Method for preparing transgenic pig with human erythropoietin gene and use thereof

Abstract

Provided are a method for preparing a transgenic pig with a human erythropoietin (EPO) gene and use thereof. The human EPO gene is knocked into a porcine fibroblast cell line to construct a humanized EPO transgenic pig; further, genotypic DNA identification and protein expression analysis of the cloned pig are performed to obtain a transgenic human EPO gene-edited donor pig for xenotransplantation. By means of modifying the pig with humanized gene introduction, the present invention alleviates problems such as renal anemia encountered during xenogeneic kidney transplantation, and thus has significant application value for advancing preclinical research on pig-to-non-human primate xenotransplantation and the clinical application of pig-to-human xenotransplantation.

Description

A method for preparing and using a pig transgenic with the human erythropoietin gene. Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to a method for preparing and using a pig transgenic with the human erythropoietin gene. Background Technology

[0002] Post-renal transplant anemia (PTA) is a common complication after kidney transplantation and a major risk factor for cardiovascular complications (myocardial infarction, heart failure, and stroke). Surgical blood loss, hemodilution, delayed recovery of transplanted kidney function (DGF), and acute rejection are all causes of PTA. Ischemia-reperfusion leads to the massive release of inflammatory cytokines, which can also inhibit erythropoietin (EPO) activity, thus exacerbating anemia. Decreased transplanted kidney function is the most significant factor contributing to late-stage PTA. Furthermore, certain clinical immunosuppressants have direct anti-proliferative effects, affecting bone marrow cell proliferation and leading to a decrease in white blood cells, platelets, and red blood cells, consequently causing anemia.

[0003] EPO is an endogenous glycoprotein hormone in the human body, belonging to the colony-stimulating factor class. Its main physiological function is to bind to the erythropoietin receptor (EPOR) on the surface of erythroid progenitor cells, promoting the differentiation of erythroid stem cells in the bone marrow into erythroid blasts and the release of reticulocytes and erythrocytes from the bone marrow.

[0004] Generally, EPO levels are consistent with the function of the transplanted kidney. When transplanted kidney function declines for various reasons, EPO levels will decrease in parallel. Recombinant human erythropoietin (rHuEPO) is one of the main drugs used clinically to treat renal anemia. It can not only effectively correct anemia in patients with chronic kidney disease, but also reduce the occurrence of cardiovascular complications in these patients.

[0005] Pigs are excellent donors for xenotransplantation, but intermolecular incompatibility in xenotransplantation is a major factor affecting graft survival. Anemia after kidney transplantation also affects the recipient's postoperative recovery and survival. Therefore, the preparation of pigs transgenic with the human erythropoietin gene is of significant research value for improving post-kidney transplant anemia and alleviating kidney failure. Summary of the Invention

[0006] In order to overcome the problems existing in the prior art, the purpose of this invention is to provide a method for preparing and using a pig transgenic erythropoietin gene.

[0007] The present invention provides an sgRNA, the nucleotide sequence of which is shown in SEQ ID NO:1 or SEQ ID NO:3.

[0008] Furthermore, the nucleotide sequence of the sgRNA is shown in SEQ ID NO:1.

[0009] The present invention also provides a target DNA expressing human erythropoietin, the nucleotide sequence of which is shown in SEQ ID NO:6.

[0010] The present invention also provides a method for constructing genetically engineered animals, the method comprising the following steps:

[0011] (1) Ligate the above sgRNA with the vector to construct a knockout vector;

[0012] (2) Construct a vector expressing the target DNA sequence of human erythropoietin;

[0013] (3) The knockout vector obtained in step (1) and the vector containing the target DNA sequence of human erythropoietin obtained in step (2) were co-transfected into animal fibroblasts, and positive clones of human erythropoietin were obtained by sequencing and identification.

[0014] (4) Using positive clone cells as nuclear donors and enucleated animal oocytes as recipients, somatic cell nuclear transfer was performed to obtain reconstructed embryos.

[0015] (5) Take the reconstructed embryo and transfer it into the female animal. Feed the female animal until it gives birth, and then take the offspring to obtain the genetically engineered animal.

[0016] Furthermore, in step (1), the carrier is a pX458 carrier.

[0017] Further, in step (2), the target DNA sequence expressing human erythropoietin includes, in sequence, a left homologous arm, an ICAM2 promoter, a human thrombotic regulatory protein sequence, an IRES sequence, a CDS sequence of human erythropoietin, a PolyA sequence, and a right homologous arm.

[0018] Further, in step (2), the target DNA sequence expressing human erythropoietin is shown in SEQ ID NO:6.

[0019] Furthermore, the animal in question is a mammal.

