Mutant microorganism having enhanced ability to produce l-histidine, and method for producing l-histidine using same

Abstract

The present invention relates to a mutant microorganism having an enhanced ability to produce L-histidine, and a method for producing L-histidine using same. In the mutant microorganism, the activity of alpha-amylase is reduced to decrease unnecessary energy consumption, and the activity of inosine 5'-monophosphate dehydrogenase is reduced to increase the supply of ATP required for histidine biosynthesis, thereby enabling the mutant microorganism to achieve a higher production yield of L-histidine than the microorganism prior to mutation.

Description

Mutant microorganism with enhanced L-histidine production capacity and method for producing L-histidine using the same

[0001] The present invention relates to a mutant microorganism with enhanced L-histidine production capacity and a method for producing L-histidine using the same.

[0002] Histidine is an essential amino acid that is not synthesized in the bodies of humans or animals and must be supplied from external sources; it is generally produced through fermentation using microorganisms such as bacteria or yeast.

[0003] Histidine production can be achieved using wild-type strains obtained from nature or mutant strains modified to enhance their amino acid production capabilities. Recently, to improve the efficiency of histidine production, genetic recombination technology has been applied to microorganisms such as Escherichia coli and Corynebacterium, which are widely used for the production of useful substances like L-amino acids. This has led to the development of various recombinant strains or mutants with superior L-histidine production capabilities, as well as methods for producing L-histidine using these strains. In particular, there have been attempts to increase the production of the corresponding amino acid by targeting genes involved in the L-histidine biosynthetic pathway, such as enzymes, transcription factors, and transport proteins, or by inducing mutations in promoters that regulate their expression. However, because there is a wide variety of proteins—including enzymes, transcription factors, and transport proteins—directly or indirectly involved in L-histidine production, much research is still needed regarding whether changes in the activity of these proteins lead to an increase in L-histidine production capabilities.

[0004] [Prior Art Literature]

[0005] [Patent Literature]

[0006] Korean Registered Patent No. 10-1904666

[0007] The present invention aims to provide a mutant microorganism with enhanced L-histidine production ability.

[0008] In addition, the present invention aims to provide a method for producing L-histidine using the above-mentioned mutant microorganism.

[0009] One aspect of the present invention provides a mutant microorganism with enhanced L-histidine production capacity, with reduced activity of alpha-amylase, inosine 5'-monophosphate dehydrogenase, or the same.

[0010] The "alpha-amylase" used in the present invention is an enzyme that hydrolyzes α-1,4 glycosidic linkages in polysaccharides (e.g., starch, glycogen) having three or more α-1,4 linked D-glucose units, and has a relatively high proportion of histidine among its constituent amino acids. The alpha-amylase in the present invention may be a polypeptide encoded by the amyA gene and having alpha-amylase activity, but is not limited thereto.

[0011] The “inosine 5’-monophosphate dehydrogenase” used in the present invention is a purine biosynthetic enzyme that catalyzes the oxidation of NAD+-dependent inosine monophosphate (IMP) to xanthosine monophosphate (XMP) and acts in ATP synthesis. The inosine 5’-monophosphate dehydrogenase in the present invention may be a polypeptide encoded by the guaB gene and having inosine 5’-monophosphate dehydrogenase activity, but is not limited thereto.

[0012] Nucleic acid and protein sequence information for the above alpha-amylase and inosine 5'-monophosphate dehydrogenase can be obtained through known sequence databases (e.g., GenBank, UniProt).

[0013] The terms “reduced activity” or “reduced activity” as used in the present invention refer to a decrease in the activity of a target polypeptide or protein compared to its intrinsic activity or the absence of such activity, and may be used interchangeably with terms such as inactivation, deficiency, reduction, or lowering. Such reduced activity may include, but is not limited to, cases where the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide possessed by the original microorganism, i.e., the wild type or the microorganism before modification, due to a nucleotide modification of the gene encoding the polypeptide; cases where the overall degree of polypeptide activity (expression level) is lower than that of the original microorganism due to inhibition of expression or translation of the target gene caused by a modification of the regulatory region of the gene encoding the polypeptide; cases where there is no polypeptide activity even if the gene encoding the polypeptide is expressed.

