Combination therapies for the treatment of cancer

Abstract

Provided are methods of treating cancer, such as breast cancer, in a patient in need thereof, comprising administering to the patient an AKT inhibitor, such as capivasertib or a pharmaceutically acceptable salt thereof, in combination with a KAT6A inhibitor. Also provided are pharmaceutical compositions comprising an AKT inhibitor, such as capivasertib or a pharmaceutically acceptable salt thereof, and a KAT6A inhibitor, and a pharmaceutically acceptable excipient, and the use of such pharmaceutical compositions in the methods described herein.

Description

[0001] COMBINATION THERAPIES FOR THE TREATMENT OF CANCER CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to European Patent Application No. 25165138.6, filed March 20, 2025, the disclosure of which is incorporated by reference herein.

[0003] FIELD

[0004] The specification relates to the use of an AKT inhibitor in combination with a KAT6A inhibitor to treat cancer, for example breast cancer.

[0005] SEQUENCE LISTING

[0006] The present application is filed with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled 300134-PCT01-NP Sequence listing.xml, created on 13 March 2026, which is 17.3 kB in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

[0007] BACKGROUND

[0008] Breast cancer remains a major cause of death. Although effective treatments (especially endocrine therapies such as aromatase inhibitors and selective estrogen modulators) have been developed over the last 50 years, they may not be effective in all cancer types, or may lose potency over time due to the development of tumour resistance. As such, new ways to treat cancer (and particularly advanced or metastatic breast cancer) are still needed.

[0009] One modern approach to treating breast cancer relies on the use of targeted therapies - such as receptor tyrosine kinase inhibitors (TKIs) - to deal with cancers not managed under current paradigms or to overcome the pathways by which cancer cells evolve resistance. For example, AKT is a serine / threonine-specific protein kinase that operates as part of the PI3K / AKT / PTEN pathway, playing a key role in multiple cellular processes such as glucose metabolism, apoptosis, cell proliferation, transcription, and cell migration. Mammalian cells express three closely related AKT isoforms encoded by different genes: AKT1 (protein kinase Ba), AKT2 (protein kinase BP), and AKT3 (protein kinase By). Capivasertib, sold under the brand name TRUQAP, is a selective inhibitor of all three AKT isoforms, and has demonstrated utility in the treatment of certain types of breast cancer. However, the evolutionary nature of cancer means that resistance to capivasertib treatment itself is likely to develop over time, reducing its efficacy.

[0010] The KAT6A gene encodes lysine (K) acetyltransferase 6A (KAT6A) that is a member of the MYST family. As described herein, from genome-scale CRISPR screens, KAT6A has been identified as a gene that when "knocked out" increases sensitivity to capivasertib in estrogen receptor positive (ER+) breast cancer cell lines. The present specification therefore discloses that KAT6A inhibition can further sensitise certaintypes of cancer cell to inhibition with AKT, potentially providing a way to increase the efficacy of drugs such as capivasertib both up-front and after resistance to earlier capivasertib-based therapy has developed.

[0011] It has therefore been determined that treatment with a KAT6A inhibitor may overcome resistance, resensitizing cancer to the therapeutic effects of inhibiting AKT. As such, combinations of an AKT inhibitor and a KAT6A inhibitor may act synergistically together in cancer therapy.

[0012] SUMMARY

[0013] The present specification provides a means for enhancing the anti-proliferative effects of AKT treatment in cancer (for example breast cancer) utilising a KAT6A inhibitor in combination with an AKT inhibitor. In an aspect, there is provided a method of treating cancer in a patient in need thereof, comprising administering to the patient an amount of an AKT inhibitor in combination with an amount of a KAT6A inhibitor, wherein the amount of the AKT inhibitor and the amount of a KAT6A inhibitor together comprise a therapeutically effective amount.

[0014] In a further aspect, there is provided an AKT inhibitor for use in the treatment of cancer in a patient in need thereof, wherein the AKT inhibitor is administered in combination with a KAT6A inhibitor.

[0015] In a further aspect, there is provided a KAT6A inhibitor for use in the treatment of cancer in a patient in need thereof, wherein the KAT6A inhibitor is administered in combination with an AKT inhibitor.

[0016] In a further aspect, there is provided the use of an AKT inhibitor in the manufacture of a medicament for the treatment of cancer in a patient in need thereof, wherein the AKT inhibitor is administered in combination with a KAT6A inhibitor.

[0017] In a further aspect, there is provided the use of a KAT6A inhibitor in the manufacture of a medicament for the treatment of cancer in a patient in need thereof, wherein the KAT6A inhibitor is administered in combination with an AKT inhibitor.

[0018] In a further aspect, there is provided a kit comprising (a) an AKT inhibitor, (b) instructions for use of the AKT inhibitor in combination with a KAT6A inhibitor for the treatment of cancer in a patient in need thereof, and optionally (c) the KAT6A inhibitor and / or an antiestrogen.

[0019] In a further aspect, there is provided a kit comprising (a) a KAT6A inhibitor, (b) instructions for use of the KAT6A inhibitor in combination with an AKT inhibitor for the treatment of cancer in a patient in need thereof, and optionally (c) the AKT inhibitor and / or an antiestrogen.

[0020] In a further aspect, there is provided a pharmaceutical composition comprising an AKT inhibitor and a KAT6A inhibitor, and a pharmaceutically acceptable excipient. In a further aspect, the pharmaceutical composition may be used in any of the methods described herein.

[0021] Further aspects of the disclosure will be apparent to one skilled in the art from reading this specification.LIST OF FIGURES

[0022] Figures 1 to 3: Bar graphs representing day 18 of proliferation of MCF7 (Figure 1), T47D (Figure 2) and CAMA-l (Figure 3): CTRLs and KAT6A KOs treated with capivasertib, fulvestrant and combination. MCF7 lpM, T47D 750nM, CAMA-l 400nM capivasertib; fulvestrant lOnM for all cells used for this study. Data are plotted as mean ± SD (n = 3). Statistical analysis one way ANOVA vs CTRL, *p <= 0.05, **p <= 0.01, ***p <= 0.001, ****p <= 0.0001.

[0023] Figures 4 to 6: Proliferation curves of MCF7 (Figure 4), T47D (Figure 5) and CAMA1 (Figure 6): CTRL and KAT6A KOs treated with capivasertib (capiva) (MCF7 lpM, T47D 750nM, CAMA1 400Nm). Data are plotted as mean ± SD (n = 3). Statistical analysis 2-way ANOVA vs CTRL, *p <= 0.05, **p <= 0.01, ***p <= 0.001, ****p <= 0.0001.

[0024] Figures 7 to 9: Dose response graphs of MCF7 (CTRL, KAT6A KO, Figure 7), T47D (CTRL, KAT6A KO, Figure 8), CAMA-l (CTRL, KAT6A KO, Figure 9) cells used in this study treated for 7 days with capivasertib (capiva) (5 different doses). Dose responses were calculated using Graphpad Prism (n=2).

[0025] Figures 10 to 12: Proliferation curves show the effect on parental MCF7 (Figure 10), T47D (Figure 11) and CAMA-l (Figure 12) of KAT6Ai monotherapy and in combination with capivasertib. CTx-648 (PF-9363) (K6Ai) was used: 3pM in MCF7, lpM in T47D and lpM in CAMA-l. Capivasertib (capiva) was used: lpM in MCF7, 750nM in T47D and 400nM in CAMA-l. Data are plotted as mean ± SD (n = 3). Statistical analysis 2-way ANOVA vs CTRL, *p <= 0.05, **p <= 0.01, ***p <= 0.001, ****p <= 0.0001.

[0026] Figures 13 to 15: Proliferation curves show the effect on MCF7 (Figure 13), T47D fulvestrant resistant cells (FulvR) (Figure 14) and MCF7 ESRI Y537S (Figure 15) of KAT6Ai (K6Ai) monotherapy and in combination with capivasertib. KAT6Ai was used: 3pM in MCF7 and lpM in T47D. Capivasertib (capiva) was used: lpM in MCF7 and 750nM in T47D. Cells were cultivated with continuous fulvestrant (fulv) lOOnM. Data are plotted as mean ± SD (n = 2). Statistical analysis 2-way ANOVA vs CTRL, *p <= 0.05, **p <= 0.01, ***p <= 0.001, ****p <= 0.0001.

[0027] Figures 16 to 18: Proliferation curves show the effect on MCF7 (Figure 16), T47D (Figure 17) and CAMA-1 capivasertib resistant cells (CapiR) (Figure 18) of KAT6Ai (K6Ai) monotherapy and in combination with capivasertib. KAT6Ai was used: 3pM in MCF7, lpM in T47D and lpM in CAMA-l. Cells were cultivated with continuous capivasertib (capiva) lOpM. Data are plotted as mean ± SD (n = 3). Statistical analysis 2-way ANOVA vs CTRL, *p <= 0.05, **p <= 0.01, ***p <= 0.001, ****p <= 0.0001.Figure 19: Live / dead staining NIR780 (Thermo Fisher Scientific) in T47D CapiR KAT6A KO. Cells were analysed on a FACSymphony (Becton Dickinson, USA). Cell death gating was carried out using FlowJo_vl0.8.0 software and plotted using GraphPad PRISM 8. Statistical analysis t test vs CTRL *p <= 0.05, **p <= 0.01, ***p <= 0.001, ****p <= 0.0001 (n=2).

[0028] DETAILED DESCRIPTION

[0029] The disclosure may be more fully appreciated by reference to the following description, including the following definitions and examples.

[0030] It is to be appreciated that certain features of the invention which are, for clarity, described herein in the context of separate embodiments, may also be provided in combination in a single embodiment. That is, unless obviously incompatible or excluded, each individual embodiment is deemed to be combinable with any other embodiment(s) and such a combination is considered to be another embodiment. Conversely, various features of the invention that are, for brevity, described in the context of a single embodiment, may also be provided separately or in any sub-combination.

[0031] All documents cited herein are each entirely incorporated by reference herein, including all data, tables, figures, and text presented in the cited documents.

[0032] Unless otherwise defined herein, scientific and technical terms used in the present disclosure shall have the meanings that are commonly understood by one of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.

[0033] When a value is expressed as an approximation by use of the descriptor "about" it will be understood that the particular value forms another embodiment. In general, use of the term "about" indicates approximations that can vary depending on the desired properties sought to be obtained by the disclosed subject matter and is to be interpreted in the specific context in which it is used, based on its function. The person skilled in the art will be able to interpret this as a matter of routine. In some cases, the number of significant figures used for a particular value may be one non-limiting method of determining the extent of the word "about." In other cases, the gradations used in a series of values may be used to determine the intended range available to the term "about" for each value. Where present, all ranges are inclusive and combinable. That is, references to values stated in ranges include every value within that range.

[0034] The terms "treat," "treating," and "treatment" refer to at least partially alleviating, inhibiting and / or ameliorating a condition, disorder, or disease, such as cancer, for example breast cancer. The term "treatment of cancer" includes both in vitro and in vivo treatments, including in warm-blooded animals such as humans. The effectiveness of treatment of cancer can be assessed in a variety of ways, includingbut not limited to: inhibiting cancer cell proliferation (including the reversal of cancer growth); promoting cancer cell death (e.g., by promoting apoptosis or another cell death mechanism); improvement in symptoms; duration of response to the treatment; delay in progression of disease; and prolonging survival. Treatments can also be assessed with regard to the nature and extent of side effects associated with the treatment. Furthermore, effectiveness can be assessed with regard to biomarkers, such as levels of expression or phosphorylation of proteins known to be associated with particular biological phenomena. Other assessments of effectiveness are known to those of skill in the art.

[0035] The phrase "in combination with" and similar terms encompass administration of two or more active pharmaceutical ingredients to a patient and include simultaneous administration in separate compositions, administration at different times in separate compositions, or administration in a composition in which two or more active pharmaceutical ingredients are present.

[0036] In some embodiments, administration of the AKT inhibitor and the KAT6A inhibitor is separate, sequential, or simultaneous.

[0037] In some embodiments, administration of the AKT inhibitor and the KAT6A inhibitor is separate.

[0038] In some embodiments, administration of the AKT inhibitor and the KAT6A inhibitor is sequential.

