RNA inhibitor for inhibiting angptl3 gene expression and use thereof

WO2026194124A1PCT designated stage Publication Date: 2026-09-24
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/108745
Authority / Receiving Office
WO · WO
Patent Type
Applications
Priority Date
2025-03-20
Filing Date
2025-07-16
Publication Date
2026-09-24

Smart Images

  • Figure CN2025108745_24092026_PF_FP_ABST
    Figure CN2025108745_24092026_PF_FP_ABST
Patent Text Reader

Abstract

Provided is an RNA inhibitor for inhibiting ANGPTL3 gene expression, or a pharmaceutically acceptable salt thereof. The RNA inhibitor further comprises carrier structures 5'MVIP and 3'MVIP in the structure thereof. The provided RNA inhibitor interferes with the translation template function of ANGPTL3 mRNA, thereby continuously and efficiently inhibiting ANGPTL3 gene expression and achieving a sustained reduction in blood ANGPTL3 levels. The inhibitor can be used for treating and / or preventing diseases associated with elevated ANGPTL3 levels.
Need to check novelty before this filing date? Find Prior Art

Description

An RNA inhibitor that suppresses ANGPTL3 gene expression and its application Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to an RNA inhibitor that inhibits the expression of the ANGPTL3 gene and its application. Background Technology

[0002] RNAi

[0003] RNA interference (RNAi) was discovered in 1998 by Andrew Z. Fire and others during antisense RNA inhibition experiments in *Caenorhabditis elegans*, and the process was named RNA interference. This discovery was named one of the top ten scientific breakthroughs of 2001 by *Science* magazine and topped the list of the top ten scientific breakthroughs of 2002. Since then, siRNA, which acts through RNA interference, has received widespread attention as a potential gene therapy drug. In 2006, Andrew Fahrenheit and Craig C. Mello were awarded the Nobel Prize in Physiology or Medicine for their contributions to the study of RNA interference mechanisms. RNAi can be triggered by double-stranded RNA (dsRNA) in many organisms, including animals, plants, and fungi. In the RNA inhibition process, an endonuclease called "Dicer" cleaves or "dices" long dsRNA into small fragments of 21–25 nucleotides in length. These small fragments, called small interfering RNA (siRNA), have their guide strands loaded onto the Argonaute protein (AGO2). AGO2 loading occurs within a RISC-loading complex, a ternary complex composed of the Argonaute protein, Dicer, and dsRNA-binding protein (TRBP). During loading, the passenger strand is cleaved and ejected by AGO2. AGO2 then uses its antisense strand to bind to mRNA containing perfectly complementary sequences, catalyzing the cleavage of these mRNAs. This causes the mRNA to lose its translation template function, thus preventing the synthesis of related proteins. After cleavage, the cleaved mRNA is released, and the RISC-loading complex loaded with the antisense strand is recycled for another round of cleavage.

[0004] Statistics show that over 80% of disease-related proteins in the human body cannot be targeted by conventional small-molecule drugs and biological macromolecules, thus belonging to the category of undrugable proteins. Gene therapy, which aims to treat diseases through gene expression and silencing, is considered by the industry as the third generation of therapeutic drugs after chemical small-molecule drugs and biological macromolecules. This therapy achieves disease treatment at the gene level, unaffected by undrugable proteins. As the most mainstream type of gene therapy, RNAi technology treats diseases at the mRNA level, offering higher efficiency compared to chemical small-molecule drugs and biological macromolecules at the protein level. Using RNAi technology, highly specific and effective siRNA sense and antisense strand sequences can be designed based on specific gene sequences. These single-stranded sequences are synthesized in a solid-phase environment, and then the sense and antisense strands are paired according to base pairing principles in a specific annealing buffer to form siRNA. Finally, it is delivered to the corresponding target site in the body through a vector system, degrading the target mRNA, disrupting its function as a translation template, and thus preventing the synthesis of related proteins.

[0005] siRNA delivery system

[0006] siRNA is unstable in blood and tissues and is easily degraded by nucleases. To improve the stability of siRNA, the sense and / or antisense strands can be modified. However, these chemical modifications only provide limited protection against nuclease degradation and may ultimately affect the activity of siRNA. Therefore, a suitable delivery system is needed to ensure that siRNA can safely and efficiently cross the cell membrane. Due to its large molecular weight, numerous negative charges, and high water solubility, siRNA cannot easily cross the cell membrane to reach the cell.

[0007] The basic structure of liposomes consists of a hydrophilic core and a phospholipid bilayer. Possessing a phospholipid bilayer similar to a biological membrane, liposomes exhibit high biocompatibility, making them one of the most popular and widely used siRNA carriers. Liposome-mediated siRNA delivery primarily involves encapsulating the siRNA within the liposome, protecting it from nuclease degradation, and improving its efficiency in crossing cell membrane barriers, thereby promoting cellular uptake. Examples include anionic liposomes, pH-sensitive liposomes, immunoliposomes, fusogenic liposomes, and cationic liposomes. Despite some progress, liposomes themselves are prone to inducing inflammatory responses. Prior to administration, multiple antihistamines and hormones such as cetirizine and dexamethasone must be used to reduce potential acute inflammatory reactions. Therefore, they are not suitable for all therapeutic areas in clinical practice, especially in the treatment of some chronic diseases, where the potential for cumulative toxicity from long-term use poses a safety hazard. Therefore, a safer and more efficient carrier system for siRNA delivery is needed.

[0008] The desialyl glycoprotein receptor (ASGPR) in the liver is a receptor specifically expressed by hepatocytes and is a highly efficient endocytic receptor. Because various glycoproteins, after enzymatic or acidic hydrolysis of sialic acid under physiological conditions, expose galactose residues at their secondary terminals, ASGPR specifically binds to galactose, hence it is also called a galactose-specific receptor. Monosaccharides and polysaccharides such as galactose, galactosamine, and N-acetylgalactosamine all have high affinity for ASGPR. The main physiological function of ASGPR is to mediate the clearance of desialyl glycoproteins, lipoproteins, and other substances from the blood, and it is closely related to the occurrence and development of liver diseases such as viral hepatitis, cirrhosis, and liver cancer. The discovery of this characteristic of ASGPR plays an important role in the diagnosis and treatment of hepatogenic diseases (Ashwell G, Harford J, Carbohydrate specific Receptors of the Liver, Ann Rev Biochem 1982 51:531-554). Hepatogenic drugs containing galactose or galactosamine and their derivatives in their structure can specifically bind to ASGPR, thus exhibiting active liver targeting without requiring other delivery systems.

[0009] ANGPTL3

[0010] Three members of the angiopoietin-like (ANGPTL) protein family—ANGPTL3, ANGPTL4, and ANGPTL8—are important regulators of plasma lipoproteins. They inhibit lipoprotein lipase, an enzyme that plays a crucial role in the intravascular lipolysis of certain lipoprotein triglycerides. Studies have shown that loss of function, gene mutations, and inactivation of the Angptl3 gene in mice are associated with significantly reduced plasma triglyceride and cholesterol levels, as well as increased lipoprotein lipase and endothelial lipase activity. In patients with ANGPTL3 deficiency caused by homozygous loss-of-function (LOF) variants, all plasma lipoprotein levels are significantly reduced. This dyslipidemia, known as familial combined hypolipidemia (FHBL2), appears to be independent of significant pathological manifestations. Compared to non-carriers, heterozygous carriers of the LOF variant have lower plasma total cholesterol and triglyceride levels and a lower risk of atherosclerotic cardiovascular disease. These observations provide a theoretical basis for a strategy of reducing atherosclerogenic lipoprotein levels in human plasma by inhibiting ANGPTL3. ANGPTL3, ANGPTL4, and ANG-PTL8 share a common characteristic: they are negative regulators of lipoprotein lipase (LPL) activity to varying degrees. LPL is a key enzyme in the intravascular lipolysis of triglycerides (TG) found in some lipoproteins, such as chylomicrons and very low-density lipoprotein (VLDL). Studies have shown that individuals with loss-of-function (LoF) variants of ANGPTL3 have significantly reduced TG levels and a cardiovascular event risk that is reduced by more than 40%. Clinical data from antisense oligonucleotides (ASOs) targeting ANGPTL3 messenger RNA show that inhibiting ANGPTL3 messenger RNA significantly reduces serum TG and LDL-C levels.

[0011] lipid metabolism disorder

[0012] Lipid metabolism disorders refer to abnormalities in the quantity and quality of lipids (lipids) and their metabolic products in the blood and other tissues and organs, caused by congenital or acquired factors. Lipid metabolism includes the digestion and absorption of lipids in the small intestine, their entry into the bloodstream via the lymphatic system (through lipoprotein transport), their transformation in the liver, and their storage in adipose tissue, where they are utilized by tissues when needed. Lipid metabolism disorders include, but are not limited to: atherosclerosis, hyperlipidemia, chylomicron syndrome, familial chylomicronemia, hypertriglyceridemia, lipid storage diseases and their resulting clinical syndromes, obesity, ketoacidosis, fatty liver, and neonatal sclerema. Hyperlipidemia, also known as high blood lipids or dyslipidemia, typically refers to elevated levels of triglycerides (TG) and total cholesterol (TC) in plasma, elevated low-density lipoprotein (LDL-C), and decreased high-density lipoprotein (HDL-C).

[0013] Lipid metabolism disorders can also lead to a series of complications, such as diabetes, central obesity, hypercholesterolemia, hypertriglyceridemia, hypertension, polycystic ovary syndrome, hypothyroidism, and uremia; hypercholesterolemia can also lead to gout and xanthoma (subcutaneous cholesterol deposition).

[0014] Types of lipid-lowering drugs

[0015] Lipid-lowering drugs typically include fenofibrate, atorvastatin, and acilimus. Among them, atorvastatin belongs to the class of reductase inhibitors. It can reduce cholesterol synthesis and lower blood lipids by inhibiting the rate-limiting enzyme in the liver that synthesizes cholesterol. It has a strong lipid-lowering effect and a long duration of action. Studies have shown that 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) reductase inhibitors (statins) can reduce cardiovascular risk by about 50-60% and are widely used lipid-lowering drugs on the market.

[0016] Combination of lipid-lowering drugs

[0017] In recent trials, combination therapy with statins and PCSK9 inhibitors has been shown to effectively promote the regression of coronary atherosclerosis in patients with intermediate to high CVD risk. Both statins and PCSK9 inhibitors affect functional LDL receptors (LDLRs).

[0018] Some patients experience statin intolerance, while others lack sufficient functional LDL receptors (LDLR), resulting in inadequate responses to statins and PCSK9 inhibitors. This population requires novel treatment approaches. Since the effect of ANGPTL3 inhibition on lipid levels is independent of LDLR function, ANGPTL3 inhibitors may benefit patients with lipid metabolism disorders who do not respond adequately to statins or PCSK9 inhibitors, and further reduce the cardiovascular disease risk in patients already taking statins or PCSK9 inhibitors. Therefore, there is a need in this field for drugs with novel mechanisms of action, fewer side effects, and more effective treatment compared to existing clinical medications. Summary of the Invention

[0019] On the one hand, the present invention provides an RNA inhibitor for inhibiting ANGPTL3 gene expression or a pharmaceutically acceptable salt thereof.

[0020] An RNA inhibitor for inhibiting ANGPTL3 gene expression or a pharmaceutically acceptable salt thereof, the RNA inhibitor being formed by base pairing of a sense strand and an antisense strand of 15-30 nucleotides in length, preferably 19-23 nucleotides in length, wherein the antisense strand includes a region complementary to the mRNA encoding ANGPTL3, and wherein the complementary region includes at least 15 consecutive nucleotides differing from any antisense strand in Table 1 by 0, 1, 2, or 3 nucleotides.

[0021] The aforementioned RNA inhibitor for inhibiting ANGPTL3 gene expression or a pharmaceutically acceptable salt thereof, wherein the antisense strand includes a region complementary to the target sequence, the target sequence being: cucaacauauuugaucagucu SEQ ID NO: 42, ranging from position 270 to 290 in NM_014495.3, and there is at least 85% base complementarity between the sense and antisense strands.

[0022] The RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof, wherein the sense strand is selected from any one of SEQ ID NO: 1-SEQ ID NO: 156 or a sequence having the same at least 15 consecutive nucleotides, or a sequence differing from it by one, two or three nucleotides, and the antisense strand is selected from any one of SEQ ID NO: 157-SEQ ID NO: 312 or a sequence having the same at least 15 consecutive nucleotides, or a sequence differing from it by one, two or three nucleotides.

[0023] Preferably, the RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof has its antisense strand selected from the following sequences:

[0024] 5'agactgaucaaauauguugagcu 3' SEQ ID NO: 199;

[0025] 5'agacugaucaaauauguugagcu 3' SEQ ID NO: 198;

[0026] It may have a sequence that is identical to the antisense strand for at least 15 consecutive nucleotides, or a sequence that differs from the antisense strand by one, two, or three nucleotides.

[0027] Where g = guanylic acid, a = adenosine acid, u = uridine acid, c = cytidine acid, and t = thymine deoxyribonucleotide.

[0028] The aforementioned RNA inhibitors or their pharmaceutically acceptable salts, with the sense strand selected from the following sequences:

[0029] 5'cucaacauauuugaucagucu 3' SEQ ID NO: 42, 43;

[0030] It may have a sequence that is identical to the positive strand of at least 15 consecutive nucleotides, or a sequence that differs from the positive strand by one, two, or three nucleotides.

[0031] Where g = guanylic acid, a = adenosine acid, u = uridine acid, and c = cytidine acid.

[0032] The aforementioned RNA inhibitor or its pharmaceutically acceptable salt, having a sense strand of SEQ ID NO: 42 or a sequence having at least 15 consecutive nucleotides identical to it, or a sequence differing from it by one, two, or three nucleotides; and an antisense strand of SEQ ID NO: 198 or a sequence having at least 15 consecutive nucleotides identical to it, or a sequence differing from it by one, two, or three nucleotides:

[0033] Chain of Justice: 5'cucaacauauuugaucagucu 3' SEQ ID NO: 42;

[0034] Antonym: 5'agacugaucaaauauguugagcu 3' SEQ ID NO: 198;

[0035] Alternatively, the sense strand is SEQ ID NO.43 or a sequence having at least 15 consecutive nucleotides identical to it, or a sequence differing from it by one, two, or three nucleotides; and the antisense strand is SEQ ID NO.199 or a sequence having at least 15 consecutive nucleotides identical to it, or a sequence differing from it by one, two, or three nucleotides.

[0036] Chain of Justice: 5'cucaacauauuugaucagucu 3' SEQ ID NO: 43;

[0037] Antonym: 5'agactgaucaaauauguugagcu 3' SEQ ID NO: 199;

[0038] Where g = guanylic acid, a = adenosine acid, u = uridine acid, c = cytidine acid, and t = thymine deoxyribonucleotide.

[0039] The aforementioned RNA inhibitor or its pharmaceutically acceptable salt, wherein at least one nucleotide of the RNA inhibitor is modified.

[0040] The aforementioned RNA inhibitors or their pharmaceutically acceptable salts may be modified with the following modifications: 2'-fluorine modification, 2'-methoxy modification, thiophosphate modification, invAb modification, glycerol nucleotides, 3'-terminal deoxythymidine (dT) nucleotides, locked nucleotides, unlocked nucleotides, conformation-restricted nucleotides, restricted ethyl nucleotides, 2'-amino modified nucleotides, 2'-O-allyl modified nucleotides, 2'-C-alkyl modified nucleotides, 2'-hydroxy modified nucleotides, 2'-methoxyethyl modified nucleotides, 2'-O-alkyl modified nucleotides, 2'-phosphate modified or 2-O-(N-methylacetamide) modified nucleotides, morpholino nucleotides, aminophosphates, baseless nucleotides, baseless deoxynucleotides, nucleotides containing non-natural bases, tetrahydropyran modified nucleotides, 1,5-dehydrohexyl alcohol modified nucleotides, cyclohexenyl modified nucleotides, methylphosphonate modification, 5'-phosphate modification, 5'-phosphate analog modification, heat-labile nucleotides, and one or more combinations of nucleotide analogs.

[0041] The aforementioned RNA inhibitor or its pharmaceutically acceptable salt, wherein the sense strand is selected from any one of SEQ ID No:313-SEQ ID No:477 or a sequence having at least 15 consecutive nucleotides identical to it, or a sequence differing from it by one, two or three nucleotides, and the antisense strand is selected from any one of SEQ ID No:478-SEQ ID No:642 or a sequence having at least 15 consecutive nucleotides identical to it, or a sequence differing from it by one, two or three nucleotides.

[0042] Preferably, the aforementioned RNA inhibitor or its pharmaceutically acceptable salt has an antisense strand selected from the following sequences:

[0043] 5'AsfGsAfCUfGAfUCAAAUfAUfGUfUGAfGsCsU 3' SEQ ID NO: 519;

[0044] 5'AsdGsACTGdAUCAAdAUfAUGUUGAGsCsU 3' SEQ ID NO: 520

[0045] Wherein, G = 2'-O-methylguanosine, A = 2'-O-methyladenosine, U = 2'-O-methyluridine, C = 2'-O-methylcytidine; Gs = 2'-O-methyl-3'-thioguanosine, As = 2'-O-methyl-3'-thioadenosine, Cs = 2'-O-methyl-3'-thiocytidine; fG = 2'-fluoroguanosine, fA = 2'-fluoroadenosine, fU = 2'-fluorouridine, fC = 2'-fluorocytidine; fGs = 2'-fluoro-3'-thioguanosine, T = 2'-O-methyldeoxythymidine, dA = 2'-deoxy-adenosine, dG = 2'-deoxy-guanosine.