[0014] Here, the above nucleotide modification refers to a difference from the original polynucleotide sequence due to wholly or partially deleted, substituted, added, or a combination thereof in the polynucleotide sequence of a gene encoding a polypeptide. The above regulatory region modification refers to a difference from the original polynucleotide sequence due to wholly or partially deleted, substituted, added, or a combination thereof in the polynucleotide sequence of elements constituting a regulatory region (regulatory sequence), such as a promoter, enhancer, or transcription terminator, and may, for example, be replaced with a weak promoter to reduce or suppress gene expression. Here, deletion means a change in which a base, nucleotide, polynucleotide, or nucleic acid is removed; substitution means a change in which a base, nucleotide, polynucleotide, or nucleic acid is replaced with another base, nucleotide, polynucleotide, or nucleic acid; and addition means a change in which another base, nucleotide, polynucleotide, or nucleic acid is added.

[0015] According to one embodiment of the present invention, the activity attenuation may be an alpha-amylase, inosine 5'-monophosphate dehydrogenase, or a nucleotide modification, a regulatory region modification, or a combination thereof of a gene encoding these.

[0016] For example, the weakening of the activity of the above alpha-amylase may be due to the deletion of all or part of the polynucleotide sequence of the gene encoding alpha-amylase, but is not limited thereto.

[0017] The above alpha-amylase is derived from Escherichia coli and may be encoded by the nucleotide sequence of SEQ ID NO. 1 or composed of the amino acid sequence of SEQ ID NO. 2.

[0018] The base sequence or amino acid sequence of alpha-amylase according to the present invention may consist of or essentially include a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology or identity when compared to the base sequence of SEQ ID NO. 1 or the amino acid sequence of SEQ ID NO. 2, and may have an original function. Here, “homology” or “identity” means the percentage of agreement between two sequences when a reference base sequence or amino acid sequence and any other base sequence or amino acid sequence are aligned to correspond as much as possible and analyzed.

[0019] For example, the weakening of the activity of the inosine 5'-monophosphate dehydrogenase may be due to substitution of all or part of the polynucleotide sequence of the gene encoding inosine 5'-monophosphate dehydrogenase, or replacement of the start codon, but is not limited thereto.

[0020] The above inosine 5'-monophosphate dehydrogenase is derived from Escherichia coli and may be encoded by the nucleotide sequence of SEQ ID NO. 3 or composed of the amino acid sequence of SEQ ID NO. 4.

[0021] The nucleotide sequence or amino acid sequence of the inosine 5'-monophosphate dehydrogenase according to the present invention may consist of or essentially include a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology or identity compared to the nucleotide sequence of SEQ ID NO. 3 or the amino acid sequence of SEQ ID NO. 4, and may have an original function.

[0022] The term “improved L-histidine production capacity” as used in the present invention means that the productivity of L-histidine is increased compared to the parent strain. The parent strain refers to a wild-type or mutant strain that is the subject of mutation, and includes the subject that is directly subjected to mutation or transformed by a recombinant vector, etc. In the present invention, the parent strain may be a microorganism or strain of the genus Escherichia that has no L-histidine production capacity or has L-histidine production capacity, and may be a wild-type Escherichia or a mutated Escherichia from the wild-type.

[0023] According to one embodiment of the present invention, the mutant microorganism may be of the genus Escherichia.

[0024] Specifically, the genus Escherichia mentioned above may include, but is not limited to, Escherichia coli, Escherichia albertii, Escherichia blattae, Escherichia fergusonii, Escherichia hermannii, Escherichia vulneris, etc.

[0025] For example, the above-mentioned mutant microorganism may be Escherichia coli.

[0026] According to one embodiment of the present invention, the mutant microorganism may have weakened activity of alpha-amylase or inosine 5'-monophosphate dehydrogenase, or weakened activity of alpha-amylase and inosine 5'-monophosphate dehydrogenase.

[0027] In the mutant microorganism according to the present invention, unnecessary energy consumption is reduced by weakening the activity of alpha-amylase, and the supply of ATP required for histidine biosynthesis is increased by weakening the activity of inosine 5'-monophosphate dehydrogenase, thereby improving the production capacity of L-histidine.