[0039] In some embodiments, administration of the AKT inhibitor and the KAT6A inhibitor is simultaneous. The term "therapeutically effective amount" refers to that amount of a compound or combination of compounds as described herein that is sufficient to effect the intended application including, but not limited to, disease treatment. A therapeutically effective amount may vary depending upon the intended application (in vitro or in vivo), or the patient and disease condition being treated (e.g., the weight, age and gender of the patient), the severity of the disease condition, the manner of administration, etc. which can readily be determined by one of ordinary skill in the art. The term also applies to a dose that will induce a particular response in target cells (e.g. the amount of apoptosis). The specific dose will vary depending on the particular compounds chosen, the dosing regimen to be followed, whether the compound is administered in combination with other compounds, timing of administration, the tissue to which it is administered, and the physical delivery system in which the compound is carried.

[0040] In one aspect, there is provided a pharmaceutical composition comprising an AKT inhibitor, a KAT6A inhibitor, and a pharmaceutically acceptable excipient.

[0041] The term "pharmaceutically acceptable" is used to specify that an object (for example a salt, dosage form [such as a tablet or capsule] or excipient [such as a diluent or carrier]) is suitable for use in patients. An example list of pharmaceutically acceptable salts can be found in the "Handbook of Pharmaceutical Salts: Properties, Selection and Use", P. H. Stahl and C. G. Wermuth, editors, Weinheim / Zurich:Wiley-VCH / VFiCA, 2002 or subsequent editions.Pharmaceutically acceptable acid addition salts can be formed with inorganic acids and organic acids. Inorganic acids from which salts can be derived include, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid and phosphoric acid. Organic acids from which salts can be derived include, for example, acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid and salicylic acid. Pharmaceutically acceptable base addition salts can be formed with inorganic and organic bases. Inorganic bases from which salts can be derived include, for example, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese and aluminium. Organic bases from which salts can be derived include, for example, primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins. Examples include isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, and ethanolamine.

[0042] Cancer Treatment

[0043] In some embodiments, the treatment of cancer is treatment of an animal cancer (for example a mammalian cancer such as a human cancer).

[0044] In some embodiments, the cancer is hormone-sensitive cancer (for example estrogen-sensitive cancer or androgen-sensitive cancer). "Estrogen or androgen-sensitive" means that growth of the cancer is at least partially driven by the respective hormonal pathway, such that blocking the hormone attenuates growth and effects treatment.

[0045] In some embodiments, the cancer is breast cancer, prostate cancer, ovarian cancer, endometrial cancer, testicular cancer, lung cancer, colon cancer, brain cancer, head and neck cancer, stomach cancer, pancreatic cancer, melanoma, endocrine cancer, uterine cancer, or bladder cancer.

[0046] In some embodiments, the cancer is breast cancer (for example advanced breast cancer or metastatic breast cancer, such as locally advanced breast cancer or metastatic breast cancer).

[0047] In some embodiments, the cancer is advanced breast cancer.

[0048] In some embodiments, the cancer is locally advanced breast cancer.

[0049] In some embodiments, the cancer is metastatic breast cancer.

[0050] In some embodiments, the cancer is hormone-sensitive breast cancer.

[0051] In some embodiments, the cancer is estrogen-sensitive breast cancer.

[0052] In some embodiments, the cancer is ovarian cancer.

[0053] In some embodiments, the cancer is estrogen-sensitive ovarian cancer.

[0054] In some embodiments, the cancer is endometrial cancer.

[0055] In some embodiments, the cancer is estrogen-sensitive endometrial cancer.In some embodiments, the cancer is prostate cancer.

[0056] In some embodiments, the cancer is androgen-sensitive prostate cancer.

[0057] Patient selection

[0058] In some embodiments, the patient is a human patient or animal (e.g. mammalian) patient.

[0059] In some embodiments, the patient is a human patient.

[0060] In some embodiments, the cancer is hormone receptor-positive (HR+) breast cancer. Hormone receptorpositive (HR+) tumour cells express surface receptors that bind to the hormones estrogen and / or progesterone. HR+ status can be determined by methods known in the art, for example by IHC tests. In some embodiments, the cancer is estrogen receptor positive (ER+) breast cancer. Estrogen receptorpositive (ER+) tumour cells express surface receptors that bind to the estrogen hormone. ER+ status can be determined by methods known in the art, for example by IHC tests.

[0061] In some embodiments, the cancer is a HER2-negative cancer, meaning that the tumour cells do not express human epidermal growth factor receptor 2 (HER2). This is histologically confirmed from biopsy taken at diagnosis or from metastasis. In some embodiments, HER2-negative is defined as immunohistochemistry (IHC) scores of 0, 1+, or 2+ and in situ hybridisation (ISH)-negative.

[0062] In some embodiments, the cancer is HR+, HER2-negative breast cancer.

[0063] In some embodiments, the cancer is ER+, HER2-negative breast cancer.

[0064] In some embodiments, the cancer (such as breast cancer) comprises one or more AKT1, PIK3CA and / or PTEN gene alterations. For example, the cancer comprises a cancerous cell (for example, a population of cancerous cells, such as the majority of cancerous cells in a given population) with such a gene alteration. The human wild-type PIK3CA, AKT1 and PTEN genes are identified in Table A.

[0065] Table A

[0066] Gene Full Name Ensemble Transcript Refseq

[0067] PIK3CA phosphatidylinositol-4,5- ENST00000263967 NM_006218.2

[0068] bisphosphate 3-kinase, catalytic

[0069] subunit alpha

[0070] AKT1 AKT serine / threonine kinase 1 ENST00000555528.5 NM_005163

[0071] PTEN phosphatase and tensin homolog ENST00000371953 NM_000314.4

[0072]

[0073] The PIK3CA and AKT1 genes are oncogenes, and activating mutations in these genes lead to activation of the PI3K / AKT signalling pathway. Accordingly, in some embodiments, the cancer (such as breast cancer) comprises one or more AKT1 and / or PIK3CA activating gene mutations. The PIK3CA and AKT1 gene mutation status may be determined by methods known in the art.

[0074] The PTEN gene is a tumour suppressor gene. Alterations to the PTEN gene that result in reduction or loss of function of the encoded PTEN protein result in activation of the PI3K / AKT pathway. Accordingly, in some embodiments, the cancer (such as breast cancer) comprises one or more loss of function PTEN gene alterations. The PTEN gene alteration status may be determined by methods known in the art. In some embodiments, the cancer (such as breast cancer) comprises one or more AKT1 and / or PIK3CA activating gene mutations, and / or one or more loss of function PTEN gene alterations.

[0075] In some embodiments, the cancer (such as breast cancer) comprises an E17K mutation in the AKT1 gene. In some embodiments, the cancer (such as breast cancer) comprises one or more mutations in the PIK3CA gene selected from R88Q, N345K, C420R, E542K, E545A, E545D, E545G, E545K, E545Q, Q546E, Q546K, Q546P, Q546R, M1043V, M1043I, H1047L, H1047R, H1047Y, and G1049R.

[0076] In some embodiments, the cancer (such as breast cancer) comprises one or more alterations in the PTEN gene selected from (a) one or more mutations in the PTEN gene selected from C124R, C124S, G129E, G129V, G129R, R130Q, R130G, R130L, R130P, C136R, C136Y, S170R, and R173C; (b) any nonsense (including stop codons), frameshift, or splice site alteration, including those that affect the start codon; and (c) any homozygous deletion of one or more exons, regardless of transcript.

[0077] In some embodiments, the cancer (such as breast cancer) comprises one or more alterations in the PTEN gene selected from (a) one or more mutations in the PTEN gene selected from C124R, C124S, G129E, G129V, G129R, R130Q, R130G, R130L, R130P, C136R, C136Y, S170R, and R173C; (b) any nonsense (including stop codons), frameshift, or splice site alteration, including those that affect the start codon; (c) any homozygous deletion of one or more exons, regardless of transcript; and (d) any rearrangement that disrupts protein function, regardless of transcript; intragenic events including duplications of only part of the gene, deletions, or inversions; and / or translocations, deletions, or inversions where one breakpoint is in PTEN and the other breakpoint is in another gene or intergenic region.

[0078] In some embodiments, the cancer (such as breast cancer) comprises one or more AKT1, PIK3CA, and / or PTEN alterations described herein.

[0079] In some embodiments, the cancer is HR+ (such as ER+), HER2-negative breast cancer comprising one or more AKT1, PIK3CA and / or PTEN gene alterations.In some embodiments, the cancer is HR+ (such as ER+), HER2-negative breast cancer comprising one or more AKT1, PIK3CA and / or PTEN gene alterations, as described herein.

[0080] In some embodiments, the cancer is locally advanced or metastatic HR+ (such as ER+), HER2-negative breast cancer comprising one or more AKT1, PIK3CA and / or PTEN gene alterations.

[0081] In some embodiments, the cancer is locally advanced or metastatic HR+ (such as ER+), HER2-negative breast cancer comprising one or more AKT1, PIK3CA and / or PTEN gene alterations, as described herein. In some embodiments, the cancer is locally advanced or metastatic HR+ (such as ER+), HER2-negative breast cancer comprising one or more AKT1, PIK3CA and / or PTEN gene alterations.

[0082] In some embodiments, the cancer is locally advanced or metastatic HR+ (such as ER+), HER2-negative breast cancer comprising one or more AKT1, PIK3CA and / or PTEN gene alterations, as described herein. The sample for testing of PIK3CA, AKT1 and PTEN gene mutation status may be any sample type from the patient that contains tumour genomic material (e.g. tissue, blood, plasma or cell-free DNA). In some embodiments, the sample is a breast tumour tissue sample.

[0083] There are a variety of methods which are routinely used in the art to detect genetic mutations, and any suitable method can be used.

[0084] Next-generation sequencing (NGS) technologies can detect hundreds of alterations across multiple genes in a single test, and as the skilled person will be aware, NGS can be used to define tumour biomarker status. A single NGS assay can sensitively detect activating PIK3CA mutations and AKT1 mutations across their entire gene structures, as well as PTEN alterations and gene deletion.

[0085] In some embodiments, NGS is used to detect the presence or absence of any of the mutations of PIK3CA, AKT1 and PTEN described herein in a sample containing tumour cells obtained from the patient. In some embodiments, the sample is a breast tumour tissue sample.

[0086] Commercially available NGS technologies include the FoundationOne*CDx (FICDx) NGS Clinical Trial Assay (from Foundation Medicine, Cambridge, MA, USA), which can be used to detect single-nucleotide variations, insertion and deletion alterations, and copy number alterations in DNA isolated from formalin-fixed paraffin-embedded tumour tissue specimens. The GuardantOMNI™ (Guardant Health, Redwood City, CA, USA) detects single-nucleotide variations, insertion and deletion alterations, copy number alterations, or fusions in 500 genes, including PIK3CA, AKT1, and PTEN alterations, using NGS of cfDNA extracted from plasma samples. Burning Rock Biotech Limited (Guangzhou, China) is developing a liquid biopsy approach, with NGS-based circulating tumour DNA (ctDNA) assays.Jones R.H. et al. (Lancet Oncol, 21: 345-57 (2020)) describe using pyrosequencing and / or digital-droplet PCR [ddPCR] tests on tumour tissue or cell-free DNA [cfDNA]) or displayed loss of PTEN expression by immunohistochemistry to identify tumour PI3K / AKT / PTEN pathway status.

[0087] In some embodiments, the patient is an adult.

[0088] In some embodiments, the patient is a post-menopausal woman or a pre-menopausal woman.

[0089] A woman is an adult human female of the sex designed to produce large gametes (eggs).

[0090] In some embodiments, the patient is a post-menopausal woman.

[0091] In some embodiments, the patient is a pre-menopausal woman.

[0092] In some embodiments, the patient has previously received endocrine therapy (such as treatment with a selective estrogen receptor degrader (SERD), a selective estrogen receptor modulator (SERM) and / or an aromatase inhibitor (Al)).

[0093] In some embodiments, the patient's cancer has reached the stage of maximal response (minimal residual disease) during or after endocrine therapy (such as treatment with a SERD, a SERM and / or an Al). In some embodiments, the cancer is resistant to endocrine therapy, such as treatment with a SERD, a SERM and / or an AL

[0094] In some embodiments, the cancer is resistant to treatment with fulvestrant.

[0095] In some embodiments, the patient's cancer has progressed during or after previous endocrine therapy, such as treatment with a SERD, a SERM and / or an Al.

[0096] In some embodiments, the patient's cancer has progressed during or after previous treatment with fulvestrant.

[0097] When a cancer's growth has "progressed", its growth is no longer suitably controlled by the therapy in question.

[0098] In some embodiments, the patient has previously received treatment with an AKT inhibitor, such as capivasertib.

[0099] In some embodiments, the patient's cancer has reached the stage of maximal response (minimal residual disease) during or after treatment with an AKT inhibitor, such as capivasertib.

