Homology-independent paired prime gene editing-directed method to program large DNA insertions

Abstract

Provided are methods of editing a nucleic acid sequence to replace or insert large DNA sequences using prime editing and linear double-stranded DNA donors. The methods utilize paired prime editor guide RNAs to generate flaps homologous to the ends of a linear DNA donor, enabling scarless, HDR-independent insertion of gene-sized DNA fragments. Also provided are methods of treating genetic diseases using the disclosed genome editing methods.

Description

[0001] Docket No. 084284.00355

[0002] HOMOLOGY-INDEPENDENT PAIRED PRIME GENE EDITING-DIRECTED METHOD TO PROGRAM LARGE DNA INSERTIONS

[0003] CROSS-REFERENCE TO RELATED APPLICATIONS

[0004] This application is entitled to priority pursuant to 35 U.S.C. §119(e) to U.S. Provisional Application No. 63 / 771,217, filed on March 13, 2025. The content of the application is incorporated herein by reference in its entirety.

[0005] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0006] This invention was made with government support under Grant No. 5R00HL153940 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0007] REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0008] The contents of the electronic sequence listing (084284.00355SeqList.xml; Size: 185,853 bytes; and Date of Creation: March 10, 2026) are herein incorporated by reference in their entirety.

[0009] FIELD OF THE INVENTION

[0010] This disclosure relates generally to methods of editing a nucleic acid sequence to replace or insert large DNA sequences.

[0011] BACKGROUND OF THE INVENTION

[0012] Many genetic diseases are caused by diverse mutations across various loci, necessitating precise therapeutic strategies. However, current genome editing approaches struggle to efficiently or accurately insert or replace large DNA fragments. This limitation has made it difficult to develop editing approaches that can address most or all mutations among a patient population. As a result, separate therapeutic editing strategies must often be pursued on an allele-by-allele basis, which is slow, arduous, expensive, and inefficient. Traditional approaches for targeted integration or replacement of gene-sized DNA fragments rely on double-strand break (DSB) repair via non-homologous end joining (NHEJ) or homology-directed repair (HDR). Unfortunately, these methods have significant limitations. DSBs can cause uncontrolled insertions or deletions (indels) and activate p53, resulting in DNA damage and cytotoxicity. In the presence of a donor DNA, aDocket No. 084284.00355

[0013] DSB can be precisely repaired by HDR, but HDR is usually inefficient for large DNA insertions in primary cells and in vivo contexts. Thus, developing methods for precise, efficient large DNA integration remains a key challenge in genome editing.

[0014] CRISPR techniques, including Cas9 nuclease, base editing, and prime editing, have achieved great successes in programming versatile genomic modifications, ranging from single nucleotide conversions, small deletion / insertions, and large deletions. However, their applications for efficiently inserting gene-sized genomic fragments into the desired locus are limited. Currently, there are three available CRISPR-mediated insertion approaches.

[0015] The first approach is Cas9 nucl ease-mediated insertion. By creating double-stranded DNA breaks (DSBs), Cas9 nuclease can recruit the DNA repair machinery into the target site to program (1) homology-dependent insertion (HDR), which has limited insertion efficiency in most postmitotic cells or in vivo, or (2) homology-independent insertion (HITI), which tends to introduce many unintended indels at the insertion site.

[0016] The second approach is site-specific recombinase-mediated insertion. Prime editor and a recombinase can insert gene-sized genetic elements into the target site without causing DSBs. However, this method will introduce recombination scars flanking the inserted sequence, impairing editing accuracy. Moreover, delivery of the circular donor template in vivo can be challenging.

[0017] The third approach is a precise and specific deletion and repair (PEDAR; PE-Cas9-based deletion and repair)-mediated genomic DNA replacement strategy: A paired prime editing (paired PE) genome replacement strategy was engineered to delete long DNA sequences and concurrently insert the desired sequence. However, this strategy cannot insert >100-bp large DNA fragments, and will introduce imperfect editing due to the DSBs.

[0018] Recent advances in prime editing (PE)-associated technologies, combined with serine integrases, have enabled large insertions into the genome. However, these approaches often produce junctional scars at insertion sites, such as attP-attB junctions or recombination-induced misalignments, leading to small insertions, deletions, or substitutions. These imperfect editing events could have adverse functional consequences. Moreover, the in vivo or clinical safety of integrases remains poorly characterized, and the substantial size and structural complexity — including PE / recombinase effectors, plasmid donors, and pegRNA templates — pose considerableDocket No. 084284.00355

[0019] challenges for efficient delivery. These factors present significant translational barriers, although various studies have aimed to address these and other limitations. Current PE -based systems, such as PASSIGE and PASTE, primarily use plasmids as donor templates. However, plasmids exhibit poor uptake in vivo and can elicit innate immune responses due in part to unmethylated CpG motifs, leading to inflammation.

[0020] Thus, there is a need to develop a scarless, plasmid-free, and integrase-free system capable of achieving efficient, HDR-independent, precise large DNA insertions, particularly for therapeutic applications.

[0021] SUMMARY OF THE INVENTION

[0022] In one aspect, provided is a method for editing a nucleotide sequence. In some embodiments, the method comprises:

[0023] i) contacting a nucleic acid molecule comprising a target nucleotide sequence with a catalytically active or impaired Cas9 protein, a first prime editor guide RNA molecule conjugated to a first reverse transcriptase DNA insertion template, and a second prime editor guide RNA molecule conjugated to a second reverse transcriptase DNA insertion template, wherein the first and second reverse transcriptase DNA templates are not complementary, and wherein the first prime editor guide RNA molecule binds to a sense strand of the target nucleotide sequence, and the second prime editor guide RNA molecule binds to an antisense strand of the target nucleotide sequence;

[0024] ii) creating, with the catalytically active or impaired Cas9 protein, two cuts or nicks, respectively, on the sense strand and the antisense strand of the target nucleotide sequence such that the target nucleotide sequence is deleted;

[0025] iii) incorporating by reverse transcription two nucleotide sequences respectively encoded by the first and second reverse transcriptase insertion templates into the target nucleotide sequence, wherein the two nucleotide sequences are homologous to the ends of a linear double-stranded DNA donor; and

[0026] iv) ligating the two nucleotide sequences to the ends of the linear double-stranded DNA donor such that the DNA donor is inserted into the nucleic acid molecule.

[0027] In some embodiments, the linear double-stranded DNA donor has a length ranging from 100 to 12,000 base pairs. In some embodiments, the linear double-stranded DNA donor has aDocket No. 084284.00355

[0028] length ranging from 100 to 2,000 base pairs. In some embodiments, the linear double-stranded DNA donor has a length ranging from 100 to 1,000 base pairs. In some embodiments, the two nucleotide sequences encoded by the first and second reverse transcriptase insertion templates have a length of at least 20 base pairs. In some embodiments, the two nucleotide sequences have a length of about 30 to about 50 base pairs. In one embodiment, the target nucleic acid molecule comprises a genomic DNA locus.

[0029] In one embodiment, the linear double-stranded DNA donor comprises chemical modifications. In one embodiment, the chemical modifications comprise triethylene glycol (TEG) and phosphorothioate bonds.

[0030] In one embodiment, the linear double-stranded DNA donor comprises 3' overhangs. In one embodiment, the 3' overhangs are generated by 5'-to-3' exonuclease treatment. In one embodiment, the method further comprises contacting the nucleic acid molecule with a DNA-PK inhibitor. In one embodiment, the DNA-PK inhibitor is AZD-7648.

[0031] In one embodiment, the target nucleotide sequence is associated with a genetic disease. In some embodiments, the genetic disease is cystic fibrosis (CF), Duchenne muscular dystrophy (DMD), cancer, Huntington’s disease (HD), Fragile X syndrome (FXS), or alpha-1 antitrypsin deficiency (AATD).

[0032] In one embodiment, the linear double-stranded DNA donor comprises two or more overlapping DNA segments. In one embodiment, the two or more overlapping DNA segments have an overlap of about 20 to about 50 base pairs. In one embodiment, the linear double-stranded DNA donor is inserted into a safe harbor locus. In one embodiment, the safe harbor locus is the AAVS1 locus.

[0033] In one aspect, provided is a method of treating a genetic disease in a subject in need thereof, comprising administering to the subject: i) a composition comprising a catalytically active or impaired Cas9 protein fused to a reverse transcriptase, a first prime editor guide RNA (pegRNA) molecule conjugated to a first reverse transcriptase DNA insertion template and a second prime editor guide RNA molecule conjugated to a second reverse transcriptase DNA insertion template, wherein said first and second reverse transcriptase DNA templates are not complementary; and ii) a linear double-stranded DNA donor.Docket No. 084284.00355

[0034] In some embodiments, the genetic disease is cystic fibrosis (CF), Duchenne muscular dystrophy (DMD), cancer, Huntington’s disease (HD), Fragile X syndrome (FXS), or alpha-1 antitrypsin deficiency (AATD). In one embodiment, the subject is a human. In some embodiments, the linear double-stranded DNA donor has a length ranging from 100 base pairs to 12,000 base pairs. In some embodiments, the linear double-stranded DNA donor has a length ranging from 100 to 2,000 base pairs. In one embodiment, the linear double-stranded DNA donor is inserted into a target nucleotide sequence of the subject’s genomic DNA. In one embodiment, the target nucleotide sequence is associated with the genetic disease.

[0035] In one embodiment, the linear double-stranded DNA donor comprises chemical modifications. In one embodiment, the chemical modifications comprise triethylene glycol (TEG) and phosphorothioate bonds.

[0036] In one embodiment, the linear double-stranded DNA donor comprises 3’ overhangs. In one embodiment, the method further comprises administering a DNA-PK inhibitor to the subject. In one embodiment, the DNA-PK inhibitor is AZD-7648. In one embodiment, the linear doublestranded DNA donor comprises the full-length coding sequence of the dystrophin gene. In one embodiment, the linear double-stranded DNA donor is inserted into the AAVS 1 locus or the TRAC locus.

[0037] BRIEF DESCRIPTION OF THE DRAWINGS FIGS. 1A, IB, and 1C illustrate use of the Hi-PPE strategy to program long insertions.