[0028] Specifically, the mutant microorganism with enhanced L-histidine production capacity exhibits increased L-histidine production capacity compared to the microorganism before mutation (parent strain), and in particular, compared to the parent strain, the L-histidine production increases by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or by 1.1 times, 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, It may be increased by 9, 9.5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 times, but is not limited thereto. For example, the activity of the alpha-amylase or inosine 5'-monophosphate dehydrogenase may be weakened, or a mutant microorganism in which the activity of alpha-amylase and inosine 5'-monophosphate dehydrogenase is weakened may have an L-histidine production of 5% or more, specifically 5 to 80% (preferably 7 to 50%), compared to the parent strain.

[0029] The mutant microorganism according to the present invention can be used as a composition for producing L-histidine.

[0030] Specifically, the histidine production composition may include a mutant microorganism with weakened activity of alpha-amylase or inosine 5'-monophosphate dehydrogenase, or a microorganism with weakened activity of alpha-amylase and inosine 5'-monophosphate dehydrogenase.

[0031]

[0032] A mutant microorganism with enhanced L-histidine production capacity according to one embodiment of the present invention may be implemented through a gene inactivation method or a recombinant vector for deleting a gene encoding alpha-amylase in the mutant microorganism prior to mutation, and / or introducing a sequence variant in a gene encoding inosine 5'-monophosphate dehydrogenase.

[0033] A variation in the base sequence of the above gene (base variation) refers to a change or variation in the sequence showing a difference of one or more bases or nucleotides (A, T, C, or G; nucleotide A means adenine, nucleotide T means thymine, nucleotide C means cytosine, or nucleotide G means guanine), and a variation in a single base or nucleotide is called a single base sequence variation or a single nucleotide variant. If such a base variation exists in a region that encodes a protein (coding sequence), it affects the structure of the protein, which may alter the structure or function of the protein; if it exists in a non-coding region that does not encode a protein, such as a promoter, it causes differences in the expression level of the protein, which may increase or decrease the overall activity of the protein. A gene having such a variation is called a variant gene or a gene variant.

[0034] For example, the gene variant of the inosine 5'-monophosphate dehydrogenase above may be one in which the 1st base A in the base sequence of SEQ ID NO. 3 is substituted with G or T, but is not limited thereto.

[0035] The above gene inactivation method may be used without limitation as long as it is a method known in the art, such as, for example, the one-step inactivation method (Warner et al., PNAS, 6:6640-6645(2000)), the CaCl₂ method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114(1973)), the Hanahan method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114(1973); Hanahan, D., J. Mol. Biol., 166:557-580(1983)), and the electroporation method (Dower, WJ et al., Nucleic. Acids Res., 16:6127-6145(1988)), but is not limited thereto.

[0036] As used in the present invention, the term "vector" refers to any type of nucleic acid sequence carrier structure used as a means to deliver and express a target gene to a mutation target (host cell). Unless otherwise specified, the vector may mean a structure in which a carried nucleic acid sequence is inserted into the host cell genome to be expressed and / or expressed independently. Such a vector comprises an essential regulatory element operably linked to enable the expression of the gene insertion, where "operably linked" means that the target gene and its regulatory sequence are linked in a manner in which they are functionally coupled to enable gene expression, and the "regulatory element" or "regulatory sequence" includes a promoter for performing transcription, any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation, etc.

[0037] The vector used in the present invention is not particularly limited as long as it is capable of replicating within a host cell, and any vector known in the art may be used. Examples of such vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors, but are not limited thereto.

[0038] The above vector can typically be constructed as a vector for cloning or as a vector for expression. The vector for expression may be a conventional one used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and may be constructed through various methods known in the art.

[0039] The “recombinant vector” used in the present invention may be constructed using a prokaryotic or eukaryotic cell as a host, and may be capable of replication independently of the host cell’s genome or may be sealed to the genome itself. The host cell is capable of replication by the vector and may include a replication origin, which is a specific nucleotide sequence at which replication is initiated. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it generally includes a potent promoter capable of proceeding transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. When the host is a eukaryotic cell, the replication origins included in the vector that operate in eukaryotic cells include, but are not limited to, f1 replication origins, SV40 replication origins, pMB1 replication origins, adeno replication origins, AAV replication origins, and BBV replication origins. In addition, promoters derived from the genome of mammalian cells (e.g., metallothionine promoters) or promoters derived from mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, HSV tk promoter) may be used and generally have a polyadenylation sequence as a transcription termination sequence.