[0100] In some embodiments, the cancer is resistant to treatment with an AKT inhibitor, such as capivasertib. In some embodiments, the cancer is resistant to treatment with capivasertib.

[0101] In some embodiments, the patient's cancer has progressed during or after previous treatment with an AKT inhibitor, such as capivasertib.

[0102] In some embodiments, the patient's cancer has progressed during or after previous treatment with capivasertib.

[0103] AKT InhibitorsIn some embodiments, the AKT inhibitor is any molecule which binds to and inhibits the activity of one or more AKT isoforms (for example having a plC5o of >4.5, >5, >6, >7, >8 or >9 when tested in a standard potency assay, for example as described in W02009 / 047563).

[0104] In some embodiments, the AKT inhibitor is selected from capivasertib or a pharmaceutically acceptable salt thereof, miransertib or a pharmaceutically acceptable salt thereof, BAY1125976 or a pharmaceutically acceptable salt thereof, borussertib or a pharmaceutically acceptable salt thereof, AT7867 or a pharmaceutically acceptable salt thereof, CCT128930 or a pharmaceutically acceptable salt thereof, A-674563 or a pharmaceutically acceptable salt thereof, PHT-427 or a pharmaceutically acceptable salt thereof, Akti-1 / 2 or a pharmaceutically acceptable salt thereof, AT13148 or a pharmaceutically acceptable salt thereof, SC79 or a pharmaceutically acceptable salt thereof, miltefosine or a pharmaceutically acceptable salt thereof, perifosine or a pharmaceutically acceptable salt thereof, MK-2206 or a pharmaceutically acceptable salt thereof, RX-0201 or a pharmaceutically acceptable salt thereof, erucylphosphocholine or a pharmaceutically acceptable salt thereof, PBI-05204 or a pharmaceutically acceptable salt thereof, GSK690693 or a pharmaceutically acceptable salt thereof, afuresertib or a pharmaceutically acceptable salt thereof, uprosertib or a pharmaceutically acceptable salt thereof, XL-418 or a pharmaceutically acceptable salt thereof, ipatasertib or a pharmaceutically acceptable salt thereof, rupitasertib or a pharmaceutically acceptable salt thereof, pifusertib or a pharmaceutically acceptable salt thereof, NTQ1062 or a pharmaceutically acceptable salt thereof, and HU-7691 or a pharmaceutically acceptable salt thereof.

[0105] In some embodiments, the AKT inhibitor is capivasertib or a pharmaceutically acceptable salt thereof. Capivasertib has the following chemical structure:

[0106]

[0107] The free base of capivasertib is known by the chemical name (S)-4-amino-N-(l-(4-chlorophenyl)-3-hydroxypropyl)-l-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)piperidine-4-carboxamide). Capivasertib is disclosed in W02009 / 047563, and also describes its synthesis.In some embodiments, the AKT inhibitor is capivasertib.

[0108] In some embodiments, the AKT inhibitor is a pharmaceutically acceptable salt of capivasertib.

[0109] MK-2206 has the following chemical structure:

[0110]

[0111] The free base of MK-2206 is known by the chemical name 8-[4-(l-aminocyclobutyl)phenyl]-9-phenyl[l,2,4]triazolo[3,4-f][l,6]naphthyridin-3(2H)-one. MK-2206 is disclosed in W02008070016. GSK690693 has the following chemical structure:

[0112] OH

[0113]

[0114] The free base of GSK690693 is known by the chemical name 4-(2-(4-amino-l,2,5-oxadiazol-3-yl)-l-ethyl-7-{[(3S)-3-piperidinylmethyl]oxy}-lH-imidazo[4,5-c]pyridin-4-yl)-2-methyl-3-butyn-2-ol. GSK690693 is disclosed in W02007058850.

[0115] NTQ1062 has the following chemical structure:

[0116]

[0117] The free base of NTQ1062 is known by the chemical name (R)-4-((lR,6S)-5-((S)-2-(4-chlorophenyl)-3-(isopropylamino)propionyl)-2,5-diazabicyclo[4.1.0]heptan-2-yl)-5-methyl-5,8-dihydropyrido[2,3-d]pyrimidin-7(6H)-one. NTQ1062 is disclosed in Ma et al., J Med Chem, 2022, 65, 8144.HU-7691 has the following chemical structure:

[0118]

[0119] The free base of HU-7691 is known by the chemical name N-((3S,4S)-4-(3,4-difluorophenyl)piperidin-3-yl)-2-fluoro-4-(l-methyl-lH-pyrazol-5-yl)benzamide. HU-7691 is disclosed in Che et al., J Med Chem, 2021, 64, 12163.

[0120] KAT6A Inhibitors

[0121] In some embodiments, the KAT6A inhibitor is any molecule which binds to and inhibits the activity of KAT6A (for example having a plC5o of >4.5, >5, >6, >7, >8 or >9 when tested in a standard potency assay, for example as described in WO 2020 / 254946).

[0122] In some embodiments, the KAT6A inhibitor is selected from any KAT6A inhibitor disclosed in International Publication No. WO2016 / 198507; International Publication No. WO2019 / 043139; International Publication No. WO2019 / 243491; International Publication No. W02020 / 002587; International Publication No. WO2020 / 254989; International Publication No. WO2020 / 254946; International Publication No. WO2023 / 088233; International Publication No. WO2022 / 243983; International Publication No. WO2023 / 016484; International Publication No. WO2024 / 189598; and International Publication No. W02023 / 114710.

[0123] In some embodiments, the KAT6A inhibitor is 2,6-dimethoxy-N-{4-methoxy-6-[(lH-pyrazol-l-yl)methyl]-l,2-benzoxazol-3-yl}benzene-l-sulfonamide (referred to herein as CTx-648 or PF-9363) or a pharmaceutically acceptable salt thereof.

[0124] CTx-648 has the following chemical structure:

[0125]

[0126] CTx-648 is described in Sharma et al., Cell Chemical Biology 2023, 30, 1191, and in International Publication No. WO 2020 / 254946.In some embodiments, the KAT6A inhibitor is 2-methoxy-N-{4-methoxy-6-[(lH-pyrazol-l-yl)methyl]-l,2-benzoxazol-3-yl}benzene-l-sulfonamide (referred to herein as Compound 1) or a pharmaceutically acceptable salt thereof. Compound 1 is also known as prifetrastat or PF-07248144.

[0127] Compound 1 has the following chemical structure:

[0128]

[0129] Compound 1 is described in International Publication No. WO 2020 / 254946.

[0130] In some embodiments, the KAT6A inhibitor is N'-(4-fluoro-5-methyl-[l,l'-biphenyl]-3-carbonyl)benzenesulfonohydrazide (referred to herein as WM-8014) or a pharmaceutically acceptable salt thereof.

[0131] WM-8014 has the following chemical structure:

[0132]

[0133] In some embodiments, the KAT6A inhibitor is N'-(3-fluoro-5-(pyridin-2-yl)benzoyl)-2-fluorobenzenesulfonohydrazide (referred to herein as WM-1119) or a pharmaceutically acceptable salt thereof.

[0134] WM-1119 has the following chemical structure:

[0135]

[0136] WM-8014 and WM-1119 are described in Baell et al. Nature 2018, 560, 253 and International Publication No. WO 2016 / 198507.In some embodiments, the KAT6A inhibitor is N'-(5-chloro-4-fluoro-[l,l'-biphenyl]-3- carbonyl)benzenesulfonohydrazide (referred to herein as Compound 2) or a pharmaceutically acceptable salt thereof.

[0137] Compound 2 has the following chemical structure:

[0138]

[0139] Compound 2 is described in International Publication No. WO 2016 / 198507.

[0140]

[0141]

[0142] , or a pharmaceutically acceptable salt thereof. Such compounds are described in International Publication No. WO2023 / 088233.In some embodiments, the KAT6A inhibitor is selected from

[0143]

[0144]

[0145]

[0146]

[0147]

[0148] or a pharmaceutically acceptable salt thereof. Such compounds are disclosed in International Publication No. WO2022 / 243983.

[0149] Non-limiting examples of KAT6A inhibitors include PF-07248144 (Pfizer), CTx-648 (PF-9363) (Pfizer), OP-3186 (Olema Pharmaceuticals), ISM5043 (InSilico Medicine), WM-8014 and WM-1119. In some embodiments, the KAT6A inhibitor is PF-07248144. In some embodiments, the KAT6A inhibitor is CTx-648. In some embodiments, the KAT6A inhibitor is OP-3186. In some embodiments, the KAT6A inhibitor is ISM5043. In some embodiments, the KAT6A inhibitor is WM-8014. In some embodiments, the KAT6A inhibitor is WM-1119.Antiestrogens

[0150] In some embodiments, the AKT inhibitor and the KAT6A inhibitor are administered in combination with an antiestrogen.

[0151] In some embodiments, administration of the AKT inhibitor, the KAT6A inhibitor and the antiestrogen is separate, sequential, or simultaneous.

[0152] In some embodiments, administration of the AKT inhibitor, the KAT6A inhibitor and the antiestrogen is separate.

[0153] In some embodiments, administration of the AKT inhibitor, the KAT6A inhibitor and the antiestrogen is sequential.

[0154] In some embodiments, administration of the AKT inhibitor, the KAT6A inhibitor and the antiestrogen is simultaneous.

[0155] The term "antiestrogen" as used herein refers to a class of drugs that prevent estrogens like estradiol from mediating the biological effects in the body. Antiestrogens act by blocking the estrogen receptor (ER) and / or inhibiting or suppressing estrogen production. In some embodiments, the antiestrogen is a selective estrogen receptor degrader (SERD), a selective estrogen receptor modulator (SERM), or an aromatase inhibitor.

[0156] "Selective estrogen degraders" (SERDs) bind to the estrogen receptor causing it to be degraded and therefore downregulated.

[0157] In some embodiments, the antiestrogen is a selective estrogen receptor degrader (SERD).

[0158] In some embodiments, the SERD is selected from fulvestrant, camizestrant, amcenestrant, giredestrant elacestrant, imlunestrant, rintodestrant, palazestrant, brilanestrant, bexirestrant, taragarestrant or vepdegestrant, or a pharmaceutically acceptable salt thereof.

[0159] In some embodiments, the SERD is fulvestrant or a pharmaceutically acceptable salt thereof.

[0160] In some embodiments, the SERD is fulvestrant.

[0161] In some embodiments, the SERD is camizestrant or a pharmaceutically acceptable salt thereof.

[0162] In some embodiments, the SERD is camizestrant.

[0163] In some embodiments, the SERD is amcenestrant or a pharmaceutically acceptable salt thereof.

[0164] In some embodiments, the SERD is giredestrant or a pharmaceutically acceptable salt thereof.

[0165] In some embodiments, the SERD is elacestrant or a pharmaceutically acceptable salt thereof.

[0166] In some embodiments, the SERD is imlunestrant or a pharmaceutically acceptable salt thereof.

[0167] In some embodiments, the SERD is rintodestrant or a pharmaceutically acceptable salt thereof.

[0168] In some embodiments, the SERD is palazestrant or a pharmaceutically acceptable salt thereof.In some embodiments, the SERD is brilanestrant or a pharmaceutically acceptable salt thereof.

[0169] In some embodiments, the SERD is bexirestrant or a pharmaceutically acceptable salt thereof.

[0170] In some embodiments, the SERD is taragarestrant or a pharmaceutically acceptable salt thereof.

[0171] In some embodiments, the SERD is vepdegestrant or a pharmaceutically acceptable salt thereof.

[0172] "Selective estrogen modulators" (SERMs) are compounds that agonise or antagonise the estrogen receptor, often differently depending on which tissue they act. In some embodiments, the selective estrogen modulator has an anti-estrogenic effect on cancer. In some embodiments, the selective estrogen receptor modulator is selected from tamoxifen (e.g. nolvadex®) or a pharmaceutically acceptable salt thereof, toremifene (e.g. fareston®) or a pharmaceutically acceptable salt thereof, raloxifene (e.g. evista®) or a pharmaceutically acceptable salt thereof, and clomifene or a pharmaceutically acceptable salt thereof.

[0173] In some embodiments, the antiestrogen is a selective estrogen receptor modulator (SERM).

[0174] In some embodiments, the SERM is tamoxifen or a pharmaceutically acceptable salt thereof.

[0175] In some embodiments, the SERM is toremifene or a pharmaceutically acceptable salt thereof.

[0176] In some embodiments, the SERM is raloxifene or a pharmaceutically acceptable salt thereof.