[0038] FIG. 1A is an overview of the Hi-PPE strategy. FIG. IB depicts Hi-PPE-mediated insertion of GFP sequence into 3’UTR of GAPDH. FIG. 1C is a graph of the results of FIG. IB. Three biological replicates. Catalytically impaired Cas9 (nCas9) was used.

[0039] FIGS. 2A and 2B depict the use of PE-Cas9-mediated Hi-PPE to program target replacement of a large genomic sequence. FIG. 2A shows replacement of a 1-kb target sequence with a Halo-tag at the HEK3 site. P = 0.013 (*) and 0.0455 (*). Three biological replicates. FIG.

[0040] 2B is a graph of target sequence replacement at HEK3 site in the HCT116-WT and lig4- / - cells. P = 0.0433(*). Three biological replicates. Catalytically active Cas9 was used.

[0041] FIGS. 3A, 3B, 3C, 3D, 3E, and 3F illustrate prime assembly (PA) for large insertion using a dsDNA donor. FIG. 3A is a schematic depicting DNA insertion based on complementarityDocket No. 084284.00355

[0042] between the twinPE flaps and dsDNA donor. 35-nt flaps A and B match the ends of the dsDNA donor generated by PCR. FIG. 3B is an agarose gel analysis of a 0.8-kb DNA donor inserted at the AAVS1 site. HEK293T cells were transfected with the indicated components. H840A: Cas9 nickase; Plasmid: circular plasmid donor. The arrow denotes targeted insertion (INS). Ctrl, cells without transfection; *, nonspecific band. FIG.3C is a graph of the insertion efficiency (% editing) of the 0.8-kb donor measured by ddPCR. Data and error bars indicate the mean and s.d. of independent biological replicates (n = 4 to 5). FIG. 3D is an agarose gel analysis of PA at the AAVS1 site with donors of indicated lengths. M, molecular weight marker. FIG. 3E shows a PA-tag assay using donor-specific primers. UMI, unique molecular identifier. FIG. 3F demonstrates that PA-tag validates the high specificity of PA. Red dots denote the AAVS1 site. Quantification of 3’ reads is shown. M, mitochondria.

[0043] FIGS. 4A, 4B, 4C, 4D, 4E, and 4F demonstrate NHEJ Inhibitor (AZD-7648) and 3’-overhang dsDNA for prime assembly. FIG. 4A is an agarose gel analysis of the 0.8-kb dsDNA insertion at the AAVS 1 site ± DNA-PK inhibitor AZD-7648. FIG.4B is a graph of the fold change of 0.8-kb donor insertion in the presence of AZD-7648 compared to the absence of inhibitor, measured by ddPCR (n = 4). FIG. 4C is a diagram depicting the 3 '-overhang dsDNA (odsDNA) donor, generated by PCR amplification and 5 '-end resection using lambda exonuclease. The 3'-overhangs anneal to the flaps generated by PE. FIG. 4D is an agarose gel analysis of the 0.8-kb odsDNA donor insertion at the AAVS1 site ± AZD-7648. FIG. 4E is a graph of the insertion efficiency of the 0.8-kb donor measured by ddPCR (n = 3 to 5). Ctrl = cells without transfection and treatment. Data and error bars indicate the mean and s.d. of independent biological replicates.

[0044] FIG. 4F demonstrates that PA-tag validates the high specificity of PA + odsDNA.

[0045] FIGS. 5A, 5B, 5C, 5D, 5E, and 5F illustrate multiple donor prime assembly in mammalian cells. FIG. 5A is an illustration of PA insertion of two donor segments that overlap by 30-bp (middle section beneath the plus sign). The outside ends of the dsDNA donor (light grey lines) match the two 35-nt flaps generated by twinPE. FIG. 5B is an agarose gel analysis of insertion mediated by PA 2 donor ± AZD-7648. FIG.5C is a graph of the insertion efficiency of PA 2 donor or control measured by ddPCR (-AZD). HEK293T cells were transfected with PE6, pegA+pegB, GFP-N (432 bp) and GFP-C (431 bp) PCR donors (n = 4 to 5). Ctrl = cells without transfection and treatment. FIG. 5D is a graph of the average percent reads (n = 2 biological replicates) that correspond to precise insertion and indels (i.e., NHEI insertion) between the GFP-N and GFP-CDocket No. 084284.00355

[0046] donors ± AZD-7648. FIG. 5E shows a PA 3 donor of a 1 ,9-kb IRES-AAT insertion at the AAVS1 site. 293T cells were transfected with PA 1 donor or 3 donor ± AZD-7648. FIG. 5F is a graph of the insertion rates with varying numbers of AAT donors measured by ddPCR. Data and error bars indicate the mean and s.d. of independent biological replicates.

[0047] FIGS. 6A, 6B, 6C, 6D, and 6E show that prime assembly enables dystrophin and CAR insertion. FIG. 6A is a schematic of PA insertion of the 11.3-kb full-length dystrophin cDNA.

[0048] FIG. 6B is a graph of ddPCR of dystrophin insertion at the AAVS1 site. HEK293T cells were transfected with PE6c, pegA+pegB, and donor. Ctrl = cells without transfection and treatment. Error bars are s.d. FIG.6C is an agarose gel of dystrophin insertion ± AZD-7648. n.s., nonspecific band. FIG. 6D is an agarose gel of PA-mediated CD19 CAR-p2A-GFP insertion into the T-cell receptor a constant (TRAC) locus in 293T cells in the presence of AZD-7648. Replicate transfections are shown. FIG. 6E shows ddPCR of FIG. 6D. n = 3 for PA+CAR and n = 2 for Ctrl.

[0049] DETAILED DESCRIPTION OF THE INVENTION

[0050] The present disclosure provides methods for genome editing to replace or insert large DNA sequences using prime editing paired with linear double-stranded DNA donors. The methods achieve scarless insertion of DNA fragments ranging from about 100 base pairs to about 12,000 base pairs. In some embodiments, the methods achieve insertion efficiency of at least about 50% and editing precision of at least about 95%. The methods are independent of homology-directed repair (HDR), do not require double-strand breaks (DSBs), and do not introduce recombination scars at the insertion site.

[0051] In some embodiments, the linear double-stranded DNA donor sequence has a length of at least 100 base pairs, at least 500 base pairs, at least 800 base pairs, at least 1,000 base pairs, at least 2,000 base pairs, at least 4,000 base pairs, at least 8,000 base pairs, at least 10,000 base pairs, or at least 11,000 base pairs. In some embodiments, the linear double-stranded DNA donor sequence has a length ranging from about 100 base pairs to about 12,000 base pairs (e.g, about 100 base pairs, about 200 base pairs, about 300 base pairs, about 400 base pairs, about 500 base pairs, about 600 base pairs, about 700 base pairs, about 800 base pairs, about 900 base pairs, about 1,000 base pairs, about 2,000 base pairs, about 3,000 base pairs, about 4,000 base pairs, about 5,000 base pairs, about 6,000 base pairs, about 7,000 base pairs, about 8,000 base pairs, about 9,000 baseDocket No. 084284.00355

[0052] pairs, about 10,000 base pairs, about 11,000 base pairs, about 12,000 base pairs, or any number of base pairs therebetween). In some embodiments, the linear double-stranded DNA donor sequence has a length ranging from about 100 base pairs to about 2,000 base pairs (e. ., about 100 base pairs, about 200 base pairs, about 300 base pairs, about 400 base pairs, about 500 base pairs, about 600 base pairs, about 700 base pairs, about 800 base pairs, about 900 base pairs, about 1,000 base pairs, about 1,300 base pairs, about 1,600 base pairs, about 1,900 base pairs, about 2,000 base pairs, or any number of base pairs therebetween). In some embodiments, the linear double-stranded DNA donor sequence has a length ranging from about 100 base pairs to about 1,000 base pairs (e.g., about 100 base pairs, about 200 base pairs, about 300 base pairs, about 400 base pairs, about 500 base pairs, about 600 base pairs, about 700 base pairs, about 800 base pairs, about 900 base pairs, about 1,000 base pairs, or any number of base pairs therebetween). In some embodiments, the linear double-stranded DNA donor sequence has a length ranging from about 800 base pairs to about 11,300 base pairs. The methods described herein surpass current genome editing techniques in inserting large DNA sequences without requiring delivery of a large DNA donor (such as a circular donor template) or relying on error-prone DNA repair pathways. Consequently, the methods described herein address a long-felt need of accurately inserting gene-sized genomic fragments in target DNA for genomic modification.

[0053] In some embodiments, the editing efficiency is at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, or at least about 50%. In some embodiments, the editing precision is at least about 80%, at least about 85%, at least about 90%, or at least about 95% as measured by the percentage of insertion junctions with the correct sequence.

[0054] In one aspect, provided is a method for editing a nucleotide sequence, comprising: i) contacting a nucleic acid molecule comprising a target nucleotide sequence with a catalytically active or impaired Cas9 protein, a first prime editor guide RNA molecule conjugated to a first reverse transcriptase DNA insertion template, and a second prime editor guide RNA molecule conjugated to a second reverse transcriptase DNA insertion template, wherein the first and second reverse transcriptase DNA templates are not complementary, and wherein the first prime editor guide RNA molecule binds to a sense strand of the target nucleotide sequence, and a second prime editor guide RNA binds to an antisense strand of the target nucleotide sequence; ii) creating, with the catalytically active or impaired Cas9 protein, two cuts or nicks, respectively, on the sense strandDocket No. 084284.00355

[0055] and the antisense strand of the target nucleotide sequence such that the target nucleotide sequence is deleted; iii) incorporating by reverse transcription two nucleotide sequences respectively encoded by the first and second reverse transcriptase insertion templates into the target nucleotide sequence, wherein the two nucleotide sequences are homologous to the ends of a linear doublestranded DNA donor; and iv) ligating the two nucleotide sequences to the ends of the linear doublestranded DNA donor such that the DNA donor is inserted into the nucleic acid molecule.

[0056] In one embodiment, the two cuts or nicks function as homologous sequences to direct the ligation to the ends of a linear double-stranded DNA donor.