[0040] The above recombinant vector may include a selection marker, which is intended to select transformants (host cells) transformed by the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, the selection of transformed cells is possible. Representative examples of the selection marker include ampicillin, kanamycin, streptomycin, and chloramphenicol, but are not limited thereto.

[0041] A transformant can be produced by inserting the above-mentioned recombinant vector into a host cell, and the transformant may be obtained by introducing the recombinant vector into a suitable host cell. Any host cell known in the art may be used as a cell capable of stably and continuously cloning or expressing the above-mentioned expression vector.

[0042] When transforming a prokaryotic cell to produce a recombinant microorganism, various intestinal bacteria such as Escherichia coli (E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli, E. coli X 1776, E. coli W3110, E. coli XL1-Blue), Corynebacterium, Bacillus subtilis, Bacillus thuringiensis, Salmonella typhimurium, Serratia marcescens, and Pseudomonas may be used as host cells, but are not limited thereto.

[0043] When transforming into a eukaryotic cell to produce a recombinant microorganism, host cells such as yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell lines, etc., may be used, but are not limited thereto.

[0044] As used in this invention, “transformation” refers to a phenomenon in which external DNA is introduced into a host cell to artificially induce a genetic change, and “transformant” refers to a host cell into which external DNA is introduced to stably maintain the expression of a target gene.

[0045] The above transformation may be performed by selecting a vector introduction technique suitable for the host cell to express the target gene or a recombinant vector containing it within the host cell. For example, vector introduction may be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene may be included without limitation, whether inserted into the chromosomes of the host cell or located extrachromosomally, as long as it can be expressed within the host cell.

[0046] The genes inserted into the recombinant vector for transformation of the present invention can be introduced into host cells through homologous recombination crossing.

[0047] The above transformant comprises cells that have been transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used interchangeably with recombinant host cells, recombinant cells, or recombinant microorganisms.

[0048] The transformant in the present invention may be one other than a human.

[0049] According to one embodiment of the present invention, the host cell may be of the genus Escherichia, for example Escherichia coli, but is not limited thereto.

[0050]

[0051] Another aspect of the present invention provides a method for producing L-histidine, comprising the steps of: culturing the mutant microorganism in a medium; and recovering L-histidine from the mutant microorganism or the medium in which the mutant microorganism is cultured.

[0052] The above culture may be carried out according to appropriate media and culture conditions known in the art, and a person skilled in the art can easily adjust and use the media and culture conditions. Specifically, the media may be liquid media, but is not limited thereto. The culture method may include, for example, batch culture, continuous culture, fed-batch culture, or a combination thereof, but is not limited thereto.

[0053] According to one embodiment of the present invention, the medium must satisfy the requirements of a specific strain in an appropriate manner and may be appropriately modified by a person skilled in the art. For culture media for strains of the genus Escherichia, reference may be made to the known literature (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but is not limited thereto.

[0054] According to one embodiment of the present invention, the culture medium may contain various carbon sources, nitrogen sources, and trace element components. Carbon sources that may be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These substances may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that may be used include peptone, yeast extract, meat broth, malt extract, corn steep liquid, soybean meal, and urea or inorganic compounds, such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that may be used may include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium-containing salts. Additionally, the culture medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth, but are not limited thereto. Furthermore, essential growth substances such as amino acids and vitamins may be included. In addition, suitable precursors may be used in the culture medium. The medium or individual components may be added to the culture solution in a batch or continuous manner in a manner suitable for the culture process, but are not limited thereto.

[0055] According to one embodiment of the present invention, the pH of the culture medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid to the microbial culture medium in an appropriate manner during cultivation. Additionally, bubble formation can be suppressed by using an antifoaming agent such as a fatty acid polyglycol ester during cultivation. Furthermore, oxygen or an oxygen-containing gas (e.g., air) can be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium can typically be 20 to 45°C, for example, 25 to 40°C. The cultivation period can continue until a desired amount of useful material is obtained, for example, 10 to 160 hours.

