Mutant microorganism having enhanced ability to produce l-aromatic amino acid, and method for producing l-aromatic amino acid using same
Patent Information
- Application Number
- PCT/KR2026/004373
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-03-18
- Filing Date
- 2026-03-18
- Publication Date
- 2026-09-24
Smart Images

Figure PCTKR2026004373-APPB-IMG-000001
Abstract
Description
Mutant microorganism with enhanced L-aromatic amino acid production capacity and method for producing L-aromatic amino acids using the same
[0001] The present invention relates to a mutant microorganism with enhanced L-aromatic amino acid production ability and a method for producing L-aromatic amino acids using the same.
[0002] Amino acids are classified into hydrophobic, hydrophilic, basic, and acidic amino acids based on the properties of their side chains, and among these, amino acids having a benzene ring are called aromatic amino acids. Aromatic amino acids include phenylalanine, tyrosine, and tryptophan. Phenylalanine and tryptophan are essential amino acids that are not synthesized in the body and constitute a high-value-added industry forming a global market worth $300 billion annually.
[0003] Aromatic amino acids can be produced using wild-type strains obtained from nature or mutant strains modified to enhance their amino acid production capabilities. Recently, to improve the production efficiency of aromatic amino acids, genetic recombination technology has been applied to microorganisms such as Escherichia coli and Corynebacterium, which are widely used for the production of useful substances like L-amino acids. This has led to the development of various recombinant strains or mutants with superior L-aromatic amino acid production capabilities, as well as methods for producing L-aromatic amino acids using these strains. In particular, there have been attempts to increase the production of these amino acids by targeting genes such as enzymes, transcription factors, and transport proteins involved in the biosynthetic pathway of L-aromatic amino acids, or by inducing mutations in promoters that regulate their expression. However, because there is a wide variety of proteins—such as enzymes, transcription factors, and transport proteins—directly or indirectly involved in L-aromatic amino acid production, much research is still needed regarding whether changes in the activity of these proteins lead to an increase in L-aromatic amino acid production capabilities.
[0004] [Prior Art Literature]
[0005] [Patent Literature]
[0006] Korean Registered Patent No. 10-1830002
[0007] The present invention aims to provide a mutant microorganism with enhanced L-aromatic amino acid production ability.
[0008] In addition, the present invention aims to provide a method for producing L-aromatic amino acids using the above-mentioned mutant microorganism.
[0009] One aspect of the present invention provides a mutant microorganism with enhanced L-aromatic amino acid production capacity and weakened activity of the cobalamin outer membrane transporter.
[0010] The "cobalamin outer membrane transporter" used in the present invention is an outer membrane porin that mediates the high-affinity binding of vitamin B12 or cyanocobalamin and TonB-dependent active transport. The cobalamin outer membrane transporter in the present invention may be a polypeptide encoded by the btuB gene and having cobalamin outer membrane transporter activity, but is not limited thereto.
[0011] Nucleic acid and protein sequence information for the above-mentioned cobalamin outer membrane transporter can be obtained through known sequence databases (e.g., GenBank, UniProt).
[0012] The terms “reduced activity” or “reduced activity” as used in the present invention refer to a decrease in the activity of a target polypeptide or protein compared to its intrinsic activity or the absence of such activity, and may be used interchangeably with terms such as inactivation, deficiency, reduction, or lowering. Such reduced activity may include, but is not limited to, cases where the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide possessed by the original microorganism, i.e., the wild type or the microorganism before modification, due to a nucleotide modification of the gene encoding the polypeptide; cases where the overall degree of polypeptide activity (expression level) is lower than that of the original microorganism due to inhibition of expression or translation of the target gene caused by a modification of the regulatory region of the gene encoding the polypeptide; cases where there is no polypeptide activity even if the gene encoding the polypeptide is expressed.
[0013] Here, the above nucleotide modification refers to a difference from the original polynucleotide sequence due to wholly or partially deleted, substituted, inserted, or a combination thereof in the polynucleotide sequence of a gene encoding a polypeptide. The above regulatory region modification refers to a difference from the original polynucleotide sequence due to wholly or partially deleted, substituted, inserted, or a combination thereof in the polynucleotide sequence of elements constituting a regulatory region (regulatory sequence), such as a promoter, enhancer, or transcription terminator, and may, for example, be replaced with a weak promoter to reduce or suppress gene expression. Here, deletion means a change in which a base, nucleotide, polynucleotide, or nucleic acid is removed; substitution means a change in which a base, nucleotide, polynucleotide, or nucleic acid is replaced with another base, nucleotide, polynucleotide, or nucleic acid; and insertion means a change in which another base, nucleotide, polynucleotide, or nucleic acid is added.