[0057] In one embodiment, the linear double-stranded DNA sequence donor comprises a promoter and a correct gene coding sequence that is inserted into a safe harbor locus. In another embodiment, the linear double-stranded DNA donor sequence comprises a coding sequence that is inserted into exon 1 of a defective gene (such as a gene that exhibits improper activity and / or low expression).

[0058] In one embodiment, the linear double-stranded DNA donor sequence comprises the coding sequence of alpha- 1 antitrypsin (AAT). In one embodiment, the AAT gene has a length of about 1.9 kilobases. In one embodiment, the AAT gene is inserted using two or more overlapping DNA segments that are assembled in vivo. In one embodiment, the AAT gene is inserted into the AAVS 1 locus.

[0059] In one embodiment, the linear double-stranded DNA donor sequence comprises the full-length coding sequence of the dystrophin gene. In one embodiment, the dystrophin gene has a length of about 11.3 kilobases. In one embodiment, the dystrophin gene is inserted into the AAVS 1 locus. In one embodiment, insertion of the dystrophin gene is enhanced by treatment with a DNA-PK inhibitor.

[0060] In one embodiment, the linear double-stranded DNA donor sequence encodes a chimeric antigen receptor (CAR). In one embodiment, the CAR comprises a CD19-specific single chain variable fragment. In one embodiment, the CAR gene is inserted into the TRAC locus. In one embodiment, the CAR gene has a length of about 2.4 kilobases. In one embodiment, the CAR gene is linked to a reporter gene, such as GFP, via a 2A self-cleaving peptide sequence.Docket No. 084284.00355

[0061] In one embodiment, the genome editing method replaces a small DNA region (less than about 100 bp) with a large DNA fragment. In one embodiment, the genome editing method does not cause double-stranded DNA breaks.

[0062] In one embodiment, the genome editing method replaces a large DNA fragment with another large DNA fragment.

[0063] In one embodiment, the genome editing method achieves an insertion efficiency of at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, or at least about 50%. In one embodiment, the genome editing method achieves an editing precision of at least about 80%, at least about 85%, at least about 90%, or at least about 95%, as measured by the percentage of insertion junctions with the correct sequence.

[0064] In one embodiment, the linear double-stranded DNA donor has a length of at least 100 base pairs, at least 500 base pairs, at least 800 base pairs, at least 1,000 base pairs, at least 2,000 base pairs, at least 4,000 base pairs, at least 8,000 base pairs, at least 10,000 base pairs, or at least 11,000 base pairs. In one embodiment, the linear double-stranded DNA donor has a length ranging from about 100 base pairs to about 12,000 base pairs. In one embodiment, the linear double-stranded DNA donor has a length ranging from about 100 base pairs to about 2,000 base pairs.

[0065] In one embodiment, the two nucleotide sequences encoded by the first and second reverse transcriptase insertion templates have a length of about 13 to about 50 base pairs. In one embodiment, the two nucleotide sequences have a length of about 30 to about 40 nucleotides. In one embodiment, the two nucleotide sequences have a length of about 35 nucleotides.

[0066] In one embodiment, the linear double-stranded DNA donor is inserted into a safe harbor locus. In one embodiment, the safe harbor locus is the AAVS1 locus. In one embodiment, the safe harbor locus is the TRAC locus. In one embodiment, the linear double-stranded DNA donor is inserted into the GAPDH locus. In one embodiment, the linear double-stranded DNA donor is inserted into the HEK3 locus. In one embodiment, the linear double-stranded DNA donor is inserted into the ACTB locus.

[0067] In one embodiment, the linear double-stranded DNA donor comprises two or more overlapping DNA segments. In one embodiment, the two or more overlapping DNA segments have an overlap of about 20 to about 50 base pairs, such as about 30 base pairs. In one embodiment,Docket No. 084284.00355

[0068] the two or more overlapping DNA segments are assembled in vivo following transfection. In one embodiment, the method comprises delivering three overlapping DNA segments that are assembled in vivo to insert a DNA fragment of about 1.9 kilobases or larger.

[0069] In one embodiment, the linear double-stranded DNA donor comprises 3' overhangs. In one embodiment, the 3' overhangs are generated by 5'-to-3' exonuclease treatment. In one embodiment, the 5'-to-3' exonuclease is lambda exonuclease. In one embodiment, the 3' overhang dsDNA (odsDNA) donor supports insertion efficiency of about 20% to about 40%. In one embodiment, the odsDNA donor results in increased precision compared to blunt-ended dsDNA donors. In one embodiment, the linear double-stranded DNA donor comprises internal phosphorothioate linkages adjacent to the 3' overhang region to prevent excessive 5'-end resection.

[0070] In one embodiment, the linear double-stranded DNA donor comprises a single-stranded DNA (ssDNA) donor. In one embodiment, the method comprises co-transfecting two ssDNA donors to mediate insertion. In one embodiment, the ssDNA donors mediate insertion of a sequence containing a restriction enzyme recognition site, such as an I-Scel site.

[0071] In one embodiment, the method is performed in a cell selected from the group consisting of HEK293T cells, Jurkat cells, K562 cells, IMR-90 cells, HuH7 cells, and HCT116 cells. In one embodiment, the method is performed in a primary cell. In one embodiment, the method is performed in a T cell. In one embodiment, the method is performed in a hematopoietic stem cell.

[0072] In one embodiment, the Cas9 protein is a Cas9 nickase (nCas9) comprising a D10A mutation or an H840A mutation. In one embodiment, the Cas9 protein is a catalytically active Cas9 (PE-Cas9). In one embodiment, the prime editor is PE6c. In one embodiment, the prime editor is PEmax.

[0073] In one embodiment, the editing method does not introduce recombination scars at the insertion site. In one embodiment, the editing method does not require homology-directed repair (HDR). In one embodiment, the editing method does not require non-homologous end joining (NHEJ). In one embodiment, the editing method does not require a recombinase enzyme.

[0074] In one embodiment, the editing method achieves scarless insertion of the linear doublestranded DNA donor. In one embodiment, the term “scarless” means that the insertion junction does not contain additional nucleotides beyond those encoded by the donor and the target site.Docket No. 084284.00355

[0075] In one embodiment, the prime editor guide RNA molecule comprises an engineered prime editing guide RNA (epegRNA). In one embodiment, the epegRNA comprises structural modifications that enhance stability. In one embodiment, the first and second prime editor guide RNA molecules are twin-epegRNAs that generate complementary flaps at the target site.

[0076] In one embodiment, the linear double-stranded DNA donor is prepared by PCR amplification. In one embodiment, the linear double-stranded DNA donor is prepared using a high-fidelity DNA polymerase. In one embodiment, the linear double-stranded DNA donor is column-purified prior to transfection.

[0077] In one embodiment, the method comprises delivering the Cas9 protein, the prime editor guide RNA molecules, and the linear double-stranded DNA donor by lipofection. In one embodiment, the method comprises delivering the components by electroporation. In one embodiment, the electroporation is performed using a Neon electroporation system.

[0078] In one embodiment, the method further comprises contacting the nucleic acid molecule with a DNA-PK inhibitor. In one embodiment, the DNA-PK inhibitor is administered about 6 hours post-transfection. In one embodiment, the DNA-PK inhibitor is AZD-7648 or NU7026.

[0079] In one embodiment, the genome editing method utilizes a DNA-PK inhibitor to enhance insertion efficiency. In one embodiment, the DNA-PK inhibitor is AZD-7648. In one embodiment, the DNA-PK inhibitor increases insertion efficiency by about 2-fold. In one embodiment, the DNA-PK inhibitor reduces indel frequency at the insertion junction from about 12-17% to about 9-12%. In one embodiment, the genome editing method is independent of the cell cycle.

[0080] In one embodiment, the genome editing method utilizes a DNA-PK inhibitor to enhance insertion efficiency. In one embodiment, the DNA-PK inhibitor is AZD-7648. In one embodiment, the linear double-stranded DNA donor comprises 3' overhangs generated by 5’-to-3’ exonuclease treatment.

[0081] In one aspect, provided is a method of treating a genetic disease in a subject in need thereof, comprising administering to the subject: i) a composition comprising a catalytically active or impaired Cas9 protein fused to a reverse transcriptase, a first prime editor guide RNA (pegRNA) molecule conjugated to a first reverse transcriptase DNA insertion template and a second prime editor guide RNA molecule conjugated to a second reverse transcriptase DNA insertion template,Docket No. 084284.00355

[0082] wherein said first and second reverse transcriptase DNA templates are not complementary; and ii) a linear double-stranded DNA donor.

[0083] In some embodiments, the composition is administered ex vivo to cells isolated from the subject. In some embodiments, the edited cells are subsequently administered to the subject. In some embodiments, the composition is administered in vivo to the subject.

[0084] The methods described herein can be used to treat various diseases that involve genomic deletions, insertions, or mutations. These diseases include, but are not limited to, Cystic Fibrosis (CF), Fragile X syndrome (FXS), cancer, Duchenne muscular dystrophy (DMD), alpha- 1 antitrypsin deficiency, sickle cell disease, beta-thalassemia, hemophilia, and other monogenic disorders. In cancers such as lung cancer, EGFR gene exon 19 deletion is the most common mutation activating the EGFR pathway. The methods may also be used for applications beyond disease treatment, including the production of engineered cells for research, industrial, or agricultural purposes.

[0085] In some embodiments, the linear double-stranded DNA donor encodes a chimeric antigen receptor (CAR). In some embodiments, the CAR is a CD19-targeting CAR. In some embodiments, the CAR gene is inserted into the TRAC locus. In some embodiments, the method of treatment is used to produce CAR-T cells for adoptive cell therapy.

[0086] In some embodiments, the method of treatment comprises administering a DNA-PK inhibitor to the subject. In some embodiments, the DNA-PK inhibitor is AZD-7648. In some embodiments, the DNA-PK inhibitor is administered within about 6 hours following administration of the composition comprising the prime editor. In some embodiments, the DNA-PK inhibitor enhances insertion efficiency by about 2-fold.

[0087] In one embodiment, the target nucleotide sequence is associated with a genetic disease. In some embodiments, the genetic disease is cystic fibrosis (CF), Duchenne muscular dystrophy (DMD), cancer, Huntington’s disease (HD), Fragile X syndrome (FXS), alpha-1 antitrypsin deficiency (AATD), sickle cell disease, beta-thalassemia, or hemophilia.