[0020] Furthermore, the mammal in question is a pig.

[0021] The present invention also provides an endothelial cell, wherein the endothelial cell expresses human erythropoietin; the endothelial cell is prepared by the following method: constructing a genetically engineered animal according to the above method, and isolating the endothelial cell.

[0022] The present invention also provides a genetically engineered animal constructed according to the above method.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] This invention involves knocking in the human EPO gene into a porcine fibroblast cell line to construct humanized EPO transgenic pigs. Further genotypic DNA identification and protein expression analysis of the cloned pigs yielded donor pigs with humanized EPO gene-edited xenotransplantation. This invention, by modifying pigs with humanized genes, alleviates problems such as renal anemia encountered during xenotransplantation of kidney organs, and has significant application value in promoting preclinical research on pig-nonhuman primate xenotransplantation and the clinical application of pig-human xenotransplantation.

[0025] The sgRNA vector described in this invention can be transcribed into gRNA, which binds to the Cas protein to form a complex, targeting specific regions of the pig genome and causing the desired DNA cleavage, thereby editing the pig genome.

[0026] The term "vector" refers to a polynucleotide within a cell that can replicate under its own control, or a genetic element that replicates and / or is expressed by inserting into the host cell's chromosome, such as a plasmid, chromosome, virus, or transposon. Suitable vectors include, but are not limited to, plasmids, transposons, bacterial phages, and granules.

[0027] The "gRNA" described in this invention, also known as guide RNA, is an RNA transcribed from a sgRNA vector in a cell. It is specific to target sequences in the cell and can form a complex with Cas proteins.

[0028] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0029] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following embodiments. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0030] Figure 1 illustrates the editing strategy for site-specific integration of exogenous genes at the COL1A1 site.

[0031] Figure 2 shows the DNA identification results of positive cell clones.

[0032] Figure 3 shows the DNA identification results of positive cloned piglets. Detailed Implementation

[0033] The raw materials and equipment used in this invention are all known products, obtained by purchasing commercially available products.

[0034] Example 1: Screening of positive clonal sites

[0035] 1. Screening of sgRNA

[0036] Design sgRNA sequences targeting the COL1A1 site in pigs, where sgRNA1 is shown in SEQ ID No:1, sgRNA2 in SEQ ID No:2, and sgRNA3 in SEQ ID No:3. The sgRNA sequences were constructed into the PX458 plasmid. After sequencing confirmed accuracy, the plasmid containing the sgRNA sequences was extracted and electroporated into pig ear fibroblasts. GFP-positive cells were enriched after 48-72 hours. DNA was extracted from the GFP-positive cells, and the target fragment (knockout target sequence) was amplified by PCR. The primer sequences are as follows:

[0037] COL1A1-F(SEQ ID No:4):TGGCCTCTTGAGCCTTGTTG;

[0038] COL1A1-R(SEQ ID No:5):GGGTGCTTCGTCTGCTGAGTT;

[0039] The target fragment was obtained, cloned into the T vector using TA, and single colonies were selected for sequencing identification. The knockout efficiency statistics are shown in Table 1. The knockout efficiency of sgRNA1 was the highest, at 100%, and sgRNA1 was selected for subsequent experiments.

[0040] Table 1. Knockout efficiency of the COL1A1-targeting sgRNA designed in this invention.

[0041] 2. Construct a fixed-point integration platform

[0042] The editing strategy for the COL1A1 site is shown in Figure 1.

[0043] The human TM gene (hTM, human thrombomodulin), the CDS sequence of EPO (hEPO), the IRES sequence, and the polyA sequence were synthesized by Suzhou Genewise Biotech Co., Ltd. and ligated into the pUC57 plasmid to obtain vector 1.

[0044] DNA was extracted from pig ear tissue for the left and right homologous arms of the COL1A1 site and the promoter sequence of the porcine ICAM2 gene. The primers in Table 2 were added to the DNA for PCR. The PCR products were recovered by gel cloning and ligated into the pClone007 Versatile Simple Vector to obtain vector 2.

[0045] The fragments obtained from vectors 1 and 2 were seamlessly ligated using overlap PCR, with EcoRI and NotI restriction sites introduced at both ends to obtain the target DNA sequence (SEQ ID No: 6). This target DNA sequence was then ligated into the pCDNA3.1 vector to obtain the EPO expression vector. Sequencing confirmed the sequence was correct, and the plasmid (EPO expression vector) was extracted for subsequent steps.