[0014] According to one embodiment of the present invention, the weakening of activity may be a nucleotide modification, a regulatory region modification, or a combination thereof of a gene encoding a cobalamin outer membrane transporter.
[0015] For example, the weakening of the activity of the cobalamin outer membrane transporter may be due to the deletion of all or part of the polynucleotide sequence of the gene encoding the cobalamin outer membrane transporter, but is not limited thereto.
[0016] The above cobalamin outer membrane transporter is derived from Escherichia coli and may be encoded by the nucleotide sequence of SEQ ID NO. 1 or composed of the amino acid sequence of SEQ ID NO. 2.
[0017] The base sequence or amino acid sequence of the cobalamin outer membrane transporter according to the present invention may consist of or essentially include a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology or identity compared to the base sequence of SEQ ID NO. 1 or the amino acid sequence of SEQ ID NO. 2, and may have an original function. Here, “homology” or “identity” refers to the percentage of agreement between two sequences when a reference base sequence or amino acid sequence and any other base sequence or amino acid sequence are aligned and analyzed to correspond as much as possible.
[0018] The term “improved L-aromatic amino acid production capacity” as used in the present invention means that the productivity of L-aromatic amino acids is increased compared to the parent strain. The parent strain refers to a wild-type or mutant strain that is the subject of mutation, and includes a subject that is directly subjected to mutation or transformed by a recombinant vector, etc. In the present invention, the parent strain may be a microorganism or strain of the genus Escherichia that has no L-aromatic amino acid production capacity or has L-aromatic amino acid production capacity, and may be a wild-type Escherichia or a mutated Escherichia from the wild-type.
[0019] According to one embodiment of the present invention, the L-aromatic amino acid may be one or more selected from the group consisting of L-tryptophan, L-phenylalanine, and L-tyrosine.
[0020] According to one embodiment of the present invention, the genus Escherichia may be Escherichia coli, Escherichia albertii, Escherichia blattae, Escherichia fergusonii, Escherichia hermannii, Escherichia vulneris, etc., but is not limited thereto.
[0021] For example, the microorganism of the genus Escherichia mentioned above may be Escherichia coli.
[0022] The mutant microorganism according to the present invention may be endowed with resistance to bacteriophage infection by weakening the activity of the cobalamin outer membrane transporter, thereby improving the production capacity of L-aromatic amino acids.
[0023] Specifically, the mutant microorganism with enhanced L-aromatic amino acid production capacity exhibits increased L-aromatic amino acid production capacity compared to the microorganism before mutation (parent strain), and in particular, compared to the parent strain, the L-aromatic amino acid production increases by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or by 1.1 times, 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, It may be increased by 9, 9.5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 times, but is not limited thereto. For example, a mutant microorganism with weakened activity of the cobalamin outer membrane transporter may have an L-aromatic amino acid production of 5% or more, specifically 5 to 80% (preferably 7 to 50%), compared to the parent strain.
[0024] The mutant microorganism according to the present invention can be used as a composition for producing L-aromatic amino acids.
[0025] Specifically, the composition for producing L-aromatic amino acids may include a mutant microorganism in which the activity of the cobalamin outer membrane transporter is weakened.
[0026]
[0027] A mutant microorganism with enhanced L-aromatic amino acid production capacity according to one embodiment of the present invention can be realized through a gene inactivation method or a recombinant vector for deleting a gene encoding a cobalamin outer membrane transporter in the mutant microorganism prior to mutation.
[0028] The above gene inactivation method may be used without limitation as long as it is a method known in the art, such as, for example, the one-step inactivation method (Warner et al., PNAS, 6:6640-6645(2000)), the CaCl₂ method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114(1973)), the Hanahan method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114(1973); Hanahan, D., J. Mol. Biol., 166:557-580(1983)), and the electroporation method (Dower, WJ et al., Nucleic. Acids Res., 16:6127-6145(1988)), but is not limited thereto.
[0029] As used in the present invention, the term "vector" refers to any type of nucleic acid sequence carrier structure used as a means to deliver and express a target gene to a mutation target (host cell). Unless otherwise specified, the vector may mean a structure in which a carried nucleic acid sequence is inserted into the host cell genome to be expressed and / or expressed independently. Such a vector comprises an essential regulatory element operably linked to enable the expression of the gene insertion, where "operably linked" means that the target gene and its regulatory sequence are linked in a manner in which they are functionally coupled to enable gene expression, and the "regulatory element" or "regulatory sequence" includes a promoter for performing transcription, any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation, etc.