[0088] In some embodiments, the genetic disease is alpha-1 antitrypsin deficiency (AATD). In some embodiments, the linear double-stranded DNA donor encodes alpha- 1 antitrypsin (AAT). In some embodiments, the AAT gene is delivered as multiple overlapping DNA segments. In some embodiments, the genetic disease is Duchenne muscular dystrophy (DMD). In some embodiments,Docket No. 084284.00355

[0089] the linear double-stranded DNA donor encodes dystrophin. In some embodiments, the dystrophin gene has a length of about 11.3 kilobases. In some embodiments, the dystrophin gene is inserted into a safe harbor locus, such as the AAVS1 locus.

[0090] In some embodiments, the method of treatment is an ex vivo method comprising isolating cells from the subject, editing the cells using the genome editing method, and administering the edited cells to the subject. In some embodiments, the cells are autologous cells. In some embodiments, the cells are allogeneic cells.

[0091] In some embodiments, the method of treatment is an in vivo method comprising administering the composition and the linear double-stranded DNA donor directly to the subject. In some embodiments, the in vivo administration is via injection. In some embodiments, the in vivo administration targets a specific tissue or organ.

[0092] In some embodiments, the genetic disease is alpha-1 antitrypsin deficiency (AATD). In some embodiments, the linear double-stranded DNA donor encodes alpha- 1 antitrypsin (AAT). In some embodiments, the AAT gene is delivered as multiple overlapping DNA segments. In some embodiments, the genetic disease is Duchenne muscular dystrophy (DMD). In some embodiments, the linear double-stranded DNA donor encodes dystrophin. In some embodiments, the dystrophin gene is inserted into a safe harbor locus, such as the AAVS1 locus.

[0093] In some embodiments, the genetic disease is alpha-1 antitrypsin deficiency (AATD). In some embodiments, the linear double-stranded DNA donor encodes alpha-1 antitrypsin (AAT).

[0094] As used herein, the term “prime editing” refers to an approach for gene editing using nucleic acid programmable DNA binding proteins (napDNAbps), a polymerase (e.g., a reverse transcriptase), and specialized guide RNAs that include a DNA synthesis template for encoding desired new genetic information (or deleting genetic information) that is then incorporated into a target DNA sequence. Prime editing manipulates the genetic information of a targeted DNA site to essentially “rewrite” the coded sequences.

[0095] The term “prime editor” or “PE” as used herein, is a fusion protein comprising a catalytically active or impaired Cas9 endonuclease (nickase; nCas9) that can nick or cut DNA fused to an engineered reverse transcriptase enzyme, and a prime editing guide RNA (pegRNA). The pegRNA is capable of programming the nCas9 or catalytically active Cas9 to recognize aDocket No. 084284.00355

[0096] target site with the encoded crRNA-tracrRNA. In some embodiments, the PE recognizes a ‘NGG’ PAM sequence. The resulting nicked or cut genomic DNA can be extended by the reverse transcriptase based on the pegRNA template sequence to integrate a new sequence. Once one strand is recoded, cellular DNA repair pathways fdl in the other strand to create the new sequence. Such manipulation includes, but is not limited to, insertions, deletions, and base-to-base conversions without the need for double-strand breaks (DSBs) or donor DNA templates. For example, such prime editing may be performed by a Cas9 CRISPR platform programmed with a pegRNA, such as a catalytically active or impaired Cas9 nickase platform with an appropriate reverse transcriptase. See US20240175056, which is herein incorporated by reference in its entirety.

[0097] As used herein, the term “prime assembly” or “PA” refers to an approach for large DNA insertion in which the ends of a linear double-stranded DNA donor are homologous to programmable flaps generated by twin prime editing (twinPE). In prime assembly, the PE flaps anneal to the DNA donor ends, enabling integration of the donor into the target genomic site without requiring long homology arms, double-strand breaks, or recombinase enzymes.

[0098] As used herein, the terms “complementary” or “complementarity” are used in reference to “polynucleotides” and “oligonucleotides” (which are interchangeable terms that refer to a sequence of nucleotides) related by the base-pairing rules. For example, the sequence “C-A-G-T,” is complementary to the sequence “G-T-C-A .” Complementarity can be “partial” or “total.” “Partial” complementarity is where one or more nucleic acid bases is not matched according to the base pairing rules. “Total” or “complete” complementarity between nucleic acids is where each and every nucleic acid base is matched with another base under the base pairing rules. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods which depend upon binding between nucleic acids.

[0099] The terms “homology” and “homologous” as used herein in reference to nucleotide sequences refer to a degree of complementarity with other nucleotide sequences. There may be partial homology or complete homology (z.e., identity). A nucleotide sequence which is partially complementary, i.e., “substantially homologous,” to a nucleic acid sequence is one that at leastDocket No. 084284.00355

[0100] partially inhibits a completely complementary sequence from hybridizing to a target nucleic acid sequence. The inhibition of hybridization of the completely complementary sequence to the target sequence may be examined using a hybridization assay (Southern or Northern blot, solution hybridization and the like) under conditions of low stringency. A substantially homologous sequence or probe will compete for and inhibit the binding i.e., the hybridization) of a completely homologous sequence to a target sequence under conditions of low stringency. This is not to say that conditions of low stringency are such that non-specific binding is permitted; low stringency conditions require that the binding of two sequences to one another be a specific (i.e., selective) interaction. The absence of non-specific binding may be tested by the use of a second target sequence which lacks even a partial degree of complementarity (e.g., less than about 30% identity); in the absence of non-specific binding, the probe will not hybridize to the second noncompl ementary target.

[0101] The terms “homology” and “homologous” as used herein in reference to amino acid sequences refer to the degree of identity of the primary structure between two amino acid sequences. Such a degree of identity may be directed to a portion of each amino acid sequence, or to the entire length of the amino acid sequence. Two or more amino acid sequences that are “substantially homologous” may have at least 50% identity, preferably at least 75% identity, more preferably at least 85% identity, most preferably at least 95%, or 100% identity.

[0102] As used herein, the term “base pairs” refers to specific nucleobases (also termed nitrogenous bases), that are the building blocks of nucleotide sequences that form a primary structure of both DNA and RNA. Double-stranded DNA may be characterized by specific hydrogen bonding patterns, base pairs may include, but are not limited to, guanine-cytosine and adenine-thymine base pairs.

[0103] As used herein, the term “a prime editing guide RNA (pegRNA)” or “pegRNA molecule” refers to a Cas9 guide RNA molecule that encodes the crRNA-tracrRNA fused to a primer binding site (PBS) and a reverse transcriptase template (RTT). The primer binding site hybridizes to a desired genomic sequence released by the binding and cleavage of the Cas9 nickase. The 3' end and / or 5' end of a genomic sequence is extended by the reverse transcriptase based on the reverse transcriptase template sequence.Docket No. 084284.00355

[0104] As used herein, the term “31overhang double-stranded DNA” or “odsDNA” refers to a linear double-stranded DNA donor in which the 5' ends have been resected, generating 3' singlestranded overhangs. In one embodiment, the 3' overhangs are generated by treatment with a 5'-to-3' exonuclease such as lambda exonuclease.

[0105] As used herein, the term “edit,” “editing,” or “edited” refers to a method of altering a nucleic acid sequence of a polynucleotide (e.g., a wild type naturally occurring nucleic acid sequence or a mutated naturally occurring sequence) by selective deletion of a specific genomic target, the specific inclusion of new sequence through the use of an exogenously supplied DNA template, or the conversion of one DNA base to another DNA base.

[0106] The term “Cas9” or “Cas9 nuclease” refers to an RNA-guided nuclease comprising a Cas9 domain, or a fragment thereof (e. ., a protein comprising an active or inactive DNA cleavage domain of Cas9, and / or the gRNA binding domain of Cas9).

[0107] As used herein, the term “catalytically active Cas9” refers to an unmodified Cas9 nuclease comprising full nuclease activity.

[0108] As used herein, the term “catalytically impaired Cas9” or “nCas9” refers to a modified Cas9 nuclease that lacks full nuclease activity. Catalytically impaired Cas9 refers to a modified version of the Cas9 protein that has lost its ability to create double-strand breaks (DSBs) in DNA. This impairment is usually achieved through specific mutations in the catalytic domains of Cas9, rendering it either partially or completely inactive in terms of its nuclease function. In some embodiments, catalytically impaired Cas9 variants are generated through specific mutations in its two nuclease domains, RuvC and HNH. These mutations disable or alter its DNA-cutting activity while retaining its ability to bind DNA when guided by a CRISPR RNA, including D10A (Aspartate to Alanine at position 10) that inactivates the RuvC domain, leaving the HNH domain functional. This allows Cas9 to introduce single-stranded nicks instead of double-strand breaks (DSBs), and / or H840A (Histidine to Alanine at position 840) that inactivates the HNH domain, leaving the RuvC domain functional. Similar to D10A, this also results in single-stranded nicks. In some embodiments, Cas9 variants with alternative PAM specificities are used, including but not limited to SpCas9-NG, xCas9, SpRY, and SaCas9 variants.

[0109] As used herein, the term “guide RNA” is a particular type of guide nucleic acid which is most commonly associated with a Cas protein of a CRISPR-Cas9 and which associates with Cas9,Docket No. 084284.00355

[0110] directing the Cas9 protein to a specific sequence in a DNA molecule that includes complementarity to the protospacer sequence of the guide RNA. However, this term also embraces the equivalent guide nucleic acid molecules that associate with Cas9 equivalents, homologs, orthologs, or paralogs, whether naturally occurring or non-naturally occurring (e.g., engineered or recombinant), and which otherwise program the Cas9 equivalent to localize to a specific target nucleotide sequence.

[0111] The term “linker,” as used herein, refers to a molecule linking two other molecules or moi eties. The linker can be an amino acid sequence in the case of a linker joining two fusion proteins. For example, a Cas9 can be fused to a polymerase (e.g., reverse transcriptase) by an amino acid linker sequence.