[0046] The aforementioned RNA inhibitors or their pharmaceutically acceptable salts, with the sense strand selected from the following sequences:

[0047] 5'CsUsCAACAUfAfUfUUGAUCAGUsCsU 3' SEQ ID NO: 354;

[0048] 5'CsUsCAACAUfAfUfUUGAUCAGUsCsU 3' SEQ ID NO: 355;

[0049] Wherein, G = 2'-O-methylguanosine, A = 2'-O-methyladenosine, U = 2'-O-methyluridine, C = 2'-O-methylcytidine; Gs = 2'-O-methyl-3'-thioguanosine, As = 2'-O-methyl-3'-thioadenosine, Us = 2'-O-methyl-3'-thiouridine, Cs = 2'-O-methyl-3'-thiocytidine; fG = 2'-fluoroguanosine, fA = 2'-fluoroadenosine, fU = 2'-fluorouridine, fC = 2'-fluorocytidine.

[0050] The aforementioned RNA inhibitor or its pharmaceutically acceptable salt, having a sense strand of SEQ ID NO: 354 or a sequence differing from it by one, two, or three nucleotides, and an antisense strand of SEQ ID NO: 519 or a sequence differing from it by one, two, or three nucleotides:

[0051] Chain of Justice: 5'CsUsCAACAUfAfUfUUGAUCAGUsCsU 3' SEQ ID NO: 354;

[0052] Antonym: 5'AsfGsAfCUfGAfUCAAAUfAUfGUfUGAfGsCsU 3' SEQ ID NO: 519;

[0053] Alternatively, the sense strand is SEQ ID NO: 355 or a sequence differing from it by one, two, or three nucleotides, and the antisense strand is SEQ ID NO: 520 or a sequence differing from it by one, two, or three nucleotides:

[0054] Chain of Justice: 5'CsUsCAACAUfAfUfUUGAUCAGUsCsU 3' SEQ ID NO: 355;

[0055] Antonym: 5'AsdGsACTGdAUCAAdAUfAUGUUGAGsCsU 3' SEQ ID NO: 520;

[0056] Wherein, G = 2'-O-methylguanosine, A = 2'-O-methyladenosine, U = 2'-O-methyluridine, C = 2'-O-methylcytidine; Gs = 2'-O-methyl-3'-thioguanosine, As = 2'-O-methyl-3'-thioadenosine, Us = 2'-O-methyl-3'-thiouridine, Cs = 2'-O-methyl-3'-thiocytidine; fG = 2'-fluoroguanosine, fA = 2 '-Fluoroadenosine, fU = 2'-fluorouridine, fC = 2'-fluorocytidine; fGs = 2'-fluoro-3'-thioguanosine, fAs = 2'-fluoro-3'-thioadenosine, fUs = 2'-fluoro-3'-thiouridine, fCs = 2'-fluoro-3'-thiocytidine, T = 2'-O-methyldeoxythymidine, Ts = 2'-O-methyl-3'-thiodeoxythymidine, dA = 2'-deoxy-adenosine.

[0057] In some embodiments, the sense or antisense strand of the RNA inhibitor of the present invention may accommodate no more than three mismatched nucleotides, for example, in 5, 4, 3 or 2 nucleotides at the 5' end and / or 3' end.

[0058] In the preferred embodiment, the RNA inhibitor of the present invention or its pharmaceutically acceptable salt further comprises carrier structures 5'MVIP and 3'MVIP, and the structure of the RNA inhibitor is shown in formula Ia, Ib or Ic:

[0059] in,

[0060] The carrier structure includes a 5'MVIP (5'MultiValent Import Platform) and a 3'MVIP (3'MultiValent Import Platform);

[0061] 5'MVIP consists of a transition point R1, a linker chain D, a connector B, a branch chain L, and a liver-targeting specific ligand X. It is connected to the 5' end of the sense strand or the 5' end of the antisense strand via the transition point R1, and its structure is shown in general formula I: (XL) n -BD-R1- I

[0062] 3'MVIP consists of a transition point R2, a linker chain D, a connector B, a branch chain L, and a liver-targeting specific ligand X. It is connected to the 3' end of the sense strand or the 3' end of the antisense strand via the transition point R2, and its structure is shown in general formula II: (XL) m -BD-R2- II

[0063] in,

[0064] n and m are each an independent integer from 0 to 4, preferably an integer from 1 to 3, and n+m = an integer from 2 to 6, preferably n+m = 2, 3 or 4, more preferably 4;

[0065] Transition point R1 is a heterocyclic or carbide ring structure containing N, S, or O, as shown below:

[0066] Alternatively, R1 can be -NH(CH2). x CH2O-, where x is any integer from 3 to 12, preferably any integer from 4 to 6;

[0067] Transition point R2 is a heterocyclic or carbide ring structure containing N, S, or O, as shown below:

[0068] Alternatively, the transition point R2 can be -NH(CH2). x1 CH(OH)(CH2) x2 CH2O-, where x1 is any integer from 1 to 4, and x2 is any integer from 0 to 4;

[0069] The liver-targeting specific ligand X is selected from structures used to enhance the uptake of RNA inhibitors by hepatocytes, and is the same or different within each of 5'MVIP and 3'MVIP, or between 5'MVIP and 3'MVIP. It is selected from monosaccharides and their derivatives, preferably N-acetylgalactosamine and its derivatives, and more preferably from the following structures:

[0070] Wherein, W is selected from -OH, -NHCOOH, and -NHCO(CH2). q One or two of CH3, where q is an integer from 0 to 4;

[0071] The branch L may be the same or different within each of the 5'MVIP and 3'MVIP, or between the 5'MVIP and 3'MVIP, and is selected from one or more of the following structures:

[0072] Where r1 is any integer from 1 to 12, r2 is any integer from 0 to 20, and Z is H, alkyl or amide group, such as C1-C5 alkyl groups;

[0073] Connector B may be the same or different within each of the 5'MVIP and 3'MVIP, or between the 5'MVIP and 3'MVIP, and may be selected from the following structures:

[0074] Wherein, A1 and A2 are each independently C, O, S, -NH-, carbonyl, amide, phosphoryl or thiophosphoryl, and r is any integer from 0 to 4;

[0075] The connecting chain D may be the same or different within each of the 5'MVIP and 3'MVIP, or between the 5'MVIP and 3'MVIP, and it is selected from the following structures:

[0076] In this context, each p is an independent integer from 1 to 20; s is an arbitrary integer from 2 to 13; Z1 and Z2 are the same or different substituent groups, such as C3-C. 10 alkyl.

[0077] In some implementations, 5'MVIP is selected from any one of 5'MVIP01 to 5'MVIP22 in Table 11.

[0078] In some implementations, 3'MVIP is selected from any one of 3'MVIP01 to 3'MVIP27 in Table 12.

[0079] In some embodiments, the RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof, wherein the 5'MVIP is 5'MVIP01 or 5'MVIP09 as shown below, and the 3'MVIP is 3'MVIP01, 3'MVIP09 or 3'MVIP17 as shown below:

[0080] In some embodiments, the RNA inhibitor of the present invention, or a pharmaceutically acceptable salt thereof, wherein the combination of the sense strand 5'MVIP and the antisense strand 3'MVIP is 5'MVIP01 / 3'MVIP01, 5'MVIP01 / 3'MVIP17, or 5'MVIP09 / 3'MVIP09, or the combination of the sense strand 5'MVIP and the sense strand 3'MVIP is 5'MVIP01 / 3'MVIP09 or 5'MVIP09 / 3'MVIP01.

[0081] On the other hand, the RNA inhibitors are selected from Kylo-10-DS1621 and Kylo-10-DS1631.

[0082] On the other hand, the use of the RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof in the preparation of medicaments for treating and / or preventing diseases associated with elevated ANGPTL3 levels, including but not limited to lipid metabolism disorders.

[0083] On the other hand, a pharmaceutical composition comprising the aforementioned RNA inhibitor or other therapeutic agents for the treatment or prevention of ANGPTL3-related diseases.

[0084] On the other hand, a pharmaceutical composition comprising the aforementioned RNA inhibitor or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient, wherein the dosage form is an oral, intravenous, or subcutaneous or intramuscular injection, preferably a subcutaneous injection.

[0085] Other aspects and advantages of this application will readily be apparent to those skilled in the art from the detailed description below. Only exemplary embodiments of this application are shown and described in the following detailed description. As will be appreciated by those skilled in the art, the content of this application enables them to make modifications to the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application pertains. Accordingly, the descriptions in the accompanying drawings and specification of this application are merely exemplary and not restrictive. Attached Figure Description

[0086] The specific features of the invention involved in this application are shown in the appended claims. The features and advantages of the invention can be better understood by referring to the exemplary embodiments and accompanying drawings described in detail below.

[0087] A brief description of the attached figures is as follows:

[0088] Figure 1 is a high-resolution mass spectrum of ERCd-01-c2 synthesized in 3.1.15 of Example 3 of this application;

[0089] Figure 2 is a high-resolution mass spectrum of 3'MVIP17-c1 synthesized in 3.1.2.6 of Example 3 of this application;

[0090] Figure 3 is a high-resolution mass spectrum of 5'MVIP09-ERCd-PFP-c2 synthesized in 3.2.1.2 of Example 3 of this application;

[0091] Figure 4 shows the inhibitory effect of RNA inhibitor on ANGPTL3 in the serum of transgenic mice after administration of RNA inhibitor in Example 7 of this application;

[0092] Figure 5 shows the LDL-C detection results of the RNA inhibitor Kylo-10-DS1621 in Example 8-1 of this application;

[0093] Figure 6 shows the changes in serum lipid (LDL-C) levels of the RNA inhibitor Kylo-10-DS1621 in Example 8-1 of this application;

[0094] Figure 7 shows the blood lipid (HDL-C) detection results of the RNA inhibitor Kylo-10-DS1621 in Example 8-1 of this application;

[0095] Figure 8 shows the changes in serum lipid (HDL-C) levels of the RNA inhibitor Kylo-10-DS1621 in Example 8-1 of this application;

[0096] Figure 9 shows the blood lipid (TG) detection results of the RNA inhibitor Kylo-10-DS1621 in Example 8-1 of this application;

[0097] Figure 10 shows the changes in serum lipid (TG) levels of the RNA inhibitor Kylo-10-DS1621 in Example 8-1 of this application;

[0098] Figure 11 shows the ANGPTL3 detection results of the RNA inhibitor Kylo-10-DS1621 in Example 8-1 of this application;

[0099] Figure 12 shows the ANGPTL3 detection results of the RNA inhibitor Kylo-10-DS1621 in Example 8-1 of this application;

[0100] Figure 13 shows the blood lipid (TC) detection results of the RNA inhibitor Kylo-10-DS1631 in Example 8-2 of this application;

[0101] Figure 14 shows the changes in serum lipid (TC) levels of the RNA inhibitor Kylo-10-DS1631 in Examples 8-2 of this application;

[0102] Figure 15 shows the LDL-C detection results of the RNA inhibitor Kylo-10-DS1631 in Examples 8-2 of this application;

[0103] Figure 16 shows the changes in serum lipid (LDL-C) levels of the RNA inhibitor Kylo-10-DS1631 in Examples 8-2 of this application;

[0104] Figure 17 shows the blood lipid (HDL-C) detection results of the RNA inhibitor Kylo-10-DS1631 in Examples 8-2 of this application;

[0105] Figure 18 shows the changes in serum lipid (HDL-C) levels of the RNA inhibitor Kylo-10-DS1631 in Examples 8-2 of this application;

[0106] Figure 19 shows the blood lipid (TG) detection results of the RNA inhibitor Kylo-10-DS1631 in Examples 8-2 of this application;

[0107] Figure 20 shows the changes in serum lipid (TG) levels of the RNA inhibitor Kylo-10-DS1631 in Examples 8-2 of this application;

[0108] Figure 21 shows the ANGPTL3 detection results of the RNA inhibitor Kylo-10-DS1631 in Example 8-2 of this application;

[0109] Figure 22 shows the ANGPTL3 detection results of the RNA inhibitor Kylo-10-DS1631 in Example 8-2 of this application. Detailed Implementation

[0110] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification.

[0111] Terminology Definition

[0112] In this application, the term "angiopoietin-like protein 3" may be used interchangeably with the term "ANGPTL3," and examples of ANGPTL3 mRNA sequences are readily available from publicly available databases, such as GenBank, UniProt, OMIM, and the Macaca Genome Project website. The term "ANGPTL3" includes human ANGPTL3, whose mRNA sequences are available, for example, in GenBank NM_014495.3 and GenBank NM_014495.4; mouse ANGPTL3 mRNA GenBank accession number NM_013913.3; rat ANGPTL3 mRNA GenBank accession number NM_001025065.1; cynomolgus monkey ANGPTL3 mRNA GenBank accession number XM_005543185.2; and rhesus monkey ANGPTL3 mRNA GenBank accession number XM_001086114.2.

[0113] In this application, a "target sequence" refers to a continuous portion of the nucleotide sequence of the mRNA molecule formed during the transcription of the ANGPTL3 gene, including mRNA as a product of RNA processing of the primary transcript. In some embodiments, the target portion of the sequence will be at least long enough to serve as a substrate for RNA inhibitor-guided degradation at or near said portion of the nucleotide sequence of the mRNA molecule formed during the transcription of the ANGPTL3 gene. The length of the "target sequence" is typically about 15-30 nucleotides.

[0114] In this application, the term "RNA inhibitor" generally refers to an agent comprising RNA as defined in the terminology of this invention, which mediates targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. The expression of the ANGPTL3 gene in cells (e.g., cells in subjects such as mammalian subjects) is regulated (e.g., inhibited) via a process called RNA repression, which directs sequence-specific degradation of mRNA.

[0115] In some implementations, the RNA inhibitor may be a single-stranded siRNA (ssRNA inhibitor) introduced into cells or organisms to inhibit the target mRNA (i.e., the ANGPTL3 gene). The single-stranded RNA inhibitor binds to the RISC endonuclease Argonaute 2, which then cleaves the target mRNA. The single-stranded siRNA is typically 15 to 30 nucleotides in length and is chemically modified.

[0116] In some embodiments, the "RNA inhibitor" used in this application is double-stranded RNA, and is referred to herein as a "double-stranded RNA inhibitor," "double-stranded RNA (dsRNA, DS) molecule," "dsRNA agent," or "dsRNA." The term "dsRNA" refers to a complex of ribonucleic acid molecules having a double-stranded structure comprising two antiparallel and substantially complementary nucleic acid strands, described as having "sense" and "antisense" orientations relative to the target mRNA. In some embodiments of this application, double-stranded RNA (dsRNA) triggers the degradation of the target mRNA through a post-transcriptional gene silencing mechanism (referred to herein as RNA inhibition or RNA interference).

[0117] The double-stranded structure can be of any length that triggers the specific degradation of ANGPTL3 mRNA via the RISC pathway, and can be in the length range of about 15 to 36 base pairs, for example, about 15-30 base pairs, for example, about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or 36 base pairs. In some embodiments, the RNA inhibitor of this application is a 15-30 nucleotide dsRNA that interacts with the target sequence to guide the cleavage of ANGPTL3 mRNA.

[0118] Typically, the sense and antisense strands of dsRNA molecules are predominantly ribonucleotides, but as detailed in this invention, they may also include one or more non-ribonucleotides, such as deoxyribonucleotides or modified nucleotides. Furthermore, the RNA inhibitors described herein may include chemically modified ribonucleotides, which may have modifications in multiple regions. As used herein, the term "modified nucleotide" refers to a nucleotide that independently has a modified sugar moiety, modified internucleotide linkages, or modified nucleobases, or any combination thereof. Therefore, the term "modified nucleotide" encompasses substitutions, additions, or removals of, for example, functional groups or atoms, of internucleotide linkages, sugar moieties, or nucleobases. Modifications applicable to the RNA inhibitors of this application include all types of modifications disclosed herein or known in the art.

[0119] In this application, the term "nucleotide sequence" generally refers to a series or sequence of nucleotides, whether modified or unmodified, described by a series of letters using standard nucleotide nomenclature and the symbol table of modified nucleotides described in this application. The nucleotide sequences described in this application are polymers composed of phosphodiester bonds (or their associated structural variants or synthetic analogs), including naturally occurring nucleotide polymers, but it should be understood that the scope of this term also includes various analogs, including but not limited to: peptide nucleic acids (PNAs), aminophosphates, thiophosphates, methylphosphonates, and 2'-O-methylribonucleic acid. Typically, there are about 15-30 nucleotides, but the term can also refer to molecules of any length.

[0120] In some embodiments, the nucleotide sequence comprises one or more unmodified ribonucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleotides. The term "modified nucleotide sequence" generally refers to a sequence of nucleotides containing at least one modification and / or at least one modified nucleotide linked together.

[0121] In this application, the term "modified nucleotide" generally refers to a nucleotide that contains at least one chemical modification compared to a naturally occurring RNA or DNA nucleotide. Examples include nucleotides modified with 2'-deoxy-thymidine 2'-O-methyl, 2'-fluoro, 2'-deoxy-, locked nucleotides, debased nucleotides, 2'-amino-, 2'-O-long-chain alkyl- (e.g., hexadecyl), morpholinonucleotides, aminophosphate nucleotides, non-natural nucleobase nucleotides, 5'-thiophosphate nucleotides, and nucleotides linked to cholesterol derivatives or dodecanoic acid didecylamide groups.

[0122] The modified nucleotides contain modified sugar groups and / or modified nucleobases.

[0123] In this application, the term "nucleobase" or "base" generally refers to a heterocyclic pyrimidine or purine compound, which is a component of all nucleic acids and includes adenine, guanine, cytosine, thymine, and uracil. Nucleotides may include modified nucleotides or nucleotide analogs, abasics, or substitutes. The term "unmodified nucleobase" or "naturally occurring nucleobase" generally refers to naturally occurring heterocyclic nucleobases in RNA or DNA: purine bases adenine and guanine; and pyrimidine bases thymine, cytosine, and uracil. "Modified nucleobase" generally refers to any nucleobase that is not naturally occurring.