[0030] The vector used in the present invention is not particularly limited as long as it is capable of replicating within a host cell, and any vector known in the art may be used. Examples of such vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors, but are not limited thereto.
[0031] The above vector can typically be constructed as a vector for cloning or as a vector for expression. The vector for expression may be a conventional one used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and may be constructed through various methods known in the art.
[0032] The “recombinant vector” used in the present invention may be constructed using a prokaryotic or eukaryotic cell as a host, and may be capable of replication independently of the host cell’s genome or may be sealed to the genome itself. The host cell is capable of replication by the vector and may include a replication origin, which is a specific nucleotide sequence at which replication is initiated. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it generally includes a potent promoter capable of proceeding transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. When the host is a eukaryotic cell, the replication origins included in the vector that operate in eukaryotic cells include, but are not limited to, f1 replication origins, SV40 replication origins, pMB1 replication origins, adeno replication origins, AAV replication origins, and BBV replication origins. In addition, promoters derived from the genome of mammalian cells (e.g., metallothionine promoters) or promoters derived from mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, HSV tk promoter) may be used and generally have a polyadenylation sequence as a transcription termination sequence.
[0033] The above-mentioned recombinant vector may include a selection marker, which is intended to select transformants (host cells) transformed by the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, the selection of transformed cells is possible. Representative examples of the selection marker include ampicillin, kanamycin, streptomycin, and chloramphenicol, but are not limited thereto.
[0034] A transformant can be produced by inserting the above-mentioned recombinant vector into a host cell, and the transformant may be obtained by introducing the recombinant vector into a suitable host cell. Any host cell known in the art may be used as a cell capable of stably and continuously cloning or expressing the above-mentioned expression vector.
[0035] When transforming a prokaryotic cell to produce a recombinant microorganism, various intestinal bacteria such as Escherichia coli (E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli, E. coli X 1776, E. coli W3110, E. coli XL1-Blue), Corynebacterium, Bacillus subtilis, Bacillus thuringiensis, Salmonella typhimurium, Serratia marcescens, and Pseudomonas may be used as host cells, but are not limited thereto.
[0036] When transforming into a eukaryotic cell to produce a recombinant microorganism, host cells such as yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell lines, etc., may be used, but are not limited thereto.
[0037] As used in this invention, “transformation” refers to a phenomenon in which external DNA is introduced into a host cell to artificially induce a genetic change, and “transformant” refers to a host cell into which external DNA is introduced to stably maintain the expression of a target gene.
[0038] The above transformation may be performed by selecting a vector introduction technique suitable for the host cell to express the target gene or a recombinant vector containing it within the host cell. For example, vector introduction may be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene may be included without limitation, whether inserted into the chromosomes of the host cell or located extrachromosomally, as long as it can be expressed within the host cell.
[0039] The genes inserted into the recombinant vector for transformation of the present invention can be introduced into host cells through homologous recombination crossing.
[0040] The above transformant comprises cells that have been transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used interchangeably with recombinant host cells, recombinant cells, or recombinant microorganisms.
[0041] The transformant in the present invention may be one other than a human.
[0042] According to one embodiment of the present invention, the host cell may be of the genus Escherichia, for example Escherichia coli, but is not limited thereto.
[0043]
[0044] Another aspect of the present invention provides a method for producing L-aromatic amino acids, comprising the steps of: culturing the mutant microorganism in a medium; and recovering L-aromatic amino acids from the mutant microorganism or the medium in which the mutant microorganism is cultured.
[0045] The above culture may be carried out according to appropriate media and culture conditions known in the art, and a person skilled in the art can easily adjust and use the media and culture conditions. Specifically, the media may be liquid media, but is not limited thereto. The culture method may include, for example, batch culture, continuous culture, fed-batch culture, or a combination thereof, but is not limited thereto.
[0046] According to one embodiment of the present invention, the medium must satisfy the requirements of a specific strain in an appropriate manner and may be appropriately modified by a person skilled in the art. For culture media for strains of the genus Escherichia, reference may be made to the known literature (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but is not limited thereto.
[0047] According to one embodiment of the present invention, the culture medium may contain various carbon sources, nitrogen sources, and trace element components. Carbon sources that may be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These substances may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that may be used include peptone, yeast extract, meat broth, malt extract, corn steep liquid, soybean meal, and urea or inorganic compounds, such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that may be used may include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium-containing salts. Additionally, the culture medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth, but are not limited thereto. Furthermore, essential growth substances such as amino acids and vitamins may be included. In addition, suitable precursors may be used in the culture medium. The medium or individual components may be added to the culture solution in a batch or continuous manner in a manner suitable for the culture process, but are not limited thereto.