[0112] As used herein, the term “twin prime editing” or “twinPE” refers to a prime editing approach in which a pair of pegRNAs simultaneously target opposite strands of a double-stranded DNA target, generating two flaps that can be used for programmable DNA modifications including deletions, inversions, and insertions. In twinPE, the first pegRNA binds to the sense strand and the second pegRNA binds to the antisense strand of the target nucleotide sequence.

[0113] As used herein, the term “safe harbor locus” refers to a genomic site where foreign genetic material can be stably integrated and expressed without disrupting essential genes or causing insertional mutagenesis. In some embodiments, the safe harbor locus is the AAVS1 locus (adeno-associated virus integration site 1). In some embodiments, the safe harbor locus is the TRAC locus (T-cell receptor alpha constant). In some embodiments, the safe harbor locus is the CCR5 locus or the ROSA26 locus.

[0114] As used herein, the term “insertion efficiency” refers to the percentage of target sites that have been successfully edited to incorporate the linear double-stranded DNA donor. In some embodiments, insertion efficiency is measured by droplet digital PCR (ddPCR). In some embodiments, insertion efficiency is measured by agarose gel electrophoresis. In some embodiments, insertion efficiency is measured by amplicon sequencing.

[0115] As used herein, the term “editing precision” or “insertion precision” refers to the percentage of successful insertions that have the correct junction sequence at the insertion site. In some embodiments, editing precision is measured by amplicon sequencing across the insertion junction. In some embodiments, editing precision is measured by Nanopore long-read sequencing.Docket No. 084284.00355

[0116] As used herein, the term “DNA-PK inhibitor” refers to a compound that inhibits the activity of DNA-dependent protein kinase (DNA-PK). In one embodiment, the DNA-PK inhibitor is AZD-7648. In one embodiment, the DNA-PK inhibitor is NU7026. DNA-PK inhibitors can enhance the efficiency and precision of prime assembly-mediated insertions by reducing NHEJ-mediated indels at the insertion junction.

[0117] The term “effective amount,” as used herein, refers to an amount of a biologically active agent that is sufficient to elicit a desired biological response. For example, in some embodiments, an effective amount of a prime editor (PE) may refer to the amount of the editor that is sufficient to edit a target site nucleotide sequence, e.g., a genome.

[0118] As used herein, the term “treating” or “treatment” of a genetic disease, refers, in one embodiment, to ameliorating the genetic disease (z.e., arresting or reducing the development of the disease or at least one of the clinical symptoms thereof). In another embodiment, “treating” or “treatment” refers to ameliorating at least one physical parameter, which may not be discernible by the subject. In yet another embodiment, “treating” or “treatment” refers to modulating the genetic disease, either physically (e.g., stabilization of a discernible symptom), physiologically (e.g., stabilization of a physical parameter), or both. In yet another embodiment, “treating” or “treatment” refers to preventing or delaying the onset or development or progression of a genetic disease.

[0119] As used herein, the term “subject” refers to a mammal. The term “mammal” as used herein is intended to include, but is not limited to, humans, laboratory animals, domestic pets, and farm animals. Mammals, include, but are not limited to, a human or non-human mammal, such as a canine, bovine, equine, ovine, or feline, etc. Individuals and patients are also subjects herein.

[0120] An “insertion” or “addition” is that change in a nucleotide or amino acid sequence which has resulted in the addition of one or more nucleotides or amino acid residues.

[0121] A “deletion” is defined as a change in either nucleotide or amino acid sequence in which one or more nucleotides or amino acid residues, respectively, are absent.

[0122] As used herein, the phrases “in one embodiment,” “in various embodiments,” “in some embodiments,” and the like are used repeatedly. Such phrases do not necessarily refer to the same embodiment, but they may unless the context dictates otherwise.Docket No. 084284.00355

[0123] As used herein, the terms “and / or” or “ / ” means any one of the items, any combination of the items, or all of the items with which this term is associated.

[0124] As used herein and in the appended claims, the singular forms “a,” “and” and “the” include plural references unless the context clearly dictates otherwise.

[0125] As used herein, the term “approximately” or “about,” as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In some embodiments, the term “approximately” or “about” refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value). Unless indicated otherwise herein, the term “about” is intended to include values, e.g., weight percents, proximate to the recited range that are equivalent in terms of the functionality of the individual ingredient, the composition, or the embodiment.

[0126] As used herein, the term “each,” when used in reference to a collection of items, is intended to identify an individual item in the collection but does not necessarily refer to every item in the collection. Exceptions can occur if explicit disclosure or context clearly dictates otherwise.

[0127] As disclosed herein, a number of ranges of values are provided. It is understood that each intervening value, to the tenth of the unit of the lower limit, unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the present disclosure. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither, or both limits are included in the smaller ranges is also encompassed within the present disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the present disclosure.

[0128] The following examples serve to further illustrate the methods of the present disclosure.Docket No. 084284.00355

[0129] EXAMPLES

[0130] Example 1. Materials and methods.

[0131] This Example describes the materials and methods used in Examples 2-3.

[0132] 1. PegRNA design

[0133] HEK3-pegF (SEQ ID NO: 1):

[0134] Ggcccagactgagcacgtga Gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtgggaccgagtcggtgc gatgtcatttgcttccaatT cgtgctcagtctg

[0135] HEK3-pegR (SEQ ID NO: 2):

[0136] Gtgatcacctgcccaaatgtg Gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtgggaccgagtcggtgc aagaatgaactgaagctgat atttgggcaggtg

[0137] GAPDH-pegF (SEQ ID NO: 3):

[0138] GAGAGAGACCCTCACTGCTGGttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaa gtgggaccgagtcggtgc gcggcttcggccagtaacgt cagtgaggg

[0139] GAPDH-pegR (SEQ ID NO: 4):

[0140] GGGGAGATTCAGTGTGGTGG

[0141] Gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtgggaccgagtcggtgc ggatgcggtgggctctatgg ccacactgaatct

[0142] Bold indicates spacer sequence. Underlining indicates inserted sequence serving as primers for long insertion. Italics indicate primer binding site (PBS).

[0143] 2, Modified template synthesis

[0144] (1) Modified IRES-GFP template synthesis: amplification of IRES-GFP sequence using the following primers:

[0145] F: / 5Sp9 / a*c*g*ttactggccgaagccgc (SEQ ID NO: 5)

[0146] R: / 5Sp9 / C*c*a*tagagcccaccgcatcc (SEQ ID NO: 6)Docket No. 084284.00355

[0147] (2) Modified Halo-tag template synthesis: amplification of Halo-tag sequence using the following primers:

[0148] F: / 5Sp9 / A*a*t*tggaagcaaatgacatc (SEQ ID NO: 7)

[0149] R: / 5Sp9 / a*t*c*agcttcagttcattctt (SEQ ID NO: 8)

[0150] / 5Sp9 / =tri ethylene glycol (TEG); *= phosphorothioate bonds

[0151] Example 2. Chemically-modified DNA template enables homology-independent paired PE-mediated large insertion (Hi-PPE).

[0152] This study aimed to design paired PE strategies to insert gene-sized genomic fragments using a linearized donor as the template. Specifically, paired PE can create two cuts or nicks flanking the target site and simultaneously insert two short DNA sequences homologous to the ends of an exogenous double-stranded DNA donor. The two 5’ flaps functioning as microhomologous sequences, invade the donor template to prime DNA synthesis (FIG. 1A).

[0153] Consequently, the desired sequence is incorporated into the target site without leaving genomic scars. This homology-independent paired PE-mediated insertion approach is termed Hi-PPE.

[0154] To test the feasibility and efficiency of Hi-PPE, a GFP sequence was inserted into the 3’ untranslated region (UTR) of the GAPDH gene. Given that RNAitriethylene glycol (TEG) modified HDR repair template can improve Cas9-mediated HDR efficiency, primers were designed containing a TEG modification (labeled as 5Sp9 in Example 1). A chemically-modified donor DNA carrying an IRES-GFP-polyA sequence, and a pair of pegRNAs was synthesized to nick the 3 ’UTR of the GAPDH gene and simultaneously insert two 20-bp sequences that are homologous to the donor DNA (FIG. IB). The IRES sequence allows the co-expression of GFP with GAPDH. To benchmark Hi-PPE against the existing insertion methods, an NHEJ-based large insertion approach, HITI, was included as a reference. Three days after transfection of the editing components into HEK293T cells, GFP signal was analyzed by FACS, and 6.91 ±0.993% GFP-positive cells were identified in the Hi-PPE-treated group, 1.78-fold higher than the HITI approach (FIG. 1C)

[0155] Example 3. Replacing target DNA without causing DSBs.

[0156] Next, Hi-PPE was used to replace long DNA sequences. A pair of pegRNAs were designed targeting the HEK3 locus to direct 1-kb target deletion and concurrent insertion of two 20-bpDocket No. 084284.00355

[0157] sequences homologous to the ends of a donor DNA carrying a 1.5-kb Halo-tag sequence (FIG.

[0158] 2A, left panel). The target deletion-insertion rate mediated by different gene editors was compared, including PE-Cas9, Cas9, and PEmax. PE-Cas9 tends to induce DSBs, which can induce undesired cell death. Compared to PE-Cas9, PEmax led to a lower editing rate; however, compared to the Cas9 group, PEmax achieved more than 2-fold higher editing rates (FIG. 2A, right panel). Specifically, PE-Cas9 can program 4.71±0.923% desired editing, significantly higher than Cas9-and PEmax-treated groups in HEK293T cells (FIG. 2A, right panel).

[0159] To further understand the cellular determinants that impact Hi-PPE efficiency, a wild-type HCT116 cell line (HCT116-WT) and an NHEJ-defective HCT116 cell line (HCT116-lig4 / ) were used. By transfecting the cells with PE-Cas9 or Cas9, the paired pegRNAs targeting the HEK3 site, and the 1.5-kb donor DNA, abolished Cas9-mediated editing was observed in the HCT116-lig4 / _cells, whereas the PE-Cas9-mediated deletion-insertion efficiencies are comparable in the two cell lines (FIG.2B). This indicates that the PE-Cas9-mediated Hi-PPE approach does not rely on the error-prone NHEJ pathway.

[0160] The foregoing data demonstrate that the Hi-PPE strategy surpasses current genome editing methods in programming the insertion or replacement of large DNA fragments.