[0124] In this application, the term "glycosyl" generally means a naturally occurring glycosyl or modified glycosyl of a nucleotide. The term "naturally occurring glycosyl" generally means a furanose ribosyl, such as that found in naturally occurring RNA, or a deoxyfuranose ribosyl, such as that found in naturally occurring DNA. "Modified glycosyl" means a substituted glycosyl or sugar substitute, such as a fluorinated or methoxy substitution at the 2' position of the glycosyl group.

[0125] In this application, the term "nucleotide link" generally refers to a covalent link between adjacent nucleotides in a nucleotide sequence. "Naturally occurring nucleotide link" refers to a 3' to 5' phosphodiester link. "Modified nucleotide link" refers to any nucleotide link other than a naturally occurring nucleotide link.

[0126] In this application, the term "antisense strand" (AS) generally refers to a strand of an RNA inhibitor (e.g., dsRNA) that includes a region substantially complementary to the target sequence. When used in this invention, the term "complementary region" generally refers to a region on the antisense strand that is substantially complementary to a sequence (e.g., the target sequence) as defined in this application.

[0127] In this application, the term "sense strand" (S) generally refers to a strand of an RNA inhibitor (e.g., dsRNA) that includes regions substantially complementary to the regions of the "antisense strand" (AS). The "sense strand" is sometimes referred to as the "sense" strand, the "passenger" strand, or the "antiguide" strand. Using the sequence of the sense strand, the antisense strand targets the desired mRNA, while the sense strand may target different targets or be degraded. Therefore, if the antisense strand is incorporated into a RISC, the correct target is targeted. Incorporation of the sense strand can lead to off-target effects. These off-target effects can be limited by using modifications on the sense strand or by using a 5' cap.

[0128] For siRNA double-stranded loading into an AGO protein, it must first be initiated by recognition at the 5' end of the antisense strand. This is a prerequisite for placing the remaining portion of the double strand into the AGO protein's nucleic acid binding channel. The MID domain of the AGO protein recognizes the nucleotide at the 5' end. After recognition, the siRNA double-stranded loading into the AGO protein's nucleic acid binding channel forms the pre-RISC. After loading the siRNA double-stranded loading into the nucleic acid binding channel, the pre-RISC releases the sense strand (passenger strand), which, together with the remaining antisense strand (guide strand), forms the RISC.

[0129] In this application, the term "complementarity" refers to the ability of two nucleotide sequences to hybridize under certain conditions, forming base pair hydrogen bonds and thus a double-stranded or double-helix structure. This includes hybridization of the antisense strand of an RNA inhibitor with the sense strand of an RNA inhibitor or ANGPTL3 mRNA to form Watson-Crick base pairs or non-Watson-Crick base pairs, and includes native or modified nucleotides or nucleotide analogs. "Complementarity" does not necessarily mean nucleobase complementarity on every nucleotide. Instead, some mismatches can be tolerated.

[0130] In this application, the term "mismatch" refers to a mismatch that occurs when the complementary region is not perfectly complementary to the target sequence. Mismatches can occur in the core region or the terminal region. Typically, the most permissible mismatches are in the terminal region, for example, within 5, 4, 3, or 2 nucleotides at the 5' and / or 3' ends, and no more than 3 mismatches.

[0131] For example, the research results of Gu S, Jin L, Zhang F, Huang Y, Grimm D, Rossi JJ, Kay MA. Thermodynamic stability of small hairpin RNAs highly influences the loading process of different mammalian Argonautes. Proc Natl Acad Sci USA 2011, 108:92089213. indicate that any factor affecting the thermodynamic stability of double strands, such as mismatches and non-Watson-Crick base pairs, is conducive to the expulsion of the sense strand from pre-RISC to form RISC.

[0132] In this application, the term "ligand" generally refers to any compound or molecule capable of covalently or otherwise chemically binding to a biologically active substance (such as dsRNA). In some embodiments, the ligand is capable of interacting directly or indirectly with another compound, such as a receptor. The receptor interacting with the ligand may be present on the cell surface, or alternatively may be an intracellular and / or intercellular receptor. The interaction between the ligand and the receptor may result in a biochemical reaction, or may simply be a physical interaction or binding.

[0133] In this application, the term "pharmaceutically acceptable" generally refers to one or more non-toxic substances that do not inhibit the effectiveness of the biological activity of the active ingredient. Such formulations typically contain salts, excipients, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. These pharmaceutically acceptable formulations may also typically contain compatible solid or liquid fillers, diluents, or encapsulation materials suitable for human administration. When used in medicine, the salt should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts can be conveniently used to prepare pharmaceutically acceptable salts, and these should not be excluded from the scope of this application. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, boric acid, formic acid, malonic acid, succinic acid, etc. Pharmaceutically acceptable salts can also be prepared as alkali metal salts or alkaline earth metal salts, such as sodium, potassium, or calcium salts.

[0134] In this application, the term "lipid nanoparticle" or "LNP" generally refers to a vesicle containing a lipid layer encapsulating a pharmacologically active molecule (e.g., dsRNA). LNPs are described, for example, in Chinese Patent No. CN103189057B, the entire contents of which are incorporated herein by reference.

[0135] Invention Details

[0136] On the one hand, the present invention provides an RNA inhibitor for inhibiting ANGPTL3 gene expression or a pharmaceutically acceptable salt thereof.

[0137] siRNA design

[0138] A group of siRNAs targeting the human ANGPTL3 gene (human: NCBI refseq ID NM_014495.3, NCBI refseq ID NM_014495.4) were screened using a self-designed sequence screening software.

[0139] Unmodified primary sequences are shown in Table 1. Modified secondary sequences are shown in Table 2.

[0140] siRNA synthesis: siRNA was synthesized and annealed using conventional methods known in the art.

[0141] In some embodiments, the double-stranded structure (complementary region) formed by the antisense strand and the sense strand includes at least 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides.

[0142] In some embodiments, the sense strand of the RNAi agent is substantially homologous to the target sequences in Table 1.

[0143] Table 1 Primary Sequence

[0144] Where n is a, u, g, or c, g = guanylic acid, a = adenosine acid, u = uridine acid, c = cytidine acid, and t = thymine deoxyribonucleotide.

[0145] In some screening implementations, the sense and antisense strands of the RNAi agent are selected from the sequences in Table 1 or differ from each of the sequences in Table 1 by one, two, or three nucleotides.

[0146] In some implementations, the base pairs of the sense strand and the corresponding antisense strand in Table 1 are complementary to form dsRNA, which can be partially or completely complementary. The partial complementarity can be at least 85% base pairing.

[0147] In some implementations, the combination of the justice chain and the antisense chain is not limited to the two-chain combination in Table 1. One of the justice chains in Table 1 can be paired with any antisense chain.

[0148] This invention aims to protect the core sequences of the sequences in Table 1. The core sequence is any segment of the above sequences that is at least 15 consecutive nucleotides, where at least 15 refers to 15, 16, 17, 18, 19, 20, 21, 22, 23, etc. In some embodiments, the sense strand is as shown in formula (1): 5′-X core sequence Y-3′, and the antisense strand and sense strand have at least 85% base complementarity. X and Y contain 0, 1, 2, 3, 4, 5, and 6 nucleotides, and 0, 1, 2, and 3 unpaired bases are allowed at the terminal positions of the double strand.

[0149] The antisense strand contains consecutive nucleotides that differ from formula (2) by 0, 1, 2 or 3 nucleotides. Formula (2): 5′-X' core sequence Y'-3′. There is at least 85% base complementarity between the antisense strand and the sense strand. X' and Y' contain 0, 1, 2, 3, 4, 5 or 6 nucleotides. 0, 1, 2 or 3 unpaired bases are allowed at the end positions of the double strand.

[0150] As one example, the core sequence allows for 0, 1, 2, or 3 nucleotide differences, which can be base pairs formed according to the Watson-Crick principle or mismatches.

[0151] In some embodiments, the RNA inhibitor can be administered to cell lines for sequence screening via cell transfection methods or liposome-nucleic acid nanoparticles, as is well known to those skilled in the art. The full text of patents US9233971B2, US9080186B2, CN102985548B, and CN103189057B relating to lipid compounds and methods for preparing liposome-nucleic acid nanoparticles is incorporated herein by reference.

[0152] In some embodiments, the amphoteric lipids in the lipid compounds are preferably macrocyclic lipid compounds D1C1, T1C1, T1C6, T4C4, B2C1, B2C6, B2C7 and M10C1.

[0153] It is well known to those skilled in the art that dsRNAs with a double-stranded structure of about 20 to 23 base pairs, for example, 21 base pairs, have been considered to induce RNA repression particularly effectively (Elbashir et al., EMBO 2001, 20: 6877-6888). However, others have found that shorter or longer RNA double-stranded structures are also effective (Chu and Rana (2007) RNA 14: 1714-1719; Kim et al. (2005) Nat Biotech 23: 222-226). It is reasonable to expect that double-stranded structures derived from a sequence in Tables 1 and 2 by subtracting or adding a few nucleotides at one or both ends could be similarly effective compared to the dsRNAs described above. Therefore, any dsRNA having a sequence of at least 15, 16, 17, 18, 19, 20, 21 or more consecutive nucleotides derived from one of the sequences in Tables 1 and 2, and whose ability to suppress ANGPTL3 gene expression differs from that of a dsRNA containing the full sequence by no more than about 5, 10, 15, 20, 25 or 30% in terms of suppression.

[0154] The dsRNA described in this application may further include one or more single-stranded nucleotide overhangs, for example, 1, 2, 3, or 4 nucleotides. The nucleotide overhangs may comprise nucleotide / nucleoside analogs or combinations thereof, including deoxynucleotides. The overhang may be on the sense strand, antisense strand, or a combination thereof. Furthermore, the overhanging nucleotides may be present at the 5' end, 3' end, or both ends of the antisense strand or sense strand of the dsRNA. The overhang may be formed by one strand being longer than the other, or by two strands of equal length interleaved. When the overhang is on the antisense strand, it may form a mismatch or complement with ANGPTL3 mRNA or may be another sequence. For example, the overhang may be located at the 3' end of the sense strand, or alternatively, at the 3' end of the antisense strand.

[0155] The dsRNA can also have blunt ends, which means that there are no unpaired nucleotides at that end of the dsRNA, i.e., no nucleotide overhangs. The blunt ends can be located at the 5' end of the antisense strand and the 3' end of the sense strand, or vice versa, or a double-ended blunt body, which is a double-stranded dsRNA along its entire length, i.e., there are no nucleotide overhangs at either end of the molecule.

[0156] In some embodiments, the sense or antisense strand of the dsRNA has a nucleotide overhang at the 3' end containing 1, 2, 3, or 4 nucleotides, while the 5' end is blunt.

[0157] In some implementations, the overhang is present at the 3' end of both the sense and antisense strands, and the overhang contains 1, 2, 3 or 4 nucleotides, including but not limited to TT, UU, AU or UA.

[0158] In some embodiments, the dsRNA is a double-ended blunt-ended form of 19, 21, or 23 nucleotides in length, which is a double-stranded dsRNA throughout its length, i.e., without any nucleotide overhangs at either end of the molecule.

[0159] In some embodiments, the dsRNA has a length of 21 nucleotides, and both the sense and antisense strands have a 2-nucleotide overhang at the 3' end.

[0160] To enhance the in vivo stability of the RNA inhibitor described in this application, without affecting or even enhancing its activity, the sense and antisense strands of the RNA inhibitor can be modified. The nucleotides may have modifying groups, and the entire strand or parts of the strand may be modified. In some embodiments, one or more nucleotides on the sense and / or antisense strands are modified to form modified nucleotides.

[0161] In some embodiments, the sense and antisense strands of the RNA inhibitor (e.g., dsRNA) described in this application are unmodified. In other embodiments, the sense and antisense strands of the RNA inhibitor described in this application are chemically modified or coupled using methods known in the art and described in this invention to enhance stability or other advantageous properties. In other embodiments of this application, all or substantially all nucleotides of the RNA inhibitor described in this application may be modified, i.e., the RNA inhibitor strand contains no more than 5, 4, 3, 2, or 1 unmodified nucleotides.

[0162] The sense and antisense strands of the RNA inhibitors described in this application can be synthesized and / or modified using methods known in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, SL et al. (eds.), John Wiley & Sons, Inc., New York, NY, USA, which are incorporated herein by reference. In the RNA inhibitors provided in this application, neither the sense nor antisense strands require uniform modification; one or more modifications can be incorporated into individual nucleotides.

[0163] In some implementations, nucleotide modifications include: 5' end modified nucleotides, 3' end modified nucleotides, base modifications, sugar modifications or sugar substitutions, and backbone modifications. 5' end modifications refer to phosphorylation, coupling, and reverse linkage. 3' end modifications refer to coupling, DNA nucleotides, reverse linkage, etc.; base modifications refer to: replacing, removing (without bases), or conjugating bases with stable bases, destabilizing bases, or bases paired with bases from an expanded partner library. Sugar modifications are generally at the 2' or 4' position. Backbone modifications refer to: modifications or substitutions of phosphodiester bonds.

[0164] Specific nucleotide modifications may include, but are not limited to: 5'-terminal phosphorus-containing nucleotide modifications, vinylphosphonate deoxyribonucleotides, vinylphosphonate-containing nucleotides and cyclopropylphosphonate-containing nucleotides, 3'-terminal deoxythymidine (dT) nucleotides, 2'-O-methyl modified nucleotides, 2'-fluorine modified nucleotides, 2'-deoxy modified nucleotides, 2'-amino modified nucleotides, 2'-O-allyl modified nucleotides, 2'-C-alkyl modified nucleotides, 2'-hydroxy modified nucleotides, 2'-methoxyethyl modified nucleotides, 2'-O-alkyl modified nucleotides, 2-O-(N-methylacetamide) modified nucleotides, and 3'-O-methoxy... (2'-nucleotide linker) nucleotide, 2'-F-arabinonucleotide, 5'-Me / 2'-fluoronucleotide, locked nucleotide, unlocked nucleotide, unlocked nucleobase analog, conformation-restricted nucleotide, restricted ethyl nucleotide, baseless nucleotide, morpholinonucleotide, aminophosphate, nucleotide containing non-natural base, tetrahydropyran-modified nucleotide, 1,5-dehydrohexanol-modified nucleotide, cyclohexenyl-modified nucleotide, nucleotide containing methylphosphonate group, heat-labile nucleotide, GNA, deoxyribonucleotide, nucleotide analog, morpholinonucleotide, debaseted nucleotide, 3' to 3' linked (inverted) nucleotide, bridging nucleotide, peptide nucleic acid (PNA).

[0165] The 5'-terminal phosphorus-containing nucleotide modification can be a 5'-phosphate nucleotide or a nucleotide containing a 5'-phosphate analogue, or a deoxynucleotide; having, but not limited to: 5'-terminal phosphate ester (5'-P), 5'-terminal thiophosphate ester (5'-PS), 5'-terminal thiophosphate diester (5'-PS2), 5'-terminal vinylphosphonate (5'-VP), 5'-terminal methylphosphonate (MePhos), or 5'-deoxy-5'-C-malonyl. When the 5'-terminal phosphorus-containing group is a 5'-terminal vinylphosphonate (5'-VP), 5'-VP can be a 5'-E-VP isomer (i.e., trans-vinylphosphonate), a 5'-Z-VP isomer (i.e., cis-vinylphosphate), or a mixture thereof.

[0166] Modifications between nucleotides may include, but are not limited to: thiophosphates, chiral thiophosphates, dithiophosphates, phosphate triesters, aminoalkyl phosphate triesters, alkyl phosphonates, hypophosphonates, aminophosphates, thiocarbonylphosphonamide esters, thiocarbonylalkyl phosphonates, thiocarbonylalkyl phosphate triesters, borane phosphates, and also include various salts and free acids.

[0167] Terminal modifications of the sense or antisense strand can prevent exonuclease degradation and enhance nuclease stability. For example, cap structures include inverted deoxy abasiccaps (invAbs). InvAbs are well-known in the field, and specific performance verification can be found in F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16.

[0168] In some embodiments, the 2' position of the nucleotide glycosyl group at at least two or more even-numbered positions starting from the 5' end of the antisense strand is fluorine.

[0169] In some embodiments, the 2' positions of the even-numbered nucleotide glycosyl groups starting at the 5' end of the antisense strand are all fluorinated.

[0170] In some embodiments, at least one of the 2' positions of the nucleotide glycosyl groups at positions 2, 4, 6, 8, 12, and 14 starting from the 5' end of the antisense strand is fluorine. For example, the 2' positions of the nucleotide glycosyl groups at positions 2, 4, 6, 8, 12, and 14 starting from the 5' end of the antisense strand are all fluorine.

[0171] In some embodiments, the antisense strand has at least one methoxy group at the 2' position of the nucleotide glycosyl group, except for the nucleotides at positions 2, 6, 8, 10, 14, and 16 starting from the 5' end.

[0172] In some embodiments, the antisense strand has at least one methoxy group at the 2' position of the nucleotide glycosyl group, except for the nucleotides at positions 2, 4, 6, 8, 14, and 16 starting from the 5' end.

[0173] In some embodiments, the antisense strand, except for the nucleotides at positions 2, 4, 6, 8, 14, 16, 18, and 20 starting from the 5' end, has at least one methoxy group at the 2' position of the remaining nucleotide glycosyl group.

[0174] In some embodiments, at least two or more nucleotide sugars at the 2' position of the odd-numbered position starting at the 5' end of the positive strand are fluorine.

[0175] In some embodiments, the 2' positions of the nucleotide sugars at the odd-numbered positions starting at the 5' end of the positive strand are all fluorine.

[0176] In some embodiments, at least one of the 2' positions of the 5th, 7th, 8th, and 9th nucleotide sugars starting from the 5' end of the positive strand is fluorine. For example, the 2' positions of the 5th, 7th, 8th, and 9th nucleotide sugars starting from the 5' end of the positive strand are all fluorine.