[0177] In some embodiments, the SERM is clomifene or a pharmaceutically acceptable salt thereof.

[0178] "Aromatase inhibitors" are compounds that block the biosynthesis of estrogen. In some embodiments, the aromatase inhibitor is selected from anastrozole (e.g. arimidex®) or a pharmaceutically acceptable salt thereof, letrozole (e.g. femara®) or a pharmaceutically acceptable salt thereof and exemestane (e.g. aromasin®) or a pharmaceutically acceptable salt thereof.

[0179] In some embodiments, the antiestrogen is an aromatase inhibitor.

[0180] In some embodiments the aromatase inhibitor is anastrozole or a pharmaceutically acceptable salt thereof.

[0181] In some embodiments the aromatase inhibitor is letrozole or a pharmaceutically acceptable salt thereof. In some embodiments the aromatase inhibitor is exemestane or a pharmaceutically acceptable salt thereof.

[0182] Specific Combinations

[0183] In some embodiments, the AKT inhibitor is administered in combination with a KAT6A inhibitor, the KAT6A inhibitor is CTx-648 or a pharmaceutically acceptable salt thereof, and the AKT inhibitor is capivasertib or a pharmaceutically acceptable salt thereof.In some embodiments, the AKT inhibitor is administered in combination with a KAT6A inhibitor, the KAT6A inhibitor is Compound 1 or a pharmaceutically acceptable salt thereof, and the AKT inhibitor is capivasertib or a pharmaceutically acceptable salt thereof.

[0184] In some embodiments, the AKT inhibitor is administered in combination with a KAT6A inhibitor and an antiestrogen, the AKT inhibitor is capivasertib or a pharmaceutically acceptable salt thereof, the KAT6A inhibitor is CTx-648 or a pharmaceutically acceptable salt thereof, and the antiestrogen is fulvestrant or a pharmaceutically acceptable salt thereof.

[0185] In some embodiments, the AKT inhibitor is administered in combination with a KAT6A inhibitor and an antiestrogen, the AKT inhibitor is capivasertib or a pharmaceutically acceptable salt thereof, the KAT6A inhibitor is Compound 1 or a pharmaceutically acceptable salt thereof, and the antiestrogen is fulvestrant or a pharmaceutically acceptable salt thereof.

[0186] In some embodiments, the AKT inhibitor is administered in combination with a KAT6A inhibitor and an antiestrogen, the AKT inhibitor is capivasertib or a pharmaceutically acceptable salt thereof, the KAT6A inhibitor is CTx-648 or a pharmaceutically acceptable salt thereof, and the antiestrogen is camizestrant or a pharmaceutically acceptable salt thereof.

[0187] In some embodiments, the AKT inhibitor is administered in combination with a KAT6A inhibitor and an antiestrogen, the AKT inhibitor is capivasertib or a pharmaceutically acceptable salt thereof, the KAT6A inhibitor is Compound 1 or a pharmaceutically acceptable salt thereof, and the antiestrogen is camizestrant or a pharmaceutically acceptable salt thereof.

[0188] In some embodiments, the AKT inhibitor is administered in combination with a KAT6A inhibitor and fulvestrant or a pharmaceutically acceptable salt thereof or camizestrant or a pharmaceutically acceptable salt thereof.

[0189] In some embodiments, the AKT inhibitor is administered in combination with a KAT6A inhibitor and fulvestrant or a pharmaceutically acceptable salt thereof.

[0190] In some embodiments, the AKT inhibitor is administered in combination with a KAT6A inhibitor and camizestrant or a pharmaceutically acceptable salt thereof.

[0191] Pharmaceutical Compositions

[0192] In some embodiments there is provided a pharmaceutical composition comprising an AKT inhibitor and a KAT6A inhibitor, and a pharmaceutically acceptable excipient. The AKT inhibitor and KAT6A inhibitor may be as described herein.In some embodiments there is provided a pharmaceutical composition comprising capivasertib or a pharmaceutically acceptable salt thereof and a KAT6A inhibitor, and a pharmaceutically acceptable excipient. The KAT6A inhibitor may be as described herein.

[0193] "Pharmaceutically acceptable excipients" include diluents, disintegrants or lubricants. In a further embodiment, the pharmaceutical composition comprises one or more pharmaceutical diluents, one or more pharmaceutical disintegrants or one or more pharmaceutical lubricants.

[0194] In some embodiments, the composition is an oral dosage form.

[0195] In some embodiments, the composition is in the form of a tablet or capsule.

[0196] Dosing

[0197] In the combinations disclosed in this specification, capivasertib, or a pharmaceutically acceptable salt thereof, is generally administered to the patient at a daily dosage from about 100 mg to about 1600 mg. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a daily dosage from about 150 mg to about 1500 mg. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a daily dosage from about 200 mg to about 1400 mg. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a daily dosage from about 300 mg to about 1300 mg. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a daily dosage from about 400 mg to about 1200 mg. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a daily dosage from about 500 mg to about 1100 mg. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a daily dosage from about 600 mg to about 1000 mg. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered to the patient once daily (QD).

[0198] In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered to the patient twice daily (BID). In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 50 mg to about 900 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 100 mg to about 875 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 200 mg to about 850 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 250 mg to about 825 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 150 mg to about 250 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 250 mg to about 350 mg twice daily. In someembodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 350 mg to about 450 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 450 mg to about 550 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 550 mg to about 650 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 650 mg to about 750 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage from about 750 mg to about 850 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 160 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 200 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 240 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 280 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 320 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 360 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 400 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 440 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 480 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 520 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 560 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 600 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 640 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 680 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 720 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 760 mg twice daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered at a dosage of about 800 mg twice daily.In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered under a continuous dosing schedule. In some embodiments, for example, capivasertib, or a pharmaceutically acceptable salt thereof, is administered for more than 1, 2, 3, 4, 5, 6, 7, 14, 21, 28, 35, 42, 49, or 56 days. In some embodiments, the dosing cycle is 28 days. Administration of capivasertib, or a pharmaceutically acceptable salt thereof, and repeat of the dosing cycle can continue as long as tolerable and beneficial for the patient.

[0199] In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered to the patient on an intermittent dosage schedule. Administering capivasertib, or a pharmaceutically acceptable salt thereof, on an intermittent dosage schedule can, for example, have greater effectiveness and / or tolerability than on a continuous dosing schedule. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is intermittently dosed on a 1 day on / 6 days off schedule (i.e., capivasertib, or a pharmaceutically acceptable salt thereof, is administered for one day followed by a six-day holiday). In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is intermittently dosed on a 2 days on / 5 days off schedule (i.e., capivasertib, or a pharmaceutically acceptable salt thereof, is administered for two days followed by a five-day holiday). In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is intermittently dosed on a 3 days on / 4 days off schedule (i.e., capivasertib, or a pharmaceutically acceptable salt thereof, is administered for three days followed by a four-day holiday). In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is intermittently dosed on a 4 days on / 3 days off schedule (i.e., capivasertib, or a pharmaceutically acceptable salt thereof, is administered for four days followed by a three-day holiday). In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is intermittently dosed on a 5 days on / 2 days off schedule (i.e., capivasertib, or a pharmaceutically acceptable salt thereof, is administered for five days followed by a two-day holiday). In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is intermittently dosed on a 6 days on / 1 day off schedule (i.e., capivasertib, or a pharmaceutically acceptable salt thereof, is administered for six days followed by a one-day holiday). The dosing cycle of such embodiments would then repeat as long as tolerable and beneficial for the patient. In some embodiments, the dosing cycle is 7 days. In some embodiments, the dosing cycle is 14 days. In some embodiments, the dosing cycle is 21 days. In some embodiments, the dosing cycle is 28 days. In some embodiments, the dosing cycle is two months. In some embodiments, the dosing cycle is six months. In some embodiments, the dosing cycle is one year.

[0200] In some embodiments, the dosing cycle is 28 days, but capivasertib, or a pharmaceutically acceptable salt thereof, is not co-administered to the patient during the fourth week of the dosing cycle (i.e., thereis a capivasertib, or a pharmaceutically acceptable salt thereof, drug holiday during the final week of the dosing cycle).

[0201] In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered to the patient orally, twice-daily, on an intermittent weekly schedule of 4 days on followed by 3 days off. For example, in such a schedule, capivasertib, or a pharmaceutically acceptable salt thereof, is orally administered to the patient twice a day on days 1, 2, 3, 4, 8, 9, 10 and 11, of a two-week period, but not on days 5, 6, 7, 12, 13 and 14.

[0202] In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered to the patient at a dosage of 400 mg, orally, twice-daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered to the patient at a dosage of 400 mg, orally, twice-daily, on an intermittent weekly schedule of 4 days on followed by 3 days off.

[0203] In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered to the patient at a dosage of 320 mg, orally, twice-daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered to the patient at a dosage of 320 mg, orally, twice-daily, on an intermittent weekly schedule of 4 days on followed by 3 days off.

[0204] In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered to the patient at a dosage of 200 mg, orally, twice-daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered to the patient at a dosage of 200 mg, orally, twice-daily, on an intermittent weekly schedule of 4 days on followed by 3 days off.

[0205] In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered to the patient at a dosage of 160 mg, orally, twice-daily. In some embodiments, capivasertib, or a pharmaceutically acceptable salt thereof, is administered to the patient at a dosage of 160 mg, orally, twice-daily, on an intermittent weekly schedule of 4 days on followed by 3 days off.

[0206] In any embodiment where a marketed or approved drug is mentioned, the marketed or approved drug may be administered in accordance with its dosage leaflet (for example as approved by the United States FDA or any other similar regulatory agency).

[0207] In any embodiment where a drug that is being investigated in human trials is mentioned, the drug may be administered in accordance with the dosage regime described in any of its published clinical trial protocols (for example as described on clinicaltrials.gov or similar).

[0208] 1In some embodiments, the capivasertib or a pharmaceutically acceptable salt thereof is administered to the patient orally. In some embodiments, the capivasertib or a pharmaceutically acceptable salt thereof is administered to the patient orally in the form of a tablet.

[0209] In some embodiments, capivasertib is administered to the patient orally in the form of one or more film-coated tablets each comprising 160 mg or 200 mg capivasertib. In some embodiments, the tablets also contain croscarmellose sodium, dibasic calcium phosphate, magnesium stearate, and microcrystalline cellulose. In some embodiments, the film coat contains the following inactive ingredients: copovidone, hypromellose, iron oxide black, iron oxide red, iron oxide yellow, medium chain triglycerides, polydextrose, polyethylene glycol 3350, and titanium dioxide.

[0210] In some embodiments, the KAT6A inhibitor is 2-methoxy-N-{4-methoxy-6-[(lH-pyrazol-l-yl)methyl]-l,2-benzoxazol-3-yl}benzene-l-sulfonamide (referred to herein as Compound 1) or a pharmaceutically acceptable salt thereof.

[0211] International publication W02024 / 023703 describes dosing regimens of Compound 1 for the treatment of cancer.

[0212] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a daily dosage of from about 0.1 mg to about 15 mg. In some embodiments, the daily dose of Compound 1 or a pharmaceutically acceptable salt thereof is from about 1 mg to about 15 mg, such as from 1 mg to about 10 mg, from about 1 mg to about 8 mg, from about 0.1 mg to about 8 mg, from about 1 mg to about 5 mg, from about 0.1 mg to about 5 mg, or from about 0.5 mg to about 5 mg. In some embodiments, the daily dose of Compound 1 or a pharmaceutically acceptable salt thereof is from about 0.1 mg to less than 1 mg or from about 0.1 mg to about 0.75 mg. In some embodiments, the daily dose of Compound 1 or a pharmaceutically acceptable salt thereof is about 0.5 mg, about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg or about 8 mg. In some embodiments, the daily dose of Compound 1 or a pharmaceutically acceptable salt thereof is about 0.5 mg, about 1 mg, about 2 mg, about 3 mg, about 4 mg, or about 5 mg. In some embodiments, the daily dose of Compound 1 or a pharmaceutically acceptable salt thereof is 0.5 mg, 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg or 8 mg. In some embodiments, the daily dose of Compound 1 or a pharmaceutically acceptable salt thereof is 0.5 mg, 1 mg, 2 mg, 3 mg, 4 mg, or 5 mg.