[0161] Example 4. Materials and methods.

[0162] This Example describes the materials and methods used in Example 5.

[0163] Cell culture and small molecule inhibitor treatment

[0164] HEK293T, Jurkat, IMR-90, and HuH7 cells were acquired from ATCC and cultured at 37 °C with 5% CO2 in Dulbecco’s modified Eagle medium (DMEM) with 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin. K562 cells were cultured in RPMI 1640 medium with L-glutamine and 10% FBS. Six hours post-transfection, HEK293T cells were treated using inhibitors with indicated concentrations. The inhibitors, RAD51 Inhibitor B02, Mrel l-Rad50-Nbsl (MRN) complex inhibitor, NU7026, AZD-7648, and Nocodazole were purchased from MedChemExpress. Olaparib and Palbociclib were purchased from Selleck Chemicals. ART558 was purchased from TargetMol.Docket No. 084284.00355

[0165] Plasmids

[0166] epegRNA expression plasmids were constructed using a custom vector (BfuAI- and EcoRI-digested) that has been described elsewhere (Liu, B. et al. A split prime editor with untethered reverse transcriptase and circular RNA template. Nat. Biotechnol. 40, 1388-1393 (2022)). The gBlocks gene fragments with homology sequence to the vector were synthesized by Integrated DNA Technologies (IDT), followed by Gibson assembly using Gibson Assembly Master Mix (New England Biolabs). The donor plasmids were constructed by Gibson assembly using pMD217 Vector. Colonies were selected and further confirmed by Sanger sequencing using the commercial human U6, M13R and other specific primers. Sequences of epegRNA are listed in Table 1.

[0167] The SA-GFP donor plasmid used for double-stranded DNA (dsDNA) donor preparation was constructed using the pMD217 vector. The human U6 promoter was removed, and the gene sequence of interest was inserted via Gibson assembly.

[0168] pCMV-PE6c (Addgene plasmid #207853), pCMV-evoCAST-Cas6 (Addgene plasmid #234725), pCMV-evoCAST-eCas7 (Addgene plasmid #234726), pCMV-evoCAST-eCas8 (Addgene plasmid #234727), pCMV-evoCAST-TniQ (Addgene plasmid #234728), pCMV-evoCAST-evoTnsAB (Addgene plasmid #234729), pCMV-evoCAST-evoTnsC (Addgene plasmid #234730), pU6-AAVSl-5-lkbdonor (Addgene plasmid #234735), p37-2iDMD-LR (Addgene plasmid #88892), and pSLCAR-CD19-28z (Addgene plasmid #135991) were used. Table 1. Sequences of epegRNA.

[0169]

[0170] Docket No. 084284.00355

[0171]

[0172] Bold indicates RTT. Italics indicate PBS. Sequences not in bold or italics are spacer.Docket No. 084284.00355

[0173] Linear dsDNA / ssDNA Donor Preparation and transfection

[0174] For linear dsDNA purification, Phusion Flash High-Fidelity PCR Master Mix (Thermo Scientific™) was used for PCR amplification according to the manufacturer’s instructions. To obtain a high concentration for transfection, a total of 0.5 mL of PCR reaction product was purified using two QIAquick PCR Purification (QIAGEN) columns with the same elution buffer. DNA was eluted in 50 pL of nuclease-free water. Specific primer sequences for detecting insertions and preparing donors are listed in Table 2.

[0175] For odsDNA preparation, PCR products were digested with lambda exonuclease (New England Biolabs, NEB) at 37 °C for 3 hours, followed by heat inactivation at 80 °C, as per the manufacturer’s protocol. The digested products were subsequently purified using QIAquick PCR Purification columns. Donor sizes were assessed via agarose gel electrophoresis, and DNA concentration was measured using a NanoDrop™ One UV-Vis Spectrophotometer.

[0176] The ssDNA syntheses were performed by Genewiz from Azenta Life Sciences. dsDNA / ssDNA donor sequences and plasmid template sequences are listed in Table 3.

[0177] Table 2. Primer sequences for detecting insertions and preparing donors.

[0178]

[0179] Docket No. 084284.00355

[0180]

[0181] Docket No. 084284.00355

[0182]

[0183] Docket No. 084284.00355

[0184]

[0185] Docket No. 084284.00355

[0186]

[0187] Docket No. 084284.00355

[0188]

[0189] / 5Sp9 / =tri ethylene glycol; *= phosphorothioate bonds

[0190] Table 3. dsDNA / ssDNA donor sequences and plasmid template sequences.

[0191]

[0192] Docket No. 084284.00355

[0193]

[0194] Docket No. 084284.00355

[0195]

[0196] Docket No. 084284.00355

[0197]

[0198] Docket No. 084284.00355

[0199]

[0200] Docket No. 084284.00355

[0201]

[0202] Docket No. 084284.00355

[0203]

[0204] Docket No. 084284.00355

[0205]

[0206] Docket No. 084284.00355

[0207]

[0208] Docket No. 084284.00355

[0209]

[0210] Docket No. 084284.00355

[0211]

[0212] Docket No. 084284.00355

[0213]

[0214] Docket No. 084284.00355

[0215]

[0216] Docket No. 084284.00355

[0217]

[0218] Docket No. 084284.00355

[0219]

[0220] Docket No. 084284.00355

[0221]

[0222] Docket No. 084284.00355

[0223]

[0224] Docket No. 084284.00355

[0225]

[0226] Transfection and Genomic DNA Isolation

[0227] Cell transfection was performed using the Lipofectamine 3000 reagent (Invitrogen, L3OOOO15) according to the manufacturer’s instructions. Briefly, 0.8 x 105cells were seeded per well in a 12-well plate and incubated overnight. Transfection was carried out using 3.5 pL of Lipofectamine 3000 and P3000 reagent (2 pL per pg of DNA). For each well, 500 ng of epegRNADocket No. 084284.00355

[0228] plasmids, 1 pg of PE6 plasmids, and 1-2 pg of purified linear DNA donors or 100 pmol ssDNA were used.

[0229] For evoCAST, 0.8 x io5cells were seeded per well in a 12-well plate and incubated overnight. Transfection was performed using Lipofectamine 3000 reagent with 100 ng each of pCas6, pCas7, and pCas8, 100 ng of pTniQ, 200 ng of pTnsAB, 50 ng of pTnsC, and 600 ng of pDonor-crRNA.

[0230] For PAINT3.0, HEK293T cells were seeded in 6-well plates and transfected using Lipofectamine 3000 reagent with 1 pg PE2, 0.8 pg SaCas9, 1 pg donor, 0.3 pg sgRNA, and 0.3 pg pegRNA plasmids. Donor-only served as a control.

[0231] Seventy -two hours post-transfection, cells were collected and lysed using 100 pL of Quick Extraction Buffer (Lucigen). The lysate was incubated in a thermocycler at 65 °C for 15 minutes, followed by 98 °C for 5 minutes, according to the Quick Extraction protocol.

[0232] Nucleofection

[0233] For Jurkat cells nucleofection, the Neon™ electroporation system was used. Briefly, 1 x 105cells were used for each electroporation with 10-pl Neon tips. For each electroporation, 500 ng of epegRNA plasmids, 1 pg of PE6 plasmids, and 1 pg of purified linear DNA donors were used with the following electroporation parameters: 1,600 V, 10 ms, three pulses. After electroporation, cells were plated in prewarmed 48-well plates with DMEM containing 10% FBS and inhibitors and incubated for 72 h before analysis. Genomic DNA isolation was performed using 50 pL of Quick Extraction Buffer (Lucigen) according to the Quick Extraction protocol.

[0234] For K562 electroporation, 500 ng of each epegRNA plasmid, 1 pg of the PE6c plasmid, and 2 pg of the dsDNA donor were electroporated in a final volume of 10 pL. Electroporation was performed with the Neon NxT Electroporation 10 pL Kit (Invitrogen) using 100,000 cells per reaction and the following parameters: 1,350 V, 10 ms, 4 pulses.

[0235] IMR-90 cells below passage 10 were used for experiments. Electroporation was performed with the Neon™ NxT Electroporation 10 pL Kit (Invitrogen) using 100,000 cells per reaction and the following parameters: 1050 V, 20 ms, 1 pulse.Docket No. 084284.00355

[0236] Sanger sequencing

[0237] PCR amplification was performed at the target locus using Phusion Flash PCR Master Mix (Thermo Fisher) and specific primers. The PCR products were purified using agarose gel electrophoresis, and Sanger sequencing was carried out by Genewiz (Azenta Life Sciences). Quantification of DNA insertion efficiency via droplet digital PCR (ddPCR)

[0238] A ddPCR approach was used to quantify the efficiency of precision insertion junction in comparison to a reference amplicon. Briefly, genomic DNA was mixed with the ddPCR Supermix (no dUTP; Bio-Rad), along with probes (250 nM) and primers (900 nM), in a final volume of 20 pl. Droplet generation was performed using a QX200™ Manual Droplet Generator (Bio-Rad). The following PCR program was used: 95 °C for 10 min, 35 cycles of 94 °C for 30 s and 58 °C for 1 min, 98 °C for 10 min, and 4 °C holds. Data acquisition was performed on a QX200™ Droplet Reader (Bio-Rad). Data analysis was performed using QuantaSoft (Bio-Rad). Editing efficiency was calculated by using the following formula: editing % = 100% x FAM+ / HEX+. Sequences of probes and primers are listed in Table 4.

[0239] Table 4. Sequences of probes and primers.

[0240]

[0241] Docket No. 084284.00355

[0242]

[0243] Ref indicates reference probe. Ins indicates insertion detection probes.

[0244] Flow cytometry analysis

[0245] Flow cytometry analysis was performed three days after transfection. Cells were collected following PBS washing and 0.25% trypsinization, then centrifuged at 300 x g for 5 min and resuspended in PBS supplemented with 2% FBS. The proportions of cells were quantified using a MACSQuant® VYB flow cytometer, and data were analyzed with FlowJo vlO software.

