Modified oligonucleotides

Abstract

The present disclosure provides modified oligonucleotides, modified guides, and methods of use thereof.

Description

[0001] EDIT0005WO / 68KM-408384-WO

[0002] MODIFIED OLIGONUCLEOTIDES

[0003] Sequence Listing

[0004] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled EDIT0005SEQ.xml created March 6, 2026, which is 126,784 bytes in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

[0005] Field

[0006] The present disclosure provides modified oligonucleotides, modified guides, and methods of use thereof.

[0007] Background

[0008] Gene editing technology is useful for inserting, deleting, modifying, or replacing nucleobases in target nucleic acids. CRISPR guided gene editing is effected by a multi-component complex that identifies specific nucleobase sequences to direct cleavage or modification of target nucleic acids. Gene editing can be used to treat or cure disease.

[0009] Summary

[0010] The present disclosure provides modified oligonucleotides, modified guides, and methods of use thereof. Modified oligonucleotides and modified guides may be useful in gene editing.

[0011] Brief Description of the Drawings

[0012] Figure 1 shows an editing system comprising a Cas protein and guide interacting with a double-stranded target nucleic acid, labeled with the spacer sequence and scaffold sequence of the guide; and the target strand, non-target strand, anti-spacer sequence, protospacer sequence, and edit regions of the target nucleic acid. Figure 2 shows an editing system comprising a Cas protein and guide interacting with a single-stranded target nucleic acid, labeled with the spacer sequence and scaffold sequence of the guide; and the anti-spacer sequence, and edit region of the target nucleic acid.

[0013] Detailed Description

[0014] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and / or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and

[0015] SMRH:4931-9018-2038.1 1EDIT0005WO / 68KM-408384-WO components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

[0016] As used herein, numerical ranges are provided for certain quantities. It is to be understood that these ranges comprise all subranges therein. Thus, the range “from 50 to 80” includes all possible ranges therein (e.g., 51-79, 52-78, 53-77, 54-76, 55-75, 60-70, etc.). Furthermore, all values within a given range may be an endpoint for the range encompassed thereby (e.g., the range 50-80 includes the ranges with endpoints such as 55-80, 50-75, etc.).

[0017] DEFINITIONS

[0018] The following definitions are provided, along with additional definitions throughout the specification, for a complete understanding of the instant invention. Unless specific definitions are provided herein, nomenclature used in connection with, and procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Unless otherwise indicated, as used herein, terms have the following meanings:

[0019] “Anti-spacer sequence” means the portion of a target nucleic acid that is complementary to a spacer sequence.

[0020] “Cas protein” means a polypeptide comprising (1) a region that interacts with a scaffold sequence of a guide; and (2) a region that interacts with a PAM of a target nucleic acid.

[0021] “Edit region” means the portion, or portions, of a target nucleic acid in which gene editing occurs. “Editing system” means a complex comprising (1) a Cas protein, or a nucleic acid encoding a Cas protein; (2) a guide; and, optionally, (3) a delivery system, such as a lipid nanoparticle (LNP).

[0022] “Gene editing” means a process for changing the nucleobase sequence, or nucleobase sequences, of a target nucleic acid. Gene editing may be measured by the presence or absence of InDels within an edit region.

[0023] “Guide” means one or more oligonucleotide(s) comprising, individually or together, (1) a spacer sequence; and (2) a scaffold sequence. A “single guide” is an individual oligonucleotide comprising (1) a spacer sequence; and (2) a scaffold sequence. A “dual guide” is a complex comprising (1) a first oligonucleotide comprising a spacer sequence and a first partial scaffold sequence; and (2) a second oligonucleotide comprising a second partial scaffold sequence, wherein nucleobases in the first partial scaffold sequence hydrogen bond to complementary nucleobases in the second partial scaffold sequence. “Modified guide” means a guide comprising at least one modified internucleoside linkage, modified sugar moiety, and / or modified nucleobase.

[0024] “InDel” means an insertion or deletion of nucleobases within the nucleobase sequence, or nucleobase sequences, of a target nucleic acid.

[0025] “PAM” means a short nucleobase sequence in a target nucleic acid to which a Cas protein interacts. SMRH:4931-9018-2038.1 2EDIT0005WO / 68KM-408384-WO “Scaffold sequence” means the portion of a guide that interacts with a Cas protein.

[0026] “Spacer sequence” means the portion of a guide that hybridizes to a target nucleic acid.

[0027] “Target nucleic acid” means the intended nucleic acid substrate of an editing system. Target nucleic acids include single-stranded target nucleic acids and double-stranded nucleic acids. “Single-stranded target nucleic acids” comprise (1) an anti-spacer sequence, and (2) a PAM, both within a single nucleobase sequence. Single-stranded target nucleic acids include single-stranded RNAs. “Double-stranded target nucleic acids” comprise a (1) a target strand having an anti-spacer sequence, and (2) a non-target strand having a PAM. Double -stranded target nucleic acids include genomic DNA.

[0028] “Complementary” means that at least 70% of the nucleobases of a first sequence, or portion thereof, and a second sequence, or portion thereof, are capable of hydrogen bonding with one another when the nucleobases of the first sequence and the second sequence are aligned in reverse orientation. Complementary nucleobase pairs include adenine (A) and thymine (T); adenine (A) and uracil (U); cytosine (C) and guanine (G); and 5 -methylcytosine (mC) and guanine (G); hypoxanthine (I) and thymine (T); hypoxanthine (I) and adenine (A); hypoxanthine (I) and uracil (U); hypoxanthine (I) and cytosine (C); hypoxanthine (I) and 5-methylcytosine (mC); pseudouridine and adenine (A); and 1 -methylpseudouridine and adenine (A).

[0029] Hypoxanthine is the nucleobase of the nucleoside inosine.

[0030] “Internucleoside linkage” means the covalent linkage between immediately adjacent subunits in an oligonucleotide. An “unmodified internucleoside linkage” is a phosphodiester internucleoside linkage. A “modified internucleoside linkage” is any internucleoside linkage other than a phosphodiester internucleoside linkage. A “phosphorothioate internucleoside linkage” is a modified internucleoside linkage in which one of the non-linking oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom. A “mesyl phosphoramidate internucleoside linkage” is a modified internucleoside linkage in which one of the non-linking oxygen atoms of a phosphodiester internucleoside linkage is replaced with -NHS(=O)2CH3. Unless otherwise indicated, for linked nucleosides comprising furanosyl sugar moieties, an internucleoside linkage joins the 3'-carbon of one furanosyl sugar moiety to the 5'-carbon of another furanosyl sugar moiety.

[0031] “Nucleobase" means an unmodified nucleobase or a modified nucleobase. “Modified nucleobase” means a nucleobase other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase. “5-methylcytosine” (mC) and hypoxanthine (I) are modified nucleobases.

[0032] “Nucleobase sequence” means the order of contiguous nucleobases independent of any sugar or internucleoside linkage modification.

[0033] “Oligonucleotide” means a polymer consisting of 10-160 linked subunits. “Modified oligonucleotide” means an oligonucleotide comprising at least one modified internucleoside linkage, modified sugar moiety, and / or modified nucleobase.

[0034] “Nucleoside” means an oligonucleotide subunit comprising (1) a sugar moiety or a sugar surrogate; and (2) a nucleobase.

[0035] SMRH:4931-9018-2038.1 3EDIT0005WO / 68KM-408384-WO “Nucleotide” means an oligonucleotide subunit comprising (1) a sugar moiety or a sugar surrogate; (2) a nucleobase; and (3) an internucleoside linkage.

[0036] “Sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. “Unmodified sugar moiety” means a 2’-OH(H) ribosyl moiety, as found in RNA (“0-D -ribosyl sugar moiety”), or a 2’-H(H) deoxyribosyl sugar moiety, as found in DNA (“P-D-2-deoxyribosyl sugar moiety”). “Modified sugar moiety” means a modified furanosyl sugar moiety or a sugar surrogate.

[0037] “Treat” means improve at least one symptom of disease either before or after symptoms emerge. “Cure” means to correct the underlying cause of a disease.

[0038] “Prevent” means stop or delay all symptoms of disease before their emergence.

[0039] “2'-substituted sugar moiety” means a modified furanosyl sugar moiety wherein the 2'-position is attached to at least one substituent other than H or OH. A 2'-substituted sugar moiety includes a bicyclic sugar moiety wherein the second ring is joined to the furanosyl ring at the 2'-position. 2'-substituted sugar moieties include: 2'-OMe sugar moiety, 2'-M0E sugar moiety, 2'-F sugar moiety, 2'-NMA sugar moiety, cEt sugar moiety, and LNA sugar moiety.

[0040] “2'-OMe sugar moiety” means a sugar moiety with a 2'-OCH3 group at the 2'-position of a furanosyl sugar moiety.

[0041] “2'-M0E sugar moiety” means a sugar moiety with a 2'-OCH2CH2OCH3 group at the 2'-position of a furanosyl sugar moiety.

[0042] “2'-F sugar moiety” means a sugar moiety with a 2'-F group at the 2'-position of a furanosyl sugar moiety.

[0043] “2'-NMA sugar moiety” means a sugar moiety with a 2'-OCH2C(=O)-N(H)CH3 group at the 2'-position of a furanosyl sugar moiety.

[0044] “cEt sugar moiety” means a furanosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4'-carbon and the 2'-carbon of the furanosyl sugar moiety, wherein the bridge has the formula 4'-CH(CH3)-O-2'.

[0045] “LNA sugar moiety” means a furanosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4'-carbon and the 2 '-carbon of the furanosyl sugar moiety, wherein the bridge has the formula 4'-CH2-O-2.'

[0046] Certain Embodiments

[0047] The present disclosure provides the following non-limiting embodiments:

[0048] Embodiment 1. A modified oligonucleotide consisting of 70 to 250 linked nucleosides, wherein at least one of the five internucleoside linkages at the 5 '-end and at least one of the five internucleoside linkages at the 3'-end are modified internucleoside linkages, and at least one of the said modified internucleoside linkages is an internucleoside linkage of Formula I

[0049] SMRH:4931-9018-2038.1 4EDIT0005WO / 68KM-408384-WO

[0050] 9 Ri

[0051] i v°

[0052] 9 oA

[0053]

[0054] ± R2.

[0055] wherein independently for each such internucleoside linkage of Formula I:

[0056] X is selected from O or S;

[0057] Ri is selected from H, C1-C6alkyl, and substituted C1-C6alkyl; and

[0058] R2 is selected from an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a diazole, a substituted diazole, a Ci-Ce alkoxy, a Ci-Ce alkyl, a Ci-Ce alkenyl, a Ci-Ce alkynyl, a substituted Ci-Ce alkyl, a substituted Ci-Ce alkenyl and a substituted Ci-Ce alkynyl.

[0059] Embodiment 2. The modified oligonucleotide of embodiment 1, wherein the modified oligonucleotide is a guide.

[0060] Embodiment 3. The modified oligonucleotide of any of embodiments 1-2, wherein at least two of the five internucleoside linkages at the 5 '-end are modified internucleoside linkages.

[0061] Embodiment 4. The modified oligonucleotide of any of embodiments 1-3, wherein at least two of the last internucleoside linkages at the 3'-end are modified internucleoside linkages.

[0062] Embodiment 5. The modified oligonucleotide of any of embodiments 1-4, wherein at least three of the five internucleoside linkages at the 5 ’-end are modified internucleoside linkages.

[0063] Embodiment 6. The modified oligonucleotide of any of embodiments 1-5, wherein at least three of the five internucleoside linkages at the 3'-end are modified internucleoside linkages.

[0064] Embodiment 7. The modified oligonucleotide of any of embodiments 1-6, wherein at least four of the five internucleoside linkages at the 5 '-end are modified internucleoside linkages.

[0065] Embodiment 8. The modified oligonucleotide of any of embodiments 1-7, wherein at least four of the five internucleoside linkages at the 3'-end are modified internucleoside linkages.

[0066] Embodiment 9. The modified oligonucleotide of any of embodiments 1-8, wherein the five internucleoside linkages at the 5 '-end are modified internucleoside linkages.

[0067] Embodiment 10. The modified oligonucleotide of any of embodiments 1-9, wherein the five internucleoside linkages at the 3 '-end are modified internucleoside linkages.

[0068] Embodiment 11. The modified oligonucleotide of any of embodiments 1-10, wherein each remaining internucleoside linkage is a phosphodiester internucleoside linkage.

[0069] Embodiment 12. The modified oligonucleotide of any of embodiments 1-11, wherein each modified internucleoside linkage is selected from phosphorothioate or an internucleoside linkage of Formula I. Embodiment 13. The modified oligonucleotide of any of embodiments 1-12, wherein for each internucleoside linkage of Formula I, X is O.

[0070] SMRH:4931-9018-2038.1 5EDIT0005WO / 68KM-408384-WO Embodiment 14. The modified oligonucleotide of any of embodiments 1-13, wherein for each internucleoside linkage of Formula I, Ri is H.

[0071] Embodiment 15. The modified oligonucleotide of any of embodiments 1-14, wherein for each internucleoside linkage of Formula I, R2 is methyl.

[0072] Embodiment 16. The modified oligonucleotide of any of embodiments 1-15, wherein for each internucleoside linkage of Formula I, X is O, Ri is H, and R2 is methyl.

[0073] Embodiment 17. The modified oligonucleotide of any of embodiments 1-16, wherein each internucleoside linkage is selected from a phosphodiester, a phosphorothioate, and a mesyl phosphoramidate internucleoside linkage.

[0074] Embodiment 18. The modified oligonucleotide of any of embodiments 1-17, wherein at least one of the five nucleotides at the 5 '-end comprises a modified sugar moiety.

[0075] Embodiment 19. The modified oligonucleotide of any of embodiments 1-18, wherein at least one of the five nucleotides at the 3'-end comprises a modified sugar moiety.

[0076] Embodiment 20. The modified oligonucleotide of any of embodiments 1-19, wherein at least two of the five nucleotides at the 5 '-end comprise a modified sugar moiety.

[0077] Embodiment 21. The modified oligonucleotide of any of embodiments 1 -20, wherein at least two of the five nucleotides at the 3'-end comprise a modified sugar moiety.

[0078] Embodiment 22. The modified oligonucleotide of any of embodiments 1-21, wherein at least three of the five nucleotides at the 5 '-end comprise a modified sugar moiety.

[0079] Embodiment 23. The modified oligonucleotide of any of embodiments 1-22, wherein at least three of the five nucleotides at the 3'-end comprise a modified sugar moiety.

[0080] Embodiment 24. The modified oligonucleotide of any of embodiments 1-23, wherein at least four of the five nucleotides at the 5 '-end comprise a modified sugar moiety.

[0081] Embodiment 25. The modified oligonucleotide of any of embodiments 1-24, wherein at least four of the five nucleotides at the 3'-end comprise a modified sugar moiety.

[0082] Embodiment 26. The modified oligonucleotide of any of embodiments 1-25, wherein the five nucleotides at the 5 '-end comprise a modified sugar moiety.

[0083] Embodiment 27. The modified oligonucleotide of any of embodiments 1-26, wherein the five nucleotides at the 3'-end comprise a modified sugar moiety.

[0084] Embodiment 28. The modified oligonucleotide of any of embodiments 12-27, wherein the modified sugar moiety is a 2'-substituted sugar moiety.

[0085] Embodiment 29. The modified oligonucleotide of any of embodiments 12-28, wherein the modified sugar moiety is selected from a 2'-OMe sugar moiety, a 2'-M0E sugar moiety, a 2'-F sugar moiety, a 2'- NMA sugar moiety, a cEt sugar moiety, and an LNA sugar moiety.

[0086] Embodiment 30. A modified oligonucleotide consisting of 70 to 250 linked nucleosides according to the following formula (5’ to 3’):

[0087] SMRH:4931-9018-2038.1 6EDIT0005WO / 68KM-408384-WO N1L1-N2L2-N3L3-N4L4-N5L5-T(59-239)-N6L6-N7L7-N8L8-N9L9-N10L10-N11, wherein:

[0088] each of N1, N2, N3, N4, N5, N6, N7, N8, N9, N10, and N11 is a nucleoside;

[0089] each of L1, L2, L3, L4, L5, L6, L7, L8, L9, and L10 is an internucleoside linkage;

[0090] each T is a nucleotide consisting of a nucleoside and an internucleoside linkage; and

[0091] at least one of L1, L2, L3, L4, L5, L6, L7, L8, L9, and L10 is an internucleoside linkage of Formula I

[0092] JWV

[0093] I D

[0094]

[0095] EV")

[0096] wherein independently for each such internucleoside linkage of Formula I;

[0097] X is selected from O or S;

[0098] R1 is selected from H, C1-C6 alkyl, and substituted C1-C6 alkyl; and

[0099] R2 is selected from an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a diazole, a substituted diazole, a C1-C6 alkoxy, a C1-C6 alkyl, a C1-C6 alkenyl, a C1-C6 alkynyl, a substituted C1-C6 alkyl, a substituted C1-C6 alkenyl and a substituted C1-C6 alkynyl.

[0100] Embodiment 31. The modified oligonucleotide of embodiment 30, wherein the modified oligonucleotide is a guide.

[0101] Embodiment 32. The modified oligonucleotide of any of embodiments 30-31, wherein at least two of L1, L2, L3, L4, L5, L6, L7, L8, L9, and L10 are sulfonyl phosphoramidate internucleoside linkages.

[0102] Embodiment 33. The modified oligonucleotide of any of embodiments 30-32, wherein at least three of L1, L2, L3, L4, L5, L6, L7, L8, L9, and L10 are sulfonyl phosphoramidate internucleoside linkages.

[0103] Embodiment 34. The modified oligonucleotide of any of embodiments 30-33, wherein at least four of L1, L2, L3, L4, L5, L6, L7, L8, L9, and L10 are sulfonyl phosphoramidate internucleoside linkages.

[0104] Embodiment 35. The modified oligonucleotide of any of embodiments 30-34, wherein at least five of L1, L2, L3, L4, L5, L6, L7, L8, L9, and L10 are sulfonyl phosphoramidate internucleoside linkages.

[0105] Embodiment 36. The modified oligonucleotide of any of embodiments 30-35, wherein at least six of L1, L2, L3, L4, L5, L6, L7, L8, L9, and L10 are sulfonyl phosphoramidate internucleoside linkages.

[0106] Embodiment 37. The modified oligonucleotide of any of embodiments 30-36, wherein at least seven of L1, L2, L3, L4, L5, L6, L7, L8, L9, and L10 are sulfonyl phosphoramidate internucleoside linkages.

[0107] Embodiment 38. The modified oligonucleotide of any of embodiments 30-37, wherein at least eight of L1, L2, L3, L4, L5, L6, L7, L8, L9, and L10 are sulfonyl phosphoramidate internucleoside linkages.

[0108] Embodiment 39. The modified oligonucleotide of any of embodiments 30-38, wherein at least nine of L1, L2, L3, L4, L5, L6, L7, L8, L9, and L10 are sulfonyl phosphoramidate internucleoside linkages.

[0109] SMRH:4931-9018-2038.1 7EDIT0005WO / 68KM-408384-WO Embodiment 40. The modified oligonucleotide of any of embodiments 30-39, wherein each of L1, L2, L3, L4, L5, L6, L7, L8, L9, and L10 are sulfonyl phosphoramidate internucleoside linkages.

[0110] Embodiment 41. The modified oligonucleotide of any of embodiments 30-32, wherein L1 and L2 are sulfonyl phosphoramidate internucleoside linkages.

[0111] Embodiment 42. The modified oligonucleotide of any of embodiments 30-32, wherein L1 and L3 are sulfonyl phosphoramidate internucleoside linkages.

[0112] Embodiment 43. The modified oligonucleotide of any of embodiments 30-32, wherein L1 and L4 are sulfonyl phosphoramidate internucleoside linkages.

[0113] Embodiment 44. The modified oligonucleotide of any of embodiments 30-32, wherein L1 and L5 are sulfonyl phosphoramidate internucleoside linkages.

[0114] Embodiment 45. The modified oligonucleotide of any of embodiments 30-32, wherein L2 and L3 are sulfonyl phosphoramidate internucleoside linkages.

[0115] Embodiment 46. The modified oligonucleotide of any of embodiments 30-32, wherein L2 and L4 are sulfonyl phosphoramidate internucleoside linkages.

[0116] Embodiment 47. The modified oligonucleotide of any of embodiments 30-32, wherein L2 and L5 are sulfonyl phosphoramidate internucleoside linkages.

[0117] Embodiment 48. The modified oligonucleotide of any of embodiments 30-32, wherein L3 and L4 are sulfonyl phosphoramidate internucleoside linkages.

[0118] Embodiment 49. The modified oligonucleotide of any of embodiments 30-32, wherein L3 and L5 are sulfonyl phosphoramidate internucleoside linkages.

[0119] Embodiment 50. The modified oligonucleotide of any of embodiments 30-32, wherein L4 and L5 are sulfonyl phosphoramidate internucleoside linkages.