[0056] According to one embodiment of the present invention, the step of recovering L-histidine from the cultured mutant microorganism or the medium in which the mutant microorganism is cultured may involve collecting or recovering L-histidine from the medium using a suitable method known in the art according to the culture method. For example, methods such as centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), and chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but are not limited thereto.

[0057] According to one embodiment of the present invention, the step of recovering L-histidine may involve removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.

[0058] According to one embodiment of the present invention, the step of recovering L-histidine may include a process of purifying L-histidine.

[0059] In the mutant microorganism according to the present invention, unnecessary energy consumption is reduced by weakening the activity of alpha-amylase, and the supply of ATP required for histidine biosynthesis is increased by weakening the activity of inosine 5'-monophosphate dehydrogenase, so the production yield of L-histidine can be improved compared to the microorganism before mutation.

[0060] The present invention will be described in more detail below. However, this description is provided merely as an example to aid in understanding the invention, and the scope of the invention is not limited by this exemplary description.

[0061]

[0062] Example 1. Preparation of a mutant strain with weakened inosine 5'-monophosphate dehydrogenase activity

[0063] To produce strains with weakened inosine 5'-monophosphate dehydrogenase activity, a variant in which the start codon ATG is substituted with GTG (guaB_A1G, SEQ ID NO. 5) or TTG is substituted with GTG (guaB_A1T, SEQ ID NO. 6) was introduced into L-histidine-producing Escherichia coli DS9H (MG1655) (accession number KCTC14419BP) using a one-step inactivation method (Warner et al., PNAS, 6:6640-6645(2000)) of the inosine 5'-monophosphate dehydrogenase gene guaB.

[0064]

[0065] 1-1. guaB_A1G

[0066] To obtain the forward and backward fragments of the guaB gene for homologous recombination, the guaB_HF and guaB_HR fragments were amplified by PCR using the genomic DNA of E. coli DS9H as a template and primer pairs guaB_HF-F / guaB_HF-R and guaB_HR-F / guaB_HR-R, respectively. Then, to obtain a cassette containing the kanamycin antibiotic marker and FRT, the cassette fragment was obtained by PCR amplification using the pKD13 plasmid (GenBank AY048744) as a template and primer pairs FRT(guaB)-F / FRT+guaB_HR-R. Finally, to obtain guaB_A1G, the guaB_A1G fragment was obtained by PCR using the genomic DNA of E. coli DS9H as a template and primer pairs guaB_A1G+guaB_HF-F / guaB(FRT)-R. Finally, these four amplified PCR fragments were used as templates to ligate them into a single fragment using overlapping PCR with the primer pair guaB_HF-F / guaB_HR-R. Bioneer AccuPower® PCR Pfu PreMix was used as the polymerase, and the PCR amplification conditions consisted of 30 cycles of denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and polymerization at 72°C for 1 minute / Kb.

[0067] A single linked DNA fragment was introduced into E. coli DS9H containing the pKD46 plasmid (GenBank AY048746) via electrolysis. Subsequently, PCR was performed on kanamycin-resistant cell lines using the primer pair guaB-CF / guaB-CR to identify strains with the introduction of guaB_A1G. A process to remove the antibiotic resistance gene, the kanamycin marker, was performed on the strains in which the introduction was confirmed. After inducing FLP recombination by introducing the pCP20 plasmid (Cherepanov and Wackerneagel, 1995; Datsenko and Wanner, 2000) into the strains confirmed to have guaB_A1G, the removal of the antibiotic was confirmed by observing growth on LB plates with and without the antibiotic (kanamycin). It was confirmed that strains with antibiotic resistance genes removed grow on LB plates but not on LB plates supplemented with the antibiotic (kanamycin). Finally, the sequences were verified using the primer pair guaB-CF / guaB-CR, and the mutant strain with introduced guaB_A1G was named DS9H_guaB::A1G. Bioneer AccuPower® PCR PreMix was used as the polymerase, and the PCR amplification conditions consisted of 30 cycles of denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and polymerization at 72°C for 1 minute / Kb.