[0246] Amplicon sequencing and data analysis

[0247] Sequencing library preparation has been described previously (Liu, B. et al. A split prime editor with untethered reverse transcriptase and circular RNA template. Nat. Biotechnol. 40, 1388— 1393 (2022)). Briefly, for the first round of PCR, the specific primers with Illumina forward and reverse adapters (Table 5) were used to amplify the genomic sites of interest by Phusion Hot Start II PCR Master Mix (Thermo Scientific). For the second round of PCR, primers containing unique Illumina barcodes were used and PCR reactions were performed using the following parameters: 98 °C for 10 s, 20 cycles of 98 °C for 1 s, 50 °C for 5 s, and 72 °C for 7 s, followed by 72 °C for 2 min as a final extension. The DNA products of the second-round PCR were collected and purified by gel purification using the QIAquick Gel Extraction kit (Qiagen), and DNA concentration was determined by Qubit dsDNA HS assay. Subsequently, the library was sequenced on an Illumina MiniSeq following the manufacturer’s protocol.

[0248] To quantify precise edits and indels at insertion junctions, CRISPResso2 was run in NHEJ mode with expected junction sequences after editing using default settings except “ignore_substitutions” set to “TRUE” and “qwc” (quantification window) set to include the full amplicon except the first and last 15 nucleotides. The percentage of “UNMODIFIED” reads reported by CRISPResso2 is designated as the frequency of perfect editing, and the percentage of “MODIFIED” reads is designated as the frequency of indel. To quantify precise edits for ssDNADocket No. 084284.00355

[0249] short insertion, CRTSPResso2 was run in multiple allele mode, where wild-type sequence (“WT”) and expected sequences after only flap incorporation (“FLAP”) as well as perfect insertion of the donor (“INS”) were provided as different alleles. The percentage of mapped reads reported by CRISPResso2 as “INS UNMODIFIED” was designated as the frequency of perfect editing. Table 5. Primers used with Illumina forward and reverse adapters.

[0250]

[0251] Genome-wide off-target detection by PA-tag

[0252] Samples were prepared generally as previously described (Pandey, S. et al. Efficient sitespecific integration of large genes in mammalian cells via continuously evolved recombinases and prime editing. Nat. Biomed. Eng. 9, 22-39 (2025); Liang, S.-Q. et al. Genome-wide profiling of prime editor off-target sites in vitro and in vivo using PE-tag. Nat. Methods 20, 898-907 (2023); Giannoukos, G. et al. UDiTaS™, a genome editing detection method for indels and genome rearrangements. BMC Genomics 19, 212 (2018)). Genomic DNA was extracted using the Nanobind CBB Kit (PacBio, 102-301-900). To remove residual donor DNA, the genomic DNA was processed with the SRE XL Kit (PacBio, 102-208-400), followed by a 1-hour treatment with exonuclease V (NEB, M0345).

[0253] Two hundred nanograms of DNA were tagmented with 1.5 pl Tn5 transposase at 55 °C for 7 minutes. The reaction was quenched with 1 pl proteinase K and 2 pl 0.2% SDS at 55 °C for 7 minutes. The DNA was purified using the DNA Clean & Concentrator Kit (Zymo, D4013), followed by 0.8* Ampure XP SPRI bead cleanup. The tagmented DNA was analyzed using the Agilent High Sensitivity D5000 ScreenTape Kit to confirm fragment sizes of approximately 500 bp to 2 kb. Library PCR was performed as previously described (Zheng, C. et al. The reverseDocket No. 084284.00355

[0254] transcriptase domain of prime editors contributes to DNA repair in mammalian cells. Nat. Biotechnol. (2025)) and cleaned using 0.8* bead purification. PCR products were pooled and again purified with 0.8* beads. The final libraries were loaded onto an Illumina NextSeq system according to the manufacturer’s instructions.

[0255] Paired-end reads are aligned to the human hg38 reference genome and donor sequence, separately, using bowtie2 (Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 9, 357-9 (2012)) with parameters “-very-sensitive —local -X 2500 -k 2”. Only reads with both pairs uniquely aligned to genomic sequence in expected orientations and read 2 aligned to the expected region of the donor with soft-clipped bases are kept for downstream analysis. Filtered reads are deduplicated by umi-tools dedup (Smith, T., Heger, A. & Sudbery, I. UMI-tools: modeling sequencing errors in Unique Molecular Identifiers to improve quantification accuracy. Genome Res. 27, 491-499). Deduplicated reads that map to each consecutive 2.5 kb bins over the genome are counted using bamCoverage and plotted (Ramirez, F., Diindar, F., Diehl, S., Griming, B. A. & Manke, T. deepTools: a flexible platform for exploring deep-sequencing data. Nucleic Acids Res. 42, W187-91 (2014)).

[0256] Nanopore sequencing and data analysis

[0257] PCR products were purified using 0.7 x homemade magnetic beads to eliminate the short fragment amplified from the unedited genome. The purified DNA was quantified by NanoDrop and sent to Plasmidsaurus for their “Premium PCR” service (ligation-based long-read nanopore sequencing). Raw reads in FASTQ format were requested and used for subsequent analysis.

[0258] Raw reads were aligned to the expected sequences after editing using minimap2 with the parameter “-x-map-ont” (Li, H. Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics 34, 3094-3100 (2018); Li, H. New strategies to improve minimap2 alignment accuracy. Bioinformatics 37, 4572-4574 (2021)). The output BAM files were filtered for reads with >10% homology compared to the reference. Locations and sizes of the indels were extracted from the filtered BAM files. “Flap indel” frequency was calculated using (number of reads with indels >6 bp in the 100 bp region flanking the insertion point) / (total number of reads after filtering). “Precise editing” frequency was calculated using 1 - (flap indel).Docket No. 084284.00355

[0259] Example 5. Prime assembly with linear DNA donors enables large genomic insertions.

[0260] TwinPE, DNA polymerase editing (DPE), and related technologies have previously been developed. However, these approaches are not yet efficient at achieving gene-sized insertions (>800 bp), likely due to multiple factors including pegRNA instability, limited DNA synthesis activity of the exogenous reverse transcriptase (RT) or DNA-dependent DNA polymerase, DNA repair bottlenecks, and other constraints. Because prime editors efficiently generate 30- to 40-nucleotide (nt) flaps, it was hypothesized that a linear double-stranded DNA (dsDNA) donor, matching the flaps generated by twinPE, could bypass the limitations of exogenous polymerase-mediated synthesis and enable large DNA insertions.

[0261] To test this, a Prime Assembly (PA) approach was developed, in which the ends of a PCR-produced dsDNA donor are homologous to programmable flaps generated by twinPE (FIG. 3A).

[0262] Co-transfection of plasmids encoding PE6c and twin-epegRNAs (A and B with 35-nt flaps) targeting the AAVS1 locus, along with a linear dsDNA donor, into HEK293T cells resulted in efficient insertion of the 0.8-kb DNA (FIG. 3B). No insertion bands were detected in control samples, including no donor, circular plasmid template, no RT, and non-cognate pegRNA controls (FIG. 3B). Sequence analysis indicated that the PA approach generates accurate junctions on each side of the insertion. Analyzing the effect of flap length on PA efficiency, robust editing was observed with 30- and 50-nt flaps and very weak editing with a 13-nt flap. Using droplet digital PCR (ddPCR), the efficiency of insertion of the 0.8-kb donor into AAVS1 was estimated to be -50% by PA (FIG. 3C). Importantly, PA was also effective for insertion of 2.2- and 4-kb donors into the AAVS1 site in HEK293T cells (FIG. 3D), and of a 0.8-kb donor into the TRAC locus in Jurkat cells.

[0263] To analyze the precision of editing by PA, amplicon sequencing was performed across each insertion junction — i.e., corresponding to the flap homology regions. Precise junction sequences comprised 83%- 88% of reads, whereas indels / SNPs comprised 12%— 17% of reads. Given the large quantification window used in this analysis (spanning the entire amplicon), some of the detected indels may result from background noise such as sequencing or PCR errors, potentially leading to an overestimation of true indel rates. To control for amplification or sequencing errors, amplicon sequencing was performed of synthetic gBlocks Gene Fragments corresponding to each junction sequence. It was observed that 91%-92% of reads possessed the precise junctionDocket No. 084284.00355

[0264] sequence. Because the error rate of gBlocks Gene Fragment synthesis is estimated at 1:5000, or 0.02% (Integrated DNA Technologies), these results indicate that amplicon sequencing errors account for 8%-9% of imprecise junction sequence reads and that the editing precision might be closer to 95%. Many of the indels were consistent with MMEJ-induced deletions around the PE flap region (Liu, B. et al. Targeted genome editing with a DNA-dependent DNA polymerase and exogenous DNA-containing templates. Nat. Biotechnol. 42, 1039-1045 (2024); Zheng, C. et al. Template-jumping prime editing enables large insertion and exon rewriting in vivo. Nat. Commun.

[0265] 14, 3369 (2023)). Nanopore long-read sequencing across the entire insertion produced similar results. Therefore, these results indicate that PA enables precise genomic insertion of large DNA fragments.

[0266] Previous studies have shown that cellular determinants and DNA repair machinery activity modulate prime editing outcomes. Thus, small molecular inhibitors were used to block RAD51 (B02), the Mrel l-Rad50-Nbsl (MRN) complex (Mirin), DNA-PK and PI3K (Nu 7026), mitosis (Nocodazole), PARP (Olaparib), PolO (ART558), and DNA-PK (AZD-7648) to analyze how they affect PA. Among these inhibitors, the DNA-PK inhibitor AZD-7648 increased the insertion efficiency by approximately 2-fold (FIGS.4A and 4B). PA was not affected by nocodazole, which indicates that PA is independent of the cell cycle. In cells treated with AZD-7648, PA-mediated indels decreased from 12%— 17% to 9%-12%, indicating that inhibition of DNA-PK improves the accuracy of PA insertion. To test PA at an additional genomic site, GFP knock-in at exon 2 of ACTB was successfully achieved and GFP expression was confirmed by fluorescence microscopy. PA also replaced a 1-kb HEK3 region with a 1.3-kb Halo-tag using PECas9 or PEmax (liang, T. et al. Deletion and replacement of long genomic sequences using prime editing. Nat. Biotechnol.

[0267] 40, 227-234 (2022); Chen, P. J. et al. Enhanced prime editing systems by manipulating cellular determinants of editing outcomes. Cell 184, 5635-5652. e29 (2021)).