[0213] In some embodiments, Compound 1, or a pharmaceutically acceptable salt thereof, is administered at a dosage of from about 0.1 mg to about 15 mg once daily. In some embodiments, the dose of Compound 1 or a pharmaceutically acceptable salt thereof is from about 1 mg to about 15 mg once daily, such as from 1 mg to about 10 mg once daily, from about 1 mg to about 8 mg once daily, from about 0.1 mg to about 8 mg once daily, from about 1 mg to about 5 mg once daily, from about 0.1 mg to about 5 mg oncedaily, or from about 0.5 mg to about 5 mg once daily. In some embodiments, the dose of Compound 1 or a pharmaceutically acceptable salt thereof is from about 0.1 mg to less than 1 mg once daily or from about 0.1 mg to about 0.75 mg once daily. In some embodiments, the dose of Compound 1 or a pharmaceutically acceptable salt thereof is about 0.5 mg once daily, about 1 mg once daily, about 2 mg once daily, about 3 mg once daily, about 4 mg once daily, about 5 mg once daily, about 6 mg once daily, about 7 mg once daily or about 8 mg once daily. In some embodiments, the dose of Compound 1 or a pharmaceutically acceptable salt thereof is about 0.5 mg once daily, about 1 mg once daily, about 2 mg once daily, about 3 mg once daily, about 4 mg once daily, or about 5 mg once daily. In some embodiments, the dose of Compound 1 or a pharmaceutically acceptable salt thereof is 0.5 mg once daily, 1 mg once daily, 2 mg once daily, 3 mg once daily, 4 mg once daily, 5 mg once daily, 6 mg once daily, 7 mg once daily or 8 mg once daily. In some embodiments, the dose of Compound 1 or a pharmaceutically acceptable salt thereof is 0.5 mg once daily, 1 mg once daily, 2 mg once daily, 3 mg once daily, 4 mg once daily, or 5 mg once daily.

[0214] Embodiments describing a mass of a compound or a pharmaceutically acceptable salt thereof refer to the specified mass of the compound or an equivalent molar amount of a pharmaceutically acceptable salt of the compound. For example, 200 mg of a pharmaceutically acceptable salt of capivasertib refers to the mass of the pharmaceutically acceptable salt of capivasertib required to deliver 200 mg of capivasertib.

[0215] Further embodiments

[0216] Embodiment 1. An AKT inhibitor for use in the treatment of cancer in a patient in need thereof, wherein the AKT inhibitor is administered in combination with a KAT6A inhibitor.

[0217] Embodiment 2. The AKT inhibitor for use of embodiment 1, wherein the administration of the AKT inhibitor and the KAT6A inhibitor is separate, sequential, or simultaneous.

[0218] Embodiment 3. The AKT inhibitor for use of embodiment 1 or 2, wherein the cancer comprises one or more AKT1, PIK3CA and / or PTEN gene alterations.

[0219] Embodiment 4. The AKT inhibitor for use of any one of embodiments 1 to 3, wherein the cancer is breast cancer.Embodiment 5. The AKT inhibitor for use of any one of embodiments 1 to 4, wherein the cancer is locally advanced breast cancer or metastatic breast cancer.

[0220] Embodiment 6. The AKT inhibitor for use of embodiment 4 or embodiment 5, wherein the breast cancer is a hormone receptor positive (HR+) breast cancer, optionally an estrogen receptor positive (ER+) breast cancer.

[0221] Embodiment 7. The AKT inhibitor for use of any one of embodiments 4 to 6, wherein the breast cancer is a HER2-negative breast cancer.

[0222] Embodiment 8. The AKT inhibitor for use of any one of embodiments 1 to 7 , wherein the patient is a post-menopausal woman or a pre-menopausal woman.

[0223] Embodiment 9. The AKT inhibitor for use of any one of embodiments 4 to 8, wherein the breast cancer is resistant to endocrine therapy, such as treatment with a selective estrogen receptor degrader (SERD), a selective estrogen receptor modulator (SERM) or an aromatase inhibitor (Al).

[0224] Embodiment 10. The AKT inhibitor for use of any one of embodiments 4 to 9, wherein the patient's breast cancer has progressed during or after previous endocrine therapy, such as treatment with a SERD, a SERM and / or an Al.

[0225] Embodiment 11. The AKT inhibitor for use of any one of embodiments 1 to 10, wherein the AKT inhibitor is capivasertib or a pharmaceutically acceptable salt thereof.

[0226] Embodiment 12. The AKT inhibitor for use of embodiment 11, wherein the capivasertib or a pharmaceutically acceptable salt thereof is administered to the patient at a daily dosage from about 100 mg to about 1600 mg.

[0227] Embodiment 13. The AKT inhibitor for use of embodiment 11, wherein the capivasertib, or a pharmaceutically acceptable salt thereof, is administered to the patient at a dosage of 160 mg, 200 mg, 320 mg or 400 mg, orally, twice-daily, on an intermittent weekly schedule of 4 days on followed by 3 days off.Embodiment 14. The AKT inhibitor for use of any one of embodiments 1 to 13, wherein the KAT6A inhibitor is 2,6-dimethoxy-N-{4-methoxy-6-[(lH-pyrazol-l-yl)methyl]-l,2-benzoxazol-3-yl}benzene- 1-sulfonamide (CTx-648) or a pharmaceutically acceptable salt thereof.

[0228] Embodiment 15. The AKT inhibitor for use of any one of embodiments 1 to 13, wherein the KAT6A inhibitor is 2-methoxy-N-{4-methoxy-6-[(lH-pyrazol-l-yl)methyl]-l,2-benzoxazol-3-yl}benzene-l- sulfonamide (Compound 1) or a pharmaceutically acceptable salt thereof.

[0229] Embodiment 16. The AKT inhibitor for use of embodiment 15, wherein the Compound 1 or a pharmaceutically acceptable salt thereof is administered at a daily dosage of from about 0.1 mg to about 15 mg.

[0230] Embodiment 17. The AKT inhibitor for use of any one of embodiments 1 to 16, wherein the AKT inhibitor and KAT6A inhibitor are administered in combination with an antiestrogen.

[0231] Embodiment 18. The AKT inhibitor for use of embodiment 17, wherein the administration of the AKT inhibitor, the KAT6A inhibitor and the antiestrogen is separate, sequential, or simultaneous.

[0232] Embodiment 19. The AKT inhibitor for use of embodiment 17 or embodiment 18, wherein the antiestrogen is a SERD.

[0233] Embodiment 20. The AKT inhibitor for use of any one of embodiments 17 to 19, wherein the SERD is fulvestrant or a pharmaceutically acceptable salt thereof.

[0234] Embodiment 21. The AKT inhibitor for use of any one of embodiments 17 to 19, wherein the SERD is camizestrant or a pharmaceutically acceptable salt thereof.

[0235] Embodiment 22. The AKT inhibitor for use of embodiment 17 or embodiment 18, wherein the antiestrogen is a SERM.

[0236] Embodiment 23. The AKT inhibitor for use of embodiment 17 or embodiment 18, wherein the antiestrogen is an Al.

[0237] EXAMPLESThe specific Examples below, with reference to the accompanying Figures, are provided for illustrative purposes only and are not to be construed as limiting the teachings herein.

[0238] Example 1: Cell Line generation

[0239] 1A. HEK-293T cell line: HEK-293T is an epithelial-like cell line that was isolated from a human embryonic kidney and expresses large T antigen. This cell line was purchased from GeneHunter Corporation (Catalogue number Q.401) and used for viral production. HEK-293T cells were routinely cultured in DMEM media supplemented with 10% Fetal Calf Serum (FCS) and 1% Glutamax, and incubated at 37°C, 5% CO2. This cell line was used to produce viral particles to obtain Cas9 expressing cells and KAT6A KO cells in Figures 1 to 9 and 19.

[0240] IB Cas9 Lentivirus Generation. HEK-293T cells were plated in a 75 cm2flask. Number of HEK-293T cells per 75 cm2flask: 8 million cells (1x75 cm2flask set up). The cells were cultured in DMEM media + 10% FCS + 1% Glutamax. HEK-293T cells should be around 80-90% confluent on the day of transfection. On the day of transfection (Day 0), the Cas9 gRNA lentiviral vector (pKLV2-EFla-Cas9-Bsd-W), the packaging mix and PLUS into Opti-MEM were added into a 15 mL canonical tube (see table below for volumes) and then mixed either by pipetting or vortexing for 2 seconds. They were then incubated for 5 mins at room temperature.

[0241] Table 1: Transfection Mixtures

[0242] Component Amount per Flask

[0243] Opti-MEM 4 ml

[0244] Lentiviral transfer vector 7-2 pg

[0245] psPAX2 7-2 pg

[0246] pMG2.G 1-6 pg

[0247] PLUS reagent 16 pL

[0248]

[0249] Lipofectamine LTX 48 pL

[0250] Lipofectamine LTX was then added to the solution with DNA and mixed either by pipetting or vortexing for 2 seconds. The resultant solutions were incubated 30 minutes at room temperature. The old medium was aspirated, and cells washed once with 10 mL of Opti-MEM media. 7 mL of Opti-MEM was then added to the 75 cm2flask, followed by the addition of the DNA / Lipofectamine complex using a pipette and swirling very gently. Finally, the vessel contents were incubated at 37 °C for 6 hours and the transfection medium replaced with 30 mLof DMEM media containing 10% FCS and 1% Glutamax. After 48 hours (Day 2), collection of Cas9 lentiviral supernatant was done with a 10 mL syringe (x3 syringes in total) and filtered with 0.45 pm filter cartridge. Cas9 lentiviral supernatant was aliquoted into 1.5 mL cryovials (400 pL per cryovial, 75 cryovials in total) for storage at -80°C.1C. T47D stable cell lines expressing spCas9: T47D is a cell line derived from pleural fluid / effusion obtained from a patient with breast ductal carcinoma. The cell line was obtained from ATCC HTB-133 and harbours the activating mutation in PIK3CA H1047R. T47D cells were routinely cultured in RPMI media (Gibco #11835-063) supplemented with 10% Fetal Calf Serum (FCS) and 1% Glutamax, and incubated at 37°C, 5% CO2. T47D cells constitutively expressing spCas9 were prepared using the following protocol in a 6-well plate:

[0251] 1. Lentivirus was removed from -80°C freezer and thawed at room temperature.

[0252] 2. Viral transduction mixtures were prepared in 1.5 mL Eppendorf tubes. For each cell line, a Cas9 mixture and a no virus control mixture were prepared as described below.

[0253] Table 2. Table outlining the transduction volumes required per well.

[0254] Transduction Volume of media Volume of Polybrene Volume of Cas9 virus condition (at 40 pg / mL stock)

[0255] Cas9 650 pL 200 pL 150 pL

[0256] No virus control 800 pL 200 pL -

[0257]

[0258] 3. 100,000 cells in a total volume of 1 mL media per well were seeded in a 6-well plate (set up three wells per cell line). Two wells per cell line (T47D) - one well labelled "Cas9" and the other well "no virus control".

[0259] 4. Immediately after plating cells, 1 mL transduction mixture (Cas9 or no virus control) was added to each well of cells. The 6-well plate was gently rocked to mix and plate in an incubator.

[0260] 5. 24 hours post-transduction, virus containing media was removed from each well and replaced with 3 mL of fresh media.

[0261] 6. 72 hours post-transduction all cells from each well (Cas9 or no virus control) were moved into a T75 flask with blasticidin selection (Use 40 pg / mL of blasticidin).

[0262] 7. Cells were selected with blasticidin until no viable cells remained in the no-virus control flask. If cells became confluent during selection, they were moved into a T175 and continue blasticin selection.

[0263] 8. After blasticin selection of the Cas9 cell line was complete, cells were expanded for at least one week before testing Cas9 activity.

[0264] Cas9 activity of new Cas9 cell lines was determined with a reporter assay. The Cas9 activity assay consists of two separate lentiviruses vectors. A sgRNA targeting GFP is introduced into cell lines using a lentivirus (pKLV2-U6gRNA5(gGFP)- PGKBFP2AGFP-W) that is labelled with BFP and GFP. In the absence of functional Cas9 the cells transduced with this lentivirus will express both BFP and GFP. But in thepresence of Cas9, the gRNA will target GFP and cells will no longer express GFP (BFP+ GFP-). The activity of Cas9 in the cells is the fraction of transduced cells that are BFP positive but GFP negative. Cas9 cells transduced with the control reporter virus (pKLV2-U6gRNA5(Empty)-PGKBFP2AGFP-W) should express both BFP and GFP. Total number of transduced cells are determined as: BFP+-GFP+ double positive cells plus BFP+ cells. Cas9 activity in bulk population of cells (%) is determined from (BFP+ positive cells) / (total number of transduced cells). Cas9 activity in T47D cells constitutively expressing spCas9 was determined in 6-well plates using the following protocol:

[0265] 1. Lentivirus was removed from -80°C freezer and thawed at room temperature.