[0120] Embodiment 51. The modified oligonucleotide of any of embodiments 30-34 or embodiments 41-50, wherein L6 and L7 are sulfonyl phosphoramidate internucleoside linkages.

[0121] Embodiment 52. The modified oligonucleotide of any of embodiments 30-34 or embodiments 41-50, wherein L6 and L8 are sulfonyl phosphoramidate internucleoside linkages.

[0122] Embodiment 53. The modified oligonucleotide of any of embodiments 30-34 or embodiments 41-50, wherein L6 and L9 are sulfonyl phosphoramidate internucleoside linkages.

[0123] Embodiment 54. The modified oligonucleotide of any of embodiments 30-34 or embodiments 41-50, wherein L6 and L10 are sulfonyl phosphoramidate internucleoside linkages.

[0124] Embodiment 55. The modified oligonucleotide of any of embodiments 30-34 or embodiments 41-50, wherein L7 and L8 are sulfonyl phosphoramidate internucleoside linkages.

[0125] Embodiment 56. The modified oligonucleotide of any of embodiments 30-34 or embodiments 41-50, wherein L7 and L9 are sulfonyl phosphoramidate internucleoside linkages.

[0126] Embodiment 57. The modified oligonucleotide of any of embodiments 30-34 or embodiments 41-50, wherein L7 and L10 are sulfonyl phosphoramidate internucleoside linkages.

[0127] SMRH:4931-9018-2038.1 8EDIT0005WO / 68KM-408384-WO Embodiment 58. The modified oligonucleotide of any of embodiments 30-34 or embodiments 41-50, wherein L8 and L9 are sulfonyl phosphoramidate internucleoside linkages.

[0128] Embodiment 59. The modified oligonucleotide of any of embodiments 30-34 or embodiments 41-50, wherein L8 and L10 are sulfonyl phosphoramidate internucleoside linkages.

[0129] Embodiment 60. The modified oligonucleotide of any of embodiments 30-34 or embodiments 41-50, wherein L9 and L10 are sulfonyl phosphoramidate internucleoside linkages.

[0130] Embodiment 61. The modified oligonucleotide of any of embodiments 32-60, wherein each sulfonyl phosphoramidate internucleoside linkage is a mesyl phosphoramidate internucleoside linkage.

[0131] Embodiment 62. The modified oligonucleotide of any of embodiments 30-61, wherein at least one of N1, N2, N3, N4, N5, N6, N7, N8, N9, and N10 comprises a modified sugar moiety.

[0132] Embodiment 63. The modified oligonucleotide of any of embodiments 30-62, wherein at least two of N1, N2, N3, N4, N5, N6, N7, N8, N9, and N10 comprises a modified sugar moiety.

[0133] Embodiment 64. The modified oligonucleotide of any of embodiments 30-63, wherein at least three of N1, N2, N3, N4, N5, N6, N7, N8, N9, and N10 comprises a modified sugar moiety.

[0134] Embodiment 65. The modified oligonucleotide of any of embodiments 30-64, wherein at least four of N1, N2, N3, N4, N5, N6, N7, N8, N9, and N10 comprises a modified sugar moiety.

[0135] Embodiment 66. The modified oligonucleotide of any of embodiments 30-65, wherein at least five of N1, N2, N3, N4, N5, N6, N7, N8, N9, and N10 comprises a modified sugar moiety.

[0136] Embodiment 67. The modified oligonucleotide of any of embodiments 30-66, wherein at least six of N1, N2, N3, N4, N5, N6, N7, N8, N9, and N10 comprises a modified sugar moiety.

[0137] Embodiment 68. The modified oligonucleotide of any of embodiments 30-67, wherein at least seven of N1, N2, N3, N4, N5, N6, N7, N8, N9, and N10 comprises a modified sugar moiety.

[0138] Embodiment 69. The modified oligonucleotide of any of embodiments 30-68, wherein at least eight of N1, N2, N3, N4, N5, N6, N7, N8, N9, and N10 comprises a modified sugar moiety.

[0139] Embodiment 70. The modified oligonucleotide of any of embodiments 30-69, wherein at least nine of N1, N2, N3, N4, N5, N6, N7, N8, N9, and N10 comprises a modified sugar moiety.

[0140] Embodiment 71. The modified oligonucleotide of any of embodiments 30-70, wherein each of N1, N2, N3, N4, N5, N6, N7, N8, N9, and N10 comprises a modified sugar moiety.

[0141] Embodiment 72. The modified oligonucleotide of any of embodiments 30-63, wherein N1 and N2 comprise modified sugar moieties.

[0142] Embodiment 73. The modified oligonucleotide of any of embodiments 30-63, wherein N1 and N3 comprise modified sugar moieties.

[0143] Embodiment 74. The modified oligonucleotide of any of embodiments 30-63, wherein N1 and N4 comprise modified sugar moieties.

[0144] Embodiment 75. The modified oligonucleotide of any of embodiments 30-63, wherein N1 and N5 comprise modified sugar moieties.

[0145] SMRH:4931-9018-2038.1 9EDIT0005WO / 68KM-408384-WO Embodiment 76. The modified oligonucleotide of any of embodiments 30-63, wherein N2and N3comprise modified sugar moieties.

[0146] Embodiment 77. The modified oligonucleotide of any of embodiments 30-63, wherein N2 and N4 comprise modified sugar moieties.

[0147] Embodiment 78. The modified oligonucleotide of any of embodiments 30-63, wherein N2and N5comprise modified sugar moieties.

[0148] Embodiment 79. The modified oligonucleotide of any of embodiments 30-63, wherein N3and N4comprise modified sugar moieties.

[0149] Embodiment 80. The modified oligonucleotide of any of embodiments 30-63, wherein N3 and N5 comprise modified sugar moieties.

[0150] Embodiment 81. The modified oligonucleotide of any of embodiments 30-63, wherein N4 and N5 comprise modified sugar moieties.

[0151] Embodiment 82. The modified oligonucleotide of any of embodiments 30-63or embodiments 71-72, wherein N1, N2, and N3 comprise modified sugar moieties.

[0152] Embodiment 83. The modified oligonucleotide of any of embodiments 30-63 or embodiments 72-72, wherein N6 and N7 comprise modified sugar moieties.

[0153] Embodiment 84. The modified oligonucleotide of any of embodiments 30-63 or embodiments 72-82, wherein N6 and N8 comprise modified sugar moieties.

[0154] Embodiment 85. The modified oligonucleotide of any of embodiments 30-62 or embodiments 71-81, wherein N6 and N8 comprise modified sugar moieties.

[0155] Embodiment 86. The modified oligonucleotide of any of embodiments 30-63 or embodiments 72-82, wherein N6 and N10 comprise modified sugar moieties.

[0156] Embodiment 87. The modified oligonucleotide of any of embodiments 30-63 or embodiments 72-82, wherein N6 and N11 comprise modified sugar moieties.

[0157] Embodiment 88. The modified oligonucleotide of any of embodiments 30-63 or embodiments 72-82, wherein N7 and N8 comprise modified sugar moieties.

[0158] Embodiment 89. The modified oligonucleotide of any of embodiments 30-63 or embodiments 72-82, wherein N7 and N9 comprise modified sugar moieties.

[0159] Embodiment 90. The modified oligonucleotide of any of embodiments 30-63 or embodiments 72-82, wherein N7 and N10 comprise modified sugar moieties.

[0160] Embodiment 91. The modified oligonucleotide of any of embodiments 30-63 or embodiments 72-82, wherein N7 and N11 comprise modified sugar moieties.

[0161] Embodiment 92. The modified oligonucleotide of any of embodiments 30-63 or embodiments 72-82, wherein N6 and N8 comprise modified sugar moieties.

[0162] Embodiment 93. The modified oligonucleotide of any of embodiments 30-63 or embodiments 72-82, wherein N6 and N10 comprise modified sugar moieties.

[0163] SMRH:4931-9018-2038.1 10EDIT0005WO / 68KM-408384-WO Embodiment 94. The modified oligonucleotide of any of embodiments 30-63 or embodiments 72-82, wherein N6 and N11 comprise modified sugar moieties.

[0164] Embodiment 95. The modified oligonucleotide of any of embodiments 30-63 or embodiments 72-82, wherein Ns and Nio comprise modified sugar moieties.

[0165] Embodiment 96. The modified oligonucleotide of any of embodiments 30-63 or embodiments 72-82, wherein N6 and N11 comprise modified sugar moieties.

[0166] Embodiment 97. The modified oligonucleotide of any of embodiments 30-63 or embodiments 72- 8281, wherein Nio and Nn comprise modified sugar moieties.

[0167] Embodiment 98. The modified oligonucleotide of any of embodiments 30-63 or embodiments 72-82, or embodiments 95-98, wherein N9, N10, and N11 comprise modified sugar moieties.

[0168] Embodiment 99. The modified oligonucleotide of any of embodiments 62-98, wherein the modified sugar moiety is a 2'-substituted sugar moiety.

[0169] Embodiment 100. The modified oligonucleotide of any of embodiments 62-98, wherein the modified sugar moiety is selected from 2'-OMc sugar moiety, 2'-M0E sugar moiety, 2'-F sugar moiety, 2’-NMA sugar moiety, cEt sugar moiety, and LNA sugar moiety.

[0170] Embodiment 101. The modified oligonucleotide of embodiment 30, wherein each of N1, N2, N3 and N9, N10, and N11 comprise a modified sugar moiety and at least two of L1, L2, L3 and at least two of L8, L9, and L10 are modified internucleoside linkages of Formula I; L4, L5, L6, L7 are phosphodiester internucleoside linkages; and each remaining internucleoside linkage is a phosphodiester internucleoside linkage.

[0171] Embodiment 102. The modified oligonucleotide of embodiment 101, wherein each of Ni, N2, N3 and Ns, Nio, and Nn comprises a 2’-OMe sugar moiety.

[0172] Embodiment 103. The modified oligonucleotide of embodiment 101 or 102, wherein each remaining nucleoside comprises an unmodified 2’-OH(H) ribosyl sugar moiety.

[0173] Embodiment 104. The modified oligonucleotide of any of embodiments 101-103, wherein for each internucleoside linkage of Formula I, X is O, Ri is H and R2 is methyl.

[0174] Embodiment 105. The modified oligonucleotide of any of embodiments 1-104, wherein the modified oligonucleotide consists of 70-160 linked nucleosides.

[0175] Embodiment 106. The modified oligonucleotide of embodiment 105, wherein the modified oligonucleotide consists of 70-130, 80-120, 90-110, or 95-105 linked nucleosides.

[0176] Embodiment 107. An editing system comprising the modified oligonucleotide of any of embodiments 1-106 and an mRNA encoding a Cas protein.

[0177] Embodiment 108. An editing system comprising the modified oligonucleotide of any of embodiments 1-106 and a Cas protein.

[0178] Embodiment 109. The editing system of embodiment 107 or 108, further comprising a delivery system. Embodiment 110. The editing system of embodiment 109, wherein the delivery system comprises a lipid nanoparticle.

[0179] SMRH:4931-9018-2038.1 11EDIT0005WO / 68KM-408384-WO Embodiment 111. A composition comprising the modified oligonucleotide of any of embodiments 1- 106 or the editing system of any of embodiments 107-110.

[0180] Embodiment 112. A method of editing a target nucleic acid, comprising administering the modified oligonucleotide of any of embodiments 1-106, the editing system of any of embodiments 107-110, or the composition of embodiment 111 to a subject.

[0181] Embodiment 113. A method of editing a target nucleic acid, comprising contacting a cell with the modified oligonucleotide of any of embodiments 1-106, the editing system of any of embodiments 107- 110, or the composition of embodiment 111.

[0182] Embodiment 114. Use of the modified oligonucleotide of any of embodiments 1-106, the editing system of any of embodiments 107-110, or the composition of embodiment 111 in the manufacture of a medicament for editing a target nucleic acid.

[0183] Embodiment 115. A kit comprising the modified oligonucleotide of any of embodiments 1-106, the editing system of any of embodiments 107-110, or the composition of embodiment 111, and optionally instructions for use, optionally wherein the kit is for, or when used for, editing a target nucleic acid.

[0184] Provided herein are modified oligonucleotides. In certain embodiments, such modified oligonucleotides are modified guides. In certain embodiments, such modified guides are modified single guides. In certain embodiments, modified oligonucleotides, including modified guides, comprise 70 to 160 linked subunits. In certain embodiments, each subunit is a nucleoside.

[0185] In certain embodiments, the internucleoside linkages of modified oligonucleotides are independently selected from unmodified internucleoside linkages and modified internucleoside linkages. In certain embodiments, at least one intemucleoside linkage of a modified oligonucleotide is a sulfonyl phosphoramidate internucleoside linkage. In certain such embodiments, at least 1, 2, 3, 4, or 5 of the first 5 internucleoside linkages from the 5’ end and at least 1, 2, 3, 4, or 5 of the last 5 internucleoside linkages from the 3’ end are sulfonyl phosphoramidate internucleoside linkages. In certain embodiments, such sulfonyl phosphoramidate internucleoside linkages are mesyl phosphoramidate internucleoside linkages. In certain embodiments, modified oligonucleotides comprise at least one sulfonyl phosphoramidate internucleoside linkage and at least one modified internucleoside linkage that is not a sulfonyl phosphoramidate internucleoside linkage. Certain such modified internucleoside linkages are described below.

[0186] I. Certain Oligonucleotides

[0187] A. Modified Internucleoside Linkages

[0188] i. Sulfonyl phosphoramidate linkages

[0189] In certain embodiments, modified oligonucleotides, including modified guides, comprises one or more sulfonyl phosphoramidate intemucleoside linkage according to Formula I:

[0190] SMRH:4931-9018-2038.1 12EDIT0005WO / 68KM-408384-WO

[0191]

[0192] wherein independently for each such internucleoside linking group of Formula I:

[0193] X is selected from O or S;

[0194] Ri is selected from H, C1-C6alkyl, and substituted C1-C6alkyl; and

[0195] R2 is selected from an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a diazole, a substituted diazole, a Ci-Ce alkoxy, a Ci-Ce alkyl, a Ci-Cg alkenyl, a Ci-Ce alkynyl, a substituted Ci-Ce alkyl, a substituted Ci-Ce alkenyl and a substituted Ci-Ce alkynyl.

[0196] In certain embodiments, a linkage of Formula I is a mesyl phosphoramidate linkage according to Formula II:

[0197] I

[0198] o

[0199] O=p- N-SO2Me

[0200]

[0201] II

[0202] In certain embodiments, a linkage of Formula I is selected from Formula III, IV, or V below:

[0203] O=P–N–SO2(CH2)3CH3O=P–N–SO2(CH2)5CH3

[0204]

[0205] Formula III Formula IV

[0206] In certain embodiments, a linkage of Formula I is selected from Formula VI or VII below:

[0207]

[0208] Formula VI Formula VII.

[0209] SMRH:4931-9018-2038.1 13EDIT0005WO / 68KM-408384-WO In certain embodiments, a linkage of Formula I is selected from Formula VIII-X below:

[0210]

[0211] Formula VIII Formula IX Formula X.

[0212] In certain embodiments, an internucleoside linkage of Formula I is selected from Formula XI-XIII below:

[0213]

[0214] NH2Formula XI Formula XII Formula XIII

[0215] In certain embodiments, an internucleoside linkage of Formula I is selected from Formula XIV- Formula XVIII below:

[0216] Formula XIVFormula XV

[0217]

[0218] Formula XVI

[0219] SMRH:4931-9018-2038.1 14EDIT0005WO / 68KM-408384-WO

[0220] Formula XVII

[0221]

[0222] Formula XVIII

[0223] In certain embodiments, an internucleoside linkage of Formula I is selected from Formula XIX or Formula XX below:

[0224]

[0225] Formula XIX Formula XX

[0226] In certain embodiments, an internucleoside linkage of Formula I is selected from XXI or Formula XXII below:

[0227]

[0228] Formula XXI

[0229]

[0230] The internucleoside linkage of Formula I has a chiral center and therefor has two conformations as depicted below.

[0231] SMRH:4931-9018-2038.1 15EDIT0005WO / 68KM-408384-WO

[0232]

[0233] where Bx is a nucleobase.

[0234] In embodiments in which Formula I is a mesyl phosphoramidate internucleoside having Formula II, the conformations are depicted below:

[0235]

[0236] where Bx is a nucleobase.

[0237] Modified oligonucleotides comprising internucleoside linkages having a chiral center may be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising internucleoside linkages containing chiral centers in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise one or more mesyl phosphoramidate internucleoside linkages wherein all of the mesyl phosphoramidate internucleoside linkages are stereorandom. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular mesyl phosphoramidate internucleoside linkages in a particular, independently selected stereochemical configuration (e.g., Rp or, Sp). In certain embodiments, the particular mesyl phosphoramidate linkage is present in the selected configuration in at least X% to Y% of the molecules in the population, wherein X represents the lowest number in the range and Y represents the highest number in the range, wherein X and Y are each independently selected from 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99, provided that X< Y. In certain embodiments, the particular mesyl phosphoramidate linkage is present in the selected configuration in at least 65%, 70%, SMRH:4931-9018-2038.1 16EDIT0005WO / 68KM-408384-WO 80, 90%, or 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka, N., et al. J. Am. Chem. Soc. 2003, 125, 8307-8317; Wan, W. B., et al. Nucleic Acids Res. 2014, 42, 13456. and WO 2017 / 015555.

[0238] Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein may be stereorandom or chirally enriched.

[0239] ii. Other Internucleoside Linkages

[0240] In certain embodiments, not every internucleoside linkage of a modified oligonucleotide is a sulfonyl phosphoramidate linkage. In such embodiments, the other internucleoside linkages are selected from unmodified internucleoside linkages and modified internucleoside linkages. In certain embodiments, such modified internucleoside linkages include phosphorothioate linkages.

[0241] O O I I

[0242] O=P l-OH S=P l- OH

[0243] o o

[0244]

[0245] JL X

[0246] Phosphodiester internucleoside linking group Phosphorothioate internucleoside linking group

[0247] Other modified internucleoside linkages that may be incorporated into modified oligonucleotides, including modified guides, have been described previously (see, e.g., WO2017 / 214460, WO2018 / 126176).

[0248] B. Modified Nucleosides

[0249] In certain embodiments, at least one nucleoside of modified oligonucleotides is a modified nucleotide (comprising a modified sugar and / or modified base). Certain such modified nucleosides are described below.

[0250] i. Modified Sugar Moieties

[0251] Modified sugar moieties include modified furanosyl sugar moieties, cyclic sugar surrogates, and acyclic sugar surrogates. In certain embodiments, modified sugar moieties are non-bicyclic modified furanosyl sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic furanosyl sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.

[0252] In certain embodiments, modified sugar moieties are non-bicyclic modified furanosyl sugar moieties comprising one or more substituent groups including, but not limited to, substituents at the 2', 3', 4', and / or 5' positions, as numbered below:

[0253]

[0254] SMRH:4931-9018-2038.1 17EDIT0005WO / 68KM-408384-WO

[0255] In certain embodiments, the modified furanosyl sugar moiety is a ribosyl sugar moiety that is not an unmodified sugar moiety (i.e., an unmodified RNA or unmodified DNA moiety). In certain embodiments, the modified furanosyl sugar moiety is a xylosyl, lyxosyl, or arabinosyl sugar moiety.

[0256] In certain embodiments, non-bicyclic modified sugar moieties are 2'-substituted sugar moieties and comprise a substituent group at the 2'-position. Examples of substituent groups suitable for the 2'-position of modified sugar moieties include but are not limited to: F, OCH3 (“OMe” or “O-methyl”), and OtCI FhOClE (“MOE” or “O-mcthoxycthyl” or OCH2CH2OCH3). In certain embodiments, 2'-substituent groups are selected from: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, C1-C10 alkoxy, substituted C1-C10 alkoxy, C1-C10 alkyl, substituted C1-C10 alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm) -alkenyl, O-alkynyl, S-alkynyl, N(Rm) -alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn) or OCH2C(=O)-N(Rm)(Rn), where each Rmand Rnis, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl, OfCfEhON ClEh (“DMAOE”), or O(CH2)2O(CH2)2N(CH3)2 (“DMAEOE”). Synthetic methods for some of these 2'-substitucnt groups may be found, e.g., in Cook et al., U.S. 6,531,584; Cook et al., U.S. 5,859,221; and Cook et al., U.S. 6,005,087. Certain embodiments of these 2'-substituent groups may be further substituted with one or more substituent groups independently selected from: halo, cyano, ORa2, NO2, NH2, NHRa2, N(Ra2)2, Ci-Ce alkyl, C1-C6 haloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C10 cycloalkyl, Cg-Cioaryl, heteroaryl, heterocyclyl, C1-C6 alkylene-NH2, C1-C6 alkylene-NHRa2, Ci-C6alkylene-N(Ra2)2, C(O)Ra3, C(O)ORa3, C(O)NHRa3, C(O)N(CI-C4alkyl)Ra3, SRa3, S(O)2Ra3, S(O)Ra3, NHC(O)Ra3, N(C1-C4alkyl)C(O)Ra3, NHS(O)Ra3, N(C1-C4alkyl)S(O)Ra3, NHS(O)2Ra3, and N(C1-C4alkyl)S(O)2Ra3; where each Ra2is independently selected from C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C10 cycloalkyl, C6-C10 aryl, heteroaryl, and heterocyclyl; and each Ra3is independently hydrogen, OH, C1-C6 alkyl, C1-C6 haloalkyl, C3-C10 cycloalkyl, C6-C10 aryl, heteroaryl, or heterocyclyl. In certain embodiments, a sugar moiety comprises two of the above substituents at the 2'-position. In certain embodiments, a sugar moiety comprises a 2'-fluoro and a second 2'-substituent.