[0177] In some embodiments, except for the 5th, 7th, 8th, and 9th nucleotides starting at the 5' end, at least one of the 2' positions of the remaining nucleotide glycosyl groups is a methoxy group.

[0178] In some embodiments, at least one of the 2' positions of the 7th, 9th, 10th, and 11th nucleotide glycosyl positions starting from the 5' end of the positive strand is fluorine. For example, the 2' positions of the 7th, 9th, 10th, and 11th nucleotide glycosyl positions starting from the 5' end of the positive strand are all fluorine.

[0179] In some embodiments, except for the 7th, 9th, 10th, and 11th nucleotides starting at the 5' end, at least one of the 2' positions of the remaining nucleotide glycosyl groups is a methoxy group.

[0180] In some embodiments, at least one of the 2' positions of the nucleotide glycosyl groups at positions 3, 5, 7, 9, 10, 11, 13, and 15 starting from the 5' end of the positive strand is fluorine. For example, the 2' positions of the nucleotide glycosyl groups at positions 3, 5, 7, 9, 10, 11, 13, and 15 starting from the 5' end of the positive strand are all fluorine.

[0181] In some embodiments, except for the nucleotides at positions 3, 5, 7, 9, 10, 11, 13, and 15 starting from the 5' end, at least one of the 2' positions of the nucleotide glycosyl groups is a methoxy group.

[0182] In some embodiments, except for the 7th, 8th, 9th, and 10th nucleotides starting at the 5' end, at least one of the 2' positions of the remaining nucleotide glycosyl groups is a methoxy group.

[0183] For example, the -OH at the 2' position of some or all of the nucleotide glycosyl positions of the sense strand and / or antisense strand can be substituted, wherein the substituent group is fluorine or methoxy. Preferably, the 2' position of the nucleotide glycosyl position at the 9th, 10th, and 11th positions starting from the 5' end of the sense strand is fluorine and the 2' position of the nucleotide glycosyl position at the 2nd, 4th, 6th, 12th, 14th, 16th, 18th, and 20th positions starting from the 5' end of the antisense strand is fluorine, and the remaining nucleotide glycosyl positions at the 2' position are methoxy. Alternatively, preferably, the 2' position of the nucleotide glycosyl position at the 5th, 7th, 8th, and 9th positions starting from the 5' end of the sense strand is fluorine and the 2' position of the nucleotide glycosyl position at the 2nd, 4th, 8th, 14th, and 16th positions starting from the 5' end of the antisense strand is fluorine, and the remaining nucleotide glycosyl positions at the 2' position are methoxy.

[0184] In some embodiments, there are at least two consecutive phosphate thioester bonds between the nucleotides of the sense strand and / or antisense strand.

[0185] In some embodiments, at least two consecutive phosphate thioester bonds exist between three consecutive nucleotides at at least one end of the sense strand and / or antisense strand.

[0186] For example, there are at least two consecutive phosphate thioester bonds between the three consecutive nucleotides at the 5' and 3' ends of the sense and antisense strands.

[0187] For example, the 2' position of the nucleotide glycosyl group at positions 9, 10, and 11, starting from the 5' end of the sense strand, is fluorinated, and the 2' position of the nucleotide glycosyl group at positions 2, 4, 6, 12, 14, 16, 18, and 20, starting from the 5' end of the antisense strand, is fluorinated, while the 2' position of the remaining nucleotide glycosyl groups is methoxylated. Furthermore, there are at least two consecutive phosphate thioester bonds between the three consecutive nucleotides at the 5' and 3' ends of the sense and antisense strands.

[0188] In some embodiments, a portion of the nucleotides at the 2' position of the positive strand are fluorine or methoxy, and the terminal of the antisense strand has at least three adjacent phosphate ester bonds that can be thiolated. The nucleotides at positions 5, 7, 8, and 9, or positions 3, 5, 7, 8, 9, 11, 13, and 15, starting from the 5' end of the positive strand, are fluorine at the 2' position, while the remaining nucleotides are methoxy at the 2' position, and the terminal of the antisense strand has at least three adjacent phosphate ester bonds that can be thiolated.

[0189] In some embodiments, a portion of the nucleotides at the 2' position of the positive strand are fluorine or methoxy, and the terminal of the antisense strand has at least three adjacent phosphate ester bonds that can be thiolated. The nucleotides at positions 9, 10, 11 or 3, 5, 7, 8, 9, 11, 13, 15, and / or 17, starting from the 5' end of the positive strand, are fluorine at the 2' position, the remaining nucleotides are methoxy, and the terminal of the antisense strand has at least three adjacent phosphate ester bonds that can be thiolated.

[0190] In some embodiments, the sense and antisense strands in the RNA inhibitor of the present invention are selected from Table 2 below:

[0191] Table 2 RNA inhibitors with modified sequences

[0192] Wherein, G = 2'-O-methylguanosine monophosphate, A = 2'-O-methyladenosine monophosphate, U = 2'-O-methyluridine monophosphate, C = 2'-O-methylcytidine monophosphate; Gs = 2'-O-methyl-3'-thioguanosine monophosphate, As = 2'-O-methyl-3'-thioadenosine monophosphate, Us = 2'-O-methyl-3'-thiouridine monophosphate, Ts = 2'-O-methyl-3'-thiothymidine monophosphate, Cs = 2'-O-methyl-3'-thiocytidine monophosphate; fG = 2'-fluoroguanosine monophosphate. nucleotides, fA = 2'-fluoroadenosine, fU = 2'-fluorouridine, fC = 2'-fluorocytidine, fT = 2'-fluorothymidine; fGs = 2'-fluoro-3'-thioguanosine, fAs = 2'-fluoro-3'-thioadenosine, fUs = 2'-fluoro-3'-thiouridine, fCs = 2'-fluoro-3'-thiocytidine, T = deoxythymidine, dA = 2'-deoxy-adenosine, invAb is inverted deoxy abasiccap, Tgn is ethylene glycol deoxythymidine.

[0193] In some embodiments, the sense or antisense strand of the RNA inhibitor of the present invention is a sequence having at least 15 consecutive nucleotides identical to the sense or antisense strands in Tables 1 to 2, or a sequence differing by one, two, or three nucleotides.

[0194] In some implementations, the distribution, targeting, or stability of RNA inhibitors is altered by introducing ligands of target tissue receptors into the vector. For example, specific ligands can provide enhanced affinity for selected targets (e.g., molecules, cells or cell types, compartments (e.g., cell or organ compartments, body tissues, organs, or regions)) compared to species where ligands are absent.

[0195] Ligands can include naturally occurring substances such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulins); carbohydrates (e.g., dextran, styrax, chitosan, chitin, inulin, cyclodextrin, N-acetylglucosamine, N-acetylglucosamine, or hyaluronic acid); or lipids. Ligands can also be recombinant or synthetic molecules, such as synthetic polymers, like synthetic polyamino acids.

[0196] The ligand may also include a targeting group, such as a cell or tissue target that binds to a specific cell type, such as kidney cells, for example, a lectin, glycoprotein, lipid, or protein, such as an antibody. The targeting group may be thyroid-stimulating hormone, melanocyte-stimulating hormone, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, polygalactose, polygalactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polymannose, polyfucose, glycosylated polyamino acids, polygalactose, transferrin, bisphosphonates, polyglutamic acid, polyaspartic acid, lipids, cholesterol, steroids, bile acids, folic acid, vitamin B12, vitamin A, biotin, or RGD peptide or RGD peptide mimics. In some embodiments, the ligand is a polygalactose, such as N-acetyl-galactosamine.

[0197] The sense and antisense strands of the RNA inhibitor described in this invention can be conveniently and routinely prepared using well-known solid-phase synthesis techniques. Alternatively or alternatively, any other methods known in the art for this type of synthesis, such as liquid-phase synthesis or fermentation, can be used.

[0198] In some embodiments, in addition to commercially available and conventionally used standard nucleoside phosphoramide monomers and non-standard nucleoside phosphoramide monomers, the sense and antisense strands contained in the RNA inhibitor of this application can be synthesized by an automated synthesizer using a phosphoramide method derived from the carrier-nucleoside phosphoramide monomer.

[0199] In some embodiments, the ligands of the present invention are coupled to the 5' end and / or 3' end of the antisense strand, and / or the 5' end and / or 3' end of the sense strand via a carrier structure.

[0200] For example, the carrier structure may be coupled to the 5' end and / or the 3' end of the sense strand; or the carrier structure may be coupled to the 5' end of the antisense strand and the carrier structure may be coupled to the 3' end of the sense strand; or the carrier structure may be coupled to the 3' end of the antisense strand and the ligand may be coupled to the 5' end of the sense strand.

[0201] In some embodiments, the carrier structure includes a 5'MVIP and a 3'MVIP, wherein the 5'MVIP is coupled to the 5' end of the sense chain and / or the antisense chain, and the 3'MVIP is coupled to the 3' end of the antisense chain and / or the sense chain. The structure of the 5'MVIP is shown in Formula I, and the structure of the 3'MVIP is shown in Formula II. (XL) n -BD-R1-, I (XL) m -BD-R2-, II

[0202] in,

[0203] X is a liver-targeting specific ligand;

[0204] L represents a branch;

[0205] B is the connector;

[0206] D stands for the connecting chain;

[0207] R1 and R2 are transition points;

[0208] The 5'MVIP is connected to the 5' end of the justice chain or the 5' end of the antisense chain via the transition point R1, and the 3'MVIP is connected to the 3' end of the justice chain or the 3' end of the antisense chain via the transition point R2. n and m are each independent integers from 0 to 4, and n+m = integers from 2 to 6, preferably n+m = 2, 3 or 4, more preferably 4.

[0209] In some embodiments, the connection between R1 or R2 and the sense or antisense chain is via a phosphate ester or a modified phosphate ester, and R1 or R2 is preferably connected to the sense or antisense chain via a phosphate ester or a thiophosphate ester.

[0210] In some implementations, m or n can be 0, meaning there is no 3'MVIP or 5'MVIP.

[0211] In some implementations, when n = 0 (i.e., there is no 5' MVIP), the structure of the 3' MVIP can be:

[0212] In some implementations, when n=1, the structure of the 3'MVIP can be:

[0213] In some implementations, when n=2, the structure of the 3'MVIP can be:

[0214] In some implementations, when n=3, the structure of the 3'MVIP can be:

[0215] In some implementations, when n=4, the structure of the 3'MVIP can be:

[0216] In some embodiments, n refers to the sum of n simultaneously placed in the 5' end 5' MVIP of both the sense and antisense strands of the RNA inhibitor, and m refers to the sum of m simultaneously placed in the 3' end 3' MVIP of both the sense and antisense strands of the RNA inhibitor.

[0217] In some embodiments, the structures R1 and R2 contain -NH-, -S- and / or -O-, and R1 and R2 are connected to the connecting chain D and the 5' and 3' ends of the sense chain and / or antisense chain respectively through the -NH-, -S- or -O- in the structure. R1 and R2 may be the same or different.

[0218] In some embodiments, R1 and R2 are optionally straight carbon chains, or straight carbon chains or cyclic structures with amide, carboxyl or alkyl branches, wherein the cyclic structure includes saturated or unsaturated aliphatic carbocyclic groups, or five- or six-membered heterocyclic groups or aromatic hydrocarbon groups containing sulfur, oxygen or nitrogen atoms.

[0219] In some implementations, R1 and / or R2 are -E1(CH2). x CH2E2-, where x is any integer from 3 to 12, and groups E1 and E2 can be -NH-, -S-, or -O-, respectively.

[0220] In some implementations, R1 and / or R2 are -E1(CH2). x1 CH(OH)(CH2) x2 E2-, where x1 or x2 is an independent integer from 3 to 10, and E1 and E2 can be -NH-, -S- or -O- respectively.

[0221] In some embodiments, R1 is a heterocyclic or carbocyclic structure containing N, S, or O, as shown below:

[0222] In some embodiments, the transition point R1 is -NH(CH2). x CH2O-, where x is any integer from 3 to 12, preferably any integer from 4 to 6, can be introduced by the following two phosphoramide monomers.

[0223] In the i.R1 structure, one -O- or -S- is used for the synthesis of the R1 phosphoridamide monomer, which is inserted into the 5' end of the sense or antisense strand of the RNA inhibitor via solid-phase synthesis. The -NH-, -S-, or -O- in the structure is used to connect with the linker strand D in the 5' MVIP, thereby introducing a liver-targeting specific ligand X into the 5' end of the sense or antisense strand of the RNA inhibitor. An exemplary structure of the monomer introduced into the 5' end of the sense or antisense strand of the RNA inhibitor is as follows:

[0224] In some implementations, the following structure is preferred:

[0225] ii. In the R1 structure, one -NH-, -S-, or -O- group is first attached to the linking chain D, and the other -NH-, -S-, or -O- group is used in the synthesis of the 5'MVIP phosphorous amide monomer to form an ester with the phosphorous amide. Examples of the sense or antisense chain 5'MVIP phosphorous amide monomer structures are shown below:

[0226] In some embodiments, the 5'MVIP phosphorus amide monomer with the sense or antisense chain preferably has the following structure:

[0227] When n is 1-4 in the general formula, the B portion of the linker in the monomer is branched 1 to 4 times to obtain the corresponding monomer compound. With the help of the monomer compound, the liver-targeting specific ligand X is introduced into the 5' end of the sense or antisense chain through solid-phase synthesis.

[0228] In some embodiments, the transition point R1 is -NH(CH2). x CH2O-, where x can be any integer from 3 to 12, preferably any integer from 4 to 6.

[0229] In some embodiments, the 5'MVIP phosphorous amide monomer structure is selected from the following structures:

[0230] In some embodiments, the transition point R2 is a heterocyclic or carbide ring structure containing N, S, or O, as shown below:

[0231] In some embodiments, the transition point R2 is -NH(CH2). x1 CH(OH)(CH2) x2 CH2O-, where x1 is any integer from 1 to 4, and x2 is any integer from 0 to 4.

[0232] The transition point R2 described in this application is formed by esterification or amide formation of succinic anhydride with -NH-, -S- or -O- in the R2 structure, while simultaneously coupling with -NH- in the blank Solid Support to form a 3'MVIP solid spport. Then, the 3'MVIP is introduced into the 3' end of the sense or antisense chain through a phosphorous amide solid-phase synthesis method.

[0233] In some embodiments, the heterocycle in the transition point R2 structure is a pyrrole ring or a piperidine ring, which is connected to the 3'MVIP linking chain D through a nitrogen heteroatom in the ring, introducing an exemplary structure of the 3'MVIP solid spport as follows:

[0234] When m is 1-4 in the general formula, the connector B part in the monomer is branched 1 to 4 times to obtain the corresponding Solid Support.

[0235] In some implementations, the transition point R2 is -B4(CH2). x1 CH(OH)(CH2) x2 CH2B5-, where x1 is any integer from 1 to 4, x2 is any integer from 0 to 4, and B4 and B5 are -NH-, -S-, or -O- respectively. An exemplary structure for introducing a 3'MVIP solid spport is as follows:

[0236] When m is 1-4 in the general formula, the connector B part in the monomer is branched 1 to 4 times to obtain the corresponding Solid Support.

[0237] In some implementations, R2 is -NHCH2CH(OH)CH2O-, and an exemplary structure for introducing a 3'MVIP solid spport is as follows:

[0238] When m is 1-4 in the general formula, the connector B part in the monomer is branched 1 to 4 times to obtain the corresponding Solid Support.

[0239] In some implementations, the 3'MVIP solid support structure is as follows:

[0240] In some embodiments, the liver-targeting specific ligand X is selected from structures used to enhance the uptake of RNA inhibitors by hepatocytes, and may be lipids, steroids, vitamins, sugars, proteins, peptides, polyamines, and peptide mimicry structures. In the RNA inhibitors provided in this application, the liver-targeting specific ligand X introduced into the ends of the sense or antisense strands of the RNA inhibitor may be the same or different. For example, in terms of properties, some may enhance liver targeting, some may be structures that regulate the pharmacokinetics of the RNA inhibitor in vivo, and some may be structures with in vivo solubility activity. In some embodiments, the liver-targeting specific ligand X is selected from one or more monosaccharides and their derivatives from the following structures.

[0241] In some embodiments, the monosaccharide is selected from one or more of the following structures: mannose, galactose, D-arabinose, glucose, fructose, xylose, glucosamine, and ribose. The monosaccharide derivative is selected from mannose derivatives, galactose derivatives, glucose derivatives, ribose derivatives, and other derivatives.

[0242] In some embodiments, the liver-targeting specific ligand X is selected from galactose, galactosamine, N-acetylgalactosamine, and their derivatives, and its general structural formula is as follows:

[0243] Where W1 is a hydrogen or hydroxyl protecting group, which can be the same or different; W can be -OH, -NHCOOH, or -NHCO(CH2). q CH3, where q is an integer from 0 to 4; W2 is -NH-, O, S, or C.

[0244] In some embodiments, the liver-targeting specific ligand X is N-acetylgalactosamine or its derivatives.

[0245] In some embodiments, the liver-targeting specific ligand X is selected from the following structures:

[0246] Wherein, W is selected from -OH, -NHCOOH, or -NHCO(CH2). q One or two of CH3, where q is an integer from 0 to 4.

[0247] In some embodiments, the liver-targeting specific ligand X may be the same or different in the same 5'MVIP or 3'MVIP structure.

[0248] In some implementations, the X values ​​between 5'MVIP and 3'MVIP can be the same or different.

[0249] In some embodiments, the branched chain L contains -NH-, -C(=O)-, -O-, -S-, amide group, phosphoryl group, thiophosphoryl group, or C4-C group. 10 C4-C of aliphatic carbocyclic groups, phenyl groups, or combinations thereof 18 Carbon chain.

[0250] In some embodiments, the branched chain L also has a hydroxyethyl or carboxylic acid side chain.

[0251] In some embodiments, the branched chain L is a C7-C chain containing an amide group or a six-membered aliphatic carbocyclic group. 18 Carbon chain.