[0068]

[0069] 1-2. guaB_A1T

[0070] The same method as in Example 1-1 was performed, except that guaB_A1T+guaB_HF-F was used as the primer instead of guaB_A1G+guaB_HF-F. The mutant strain into which guaB_A1T was introduced was named DS9H_guaB::A1T.

[0071]

[0072] The primer used in Example 1 is as shown in Table 1 below.

[0073] Sequence No. Primer Name Primer Sequence (5'-3')7guaB_HF-FACCGTTTGATTCAGGCGACTAAC8guaB_HF-RGGGCAATATCTCGACCAGAGTG9guaB_A1G+guaB_HF-FCTCTGGTCGAGATATTGCCCGTGCTACGTATCGCTAAAGAAGC10guaB_A1T+guaB_HF-FCTCTGGTCGAGATATTGCCCTTGCTACGTATCGCTAAAGAAGC11guaB+FRT-RGAAGCAGCTCCAGCCTACACTCAGGAGCCCAGA CGGTAGTTC12FRT(guaB)-FACTACCGTCTGGGCTCCTGAGTGTAGGCTGGAGCTGCTC13FRT+guaB_HR-RATGAAGTCGGGCGAAGAGAAACATGAGAATTAATTCCGGGG14g uaB_HR-FTTCTCTTCGCCCGACTTCATG15guaB_HR-RAACTTTATCGCCGTGGCTCATC16guaB-CFAGTGTAAAGTACCAGTGACCGG17guaB-CRACTTCCGGGTGGAACTGTAC

[0074]

[0075] Experimental Example 1. Evaluation of L-histidine production capacity

[0076] The L-tryptophan production capacity of the mutant strain produced in Example 1 was evaluated in comparison with the parent strain E. coli DS9H.

[0077] 10 mL of the medium from Table 2 below was placed in a 100 mL flask, and each strain (parent strain or mutant strain) was inoculated at 1% and cultured at 34°C at 200 rpm for 72 hours. After the culture was finished, the concentration of L-histidine in the medium was measured using HPLC (Agilent), and the results are shown in Table 3 below.

[0078] Ingredient Content: Glucose 8%, Magnesium Sulfate 0.1%, Ammonium Sulfate 2.0%, MSG 0.1%, Potassium Monophosphate 0.1%, Yeast Extract 0.1%, Potassium Sulfate 0.02%, Thiamine-HCl 20 ppm, Nicotinic Acid 10 ppm, Iron Sulfate 5 ppm, Zinc Sulfate 5 ppm, Manganese Sulfate 5 ppm, Calcium Carbonate (Separately Sterilized) 0.5%

[0079] L-histidine concentration (g / L)DS9H7.8DS9H_guaB::A1G9.4DS9H_guaB::A1T8.9

[0080]

[0081] As shown in Table 3 above, when the start codon GTG or TTG was introduced into the gene encoding inosine 5'-monophosphate dehydrogenase, L-histidine production increased by approximately 20.5% or 14.1% compared to the parent strain. These results suggest that the activity of inosine 5'-monophosphate dehydrogenase is weakened due to the start codon mutation, thereby weakening the flow from IMP to guanosine monophosphate (GMP) while relatively increasing the flow from IMP to adenosine monophosphate (AMP). Consequently, histidine productivity is improved due to an increase in the ATP pool, which is a secondary substrate required for histidine production.

[0082]

[0083] Example 2. Preparation of a mutant strain with weakened alpha-amylase activity

[0084] To produce a strain with reduced alpha-amylase activity, the gene amyA encoding alpha-amylase was disrupted using a one-step inactivation method (Warner et al., PNAS, 6:6640-6645(2000)) on L-histidine-producing Escherichia coli DS9H (MG1655) (accession number KCTC14419BP).

[0085] First, to obtain the forward and backward fragments of the amyA gene for homologous recombination, the amyA_HF and amyA_HR fragments were amplified by PCR using the genomic DNA of E. coli DS9H as a template and primer pairs amyA_HF-F / amyA_HF-R and amyA_HR-F / amyA_HR-R, respectively. Then, to obtain a cassette containing the kanamycin antibiotic marker and FRT, the cassette fragment was obtained by amplifying via PCR using the pKD13 plasmid (GenBank AY048744) as a template and primer pairs FRT(amyA_HF)-F / FRT(amyA_HR)-R. Finally, these three amplified PCR fragments were ligated into a single fragment using overlapping PCR with primer pairs amyA_HF-F / amyA_HR-R as a template. Here, Bioneer AccuPower® PCR Pfu PreMix was used as the polymerase, and the PCR amplification conditions consisted of denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and polymerization at 72°C for 1 minute / Kb, repeated 30 times.