[0257] In certain embodiments, a 2'-substituted sugar moiety comprises a non-bridging 2'-substituent group selected from: F, NH2, N3, OCF3. OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=O)-N(Rm)(Rn)), where each Rmand Rnis, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl. In certain embodiments, a 2'-substituted sugar moiety comprises a non-bridging 2'-substituent group selected from: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2(“DMAOE”), O(CH2)2O(CH2)2N(CH3)2 (“DMAEOE”), and OCH2C(=O)-N(H)CH3(“NMA”). In certain embodiments one or more non-bridging substituent of non-bicyclic modified sugar moieties is branched.

[0258] In certain embodiments, a 2'-substituted sugar moiety comprises a 2'-substituent group selected from: F, OCH3, and O(CH2)2OCH3.

[0259] SMRH:4931-9018-2038.1 18EDIT0005WO / 68KM-408384-WO In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by stereochemical configuration. For example, a 2'-deoxyfuranosyl sugar moiety (i.e., 2'-(H)H furanosyl sugar moiety) may be in seven isomeric configurations other than the naturally occurring p-D-deoxyribosyl configuration. Such modified sugar moieties are described in, e.g., WO2020 / 072991. A 2'-modified sugar moiety has an additional stereocenter at the 2'-position relative to a 2'-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible stereochemical configurations. Modified furanosyl sugar moieties described herein are in the -D-ribosyl stereochemical configuration unless otherwise specified.

[0260] In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 4'-position. Examples of substituent groups suitable for the 4'-position of modified sugar moieties include, but are not limited to, alkoxy e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128.

[0261] In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 3'-position. Examples of substituent groups suitable for the 3 '-position of modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl).

[0262] In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 5'-position. Examples of substituent groups suitable for the 5 '-position of modified sugar moieties include, but are not limited to, vinyl, alkoxy (e.g., methoxy), alkynyl, allyl, and alkyl (e.g., methyl (7? or S), ethyl (R or 5)).

[0263] In certain embodiments, non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2'-F-5 '-methyl sugar moieties, such as described in Migawa et al., US 2010 / 0190837, or alternative 2'- and 5'-modified sugar moieties as described in Rajeev et al., US 2013 / 0203836.

[0264] Certain modified sugar moieties are bicyclic sugar moieties and comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring. In certain embodiments, the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms. Examples of such 4' to 2' bridging sugar substituents include, but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' (“LNA”), 4'-CH2-S-2', 4'-(CII2)2-O-2' (“ENA”), 4'-CII(CIl3)-O-2' (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CH2OCH3)-O-2' (“constrained MOE” or “cMOE”) and analogs thereof, 4'-C(CH3)(CH3)-O-2’ and analogs thereof, 4'-CH2-N(OCH3)-2' and analogs thereof, 4'-CH2-O-N(CH3)-2', 4'-CH2-C(H)(CH3)-2', 4'-CH2-C(=CH2)-2' and analogs thereof, 4'-C(RaRb)-N(R)-O-2', 4'-C(RaRb)-O-N(R)-2', 4'-CH2-O-N(R)-2', and 4'-CH2-N(R)-O-2', wherein each R, Ra, and Rbis, independently, H, a protecting group, or C1-C12alkyl. Representative U. S. patents that teach the preparation of such bicyclic sugar moieties include, but are not limited to: Imanishi et al., U. S. 7,427,672; Swayze et al., U. S. 7,741,457; Swayze et al., U. S. 8,022,193; Seth et al., U. S. 8,278,283; Prakash etal., U. S. 8,278,425; and Seth et al., U. S.

[0265] 8,278,426.

[0266] SMRH:4931-9018-2038.1 19EDIT0005WO / 68KM-408384-WO In certain embodiments, such 4 to 2 bridges independently comprise from 1 to 4 linked groups independently selected from: -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]n-O-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=NRa)-, -C(=O)-, -C(=S)-, -O-, -Si(Ra)2-, -S(=O)X-, and -N(Ra)-;

[0267] wherein:

[0268] x is 0, 1, or 2;

[0269] n is 1, 2, 3, or 4;

[0270] each Raand Rbis, independently, halo, cyano, ORa2, NO2, NH2, NHRa2, N(Ra2)2, C1-C6 alkyl, C1-C6haloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C10 cycloalkyl, C6-10 aryl, heteroaryl, heterocyclyl, C1-C6 alkylene-NH2, C1-C6alkylene-NHRa2, Ci-C6alkylene-N(Ra2)2, C(O)Ra3, C(O)ORa3, C(O)NHRa3, C(O)N(Ci-C4alkyl)Ra3, SRa3, S(O)2Ra3, S(O)Ra3, NHC(O)Ra3, N(CI-C4alkyl)C(O)Ra3, NHS(O)Ra3, N(C1-C4alkyl)S(O)Ra3, NHS(O)2Ra3, and N(Ci-C4alkyl)S(O)2Ra3; each Ra2is independently selected from C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C10 cycloalkyl, C6-C10 aryl, heteroaryl, and heterocyclyl; each Ra3is independently hydrogen, OH, C1-C6 alkyl, C1-C6 haloalkyl, C3-C10 cycloalkyl, C6-C10 aryl, heteroaryl, or heterocyclyl.

[0271] In certain embodiments, the bicyclic sugar moiety comprises a bridge between the 5' and the 3' furanose ring atoms. Examples of such 5' to 3' bridging sugar substituents include, but are not limited to, 5'-(CH2)2-3' (bcDNA), 5'-(CH2)3-3' (bc4,3DNA), 5'-C(F)=CH-CH2-3', and 5'-CH2-CHQ-3', wherein Q is an attachment to an internucleoside linkage.

[0272] Additional bicyclic sugar moieties are known in the art, see, for example: Wan, et al., J. Med Client.

[0273] 2016, 59, 9645-9667; Wengel et al., U. S. 8,080,644; Ramasamy et al., U. S. 6,525,191; Seth et al., U. S.

[0274] 7,547,684; and Seth et al., U. S. 7,666,854.

[0275] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by stereochemical configuration. For example, an LNA (“locked nucleic acid”) nucleoside (described herein) may be in the a-L configuration or in the P-D configuration.

[0276]

[0277] LNA (p-D-configuration) LNA (a-L-configuration)

[0278] bridge = 4'-CH2-O-2' bridge = 4'-CH2-O-2'

[0279] a-L-methyleneoxy (4'-CH2-O-2') or a-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al. Nucleic Acids Res. 2003, 21, 6365-6372). The addition of LNAs to siRNAs has been shown, in certain studies, to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al. Nucleic Acids Res. 2005, 33(1), 439-447; Mook, O. R. et al. Mol. Cane. Ther. 2007, 6(3), 833-843; Grunweller, A. et al. Nucleic Acids Res. 2003, 37(12), 3185-3193). Herein, general descriptions of bicyclic nucleosides include both stereochemical configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the P-D stereochemical configuration, unless otherwise specified.

[0280] SMRH:4931-9018-2038.1 20EDIT0005WO / 68KM-408384-WO In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5 '-substituted and 4'-2' bridged sugars).

[0281] In certain embodiments, modified sugar moieties are sugar surrogates, selected from cyclic sugar surrogates and acyclic sugar surrogates.

[0282] In certain embodiments, cyclic sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a cyclic sugar surrogate comprises a six-membered tetrahydropyran (“THP”) shown below. Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), altritol nucleic acid (Gi=OH; G2=H; “ANA”), and fluoro HNA (FHNA):

[0283]

[0284] THP HNA ANA FHNA

[0285] (Gi=F; G2=H; “FHNA”, see e.g., Egli, M. et al. J. Am. Chem. Soc. 2011, 753(41), 16642-16649; Swayze et al., U. S. 8,088,904; and Swayze et al., U. S. 8,440,803); FHNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran or 3'-FHNA).

[0286] In certain embodiments, cyclic sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported. As used herein, the term “morpholino” means a sugar surrogate having the structure shown below.

[0287] JVW

[0288] N

[0289]

[0290] JVW

[0291] morpholino

[0292] In certain embodiments, acyclic sugar surrogates are the glycerol as found in GNA (“glycol nucleic acid”) nucleosides, or the butyl as found in acyclic butyl nucleic acid. In certain embodiments, acyclic sugar surrogates are also known as “C3 spacers”. In certain embodiments, GNA is (S)-GNA.

[0293]

[0294] (, S)-GNA acyclic butyl C3 spacer

[0295] nucleic acid

[0296] Further acyclic sugar surrogates include those described in Manoharan et al., U. S. 10,913,767; US patent publication US 2021 / 0238595; and PCT publication WO 2023 / 109940.

[0297] SMRH:4931-9018-2038.1 21EDIT0005WO / 68KM-408384-WO ii. Modified Nucleobases

[0298] In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more subunits in which the sugar moiety is not attached to a nucleobase (e.g., the subunit does not comprise a nucleobase), referred to as an abasic subunit. In certain embodiments, modified oligonucleotides do not comprise abasic subunits. In certain embodiments, modified oligonucleotides comprise one or more inosine nucleosides (i.e., nucleosides comprising a hypoxanthine nucleobase). A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, an “adenine nucleobase” is an unmodified adenine nucleobase unless otherwise indicated. As used herein, a “thymine nucleobase” is an unmodified thymine nucleobase unless otherwise indicated. As used herein, a “uracil nucleobase” is an unmodified uracil nucleobase unless otherwise indicated. As used herein, a “cytosine nucleobase” is an unmodified cytosine nucleobase unless otherwise indicated. As used herein, a “guanine nucleobase” is an unmodified guanine nucleobase unless otherwise indicated.

[0299] Unless otherwise indicated, modified adenine has structure (Ai):

[0300]

[0301] wherein: R1Ais absent or H; R2Ais H, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce thioalkyl, or substituted Ci-Ce thioalkyl, Ci-Ce alkyloxy, or substituted Ci-Cg alkyloxy; R6Ais H, N(Ra)(Rb), oxo, acetyl, formyl, or O-phenyl; Y7Ais N and R7Ais absent or is Ci-Ce alkyl; or Y7Ais C and R7Ais H, Ci-C6alkyl, or N(Ra)(Rb); Y8Ais N and R8Ais absent, or Y8Ais C and R8Ais H, a halogen, OH, Ci-Ce alkyl, or substituted Ci-Ce alkyl; Raand Rbare each independently H, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce alkenyl, substituted Ci-Ce alkenyl, acetyl, or formyl, or together form a 5-7-membered heterocycle; excluding where Y7Ais N and R7Ais absent; Y8Ais C, R8Ais H, R1Ais absent, R2Ais H, and R6Ais NH2(unmodified adenine).

[0302] Unless otherwise indicated, modified guanine has structure (Gi):

[0303]

[0304] Gi

[0305] SMRH:4931-9018-2038.1 22EDIT0005WO / 68KM-408384-WO wherein: R2Gis N(Ra)(Rb); R6Gis oxo and R1Gis H, or R6Gis O-Ci-Ce alkyl or S-Ci-Ce alkyl and R1Gis absent; Y7Gis N and R7Gis absent or is Ci-C6alkyl; or Y7Gis C and R7Gis H, Ci-C6alkyl, or N(Ra)(Rb); Y8Gis N and R8Gis absent, or Y8Gis C and R8Gis H, a halogen, OH, Ci-Ce alkyl, or substituted Ci-Ce alkyl; Raand Rbare independently H, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce alkenyl, substituted Ci-Ce alkenyl, acetyl, or formyl, or together form a 5-7-membered heterocycle; excluding where Y7Gis N and R7Gis absent; Y8Gis C, R8Gis H, R2Gis NH2, R6Gis =0, and R1Gis H (unmodified guanine).

[0306] Unless otherwise indicated, modified thymine or modified uracil has structure (Ti):

[0307] X

[0308] I

[0309]

[0310] wherein: each X is independently O or S and R5Uis H, OH, halogen, O-C1-C20 alkyl, O-C1-C12 substituted alkyl, C1-C12 alkyl, substituted C1-C12 alkyl, C1-C12 alkenyl, substituted C1-C12 alkenyl, C1-C12 alkynyl, or substituted C1-C12 alkynyl; wherein if each X is O, R5Uis not H or CH3(unmodified uracil and unmodified thymine, respectively).

[0311] Unless otherwise indicated, modified cytosine has structure (Ci):

[0312]

[0313] wherein: X is O or S; R4Cis N(Ra)(Rb); R5Cis H, OH, halogen, O-C1-C12 alkyl, O-C1-C12 substituted alkyl, C1-C12 alkyl, substituted C1-C12 alkyl, C1-C12 alkenyl, or substituted C1-C12 alkenyl; Raand Rbare independently H, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce alkenyl, substituted Ci-Ce alkenyl, C1-C12 alkynyl, substituted C1-C12 alkynyl, acetyl, or formyl, or together form a 5-7-membered heterocycle; excluding where X is 0, R4Cis NH2, and R5Cis H (unmodified cytosine).

[0314] As used herein, a “5 -methyl cytosine nucleobase” is a modified cytosine where X is O, R4Cis NH2, and R5Cis methyl.

[0315] Hypoxanthine has structure (Hi):

[0316] O

[0317] '

[0318]

[0319] WW'

[0320] Hi

[0321] SMRH:4931-9018-2038.1 23EDIT0005WO / 68KM-408384-WO Hypoxanthine is considered a modified adenine, where Y7Ais N and R7Ais absent; Y8Ais C, R8Ais H, R1Ais H, R2Ais H, and R6Ais oxo.

[0322] In certain embodiments, modified nucleobases of a modified oligonucleotide are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6, and 0-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 5 -methylcytosine, hypoxanthine, 1 -methylpseudouridine, 2-aminopropyladenine, 5 -hydroxymethyl cytosine, xanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C°C-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5 -ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo (particularly 5-bromo), 5 -trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3 -deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as l,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one, and 9-(2-aminoethoxy)-l,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example, 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone. Further nucleobases include those disclosed inEnglisch, U. et al., Angew. Chem. Int. Ed. 1991, 30, 613; Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, Crooke, S. T. andLebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S. T., Ed., CRC Press, 2008, 163-166 and 442-443.

[0323] Preparation of certain of the above noted modified nucleobases, as well as other modified nucleobases, are known in the art and can be readily identified in publications, including, without limitation, Rogers et al., U. S. 5,134,066; Benner et al., U. S. 5,432,272; Matteucci et al., U. S. 5,502,177; Froehler etal., U. S. 5,594,121; and Cook et al., U. S. 5,681,941.

[0324] In certain embodiments, at least one nucleobase of a modified oligonucleotide is a modified nucleobase selected from modified adenine (A) having a structure represented by structure Ai, modified guanine (G) having a structure represented by structure Gi, modified thymine (T) or modified uracil (U) having a structure represented by structure Ti, and modified cytosine (C) having a structure represented by structure Ci.

[0325] In certain embodiments, each nucleobase of a modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, unmodified U, and 5 -methylcytosine (mC). 5 -methylcytosine is a modified nucleobase having structure Ci, where X is O, R4Cis NH2, and R5Cis CH3.

[0326] In certain embodiments, each nucleobase of a modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, unmodified U, 5 -methylcytosine (mC), and hypoxanthine. SMRH:4931-9018-2038.1 24EDIT0005WO / 68KM-408384-WO Hypoxanthine is a modified nucleobase having structure Hi and is also a modified A represented by structure Ai, where Y7Ais N and R7Ais absent; Y8Ais C, R8Ais H, R1Ais H, R2Ais H, and R6Ais oxo.

[0327] In certain embodiments, there are no modified nucleobases in a modified oligonucleotide and each nucleobase of a modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, and unmodified U.

[0328] C. Certain Motifs

[0329] In certain embodiments, the above modifications (sugar, nucleobase, internuclcosidc linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modification motifs and overall lengths as described herein, and such parameters are each independent of one another. Unless otherwise indicated, all modifications are independent of nucleobase sequence. In certain embodiments, a modified oligonucleotide is a guide. In certain embodiments, the guide has a sugar moiety, nucleobase, and / or internucleoside linkage motif described in any of the following references, each of which arc hereby incorporated by reference: WO 2014 / 144761, WO 2015 / 026885, WO 2016 / 089433, WO 2016 / 100951, WO 2016 / 123230, WO 2016 / 164356, WO 2017 / 004261, WO 2017 / 004279, WO 2017 / 068377, WO 2017 / 136794, WO 2017 / 181107, WO 2017 / 214460, WO 2018 / 009822, WO 2018 / 057946, WO 2018 / 098383, WO 2018 / 107028, WO 2018 / 125964, WO 2019 / 084664, WO 2019 / 147275, WO 2019 / 147743, WO 2019 / 183000, WO 2019 / 237069, WO 2021 / 119006, WO 2021 / 119275, WO 2021 / 125840, WO 2021 / 207651, WO 2021 / 207711, WO 2022 / 086846.

[0330] i. Certain Internucleoside Linkage Motifs

[0331] In certain embodiments, oligonucleotides comprise modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage. In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage, phosphodiester internucleoside linkage, and a sulfonyl phosphoramidate internucleoside linkage. In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage, phosphodiester internucleoside linkage, and a mesyl phosphoramidate internucleoside linkage.

[0332] In certain embodiments, the 5 ’-most internucleoside linkage of a modified oligonucleotide is a modified internucleoside linkage. In certain embodiments, the 3 ’-most internucleoside linkage of a modified oligonucleotide is a modified internucleoside linkage. In certain embodiments, at least 1, 2, 3, 4, or 5 of the SMRH:4931-9018-2038.1 25EDIT0005WO / 68KM-408384-WO 5 ’-most five internucleoside linkages of a modified oligonucleotide are modified internucleoside linkages. In certain embodiments, at least 1, 2, 3, 4, or 5 of the 3’-most five internucleoside linkages of a modified oligonucleotide are modified internucleoside linkages. In certain embodiments, the modified internucleoside linkage is a sulfonyl phosphoramidate internucleoside linkage. In certain embodiments, the modified internucleoside linkage is a mesyl phosphoramidate internucleoside linkage.

[0333] In certain embodiments, each internucleoside linkage of the guide is an unmodified phosphodiester linkage. In certain embodiments, the guide comprises one or more modified internucleoside linkages. In certain embodiments, the guide comprises one or more internucleoside linkages of Formula I:

[0334]

[0335] I

[0336] wherein independently for each such internucleoside linking group of Formula I:

[0337] X is selected from O or S;

[0338] Ri is selected from H, C1-C6alkyl, and substituted C1-C6alkyl; and

[0339] R2 is selected from an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a diazole, a substituted diazole, a Ci-Ce alkoxy, Ci-Ce alkyl, Ci-Ce alkenyl, Ci-Ce alkynyl, substituted Ci-Ce alkyl, substituted Ci-Ce alkenyl substituted Ci-Ce alkynyl.

[0340] In certain embodiments, X is S and Ri is H. In certain such embodiments, R2 is methyl.

[0341] In certain embodiments, each internucleoside linkage of Formula l is a mesyl phosphoramidate linkage of Formula II.

[0342] u'vw

[0343] I

[0344] o

[0345] I

[0346] O=P–N–SO2Me

[0347] 6 H

[0348]

[0349] » / V IW

[0350] II

[0351] In certain embodiments, the 3 ’-most one, two, three, four, or five internucleoside linkages are internucleoside linkages of Formula I. In certain embodiments, the 5 ’-most one, two, three, four, or five internucleoside linkages are internucleoside linkages of Formula I. In certain such embodiments, the remainder of the linkages are unmodified phosphodiester internucleoside linkages. In certain embodiments, the 3 ’-most and 5 ’-most one, two, three, four, or five internucleoside linkages are internucleoside linkages of Formula I, and the remainder of the linkages are unmodified phosphodiester internucleoside linkages. In certain embodiments, the three 3’-most and the three 5’-most internucleoside linkages are internucleoside

[0352] SMRH:4931-9018-2038.1 26EDIT0005WO / 68KM-408384-WO linkages of Formula I, and the remainder of the linkages are unmodified phosphodiester internucleoside linkages.

