Mutant microorganism having enhanced ability to produce l-histidine, and method for producing l-histidine using same

Abstract

The present invention relates to a mutant microorganism having an enhanced ability to produce L-histidine, and a method for producing L-histidine using same. In the mutant microorganism, the activity of D-arabinose-5-phosphate isomerase is reduced to increase the supply of D-ribulose-5-phosphate, which is a major precursor of histidine, and the activity of ATP phosphoribosyltransferase is enhanced, thereby enabling the mutant microorganism to achieve a higher production yield of L-histidine than the microorganism prior to mutation.

Description

Mutant microorganism with enhanced L-histidine production capacity and method for producing L-histidine using the same

[0001] The present invention relates to a mutant microorganism with enhanced L-histidine production capacity and a method for producing L-histidine using the same.

[0002] Histidine is an essential amino acid that is not synthesized in the bodies of humans or animals and must be supplied from external sources; it is generally produced through fermentation using microorganisms such as bacteria or yeast.

[0003] Histidine production can be achieved using wild-type strains obtained from nature or mutant strains modified to enhance their amino acid production capabilities. Recently, to improve the efficiency of histidine production, genetic recombination technology has been applied to microorganisms such as Escherichia coli and Corynebacterium, which are widely used for the production of useful substances like L-amino acids. This has led to the development of various recombinant strains or mutants with superior L-histidine production capabilities, as well as methods for producing L-histidine using these strains. In particular, there have been attempts to increase the production of the corresponding amino acid by targeting genes involved in the L-histidine biosynthetic pathway, such as enzymes, transcription factors, and transport proteins, or by inducing mutations in promoters that regulate their expression. However, because there is a wide variety of proteins—including enzymes, transcription factors, and transport proteins—directly or indirectly involved in L-histidine production, much research is still needed regarding whether changes in the activity of these proteins lead to an increase in L-histidine production capabilities.

[0004] [Prior Art Literature]

[0005] [Patent Literature]

[0006] Korean Registered Patent No. 10-1904666

[0007] The present invention aims to provide a mutant microorganism with enhanced L-histidine production ability.

[0008] In addition, the present invention aims to provide a method for producing L-histidine using the above-mentioned mutant microorganism.

[0009] One aspect of the present invention provides a mutant microorganism with enhanced L-histidine production capacity and weakened activity of D-arabinose-5-phosphate isomerase.

[0010] The "D-arabinose-5-phosphate isomerase" used in the present invention is an enzyme that interconverts D-arabinose-5-phosphate and D-ribulose-5-phosphate. The D-arabinose-5-phosphate isomerase in the present invention may be a polypeptide encoded by the kdsD gene and having D-arabinose-5-phosphate isomerase activity, but is not limited thereto.

[0011] Nucleic acid and protein sequence information for the above-mentioned D-arabinose-5-phosphate isomerase can be obtained through known sequence databases (e.g., GenBank, UniProt).

[0012] The terms “reduced activity” or “reduced activity” as used in the present invention refer to a decrease in the activity of a target polypeptide or protein compared to its intrinsic activity or the absence of such activity, and may be used interchangeably with terms such as inactivation, deficiency, reduction, or lowering. Such reduced activity may include, but is not limited to, cases where the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide possessed by the original microorganism, i.e., the wild type or the microorganism before modification, due to a nucleotide modification of the gene encoding the polypeptide; cases where the overall degree of polypeptide activity (expression level) is lower than that of the original microorganism due to inhibition of expression or translation of the target gene caused by a modification of the regulatory region of the gene encoding the polypeptide; cases where there is no polypeptide activity even if the gene encoding the polypeptide is expressed.

[0013] Here, the above nucleotide modification refers to a difference from the original polynucleotide sequence due to wholly or partially deleted, substituted, added, or a combination thereof in the polynucleotide sequence of a gene encoding a polypeptide. The above regulatory region modification refers to a difference from the original polynucleotide sequence due to wholly or partially deleted, substituted, added, or a combination thereof in the polynucleotide sequence of elements constituting a regulatory region (regulatory sequence), such as a promoter, enhancer, or transcription terminator, and may, for example, be replaced with a weak promoter to reduce or suppress gene expression. Here, deletion means a change in which a base, nucleotide, polynucleotide, or nucleic acid is removed; substitution means a change in which a base, nucleotide, polynucleotide, or nucleic acid is replaced with another base, nucleotide, polynucleotide, or nucleic acid; and addition means a change in which another base, nucleotide, polynucleotide, or nucleic acid is added.

[0014] According to one embodiment of the present invention, the weakening of the activity of D-arabinose-5-phosphate isomerase may be due to a nucleotide modification, a regulatory region modification, or a combination thereof of the gene encoding D-arabinose-5-phosphate isomerase.