[0086] A single linked DNA fragment was introduced into E. coli DS9H containing the pKD46 plasmid (GenBank AY048746) via electrolysis. Subsequently, PCR was performed on cell lines exhibiting kanamycin resistance using the primer pair amyA-CF / amyA-CR to identify strains into which the kanamycin cassette had been introduced. A process to remove the kanamycin marker, an antibiotic resistance gene, was performed on the strains in which the introduction was confirmed. After inducing FLP recombination by introducing the pCP20 plasmid (Cherepanov and Wackerneagel, 1995; Datsenko and Wanner, 2000) into the strains confirmed to have the kanamycin cassette, the removal of the antibiotic was confirmed by observing growth on LB plates with and without the antibiotic (kanamycin). It was confirmed that antibiotic-free strains grow on LB agar plates but fail to grow on LB agar plates containing the antibiotic (kanamycin). Finally, the sequences were verified using the primer pair amyA-CF / amyA-CR, and the mutant strain with the deleted amyA gene was named DS9H_△amyA. Bioneer AccuPower® PCR PreMix was used as the polymerase, and the PCR amplification conditions consisted of 30 cycles of denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and polymerization at 72°C for 1 minute / Kb.

[0087] The primer used in Example 2 is as shown in Table 4 below.

[0088] Sequence No. Primer Name Primer Sequence (5'-3')18amyA_HF-FATACCCTGGATTGCCGTCAG19amyA_HF-RAGCGTGTGGGTTATCGAAGAG20FRT(amyA_HF)-FTCTTCGATAACCCACACGCTGTGTAGGCTGGAGCTGCTTC21FRT(amyA_HR)-RTGGTATCAATATGGTCTGGTACATGAGAATTAATTCCGGGG22amyA_HR-FACCAGACCATATTGATACCAATATC23amyA_HR-RAACTGGTCGGTCAGTCATCG24amyA-CFATAGGCAGCCTGATTGTCAC25amyA-CRACTGAAACCATGATTCTGCGC

[0089]

[0090] Example 3. Preparation of mutant strains with weakened activity of alpha-amylase and inosine 5'-monophosphate dehydrogenase

[0091] To produce strains with reduced activity of alpha-amylase and inosine 5'-monophosphate dehydrogenase, the alpha-amylase-encoding gene amyA was disrupted using a one-step inactivation method (Warner et al., PNAS, 6:6640-6645(2000)) on the mutant strains DS9H_guaB::A1G and DS9H_guaB::A1T, which were produced in Example 1 and have reduced activity of inosine 5'-monophosphate dehydrogenase.

[0092] First, to obtain the forward and backward fragments of the amyA gene for homologous recombination, the amyA_HF and amyA_HR fragments were amplified by PCR using the genomic DNA of DS9H_guaB::A1G or DS9H_guaB::A1T from Example 1 as a template and the primer pairs amyA_HF-F / amyA_HF-R and amyA_HR-F / amyA_HR-R, respectively. Then, to obtain a cassette containing the kanamycin antibiotic marker and FRT, the cassette fragment was obtained by amplifying via PCR using the pKD13 plasmid (GenBank AY048744) as a template and the primer pairs FRT(amyA_HF)-F / FRT(amyA_HR)-R. Finally, these three amplified PCR fragments were used as templates to ligate them into a single fragment using overlapping PCR with the primer pair amyA_HF-F / amyA_HR-R. Bioneer AccuPower® PCR Pfu PreMix was used as the polymerase, and the PCR amplification conditions consisted of 30 cycles of denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and polymerization at 72°C for 1 minute / Kb.