[0268] For the PE flaps to anneal to the DNA donor, the 5’ ends of the dsDNA donor must be displaced or resected. It was therefore hypothesized that removing the 5’ ends of the 0.8-kb donor would result in a 3’ overhang dsDNA (odsDNA) donor that supports PA. The 5' ends of the 0.8-kb donor were resected using lambda 5'-to-3' exonuclease, generating a 3’-odsDNA donor (FIG.

[0269] 4C). Five internal phosphorothioate (PS) linkages adjacent to the flap homology region were introduced to prevent excessive 5’-end resection (FIG. 4C). The 0.8-kb odsDNA supported 20%-40% insertion atAA Sl by PA (FIGS. 4D and 4E). Compared to the unmodified dsDNA donor,Docket No. 084284.00355

[0270] the odsDNA donor slightly reduced the frequency of insertion (FIGS. 3C and 4E) but resulted in slightly increased precision. Notably, treatment with the DNA-PK inhibitor AZD-7648 substantially reduced the frequency of indels in odsDNA-mediated insertions to the background indel levels from the gBlock control, which is consistent with the results of dsDNA with inhibitor treatment. It was also demonstrated that PA mediates a 95 bp insertion containing an I-Scel site using two single-stranded DNA (ssDNA) donors.

[0271] To overcome the donor synthesis limitations imposed by long-range PCR, the feasibility of combinatorial donor assembly was tested by dividing the 0.8-kb dsDNA donor into two segments that overlap by 3O-bp, mimicking Gibson assembly (Gibson, D. G. et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods 6, 343-345 (2009)) (FIG. 5A) The split donor supported the PA-mediated 0.8-kb insertion with -30% efficiency without AZD-7648 (FIGS. 5A-5C). Additionally, AZD-7648 treatment increased the insertion efficiency and accuracy (FIGS. 5B and 5D). In the absence of AZD-7648, 6.5% indels were observed, most of which corresponded toNHEJ events between the two donor segments. However, indels were reduced to 2% in the presence of AZD-7648 (FIG. 5D), consistent with the role of DNA-PK in NHEJ. Sanger sequencing confirmed that the donor segments were correctly assembled and inserted in cells.

[0272] The assembly of three overlapping segments of a 1.9-kb alpha-1 antitrypsin (AAT) gene into the .4.4 VS1 locus was next explored. Successful integration was observed using three-segment PA (FIG. 5E). Consistent with results from two-segment PA, insertion efficiency improved upon AZD-7648 treatment (FIG. 5E). Nanopore sequencing confirmed that the insertion is precise (FIG. 5F) These results show that this approach effectively mimics Gibson assembly within mammalian cells (Gibson, D. G. et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods 6, 343-345 (2009)), advancing the ability to precisely insert large DNA segments into the mammalian genome.

[0273] Next, it was tested whether PA could mediate the insertion of a full-length Duchenne Muscular Dystrophy (DMD) dystrophin gene (11.3 kb) into the AAVS1 locus in HEK293T cells (FIG. 6A). A column-purified 11.3-kb DMD PCR donor (FIG. 6B), PE6c, and twin-epegRNAs were co-transfected into HEK293T cells. After three days, cells were harvested and genomic DNA (gDNA) was isolated, the insertion junctions were amplified, and accurate insertion of the DMDDocket No. 084284.00355

[0274] donor was confirmed by sequencing (FIG. 6C). Agarose gel analysis using outward-facing primers, which flank the insertion site to amplify the entire insertion, further validated the full-length 11.3-kb insertion (FIG. 6D). Insertion was enhanced upon AZD-7648 treatment, consistent with previous results (FIG. 6D).

[0275] Lastly, it was tested whether a CD19-specific CAR gene could be efficiently inserted into the T-cell receptor a constant (TRAC) locus in HEK293T cells (FIG. 6F) (Eyquem, J. et al. Targeting a CAR to the TRAC locus with CR1SPR / Cas9 enhances tumor rejection. Nature 543, 113-117 (2017)). These results confirmed the successful PA integration of the 2.4 kb CD19 CAR-p2A-GFP sequence into the TRAC locus, demonstrating that PA enables the integration of large DNA cargo at therapeutically relevant sites.

[0276] This study demonstrated that PA, using twinPE and linear dsDNA or ssDNA donors, enables large insertions ranging from 0.1 to ~11 kb in mammalian cells. The efficiency was up to 50% for a 0.8 kb donor. It was also found that 3 ’-overhang dsDNA donors support PA-mediated large insertions. Furthermore, the combinatorial donor assembly design overcomes the challenge of producing long DNA donors and enables the simultaneous and combinatorial assembly of multiple donors within mammalian cells. The PA system is cost-effective, scalable, and adaptable, making it a powerful tool for large gene insertions, replacements, and precise genome modifications in mammalian cells.

[0277] Recent advances in PE have opened new possibilities for precise large insertions, but the efficiency of inserting >400-bp donors remains low. By leveraging programmable flaps generated by PE, the PA system enables controlled and precise insertions without relying on double-stranded breaks (DSBs), long homology arms, or additional recombinase elements. This provides a versatile approach for genome editing and gene therapy.

[0278] The present disclosure is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention, in addition to those described herein, will become apparent to those skilled in the art from the foregoing description and the accompanying figures. Such modifications are intended to fall within the scope of the appended claims.

[0279] All references cited herein are incorporated herein by reference in their entireties.

Claims

Docket No. 084284.00355CLAIMSWhat is claimed is:

1. A method for editing a nucleotide sequence, comprising:i) contacting a nucleic acid molecule comprising a target nucleotide sequence with a catalytically active or impaired Cas9 protein, a first prime editor guide RNA molecule conjugated to a first reverse transcriptase DNA insertion template, and a second prime editor guide RNA molecule conjugated to a second reverse transcriptase DNA insertion template, wherein the first and second reverse transcriptase DNA templates are not complementary, and wherein the first prime editor guide RNA molecule binds to a sense strand of the target nucleotide sequence, and a second prime editor guide RNA binds to an antisense strand of the target nucleotide sequence;ii) creating, with the catalytically active or impaired Cas9 protein, two cuts or nicks respectively on the sense strand and the antisense strand of the target nucleotide sequence such that the target nucleotide sequence is deleted;iii) incorporating by reverse transcription two nucleotide sequences respectively encoded by the first and second reverse transcriptase insertion templates into the target nucleotide sequence, wherein the two nucleotide sequences are homologous to the ends of a linear doublestranded DNA donor; andiv) ligating the two nucleotide sequences to the ends of the linear double-stranded DNA donor such that the DNA donor is inserted into the nucleic acid molecule.

2. The method of claim 1, wherein the linear double-stranded DNA donor has a length ranging from 100 to 12,000 base pairs.

3. The method of claim 1 or 2, wherein the linear double-stranded DNA donor has a length ranging from 100 to 2,000 base pairs.

4. The method of any one of claims 1-3, wherein the two nucleotide sequences encoded by the first and second reverse transcriptase insertion templates have a length of at least 20 base pairs.Docket No. 084284.003555. The method of any one of claims 1-4, wherein the target nucleic acid molecule comprises a genomic DNA locus.

6. The method of any one of claims 1-5, wherein the linear double-stranded DNA donor comprises 3' overhangs.

7. The method of any one of claims 1-6, wherein the linear double-stranded DNA donor comprises chemical modifications.

8. The method of claim 7, wherein the chemical modifications comprise triethylene glycol (TEG) and phosphorothioate bonds.

9. The method of any one of claims 1-8, wherein the linear double-stranded DNA donor sequence encodes a chimeric antigen receptor (CAR).

10. The method of claim 9, wherein the CAR comprises a CD19-specific single chain variable fragment.

11. The method of any one of claims 1-10, wherein the target nucleotide sequence is associated with a genetic disease.

12. The method of claim 11, wherein the genetic disease is cystic fibrosis (CF), Duchenne muscular dystrophy (DMD), cancer, Huntington’s disease (HD), Fragile X syndrome (FXS), or alpha- 1 antitrypsin deficiency (AATD).

13. The method of any one of claims 1-12, wherein the method further comprises contacting the nucleic acid molecule with a DNA-PK inhibitor.

14. The method of claim 13, wherein the DNA-PK inhibitor comprises AZD-7648.Docket No. 084284.0035515. A method of treating a genetic disease in a subject in need thereof, comprising administering to the subject:i) a composition comprising a catalytically active or impaired Cas9 protein fused to a reverse transcriptase, a first prime editor guide RNA (pegRNA) molecule conjugated to a first reverse transcriptase DNA insertion template and a second prime editor guide RNA molecule conjugated to a second reverse transcriptase DNA insertion template, wherein said first and second reverse transcriptase DNA templates are not complementary; andii) a linear double-stranded DNA donor.

16. The method of claim 15, wherein the genetic disease is cystic fibrosis (CF), Duchenne muscular dystrophy (DMD), cancer, Huntington’s disease (HD), Fragile X syndrome (FXS), or alpha- 1 antitrypsin deficiency (AATD).

17. The method of claim 15 or 16, wherein the subject is a human.

18. The method of any one of claims 15-17, wherein the linear double-stranded DNA donor has a length of 100 base pairs to 12,000 base pairs.

19. The method of any one of claims 15-18, wherein the linear double-stranded DNA donor has a length ranging from 100 to 2,000 base pairs.

20. The method of any one of claims 15-19, wherein the linear double-stranded DNA donor is inserted into a target nucleotide sequence of the subject’s genomic DNA.

21. The method of claim 20, wherein the target nucleotide sequence is associated with the genetic disease.

22. The method of any one of claims 15-21, wherein the linear double-stranded DNA donor comprises 3' overhangs.

23. The method of any one of claims 15-22, wherein the linear double-stranded DNA donor comprises chemical modifications.Docket No. 084284.0035524. The method of claim 23, wherein the chemical modifications comprise triethylene glycol (TEG) and phosphorothioate bonds.

25. The method of any one of claims 15-24, wherein the linear double-stranded DNA donor sequence encodes a chimeric antigen receptor (CAR).

26. The method of claim 25, wherein the CAR comprises a CD19-specific single chain variable fragment.

Images