[0252] In some embodiments, the branch L is selected from one or more of the following structures:

[0253] Wherein, r1 is any integer from 1 to 12, r2 is any integer from 0 to 20, and Z is H, alkyl, or amide group, such as C1-C5 alkyl.

[0254] In some embodiments, the structure of the connector B is related to the number of X that can be introduced. The connector B contains -NH-, C, O, S, amide, phosphoryl, and thiophosphoryl groups. When n or m is 1, it is a straight carbon chain. When n or m is 2, 3, or 4, it branches 2, 3, or 4 times, respectively.

[0255] In some embodiments, the connector B is selected from the following structures:

[0256] Wherein, A1 and A2 are each independently C, O, S, -NH-, carbonyl, amide, phosphoryl, or thiophosphoryl, and r is an integer from 0 to 4.

[0257] In some embodiments, the connector B is selected from the following structures:

[0258] Where r is any integer from 0 to 4.

[0259] In some embodiments, the connector B is selected from the following structures:

[0260] In some embodiments, the connector B is selected from the following structures:

[0261] In some embodiments, the linking chain D contains -NH-, C=O, O, S, amide, phosphoryl, thiophosphoryl, aromatic hydrocarbon, or C4-C groups. 10 Aliphatic carbocyclic groups, five- or six-membered heterocyclic groups containing 1-3 nitrogen atoms, or combinations of these groups in C3-C2. 18 Carbon chain.

[0262] In some embodiments, the linker chain D also has side chains of hydroxymethyl, methyl tert-butyl, methylphenol, or C5-C6 aliphatic ring groups.

[0263] In some embodiments, the linking chain D is a C3-C group containing two C=O groups, a six-membered aliphatic carbocyclic group, or a phenyl group. 10 Carbon chain.

[0264] In some embodiments, the connecting chain D is a C3-C chain containing two C=Os. 10 Carbon chain.

[0265] In some implementations, the connecting chain D is selected from the following structures:

[0266] In this context, each p is an independent integer from 1 to 20; s is an integer from 2 to 13; Z1 and Z2 are the same or different substituent groups, such as C3-C. 10 alkyl.

[0267] In some implementations, the connecting chain D is selected from the following structures:

[0268] In some implementations, the connecting chain D is selected from the following structures:

[0269] In some implementations, the (XL) in the 5'MVIP structure n (XL) in -BD- and 3'MVIP structures m -BD- is selected from one or more of the following structures:

[0270] In some implementations, X, L, B, and D may be the same or different within each of the 5'MVIP and 3'MVIP, or between the 5'MVIP and 3'MVIP.

[0271] In some implementations, the (XL) in the 5'MVIP structure n -BD is selected from the structures shown in Table 3:

[0272] Table 3. 5' MVIP (XL) n -BD- Structure

[0273] In some implementations, 5'MVIP may not exist, in which case m can be any integer from 2 to 4.

[0274] In some embodiments, the (XL) in the 3'MVIP structure m -BD- is selected from the structures shown in Table 4:

[0275] Table 4. 3'MVIP (XL) m -BD- Structure

[0276] In some embodiments, the carrier structure 5'MVIP contains (XL) n The combinations of -BD- and R1 are shown in Table 5.

[0277] Table 5. 5'MVIP (XL) n - Combination of BD and R1

[0278] In some implementations, 3'MVIP may not exist, in which case n can be any integer from 2 to 4.

[0279] In some embodiments, the carrier structure 3'MVIP contains (XL) m The combinations of -BD- and R2 are shown in Table 6.

[0280] Table 6 3'MVIP (XL) m -BD- combined with R2

[0281] In some implementations, the 5'MVIP is selected from any one or more of 5'MVIP01 to 5'MVIP22 in Table 5.

[0282] In some implementations, the 3'MVIP is selected from any one or more of 3'MVIP01 to 3'MVIP27 in Table 6.

[0283] In some implementations, there is a possibility of combining any of the 5'MVIPs in Table 5 and the 3'MVIPs in Table 6, where n+m = 2, 3, 4, 5 or 6.

[0284] In some implementations, the sense and antisense strands of the RNA inhibitor may be sequences selected from the following list 7:

[0285] Table 7. Justice or Antisense Chains Coupled with the Carrier

[0286] In some embodiments, the sense and antisense strands of the RNA inhibitor described in this application are sequences having at least 15 consecutive nucleotides identical to the sense and antisense strands in Table 7, or sequences differing from the sense and antisense strands in Table 7 by one, two, or three nucleotides.

[0287] It is important to emphasize that the combination of justice chains and antisense chains is not limited to the two-chain combinations shown in Table 7. One of the justice chains in Table 7 can be paired with any antisense chain; as shown in Table 7...

[0288] CsUsCAACAUfAUfUfUfGAUCAGUsCsU (SEQ ID NO: 346, 351) can be used with

[0289] AsfGsACUGAfUCAAAUfAUfGUUGsAsG (SEQ ID NO: 511),

[0290] AsfGsACUGAUCAAAUfAUfGUUGAGsCsU (SEQ ID NO: 516) are complementary pairs. Any sense or antisense strand in this invention is an independent entity, and the combination method is not limited. At least 85% of the nucleotides can be complementary pairs, and all can form double-strand inhibitors.

[0291] In some embodiments, the antisense strand of the RNA inhibitor of the present invention is:

[0292] AsdGsACTGdAUCAAdAUfAUGUUGAGsCsU (SEQ ID NO:520), whose 5' end and / or 3' end are connected to 5' MVIP and / or 3' MVIP of different structures, wherein the antisense chain of the connection carrier structure is selected from Table 8 below:

[0293] Table 8. Combinations of 5' MVIP and / or 3' MVIP with antisense chains

[0294] In some embodiments, the antisense strand of the RNA inhibitor of the present invention is a sequence having at least 15 consecutive nucleotides identical to the antisense strand in Table 8, or a sequence differing from the antisense strand in Table 8 by one, two, or three nucleotides.

[0295] In some embodiments, the antisense strand of the RNA inhibitor described in this invention can be obtained by conjugating the antisense strands in Tables 1-2 with 5'MVIP and / or 3'MVIP.

[0296] In some embodiments, the antisense strand of the RNA inhibitor of the present invention is a sequence having at least 15 consecutive nucleotides identical to the antisense strands in Tables 1-4, or a sequence differing from the antisense strands in Tables 1-2 by one, two, or three nucleotides by being coupled to 5'MVIP and / or 3'MVIP.

[0297] In some embodiments, the double-stranded RNA inhibitor of the present invention may optionally be conjugated to one or more ligands, said ligands being capable of enhancing the activity, cellular distribution, or cellular uptake (e.g., entry into cells) of the double-stranded RNA inhibitor. The ligand may be attached to a sense strand, an antisense strand, or both strands at the 3' end, 5' end, or both ends. The vector is not limited to the MVIPs listed in this invention, but may also include, but is not limited to: GalNac vectors of any structure, cationic lipid carriers, viral vectors, lipophilic moieties, amphiphilic moieties, targeting groups, small molecule drugs, proteins, peptides, and antibodies.

[0298] In some embodiments, the sense strand of the RNA inhibitor of the present invention is: CsUsCAACAUfAfUfUUGAUCAGUsCsU (SEQ ID NO: 354, 355), wherein its 5' end and / or 3' end are connected to 5' MVIP and / or 3' MVIP with different structures, and the sense strand of the linker structure is selected from Table 9 below:

[0299] Table 9. Combinations of 5'MVIP and / or 3'MVIP with the Chain of Justice

[0300] In some embodiments, the antisense strand of the RNA inhibitor of the present invention is a sequence having at least 15 consecutive nucleotides identical to the antisense strand in Table 8, or a sequence differing from the antisense strand in Table 8 by one, two, or three nucleotides.

[0301] In some embodiments, the antisense strand of the RNA inhibitor described in this invention can be obtained by conjugating the antisense strands in Tables 1-2 with 5'MVIP and / or 3'MVIP.

[0302] In some embodiments, the antisense strand of the RNA inhibitor of the present invention is a sequence having at least 15 consecutive nucleotides identical to the antisense strands in Tables 1-2, or a sequence differing from the antisense strands in Tables 1-2 by one, two, or three nucleotides conjugated with 5'MVIP and / or 3'MVIP.

[0303] In some embodiments, the double-stranded RNA inhibitor of the present invention may optionally be conjugated to one or more ligands, said ligands being capable of enhancing the activity, cellular distribution, or cellular uptake (e.g., entry into cells) of the double-stranded RNA inhibitor. The ligand may be attached to a sense strand, an antisense strand, or both strands at the 3' end, 5' end, or both ends. The vector is not limited to the MVIPs listed in this invention, but may also include, but is not limited to: GalNac vectors of any structure, cationic lipid carriers, viral vectors, lipophilic moieties, amphiphilic moieties, targeting groups, small molecule drugs, proteins, peptides, and antibodies.

[0304] Patent CN113171371B examines in detail the effects of different X, L, B, D, R1, and R2 in the 5'MVIP and / or 3'MVIP structures on the activity of RNA inhibitors, and the entire contents of this patent are incorporated herein by reference.

[0305] When X represents galactose, galactosamine, N-acetylgalactosamine, or their derivatives, N-acetylgalactosamine and its derivatives are preferred as liver-targeting specific ligands in the RNA inhibitors provided by this invention, as shown in Table 10:

[0306] Table 10

[0307] The length of the L chain has a significant impact on the effectiveness of RNA inhibitors; the L chain cannot be too short or too long. When the RNA inhibitor contains -NH-, C=O, O, S, amide, phosphoryl, thiophosphoryl, aliphatic carbocyclic groups such as cyclohexane, or combinations of these groups, or when the L chains of the same 5'MVIP and 3'MVIP structures are different, the activities of the resulting RNA inhibitors are not significantly different within the carbon chain length range of C7-C18, as shown in Table 11.

[0308] Table 11

[0309] Except for the change in the structure of adapter B, when X, L, D, and R1 / R2 are the same as those in the combination 5'MVIP09 / 3'MVIP09, and when A1 and A2 in the general formula of adapter B are independently C, O, S, -NH-, carbonyl, amide, phosphoryl, or thiophosphoryl, and r is any integer from 0 to 4, and when adapter B is the same or different between 5'MVIP and 3'MVIP, the resulting RNA inhibitor activities are not significantly different.

[0310] Table 12

[0311] When the MVIP structure and RNA inhibitor are the same, different linker strands D will affect the activity of the RNA inhibitor. Among them, D1, D2 and D4 have similar effects and are better than D3. The D structure is shown in Table 13.

[0312] Table 13

[0313] Different transition sites R1 can affect the activity of RNA inhibitors. Among them, the RNA inhibitor with R1-1 as the transition site has the best activity. The structure of R1 is shown in Table 14.

[0314] Table 14

[0315] Different transition sites R2 can affect the activity of RNA inhibitors. Among them, R2-1 is the best RNA inhibitor when used as a transition site. The structure of R1 is shown in Table 15.

[0316] Table 15

[0317] In some embodiments, n+m in the RNA inhibitor of the present invention are 2, 3, 4, 5, and 6, respectively. The coupling positions of 5'MVIP and / or 3'MVIP include the 5' end and / or 3' end of the antisense strand, the 5' end and / or 3' end of the sense strand, the 5' end of the antisense strand and the 3' end of the sense strand, and the 5' end of the sense strand and the 3' end of the antisense strand.

[0318] In some embodiments, n+m in the RNA inhibitor of the present invention are 2, 3, 4, 5, and 6, respectively. The conjugation positions of 5'MVIP and / or 3'MVIP include the 5' and / or 3' ends of the antisense strand in Tables 1-2, the 5' and / or 3' ends of the sense strand in Tables 1-2, the 5' end of the antisense strand and the 3' end of the sense strand in Tables 1-2, and the 5' end of the sense strand and the 3' end of the antisense strand in Tables 1-2. The obtained combinations of 5'MVIP and 3'MVIP are shown in Table 16.

[0319] Table 16 List of 5'MVIP and 3'MVIP Combinations

[0320] In some implementations, n and m are each independently any integer from 0 to 4, preferably each independently an integer from 1 to 3, and n+m = an integer from 2 to 6, preferably n+m = 2, 3 or 4, more preferably 4.

[0321] In some embodiments, the RNA inhibitors described herein or their pharmaceutically acceptable salts are preferably prepared or synthesized in the form of sodium salts and triethylamine salts or other pharmaceutically acceptable salts.

[0322] In some embodiments, the RNA inhibitor described in this application or its pharmaceutically acceptable salt is more preferably its sodium salt or triethylamine salt.

[0323] On the other hand, this application also provides a pharmaceutical composition comprising the RNA inhibitor or a pharmaceutically acceptable salt thereof.

[0324] In some embodiments, the present invention provides a pharmaceutical composition comprising the RNA inhibitor or a pharmaceutically acceptable salt thereof and optionally a pharmaceutically acceptable excipient. The use of the RNA inhibitor or a pharmaceutically acceptable salt thereof provided by the present invention in the preparation of medicaments for treating and / or preventing diseases associated with elevated ANGPTL3 levels, including but not limited to lipid metabolism disorders.

[0325] In some embodiments, ANGPTL3 regulates plasma triglyceride levels by inhibiting LPL (hepatic lipase) activity in the liver and adipose tissue, thereby limiting fatty acid release. It also affects insulin resistance, lipid metabolism, and overall energy balance. Factors that may inhibit ANGPTL3 mRNA expression in vivo and / or in vitro include PPARδ, statins, insulin, leptin, thyroid hormones, and lipopolysaccharide (LPS) 5-10; the inhibitors of this invention can be used in combination with these drugs, showing promise for further improving therapeutic effects on lipid metabolism, glucose metabolism, and cardiovascular diseases.

[0326] One example is the formulation of a composition for systemic administration via parenteral delivery, such as subcutaneous (SC), intramuscular (IM), or intravenous (IV) delivery. The pharmaceutical composition provided in this application can be administered at a dose sufficient to inhibit ANGPTL3 gene expression.

[0327] Pharmaceutically acceptable "excipients" or "components" are pharmaceutically acceptable solvents, suspending agents, or any other pharmaceutically inert media for delivering one or more nucleic acids to animals. Excipients may be liquids or solids and are selected considering the planned administration method to provide the desired volume, consistency, etc., when combined with the nucleic acid and other components in a given pharmaceutical composition. The RNA inhibitors described in this invention can be delivered in a manner that targets specific tissues (e.g., hepatocytes).

[0328] In some embodiments, the pharmaceutical compositions of the present invention further comprise a delivery medium (such as nanoparticles, dendritic polymers, polymers, liposomes, or cationic delivery systems).

[0329] In some embodiments, the delivery medium of the present invention includes liposomes.

[0330] In some embodiments, the delivery medium of the present invention includes nanolipids, which are capable of forming liposome-nucleic acid nanoparticles with nucleic acid molecules.

[0331] In some embodiments, the delivery medium of the present invention includes the amphoteric lipid compound M10C1.

[0332] The pharmaceutical compositions provided by this invention include (but are not limited to) solutions, emulsions, and formulations containing liposomes. These compositions can be generated from a variety of components, including (but not limited to) pre-formed liquids, self-emulsifying solids, and self-emulsifying semi-solids. The formulations include those targeting the liver. The pharmaceutical formulations of this application, which can be conveniently present in unit dosage forms, can be prepared using conventional techniques known in the pharmaceutical industry. Such techniques include the step of combining the active ingredient with pharmaceutically acceptable excipients or excipients.

[0333] use

[0334] On the other hand, this application provides a method for reducing the expression of ANGPTL3 mRNA or protein in cells or tissues, comprising contacting the cells or tissues with an effective amount of the aforementioned RNA inhibitor that inhibits the expression of the ANGPTL3 gene or a pharmaceutically acceptable salt thereof, and / or the aforementioned pharmaceutical composition.

[0335] Cells suitable for treatment using the method of this application can be any cells expressing the ANGPTL3 gene, such as liver cells, brain cells, gallbladder cells, heart cells, or kidney cells, but preferably liver cells. Cells suitable for use in the method of this application can be mammalian cells that, when contacted with cells expressing the ANGPTL3 gene, have their expression of the ANGPTL3 gene (e.g., human, primate, non-primate, or rat ANGPTL3 gene) suppressed by an RNA inhibitor by at least about 50%, for example by PCR or a branched DNA (bDNA) based method, or by a protein-based method such as immunofluorescence assay, Western blotting, or flow cytometry.

[0336] In some embodiments, the tissue is liver tissue.

[0337] In some embodiments, the cells and tissues are in vitro.

[0338] In some embodiments, the cells and tissues are in the body of the subject.

[0339] The term "inhibition" as used in this invention may be used interchangeably with "reduction," "lowering," "silencing," "downregulation," "suppression," and other similar terms, and includes any level of inhibition. ANGPTL3 gene expression may be evaluated based on the level or change in the level of any variable associated with ANGPTL3 gene expression, such as ANGPTL3 mRNA levels. This level may be analyzed in a single cell or a cell population (including, for example, samples derived from a subject). Control levels may be any type of control level used in the art, such as baseline levels before administration or levels measured in similar subjects, cells, or samples that have never been treated or have received a control (e.g., a buffer-only control or an active agent-free control).

[0340] Inhibition of ANGPTL3 gene expression can be manifested by the reduction in the amount of mRNA expressed by a first cell or cell population (such cells may be present, for example, in a sample derived from a subject) in which the ANGPTL3 gene is transcribed and treated (e.g., by contacting one or more cells with the RNA inhibitor of this application, or by administering the RNA inhibitor of this application to a subject in which the cells are present) that inhibits ANGPTL3 gene expression, compared to a second cell or cell population that is substantially the same as the first cell or cell population but not so treated (control cells that are not treated with the RNA inhibitor or are not treated with the RNA inhibitor targeting the target gene).