[0046] Table 2 Primers for constructing the site-specific integration vector designed in this invention

[0047] SEQ ID No:6:

[0048] 3. The EPO expression vector was double-digested with EcoRI and NotI restriction endonucleases. The target fragment was recovered by gel electrophoresis and purified. It was then mixed with the knockout vector PX458-sgRNA1 constructed in step 1 and transfected into porcine ear fibroblasts. GFP-positive cells were enriched, and DNA was identified by PCR, as shown in Table 3. The sequences of the identification primers are shown in SEQ ID Nos. 17–22, yielding positive cloning sites at the COL1A1 site. The results of positive cloning site identification are shown in Figure 2.

[0049] Table 3. Primer sequences used for DNA identification of transfected pig ear fibroblasts.

[0050] Example 2: Construction of humanized EPO transgenic pigs

[0051] 1. Using somatic cell transplantation technology, positive cloning sites are fused with enucleated porcine oocytes to obtain human TM and human EPO transgenic pigs. The DNA and protein levels of the newborn transgenic piglets (cloned piglets) are then verified.

[0052] (1) DNA level identification is shown in Figure 3: PCR identification showed that all five piglets integrated transgenes at the porcine COL1A1 site.

[0053] (2) Protein level identification: Serum was separated from newborn piglets, and the EPO level in the serum was detected by ELISA. The results are shown in Table 4. The average value of transgenic EPO expression in the blood of the five piglets was significantly higher than that in human serum. Among them, the serum of the EPO group was obtained from transgenic piglets, the serum of the HUMAN group was obtained from humans, and the serum of the WT group was obtained from wild piglets.

[0054] Table 4. EPO concentration in serum of transgenic piglets

[0055] 2. Endothelial cells were isolated from one cloned piglet obtained in step 1 and cultured in vitro. The expression of EPO in the cell culture supernatant was detected by ELISA. The results are shown in Table 5. The expression of transgenic EPO was detected in the culture supernatant of cloned piglet endothelial cells and was significantly higher than that in human endothelial cell culture supernatant.

[0056] Table 5. EPO concentration in the supernatant of endothelial cell culture from transgenic piglets

[0057] In summary, this invention involves knocking in the human EPO gene into a porcine fibroblast cell line to construct humanized EPO transgenic pigs. Further genotypic DNA identification and protein expression analysis of the cloned pigs yielded donor pigs with humanized EPO gene-edited xenotransplantation. This invention, by modifying pigs with humanized genes, alleviates problems such as renal anemia encountered during xenotransplantation of kidney organs, and has significant application value in promoting preclinical research on pig-nonhuman primate xenotransplantation and the clinical application of pig-human xenotransplantation.

Claims

1. An sgRNA, characterized in that, The nucleotide sequence of the sgRNA is shown in SEQ ID NO:1 or SEQ ID NO:

3.

2. The sgRNA according to claim 1, characterized in that, The nucleotide sequence of the sgRNA is shown in SEQ ID NO:

1.

3. A target DNA expressing human erythropoietin, characterized in that, The nucleotide sequence of the target DNA is shown in SEQ ID NO:

6.

4. A method for constructing genetically engineered animals, characterized in that, The method includes the following steps: (1) The sgRNA described in any one of claims 1-2 is linked to a vector to construct a knockout vector; (2) Construct a vector expressing the target DNA sequence of human erythropoietin; (3) The knockout vector obtained in step (1) and the vector containing the target DNA sequence of human erythropoietin obtained in step (2) were co-transfected into animal fibroblasts, and positive clones of human erythropoietin were obtained by sequencing and identification. (4) Using positive clone cells as nuclear donors and enucleated animal oocytes as recipients, somatic cell nuclear transfer was performed to obtain reconstructed embryos. (5) Take the reconstructed embryo and transfer it into the female animal. Feed the female animal until it gives birth, and then take the offspring to obtain the genetically engineered animal.

5. The method according to claim 4, characterized in that, In step (1), the carrier is a pX458 carrier.

6. The method according to claim 4, characterized in that, In step (2), the target DNA sequence expressing human erythropoietin includes, in sequence, a left homologous arm, an ICAM2 promoter, a human thrombotic regulatory protein sequence, an IRES sequence, a CDS sequence of human erythropoietin, a PolyA sequence, and a right homologous arm.

7. The method according to claim 6, characterized in that, In step (2), the target DNA sequence expressing human erythropoietin is shown in SEQ ID NO:

6.

8. The method according to claim 4, characterized in that, The animal in question is a mammal.

9. The method according to claim 8, characterized in that, The mammal in question is a pig.

10. An endothelial cell, characterized in that, The endothelial cells are endothelial cells expressing human erythropoietin; the endothelial cells are prepared by constructing a genetically engineered animal according to any one of claims 4-9, and then isolating the endothelial cells.

11. A genetically engineered animal constructed according to the method of any one of claims 4-9.

Images