[0353] In certain embodiments, a guide comprises an oligonucleotide according to the following formula:

[0354]

[0355] J wherein:

[0356] each of Ni, N2, N3, N4, Ns, Ns, N7, Ng, N9, N10, and Nn is a nucleoside;

[0357] each of Li, L2, L3, L4, L5, Le, L7, Lg, L9, and Lio is an internucleoside linkage; and

[0358] each T is a nucleotide consisting of a nucleoside and an internucleoside linkage.

[0359] In certain embodiments, at least one of Li, L2, L3, L4. Ls, Lg, L7, kx. L9, and Lio is an internucleoside linking group of Formula I. In certain embodiments, at least two of Li, L2, L3. L4, Ls, Ls. L7, Ls, L9. and Lio are internucleoside linking groups of Formula I. In certain embodiments, at least one of Li, L2, L3 is an internucleoside linking group of Formula I, and at least one of Ls, L9, and Lio is an internucleoside linking group of Formula I. In certain embodiments, at least two of Li, L2, L3 are internucleoside linking groups of Formula I, and at least two of Ls, L9, and Lio arc an internucleoside linking group of Formula I. In certain embodiments, each of Li, L2, L3 is an internucleoside linking group of Formula I. In certain embodiments, each of Ls, L9, and Lio is an internucleoside linking group of Formula I. In certain embodiments, each of Li, L2, L3 and each of Ls, L, and Lio is an internucleoside linking group of Formula I. In certain embodiments, at least one of Li, L2, L3, L4, and L5 is an internucleoside linking group of Formula I, and at least one of L, L7, Ls, L9, and Lio is an internucleoside linking group of Formula I. In certain embodiments, at least two of Li, L2, L3, L4, and L5 are internucleoside linking groups of Formula I, and at least two of Ls, L9, and Lio are an internucleoside linking group of Formula I. In certain embodiments, each of Li, L2, L3. L4, and L5 is an internucleoside linking group of Formula I. In certain embodiments, each of Lg, L7, Ls, L9, and Lio is an internucleoside linking group of Formula I. In certain such embodiments, X is 0 and Ri is H. In certain such embodiments, R2 is methyl. In certain such embodiments, each internucleoside linkage of Formula I is a mesyl phosphoramidate linkage.

[0360] In certain embodiments, the guide comprises one or more phosphorothioate internucleoside linkages. In certain embodiments, the 3 ’-most one, two, three, four, or five internucleoside linkages are modified internucleoside linkages. In certain embodiments, the 5 ’-most one, two, three, four, or five internucleoside linkages are modified internucleoside linkages. In certain embodiments, the 3’-most and 5’-most one, two, three, four, or five internucleoside linkages are modified internucleoside linkages, and the remainder of the linkages are unmodified phosphodiester internucleoside linkages. In certain embodiments, the 3 ’-most one, two, three, four, or five internucleoside linkages are phosphorothioate internucleoside linkages. In certain embodiments, the 5 ’-most one, two, three, four, or five internucleoside linkages are phosphorothioate internucleoside linkages. In certain embodiments, the 3’ -most and 5 ’-most one, two, three, four, or five internucleoside linkages are phosphorothioate internucleoside linkages, and the remainder of the linkages are unmodified phosphodiester internucleoside linkages. In certain embodiments, the three 3 ’-most SMRH:4931-9018-2038.1 27EDIT0005WO / 68KM-408384-WO and the three 5 ’-most internucleoside linkages are phosphorothioate internucleoside linkages, and the remainder of the linkages are unmodified phosphodiester internucleoside linkages.

[0361] In some embodiments, the guide may comprise an oligonucleotide having the 5’ end according to the following formula:

[0362] N1L1-N2L2-N3L3-N4L4-N5L5- wherein:

[0363] each of Ni, N2, Ns, N4, and Ns is a nucleoside;

[0364] each of Li, L2, L3, L4, and L5 is an internucleoside linkage selected from Z and A according to rows 1 to 31 of Table 1, wherein Z is a sulfonyl phosphoramidate linkage of Formula I, and A is selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage:

[0365] Table 1

[0366] Row # Li L2L3L4L5

[0367] 1 Z A A A A

[0368] 2 A Z A A A

[0369] 3 A A Z A A

[0370] 4 A A A Z A

[0371] 5 A A A A Z

[0372] 6 Z Z A A A

[0373] 7 Z A Z A A

[0374] 8 Z A A Z A

[0375] 9 Z A A A Z

[0376] 10 A Z Z A A

[0377] 11 A Z A Z A

[0378] 12 A z A A Z

[0379] 13 A A Z Z A

[0380] 14 A A Z A Z

[0381] 15 A A A Z Z

[0382] 16 Z Z Z A A

[0383] 17 Z Z A Z A

[0384] 18 Z z A A Z

[0385] 19 Z A Z Z A

[0386] 20 Z A Z A Z

[0387] 21 Z A A Z Z

[0388] 22 A Z Z Z A

[0389]

[0390] SMRH:4931-9018-2038.1 28EDIT0005WO / 68KM-408384-WO 23 A Z z A z

[0391] 24 A Z A Z z

[0392] 25 A A Z Z z

[0393] 26 Z Z Z Z A

[0394] 27 Z Z Z A Z

[0395] 28 z z A Z Z

[0396] 29 z A Z Z Z

[0397] 30 A z Z Z z

[0398] 31 Z z Z z z

[0399]

[0400] In some embodiments, the guide may comprise an oligonucleotide having the 3’ end according to the following formula:

[0401] -N6L6-N7L7-N8L8-N9L9-N10L10-N11

[0402] wherein:

[0403] each of Ne N7, Ng, N9, and N10 is a nucleoside;

[0404] each of L6, L7, Ls, L9, and Lio is an internucleoside linkage selected from Z and A according to rows 1 to 31 of Table 2, wherein Z is sulfonyl phosphoramidate linkage of Formula I, and A is selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage:

[0405] Table 2

[0406] Row # Lfi L7 Ls L9 Lio

[0407] 1 Z A A A A

[0408] 2 A Z A A A

[0409] 3 A A Z A A

[0410] 4 A A A Z A

[0411] 5 A A A A Z

[0412] 6 Z Z A A A

[0413] 7 Z A Z A A

[0414] 8 Z A A Z A

[0415] 9 Z A A A Z

[0416] 10 A Z Z A A

[0417] 11 A Z A Z A

[0418] 12 A z A A Z

[0419] 13 A A Z Z A

[0420] 14 A A Z A Z

[0421]

[0422] SMRH:4931-9018-2038.1 29EDIT0005WO / 68KM-408384-WO 15 A A A z z

[0423] 16 Z Z z A A

[0424] 17 Z z A z A

[0425] 18 z z A A Z

[0426] 19 z A Z Z A

[0427] 20 z A z A Z

[0428] 21 z A A Z Z

[0429] 22 A Z Z Z A

[0430] 23 A z z A Z

[0431] 24 A z A Z Z

[0432] 25 A A z Z z

[0433] 26 Z z z z A

[0434] 27 Z z z A Z

[0435] 28 Z z A z z

[0436] 29 Z A z z z

[0437] 30 A z z z z

[0438] 31 Z z z z z

[0439]

[0440] In certain embodiments, a guide comprises an oligonucleotide according to the following formula:

[0441]

[0442] wherein:

[0443] each of Ni, N2, N3, N4, Ns, Ns, N7, Ns, N9, N10, and Nn is a nucleoside;

[0444] each of Li, L2, L3, L4. and Ls is an internucleoside linkage selected from Z and A according to rows 1 to 31 of Table 1, and each of Ls, L7, Ls. L9, and Lio is an internucleoside linkage selected from Z and A according to rows 1 to 31 of Table 2, wherein Z is a sulfonyl phosphoramidate linkage of Formula I, and A is selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage; and each T is a nucleotide consisting of a nucleoside and an internucleoside linkage.

[0445] In certain embodiments, each Z is a mesyl phosphoramidate internucleoside linkage.

[0446] ii. Certain Sugar Motifs

[0447] In certain embodiments, oligonucleotides comprise one or more type of modified sugar and / or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein. Generally, the guide comprises unmodified RNA nucleosides, and optionally one or more

[0448] SMRH:4931-9018-2038.1 30EDIT0005WO / 68KM-408384-WO modified nucleosides as described herein. In certain embodiments, the guide comprises or consists of a modified oligonucleotide.

[0449] In certain embodiments, the 5 ’-most nucleoside of a modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, the 3 ’-most nucleoside of a modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, at least 1, 2, 3, 4, or 5 of the 5’-most five nucleosides of a modified oligonucleotide comprise a modified sugar moiety. In certain embodiments, at least 1, 2, 3, 4, or 5 of the 3 ’-most five nucleosides of a modified oligonucleotide comprise a modified sugar moiety. In certain embodiments, each of the 5 ’-most three nucleosides of a modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each of the 3’ -most three nucleosides of a modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each of the 5 ’-most two nucleosides of a modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each of the 3 ’-most two nucleosides of a modified oligonucleotide comprises a modified sugar moiety.

[0450] In certain embodiments, a guide comprises a modified oligonucleotide according to the following formula:

[0451]

[0452] J wherein:

[0453] each of Ni, N2, N3, N4, Ns, Ns, N7, Ng, N9, N10, and Nn is a nucleoside;

[0454] each of Li, L2, L3, L4, L5, Lg, L7, Lg, L9, and Lio is an internucleoside linkage; and

[0455] each T is a nucleotide consisting of a nucleoside and an internucleoside linkage.

[0456] In certain embodiments, at least one of Ni, N2, N3, N4, Ns, Ng, N7, Ng, Ng, and N10 comprises a modified sugar moiety independently selected from a 2'-OMe sugar moiety, 2'-M0E sugar moiety, 2'-F sugar moiety, 2'-NMA sugar moiety, cEt sugar moiety, and LNA sugar moiety. In certain embodiments, at least one of Ni, N2, and N3 and at least one of Ng, N7, Ng, Ng, and N10 comprises a modified sugar moiety independently selected from a 2'-OMe sugar moiety, 2'-MOE sugar moiety, 2'-F sugar moiety, 2'-NMA sugar moiety, cEt sugar moiety, and LNA sugar moiety. In certain embodiments, at least two of Ni, N2, N3, N4, and Ns and at least two of Ng, N7, Ng, N9, and N10 comprises a modified sugar moiety independently selected from a 2'-OMe sugar moiety, 2'-M0E sugar moiety, 2'-F sugar moiety, 2'-NMA sugar moiety, cEt sugar moiety, and LNA sugar moiety. In certain embodiments, at least three of Ni, N2, N3, N4, and Ns and at least three of Ng, N7, Ng, N9, and N10 comprises a modified sugar moiety independently selected from a 2'-OMe sugar moiety, 2'-MOE sugar moiety, 2'-F sugar moiety, 2'-NMA sugar moiety, cEt sugar moiety, and LNA sugar moiety.

[0457] In some embodiments, the guide may comprise an oligonucleotide having the 5’ end according to the following formula:

[0458] N1L1-N2L2-N3L3-N4L4-N5L5- wherein:

[0459] SMRH:4931-9018-2038.1 31EDIT0005WO / 68KM-408384-WO each of Ni, N2, Ns, N4, and Ns is a nucleoside selected from Y and B according to rows 1 to 31 of Table 3, wherein each Y comprises a modified sugar moiety independently selected from a 2'-0Me sugar moiety, 2'-M0E sugar moiety, 2'-F sugar moiety, 2'-NMA sugar moiety, cEt sugar moiety, and LNA sugar moiety, and B is an unmodified 2’-0H(H) ribosyl sugar moiety; and

[0460] each of Li, L2, L3, L4, and Ls is an internucleoside linkage:

[0461] Table 3

[0462] Row # Ni N2N3N4N₅

[0463] 1 Y B B B B

[0464] 2 B Y B B B

[0465] 3 B B Y B B

[0466] 4 B B B Y B

[0467] 5 B B B B Y

[0468] 6 Y Y B B B

[0469] 7 Y B Y B B

[0470] 8 Y B B Y B

[0471] 9 Y B B B Y

[0472] 10 B Y Y B B

[0473] 11 B Y B Y B

[0474] 12 B Y B B Y

[0475] 13 B B Y Y B

[0476] 14 B B Y B Y

[0477] 15 B B B Y Y

[0478] 16 Y Y Y B B

[0479] 17 Y Y B Y B

[0480] 18 Y Y B B Y

[0481] 19 Y B Y Y B

[0482] 20 Y B Y B Y

[0483] 21 Y B B Y Y

[0484] 22 B Y Y Y B

[0485] 23 B Y Y B Y

[0486] 24 B Y B Y Y

[0487] 25 B B Y Y Y

[0488] 26 Y Y Y Y B

[0489] 27 Y Y Y B Y

[0490]

[0491] SMRH:4931-9018-2038.1 32EDIT0005WO / 68KM-408384-WO 28 Y Y B Y Y

[0492] 29 Y B Y Y Y

[0493] 30 B Y Y Y Y

[0494] 31 Y Y Y Y Y

[0495]

[0496] In some embodiments, the guide may comprise an oligonucleotide having the 3’ end according to the following formula:

[0497] -NeLe-NyLy-NsLg-NgLg-NioLio-Nii

[0498] wherein:

[0499] each of Ne is a nucleoside;

[0500] each of N7, Ns, No, Nio, and Nn is a nucleoside selected from Y and B according to rows 1 to 31 of Table 4, wherein each Y comprises a modified sugar moiety independently selected from a 2'-0Me sugar moiety, 2'-M0E sugar moiety, 2'-F sugar moiety, 2'-NMA sugar moiety, cEt sugar moiety, and LNA sugar moiety, and B is an unmodified 2’-OH(H) ribosyl sugar moiety; and

[0501] each of L6, L7, Ls, L9, and Lio is an internucleoside linkage:

[0502] Table 4

[0503] Row # N7Ns N9Nio Nn

[0504] 1 Y B B B B

[0505] 2 B Y B B B

[0506] 3 B B Y B B

[0507] 4 B B B Y B

[0508] 5 B B B B Y

[0509] 6 Y Y B B B

[0510] 7 Y B Y B B

[0511] 8 Y B B Y B

[0512] 9 Y B B B Y

[0513] 10 B Y Y B B

[0514] 11 B Y B Y B

[0515] 12 B Y B B Y

[0516] 13 B B Y Y B

[0517] 14 B B Y B Y

[0518] 15 B B B Y Y

[0519] 16 Y Y Y B B

[0520] 17 Y Y B Y B

[0521]

[0522] SMRH:4931-9018-2038.1 33EDIT0005WO / 68KM-408384-WO 18 Y Y B B Y

[0523] 19 Y B Y Y B

[0524] 20 Y B Y B Y

[0525] 21 Y B B Y Y

[0526] 22 B Y Y Y B

[0527] 23 B Y Y B Y

[0528] 24 B Y B Y Y

[0529] 25 B B Y Y Y

[0530] 26 Y Y Y Y B

[0531] 27 Y Y Y B Y

[0532] 28 Y Y B Y Y

[0533] 29 Y B Y Y Y

[0534] 30 B Y Y Y Y

[0535] 31 Y Y Y Y Y

[0536]

[0537] In certain embodiments, a guide comprises an oligonucleotide according to the following formula:

[0538] N1L1-N2L2-N3L3-N4L4-N5L5-T(59-149)-N6L6-N7L7-NSL8-N9L9-N1OLIO-N11 J wherein:

[0539] Nr, is a nucleoside selected from Y and B;

[0540] each of Ni, N2, N3, N4, and N5 is a nucleoside selected from Y and B according to rows 1 to 31 of Table 3 and each of N₅, Ns, N9, N10, and Nn is a nucleoside selected from Y and B according to rows 1 to 31 of Table 4, wherein each Y comprises a modified sugar moiety independently selected from a 2'-0Me sugar moiety, 2'-M0E sugar moiety, 2'-F sugar moiety, 2'-NMA sugar moiety, cEt sugar moiety, and LNA sugar moiety, and B is an unmodified 2’-0H(H) ribosyl sugar moiety;

[0541] each of Li, L2, L3, L4. and L5 is an internucleoside linkage selected from Z and A according to rows 1 to 31 of Table 1, and each of Lg, L7, Ls, L9, and Lio is an internucleoside linkage selected from Z and A according to rows 1 to 31 of Table 2 wherein Z is a sulfonyl phosphoramidate linkage of Formula I, and A is selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage; and each T is a nucleotide consisting of a nucleoside and an internucleoside linkage.

[0542] In certain embodiments, each Y is a cEt sugar moiety. In certain embodiments, each Y is a 2’ -MOE sugar moiety. In certain embodiments, each Y is a 2’-0Me sugar moiety.

[0543] iii. Certain Nucleobase Motifs

[0544] In certain embodiments, oligonucleotides comprise modified and / or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, SMRH:4931-9018-2038.1 34EDIT0005WO / 68KM-408384-WO each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.

[0545] In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3 ’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3 ’-end of the oligonucleotide. In certain embodiments, the block is at the 5’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5 ’-end of the oligonucleotide.

[0546] In certain embodiments, the modified nucleobase is selected from pseudouracil, 2-6 diamino purine, 2 -thiouracil, 4-thiouracil, 2-aminoadcninc, 6-mcthyladcninc, hypoxanthine, or 5-mcthylcytosinc.

[0547] D. Certain Lengths

[0548] In certain embodiments, modified oligonucleotides can have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270,

[0549] 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350; provided that X< Y. For example, in certain embodiments, oligonucleotides consist of 70-350, 100-350, 150-350, 200-350, 250-350, 250-300, 200-300, 70-250, 80-250, 90-250, 100-250, 110-250, 120-250, 130-250, 140-250, 150-250, 160-250, 170-250, 180-250, 190-250, 200-250, 70-160, 80-160, 90-160, 100-160, 110-160, 120-SMRH:4931-9018-2038.1 35EDIT0005WO / 68KM-408384-WO 160,130-160, 140-160, 150-160, 160-170, 90-100,100-110, 110-120, 120-130, 130-140, 140-150, 100-140, 110-140, 110-130, 120-140, or 120-150 linked nucleosides.

[0550] In certain embodiments, a single guide oligonucleotide consists of 70-350, 100-350, 150-350, 200-350, 250-350, 250-300, 200-300, 70-250, 80-250, 90-250, 100-250, 110-250, 120-250, 130-250, 140-250, 150-250, 160-250, 170-250, 180-250, 190-250, 200-250, 70-160, 80-160, 90-160, 100-160, 110-160, 120-160, 130-160, 140-160, 150-160, 90-100,100-110, 110-120, 120-130, 130-140, 140-150, 100-140, 110-140, 110-130, 120-140, 120-150 or 120-160 linked nucleosides.

[0551] E. Nucleobase Sequence

[0552] In certain embodiments, oligonucleotides are described by their nucleobase sequence. In certain embodiments a nucleobase sequence is described by reference to another nucleobase sequence. For example, the nucleobase sequence of a modified oligonucleotide or a portion thereof may be described as complementary to the nucleobase sequence of a target nucleic acid. In such embodiments, the nucleobase sequence is at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to an equal length portion of the second oligonucleotide or nucleic acid, such as a target nucleic acid. In certain embodiments, the nucleobase sequence is at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.

[0553] In certain embodiments, the spacer sequence of a guide ranges from X to Y nucleobases, wherein X represents the lowest number in the range and Y represents the highest number in the range, wherein X and Y are each independently selected from 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46,47, 48, 49 or 50; provided that X< Y. In certain embodiments, the spacer sequence of a guide consists of 15-30, 18-26, 18-24, 18-22, 20-26, 20-24, 20-22, 21-23, 22-23, 20, 21, 22, or 23 nucleobases. In some embodiments, a spacer sequence of a guide contains 18, 19 or 20 nucleobases.

[0554] In certain embodiments, the scaffold sequence of a guide consists of 60-130, 60-120, 60-110, 60-100, 70-130, 70-120, 70-110, 70-100, 70-90, 70-80, 80-130, 80-120, 80-110, 80-100, 80-90, 90-130, 90-120, 90-110, 90-100, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, or 110 nucleobases.

[0555] In certain embodiments, the scaffold sequence of a guide is truncated relative to the native guide sequence for the corresponding Cas protein. In certain embodiments, the guide is truncated at the 3’ end. In certain embodiments, the guide is shortened by removing nucleotides from stem loop and / or hairpin structures, such as removing one base pair from a hairpin to shorten the hairpin. In certain embodiments, the truncated guide is 1-5, 1-10, 1-15, 1-20, or more than 20 nucleotides shorter than the native guide. In certain embodiments, the scaffold sequence of a guide represents a length-extended version of a native guide sequence for the corresponding Cas protein. In certain embodiments, additional nucleobases are added at the SMRH:4931-9018-2038.1 36EDIT0005WO / 68KM-408384-WO 3’ end. In certain embodiments, additional nucleobases are inserted within loops and / or hairpins of the native guide.