[0341] In a preferred embodiment, the mRNA level is evaluated in a cell line that highly expresses ANGPTL3 by using an appropriate concentration of siRNA, and the mRNA level in the intervened cells is expressed as a percentage of the mRNA level in the uninterventional control cells.

[0342] In other embodiments, inhibition of ANGPTL3 gene expression can be evaluated by a decrease in a parameter functionally associated with ANGPTL3 gene expression, such as the level of ANGPTL3 in the subject's blood or serum. ANGPTL3 gene inhibition can be measured in any ANGPTL3-expressing cells (endogenous or exogenous from the expression construct) and by any analytical method known in the art.

[0343] Inhibition of ANGPTL3 expression can be manifested by a decrease in the level of ANGPTL3 expressed in cells or cell populations or in subject samples (e.g., the protein level in blood samples derived from subjects).

[0344] Control cells, cell populations, or subject samples that can be used to evaluate ANGPTL3 gene inhibition include cells, cell populations, or subject samples that have not been exposed to the RNA inhibitor of this application. For example, control cells, cell populations, or subject samples may be derived from a single subject (e.g., a human or animal subject) prior to treatment with the RNA inhibitor or from an appropriately matched population of controls.

[0345] The level of ANGPTL3 mRNA expressed in cells or cell populations can be determined using any method known in the art for evaluating mRNA expression. For example, qRT-PCR can be used to evaluate a decrease in gene expression. A decrease in protein production can be evaluated using any method known in the art, such as ELISA. In some embodiments, a liver biopsy sample is used as tissue material to monitor decreased ANGPTL3 gene expression. In other embodiments, a blood sample is used as a subject sample to monitor decreased ANGPTL3 expression.

[0346] On the other hand, the aforementioned RNA inhibitor for inhibiting ANGPTL3 gene expression or its pharmaceutically acceptable salt, or the aforementioned pharmaceutical composition, provided in this application, may be used in the preparation of a medicament for the prevention and / or treatment of a disease or condition or to reduce the risk of a disease or condition.

[0347] On the other hand, this application provides a method for preventing and / or treating a disease or condition, the method comprising administering to a subject in need an effective amount of the aforementioned RNA inhibitor that inhibits ANGPTL3 gene expression or a pharmaceutically acceptable salt thereof, and / or the aforementioned pharmaceutical composition.

[0348] The in vivo methods of this application may include administering a pharmaceutical composition comprising an RNA inhibitor to a subject, wherein the RNA inhibitor comprises a nucleotide sequence complementary to at least a portion of the ANGPTL3 mRNA of the mammal receiving the RNA inhibitor. The pharmaceutical compositions of this invention may be administered in any manner known in the art, including (but not limited to): oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and local (including buccal and sublingual) administration. In some embodiments, the pharmaceutical composition is administered by intravenous infusion or injection. In some embodiments, the pharmaceutical composition is administered by subcutaneous injection. In some embodiments, the composition is administered by intramuscular injection.

[0349] The RNA inhibitor provided in this application can also be administered as a "free RNA inhibitor." The free RNA inhibitor is administered in the absence of a pharmaceutical composition. The naked RNA inhibitor can be in a suitable buffer solution. The buffer solution may contain acetate, citrate, alcohol-soluble gluten, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate-buffered saline (PBS). The pH and osmotic pressure of the buffer solution containing the RNA inhibitor can be adjusted to suit administration to the subject.

[0350] Alternatively, the RNA inhibitors provided in this application may be administered as pharmaceutical compositions, such as liposome formulations.

[0351] The pharmaceutical composition provided in this application can be administered at a dose sufficient to inhibit ANGPTL3 gene expression. Typically, a suitable dose of the RNA inhibitor described in this application is in the range of about 0.001 to about 200.0 mg per kilogram of body weight per day, and generally in the range of about 1 to 50 mg per kilogram of body weight per day. Typically, a suitable dose of the RNA inhibitor described in this application is in the range of about 0.1 mg / kg to about 5.0 mg / kg, for example, in the range of about 0.3 mg / kg to about 3.0 mg / kg.

[0352] In some embodiments, the method further includes measuring ANGPTL3 levels in a sample from the subject.

[0353] For example, the method further includes determining the ANGPTL3 level in a blood sample, serum sample, or urine sample from the subject.

[0354] In another aspect, this application provides a cell comprising the aforementioned RNA inhibitor that inhibits ANGPTL3 gene expression or a pharmaceutically acceptable salt thereof.

[0355] On the other hand, this application provides a kit containing the aforementioned RNA inhibitor that inhibits ANGPTL3 gene expression or a pharmaceutically acceptable salt thereof, or the aforementioned pharmaceutical composition.

[0356] The embodiments described below are not intended to be limited by any theory, but are merely for illustrating the RNA inhibitors, preparation methods and uses provided in this application, and are not intended to limit the scope of the invention.

[0357] Example

[0358] illustrate:

[0359] The Chinese name for DMSO is dimethyl sulfoxide.

[0360] The Chinese name for DMF is N,N-dimethylformamide;

[0361] The Chinese name for HOBt is 1-hydroxybenzotriazole;

[0362] The Chinese name for HBTU is O-benzotriazole-tetramethylurea hexafluorophosphate.

[0363] The Chinese name for DIPEA (DIEA) is N,N-diisopropylethylamine;

[0364] The Chinese name for DCM is dichloromethane.

[0365] The Chinese name for DMAP is 4-dimethylaminopyridine;

[0366] The Chinese name for DMT-CL is 4,4'-dimethoxytriphenylchloromethane;

[0367] The Chinese name for MEOH is methanol.

[0368] The Chinese name for TBTU is O-benzotriazole-N,N,N',N'-tetramethylurea tetrafluoroboric acid;

[0369] The name is solid-phase carrier, such as macroporous aminomethyl resin (Resin).

[0370] Example 1: Synthesis of RNA Inhibitors

[0371] The sense and antisense strands of the uncoupled vector structure were synthesized using a standard solid-phase phosphoramide method and a multichannel solid-phase synthesizer. The sense strands and corresponding antisense strands were then complementarily annealed to prepare the corresponding RNA inhibitors.

[0372] The basic steps of the solid-phase phosphorous amide process include:

[0373] 1) Deprotection: Removing the Solid Support hydroxyl protecting group (DMTr) from the starting monomer;

[0374] 2) Coupling: The first phosphoramide monomer is added, and a coupling reaction occurs in the 3' to 5' direction;

[0375] 3) Oxidation: The obtained nucleoside phosphites are oxidized to more stable nucleoside phosphates (i.e., trivalent phosphorus is oxidized to pentavalent phosphorus);

[0376] 4) Blocking: The 5'-OH of the failed nucleotide sequence in the previous step is blocked by adding a cap to prevent it from participating in the reaction further; repeat the above steps until the last phosphoramidite monomer is added; then the ester bond between the Solid Support and the starting monomer is cleaved with aqueous methylamine and ammonia, and the protecting groups on the bases and phosphate groups on the resulting nucleotide sequence are removed; after separation and purification by HPLC, the nucleotides are filtered to remove bacteria and lyophilized to obtain the corresponding sense or antisense strand.

[0377] Description of the synthesis process of RNA inhibitors:

[0378] Reconstitute the lyophilized powders of the sense and antisense chains separately, mix them equimolarly, add an appropriate amount of water for injection, and then add an appropriate amount of TRIS buffer solution. Gently shake for about 1-2 minutes to ensure the solution is thoroughly mixed. Heat the water bath to 92℃-95℃. Place the reaction solution in the water bath and heat for 3-5 minutes, gently shaking to ensure uniform heating. Allow to cool naturally to room temperature. A colorless or slightly yellow transparent liquid is obtained; take a sample and send it for testing to determine its concentration.

[0379] Example 2: In vitro inhibition of ANGPTL3 gene expression by RNA inhibitors

[0380] The RNA inhibitors in this embodiment are selected from Table 1 and prepared by the method described in Example 1.

[0381] Huh7 / HepG2 / Hep3B cells were digested with trypsin and adjusted to an appropriate density, then seeded into 96-well plates at a viable cell concentration of 0.2 × 10⁻⁶ cells / well. 6 Cells / mL. Simultaneously with inoculation, cells were transfected with either test siRNA or control siRNA using Lipofectamine RNAiMax (Invitrogen-13778150). siRNA was tested in triplicate at two concentrations (1.0 nM and 0.1 nM), and a control group containing only cells and RNAiMax (without siRNA) and a positive control group were also included.

[0382] 24 hours after transfection, the culture medium was removed and the cells were harvested for RNA extraction. Total RNA was extracted using a 96-channel automated nucleic acid extraction and purification system or the Promega Total RNA Extraction Kit.

[0383] According to the manual, use II. The All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) kit was used for cDNA synthesis. The target cDNA was detected by qPCR, with GAPDH cDNA detected in parallel as an internal control. The quantitative PCR instrument (Thermo QuantStudio 1) was used with the following steps: PCR was performed at 95°C for 30 seconds, followed by 40 cycles of 95°C for 10 seconds and 60°C for 30 seconds.

[0384] Data Analysis:

[0385] The expression level of the target gene mRNA in each sample was calculated based on the Ct value, using the ΔΔCt relative quantification method. The relative expression level of the target gene was calculated using a 22 -ΔΔCt express.

[0386] The equations are listed below:

[0387] ΔCT = Average Ct of target genes - Average Ct of GAPDH

[0388] ΔΔCT = ΔCT(sample) - ΔCT(randomized control or Lipofectamine RNAiMax control);

[0389] Relative quantification of target gene mRNA = 2(-ΔΔCT)

[0390] Inhibition % = (Relative quantitation of control - Relative quantitation of sample) / Relative quantitation of control × 100%.

[0391] The results of the Huh7 cell transfection assay are shown in Table 17 below, and the results of the HepG2 cell transfection assay are shown in Table 18 below.

[0392] Table 17. Inhibitory effect of RNA inhibitors on ANGPTL3 mRNA in Huh7 cells

[0393] Table 18. Inhibitory effect of RNA inhibitors on ANGPTL3 mRNA in HepG2 cells

[0394] Table 19. Inhibitory effect of RNA inhibitors on ANGPTL3 mRNA in Hep3B cells

[0395] The experimental results showed that the RNA inhibitors listed in Tables 17, 18, and 19 exhibited varying degrees of inhibitory effects on the ANGPTL3 mRNA level in Huh7 and HepG2 cells at different concentrations. Inhibitors with good inhibition rates were selected for further modification and loading of the inhibitors.

[0396] Example 3 Synthesis of carrier structure

[0397] When the 3' end of the sense or antisense strand of the RNA inhibitor of this application is coupled with the vector structure 3'MVIP, the solid support of 3'MVIP is used as the starting monomer for solid-phase synthesis. When the 5' end of the sense or antisense strand of the RNA inhibitor of this application is coupled with the vector structure 5'MVIP, the 5'MVIP phosphorous amide monomer is used as the last monomer for solid-phase synthesis.

[0398] The general formula for the solid spport of 3'MVIP is as follows:

[0399] When m is 1-4, the connector B part in the general formula is branched 1 to 4 times respectively to obtain the corresponding 3'MVIP Solid Support.

[0400] The general formula for the 5'MVIP phosphorous amide monomer is as follows:

[0401] When n is 1-4, the B part of the connector in the general formula is branched 1 to 4 times to obtain the corresponding 5'MVIP phosphorous amide monomer.

[0402] The following are just a few exemplary chemical synthesis processes for 3'MVIP Solid Support and 5'MVIP phosphorous amide monomers. Referring to the methods described in the examples, those skilled in the art can easily synthesize the remaining 3'MVIP Solid Support and 5'MVIP phosphorous amide monomers involved in this invention. The synthesis process is described below:

[0403] 3.1 Synthesis of Solid Support for 3'MVIP

[0404] 3.1.1 Synthesis of Solid Support for 3'MVIP09

[0405] Description of the Solid Support synthesis process:

[0406] 3.1.1.1 Synthesis of ERC-01-c1

[0407] Weigh 5.0 g (54.9 mmol) of 2-amino-1,3-propanediol, add 50 mL of DMSO and 5 mL of sodium hydroxide solution (1 g / mL), cool to 0 °C, and add 20 mL (137.8 mol) of tert-butyl acrylate dropwise over 2 hours. React at room temperature for 48 hours, add 100 mL of petroleum ether, wash twice with saturated brine, and dry the organic layer. Pass the solution through a chromatography column (eluent: ethyl acetate: petroleum ether = 25%-75%), add 0.05% triethylamine, and obtain 6.2 g of a colorless oil.

[0408] 3.1.1.2 Synthesis of ERC-01-c2

[0409] Weigh 6.2 g (17.9 mmol) of ERC-01-c1, add 50 mL of dichloromethane and 23 mL of sodium carbonate solution (25%), and add 8.2 mL (57.4 mmol) of benzyl chloroformate dropwise at room temperature over 2 hours. Let the mixture react overnight at room temperature, wash three times with saturated brine, dry with anhydrous sodium sulfate, evaporate the solvent, and pass the solution through a chromatography column (ethyl acetate: petroleum ether = 5%-30%) to obtain 4.0 g of oil.

[0410] 3.1.1.3 Synthesis of ERC-01-c3

[0411] Take ERC-01-c2 (4.0 g, 8.3 mmol), add 12 mL of formic acid, react overnight at room temperature, evaporate the solvent under reduced pressure to obtain 2.8 g of product.

[0412] 3.1.1.4 Synthesis of ERCd-01-c1

[0413] Compounds ERC-01-c3 (1.11 g, 3.0 mmol) and dlSANC-c4 (3.6 g, 8.04 mmol) were added to DMF (60 mL), followed by HOBt (2.24 g) and HBTU (3.36 g), and then DIEA (4.16 mL) was slowly added. The reaction mixture was stirred at room temperature for 3 hours. Water was then added, and the aqueous layer was extracted with dichloromethane (2 x 10 mL). The organic layers were combined and washed successively with saturated sodium bicarbonate (80 mL), water (2 x 60 mL), and saturated brine (60 mL). The solution was dried over anhydrous sodium sulfate, evaporated under reduced pressure, and purified by silica gel column chromatography (eluent: 3-15% MeOH in DCM). 3.24 g of a pale yellow solid was obtained.

[0414] 3.1.1.5 Synthesis of ERCd-01-c2

[0415] ERCd-01-c1 (3.24 g, 2.6 mmol) was dissolved in methanol (60 mL), and 10% palladium on carbon (0.3 g) and acetic acid (2.0 mL) were added. Hydrogen was then added under normal pressure, and the reaction proceeded overnight. The reaction solution was filtered through diatomaceous earth, and the filtrate was evaporated to dryness under reduced pressure to obtain an oily substance, ERCd-01-c2, 2.9 g. Its high-resolution mass spectrum is shown in Figure 1.

[0416] 3.1.1.6 Synthesis of 3'MVIP09-c1

[0417] SANCd-01-c0 (0.824 g, 1.5 mmol) and ERCd-01-c2 (1.09 g, 1.0 mmol) were added sequentially to the reaction flask, followed by 10 mL of DCM. The mixture was stirred and dissolved, and then TBTU (0.963 g) and DIPEA (0.517 g) were added sequentially. The reaction was allowed to proceed overnight. Water was added, and the mixture was extracted with DCM. The organic phase was then washed with saturated brine, dried, filtered, concentrated, and finally purified by silica gel column chromatography to obtain 1.3 g of product.

[0418] 3.1.1.7 Synthesis of 3'MVIP09-c2

[0419] 3'MVIP09-c1 (1.62 g, 1 μmol) and 10 mL of DCM were added sequentially to the reaction flask and stirred at room temperature to dissolve. Then, DMAP (0.366 g) and succinic anhydride (0.2 g, 3 μmol) were added sequentially and stirred at room temperature. The reaction was analyzed by TLC. If the reaction was satisfactory, the DCM was concentrated, water was added, and the mixture was extracted with DCM. The organic phase was then washed with saturated brine, dried over anhydrous sodium sulfate, filtered, concentrated, and finally purified by silica gel column chromatography to obtain 1.55 g of product.

[0420] 3.1.1.8 Solid Support Synthesis of 3'MVIP09

[0421] Add 3'MVIP09-c2 (0.86 g, 0.5 μmol) and 10 mL DMF to the reaction flask in sequence, dissolve, then add HBTU (0.19 g), DIPEA (0.194 g) and macroporous aminomethyl resin (2.0 g) in sequence, shake on a shaker for 24 h, filter, wash the resin with 10% methanol / DCM, and then end-cap with 25% acetic acid / pyridine to a degree of substitution of 150 μmol / g.

[0422] 3.1.2 Synthesis of Solid Support for 3'MVIP17

[0423] 3'MVIP17 Solid Support

[0424] 3.1.2.1 Synthesis of SANC-01-c1

[0425] The synthesis steps are the same as those in section 3.1.1.1.ERC-01-c1.

[0426] 3.1.2.2 Synthesis of SANC-01-c2

[0427] The synthesis steps are the same as those in section 3.1.1.2. ERC-01-c2.

[0428] 3.1.2.3 Synthesis of SANC-01-c3

[0429] The synthesis steps are the same as those for the synthesis of ERC-01-c3 in section 3.1.1.3.

[0430] 3.1.2.4 Synthesis of SANCd-01-c1

[0431] The synthesis steps are the same as those in section 3.1.1.4. Synthesis of ERCd-01-c1.

[0432] 3.1.2.5 Synthesis of SANCd-01-c2

[0433] The synthesis steps are the same as those in section 3.1.1.5. Synthesis of ERCd-01-c2.

[0434] 3.1.2.6 Synthesis of 3'MVIP17-c1

[0435] The synthesis steps are the same as those for 3.1.1.6.3'MVIP09-c1. The high-resolution mass spectrum of the synthesized 3'MVIP17-c1 is shown in Figure 2.

[0436] 3.1.2.7 Synthesis of 3'MVIP17-c2

[0437] The synthesis steps are the same as those for 3'MVIP09-c2 in section 3.1.1.7.