[0048] According to one embodiment of the present invention, the pH of the culture medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid to the microbial culture medium in an appropriate manner during cultivation. Additionally, bubble formation can be suppressed by using an antifoaming agent such as a fatty acid polyglycol ester during cultivation. Furthermore, oxygen or an oxygen-containing gas (e.g., air) can be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium can typically be 20 to 45°C, for example, 25 to 40°C. The cultivation period can continue until a desired amount of useful material is obtained, for example, 10 to 160 hours.
[0049] According to one embodiment of the present invention, the step of recovering L-aromatic amino acids from the cultured mutant microorganism or the medium in which the mutant microorganism is cultured may involve collecting or recovering L-aromatic amino acids from the medium using a suitable method known in the art according to the culture method. For example, methods such as centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), and chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but are not limited thereto.
[0050] According to one embodiment of the present invention, the step of recovering the L-aromatic amino acid may involve removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.
[0051] According to one embodiment of the present invention, the step of recovering the L-aromatic amino acid may include a process of purifying the L-aromatic amino acid.
[0052] According to one embodiment of the present invention, the L-aromatic amino acid may be one or more selected from the group consisting of L-tryptophan, L-phenylalanine, and L-tyrosine.
[0053] The mutant microorganism according to the present invention is endowed with resistance to bacteriophage infection by weakening the activity of the cobalamin outer membrane transporter, thereby improving the production yield of L-aromatic amino acids compared to the microorganism before mutation.
[0054] The present invention will be described in more detail below. However, this description is provided merely as an example to aid in understanding the invention, and the scope of the invention is not limited by this exemplary description.
[0055]
[0056] Example 1. Preparation of a mutant strain with weakened activity of the cobalamin outer membrane transporter
[0057] To produce a strain with weakened activity of the cobalamin outer membrane transporter, the gene btuB encoding the cobalamin outer membrane transporter was deleted from L-tryptophan-producing Escherichia coli W0G (accession number KCCM13013P) (parent strain) using a one-step inactivation method (Warner et al., PNAS, 6:6640-6645(2000)).
[0058] PCR was performed using the pKD13 plasmid (GenBank AY048744) as a template, primer 1 containing a 50 bp upstream sequence of the btuB gene and a 20 bp upstream sequence of the pKD13 FRT, and primer 2 containing a 20 bp downstream sequence of the pKD13 FRT, and a 1423 bp fragment was obtained. Takara PrimeSTAR Max DNA polymerase was used as the polymerase, and the PCR amplification conditions consisted of 30 cycles of denaturation at 98°C for 10 seconds, annealing at 57°C for 15 seconds, and polymerization at 72°C for 10 seconds.
[0059] After introducing the red recombinase plasmid pKD46 (GenBank AY048746) into the parent strain, the generated PCR fragment was injected via electroporation to select kanamycin-resistant colonies. The selected transformants were PCR-treated using the primer pair of primers 3 and 4. Bioneer AccuPower® PCR PreMix was used as the polymerase, and the PCR amplification conditions consisted of 30 cycles of denaturation at 95°C for 30 seconds, annealing at 57°C for 30 seconds, and polymerization at 72°C for 1 minute.
[0060] Compared to the 2141 bp PCR fragment generated when the original gene is present, it was confirmed that a 1675 bp PCR fragment is generated when the btuB gene is deleted and the kanamycin resistance gene is inserted.
[0061] To remove the kanamycin resistance gene, FLP recombination was induced in selected transformants by removing pKD46 and introducing pCP20 (Cherepanov and Wackerneagel, 1995; Datsenko and Wanner, 2000). The selected transformants were subjected to PCR using the primer pair of primers 3 and 4. Bioneer AccuPower® PCR PreMix was used as the polymerase, and the PCR amplification conditions consisted of 30 cycles of denaturation at 95°C for 30 seconds, annealing at 57°C for 30 seconds, and polymerization at 72°C for 1 minute. It was confirmed that a 453 bp PCR fragment was generated after removing the kanamycin resistance gene, whereas a 1675 bp PCR fragment was generated when the gene was present. Subsequently, pCP20 was removed from the transformants.
[0062] Finally, the mutant strain confirmed to have a deleted btuB gene by removing the kanamycin resistance gene was named DS-WP01.
[0063] The primers used here are as shown in Table 1 below.