[0266] 2. Viral transduction mixtures were prepared in 1.5 mL Eppendorf tubes as described in table 3.

[0267] For each cell line, three separate mixtures were prepared: 1) BFP-GFP (empty), 2) BFP-GFP (gRNA GFP) and 3) no virus control.

[0268] Table 3. Table outlining the transduction volumes required per well (in a 6-well plate)

[0269] Lentivirus Volume of media Volume of Polybrene (at 40 pg / ml Volume of stock for 4 pg / mL final concentration) virus

[0270] BFP-GFP (empty) 600 pL 200 pL 200 pL BFP-GFP (gRNA GFP) 600 pL 200 pL 200 pL No virus control 800 pL 200 pL

[0271]

[0272] 3. 100,000 cells in a total volume of 1 mL media per well were seeded in a 6-well plate (set up three wells per cell line).

[0273] 4. Immediately after plating cells, 1ml transduction mixture (BFP-GFP empty, BFP-GFP gRNA GFP and virus control) was added to each well of cells. The 6-well plate was gently rocked to mix and plate in an incubator.

[0274] 5. 24 hours post-transduction, the virus containing media was removed from each well and replaced with 3 mL of fresh media.

[0275] 6. 72 hrs post-transduction, cells were fixed and BFP-GFP expression (BFP-GFP empty, BFP-GFP gRNA GFP and virus control) was measured by flow cytometry on the MaxQuant VYB (Cambridge Institute Flow cytometry facility). The "no virus control" cells were used to gate for BFP-GFP negative cells.

[0276] 7. Cas9 activity was calculated for each cell line as: Cas9 activity in bulk population of cells (%) = (BFP+ positive cells) / (total number of transduced cells).

[0277] 8. Cell lines with a Cas9 activity above 75% were expanded to bank stocks.

[0278] This cell line was used in Figures 2, 5 and 8.ID. MCF7 stable cell lines expressing spCas9: MCF7 is a cell line derived from pleural fluid / effusion obtained from a patient with breast ductal carcinoma. The cell line was obtained from ATCC HTB-22 and harbours the activating mutation in PIK3CA E545K. MCF7 cells were routinely cultured in RPMI media (Gibco #11835-063) supplemented with 10% Fetal Calf Serum (FCS) and 1% Glutamax, and incubated at 37°C, 5% CO2. MCF7 stable cell lines expressing spCas9 were prepared with a method similar to that of 1C, but cells were selected using 10 pg / mL blasticidin. This cell line was used in Figures 1, 4 and 7. IE. CAMA-1 stable cell lines expressing spCas9: CAMA-l is a cell line derived from pleural fluid / effusion obtained from a patient with breast adenocarcinoma. The cell line was obtained from ATCC HTB-21 and harbours loss of function mutations in PTEN D92H / F278fs. CAMA-l cells were routinely cultured in RPMI media (Gibco #11835-063) supplemented with 10% Fetal Calf Serum (FCS) and 1% Glutamax, and incubated at 37°C, 5% CO2. CAMA-l stable cell lines expressing spCas9 were prepared by a method similar to that of 1C, but cells were selected using 25 pg / mL blasticidin. This cell line was used in Figures 3, 6 and 9.

[0279] T47D CapiR (capivasertib resistant) cell line: T47D CapiR cell line was generated from the parental ATCC HTB-22 stock. Cells were cultured as described in example 1C. To set up the initial treatment flasks, the media was removed from a T175 flask, the cells washed with 10 mL DPBS and 2 mL trypsin added to detach the cells. Once detached, the cells were re-suspended in 10 mL of growth media and counted using Trypan blue and the Countess™ Cell Counter (ThermoFisher). Then, 10 mL was added to 3x T25 flasks at 3.0 x 104 / mL cells, 1 to dose with DMSO to gage the growth of the resistant cell pools versus cells in the same % of DMSO and 2 flasks to be dosed with capivasertib to generate the resistant pools. Cells were transferred to an incubator to adhere overnight. Cells were initially dosed with lpM with the aim to escalate to 10 pM once the cells start to grow out. Cells were re-dosed twice weekly. Cells were re-dosed twice weekly for 6 months. This cell line was used in Figures 16 to 19.

[0280] IF. T47D CapiR (capivasertib resistant) stable cell lines expressing spCas9: T47D is a cell line derived from pleural fluid / effusion obtained from a patient with breast ductal carcinoma. The cell line was obtained from ATCC HTB-133 and harbours the activating mutation in PIK3CA E545K. T47D cells were routinely cultured in RPMI media (Gibco #11835-063) supplemented with 10% Fetal Calf Serum (FCS) and 1% Glutamax, and incubated at 37°C, 5% CO2. To generate T47D CapiR (capivasertib resistant cells, T47D cells were cultured for 6 months with increasing doses of capivasertib up to lOpM. T47D CapiR cells were routinely cultured in RPMI media (Gibco #11835-063) supplemented with 10% Fetal Calf Serum (FCS), 1% Glutamax, lOpM capivasertib and incubated at 37°C, 5% CO2. T47D CapiR stable cell lines expressing spCas9 were prepared by a method similar to that of 1C, but cells were selected using 40 pg / mL blasticidin and continuous lOpM capivasertib. These cells were used in Figure 19.IG. MCF7 ESRI Y537S (mut / - / -) cell line: MCF7 ESRI Y537S (mut / - / -) cell line was generated from the parental ATCC HTB-22 stock. Cells were cultured as described in example ID. Cells were transfected with a sgRNA CAS9 T2A GFP vector and the donor vector with Neomycin cassette as a non-digested plasmid at a 2:1 ratio using Fugene (Promega). The gRNA sequence was "ctccagcagcaggtcataga" (SEQ ID NO:1). The donor cassette contained 800bp and lkb homology regions for incorporation of the Y537S mutation via homologous directed repair (HDR). Between the homology regions, the Neomycin resistance gene was encoded, which was expressed under the PKG promotor and used for selection of HDR events 48hrs post transfection. After two weeks of selection, single cell clones were generated and characterised. To confirm the knock-in, a digital droplet PCR was performed using ddPCR primers (Fwd: AAGGCATGGAGCATCTGT (SEQ ID NO:2) & Rev: GCTAGTGGGCGCATGTA (SEQ ID NO:3)) and specific probes (C{C}CTC{TAT}GACC{T}G (SEQ ID NO:4) and CTC{T}AT{GGC}C{T}GC (SEQ ID NO:5)). The location of the insertion was confirmed using junction PCR with the following primer pairs: Fwd TTAGATCATGCTGTAGGCCCTG (SEQ ID NO:6) & Rev CTGGAACCCATGACCGGAAAG (SEQ ID NO:7), Fwd GCAGATCCAGGGGGCATTTA (SEQ ID NO:8) & Rev GATGTGGAATGTGTGCGAGC (SEQ ID NO:9) and Fwd GGATCAATTCTCTAGAGCTCGC (SEQ ID NQ:10) & Rev CTGGAACCCATGACCGGAAAG (SEQ ID NO:11). TIDE analysis was used to confirm the frame shift mutation of the 2nd ESRI allele. Targeted Locus Amplification (TLA) sequencing (de Vree etal. 2014) confirmed the genotype of the 3 ESRI alleles (knock-in, single base insertion knock-out and inactivating 48bp deletion; mut / - / -). This cell line was used in Figure 15.

[0281] IH. MCF7 FulvR cell line: MCF7 FulvR cell line was generated from the parental ATCC HTB-22 stock. Cells were cultured as described in example ID. To set up the initial treatment flasks, the media was removed from a T175 flask, the cells washed with 10 mL DPBS and 2 mL trypsin added to detach the cells. Once detached, the cells were re-suspended in 10 mL of growth media and counted using Trypan blue and the Countess™ Cell Counter (ThermoFisher). Then, 10 mL was added to 3x T25 flasks at 3.0 x 104 / mL cells, 1 to dose with DMSO to gage the growth of the resistant cell pools versus cells in the same % of DMSO and 2 flasks to be dosed with fulvestrant to generate the resistant pools. Cells were transferred to an incubator to adhere overnight. Cells were initially dosed with 30 nM fulvestrant with the aim to escalate to 100 nM once the cells start to grow out. The media in the flask was removed and replaced with 10 mL of the fulvestrant containing media (2.2 pL 300 pM fulvestrant stock was added to 22 mL growth media, 1:10,000 dilution to give 30 nM final). Cells were re-dosed twice weekly. After a week, cells started to grow up and fulvestrant concentration was increased to 100 nM. Cells were re-dosed twice weekly for 30 days. This cell line was used in Figure 13.

[0282] II. T47D FulvR cell lines: T47D FulvR cell lines were prepared by a method similar to that of 1H. This cell line was used in Figure 14.2A. CRISPR Knockout of KAT6A using gRNA lentiviral expression vectors. The experiment involves three main steps: (1) Cloning gRNAs targeting KAT6A into the expression vector to produce KAT6A gRNA lentivirus; (2) Generate and validate KAT6A knockout ER+ breast cancer cell lines (CAMA-1, T47D, MCF7) with the lentivirus; and then (3) performing proliferation assays comparing KAT6A knockout and wildtype ER+ breast cancer cell with DMSO (control / vehicle) and capivasertib.

[0283] 1. Generation of CRISPR gRNA lentiviral expression vectors:

[0284] KAT6A guide RNAs (gRNAs) were cloned into the Yusa CRISPR lentiviral expression vector according to the following protocol, which describes how to synthesise and clone individual gRNAs into the CRISPR lentiviral single guide RNA (sgRNA) expression vector to target a single genomic locus. These vectors can then be transfected into HEK-293T cells to generate infectious sgRNA lentivirus, for transduction into human or mouse cells to generate a heterogenous population of cells with a mix of CRISPR-induced indels, known as a knockout cell pool. Knockout efficiencies in cell pools are typically 80-90%. Once knockout (KO) efficiency in the pool has been analysed, the cells can be used in assays right away while still in a heterogenous population.

[0285] Table 4: List of materials for the generation oflentiviral expression vector

[0286] Unit Description Supplier Catalogue code

[0287] Quantity Library Efficiency® DH5a™ ThermoFisher Scientific 18263012 1 mL Competent Cells

[0288] QIAGEN Plasmid Mini Kit QIAGEN 12125 100 runs Corning 96-well Assay Block (2 mL) ThermoFisher Scientific 07-200-700 Case of 25 T4 DNA Ligase NEB M0202S 50 pL

[0289] T4 DNA Ligase Reaction Buffer NEB B0202S 6 ml

[0290] T4 Polynucleotide Kinase (PNK) NEB M0201S 50 pL 2x TY Medium (+ampicill in 50ug / ml) internal

[0291]

[0292] Table 5: Lentiviral CRISPR sgRNA vectors

[0293] CRISPR lentiviral vector Addgene Description

[0294] Reference

[0295] pKLV2-U6gRNA5(Bbsl)-PGKpuroBFP-W 67974 Lentiviral gRNA expression vector with BFP and puromycin resistance marker

[0296]

[0297] gRNA and oligonucleotide design: 2gRNAs targeting KAT6A gene were selected from the V3 Yusa CRISPR knockout gRNA library. gRNA oligonucleotide described in table 10 were ordered from IDT at 100 nM ready to use solution (standard desalting). Oligonucleotides for gRNAs were designed to have the following configuration:

[0298] forward oligonucleotide: 5' CACCG — 19 bp gRNA — 3'

[0299] reverse oligonucleotide: 5' AAAC — 19 bp gRNA — C 3'

[0300] Example:

[0301] Genome: 5'-tggcgtgTAAGAGAGCATCATGGGCCACGGcagagaa-3' (SEQ ID NO:12) Guide RNA: 5'-GAAGAGAGCATCATGGGCCA-3' (SEQ ID NO:13) Forward oligonucleotide: 5'-CACCGAAGAGAGCATCATGGGCCA-3' (SEQ ID NO:14) Reverse oligonucleotide: 3'-CTTCTCTCGTAGTACCCGGTCAAA-5' (SEQ ID NO:15) The forward and reverse oligonucleotide pair with each other and result in two overhangs (5'CACC and 5' AAAC) that can be ligated to the linearized (Bbsl) gRNA expression vector. The two oligonucleotides were designed as a reverse complement because they were cloned into the vector as an annealed oligo pair.

[0302] Table 6: KAT6A gRNA sequences.