[0556] F. Secondary Structure

[0557] In certain embodiments, oligonucleotides or portions thereof adopt a defined secondary structure. Secondary structure is influenced by Watson-Crick base pairing, Hoogsteen base pairing, and / or non-canonical base pairing interactions. The secondary structure of an oligonucleotide sequence can be predicted using standard software, such as the Vienna RNA package RNAfold (http: / / rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi; see Lorenz, et al., Algorithms for Molecular Biology, 6: 1 26, 2011). In certain instances, the same algorithm or different algorithms may predict more than one secondary structure for an oligonucleotide.

[0558] A guide oligonucleotide has secondary structure, at least some portion of which forms contacts with its cognate Cas protein. For example, the guide secondary structure features for binding to spCas9 have been described in detail based on both empirical evidence (see, e.g., Zhang, et al. ChemPlusChem. 2021, 86(4): 587-600 and Dong, et al. Curr. Opin. Biotechnol. 2022, 75:102697) and the crystal structures of a guide-SpCas9-target DNA complex (see Nishimasu, et al. Cell. 2014, 156(5):935-49). By adding a tetraloop to the duplex that forms between the native crRNA and native tracrRNA of spCas9, the functions of the crRNA and tracrRNA are combined into a single guide RNA. The same tetraloop can be added to join the crRNA and tracrRNA of a novel type II Cas protein. A single guide for spCas9 has conserved structural features within its protein-binding region, including the lower stem, the upper stem, the tetraloop, the bulge, the nexus region (a hairpin with a 5 nucleotide loop), and two hairpins at the 3 ’-end. The guide RNA for certain novel type II Cas proteins have been shown to have unique secondary structures with common features formed from the scaffold sequence, including a duplex region (dual guides) or a stem loop (single guides) and one or more hairpins at the 3’ end. The 5 ’-most stem loop feature of a guide is also known as the Repeat- Anti -repeat region (R-AR).

[0559] Guide secondary structure features that are responsible for the binding of the guide to the Cas enzyme include having at least one duplex region formed by the 5 ’ end of the scaffold sequence (including one or more stem-loops for a single guide) and two or more additional stem-loop and / or hairpin regions. A bulge in the 5 ’-most stem-loop is conserved among guides for most type II Cas proteins; however, guides with diverse predicted secondary structures have also been reported (see, e.g., Alexander et al. CRISPR J. 2023, 6(3): 261-277).

[0560] In certain embodiments, the activity of a guide does not depend on a specific nucleobase sequence, but rather is driven by the formation of a specific RNA secondary structure. The sequence that creates this secondary structure can be altered. One common method of altering the sequence while maintaining the three dimensional structure required for binding of the guide to its cognate Cas is to flip base-pairs within a stem or hairpin, such as in an “A-U” flip. In such embodiments, a natural A-U base pair is replaced with a U-A base pair, swapping the position of the “A” and the “U” in the guide sequence. This can particularly improve SMRH:4931-9018-2038.1 37EDIT0005WO / 68KM-408384-WO editing efficiencies when the original guide contains four consecutive Us, a putative pol-III terminator (see, e.g. Chen ei al. Cell. 2013, 155(7): 1479-1491). Another method of altering the sequence within a stem or hairpin involves the replacement of less stable A-U or U-A base pairs with more stable C-G or G-C base pairs to increase overall hairpin stability (see, e.g. Riesenberg, et al. Nat. Commun., 2022, 13:482).

[0561] In certain embodiments a natural hairpin or stem-loop structure of the guide is extended or replaced by an extended stem-loop. It has been demonstrated in certain cases that extension of the stem can enhance the assembly of the guide with the Cas protein (Chen et al. Cell. 2013, 155(7): 1479-1491). In certain embodiments the stem of the stem loop is extended by at least 1, 2, 3, 4, 5 or more complementary base pairs (i.e. corresponding to the addition of 2, 4, 6, 8, 10 or more nucleotides in the guide). In certain embodiments, these are located at the end of the stem, adjacent to the loop of the stem loop. In certain embodiments, a natural hairpin or stem-loop structure of the guide is shortened. In certain such embodiments, the stem of the stem-loop is shortened by 1, 2, or 3 complementary base pairs (i.e. corresponding to the removal of 2, 4, or 6 nucleotides in the guide).

[0562] It has also been demonstrated that, for spCas9 guides, the loop region of the upper stern or hairpin 1 can be replaced by a longer loop comprising an aptamer. In certain embodiments, the aptamer binds to an effector protein. In certain embodiments, the aptamer binds to MS2, PP7, com, or boxB. In certain embodiments, an aptamer can be appended at the 3 ’ end of a guide, or it can be inserted into the guide as a new hairpin beyond the 3’ -most hairpin of the native guide (see, e.g., Zalatan, et al. Cell. 2015, 160(1):339-350).

[0563] In certain embodiments, a guide can be modified such that it is activated only by an external chemical signal. In one such embodiment, a guide includes a 5’-extension, appended to the 5 ’-end of the spacer sequence of the guide, which has a sequence that can form a hairpin duplex with the spacer sequence. This 5 ’-extension also includes a theophylline aptamer. In this system, the addition of theophylline causes cleavage of the 5 ’-extension, and reveals the spacer sequence of the guide. In certain embodiments, a guide can be modified such that it can be deactivated by an external chemical signal. In one such embodiment, a guide includes a theophylline aptamer incorporated into the loop region of the first stem loop as well as a second theophylline aptamer incorporated into the loop of the second hairpin. The guide works for Cas9 cleavage of a target but is cleaved when theophylline is added to the system. Various other external control systems for guides have been described (see, e.g., Zhang, et al. ChemPlusChem. 2021, 86(4): 587-600).

[0564] II. Certain Editing Systems

[0565] In certain embodiments, an editing system comprises a Cas protein and a guide. In certain embodiments, a guide consists of a single oligonucleotide and is a single guide. In certain embodiments, a guide consists of two oligonucleotides and is a dual guide. In certain embodiments, a guide comprises a spacer sequence and a scaffold sequence. In certain embodiments, the guide is a single guide consisting of an oligonucleotide that comprises a spacer sequence and a scaffold sequence. In certain embodiments, the SMRH:4931-9018-2038.1 38EDIT0005WO / 68KM-408384-WO spacer sequence is complementary to an anti-spacer sequence within the target strand of a target DNA. In certain embodiments, the spacer sequence is complementary to an anti-spacer sequence within a singlestranded RNA.

[0566] In certain embodiments, an editing system comprises a Cas protein and a guide. In certain embodiments, the Cas protein is a dead Cas protein or a Cas fusion protein.

[0567] The Cas protein is a native (naturally occurring)Cas protein or a non-naturally occurring Cas protein. In certain embodiments, the Cas protein is selected from a Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), Casl2, CasX, CasY, CaslOO, Csyl, C sy2, Csy3, Cscl, Csc2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, and Cpfl (Casl2a) protein, and functional derivatives thereof. In certain embodiments, the Cas protein is a class 2, type II CRISPR protein. In certain embodiments, the Cas protein is a class 2, type V CRISPR protein.

[0568] In certain embodiments, the Cas protein is selected from any of those described in, e.g., WO 2013 / 176772, WO2014 / 093661, WO 2016 / 205711, WO 2019 / 089820, WO 2018 / 064371, WO 2019 / 178427, WO 2020 / 181101, and functional derivatives thereof.

[0569] In certain embodiments, the Cas protein is selected from any of those described in, e.g., WO 2025 / 059543, which is incorporated by referenced herein in its entirety, and WO 2025 / 137461, which is incorporated by referenced herein in its entirety, and functional derivatives thereof.

[0570] In certain embodiments, the Cas protein is a Cas9 protein selected from Streptococcus pyogenes (SpyCas9), Staphylococcus lugdunensis (SluCas9), P. pneumotropica Cas9 (PpCas9), Staphylococcus auricularis Cas9 (SauriCas9), Staphylococcus lugdunensis Cas9 (SlugCas9), Staphylococcus lutrae Cas9 (SlutrCas9) Staphylococcus haemolyticus Cas9 (ShaCas9), Campylobacter jejuni (CjCas9), Staphylococcus aureus (SaCas9), or a variant thereof.

[0571] In certain embodiments, the Cas protein is a variant of Cas9, including but not limited to, a small Cas9, a dead Cas9 (dCas9), and a Cas9 nickase. In certain embodiments, the Cas protein comprises a RuvC or RuvC -like nuclease domain (e.g., Cpfl) and / or a IINII or IINII-like nuclease domain (e.g., Cas9).

[0572] In certain embodiments, the Cas9 protein is 5. pyogenes Cas9, S. aureus Cas9, N. meningitides Cas9, 5. thermophilus Cas9, S. thermophilus 3 Cas9, T. denticola Cas9, or a variant thereof.

[0573] In certain embodiments, the Cas protein is a Casl2 protein or a variant of a Casl2 protein.

[0574] In certain embodiments, the Cas protein is a mutant Cas protein. For example, the Cas protein can be a mutant of of a native (naturally occurring) Cas protein. The mutant Cas protein can also be a mutant Cas protein with altered activity compared to a native (naturally occurring) Cas protein, such as altered activity (e.g., altered or abrogated DNA endonuclease activity without substantially diminished binding affinity to a target nucleic acid). Such modification can allow for the sequence-specific nucleic acid targeting of the Cas protein for the purpose of transcriptional modulation (e.g., activation or repression); epigenetic modification or chromatin modification by methylation, demethylation, acetylation or deacetylation, or any other modifications SMRH:4931-9018-2038.1 39EDIT0005WO / 68KM-408384-WO of target nucleic acid binding and / or modifying proteins known in the art. In some embodiments, the mutant Cas protein has no DNA endonuclease activity.

[0575] In certain embodiments, the Cas protein is a nickase that cleaves the target strand of a double-stranded target nucleic acid but has reduced ability to cleave the non-target strand of a double-stranded target nucleic acid, or that cleaves the non-target strand of a double-stranded target nucleic acid but has reduced ability to cleave the target strand of the double-stranded target nucleic acid. In some embodiments, the Cas protein has a reduced ability to cleave both the target and the non-target strands of the target double-stranded nucleic acid.

[0576] In certain embodiments, the Cas protein binds to a guide to form a ribonucleoprotein, or RNP. In certain embodiments, the RNP binds, or is capable of binding, to a target nucleic acid. Upon binding, the RNP may create a break in the target nucleic acid, such as a double strand break or a single strand break (e.g., a nick). In certain embodiments, the break may be repaired by a process of non-homologous end-joining (“NHEJ”) or homology-directed repair (“HDR”). In certain embodiments, repair of a break can result in, for example, a gene knockout or a gene knock-in.

[0577] In certain embodiments, the guide combines, or is capable of combining, with a dead Cas protein to form a RNP that binds, or is capable of binding, to a target nucleic acid but does not break the target nucleic acid, wherein binding of the RNP prevents transcription or translation, thereby silencing expression of a target nucleic acid. In certain embodiments, the dead Cas protein is a fusion protein that includes a transcriptional repressor domain. Such embodiments encompass methods of CRISPR interference (“CRISPRi”). See, for example, Qi LS, et al. Cell. 2013, 152(5): 1173-83, the contents of which are incorporated herein by reference in their entirety.

[0578] In certain embodiments, the guide combines, or is capable of combining, with a dead Cas protein to form a RNP that binds, or is capable of binding, to a target nucleic acid but does not break the target nucleic acid, wherein binding of the RNP activates transcription or translation, thereby activating expression of or over-expressing a target nucleic acid. In certain embodiments, the dead Cas protein is a fusion protein that includes a transcriptional activator. Such embodiments encompass methods of CRISPR activation (“CRISPRa”). See, for example, Polstein LR, Gersbach CA. (2015) A light inducible CRISPR-Cas9 system for control of endogenous gene activation, Nat Chem Biol, 11 (3): 198-200; and Zalatan JG, Lee ME, et al. (2015) Engineering complex synthetic transcriptional programs with CRISPR RNA scaffolds. Cell 15; 160(1-2):339-50, the contents of which are incorporated herein by reference in their entirety.

[0579] In certain embodiments, the guide combines, or is capable of combining, with a dead Cas protein to form a RNP that binds, or is capable of binding, to a target nucleic acid but does not break the target nucleic acid, wherein binding of the RNP enables visualization of a target nucleic acid. In certain embodiments, the dead Cas protein is a fusion protein that includes a fluorescent protein. Such embodiments encompass methods of gene visualization. See, for example, Ma H, Naseri A, et al. Proc Natl Acad Sci USA. 2015, 10; 112(10):3002- 7; and Ma H, Tu LC, et al. Nat Biotechnol. 2016, 34(5):528-30; and Carlson-Stevermer,.1.,

[0580] SMRH:4931-9018-2038.1 40EDIT0005WO / 68KM-408384-WO et al. Nat. Commun. 2020, 11(1), 1-7, the contents of which are incorporated herein by reference in their entirety.

[0581] In certain embodiments, the guide combines, or is capable of combining, with a Cas protein to form a RNP that binds, or is capable of binding, to a target nucleic acid, wherein binding of the RNP enables introduction of point mutations into a target nucleic acid. In certain embodiments, the Cas protein is a fusion protein that includes a nucleobase deaminase. In certain embodiments, the nucleobase deaminase is a cytosine base editor that can introduce C> T or T> C transitions. In certain embodiments, the nucleobase deaminase is an adenine base editor that can introduce A> G or G> A transitions. Such embodiments encompass methods of base editing.

[0582] In certain embodiments, the guide is a prime editing guide and combines, or is capable of combining, with a Cas nickase protein to form a RNP that binds, or is capable of binding, to a target nucleic acid, wherein binding of the RNP enables introduction of point mutations into a target nucleic acid. In certain embodiments, the Cas nickase protein is a fusion protein that includes a reverse transcriptase. Such embodiments encompass methods of prime editing. Sec, for example, Gao P, Lyu Q, ct al. Genome Biol. 2021, 22(1 ): 83, the contents of which are incorporated herein by reference in their entirety.

[0583] III. Certain Delivery Vehicles

[0584] A. Lipid Nanoparticles (" LNP”)

[0585] i. Composition

[0586] In certain embodiments, an LNP comprises an ionizable or cationic lipid, a non-cationic helper lipid, a polymer-lipid, cholesterol or a derivative thereof, and optionally one or more excipients. The LNP at least partially encapsulates a cargo. In certain embodiments, the cargo comprises a nucleic acid, e.g., an exogenous mRNA. In certain embodiments, the cargo comprises a guide, e.g., an oligonucleotide. In certain embodiments, the cargo comprises an exogenous mRNA and a guide. In certain embodiments, the LNP is provided as a suspension in an aqueous medium. In certain embodiments, a pharmaceutical composition comprises an LNP at least partially encapsulating a cargo in an aqueous medium.

[0587] In certain embodiments, the LNP comprises 30 to 70 mol % of an ionizable or cationic lipid; 5 to 30 mol % of a non-cationic lipid; 20 to 50 mol % of cholesterol or a derivative thereof; and 1 to 10 mol % of a polymer lipid. In certain embodiments, the LNP comprises 40 to 60 mol % of an ionizable or cationic lipid; 5 to 15 mol % of a non-cationic lipid; 30 to 50 mol % of cholesterol or a derivative thereof; and 2 to 4 mol % of a polymer lipid.

[0588] The mol % of each of the ionizable or cationic lipid, a helper lipid, polymer lipid, and sterol lipid (e.g. cholesterol) are determined together (“total lipid”) irrespective of any cargo or excipients.

[0589] The LNP may be characterized by a molar ratio or mass ratio of a cargo (such as an exogenous mRNA or oligonucleotide) to total lipid. In certain embodiments, the lipid to cargo ratio is 20: 1 to 1: 1, 10: 1 to 1:1, or 5:1 to 1:1 (mass:mass).

[0590] SMRH:4931-9018-2038.1 41EDIT0005WO / 68KM-408384-WO In certain embodiments, the polymer lipid is a PEG-lipid. In certain embodiments, the helper lipid is a Zwitterionic phospholipid.

[0591] In certain embodiments, the LNP is one of those described in any of Kazemian, et al., Mol.

[0592] Pharmaceutics, 2022, 19, 1669-1689; Albertsen et al., Adv. Drug Deliv. Rev. 2022, 118, 114416; Cullis eta / ., Nat. Rev. Drug Discov. 2024, 23, 709-722.

[0593] 1. Ionizable and Cationic Lipids

[0594] In certain embodiments, provided is an LNP comprising an ionizable or a cationic lipid. As used herein, an “ionizable lipid” is a lipid-comprising compound which is substantially protonated at or below physiological pH (e.g., pH 7-7.5, or pH 7.4). As used herein, a “cationic lipid” is a lipid-comprising compound that carries a nonexchangeable net positive charge. A lipid is generally a hydrophobic moiety, which may comprise be a hydrocarbon chain.

[0595] When used in an LNP, an ionizable lipid may enhance endosomal drug escape compared to an LNP with a cationic lipid. In vivo, delivery capacity of an LNP may benefit from electrostatic charge interactions with the endosome and subsequent LNP destabilization to release the cargo. An ionizable lipid can aid delivery by either (i) protonating in mildly acidic environments to acquire positive charges and / or (ii) incorporating pH-labile groups that cleave or change conformation in a low pH environment. Such pH-sensitive lipids therefore help enhance the charge-based uptake of liposomes in target cells or trigger cargo release by destabilizing liposome membranes. Ionizable or cationic lipids comprising hydrocarbon chains including unsaturation may provide LNPs having higher fluidity.

[0596] Example publications describing ionizable or cationic lipids include U. S, Patent Publication Nos. 2006 / 0083780 and 2006 / 0240554; US 5,208,036; US 5,264,618; US 5,279,833; US 5,283,185; US 5,753,613; and US 5,785,992; and PCT Publication No. WO 96 / 10390, the disclosures of each of which are herein incorporated by reference in their entirety.

[0597] In certain embodiments, the ionizable or cationic lipids may include an ionizable or cationic head group, optionally including one or more linear hydrocarbon chains of 10-20 carbon atoms, and optionally one or more branched, optionally unsaturated, hydrocarbon chains of 12-30 carbon atoms, each of which is optionally interrupted by one or more functionalities selected from ester, ether, amine (e.g., tertiary amine), amide, carbonate, carbamate, urea, and disulfide. The ionizable or cationic lipid may comprise a branching moiety. In certain embodiments the branching moiety comprises a tertiary carbon atom, a quaternary carbon atom, a tertiary amine, a vicinal diol, an amide, a carbamate, or an acetal.

[0598] In certain embodiments, an ionizable lipid contains an amine (“ionizable amino lipid”), for example, a tertiary amine. It is believed that proton cycling of an amino group at disparate pH may provide additional stabilization of a negatively charged cargo (e.g., an exogenous mRNA or an oligonucleotide), while promoting cargo release inside a low pH compartment in vivo (e.g., an endosome).

[0599] Example publications describing ionizable or cationic lipids include U. S. Patent Publication Nos. 2006 / 0083780 and 2006 / 0240554; US 5,208,036; US 5,264,618; US 5,279,833; US 5,283,185; US SMRH:4931-9018-2038.1 42EDIT0005WO / 68KM-408384-WO 5,753,613; and US 5,785,992; and PCT Publication No. WO 96 / 10390, WO 2011 / 068810, WO 2012 / 000104, WO 2012 / 170930, WO 2013 / 086354, WO 2018 / 006052, WO 2020 / 097520, WO 2021 / 000041, WO 2022 / 266032, WO 2021 / 026647, WO 2022 / 173531, the disclosures of each of which are herein incorporated by reference in their entirety.

[0600] An ionizable or cationic lipid can be synthesized according to methods known in the art, such as methods described in, e.g. WO 2010 / 042877, WO 2009 / 086558, U. S. Patent Publication No. 2006 / 0240554, the disclosures of each of which are herein incorporated by reference in their entirety.

[0601] In certain embodiments, the ionizable lipid is DLin-MC3-DMA, ALC-0315, SM-102, or LP-01:

[0602] CH3O H3C'N'X^^^'O H3C....-CHa DLin-MC3-DMA

[0603]

[0604] SMRH:4931-9018-2038.1 43EDIT0005WO / 68KM-408384-WO 2. Polymer lipids

[0605] Polymer lipids such as PEG lipids may be used as a component in an LNP to modify the surface of the LNP. Such modification can stabilize an LNP in the presence of serum and therefore assist in extending circulation in vivo due to reduced protein absorption. In addition, the amount of polymer lipid in the LNP influences overall LNP size, which can affect the rate of cellular uptake.

[0606] In certain embodiments the ionizable lipids disclosed herein are combined with a polymer lipid to form an LNP. In certain embodiments, the polymer lipid is a pegylated or PEG lipid. When formulated as part of an LNP, PEG lipids can mask or cloak the cargo in vivo, thereby reducing immunogenicity and antigenicity of the cargo.

