system for inducible production of recombinant adeno-associated virus (rAAV) comprising:a first vector comprising the first polynucleotide of any of claims 1-123;a second vector comprising the second polynucleotide of any of claims 124-192; anda third vector comprising the third polynucleotide of any of claims 192-213.

268. A vector system for inducible production of recombinant adeno-associated virus (rAAV) comprising:a first vector comprising the first polynucleotide of any of claims 1-123;a second vector comprising the second polynucleotide of any of claims 124-192;a third vector comprising the third polynucleotide of any of claims 193-213; and a fourth vector comprising the fourth polynucleotide of any of claims 214-263.

269. A cell comprising the polynucleotide of any of claims 1-123.

270. The cell of claim 269, wherein the polynucleotide is integrated into the genome of the cell.

271. A cell comprising the system of polynucleotides of any of claims 124-263.

272. A cell comprising the vector of claim 264, or the vector system of claim 267 or claim 268.

273. A cell for inducible production of recombinant AAV (rAAV) comprising the system of polynucleotides of any of claims 124-263 or the vector system of claim 267 or claim 268.MF-367351030 290324632001440274. The cell of claim 273, wherein one or more of the polynucleotides of the system of polynucleotides are stably integrated into the cell.

275. The cell of claim 273 or claim 274, wherein rAAV production is induced in the presence of a first triggering agent and a second triggering agent.

276. The cell of claim 275, wherein the first triggering agent activates the inducible promoters and the second triggering agent activates the inducible recombinase.

277. The cell of claim 276, wherein, upon induction, the cell is capable of producing increased rAAV titer relative to a comparable cell where the Cap expression cassette comprises a native splice donor site sequence.

278. The cell of any of claims 273-277, wherein the first polynucleotide is stably integrated into the cell.

279. The cell of any of claims 273-278, wherein the second polynucleotide is stably integrated into the cell.

280. The cell of any of claims 273-249, wherein the third polynucleotide is stably integrated into the cell.

281. The cell of any of claims 273-280, wherein the fourth polynucleotide is stably integrated into the cell.

282. The cell of any of claims 273-280, wherein each of the first, second, and third polynucleotide are stably integrated into the cell.

283. The cell of any of claims 273-282, wherein the first, second, third and fourth polynucleotide are stably integrated into the cell.

284. The cell of any of claims 271-283, wherein the cell is a mammalian cell.

285. The cell of claim 284, wherein the mammalian cell is a HEK293 cell.MF-367351030 291324632001440286. The cell of claim 285, wherein the HEK293 cell expresses AAV helper proteins E1A and E1B.

287. The cell of any one of claims 269-286, wherein the cell further comprises a knockout of one or more genes encoding a protein involved in programmed cell death.

288. The cell of claim 287, wherein the protein involved in programmed cell death comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or fourteen of CASP3, CASP6, CASP7, AIF1, BAK1, BAX, IFNAR1, MYD88, TICAM1, TIRAP, RIGI, CGAS, STING, AIM2, DFFB, and IFI16.

289. The cell of claim 287 or claim 288, wherein the protein involved in programmed cell death comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or eight of CASP3, CGAS, STING1, IFNAR1, MYD88, BAK, BAK1, and DFFB.

290. The cell of any one of claims 287-289, wherein the protein involved in programmed cell death comprises CASP3.

291. The cell of any one of claims 287-290, wherein the knockout comprises a deletion in an exon within each of the one or more genes.

292. The cell of any one of claims 287-291, wherein the knockout was performed using a CRISPR system, optionally wherein the CRISPR system comprises a nuclease and at least one guide RNA.

293. A method for inducible production of recombinant AAV (rAAV) comprising contacting the cell of any of claims 273-292 with a first triggering agent and a second triggering agent, wherein the first triggering agent activates transcription of the inducible promoters in the first and second polynucleotides or activates transcription of the inducible promoters in the first, second and fourth polynucleotides, andwherein the second triggering agent activates translocation of the inducible recombinase to the nucleus of the cell to induce recombination between the recombination sites flanking each excisable element in the first and second polynucleotides,thereby inducing rAAV production.MF-367351030 292324632001440294. The method of claim 293, wherein the first triggering agent is doxycycline and the second triggering agent is tamoxifen.

295. The method of claim 293 or claim 294, further comprising contacting the cell with an apoptosis inhibitor.

296. The method of claim 295, wherein the apoptosis inhibitor is zV AD. fink.

297. A method of generating a cell for inducibly producing rAAV comprising introducing into a cell the system of polynucleotides of any of claims 124-263 or the vector system of claim 267 or claim 268.

298. The method of claim 297, further comprising performing a knockout of one or more genes encoding a protein involved in programmed cell death.

299. The method of claim 298, wherein the protein involved in programmed cell death comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or fourteen of CASP3, CASP6, CASP7, AIF1, BAK1, BAX, IFNAR1, MYD88, TICAM1, TIRAP, RIGI, CGAS, STING, AIM2, DFFB, and IFI16.

300. The method of claim 298 or claim 299, wherein the protein involved in programmed cell death comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or eight of CASP3, CGAS, STING1, IFNAR1, MYD88, BAK, BAK1, and DFFB.

301. The method of any one of claims298-300, wherein the protein involved in programmed cell death comprises CASP3.

302. The method of any one of claims 298-301, wherein the knockout comprises a deletion in an exon within each of the one or more genes.

303. The method of any one of claims 298-302, wherein performing the knockout comprises using a CRISPR system.MF-367351030 293324632001440304. The method of any one of claims 298-303, wherein performing the knockout comprises contacting the cell with a nuclease and at least one guide RNA, optionally wherein the nuclease is Cas9.

305. The method of claim 304, wherein the nuclease and at least one guide RNA is introduced into the cell by delivering a ribonucleoprotein (RNP) complex by electroporation.MF-367351030 294