[0438] 3.1.2.8 Solid Support Synthesis of 3'MVIP17

[0439] The synthesis steps are as described in section 3.1.1.8 3'MVIP09 Solid Support.

[0440] 3.1.3 Synthesis of Solid Support for 3'MVIP01:

[0441] 3'MVIP01 Solid Support

[0442] Synthesis process description:

[0443] 3.1.3.1 Synthesis of 3'MVIP01-c1

[0444] The synthesis steps are the same as those in section 3.1.1.6.3'MVIP09-c1.

[0445] 3.1.3.2 Synthesis of 3'MVIP01-c2

[0446] The synthesis steps are the same as those in section 3.1.1.7.3'MVIP09-c2.

[0447] 3.1.3.3 Solid Support Synthesis of 3'MVIP01

[0448] The synthesis steps are as described in Solid Support section 3.1.1.8.3'MVIP09.

[0449] 3.2 Synthesis of 5'MVIP phosphorous amide monomer

[0450] 3.2.1 Synthesis of 5'MVIP09 phosphorusamide monomer:

[0451] 5'MVIP09 phosphorus amide monomer

[0452] 3.2.1.1 Synthesis of 5'MVIP09-ERCd-PFP-c1

[0453] Weigh ERCd-01-c2 (2.18 g, 2.0 mmol) and dissolve it in DMF (50 mL). Add monobenzyl glutarate (0.53 g, 2.4 mmol), DIPEA (0.78 g), and TBTU (0.84 g). Stir overnight at room temperature, quench with water (50 mL), extract with DCM (30 mL * 3), wash with 10% citric acid (50 mL * 3), 50 mL saturated sodium bicarbonate, and 100 mL pyridine. Dry with anhydrous sodium sulfate, filter, rotary evaporate, and purify by column chromatography to obtain product 5'MVIP09-ERCd-PFP-c1 (2.15 g).

[0454] 3.2.1.2 Synthesis of 5'MVIP09-ERCd-PFP-c2

[0455] Weigh 5'MVIP09-ERCd-PFP-c1 (2.15 g, 1.66 mmol) and 10% palladium on carbon (0.21 g), add methanol (50 mL), stir and hydrogenate overnight at room temperature. After the reaction is complete, filter palladium on carbon with diatomaceous earth and rotary evaporate to obtain crude 5'MVIP09-ERCd-PFP-c2 (1.9 g). Its high-resolution mass spectrum is shown in Figure 3.

[0456] 3.2.1.3 Synthesis of 5'MVIP09-ERCd-PFP

[0457] Weigh 1.9 g (1.58 mmol) of crude 5'MVIP09-ERCd-PFP-c2 and dissolve it in DCM (60 mL). Add DIPEA (1.33 g), cool, add pentafluorophenol trifluoroacetate (2.21 g, 7.9 mmol), stir at room temperature for 2 h, and then rotary evaporate. Dissolve it again in DCM (60 mL), wash with saturated sodium bicarbonate (30 mL*3), 10% citric acid (30 mL*1), and saturated brine (50 mL*1), dry with anhydrous sodium sulfate, filter, and rotary evaporate to obtain crude 5'MVIP09-ERCd-PFP (2.35 g). After drying, it was used directly in the next step of the reaction without purification.

[0458] 3.2.1.4 Synthesis of 5'MVIP09 phosphorous amide monomer-c1

[0459] Crude 5'MVIP09-ERCd-PFP (2.35 g, 1.58 mmol) was dissolved in DCM (60 mL), and DIPEA (0.82 g, 6.32 mmol) and 6-amino-1-hexanol (0.37 g, 3.16 mmol) were added. The mixture was stirred overnight at room temperature. Extraction was performed with 10% citric acid (30 mL), followed by extraction with DCM (30 mL x 3), washing with saturated brine (50 mL), drying over anhydrous sodium sulfate, filtration, rotary evaporation, and column purification to obtain the product 5'MVIP09 monomer-c1 (1.73 g).

[0460] 3.2.1.5 5'MVIP09 phosphorus amide monomer

[0461] Weigh 1.3 g (1.0 mmol) of 5'MVIP09 phosphoridamide monomer-c1 and dissolve it in acetonitrile (30 mL). Add diisopropyltriazole (0.22 g) and add bis-(diisopropylamino)(2-cyanoethoxy)phosphine (0.36 g, 1.2 mmol) dropwise under ice bath. React at room temperature for 4 h. After the reaction is qualified by HPLC, concentrate and purify by column chromatography to obtain the product 5'MVIP09 monomer (1.2 g).

[0462] 3.2.2 Synthesis of 5'MVIP01 phosphorusamide monomer:

[0463] 5'MVIP01 phosphorus amide monomer

[0464] Weigh YICd-01-c2 (1.12 g, 2.0 mmol) of the phosphoramidite monomer of 5'MVIP01, and perform the remaining procedures as per 3.2.1.1 to 3.2.1.5.

[0465] Example 4: Synthesis of Vector-Conjugated RNA Inhibitors

[0466] Synthesis description of the antisense chain of the coupling support (3'MVIP 09 coupling): Purge the reagent bottle with argon for at least 2 min. Add phosphoramide monomer or acetonitrile sequentially to the reagent bottle, tighten the cap, and shake until the solid is visually completely dissolved. Then add 3A molecular sieve and let stand for at least 8 h. Purge the reagent bottle with argon for at least 2 min. Add hydroflavin and dry pyridine sequentially to the reagent bottle, tighten the cap, and shake until the solid is visually completely dissolved. Store for later use. Confirm that the following operations are performed under ambient conditions of room temperature (20-30℃): Weigh 3'MVIP Solid Support, add it to the reagent bottle, add acetonitrile, shake to mix evenly, transfer to the synthesis column, and rinse the remaining portion in the reagent bottle with acetonitrile and transfer it to the synthesis column. After rinsing, fill the synthesis column with acetonitrile and record the amount of acetonitrile used. Install and fix the synthesis column according to the instrument operation.

[0467] Connect the prepared monomer solution, CAP A, CAP B, oxidant, thioreagent, activator, decapping agent, and acetonitrile to the corresponding tubing of the AKTA PILOT100, ensuring that the tubing is inserted into the bottom of the reagent bottle.

[0468] After the synthesis method is set up and the instrument is ready, click "Run" to begin the synthesis. Observe and record the peak area of ​​each determination peak online. During the synthesis process, add additional deprotection reagent as needed based on the actual amount used.

[0469] After synthesis, purge the synthesis column with argon for ≥2 hours, and unload the column according to the operating procedure. Transfer the solid support from the synthesis column to a reaction flask, add methylamine aqueous solution and ammonia, and place the reaction flask in a shaker at 35°C for 2-3 hours. Filter the solution into a round-bottom flask, wash the residual solid phase with 50% ethanol aqueous solution, filter again, and combine with the previous filtrate. Connect the round-bottom flask to a rotary evaporator, set the water temperature to 50°C, and evaporate until no distillate is obtained. Add ethanol to the round-bottom flask, mix well, and evaporate again until no distillate is obtained. Repeat the operation until a white powder appears at the bottom of the flask. Prepare a solution from the obtained white powder, purify it using reverse chromatography, and take a sample to test OD260 and purity. Aliquot the purified antisense chain solution into vials, freeze-dry for later use, and store the product sealed at -20°C.

[0470] The synthesis of the sense chain (5'MVIP09 coupled) of the coupling support was performed in the same manner as the antisense chain, except that the solid support used for column packing was a universal support. The obtained intermediate was prepared into a solution with DIPEA, and then 5'MVIP phosphorous amide monomer was added. After mixing, the reaction flask was placed in a shaker and incubated at 35°C for 2-3 hours.

[0471] Description of the annealing process for the synthesis of RNA inhibitors:

[0472] The obtained sense and antisense strands were mixed in an equimolar ratio in a reaction flask. The mixture was incubated in a water bath at 95°C for 5 minutes, then the water bath was turned off and allowed to cool naturally to below 40°C. 3M sodium acetate aqueous solution was added to the double-stranded solution and mixed thoroughly. Then, an appropriate volume of anhydrous ethanol was added and mixed thoroughly. The reaction solution was placed in a -20°C freezer for 45 minutes. A refrigerated high-speed centrifuge was pre-cooled to 4°C. Once the temperature was reached, the double-stranded solution was added, and the centrifuge was started. The centrifuged double-stranded solution was removed, the supernatant was discarded, and ultrapure water was added to completely dissolve the solid. Samples were taken to test OD260 and purity, yielding the RNA inhibitor listed in Table 14. The purified product solution was aliquoted into vials, lyophilized, and stored in sealed containers at -20°C.

[0473] The above examples merely illustrate the synthesis of RNA inhibitors coupled with 5'MVIP09 / 3'MVIP09. All RNA inhibitors described in this invention but not listed herein are subject to this rule: when the 3' end of the sense or antisense strand of the RNA inhibitor is coupled with the 3'MVIP vector structure, the solid support of 3'MVIP serves as the starting monomer for solid-phase synthesis; when the 5' end of the sense or antisense strand of the RNA inhibitor is coupled with the 5'MVIP vector structure, the 5'MVIP phosphorous acid monomer serves as the last monomer for solid-phase synthesis. Referring to the method described in this embodiment, those skilled in the art can easily synthesize the remaining RNA inhibitors involved in this invention.

[0474] Example 5: In vitro inhibition of ANGPTL3 gene expression by RNA inhibitors

[0475] The RNA inhibitors in this embodiment were selected from Table 7. Different nucleotide sugars in the sense and antisense strands had methoxy or fluorinated modifications at the 2' position. Both the sense and antisense strands were coupled with a vector. The inhibitory effect of the RNA inhibitors was verified by free uptake by PHHs cells.

[0476] Validation method: Day 0, PHHs cells were plated and used... RNAiMAX was used to transfect the compound into cells. 48 hours after transfection, [the cells were then]... Total RNA was extracted using the Super Total RNA Extraction Kit (Promega-LS1040), and cDNA was synthesized using One-Step gDNA Removal. Green qPCR SuperMix(+Dye I) was used for qPCR detection.

[0477] Data Analysis: The expression level of the target gene mRNA in each sample was calculated based on the Ct value, using the ΔΔCt relative quantification method. The relative expression level of the target gene was expressed as 2-ΔΔCT. The calculation formulas are as follows: ΔCT = average Ct value of the target gene - average Ct value of the internal control gene; ΔΔCT = ΔCT (drug-treated group) - ΔCT (control group); relative expression level of the target gene mRNA = 2-ΔΔCT; inhibition rate of the target gene = (1 - value of sample / mean value of RNAiMAX Control) × 100%, and the results are expressed as mean ± SD of three replicates. The inhibitory effects of RNA inhibitors at concentrations of 500 nM, 100 nM, and 10 nM, and at 1 nM and 0.1 nM on ANGPTL3 mRNA in PHH cells were investigated. The experimental results are shown in Tables 20 and 21.

[0478] Table 20. Inhibitory effect of RNA inhibitors on ANGPTL3 mRNA in PHH cells

[0479] Table 21. Inhibitory effect of RNA inhibitors on ANGPTL3 mRNA in PHH cells.

[0480] Example 6: In vitro inhibition of ANGPTL3 gene expression by RNA inhibitors

[0481] The RNA inhibitors used in this embodiment are selected from Table 7.

[0482] RNA inhibitors were prepared using the method described in Example 4. Following the experimental procedure of Example 2, the inhibitory effect of the RNA inhibitor on ANGPTL3 mRNA in Hep3B cells at concentrations of 1 nM and 0.01 nM was investigated; the results are shown in Tables 22 and 24. Following the experimental procedure of Example 2, the inhibitory effect of the RNA inhibitor on ANGPTL3 mRNA in Huh-7 cells at a concentration of 0.01 nM was investigated; the results are shown in Table 23.

[0483] Table 22 Inhibitory effects of RNA inhibitors on ANGPTL3 mRNA in Hep3B cells

[0484] Table 23. Inhibitory effect of RNA inhibitors on ANGPTL3 mRNA in Huh-7 cells.

[0485] Table 24. Inhibitory effect of RNA inhibitors on ANGPTL3 mRNA in Hep3B cells.

[0486] Inhibitors with significant inhibitory effects were selected, optimized, and then used in mouse experiments.

[0487] Example 7: Evaluation of the in vivo activity of RNA inhibitors using mice.

[0488] The RNA inhibitors in this embodiment were selected from Table 7, and their inhibitory effects were verified using normal mice and transgenic mice.

[0489] Example 7-1

[0490] Experimental procedure:

[0491] Grouping and administration: Forty-eight normal mice were randomly divided into seven groups (sample group, 1 control group, n=6 per group) according to body weight, under free-feeding conditions. Each group received a single subcutaneous injection of the candidate siRNA at a dose of 3 mg / kg. Approximately 0.3 ml of blood was collected from the inner canthus of the eye on days 0 (drug administration), 7, 14, and 21. The serum was collected by centrifugation at 3000 rpm and stored at -20°C for later use.

[0492] Serological marker assay: ANGPTL3 protein expression was measured using ELISA. The assay was performed according to the kit's standard operating procedure (SOP), and the plasma dilution was 20-fold as recommended in the kit instructions.

[0493] Statistical analysis was performed using SPSS 20.0 software. The inhibition rate was calculated compared with Day 0. The experimental results are shown in Table 25.

[0494] Table 25

[0495] Example 7-2

[0496] Experimental procedure:

[0497] Preparation of hANGPTL3 high-fat mouse model: Twelve hANGPTL3 mice were subjected to free-range diet. Blood samples were collected from the inner canthus of the eye on days -3, 7, 14, 21, 28, 35, 42, 49, and 56 to determine serum ANGPTL3 protein expression.

[0498] Grouping and drug administration: ANGPTL3 expression levels were measured, and subjects were randomly divided into three groups of four each: a blank control group, a positive control group, and a sequence selection group. The sequence used in the positive control group was: sense strand: SANCc-01-C6NH-invAbs GsCUCAACAfUfAfUUUGAUCAGUsAs invAb; antisense strand: UsfAsCfUGfAUfCAfAAfUAfUGfUUfGAfGsC.

[0499] The corresponding siRNA sequence fragments were administered subcutaneously at a dose of 3 mg / kg. Blood samples were collected weekly from the inner canthus of the eye after administration, and the serum was collected by centrifugation at 3000 rpm and stored at -20°C for later use.

[0500] Serological marker determination: ANGPTL3 protein expression was determined by ELISA.

[0501] Statistical analysis: SPSS 20.0 statistical analysis software was used for statistical analysis. The normalized inhibition rate of each group was calculated compared with Day-3. The calculation formula is as follows: Normalization calculation formula: A (%) = (individual index level at each time point / index level before administration) * 100%; B (%) = (indicator level at each time point of the control group / index level before administration of the control group) * 100%; Normalized index level (%) = 1 - A (%) / B (%) * 100%. The experimental results are shown in Table 26 and Figure 4.

[0502] Table 26

[0503] Table 26 Normalized inhibition rate of hANGPTL3 in serum of transgenic mice after drug administration compared to Day-3

[0504] As can be seen from Table 26 and Figure 4, Kylo-10-DS1631 has a better inhibitory effect than the positive control, and from day 28 onwards, Kylo-10-DS1631 shows a significant advantage in inhibitory effect over the positive control, and has better stability.

[0505] Example 8: Evaluation of the in vivo activity of RNA inhibitors using cynomolgus monkeys

[0506] Example 8-1: The RNA inhibitor in this example was selected from Table 7. The efficacy of the Kylo-10-DS1621 inhibitor in high-fat diet-induced obese cynomolgus monkeys was evaluated using cynomolgus monkeys.

[0507] This experiment lasted for 14 weeks, including 1 week of animal screening, 2 weeks of acclimatization training, and 11 weeks of drug administration.

[0508] Fifteen male cynomolgus monkeys (age >8 years, weight >8 kg; other indicators: TG >2 mmol / L, T-Chol <17 mmol / L) induced by a high-fat diet were initially selected from the KBI cynomolgus monkey group. The following metabolic indicators (TG, T-Chol, HDL-c, LDL-c, glucose, insulin) and ANGPTL3 were measured. After adaptive training, four animals were selected from the 15 to enter the formal experiment and drug administration phase. These four animals were divided into two groups based on blood lipid and ANGPTL3 data, with two animals in each group. At 9:00 (±30 min, before breakfast, after blood collection), each animal received two subcutaneous injections (SC) of different test products. The drug administration design is shown in Table 27 below.

[0509] Table 27

[0510] Animal weight was measured before administration / after fasting, and the dosage for each animal was calculated based on the latest weight. The day of administration was recorded as Day 0 (d0), and the day before administration was recorded as Day-1 (d-1). During the administration period, the following operations and tests were performed: cage-side observation twice daily, daily feed intake statistics, and weekly weight measurement (or weighing the day before administration); blood lipid indicators (TG, T-Chol, HDL-c, LDL-c) and ANGPTL3 were measured on days 1 before administration, 7, 14, 21, 28, 37, 44, 51, 58, 65, and 72. The results of blood lipid tests are shown in Figures 5, 7, and 9. The blood lipid test values ​​before administration on Day 0 were used as the baseline values, and the relative change (%) was calculated. The data are expressed as Mean ± SEM, N = 2. The results are shown in Figures 6, 8, and 10. The results of ANGPTL3 tests are shown in Figures 11 and 12.

[0511] From the graph and experimental results, we can see that:

[0512] Comparing the total cholesterol (T-Chol) data, the Vehicle group showed some fluctuations during the trial period without a significant trend; the drug-treated groups showed a significant reduction: the Kylo-10-DS1621 group had the lowest average reduction of 25.1% after the first dose on Day 0, and the reduction remained at 10.4% by day 72.