[0607] The polymer lipid may be a polymer-functionalized lipid, in which the polymer and lipid (e.g., a hydrocarbon chain optionally interrupted by one or more intervening functionalities) are joined by covalent bonds with optional intervening atoms. The polymer lipid optionally includes a branching moiety. The lipid may be, e.g., a hydrocarbon chain optionally interrupted by one or more intervening functionalities. The polymer lipid generally includes an uncharged, hydrophilic moiety which is believed to limit aggregation, such as PEG, GMI, or ATTA, during formulation of an LNP. Thus, it is believed that a polymer lipid may also reduce aggregation when included in an LNP. In certain embodiments, the content of the polymer lipid in the LNP is selected to reduce particle aggregation.

[0608] Examples of polymer lipids include polyethylene glycol (PEG)-modified lipids, monosialoganglioside GMI, polyamide oligomers (" PAO"), ATTA-lipids, and PEG-functionalized lipids, such as described in US 6,320,017; US 6,320,017; US 5,820,873; US 5,534,499; and US 5,885,613. Other polymer lipids include polyoxazoline (POZ)-lipid (e.g. POZ-DAA conjugates; see, e.g., WO 2010 / 006282), polyamide oligomers (e.g., ATTA-lipid conjugates), and those described in WO 2008 / 011561, WO 2009 / 140427, WO 2012 / 099755, WO 2013 / 049328, W02015 / 017519, WO 2015 / 199952, WO 2016 / 118697, WO2016 / 094342, W02020 / 219941, WO 2020 / 061284, WO 2020 / 061295, WO 2022 / 133344, US 9,517,270 or US 9,801,944. In certain embodiments, the polymer lipid comprises one or more hydrocarbon chains that are interrupted by a biodegradable functional group, e.g., an ester. The polymer lipid may comprise a branching moiety. In certain embodiments the branching moiety comprises a tertiary carbon atom, a quaternary carbon atom, a tertiary amine, a vicinal diol, an amide, a carbamate, or an acetal.

[0609] Examples of polymer lipids include PEG-functionalized phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG-CerC20 which are described in U. S. Patent No.

[0610] 5,820,873), PEG-modified dialkylamines, PEG-modified l,2-diacyloxypropan-3-amines, PEG-modified diacylglycerols, and PEG-modified dialkylglycerols. The lipid chain may vary according to known determinants in the art and may be, for example, a hydrocarbon of 10 to 30 carbon atoms in length.

[0611] For example, certain embodiments provide a pegylated diacylglycerol (PEG-DAG) such as l-(monomethoxy-polyethyleneglycol)-2,3-dimyristoylglycerol (PEG-DMG), PEG-dipalmitoylglycerol, PEG-dilauroylglycerol, PEG-distearoylglycerol (PEG-DSPE), or 4-0-(2’,3’-di(tetradecanoyloxy)propyl-l-0-(co-SMRH:4931-9018-2038.1 44EDIT0005WO / 68KM-408384-WO methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG); a pegylated phosphatidylethanolamine (PEG-PE); a PEG-glycamide ((N-acyl-N-alkyl-glycamine) such as PEG- dimyristylglycamide, PEG-dipahnitoylglycamide, or PEG-disterylglycamide; a PEG dialkoxypropylcarbamate such as co-methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecanoxy)propyl)carbamate or 2,3-di(tetradecanoxy)propyLN-(<n-methoxy(polyethoxy)-ethyl)carbamate; PEG-cholesterol; PEG-dialkyloxypropyls (e.g., PEG-DAA), PEG-phosphatidylethanolamine, and PEG-ceramide (see, e.g., U. S. Pat. No. 5,885,613). For example, a polymer lipid may be PEG-DMG, PEG-c-DOMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE, or a combination thereof.

[0612] 3. Non-Cationic Lipids

[0613] Non-cationic lipids can help stabilize an LNP and form the basic outer layer structure of an LNP. A non-cationic lipid may be a helper lipid. In certain embodiments the ionizable or cationic lipids disclosed herein are combined with one or more non-cationic lipid to form an LNP. In certain embodiments, the noncationic lipid is a (charge) neutral or zwitterionic lipid. The non-cationic lipid can generally be any lipid species which is uncharged or neutral zwitterionic form at physiological pH. Generally, the non-cationic lipid will include a polar head group and one or more (e.g., two) hydrophobic tail groups. Exemplary head groups include phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, and inositol.

[0614] In certain embodiments, the non-cationic lipid comprises two hydrocarbon groups which are each optionally interrupted with a biodegradable moiety. Non-cationic lipids having a variety of acyl chain groups of varying chain length and degree of saturation are available or may be isolated or synthesized by well-known techniques. In certain embodiments, the non-cationic lipid comprises saturated fatty acids, or mono-or di-unsaturated fatty acids. Additionally, lipids having mixtures of saturated and unsaturated fatty acid chains can be used. In certain embodiments, a fatty acid is interrupted by a biodegradable moiety such as an ester.

[0615] In certain embodiments, the non-cationic lipid comprises a phosphatidylcholine (PC), phosphatidylethanolamine (PE), glycerophospholipid, sphingophospholipid, sphingolipid, phosphono lipids, natural lecithins, or hydrogenated phospholipid. Such lipids include, for example diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramides, sphingomyelin, dihydrosphingomyelin, cephalin, and cerebrosides.

[0616] The selection of non-cationic lipid is generally guided by consideration of, e.g., LNP particle size and stability in circulation.

[0617] In certain embodiments, the non-cationic lipid is a phospholipid. As used herein, a “phospholipid” refers to a lipid that includes a hydrophilic phosphate head group and one or more hydrophobic tail groups. In some embodiments, a phospholipid may facilitate fusion to a membrane. For example, the positive charge on a zwitterionic phospholipid may interact with one or more negatively charged phospholipids of a membrane (e.g., a cellular or intracellular membrane). Fusion of a phospholipid to a membrane may allow delivery of the one or more components of the LNP, e.g., the cargo, through the membrane, e.g., into a cell.

[0618] SMRH:4931-9018-2038.1 45EDIT0005WO / 68KM-408384-WO In certain embodiments, the phospholipid is a phosphatidylcholine. Exemplary phosphatidylcholines include, but are not limited to, l,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), dipahnitoyl phosphatidylcholine, dipahnitoyl -sn-glycero-3-phosphocholine (DPPC), 2-oleoyl-l-palmitoyl-sn-glycero-3-phosphocholine (POPC), dimyristoyl phosphatidylcholine (DMPC), and dioleoyl phosphatidylcholine (DOPC).

[0619] In certain embodiments, the non-cationic lipid is selected from l,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE); 1,2-dilinoleoyl- sn-glycero-3 -phosphocholine (DLPC); 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC); 1,2 dioleoyl-sn-glycero-3-phosphocholine (DOPC); 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC); 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), l,2-dierucoyl-sn-glycero-3-phosphocholine (DEPC), 2,3-dipalmitoyl-sn-glycero- 1 -phosphocholine, dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE) and dioleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane- 1 -carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoylphosphatidylethanolamine (DSPE), 16:0-monomethyl phosphatidylethanolamine, 16:0-dimethyl phosphatidylethanolamine, 18:1 -trans phosphatidylethanolamine, 1 -stearioyl-2-oleoylphosphatidyethanol amine (SOPE), l,2-dielaidoyl-sn-glycero-3- phophoethanolamine (transDOPE), 1,2-dioctadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC); l-oleoyl-2- cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC); 1-hexadecyl-sn- glycero-3-phosphocholine (CI 6 Lyso PC); 1,2-dilinolenoyl-sn-glycero-3- phosphocholine; l,2-diarachidonoyl-sn-glycero-3-phosphocholine; 1,2- didocosahexaenoyl-sn-glycero-3 -phosphocholine; l,2-diphytanoyl-sn-glycero-3- phosphoethanolamine (ME 16.0 PE); 1,2-distearoyl-sn-glycero-3-phosphoethanolamine; 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine; 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine; 1,2- didocosahexaenoyl-sn-glycero-3-phosphoethanolamine; l,2-dioleoyl-sn-glycero-3-phospho-rac-(l-glycerol) sodium salt (DOPG); sphingomyelins (SM); and ceramides. Such lipids may be synthetic or naturally derived.

[0620] In certain embodiments, the LNP comprises a plurality of non-cationic lipids, for example, 2, 3, or 4 distinct phospholipids selected from those described herein or known in the art.

[0621] 4. Sterols and derivatives thereof

[0622] Sterols can also help stabilize an LNP. In certain embodiments the ionizable lipids disclosed herein are combined with a sterol and other lipids to form an LNP. In certain embodiments, the sterol is cholesterol.

[0623] In certain embodiments, the LNP comprises a cholesterol derivative. In certain embodiments, the cholesterol derivative has the formula:

[0624] SMRH:4931-9018-2038.1 46EDIT0005WO / 68KM-408384-WO

[0625]

[0626] wherein G1, G2, G3, and G4are each independently 1-4 substituent(s) selected from halo, cyano, hydroxy, Ci¬ salkyl optionally substituted with Ral, Ci-ghaloalkyl, Ci-ehydroxyalkyl, Ci-gheteroalkyl, Cb-iocycloalkyl optionally substituted with Ral, Cs-iocycloalkyl-Ci-s alkyl optionally substituted with Ral, Cs-ioaryl optionally substituted with Ral, Cs-ioaryl-Ci-salkyl optionally substituted with Ral, heteroaryl optionally substituted with Ral, heteroaryl-Ci-salkyl optionally substituted with Ral, heterocyclyl optionally substituted with Ral, heterocyclyl-Ci-salkyl optionally substituted with Ral, ORa2, -NIK -NHRa2, -N(Ra2)2, -Ci- -alkylene-NII-, -Ci-6alkylene-NHRa2, -Ci-6alkylene-N(Ra2)2, -C(O)Ra3, -C(O)ORa3, -C(O)NHRa3, -C(O)N(Ci-4alkyl)Ra3, -S(O)2Ra3, -S(O)Ra3, -NHC(O)Ra3, -N(Ci-4alkyl)C(O)Ra3, -NHS(O)Ra3, -N(Ci-4alkyl)S(O)Ra3, -NHS(O)2Ra3, and -N(Ci-4alkyl)S(O)2Ra3; each Ra2is independently selected from Ci-6 alkyl, Cs-iocycloalkyl, Cs-ioaryl, heteroaryl, and heterocyclyl; each Ra3is independently hydrogen, -OH, Ci-ealkyl, Ci-ehaloalkyl, C3-locycloalkyl, Cs-ioaryl, heteroaryl, or heterocyclyl; each Ralis independently halo, cyano, hydroxy, -NH2, -NHRa4, -N(Ra4)2, Ci-ealkyl, Ci-shaloalkyl, ORa4, or Cs-iocycloalkyl; each Ra4is independently selected from Ci ealkyl, C3 wcycloalkyl, Ce-ioaryl, heteroaryl, and heterocyclyl, and each Ra4is optionally substituted with hydroxy, one to six halo, or Ci-salkoxy.

[0627] In certain embodiments, the cholesterol derivative is selected from 0-sitosterol, 0-sitosterol acetate, a 0-sitosterol amino acid conjugate, fecosterol, ergosterol, 9,11 -dehydroergosterol, campesterol, stigmasterol, brassicasterol, fucosterol, tomatidine, ursolic acid, a -tocopherol, daucosterol, cholesterol, 5-heptadecylresorcinol, cholesterol hemisuccinate, 6-keto-5a-hydroxy cholesterol, 7a-hydroxy cholesterol, 70-hydroxy cholesterol, 7-ketocholesterol, 70,25-dihydroxycholesterol, 27-hydroxycholesterol, 25-hydroxycholesterol, 20a-hydroxycholesterol, 5a-cholestanol, 50-coprostanol, cholesteryl-(2'-hydroxy)-ethyl ether, 6-ketocholestanol, cholesteryl -(4’-hydroxy)-butyl ether, 5a-cholestane, cholestenone, 50-cholestanone, cholesteryl decanoate, vitamin D3, vitamin D2, calcipotriol, botulin, luperol, oleanolic acid, DC-cholesterol, BHEM-cholesterol, cholesteryl oleate, or a combination thereof. See, e.g., Paunovska, K. et al., Adv Mater.

[0628] 2019, 31(14); Patel et al. Nat. Commun. 2020, 11:983; Ni et al. Nat. Commun. 2022 13: 4766; Kim et al. ACS Nano. 2022, 16(9), 14792-14806.

[0629] In certain embodiments, the cholesterol derivative is a corticosteroid. In certain embodiments, the LNP comprises a corticosteroid selected from cortisone, cortisol, prednisolone, methylprednisolone, 20a-dihydroprednisolone, 200-dihydroprednisolone, betamethasone, dexamethasone, prednisone, flumethasone, isoflupredone, eclomethasone, clobetasol, triamcinolone acetonide, and hydrocortisone.

[0630] ii. LNP Preparation

[0631] SMRH:4931-9018-2038.1 47EDIT0005WO / 68KM-408384-WO The LNP can be prepared by any method known in the art including, but not limited to, a continuous mixing method or a direct dilution process. LNPs can be generated according to methods known in the art, see for example PCT / US2016 / 052352; PCT / US2016 / 068300; PCT / US2017 / 037551; PCT / US2015 / 027400; PCT / US2016 / 047406; PCT / US2016 / 000129; PCT / US2016 / 014280; PCT / US2016 / 014280;

[0632] PCT / US2017 / 038426; PCT / US2014 / 027077; PCT / US2014 / 055394; PCT / US2016 / 052117;

[0633] PCT / US2012 / 069610; PCT / US2017 / 027492; PCT / US2016 / 059575; PCT / US2016 / 069491; US Patent Publication No. 2007 / 0042031; US Patent Publication No US 2013 / 0156845; US Patent Publication No. US 2013 / 0164400; WO 2008 / 103276; WO 2011 / 127255; WO 2012 / 024526; WO 2013 / 093648; US 9,668,980 all of which are incorporated by reference herein in their entirety.

[0634] In certain embodiments, provided is a method for preparing an LNP by a continuous mixing method, e.g., a process that includes providing an aqueous solution comprising a nucleic acid in a first reservoir, providing a lipid solution in a second reservoir, and mixing the aqueous solution with the lipid solution such that the organic lipid solution mixes with the aqueous solution so as to rapidly produce an LNP encapsulating the cargo. The lipid solution comprises a lower alcohol such as ethanol. This process and the apparatus for carrying this process are described in detail in U. S. Patent Publication No. 2004 / 0142025, the disclosure of which is herein incorporated by reference in its entirety. By mixing the aqueous solution comprising a cargo with the organic lipid solution, the organic lipid solution undergoes a continuous stepwise dilution in the presence of the buffer solution (i.e., aqueous solution) to produce an LNP.

[0635] In certain embodiments, provided is a method for preparing an LNP by a direct dilution process that includes forming an LNP solution and directly introducing the LNP solution into a collection vessel containing a controlled amount of dilution buffer. The collection vessel may include one or more elements configured to stir the contents of the collection vessel to facilitate dilution. In one aspect, the amount of dilution buffer present in the collection vessel is substantially equal to the volume of liposome solution introduced thereto.

[0636] The particle size distribution of LNPs can be controlled using manufacturing methods such as extrusion, sonication, homogenization, and microfluidic methods. An LNP provided herein can be size-adjusted by a method known in the art. One sizing method is described in U. S. Pat. No. 4,737,323, the disclosure of which is herein incorporated by reference in its entirety.

[0637] In certain embodiments, the LNP is prepared using methods utilizing microfluidic mixers. Exemplary microfluidic mixers may include, but are not limited to a slit interdigital micromixer including, but not limited to those manufactured by Microinnova (Allerheiligen bei Wildon, Austria) and / or a staggered herringbone micromixer (SHM), (see Zhigaltsev, I. V. et al. Langmuir. 2012, 28:3633-40; Belliveau, N. M. et al. Mol Ther Nucleic Acids. 2012, l:e37; Chen, D. et al. J Am Chem Soc. 2012, 134( 16):6948-51; each of which is herein incorporated by reference in its entirety).

[0638] The efficiency of encapsulation of a cargo describes the amount of cargo that is encapsulated or otherwise associated with a nanoparticle composition after preparation, relative to the initial amount SMRH:4931-9018-2038.1 48EDIT0005WO / 68KM-408384-WO provided. An exemplary method for determining encapsulation efficiency is comparing the amount of cargo in a solution containing the LNP before and after disintegrating the LNP, e.g., using one or more organic solvents or detergents. For example, fluorescence may be used to measure the amount of free cargo (e.g., exogenous mRNA) in a solution. In certain embodiments, the encapsulation efficiency of a cargo may be at least 50%, for example at least 90%.

[0639] B. Viral Vectors

[0640] In certain embodiments, a nucleic acid encoding an editing system, a Cas protein, or a guide, may be introduced into a cell or organism through a vector. In certain embodiments, the vector is a plasmid, a minicircle, a CELiD, an adeno-associated virus (AAV) derived virion, or a lentivirus.

[0641] Nonlimiting disclosure and incorporation by reference

[0642] Each of the literature and patent publications listed herein is incorporated by reference in its entirety. While certain compounds, compositions, and methods have been described herein with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, ENSEMBL identifiers, and the like recited in the present application. is incorporated herein by reference in its entirety.

[0643] The sequence listing accompanying this filing identifies each nucleic acid sequence as either “RNA” or “DNA” as required; however, one of skill in the art will readily appreciate that designation of “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2’ -OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (i.e., 2’-OH in place of one 2’-H of DNA) or as an RNA having a modified base (i.e., thymine (5-methyl uracil) in place of an uracil of RNA); and certain nucleic acid compounds described herein comprise one or more nucleosides comprising modified sugar moieties having 2’-substituent(s) that are neither Oil nor II. One of skill in the art will readily appreciate that labeling such nucleic acid compounds “RNA” or “DNA” does not alter or limit the description of such nucleic acid compounds.

[0644] Where a specific compound is described herein by way of a drawn chemical structure, each nucleobase, sugar, and internucleoside linkage of such a specific compound includes only the modifications indicated in the drawn chemical structure. One of skill will appreciate, however, that drawn compounds may exist in equilibrium between tautomeric forms and / or as salts in equilibrium with protonated or ionic forms. Drawn structures are intended to capture all such forms of such compounds.

[0645] While effort has been made to accurately describe compounds in the accompanying sequence listing, should there be any discrepancies between a description in this specification and in the accompanying sequence listing, the description in the specification and not in the sequence listing is the accurate description. SMRH:4931-9018-2038.1 49EDIT0005WO / 68KM-408384-WO The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 'll hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to:2H or3H in place of1H,13C or14C in place of12C,15N in place of14N,17O or18O in place of16O, and33S,34S,35S, or36S in place of32S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the oligomeric agent that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.

[0646] EXAMPLES

[0647] Example 1: Design of modified guides comprising modified internucleoside linkages

[0648] Modified single guides with a spacer sequence complementary to a mouse genomic DNA target nucleic acid were synthesized using standard techniques. The modified guides presented in the table below were designed to be used with spCas9 (SEQ ID NO: 1; Jinek M., et al. Science. 2012, 337, 816-821). Each modified guide in the table below is 100 nucleosides in length including a spacer sequence at the 5 '-end of the guide of (from 5' to 3'): UUACAGCCACGUCUACAGCA (SEQ ID NO: 3).

[0649] Guides 1876861 and 1876863 have 2'-0Me sugar moieties at positions 1, 2, 3, and 98, 99, and 100. Guide 1876861 has phosphorothioate internucleoside linkages between the nucleosides at positions 1 and 2, 2 and 3, 3 and 4, 97 and 98, 98 and 99, 99 and 100. Guide 1876863 has mesyl phosphoramidate internucleoside linkages between nucleosides at positions 1 and 2, 2 and 3, 98 and 99, and 99 and 100. Each remaining internucleoside linkage in Guides 1876861 and 1876863 is a phosphodiester internucleoside linkage.

[0650] Table 5: Modified guides

[0651] SEQ

[0652] Guide

[0653] Chemical Notation (5* to 3') ID Number

[0654] NO. UysUysAvsCroAroGroCroCroAroCroGroUroCroUroAroCroAroGroCroA.oGroUroUroUro

[0655] U roAroGroAroGroCroU roAroGroAroAroAroUroAroGroCroAroAroGroUroU roAroAroAro 1876861 AroUrcAroAroGreGroCroUroAroGroUroCreCroGroUroUrcAroUroCreAroAroCroUreUro 4 GroAroAroArcAroAroGroUroGroGroCroAroCroCroGroAroGroUroCroGroGroUr. GroCl oUr sUysUysUy UyzUyzAyoCroAroGroCroCroCroAroCroGroUroCroUroAroCroAroGroCroAroGroUroUroUro 1876863 Uro Ar oGro Ar oGroCr oUr o Ar ©Gro Ar o A ro Ar oUro Ar oGroCro A ro Ar oGroUroUroAroAro Ar o 5

[0656] AroUroAroAroGroGroCroUroAroGroUroCroCroGroUroUroAroUroCroAroAroCroUroUro

[0657]

[0658] SMRH:4931-9018-2038.1 50EDIT0005WO / 68KM-408384-WO GroAroAroAroAroAroGroUroGroGroCrcAroCroCroGroAroGroUroCroGroGroUroGroCro UroUyzUyzUy

[0659]

[0660] Each subscript “y” represents a 2'-0Me sugar moiety; each subscript “r” represents a ribosyl sugar moiety; each subscript “o” represents a phosphodiester internucleoside linkage; each subscript “s” represents a phosphorothioate internucleoside linkage; and each subscript “z” represents a mesyl phosphoramidate internucleoside linkage.