[0303] Name KAT6A gRNA Sequences (+ 5‘ CACC & 5‘ AAAC) KAT6A_v3_6-l gRNA 1 forward 5' CACCGAACTAACGGTTCGAGTGA 3' (SEQ ID NO:16) KAT6A_v3_6-2_gRNA 2 forward 5' CACCGGCTCCACATCGTAATAGA 3' (SEQ ID NO:17) KAT6A_v3_6-l gRNA 1 reverse 5' AAACTCACTCGAACCGTTAGTTC 3' (SEQ ID NO:18) KAT6A_v3_6-2_gRNA 2 reverse 5' AAACTCTATTACGATGTGGAGCC 3' (SEQ ID NO:19)

[0304]

[0305] Vector linearization and gRNA cloning into the CRISPR lentiviral expression vector:

[0306] The CRISPR gRNA expression vector was linearized with the restriction enzyme Bbsl according to the manufacturer's instructions (New England Biolabs; NEB). Linearised vector was separated with an agarose gel, purified from the gel and quantified using a NanoDrop (Thermo Fisher). Concentration was adjusted to 20 ng / pL. gRNA oligonucleotides cloning was started by the phosphorylation and annealing of the forward and reverse oligonucleotides. To this end, the components described in table 11 were mixed in a PCR tubes strip. The strip was placed in a PCR machine to run the programme: started with 37 °C, 30 minutes; followed by 95 °C, 50 minutes; ramped down to 25 °C at 0.1 °C / second.

[0307] Table 7: Phosphorylation and annealing reaction for sgRNA oligonucleotides.Component Volume

[0308] 100 pM Top strand oligonucleotide l pL

[0309] 100 pM Bottom strand oligonucleotide l pL

[0310] 10xT4 ligation buffer l pL

[0311] T4 PNK 0.5 pL

[0312] Nuclease free water 6.5 pL

[0313]

[0314] To ligate the double strand oligonucleotides (ds-oligos) to the vector, they were first diluted in EB buffer (Qiagen) on ice as follow:

[0315] • 1stdilution (142 fmol / pL): 139 pL EB buffer + 2 pL 10 pM ds-oligos

[0316] • 2nddilution (7.1 pmol / pL): 57 pL EB buffer + 3 pL 1stdilution

[0317] The ligation reaction was performed by mixing the volumes described in table 12 in a PCR tube on ice. Make a negative control (linearized CRISPR vector without annealed oligos) by adding 2 pL nuclease-free water instead of ds-oligo. The annealed oligos were ligated into the vector by incubating the linearized vector / oligo mixture at 16 °C for 4 hr to overnight.

[0318] Table 8: ds-oligonucleotides ligation reaction to the vector.

[0319] Components Volumes

[0320] 20 ng / pL linearized lentiviral vector 1 pL (=3.7 fmol)

[0321] 7.1 fmol / pL ds-oligo 2 pL (=14.2 fmol)

[0322] 10xT4 DNA ligase buffer (B0202S) l pL

[0323] T4 DNA ligase (NEB M0202S) l pL

[0324] Nuclease-free water 5 pL

[0325]

[0326] To transform bacteria with the ligated vector, 5 pL of the ligation mixture was placed in a 1.5 mL microtube and keep it on ice. 50 pL of DH5a chemical competent cells was added to the tube and mixed with the ligation mixture with a vortex for 1 second. The mix was incubated for 10 minutes on ice and immediately placed in a heat shock at 42 °C for 30 seconds. Bacterial mix was then incubated on ice for an additional 2 minutes. Next, 400 pL of S.O.C. medium was added to the transformed bacteria and incubated in a shaking incubator at 37 °C for 30 minutes. Transformed bacteria were plated on LB agar plates with ampicillin antibiotic, and incubated overnight at 37°C. Next day, plates were inspected for colony growth and confirmed that there was no colony growth on the negative control plate (ligation of linearized CRISPR vector without annealed sgRNA oligos). Two colonies were picked up for each KAT6A gRNA construct using a sterile pipette and placed into 2 mL 2xTY medium (+ampicillin at 50 pg / ml) in a 15-ml falcon tube. Bacteria was incubated for 14-16 hours at 37°C in an orbital shaker. Then, bacterialcultures were centrifuged at 4000 rpm for 10 minutes and supernatant was discarded. Plasmids were isolated using a Qiagen mini-prep kit according to the manufacturer's instructions and eluted into 50 pL of EB buffer. DNA concentration was determined using a NanoDrop (Thermo Fisher) and plasmids were stored at -20 °C.

[0327] 2. Production of KAT6 A gRNA expressing lentivirus in HEK-293T cell.

[0328] Infectious KAT6A gRNA lentiviral particles were produced for transduction into ER+ breast cancer cells according to the following procedure and materials described in following tables .

[0329] Table 9: Lentiviral expressing HEK-293T cell production materials

[0330] Catalogue

[0331] Description Supplier Unit Quantity code

[0332] Lipofectamine LTX with PLUS Thermo Fisher Lipofectamine LTX with PLUS 15338100

[0333] reagent Scientific reagent

[0334] Opti-MEM reduced serum Thermo Fisher Opti-MEM reduced serum 31985070

[0335] media Scientific media

[0336] Cell Bank

[0337] HEK-293T cells AZ cell bank HEK-293T cells

[0338] ID: 62483

[0339] DMEM media = DMEM ThermoFisher DMEM media = DMEM 21969035

[0340] Glutamax + 10% FCS Scientific Glutamax + 10% FCS

[0341] Sterile disposable syringes Sterile disposable syringes (10ml) (10ml)

[0342] 0.45 pm syringe filter Merck SLHV033RS 0.45 pm syringe filter ThermoFisher

[0343] TrypLE Express Enzyme 12604013 TrypLE Express Enzyme

[0344] Scientific

[0345]

[0346] Table 10: Backbone vectors

[0347] Vector Description

[0348] pKLV2-U6gRNA5(Bbsl)-PGKPuroBFP-W Lentiviral gRNA expression vector with BFP and puromycin resistance marker

[0349] psPAX2 - packaging plasmid 2ndgeneration lentiviral packaging plasmid

[0350] pMD2.G - envelope plasmid 2ndgeneration lentiviral VSV-G envelope plasmid

[0351]

[0352] Table 11: KAT6A gRNA Vectors used to generate lentivirusVector Description

[0353] pKLV2-U6gRNA5(Bbsl)- Lentiviral gRNA expression vector with BFP and puromycin PGKPuroBFP-W KAT6A gRNA 1 resistance marker with KAT6A gRNA 1 cloned into backbone. pKLV2-U6gRNA5(Bbsl)- Lentiviral gRNA expression vector with BFP and puromycin PGKPuroBFP-W KAT6A gRNA 2 resistance marker with KAT6A gRNA 2 cloned into backbone.

[0354]

[0355] HEK-293T cells were cultured in DMEM medium with 1% Glutamax and 10% Fetal Bovine Serum (FBS) at 37 °C with 5% CO2 and maintained according to the manufacturer's recommendation (GeneHunter; Cat no: Q.401). To passage, the medium was aspirated, and cells rinsed by gently adding 5 mL of TrypLE to the side of a T225 flask to not dislodge the cells. TrypLE was removed and cells incubated in the flask for 4-5 min at 37 °C until they begun to detach. Next, 10 mL of warm culture media was added to the flask and cells were dissociated by pipetting them up and down gently. Cells were transferred to a 50 mL Falcon tube. HEK293T cells were passaged every 2 days at a ratio of 1:4 and never allowing cells to reach more than 70% confluency. For lentiviral production, cells were kept until a passage number less than 10.

[0356] On Day 0 HEK-293T cells were plated in 6-well plates and 8 x 105cells per well in the plate. Cells should be 80-90% confluent on the day of transfection and each well produced 3 mL of lentivirus. One Day 1 morning, the CRISPR gRNA lentiviral vector described in table 16, the packaging mix vectors (psPAX2 and pMG2.G) described in tables 15 and the PLUS reagent were mixed with Opti-MEM media in a 15 mLtube as described in table 17. The transfection mixture was mixed either by pipetting or vortexing for 2 seconds and incubated for 5 mins at room temperature. Lipofectamine LTX was added and mixed either by pipetting or vortexing for 2 seconds and incubated 30 minutes at room temperature. Old media in the wells was aspirates off and cells washed once with 2 mL of Opti-MEM media per well. Take care not to dislodge cells during this step since HEK-293T cells loosely adhere on culture vessels. 1.5 mL of Opti-MEM media was added to each well. The DNA / Lipofectamine complex was added to each well drop wise using a pipette and swirl very gently. Cells were incubated with transfection solution at 37 °C for 5-7 hours. If cell were <80% confluent at the time of transfection, then reduce transfection incubation time to 5 hours to prevent excessive cell death. Medium was then replaced with 2.5 mL of fresh cell culture medium (DMEM 1% Glutamax + 10% FBS).

[0357] Table 12: Volumes and amounts to be used for the transfection step

[0358] Reagent 1-well of 6-well plate

[0359] Opti-MEM 500 pL

[0360] Lentiviral transfer vector 0.9 pg

[0361]

[0362] psPax2 0.9 pg

[0363] pMG2.G 0-2 pg

[0364] PLUS reagent 2 pL

[0365] Lipofectamine LTX 6 pL

[0366]

[0367] Prior to collecting the lentivirus, HEK-293T cells were inspected under a fluorescent microscope to detect BFP expression and assess transduction efficiency as well as successful viral production. On Day 3, 48h after transfecting the cells, the viral supernatant was collected with a 10 mL disposable syringe and filtered with a 0.45 pm filter cartridge. The plate of HEK-293T plate was discarded following the appropriate waste disposal route. The 1 mL of supernatant was aliquoted into labelled cryovials and stored at -80°C.

[0368] 3. Infection and generation ofMCF7, T47D, T47D CapiR and CAMA-1 Cas9-expressing cell lines with KAT6A gRNA lentivirus.

[0369] The aim of this protocol is to generate a pooled KAT6A KO cell lines from MCF7, T47D, T47D CapiR and CAMA-1 Cas9 stable lentiviral pools (Examples above). Each Cas9-expressing cell lines was transduced with KAT6A gRNA lentiviruses in a 6-well plate (each well of cells was transduced with a different KAT6A gRNA lentivirus). Cells were also transduced with lentivirus that does not contain a gRNA targeting KAT6A, empty vector pKLV-2. These are the CTRLs cell lines used in the proliferation experiments. KAT6A gRNA lentiviruses were thawed at room temperature, and the viral transduction mixtures prepared in 1.5 mL. 250,000 cells were seeded in a total of 1 mLof media per well in a 6-well plate. Immediately after plating cells, 1 mL transduction mixture was added to each well of cells, plates were gently mix and placed in the incubator. 24 hours post-transduction, virus containing media was removed from each well and replaced with 3 mL of fresh media. 72 hours post-transduction, cells were expanded from each well into a T75 flask with puromycin selection. The concentration of puromycin used for each cell line is shown in Table 14. Cells were kept with puromycin selection until no viable cell remained in the no-virus control flask. After puromycin selection of the KAT6A KO cell line was completed, cell lines were expanded for at least one week before testing KAT6A protein levels using western blot.

[0370] Table 13: Lentiviral expressing HEK-293T cell production materials

[0371] Transduction condition Volume of Volume of Volume of Cas9 Volume of cells media (ml) Polybrene Virus (variable by (ml)

[0372] (40 pg / ml) batch)

[0373]

[0374] KAT6A gRNA 1 500 pL 200 pL 300 pL 1KAT6A gRNA 2 500 pL 200 pL 300 pL 1

[0375]

[0376] No virus control 800 pL 200 pL - 1

[0377] Table 14: Puromycin concentration used in cell lines

[0378] Cell line Puromycin concentration (ug / ml)

[0379] MCF7 2

[0380] CAMA-1 2

[0381]

[0382] T47D 2

[0383] Western Blotting was used to confirm that the KAT6A gene had been edited from the cell lines. Protein was extracted from cells in a T25 flask with 200 pL lysis buffer (25 mM Tris HCL, 3 mM EDTA, 3 mM EGTA, 50 mM NaF, 2 mM orthovanadate, 0.27 M sucrose, 10 mM p-glycerophosphate, 5 mM pyrophosphate, 0.5% Triton X-100, 0.1% p-mercaptoethanol, deionised water) supplemented with protease inhibitor cocktail. Lysate was clarified with centrifugation and quantified using BCA assay. Protein concentration was normalised across samples and prepared with NuPAGE LDS Sample Buffer (4X). Samples were boiled, loaded in a NuPAGE BisTris gel 4-12% gel and run Gel tanks (XCell Surelock™ Mini-Cell) with NuPAGE MOPS SDS Running Buffer for 1 hour to separate proteins via electrophoresis. Proteins in the gel were transferred onto a nitrocellulose membrane using Iblot2 dry blotting system according to manufacturer's instruction with the program P3 20V 10 minutes. Total protein in the membrane was assessed using Ponceau S staining, and membranes blocked with 5% non-fat dry milk in TBST buffer (TBS with 0.05% Tween). Membranes were stained with primary antibodies overnight at 4 degrees with rocking (KAT6A antibody: 1:1000; CST #78462; Vinculin antibody: 1:1000, CST #4650). Next day, membranes were washed three times with TBST for 5 minute each time. Membranes were incubated with secondary antibodies coupled to HRP peroxidase (1:2000) from appropriate species for 1 hours are room temperature with rocking. Membranes were washed three times with TBST for 5 minute each time. Finally, membranes were incubated with a substrate detectable via chemiluminescence (Pierce Supersignal kit) and images were developed using a CCD camera in Sygene G box. Both KAT6A KO pools (guidel and guide 2) were showing a strong decrease of the KAT6A protein levels. For this reason, just the pool 1 (obtained with guide 1) was selected for the experiments in Figures 1 to 9 and 19.