[0064] Sequence Number Primer Name Primer Sequence (5'-3')3 Primer 1taatattgatgaaacctgcggcatccttcttctattgtggatgctttacagtgtaggctggagctgcttc4 Primer 2ggtgtagctgccagacaaggtgtattcccgtcctgcagtttggtagccatctgtcaaacatgagaattaa5 Primer 3gtgcgatgattgcgttatgc6 Primer 4acgggaaagcgacgttatcg
[0065]
[0066] Experimental Example 1. Evaluation of Bacteriophage Resistance
[0067] The bacteriophage resistance of the mutant strain DS-WP01 produced in Example 1 was evaluated compared with the parent strain.
[0068] The strain (parent or mutant strain) was inoculated into 3 mL of LB liquid medium and prepared by shaking incubation at 37°C and 200 rpm for 16 hours. 30 μL of the culture solution of each strain (based on OD 1.0) and a suspension (1×10⁶) of a BF23 series phage (isolated from Escherichia coli K-12 MG1655) were added to 10 mL of LB liquid medium. 7 Phage resistance was confirmed by inoculating 100 μL (cfu / mL) and incubating in a 37℃ incubator for 16 hours.
[0069] As a result, the parent strain was lysed by BF23 lineage phages, whereas the mutant strain was not lysed by BF23 lineage phages. Therefore, it was confirmed that the mutant strain acquired phage resistance due to the deletion of the btuB gene.
[0070]
[0071] Experimental Example 2. Evaluation of L-Tryptophan Production Capacity
[0072] The L-tryptophan production capacity of the mutant strain DS-WP01 produced in Example 1 was evaluated compared with the parent strain.
[0073] 10 mL of the tryptophan production medium of Table 2 below was added to a 100 mL flask, and 1% of each strain (parent strain or mutant strain) was inoculated and cultured with shaking at 200 rpm at 37°C for 48 hours. After the culture was finished, the concentration of L-tryptophan in the medium was measured using HPLC (Agilent), and the results are shown in Table 3 below.
[0074] Ingredient contentGlucose80.0 g / L(NH4)2SO420.0 g / LK2HPO40.8 g / LK2SO40.4 g / LMgCl20.8 g / LFumaric acid1.0 g / LYeast extract1.0 g / L(NH4)6Mo7O 24 0.12 ppmH3BO30.01 ppmCuSO40.01 ppmMnCl22.00 ppmZnSO40.01 ppmCoCl20.10 ppmFeCl210.00 ppmThiamine_HCl20.00 ppmL-Tyrosine200.00 ppmL-phenylalanine300.00 ppmCaCO33%pH 7.0 with NaOH (33%)
[0075] L-Tryptophan Concentration (g / L) Parent Strain 3.8DS-WP014.5
[0076]
[0077] As shown in Table 3 above, when the activity of the cobalamin outer membrane transporter was weakened, the production of L-tryptophan increased by approximately 18.4% compared to the parent strain. These results suggest that the weakening of the activity of the cobalamin outer membrane transporter leads to resistance to bacteriophage infection, and consequently, the strain's ability to produce the target product is improved.
[0078]
[0079] The present invention has been described above with reference to its preferred embodiments. Those skilled in the art will understand that the present invention may be embodied in modified forms without departing from the essential characteristics of the invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the invention is defined by the claims, not by the foregoing description, and all variations within the scope of the claims should be interpreted as being included in the invention.
[0080] [Consignment Number]
[0081] Depository Name: Korean Culture Collection Center (KCCM)
[0082] Trustee Number: KCCM13013P
[0083] Date of Trust: 20210622
[0084]
Claims
1. A mutant microorganism with enhanced L-aromatic amino acid production capacity and weakened activity of the cobalamin outer membrane transporter.
2. In Claim 1, A mutant microorganism in which the above-mentioned weakening of activity is a nucleotide modification, a regulatory region modification, or a combination thereof of a gene encoding a cobalamin outer membrane transporter.
3. In Claim 1, A mutant microorganism in which the above L-aromatic amino acid is one or more selected from the group consisting of L-tryptophan, L-phenylalanine, and L-tyrosine.
4. In Claim 1, The above mutant microorganism is a mutant microorganism of the genus Escherichia.
5. A step of culturing the variant microorganism of Claim 1 in a culture medium; and A method for producing L-aromatic amino acids comprising the step of recovering L-aromatic amino acids from the above-mentioned mutant microorganism or a medium in which the mutant microorganism is cultured.
6. In Claim 5, A method in which the above L-aromatic amino acid is one or more selected from the group consisting of L-tryptophan, L-phenylalanine, and L-tyrosine.