[0513] Comparing triglyceride (TG) data, the Vehicle group showed fluctuations during the trial period without a clear trend. The drug-treated groups showed significant reductions: the Kylo-10-DS1621 group experienced the lowest average reduction of 73.57% after the first dose on Day 0 (Day 21), and maintained a large reduction after the second dose on Day 30, with a maximum reduction of 75.85%. By the endpoint (Day 72), the reduction compared to the baseline value had recovered somewhat but remained at 56.34%.

[0514] Following drug administration, the ANGPTL3 protein level in the Vehicle group fluctuated during the trial period, without showing a significant trend. The drug-treated groups showed a significant decrease: in the Kylo-10-DS1621 group, the lowest decrease was 73.7% after the first dose on Day 0, a further decrease after the second dose on Day 30, and a maximum decrease of 83.9% on Day 44. Even at the endpoint (Day 72), the ANGPTL3 protein level was still 67.0% lower than the baseline value.

[0515] Example 8-2

[0516] The RNA inhibitors in this embodiment were selected from Table 7. The efficacy of the Kylo-10-DS1631 inhibitor in high-fat diet-induced obese cynomolgus monkeys was evaluated using cynomolgus monkeys.

[0517] This experiment lasted for 11 weeks, including 1 week before administration and 10 weeks during the administration period.

[0518] Two animals from Group A Vehicle in the previous experiment were selected for a new round of drug administration, and the following metabolic indicators (TG, T-Chol, HDL-c, LDL-c, Glucose, Insulin) and ANGPTL3 were measured. At 9:00 (±30 min, before breakfast, after blood collection), different test products were administered twice via subcutaneous injection (SC). The dosing design is shown in Table 28 below:

[0519] Table 28

[0520] Animal weight was measured before administration / after fasting, and the dosage for each animal was calculated based on the latest weight. The day of administration was recorded as Day 0 (d0), and the day before administration was recorded as Day-1 (d-1). During the administration period, the following operations and tests were performed: cage-side observation twice daily, daily feed intake statistics, and weekly weight measurement (or weighing the day before administration); blood lipid indicators (TG, T-Chol, HDL-c, LDL-c) and ANGPTL3 were measured at: d0 before administration, d7, d14, d21, d28, d35, d42, d49, d56, d63, and d70; the blood lipid test results are shown in Figures 13, 15, 17, and 19. The blood lipid test values ​​before administration at Day 0 were used as the baseline values, and the relative change (%) was calculated. The data are expressed as Mean ± SEM, N = 2; the results are shown in Figures 14, 16, 18, and 20; the ANGPTL3 test results are shown in Figures 21 and 22.

[0521] From the graph and experimental results, we can see that:

[0522] Compared with total cholesterol (T-Chol) data, the TC value decreased after administration of the Kylo-10-DS1631 inhibitor, and decreased by 39.3% compared with the baseline value by the endpoint (Day 70).

[0523] Compared with low-density lipoprotein cholesterol (LDL-C) data, it gradually decreased after five weeks of administration of Kylo-10-DS1631 inhibitor, and decreased by 25.2% compared with the baseline value at the endpoint (Day 70).

[0524] Compared with triglyceride (TG) data, the significant decrease after administration continued from the second week to the eighth week, maintaining a reduction of over 80%, reaching a maximum of 88.45% (Day 21), and still showing a 63.35% decrease compared to the baseline value at the endpoint (Day 70).

[0525] The ANGPTL3 level decreased significantly after administration, reaching a maximum of 94.20% (Day 21), and decreased by 76.97% compared to the baseline value by the endpoint (Day 70).

[0526] In summary, administration of both Kylo-10-DS1621 and Kylo-10-DS1631 inhibitors resulted in a decrease in total cholesterol, LDL cholesterol, and HDL cholesterol. Triglyceride and ANGPTL3 protein levels were significantly reduced, demonstrating excellent inhibitory effects. Furthermore, the inhibitory effect remained high until the experimental endpoint, indicating excellent stability. Compared to Kylo-10-DS1621 inhibitors, Kylo-10-DS1631 inhibitors showed a more significant inhibitory effect on triglyceride and ANGPTL3 protein levels, with ANGPTL3 levels reaching a maximum of 94.20% and TG levels reaching a maximum of 88.45% after administration. Moreover, the inhibition was more sustained, with ANGPTL3 levels still showing 76.97% inhibition and TG levels still showing 63.35% inhibition at the endpoint.

Claims

1. An RNA inhibitor for inhibiting ANGPTL3 gene expression or a pharmaceutically acceptable salt thereof, characterized in that, The RNA inhibitor is formed by base pairing of a sense strand and an antisense strand of 15-30 nucleotides in length, preferably 19-23 nucleotides in length, wherein the antisense strand includes a region complementary to the mRNA encoding ANGPTL3, and wherein the complementary region includes at least 15 consecutive nucleotides that differ from any antisense strand in Table 1 by 0, 1, 2, or 3 nucleotides.

2. The RNA inhibitor for inhibiting ANGPTL3 gene expression according to claim 1, characterized in that, The antisense strand includes a region complementary to the target sequence, which is: cucaacauauuugaucagucu SEQ ID NO: 42, ranging from position 270 to 290 in NM_014495.3, and the sense strand and antisense strand have at least 85% base complementarity.

3. The RNA inhibitor according to claim 1, or a pharmaceutically acceptable salt thereof, characterized in that, The sense strand is selected from any one of SEQ ID NO: 1-SEQ ID NO: 156 or a sequence having at least 15 consecutive nucleotides, or a sequence differing from it by one, two or three nucleotides. The antisense strand is selected from any one of SEQ ID NO: 157-SEQ ID NO: 312 or a sequence having at least 15 consecutive nucleotides, or a sequence differing from it by one, two or three nucleotides.

4. The RNA inhibitor according to claim 1, or a pharmaceutically acceptable salt thereof, characterized in that, The antisense chain is selected from the following sequences: 5'agactgaucaaauauguugagcu 3' SEQ ID NO: 199; 5'agacugaucaaauauguugagcu 3' SEQ ID NO: 198; Alternatively, it may have a sequence that is identical to the antisense strand for at least 15 consecutive nucleotides, or a sequence that differs from the antisense strand by one, two, or three nucleotides. Where g = guanylic acid, a = adenosine acid, u = uridine acid, c = cytidine acid, and t = thymine deoxyribonucleotide.

5. The RNA inhibitor according to claim 1, or a pharmaceutically acceptable salt thereof, characterized in that, The justice chain is selected from the following sequence: 5'cucaacauauuugaucagucu 3' SEQ ID NO: 42, 43; Alternatively, it may have a sequence that is identical to the positive strand of at least 15 consecutive nucleotides, or a sequence that differs from the positive strand by one, two, or three nucleotides. Where g = guanylic acid, a = adenosine acid, u = uridine acid, and c = cytidine acid.

6. The RNA inhibitor according to claim 1, or a pharmaceutically acceptable salt thereof, characterized in that, The positive strand is SEQ ID NO: 42 or a sequence having at least 15 consecutive nucleotides identical to it, or a sequence differing from it by one, two, or three nucleotides; and the antisense strand is SEQ ID NO: 198 or a sequence having at least 15 consecutive nucleotides identical to it, or a sequence differing from it by one, two, or three nucleotides: Positive strand: 5'cucaacauauuugaucagucu 3' SEQ ID NO: 42; Antisense strand: 5'agacugaucaaauauguugagcu 3' SEQ ID NO: 198; Alternatively, the sense strand is SEQ ID NO.43 or a sequence having at least 15 consecutive nucleotides identical to it, or a sequence differing from it by one, two, or three nucleotides; and the antisense strand is SEQ ID NO.199 or a sequence having at least 15 consecutive nucleotides identical to it, or a sequence differing from it by one, two, or three nucleotides. Chain of Justice: 5'cucaacauauuugaucagucu 3' SEQ ID NO: 43; Antonym: 5'agactgaucaaauauguugagcu 3' SEQ ID NO: 199; Where g = guanylic acid, a = adenosine acid, u = uridine acid, c = cytidine acid, and t = thymine deoxyribonucleotide.

7. The RNA inhibitor according to claim 1, or a pharmaceutically acceptable salt thereof, characterized in that, The RNA inhibitor has at least one nucleotide modified.

8. The RNA inhibitor according to claim 7, or a pharmaceutically acceptable salt thereof, characterized in that, The modifications include: 2'-fluorine modification, 2'-methoxy modification, thiophosphate modification, invAb modification, glycerol nucleotide, 3'-terminal deoxythymidine (dT) nucleotide, locked nucleotide, unlocked nucleotide, conformation-restricted nucleotide, restricted ethyl nucleotide, 2'-amino modified nucleotide, 2'-O-allyl modified nucleotide, 2'-C-alkyl modified nucleotide, 2'-hydroxy modified nucleotide, 2'-methoxyethyl modified nucleotide, 2'-O-alkyl modified nucleotide, 2'-phosphate modification or 2-O-(N-methylacetamide) modification, morpholino nucleotide, aminophosphate, baseless nucleotide, baseless deoxynucleotide, nucleotide containing non-natural bases, tetrahydropyran modified nucleotide, 1,5-dehydrohexyl modified nucleotide, cyclohexenyl modified nucleotide, methylphosphonate modification, 5'-phosphate modification, 5'-phosphate analog modification, heat-labile nucleotide, and one or more combinations of nucleotide analogs.

9. The RNA inhibitor according to claim 7, or a pharmaceutically acceptable salt thereof, characterized in that, The sense strand is selected from any one of SEQ ID No:313-SEQ ID No:477 or a sequence having at least 15 consecutive nucleotides identical to it, or a sequence differing from it by one, two or three nucleotides. The antisense strand is selected from any one of SEQ ID No:478-SEQ ID No:642 or a sequence having at least 15 consecutive nucleotides identical to it, or a sequence differing from it by one, two or three nucleotides.

10. The RNA inhibitor according to claim 9, or a pharmaceutically acceptable salt thereof, characterized in that, The antisense chain is selected from the following sequences: 5'AsfGsAfCUfGAfUCAAAUfAUfGUfUGAfGsCsU 3' SEQ ID NO: 519; 5'AsdGsACTGdAUCAAdAUfAUGUUGAGsCsU 3' SEQ ID NO: 520; Wherein, G = 2'-O-methylguanosine, A = 2'-O-methyladenosine, U = 2'-O-methyluridine, C = 2'-O-methylcytidine; Gs = 2'-O-methyl-3'-thioguanosine, As = 2'-O-methyl-3'-thioadenosine, Cs = 2'-O-methyl-3'-thiocytidine; fG = 2'-fluoroguanosine, fA = 2'-fluoroadenosine, fU = 2'-fluorouridine, fC = 2'-fluorocytidine; fGs = 2'-fluoro-3'-thioguanosine, T = 2'-O-methyldeoxythymidine, dA = 2'-deoxy-adenosine, dG = 2'-deoxy-guanosine.

11. The RNA inhibitor according to claim 9, or a pharmaceutically acceptable salt thereof, characterized in that, The justice chain is selected from the following sequences: 5'CsUsCAACAUfAfUfUUGAUCAGUsCsU 3' SEQ ID NO: 354; 5'CsUsCAACAUfAfUfUUGAUCAGUsCsU 3' SEQ ID NO: 355; Wherein, G = 2'-O-methylguanosine, A = 2'-O-methyladenosine, U = 2'-O-methyluridine, C = 2'-O-methylcytidine; Gs = 2'-O-methyl-3'-thioguanosine, As = 2'-O-methyl-3'-thioadenosine, Us = 2'-O-methyl-3'-thiouridine, Cs = 2'-O-methyl-3'-thiocytidine; fG = 2'-fluoroguanosine, fA = 2'-fluoroadenosine, fU = 2'-fluorouridine, fC = 2'-fluorocytidine.

12. The RNA inhibitor according to claim 11, or a pharmaceutically acceptable salt thereof, characterized in that, The sense strand is SEQ ID NO: 354 or a sequence differing from it by one, two, or three nucleotides, and the antisense strand is SEQ ID NO: 519 or a sequence differing from it by one, two, or three nucleotides: Sense strand: 5'CsUsCAACAUfAfUfUUGAUCAGUsCsU 3' SEQ ID NO: 354; Antisense strand: 5'AsfGsAfCUfGAfUCAAAUfAUfGUfUGAfGsCsU 3' SEQ ID NO: 519; Alternatively, the sense strand may be SEQ ID NO: 355 or a sequence differing from it by one, two, or three nucleotides, and the antisense strand may be SEQ ID NO: 520 or a sequence differing from it by one, two, or three nucleotides. Chain of Justice: 5'CsUsCAACAUfAfUfUUGAUCAGUsCsU 3' SEQ ID NO: 355; Antonym: 5'AsdGsACTGdAUCAAdAUfAUGUUGAGsCsU 3' SEQ ID NO: 520; Wherein, G = 2'-O-methylguanosine, A = 2'-O-methyladenosine, U = 2'-O-methyluridine, C = 2'-O-methylcytidine; Gs = 2'-O-methyl-3'-thioguanosine, As = 2'-O-methyl-3'-thioadenosine, Us = 2'-O-methyl-3'-thiouridine, Cs = 2'-O-methyl-3'-thiocytidine; fG = 2'-fluoroguanosine, fA = 2 '-Fluoroadenosine, fU = 2'-fluorouridine, fC = 2'-fluorocytidine; fGs = 2'-fluoro-3'-thioguanosine, fAs = 2'-fluoro-3'-thioadenosine, fUs = 2'-fluoro-3'-thiouridine, fCs = 2'-fluoro-3'-thiocytidine, T = 2'-O-methyldeoxythymidine, Ts = 2'-O-methyl-3'-thiodeoxythymidine, dA = 2'-deoxy-adenosine.

13. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to any one of claims 1-12, characterized in that, The RNA inhibitor also contains vector structures 5'MVIP and 3'MVIP, and the structure of the RNA inhibitor is shown in formula Ia, Ib or Ic: in, The 5'MVIP consists of a transition point R1, a connecting strand D, a linker B, a branch L, and a liver-targeting specific ligand X. It is connected to the 5' end of the sense strand or the 5' end of the antisense strand through the transition point R1, and its structure is shown in Formula I: (X-L) n -B-D-R1- I The 3'MVIP consists of a transition point R2, a connecting strand D, a linker B, a branch L, and a liver-targeting specific ligand X. It is connected to the 3' end of the sense strand or the 3' end of the antisense strand through the transition point R2, and its structure is shown in Formula II. (X-L) m -B-D-R2- II in, n and m are each an independent integer from 0 to 4, preferably an integer from 1 to 3, and n+m = an integer from 2 to 6, preferably n+m = 2, 3 or 4, more preferably 4; The transition point R1 is a heterocyclic or carbide ring structure containing N, S, or O, as shown below: Alternatively, R1 can be -NH(CH2). x CH2O-, where x is any integer from 3 to 12, preferably any integer from 4 to 6; The transition point R2 is a heterocyclic or carbide ring structure containing N, S, or O, as shown below: Alternatively, the transition point R2 can be -NH(CH2). x1 CH(OH)(CH2) x2 CH2O-, where x1 is any integer from 1 to 4, and x2 is any integer from 0 to 4; The liver-targeting specific ligand X may be the same or different within each of 5'MVIP and 3'MVIP, or between 5'MVIP and 3'MVIP, and is selected from monosaccharides and their derivatives, preferably N-acetylgalactosamine and its derivatives, and more preferably selected from the following structures: Wherein, W is selected from -OH, -NHCOOH, and -NHCO(CH2). q One or two of CH3, where q is an integer from 0 to 4; The branch L may be the same or different within each of the 5'MVIP and 3'MVIP, or between the 5'MVIP and 3'MVIP, and is selected from one or more of the following structures: Wherein, r1 is any integer from 1 to 12, r2 is any integer from 0 to 20, and Z is H, alkyl, or amide group, such as C1-C5 alkyl groups; The connector B may be the same or different within each of the 5'MVIP and the 3'MVIP, or between the 5'MVIP and the 3'MVIP, and is selected from the following structures: Wherein, A1 and A2 are each independently C, O, S, -NH-, carbonyl, amide, phosphoryl or thiophosphoryl, and r is any integer from 0 to 4; The connecting chain D may be the same or different within each of the 5'MVIP and 3'MVIP, or between the 5'MVIP and 3'MVIP, and is selected from the following structures: In this context, each p is an independent integer from 1 to 20; s is an arbitrary integer from 2 to 13; and Z1 and Z2 are the same or different substituents.

14. The RNA inhibitor according to claim 13, or a pharmaceutically acceptable salt thereof, characterized in that, The 5'MVIP is 5'MVIP01 or 5'MVIP09 as shown below, and the 3'MVIP is 3'MVIP01, 3'MVIP09 or 3'MVIP17 as shown below:

15. The RNA inhibitor according to claim 14, or a pharmaceutically acceptable salt thereof, characterized in that, The combination of the justice chain 5'MVIP and the antisense chain 3'MVIP is 5'MVIP01 / 3'MVIP01, 5'MVIP01 / 3'MVIP17, or 5'MVIP09 / 3'MVIP09, or the combination of the justice chain 5'MVIP and the justice chain 3'MVIP is 5'MVIP01 / 3'MVIP09 or 5'MVIP09 / 3'MVIP01.

16. The RNA inhibitor according to claim 15, or a pharmaceutically acceptable salt thereof, characterized in that, The RNA inhibitor is selected from Kylo-10-DS1621 and Kylo-10-DS1631.

17. The use of the RNA inhibitor or a pharmaceutically acceptable salt thereof as described in any one of claims 1-16 in the preparation of a medicament for treating and / or preventing diseases associated with elevated ANGPTL3 levels, characterized in that, The diseases mentioned include, but are not limited to, lipid metabolism disorders.

18. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises any one of the RNA inhibitors of claims 1-15 or other therapeutic agents for the treatment or prevention of ANGPTL3-related diseases.

19. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises any one of the RNA inhibitors of claims 1-16 or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient, and is in the form of an oral, intravenous, or subcutaneous or intramuscular injection, preferably a subcutaneous injection.