[0384] CAMA-1 cell lines: CAMA-1 CTRL, WT and KAT6A KO lentiviral pools were seeded at 25,000 cells / well in 48-well plates. Plates were placed in an incubator for cells to attach. After 24 hours, cells were treated with DMSO as vehicle control or 400 nM capivasertib and lOnM fulvestrant, and plates were placed on the Incucyte® S3 (Day 0 reading) immediately after adding compounds. Cells were imaged at days 2, 4, 6, 8, 10, 12, 14 and 18 (end of the assay). Multiple fields of view were acquired per well and the mean % of cell confluency per well was quantified using the Incucyte® analysis software. Values from alltimepoints were normalised to day 0. Normalised values were plotted as a line graph (X-axis = days proliferation, Y-Axis = % of cell confluence), while end point values (last day imaged) were plotted as a bar chart.

[0385] MCF7 and T47D cell lines: MCF7 and T47D, CTRL, WT (parental cell line) and KAT6A KO lentiviral pools were seeded at 60,000 cells / well and 90,000 cells / well in two duplicated 24-well plates. Plates were placed in an incubator for cells to attach. After 24 hours, cells were treated with DMSO as vehicle control, 750 nM capivasertib (T47D), lpM capivasertib (MCF7), and lOnM fulvestrant plates were placed on the Incucyte® Zoom (Day 0 reading) immediately after adding compounds. Cells were imaged at days 2, 4, 6, 8, 10, 12, 14 and 18 (end of the assay). Figure 1 and 2.

[0386] For both cell lines, multiple fields of view were acquired per well and the mean % of cell confluency per well was quantified using the Incucyte® analysis software. Values from all timepoints were normalised to day 0. Normalised values were plotted as a line graph (X-axis = days proliferation, Y-Axis = % of cell confluence), while end point values (last day imaged) were plotted as a bar chart.

[0387] Figures 1 to 9 show that:

[0388] • Knockout of KAT6A sensitises MCF7, T47D AND CAMA-1 cells to capivasertib monotherapy. • Knockout of KAT6A sensitises MCF7, T47D and CAMA-1 cells to the combination of capivasertib plus fulvestrant.

[0389] Dose responses

[0390] Cells were treated with a 5-points dose response of (0.001, 0.01, 0.1, 1, 10 pM) capivasertib. Cells were placed back into incubators and grown for 7 days with capivasertib. Media was replaced for fresh media with drug every 2 days. MCF7 and T47D seeded at 10,000 cells / well and CAMA-125,000 cells / well in two duplicated 96-well plates. Plates were placed in an incubator for cells to attach. After 24 hours, cells were treated, and plates were placed on the Incucyte® Zoom (Day 0). Dose responses were calculated using Graphpad Prism.

[0391] Figures 7, 8 and 9 show that:

[0392] • KAT6A KO increases capivasertib sensitivity in ER+ BC cells

[0393] Proliferation assays with KAT6A inhibitor CTx-648 (PF-9363) (K6Ai): The following protocol was used to set up proliferation assays and analyse resultant data shown in Figures 10 to 18.

[0394] All cell lines were cultured in phenol red free RPMI supplemented with 10% Fetal Bovine Serum (FBS), 1% Glutamax, and incubate at 37 °C with 5% CO2. First, cells were resuspended from a T75 flasks by washing them with PBS at room temperature and incubating them 5 minutes with 2 mL of Accutase™.Cell suspension was collected in a falcon and counted using a Vi-CELL counter (Beckman). Resuspended cells stocks were diluted to an appropriate cell density with media to seed 50 pL / well in 384-well plates (Greiner #781090) using a Multidrop™ Combi with standard cassette. The following cell numbers / well were seeded: MCF7 parental and CTRL, MCF7 KAT6A KO, MCF7 CapiR and MCF7 FulvR MCF7 ESRI (Y537S / - / -) (1000 cells / well), T47D parental and CTRL, T47D CapiR, T47D KAT6A KO and T47D FulvR (1000 cells / well), and CAMA-1 parental and CTRL, CAMA-1 CapiR, CAMA-1 KAT6A KO (4000 cells / well). Cells were seeded in columns (3 columns per cell line), and each plate was duplicated to have technical replicates. Edge wells in the plate were excluded (Rows A & P; Columns 1 & 24). Each cell line had at least six DMSO wells per plate (a total of twelve with two replicate plates), and at least triplicate samples for each drug treatment and plate. After cell seeding, plates were placed into an incubator until drug treatments.

[0395] All cells used were treated with drugs 24 hours after seeding CapiR and FulvR cells were seeded in presence of capivasertib (lOpM) and fulvestrant (lOOnM) respectively. Dimethyl sulfoxide (DMSO) was used as a vehicle to dilute drugs and as a neutral control. MCF7 cells were treated with lpM capivasertib and 3pM of 2,6-Dimethoxy-N-{4-methoxy-6-[(lH-pyrazol-l-yl)methyl]-l,2-benzoxazol-3-yl}benzene-l-sulfonamide (referred to herein as CTx-648, PF-9363, K6Ai or KAT6Ai), T47D cells were treated with 750nM capivasertib and lpM KAT6Ai, and CAMA-1 cells were treated with 400nM capivasertib and lpM KAT6AL

[0396] Figures 10 to 18 show that:

[0397] • KAT6A inhibitor shows a stronger effect on proliferation of ER+ breast cancer cells when combined with capivasertib

[0398] • In fulvestrant resistant cells the combination of a KAT6A inhibitor and an AKT inhibitor shows an antiproliferative phenotype

[0399] • Capivasertib resistant cells are re-sensitized to AKT inhibition when treated with a KAT6A inhibitor

[0400] Live / Dead Staining

[0401] NIR780 staining was performed in T47D cas9 capiR KAT6A KO cells. Cells were cultivated for 96 hours with capivasertib (lOpM) and then stained with NIR780 (Thermo Fisher Scientific). Live and dead cells were collected and stained (after trypsinization) with NIR780 (1:1000 in PBS) for 30' on ice. Cells were centrifuged at 1300rpm for 5' and resuspended in PBS. Cells were analysed on a FACSymphony (Becton Dickinson, USA). Cell death gating was carried out using FlowJo_vl0.8.0 software and plotted using GraphPad PRISM 8.

[0402] Figure 19 shows that genetic KO of KAT6A in T47D CapiR cells re-sensitises the cells to capivasertib.

Claims

CLAIMS1. A method of treating cancer in a patient in need thereof, comprising administering to the patient an amount of an AKT inhibitor in combination with an amount of a KAT6A inhibitor, wherein the amount of the AKT inhibitor and the amount of a KAT6A inhibitor together comprise a therapeutically effective amount.

2. The method of claim 1, wherein the administration of the AKT inhibitor and the KAT6A inhibitor is separate, sequential, or simultaneous.

3. The method of any one of the preceding claims, wherein the cancer comprises one or more AKT1, PIK3CA and / or PTEN gene alterations.

4. The method of any one of the preceding claims, wherein the cancer is breast cancer.

5. The method of any one of the preceding claims, wherein the cancer is locally advanced breast cancer or metastatic breast cancer.

6. The method of claim 4 or claim 5, wherein the breast cancer is a hormone receptor positive (HR+) breast cancer, optionally an estrogen receptor positive (ER+) breast cancer.

7. The method of any one of claims 4 to 6, wherein the breast cancer is a HER2-negative breast cancer.

8. The method of any one of the preceding claims, wherein the patient is a post-menopausal woman or a pre-menopausal woman.

9. The method of any one of claims 4 to 8, wherein the breast cancer is resistant to endocrine therapy, such as treatment with a selective estrogen receptor degrader (SERD), a selective estrogen receptor modulator (SERM) and / or an aromatase inhibitor (Al).

10. The method of any one of claims 4 to 9, wherein the patient's breast cancer has progressed during or after previous endocrine therapy, such as treatment with a SERD, a SERM and / or an Al.

11. The method of any one of the preceding claims, wherein the AKT inhibitor is capivasertib or a pharmaceutically acceptable salt thereof.

12. The method of claim 11, wherein the capivasertib or a pharmaceutically acceptable salt thereof is administered to the patient at a daily dosage from about 100 mg to about 1600 mg.

13. The method of claim 11, wherein the capivasertib, or a pharmaceutically acceptable salt thereof, is administered to the patient at a dosage of 160 mg, 200 mg, 320 mg or 400 mg, orally, twice- daily, on an intermittent weekly schedule of 4 days on followed by 3 days off.

14. The method of any one of the preceding claims, wherein the KAT6A inhibitor is 2,6-dimethoxy- N-{4-methoxy-6-[(lH-pyrazol-l-yl)methyl]-l,2-benzoxazol-3-yl}benzene-l-sulfonamide (CTx- 648) or a pharmaceutically acceptable salt thereof.

15. The method of any one of claims 1 to 13, wherein the KAT6A inhibitor is 2-methoxy-N-{4- methoxy-6-[(lH-pyrazol-l-yl)methyl]-l,2-benzoxazol-3-yl}benzene-l-sulfonamide (Compound 1) or a pharmaceutically acceptable salt thereof.

16. The method of claim 15, wherein the Compound 1 or a pharmaceutically acceptable salt thereof is administered at a daily dosage of from about 0.1 mg to about 15 mg.

17. The method of any one of the preceding claims, wherein the AKT inhibitor and KAT6A inhibitor are administered in combination with an antiestrogen.

18. The method of claim 17, wherein the administration of the AKT inhibitor, the KAT6A inhibitor and the antiestrogen is separate, sequential, or simultaneous.

19. The method of claim 17 or claim 18, wherein the antiestrogen is a SERD.

20. The method of any one of claims 17 to 19, wherein the SERD is fulvestrant or a pharmaceutically acceptable salt thereof.

21. The method of any one of claims 17 to 19, wherein the SERD is camizestrant or a pharmaceutically acceptable salt thereof.

22. The method of claim 17 or claim 18, wherein the antiestrogen is a SERM.

23. The method of claim 17 or claim 18, wherein the antiestrogen is an aromatase inhibitor.

24. An AKT inhibitor for use in the method of any one of claims 1 to 23.

25. A KAT6A inhibitor for use in the method of any one of claims 1 to 23.

26. The use of an AKT inhibitor in the manufacture of a medicament for use in the method of any one of claims 1 to 23.

27. The use of a KAT6A inhibitor in the manufacture of a medicament for use in the method of any one of claims 1 to 23.

28. A kit comprising (a) an AKT inhibitor, (b) instructions for use of the AKT inhibitor in the method of any one of claims 1 to 27, and optionally (c) the KAT6A inhibitor and / or an antiestrogen.

29. A kit comprising (a) a KAT6A inhibitor, (b) instructions for use of the KAT6A inhibitor in the method of any one of claims 1 to 27, and optionally (c) the AKT inhibitor and / or an antiestrogen.

30. A pharmaceutical composition comprising an AKT inhibitor, a KAT6A inhibitor, and a pharmaceutically acceptable excipient.

31. The pharmaceutical composition of claim 30, wherein the AKT inhibitor is capivasertib or a pharmaceutically acceptable salt thereof.

32. The pharmaceutical composition of claim 30 or 31 for use in the method of any one of claims 1

Images