[0661] The modified guides presented in the table below were designed to be used with IONCAS009 (SEQ ID NO: 15; previously disclosed in WO 2025 / 059543). Each modified guide in the table below is 98 nucleosides in length including a spacer sequence at the 5 '-end of the guide of (from 5' to 3'):

[0662] GCAAAGGAGGAAGAGUCGAAGG (SEQ ID NO: 7).

[0663] Guides 1958655 and 1958656 have 2'-M0E sugar moieties at positions 1 and 98. Guides 1958657 and 1958658 have cEt sugar moieties at positions 1 and 98. Guides 1958652, 1958653, and 1958654 have 2'-OMe sugar moieties at positions 1, 2, 97, and 98. Guides 1958655, 1958656, 1958657, and 1958658 have 2'-OMe sugar moieties at positions 2 and 97. Guide 1958652 has phosphorothioate intemucleoside linkages between the nucleosides at positions 1 and 2, 2 and 3, 96 and 97, and 97 and 98. Guides 1958655 and 1958657 have phosphorothioate internucleoside linkages between the nucleosides at positions 1 and 2, and 97 and 98. Guides 1958653, 1958656, and 1958658 have mesyl phosphoramidate internucleoside linkages between nucleosides at positions 1 and 2, and 97 and 98. Guide 1958654 has mesyl phosphoramidate internucleoside linkages between nucleosides at positions 1 and 2, 2 and 3, 96 and 97, and 97 and 98. Each remaining internucleoside linkage in Guides 1958652, 1958653, 1958654, 1958655, 1958656, 1958657. and 1958658 is a phosphodiester internucleoside linkage.

[0664] Table 6: Modified guides

[0665] Guide SEQ Number Chemical Notation (5’ to 3') ID NO.

[0666] 1958652 17

[0667] 1958653 18

[0668] 1958654 19

[0669]

[0670] SMRH:4931-9018-2038.1 51EDIT0005WO / 68KM-408384-WO

[0671] 1958655 20

[0672] 1958656 21

[0673] 1958657 22

[0674] 1958658 23

[0675]

[0676] Each subscript “y” represents a 2'-0Me sugar moiety; each subscript “k” represents a cEt sugar moiety; each subscript “e” represents a 2'-M0E sugar moiety; each subscript “r” represents a ribosyl sugar moiety; each subscript “o” represents a phosphodiester internucleoside linkage; each subscript “s” represents a phosphorothioate internucleoside linkage; each subscript “z” represents a mesyl phosphoramidate internucleoside linkage; each “mC” represents a 5 -methylcytosine; and each “C” represents a non-methylated cytosine.

[0677] The modified guides presented in the table below were designed to be used with IONCAS009 (SEQ ID NO: 15; previously disclosed in WO 2025 / 059543). Each modified guide in the table below is 98 nucleosides in length including a spacer sequence at the 5 '-end of the guide of (from 5' to 3'):

[0678] AAAGGGCUCCCAGGAUCCCUCA (SEQ ID NO: 8).

[0679] Guides 1958641 and 1958642 have 2'-M0E sugar moieties at positions 1 and 98. Guides 1958643 and 1958644 have cEt sugar moieties at positions 1 and 98. Guides 1954538, 1958639, and 1958640 have 2'-OMe sugar moieties at positions 1, 2, 97, and 98. Guides 1958641, 1958642, 1958643, and 1958644 have 2'-OMe sugar moieties at positions 2 and 97. Guide 1954538 has phosphorothioate internucleoside linkages between the nucleosides at positions 1 and 2, 2 and 3, 96 and 97, and 97 and 98. Guides 1958641 and 1958643 have phosphorothioate internucleoside linkages between the nucleosides at positions 1 and 2, and 97 and 98. Guides 1958639, 1958642, and 1958644 have mesyl phosphoramidate internucleoside linkages between nucleosides at positions 1 and 2, and 97 and 98. Guide 1958640 has mesyl phosphoramidate internucleoside linkages between nucleosides at positions 1 and 2, 2 and 3, 96 and 97, and 97 and 98. Each remaining internucleoside linkage in Guides 1954538, 1958639, 1958640, 1958641, 1958642, 1958643, and 1958644 is a phosphodiester internucleoside linkage.

[0680] SMRH:4931-9018-2038.1EDIT0005WO / 68KM-408384-WO Table 7: Modified guides

[0681] Guide SEQ Number Chemical Notation (5* to 3') ID NO.

[0682] 1954538 24

[0683] 1958639 25

[0684] 1958640 26

[0685] 1958641 27

[0686] 1958642 28

[0687] 1958643 29 oGpOGrOCpoGrOGroCroGpoGroGpoGpoGrOCpoApOGysmCk

[0688] 1958644 30

[0689]

[0690] Each subscript “y” represents a 2'-OMe sugar moiety; each subscript “k” represents a cEt sugar moiety; each subscript “e” represents a 2'-MOE sugar moiety; each subscript “r” represents a ribosyl sugar moiety; each subscript “o” represents a phosphodiester internucleoside linkage; each subscript “s” represents a phosphorothioate internucleoside linkage; each subscript “z” represents a mesyl phosphoramidate internucleoside linkage; each “mC” represents a 5 -methylcytosine; and each “C” represents a non-methylated cytosine.

[0691] The modified guides presented in the table below were designed to be used with IONCasl05 (SEQ ID NO: 16; previously disclosed in WO 2025 / 059543). Each modified guide in the table below is 104 SMRH:4931-9018-2038.1 53EDIT0005WO / 68KM-408384-WO nucleosides in length including a spacer sequence at the 5 '-end of the guide of (from 5' to 3'):

[0692] CAAGGCAGAGGAGGAGCAGACG (SEQ ID NO: 9).

[0693] Guides 1958683 and 1958684 have 2'-M0E sugar moieties at positions 1 and 104. Guides 1958685 and 1958686 have cEt sugar moieties at positions 1 and 104. Guides 1886771, 1958681, and 1958682 have 2'-OMe sugar moieties at positions 1, 2, 103, and 104. Guides 1958683, 1958684, 1958685, and 1958686 have 2'-0Me sugar moieties at positions 2 and 103. Guide 1886771 has phosphorothioate internucleoside linkages between the nucleosides at positions 1 and 2, 2 and 3, 102 and 103, and 103 and 104. Guides 1958683 and 1958685 have phosphorothioate internucleoside linkages between the nucleosides at positions 1 and 2, and 103 and 104. Guides 1958681, 1958684, and 1958686 have mesyl phosphoramidate internucleoside linkages between nucleosides at positions 1 and 2, and 103 and 104. Guide 1958682 has mesyl phosphoramidate internucleoside linkages between nucleosides at positions 1 and 2, 2 and 3, 102 and 103, and 103 and 104. Each remaining internucleoside linkage in Guides 1886771, 1958681, 1958682, 1958683, 1958684, 1958685, and 1958686 is a phosphodiester internucleoside linkage.

[0694] Table 8: Modified guides

[0695] Guide SEQ Number Chemical Notation (5' to 3') ID NO.

[0696] 1886771 38

[0697] 1958681 39

[0698] 1958682 40

[0699] 1958683 41

[0700] 1958684 42

[0701] 1958685 43

[0702]

[0703] SMRH:4931-9018-2038.1 54EDIT0005WO / 68KM-408384-WO

[0704] 1958686

[0705]

[0706] Each subscript “y” represents a 2'-0Me sugar moiety; each subscript “k” represents a cEt sugar moiety; each subscript “e” represents a 2'-M0E sugar moiety; each subscript “r” represents a ribosyl sugar moiety; each subscript “o” represents a phosphodiester internucleoside linkage; each subscript “s” represents a phosphorothioate internucleoside linkage; each subscript “z” represents a mesyl phosphoramidate internucleoside linkage; each “mC” represents a 5 -methylcytosine; and each “C” represents a non-methylated cytosine.

[0707] The modified guides presented in the table below were designed to be used with IONCasl05 (SEQ ID NO: 16; previously disclosed in WO 2025 / 059543). Each modified guide in the table below is 104 nucleosides in length including a spacer sequence at the 5 '-end of the guide of (from 5' to 3'):

[0708] GAGCUGCACGGGCUCACCACAG (SEQ ID NO: 10).

[0709] Guides 1958677 and 1958678 have 2'-MOE sugar moieties at positions 1 and 104. Guides 1958679 and 1958680 have cEt sugar moieties at positions 1 and 104. Guides 1886654, 1958675, and 1958676 have 2'-0Me sugar moieties at positions 1, 2, 103, and 104. Guides 1958677, 1958678, 1958679, and 1958680 have 2'-0Me sugar moieties at positions 2 and 103. Guide 1886654 has phosphorothioate internucleoside linkages between the nucleosides at positions 1 and 2, 2 and 3, 102 and 103, and 103 and 104. Guides 1958677 and 1958679 have phosphorothioate internucleoside linkages between the nucleosides at positions 1 and 2, and 103 and 104. Guides 1958675, 1958678, and 1958680 have mesyl phosphoramidate internucleoside linkages between nucleosides at positions 1 and 2, and 103 and 104. Guide 1958676 has mesyl phosphoramidate internucleoside linkages between nucleosides at positions 1 and 2, 2 and 3, 102 and 103, and 103 and 104. Each remaining internucleoside linkage in Guides 1886654, 1958675, 1958676, 1958677, 1958678, 1958679, and 1958680 is a phosphodiester internucleoside linkage.

[0710] Table 9: Modified guides

[0711] Guide SEQ Number Chemical Notation (5’ to 3') ID NO.

[0712] 1886654 31

[0713] 1886654 oAroGroAroCroAroAroGroGroCroAroAroAroAroUroGroCroGroGroUroGroUroUroUroAroUroGroUro

[0714] 1958675 32

[0715]

[0716] SMRH:4931-9018-2038.1 55EDIT0005WO / 68KM-408384-WO

[0717] 1958676 33

[0718] 1958677 34

[0719] 1958678 35

[0720] 1958679 36

[0721] 1958680 37

[0722]

[0723] Each subscript “y” represents a 2'-OMe sugar moiety; each subscript “k” represents a cEt sugar moiety; each subscript “e” represents a 2'-M0E sugar moiety; each subscript “r” represents a ribosyl sugar moiety; each subscript “o” represents a phosphodiester internucleoside linkage; each subscript “s” represents a phosphorothioate internucleoside linkage; and each subscript “z” represents a mesyl phosphoramidate internucleoside linkage.

[0724] Example 2: Effect of modified guides on InDels in AML12 cells

[0725] Mouse AML12 cells were seeded at a density of 16,000 cells per well in 100 pl of culture medium (DMEM F12 (Gibco) medium with 10% FBS, 1% ITS, 1% PenStrep, and 0.001% dexamethasone) in 96-well plates. Editing systems comprising mRNA encoding spCas9 (SEQ ID NO: 2), a modified guide (1:2 ratio by weight), and an LNP formulation were produced (Kazemian, et al., Mol. Pharmaceutics, ’IG’2’2, 19, 1669-1689; Albertsen et al., Adv. Drug Deliv. Rev. 2022, 118, 114416; Cullis et al., Nat. Rev. Drug Discov. 2024, 23, 709-722.). After incubating the mixture of LNP with mRNA and guide for 15 minutes, 10.6 pl of the editing system (66 ng total RNA; 22 ng spCas9 mRNA and 44 ng guide) was administered to cells.

[0726] After 24 hours, the cell media was changed, and the cells were incubated for an additional 72 hours. Cells were harvested and InDel analysis was performed. The CRISPRessoBatch module of CRISPResso2 software (Clement et al. Nat Biotechnol, 2019) was used to process and analyze all sample sequencing data. A custom script was written to calculate InDel percentages based on insertions and deletions only from SMRH:4931-9018-2038.1 56EDIT0005WO / 68KM-408384-WO CRISPResso2 analysis results. The gene editing quantification window was set to be approximately 40 nucleotides long centered on an anti-spacer sequence of approximately 20 nucleotides, with approximately 10 nucleotides upstream and approximately 10 nucleotides downstream of the anti-spacer sequence. To enable visualization alignments of low frequency InDels reads, the minimum threshold for report reads was set to 0.01% (default is 0.20%) and maximum reported alignments was set to 100 (default is 50). Results are presented in the tables below as percentage of reads with InDels (%InDels) relative to the total number of reads within the approximately 40 nucleotide quantification window described above.

[0727] Table 10

[0728] % InDels in mouse target nucleic acid in AML 12 cells

[0729] Cas Protein ID Guide ID 5'-nucleotides 3'-nucleotides % InDels spCas9 1876861 UysUyEAyEurEuyEuyEuy13.0 spCas9 1876863 UyzUyzAyo UroUY£Uy£Uy21.4

[0730]

[0731] Each subscript “y” represents a 2'-OMe sugar moiety; each subscript “r” represents a ribosyl sugar moiety; each subscript “o” represents a phosphodiester internucleoside linkage; each subscript “s” represents a phosphorothioate internucleoside linkage; and each subscript “z” represents a mesyl phosphorami date internucleoside linkage.

[0732] Example 3: Effect of modified guides on InDels in AML12 cells

[0733] Mouse AML 12 cells were seeded at a density of 13,000 cells per well in 100 pl of culture medium (DMEM F12 (Gibco) medium with 10% FBS, 1% ITS, 1% PenStrep, and 0.001% dexamethasone) in 96-well plates. Editing systems comprising mRNA encoding IONCAS009 or IONCasl05 as indicated in the tables below, a modified guide (1:2 ratio by weight), and an LNP formulation were produced (Kazemian, et al., Mol. Pharmaceutics, 2022, 19, 1669-1689; Albertsen et al., Adv. Drug Deliv. Rev. 2022, 118, 114416; Cullis et al., Nat. Rev. Drug Discov. 2024, 23, 709-722.).

[0734] After incubating the mixture of LNP with mRNA and guide for 15 minutes, 2-8 pl of the editing system was administered to cells at various concentrations as indicated in the tables below. After 24 hours, the cell media was changed, and the cells were incubated for an additional 24 hours. Cells were harvested and InDel analysis was performed. The CRISPRessoBatch module of CRISPResso2 software (Clement et al. Nat Biotechnol, 2019) was used to process and analyze all sample sequencing data. A custom script was written to calculate InDel percentages based on insertions and deletions only from CRISPResso2 analysis results. The gene editing quantification window was set to be approximately 40 nucleotides long centered on an antispacer sequence of approximately 20 nucleotides, with approximately 10 nucleotides upstream and approximately 10 nucleotides downstream of the anti-spacer sequence. To enable visualization alignments of low frequency InDels reads, the minimum threshold for report reads was set to 0.01% (default is 0.20%) and

[0735] SMRH:4931-9018-2038.1 57EDIT0005WO / 68KM-408384-WO maximum reported alignments was set to 100 (default is 50). Results are presented in the tables below as percentage of reads with InDels (%InDels) relative to the total number of reads within the approximately 40 nucleotide quantification window described above.

[0736] Table 11

[0737] % InDels in mouse target nucleic acid in AML12 cells

[0738] Cas Protein Guide 5'- 3'- % InDels

[0739] ID ID nucleotides nucleotides

[0740] 160 ng 40 ng

[0741] 1958652 GysCysAro CroArsGysCy 12 6

[0742] 1958653 GyzCyoAro CroAroGyzCy 15 8

[0743] 1958654 GyzCyzAro CroArzGyzCy 19 12

[0744] 1958655 GesCyoAro CroAroGysmCe 14 8

[0745] 1958656 GezCyoAro CroAroGyzmCe 15 9

[0746] 1958657 GksCyoAro CroAroGysmCk16 9

[0747] 1958658 GkzCyoAro CroAroGyzmCk 12 6

[0748] IONCAS009

[0749] 1954538 AysAysAro CroArsGysCy 8 4

[0750] 1958639 AyzAyoAro CroAroGyzCy 10 3

[0751] 1958640 AyzAyzAro CroArzGyzCy 9 3

[0752] 1958641 AesAyoAro CroAroGysmCe15 8

[0753] 1958642 AezAyoAro CroAroGyzmCe9 3

[0754] 1958643 AksAyoAro CroAroGysmCk 17 10

[0755] 1958644 11 4

[0756]

[0757] AkzAyoAro CroAroGyzmCk

[0758] Each subscript “y” represents a 2'-0Me sugar moiety; each subscript “k” represents a cEt sugar moiety; each subscript “e” represents a 2'-M0E sugar moiety; each subscript “r” represents a ribosyl sugar moiety; each subscript “o” represents a phosphodiester internucleoside linkage; each subscript “s” represents a phosphorothioate internucleoside linkage; and each subscript “z” represents a mesyl phosphoramidate internucleoside linkage; each “mC” represents a 5-methylcytosine; and each “C” represents a non-methylated cytosine.

[0759] Table 12

[0760] % InDels in mouse target nucleic acid in AML12 cells

[0761] % InDels

[0762] Cas Protein ID Guide ID 5 '-nucleotides 3 '-nucleotides

[0763] 160 ng 40 ng 10 ng 1886654 GysAysGro GroArsAysAy 31 14 2 1958675 GyzAyoGro GroAroAyzAy 24 6 0 1958676 GyzAyzGro G ro Arz Ay z Ay 27 9 1 IONCasl05 1958677 GcsAyoGro GroAroAysAc 28 8 1 1958678 GezAyoGro GroAroAyzAe 32 14 1 1958679 GksAyoGro GroAroAysAk 35 12 2

[0764]

[0765] 1958680 GkzAyoGro GroAroAyzAk 31 13 1

[0766] SMRH:4931-9018-2038.1 58EDIT0005WO / 68KM-408384-WO Each subscript “y” represents a 2'-0Me sugar moiety; each subscript “k” represents a cEt sugar moiety; each subscript “e” represents a 2'-M0E sugar moiety; each subscript “r” represents a ribosyl sugar moiety; each subscript “o” represents a phosphodiester internucleoside linkage; each subscript “s” represents a phosphorothioate internucleoside linkage; and each subscript “z” represents a mesyl phosphoramidate internucleoside linkage; each “mC” represents a 5-methylcytosine; and each “C” represents a non-methylated cytosine.

[0767] Example 4: Effect of modified guides on InDels in HEPG2 cells

[0768] HEPG2 cells were seeded at a density of 16,000 cells per well in 100 pl of culture medium (DMEM F12 (Gibco) medium with 10% FBS, 1% ITS, 1% PenStrep, and 0.001% dexamethasone) in 96-well plates. Editing systems comprising mRNA encoding IONCasl05, a modified guide (1:2 ratio by weight), and an LNP formulation were produced (Kazemian, et al., Mol. Pharmaceutics, 2022, 19, 1669-1689; Albertsen et al., Adv. Drug Deliv. Rev. 2022, 118, 114416; Cullis et al., Nat. Rev. Drug Discov. 2024, 23, 709-722.).

[0769] After incubating the mixture of LNP with mRNA and guide for 15 minutes, 2-8 pl of the editing system was administered to cells at various concentrations as indicated in the table below. After 24 hours, the cell media was changed, and the cells were incubated for an additional 24 hours. Cells were harvested and InDel analysis was performed. The CRISPRessoBatch module of CRISPResso2 software (Clement et al. Nat Biotechnol, 2019) was used to process and analyze all sample sequencing data. A custom script was written to calculate InDel percentages based on insertions and deletions only from CRISPResso2 analysis results. The gene editing quantification window was set to be approximately 40 nucleotides long centered on an antispacer sequence of approximately 20 nucleotides, with approximately 10 nucleotides upstream and approximately 10 nucleotides downstream of the anti-spacer sequence. To enable visualization alignments of low frequency InDels reads, the minimum threshold for report reads was set to 0.01% (default is 0.20%) and maximum reported alignments was set to 100 (default is 50). Results are presented in the tables below as percentage of reads with InDels (%InDels) relative to the total number of reads within the approximately 40 nucleotide quantification window described above.

[0770] Table 13

[0771] % InDels in human target nucleic acid in HEPG2 cells

[0772] Cas Protein Guide 5'- 3'- % InDels

[0773] ID ID nucleotides nucleotides 20 ng 10 ng 5 ng

[0774] 1886771 74 55 38

[0775] 1958681 71 59 47

[0776] 1958682 68 52 35

[0777] IONCasl05 1958683 83 70 53

[0778] 1958684 A A 57 41 27

[0779] 1958685 84 69 55

[0780]

[0781] 1958686 GroAroAyZAk 79 65 43

[0782] Each subscript “y” represents a 2'-0Me sugar moiety; each subscript “k” represents a cEt sugar moiety; each subscript “e” represents a 2'-M0E sugar moiety; each subscript “r” represents a ribosyl sugar moiety; each subscript “o” SMRH:4931-9018-2038.1 59EDIT0005WO / 68KM-408384-WO represents a phosphodiester internucleoside linkage; each subscript “s” represents a phosphorothioate internucleoside linkage; and each subscript “z” represents a mesyl phosphoramidate internucleoside linkage; each “mC” represents a 5-methylcytosine; and each “C” represents a non-methylated cytosine.