[0093] A single linked DNA fragment was introduced into DS9H_guaB::A1G or DS9H_guaB::A1T cells containing the pKD46 plasmid (GenBank AY048746) via electrolysis. Subsequently, PCR was performed on kanamycin-resistant cell lines using the primer pair amyA-CF / amyA-CR to identify strains in which the kanamycin cassette had been introduced. A process to remove the kanamycin marker, an antibiotic resistance gene, was performed on the strains in which the introduction was confirmed. After inducing FLP recombination by introducing the pCP20 plasmid (Cherepanov and Wackerneagel, 1995; Datsenko and Wanner, 2000) into the strains in which the kanamycin cassette had been introduced, the removal of the antibiotic was confirmed by observing cell growth on LB plates with and without the antibiotic (kanamycin). It was confirmed that antibiotic-free strains grow on LB agar plates but fail to grow on LB agar plates supplemented with the antibiotic (kanamycin). Finally, the sequences were verified using the primer pair amyA-CF / amyA-CR, and mutant strains with the deletion of the amyA gene were named DS9H_△amyA::guaB_A1G or DS9H_△amyA::guaB_A1T. Bioneer AccuPower® PCR PreMix was used as the polymerase, and the PCR amplification conditions consisted of 30 cycles of denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and polymerization at 72°C for 1 minute / Kb.

[0094] The primer used in Example 3 is as shown in Table 1 above.

[0095]

[0096] Experimental Example 2. Evaluation of L-histidine production capacity

[0097] The L-histidine production ability of the mutant strains produced in Examples 2 and 3 was evaluated compared with the parent strain E. coli DS9H.

[0098] 10 mL of the medium from Table 2 above was placed in a 100 mL flask, and each strain (parent strain or mutant strain) was inoculated at 1% and cultured at 34°C at 200 rpm for 72 hours. After the culture was finished, the concentration of L-histidine in the medium was measured using HPLC (Agilent), and the results are shown in Table 5 below.

[0099] L-histidine concentration (g / L)DS9H7.8DS9H_△amyA9.0DS9H_△amyA::guaB_A1G10.1DS9H_△amyA::guaB_A1T9.8

[0100]

[0101] As shown in Table 5 above, when alpha-amylase activity was weakened, L-histidine production increased by approximately 15.3% compared to the parent strain. Transcriptome analysis of the L-histidine-producing strains revealed that the expression level of the amyA gene, which encodes alpha-amylase, was significantly high, but the amyA gene is not directly involved in the histidine production pathway. Therefore, deletion of the amyA gene in L-histidine-producing strains is expected to have an effective effect in terms of energy saving, and as a result, L-histidine productivity increased.

[0102] In addition, when the activities of both alpha-amylase and inosine 5'-monophosphate dehydrogenase were weakened, L-histidine production increased by approximately 8.8% or 12.2% compared to when only alpha-amylase activity was weakened. These results suggest that the weakening of inosine 5'-monophosphate dehydrogenase activity along with alpha-amylase leads to a synergy effect, resulting in a further increase in L-histidine productivity.

[0103]

[0104] The present invention has been described above with reference to its preferred embodiments. Those skilled in the art will understand that the present invention may be embodied in modified forms without departing from the essential characteristics of the invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the invention is defined by the claims, not by the foregoing description, and all variations within the scope of the claims should be interpreted as being included in the invention.

[0105] [Consignment Number]

[0106] Depository Name: Korea Research Institute of Biotechnology and Bioengineering Biological Resource Center (KCTC)

[0107] Trustee Number: KCTC14419BP

[0108] Date of Trust: 20201228

[0109]

Claims

1. A mutant microorganism with enhanced L-histidine production ability, in which the activity of alpha-amylase (α-amylase), inosine 5'-monophosphate dehydrogenase, or these is weakened.

2. In Claim 1, A mutant microorganism in which the above-mentioned activity is reduced by a nucleotide modification, a regulatory region modification, or a combination thereof of alpha-amylase, inosine 5'-monophosphate dehydrogenase, or genes encoding these.

3. In Claim 1, The above mutant microorganism is a mutant microorganism of the genus Escherichia.

4. A step of culturing the variant microorganism of Claim 1 in a culture medium; and A method for producing L-histidine comprising the step of recovering L-histidine from the above-mentioned mutant microorganism or a medium in which the mutant microorganism is cultured.

Images