[0783] SMRH:4931-9018-2038.1 60

Claims

EDIT0005WO / 68KM-408384-WO CLAIMS1. A modified oligonucleotide consisting of 70 to 250 linked nucleosides, wherein at least one of the five internucleoside linkages at the 5 '-end and at least one of the five internucleoside linkages at the 3'-end are modified internucleoside linkages, and at least one of the said modified internucleoside linkages is an internucleoside linkage of Formula Iwherein independently for each such internucleoside linkage of Formula I:X is selected from O or S;Ri is selected from H, C1-C6alkyl, and substituted C1-C6alkyl; andR2 is selected from an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a diazole, a substituted diazole, a C1-C6alkoxy, a C1-C6alkyl, a C1-C6alkenyl, a C1-C6alkynyl, a substituted C1-C6alkyl, a substituted C1-C6alkenyl, and a substituted C1-C6alkynyl.

2. The modified oligonucleotide of claim 1, wherein the modified oligonucleotide is a guide.

3. The modified oligonucleotide of any of claims 1-2, wherein at least two of the five internucleoside linkages at the 5 '-end are modified internucleoside linkages.

4. The modified oligonucleotide of any of claims 1-3, wherein at least two of the last internucleoside linkages at the 3 '-end are modified internucleoside linkages.

5. The modified oligonucleotide of any of claims 1-4, wherein at least three of the five internucleoside linkages at the 5 '-end are modified internucleoside linkages.

6. The modified oligonucleotide of any of claims 1-5, wherein at least three of the five internucleoside linkages at the 3 '-end are modified internucleoside linkages.

7. The modified oligonucleotide of any of claims 1-6, wherein at least four of the five internucleoside linkages at the 5 '-end are modified internucleoside linkages.

8. The modified oligonucleotide of any of claims 1-7, wherein at least four of the five internucleoside linkages at the 3 '-end are modified internucleoside linkages.

9. The modified oligonucleotide of any of claims 1-8, wherein the five internucleoside linkages at the 5'-end are modified internucleoside linkages.

10. The modified oligonucleotide of any of claims 1-9, wherein the five internucleoside linkages at the 3'-end are modified internucleoside linkages.

11. The modified oligonucleotide of any of claims 1-10, wherein each remaining internucleoside linkage is a phosphodiester internucleoside linkage.SMRH:4931-9018-2038.1 61EDIT0005WO / 68KM-408384-WO 12. The modified oligonucleotide of any of claims 1-11, wherein each modified internucleoside linkage is selected from phosphorothioate or an internucleoside linkage of Formula I.

13. The modified oligonucleotide of any of claims 1-12, wherein for each internucleoside linkage of Formula I, X is O.

14. The modified oligonucleotide of any of claims 1-13, wherein for each internucleoside linkage of Formula I, Ri is H.

15. The modified oligonucleotide of any of claims 1-14, wherein for each internucleoside linkage of Formula I, R2 is methyl.

16. The modified oligonucleotide of any of claims 1-15, wherein for each internucleoside linkage of Formula I, X is O, Ri is H, and R2 is methyl.

17. The modified oligonucleotide of any of claims 1-16, wherein each internucleoside linkage is selected from a phosphodiester, a phosphorothioate, and a mesyl phosphoramidate internucleoside linkage.

18. The modified oligonucleotide of any of claims 1-17, wherein at least one of the five nucleotides at the 5'- end comprises a modified sugar moiety.

19. The modified oligonucleotide of any of claims 1-18, wherein at least one of the five nucleotides at the 3’- end comprises a modified sugar moiety.

20. The modified oligonucleotide of any of claims 1-19, wherein at least two of the five nucleotides at the 5'- end comprise a modified sugar moiety.

21. The modified oligonucleotide of any of claims 1-20, wherein at least two of the five nucleotides at the 3'- end comprise a modified sugar moiety.

22. The modified oligonucleotide of any of claims 1-21, wherein at least three of the five nucleotides at the 5 '-end comprise a modified sugar moiety.

23. The modified oligonucleotide of any of claims 1-22, wherein at least three of the five nucleotides at the 3'-end comprise a modified sugar moiety.

24. The modified oligonucleotide of any of claims 1-23, wherein at least four of the five nucleotides at the 5'- end comprise a modified sugar moiety.

25. The modified oligonucleotide of any of claims 1-24, wherein at least four of the five nucleotides at the 3'- end comprise a modified sugar moiety.

26. The modified oligonucleotide of any of claims 1-25, wherein the five nucleotides at the 5 '-end comprise a modified sugar moiety.

27. The modified oligonucleotide of any of claims 1-26, wherein the five nucleotides at the 3'-end comprise a modified sugar moiety.

28. The modified oligonucleotide of any of claims 12-27, wherein the modified sugar moiety is a 2'- substituted sugar moiety.SMRH:4931-9018-2038.1 62EDIT0005WO / 68KM-408384-WO 29. The modified oligonucleotide of any of claims 12-28, wherein the modified sugar moiety is selected from a 2'-0Me sugar moiety, a 2'-M0E sugar moiety, a 2'-F sugar moiety, a 2'-NMA sugar moiety, a cEt sugar moiety, and an LNA sugar moiety.

30. A modified oligonucleotide consisting of 70 to 250 linked nucleosides according to the following formula (5’ to 3’):N1L1-N2L2-N3L3-N4L4-N5L5-T(59-239)-N6L6-N7L7-N8L8-N9L9-N10L10-N11, wherein:each of N1, N2, N3, N4, N5, N6, N7, N8, N9, N10, and N11is a nucleoside;each of L1, L2, L3, L4, L5, L6, L7, L8, L9, and L10is an internucleoside linkage;each T is a nucleotide consisting of a nucleoside and an internucleoside linkage; andat least one of L1, L2, L3, L4, L5, L6, L7, L8, L9, and L10is an internucleoside linkage of Formula Iwherein independently for each such internucleoside linkage of Formula I:X is selected from O or S;R1is selected from H, C1-C6alkyl, and substituted C1-C6alkyl; andR2is selected from an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a diazole, a substituted diazole, a C1-C6alkoxy, a C1-C6alkyl, a C1-C6alkenyl, a C1-C6alkynyl, a substituted C1-C6alkyl, a substituted C1-C6alkenyl and a substituted C1-C6alkynyl.

31. The modified oligonucleotide of claim 30, wherein the modified oligonucleotide is a guide.

32. The modified oligonucleotide of any of claims 30-31, wherein at least two of L1, L2, L3, L4, L5, L6, L7, L8, L9, and L10are sulfonyl phosphoramidate internucleoside linkages.

33. The modified oligonucleotide of any of claims 30-32, wherein at least three of L1, L2, L3, L4, L5, L6, L7, L8, L9, and L10are sulfonyl phosphoramidate internucleoside linkages.

34. The modified oligonucleotide of any of claims 30-33, wherein at least four of L1, L2, L3, L4, L5, L6, L7, L8, L9, and L10are sulfonyl phosphoramidate internucleoside linkages.

35. The modified oligonucleotide of any of claims 30-34, wherein at least five of L1, L2, L3, L4, L5, L6, L7, L8, L9, and L10are sulfonyl phosphoramidate internucleoside linkages.

36. The modified oligonucleotide of any of claims 30-35, wherein at least six of L1, L2, L3, L4, L5, L6, L7, L8, L9, and L10are sulfonyl phosphoramidate internucleoside linkages.

37. The modified oligonucleotide of any of claims 30-36, wherein at least seven of L1, L2, L3, L4, L5, L6, L7, L8, L9, and L10are sulfonyl phosphoramidate internucleoside linkages.SMRH:4931-9018-2038.1 63EDIT0005WO / 68KM-408384-WO 38. The modified oligonucleotide of any of claims 30-37, wherein at least eight of L1, L2, L3, L4, L5, L6, L7, L8, L9, and L10are sulfonyl phosphoramidate internucleoside linkages.

39. The modified oligonucleotide of any of claims 30-38, wherein at least nine of L1, L2, L3, L4, L5, L6, L7, L8, L9, and L10are sulfonyl phosphoramidate internucleoside linkages.

40. The modified oligonucleotide of any of claims 30-39, wherein each of L1, L2, L3, L4, L5, L6, L7, L8, L9, and L10are sulfonyl phosphoramidate internucleoside linkages.

41. The modified oligonucleotide of any of claims 30-32, wherein Li and L-are sulfonyl phosphoramidate internucleoside linkages.

42. The modified oligonucleotide of any of claims 30-32, wherein L1 and L3 are sulfonyl phosphoramidate internucleoside linkages.

43. The modified oligonucleotide of any of claims 30-32, wherein L1and L4are sulfonyl phosphoramidate internucleoside linkages.

44. The modified oligonucleotide of any of claims 30-32, wherein Li and Lsare sulfonyl phosphoramidate internucleoside linkages.

45. The modified oligonucleotide of any of claims 30-32, wherein L2 and L3 are sulfonyl phosphoramidate internucleoside linkages.

46. The modified oligonucleotide of any of claims 30-32, wherein L2and L4are sulfonyl phosphoramidate internucleoside linkages.

47. The modified oligonucleotide of any of claims 30-32, wherein L2and L5are sulfonyl phosphoramidate internucleoside linkages.

48. The modified oligonucleotide of any of claims 30-32, wherein L3and L4are sulfonyl phosphoramidate internucleoside linkages.

49. The modified oligonucleotide of any of claims 30-32, wherein L3and L5are sulfonyl phosphoramidate internucleoside linkages.

50. The modified oligonucleotide of any of claims 30-32, wherein L4and L5are sulfonyl phosphoramidate internucleoside linkages.

51. The modified oligonucleotide of any of claims 30-34 or claims 41-50, wherein L6and L7are sulfonyl phosphoramidate internucleoside linkages.

52. The modified oligonucleotide of any of claims 30-34 or claims 41-50, wherein L6and L8are sulfonyl phosphoramidate internucleoside linkages.

53. The modified oligonucleotide of any of claims 30-34 or claims 41-50, wherein L6and L9are sulfonyl phosphoramidate internucleoside linkages.

54. The modified oligonucleotide of any of claims 30-34 or claims 41-50, wherein L6and L10are sulfonyl phosphoramidate internucleoside linkages.

55. The modified oligonucleotide of any of claims 30-34 or claims 41-50, wherein L7and L8are sulfonyl phosphoramidate internucleoside linkages.SMRH:4931-9018-2038.1 64EDIT0005WO / 68KM-408384-WO 56. The modified oligonucleotide of any of claims 30-34 or claims 41-50, wherein L7and L9are sulfonyl phosphoramidate internucleoside linkages.

57. The modified oligonucleotide of any of claims 30-34 or claims 41-50, wherein L7and L10are sulfonyl phosphoramidate internucleoside linkages.

58. The modified oligonucleotide of any of claims 30-34 or claims 41-50, wherein L8and L9are sulfonyl phosphoramidate internucleoside linkages.

59. The modified oligonucleotide of any of claims 30-34 or claims 41-50, wherein Lg and Lio are sulfonyl phosphoramidate internucleoside linkages.

60. The modified oligonucleotide of any of claims 30-34 or claims 41-50, wherein L8 and L10 are sulfonyl phosphoramidate internucleoside linkages.

61. The modified oligonucleotide of any of claims 32-60, wherein each sulfonyl phosphoramidate internucleoside linkage is a mesyl phosphoramidate internucleoside linkage.

62. The modified oligonucleotide of any of claims 30-61, wherein at least one of N1, N2, N3, N4, N5, N6, N7, N8, N9, and N10comprises a modified sugar moiety.

63. The modified oligonucleotide of any of claims 30-62, wherein at least two of N1, N2, N3, N4, N5, N6, N7, N8, N9, and N10comprises a modified sugar moiety.

64. The modified oligonucleotide of any of claims 30-63, wherein at least three of N1, N2, N3, N4, N5, N6, N7, N8, N9, and N10comprises a modified sugar moiety.

65. The modified oligonucleotide of any of claims 30-64, wherein at least four of N1, N2, N3, N4, N5, N6, N7, N8, N9, and N10comprises a modified sugar moiety.

66. The modified oligonucleotide of any of claims 30-65, wherein at least five of N1, N2, N3, N4, N5, N6, N7, N8, N9, and N10comprises a modified sugar moiety.

67. The modified oligonucleotide of any of claims 30-66, wherein at least six of N1, N2, N3, N4, N5, N6, N7, N8, N9, and N10comprises a modified sugar moiety.

68. The modified oligonucleotide of any of claims 30-67, wherein at least seven of N1, N2, N3, N4, N5, N6, N7, N8, N9, and N10comprises a modified sugar moiety.

69. The modified oligonucleotide of any of claims 30-68, wherein at least eight of N1, N2, N3, N4, N5, N6, N7, N8, N9, and N10comprises a modified sugar moiety.

70. The modified oligonucleotide of any of claims 30-69, wherein at least nine of N1, N2, N3, N4, N5, N6, N7, N8, N9, and N10comprises a modified sugar moiety.

71. The modified oligonucleotide of any of claims 30-70, wherein each of N1, N2, N3, N4, N5, N6, N7, N8, N9, and N10comprises a modified sugar moiety.

72. The modified oligonucleotide of any of claims 30-63, wherein N1 and N2 comprise modified sugar moieties.

73. The modified oligonucleotide of any of claims 30-63, wherein N1 and N3 comprise modified sugar moieties.SMRH:4931-9018-2038.1 65EDIT0005WO / 68KM-408384-WO 74. The modified oligonucleotide of any of claims 30-63, wherein N1 and N4 comprise modified sugar moieties.

75. The modified oligonucleotide of any of claims 30-63, wherein N1and N5comprise modified sugar moieties.

76. The modified oligonucleotide of any of claims 30-63, wherein N2and N3comprise modified sugar moieties.

77. The modified oligonucleotide of any of claims 30-63, wherein N2 and N4 comprise modified sugar moieties.

78. The modified oligonucleotide of any of claims 30-63, wherein N2and N5comprise modified sugar moieties.

79. The modified oligonucleotide of any of claims 30-63, wherein N3and N4comprise modified sugar moieties.

80. The modified oligonucleotide of any of claims 30-63, wherein N3 and N5 comprise modified sugar moieties.

81. The modified oligonucleotide of any of claims 30-63, wherein N4 and N5 comprise modified sugar moieties.

82. The modified oligonucleotide of any of claims 30-63 or claims 72-73, wherein N1, N2, and N3 comprise modified sugar moieties.

83. The modified oligonucleotide of any of claims 30-63 or claims 72-82, wherein N6and N7comprise modified sugar moieties.

84. The modified oligonucleotide of any of claims 30-63 or claims 72-82, wherein N6and N8comprise modified sugar moieties.

85. The modified oligonucleotide of any of claims 30-63 or claims 72-82, wherein N6and N9comprise modified sugar moieties.

86. The modified oligonucleotide of any of claims 30-63 or claims 72-82, wherein N6and N10comprise modified sugar moieties.

87. The modified oligonucleotide of any of claims 30-63 or claims 72-82, wherein N6and N11comprise modified sugar moieties.

88. The modified oligonucleotide of any of claims 30-63 or claims 72-82, wherein N7 and N9 comprise modified sugar moieties.

89. The modified oligonucleotide of any of claims 30-63 or claims 72-82, wherein N7and N9comprise modified sugar moieties.

90. The modified oligonucleotide of any of claims 30-63 or claims 72-82, wherein N7 and N10 comprise modified sugar moieties.

91. The modified oligonucleotide of any of claims 30-63 or claims 72-82, wherein N7 and N11 comprise modified sugar moieties.SMRH:4931-9018-2038.1 66EDIT0005WO / 68KM-408384-WO 92. The modified oligonucleotide of any of claims 30-63 or claims 72-82, wherein N8and N9comprise modified sugar moieties.

93. The modified oligonucleotide of any of claims 30-63 or claims 72-82, wherein N6 and N10 comprise modified sugar moieties.

94. The modified oligonucleotide of any of claims 30-63 or claims 72-82, wherein N6 and N11 comprise modified sugar moieties.

95. The modified oligonucleotide of any of claims 30-63 or claims 72-82, wherein N9and N10comprise modified sugar moieties.

96. The modified oligonucleotide of any of claims 30-63 or claims 72-82, wherein N9and N11comprise modified sugar moieties.

97. The modified oligonucleotide of any of claims 30-63 or claims 72-82, wherein N10and N11comprise modified sugar moieties.

98. The modified oligonucleotide of any of claims 30-63 or claims 72-82, or claims 95-97, wherein N9, N10, and N11comprise modified sugar moieties.

99. The modified oligonucleotide of any of claims 62-98, wherein the modified sugar moiety is a 2'- substituted sugar moiety.

100. The modified oligonucleotide of any of claims 62-98, wherein the modified sugar moiety is selected from 2'-0Me sugar moiety, 2'-M0E sugar moiety, 2'-F sugar moiety, 2'-NMA sugar moiety, cEt sugar moiety, and LNA sugar moiety.

101. The modified oligonucleotide of claim 30, wherein each of N1, N2, N3, N9, N10, and N11comprise a modified sugar moiety and at least two of L1, L2, and L3and at least two of L8, L9, and L10are modified internucleoside linkages of Formula I; L4, L5, L6, and L7are phosphodiester internucleoside linkages; and each remaining internucleoside linkage is a phosphodiester internucleoside linkage.

102. The modified oligonucleotide of claim 101, wherein each of Ni, No. Ns and N9, Nw, and Nn comprises a 2’-0Me sugar moiety.

103. The modified oligonucleotide of claim 30, wherein each of N1, N2, and N10, and N11comprise a modified sugar moiety and at least one of L1, L2and at least one of L9, and L10are modified internucleoside linkages of Formula I; L3, L4, L5, L6, L7, and L8are phosphodiester internucleoside linkages; and each remaining internucleoside linkage is a phosphodiester internucleoside linkage.

104. The modified oligonucleotide of claim 103, wherein each of N2and N10comprises a 2'-OMe sugar moiety, and each of N1and N11comprises a sugar moiety selected from a 2'-OMe sugar moiety, 2'-MOE sugar moiety, 2'-F sugar moiety, 2'-NMA sugar moiety, cEt sugar moiety, and LNA sugar moiety.

105. The modified oligonucleotide of claim 104, wherein each of N1and N11comprises a cEt sugar moiety.

106. The modified oligonucleotide of claim 104, wherein each of N1and N11comprises a 2'-MOE sugar moiety.SMRH:4931-9018-2038.1 67EDIT0005WO / 68KM-408384-WO107. The modified oligonucleotide of claim 101, or 102-106, wherein each remaining nucleoside comprises an unmodified 2’-0H(H) ribosyl sugar moiety.

108. The modified oligonucleotide of any of claims 101-107, wherein for each internucleoside linkage of Formula I, X is O, Ri is H and R2 is methyl.

109. The modified oligonucleotide of any of claims 1-108, wherein the modified oligonucleotide consists of 70-160 linked nucleosides.

110. The modified oligonucleotide of claim 109, wherein the modified oligonucleotide consists of 70-130, 80-120, 90-110, or 95-105 linked nucleosides.

111. An editing system comprising the modified oligonucleotide of any of claims 1-110 and an mRNA encoding a Cas protein.

112. An editing system comprising the modified oligonucleotide of any of claims 1-110 and a Cas protein.

113. The editing system of claim 111 or 112, further comprising a delivery system.

114. The editing system of claim 113, wherein the delivery system comprises a lipid nanoparticle.

115. A composition comprising the modified oligonucleotide of any of claims 1-110 or the editing system of any of claims 111-114.

116. A method of editing a target nucleic acid, comprising administering the modified oligonucleotide of any of claims 1-110, the editing system of any of claims 111-114, or the composition of claim 115 to a subject.

117. A method of editing a target nucleic acid, comprising contacting a cell with the modified oligonucleotide of any of claims 1-110, the editing system of any of claims 111-114, or the composition of claim 115.

118. The method of claim 117, which comprises administering the modified oligonucleotide and a Cas protein or a nucleic acid encoding the Cas protein.

119. Use of the modified oligonucleotide of any of claims 1-110, the editing system of any of claims 111- 114, or the composition of claim 115 in the manufacture of a medicament for editing a target nucleic acid.

120. A kit comprising the modified oligonucleotide of any of claims 1-110, the editing system of any of claims 111-114, or the composition of claim 115, and optionally instructions for use, optionally wherein the kit is for, or when used for, editing a target nucleic acid.SMRH:4931-9018-2038.1 68

Images