[0015] For example, the weakening of the activity of the above-mentioned D-arabinose-5-phosphate isomerase may be due to the deletion of all or part of the polynucleotide sequence of the gene encoding D-arabinose-5-phosphate isomerase, but is not limited thereto.

[0016] The above D-arabinose-5-phosphate isomerase is derived from Escherichia coli and may be encoded by the nucleotide sequence of SEQ ID NO. 1 or composed of the amino acid sequence of SEQ ID NO. 2.

[0017] The nucleotide sequence or amino acid sequence of D-arabinose-5-phosphate isomerase according to the present invention may consist of or essentially include a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology or identity compared to the nucleotide sequence of SEQ ID NO. 1 or the amino acid sequence of SEQ ID NO. 2, and may have an original function. Here, “homology” or “identity” means the percentage of agreement between two sequences when a reference nucleotide sequence or amino acid sequence and any other nucleotide sequence or amino acid sequence are aligned to correspond as much as possible and analyzed.

[0018] According to one embodiment of the present invention, the mutant microorganism may additionally have enhanced activity of ATP phosphoribosyltransferase.

[0019] The "ATP phosphoribosyltransferase" used in the present invention is an enzyme that catalyzes the first step of the histidine biosynthetic pathway and produces ATP and 5-phospho-alpha-D-ribose 1-diphosphate from 1-(5-phospho-D-ribosyl)-ATP and diphosphate. The ATP phosphoribosyltransferase in the present invention may be a polypeptide encoded by the hisG gene and having ATP phosphoribosyltransferase activity, but is not limited thereto.

[0020] Nucleic acid and protein sequence information for the above ATP phosphoribosyltransferase can be obtained through known sequence databases (e.g., GenBank, UniProt).

[0021] The terms “enhanced activity” or “enhanced activity” used in the present invention refer to an increase in the activity of a target polypeptide or protein relative to its intrinsic activity. Such enhanced activity includes cases where the activity of the polypeptide itself increases relative to the activity of the polypeptide possessed by the original microorganism, i.e., the wild type or the microorganism before modification, due to a nucleotide modification of the gene encoding the polypeptide; cases where the copy number of the gene encoding the polypeptide increases; cases where the overall degree of activity (expression level) of the polypeptide is higher than that of the original microorganism due to an increase in the expression or translation of the target gene resulting from a modification of the regulatory region of the gene encoding the polypeptide; and combinations thereof.

[0022] Here, the above-mentioned nucleotide modification refers to a polynucleotide sequence that differs from the original polynucleotide sequence due to the deletion, substitution, addition, or combination thereof of all or part of the polynucleotide sequence of a gene encoding a polypeptide, and includes cases where the polynucleotide sequence of a foreign gene is introduced. A foreign gene is a gene encoding a polypeptide or protein present in another microorganism, and may or may not be present in the original microorganism. The introduced foreign gene may encode a polypeptide having the same or similar activity as the polypeptide present in the original microorganism, and the polypeptide may be expressed and its activity may increase due to the introduction of the foreign gene.

[0023] The above modification of the regulatory region refers to a difference from the original polynucleotide sequence resulting from the deletion, substitution, addition, or combination thereof of all or part of the polynucleotide sequence of elements constituting the regulatory region (regulatory sequence), such as promoters, enhancers, and transcription terminators; for example, it may be replaced with a strong promoter to increase gene expression.

[0024] The above copy number increase means that one or more copies of the polynucleotide sequence of the gene encoding the polypeptide are introduced into the original microbial chromosome.

[0025] According to one embodiment of the present invention, the enhancement of the activity of the ATP phosphoribosyltransferase may be a nucleotide modification, an increase in the copy number, a modification of the regulatory region, or a combination thereof of the gene encoding the ATP phosphoribosyltransferase.

[0026] For example, the enhancement of the activity of the above-mentioned ATP phosphoribosyltransferase may be due to the replacement of the promoter of the gene encoding ATP phosphoribosyltransferase, but is not limited thereto.

[0027] The above ATP phosphoribosyltransferase is derived from Corynebacterium glutamicum and may be encoded by the nucleotide sequence of SEQ ID NO. 3 or composed of the amino acid sequence of SEQ ID NO. 4.

[0028] The base sequence or amino acid sequence of the ATP phosphoribosyltransferase according to the present invention may consist of or essentially include a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology or identity compared to the base sequence of SEQ ID NO. 3 or the amino acid sequence of SEQ ID NO. 4, and may have an original function.

[0029] The term “improved L-histidine production capacity” as used in the present invention means that the productivity of L-histidine is increased compared to the parent strain. The parent strain refers to a wild-type or mutant strain that is the subject of mutation, and includes the subject that is directly subjected to mutation or transformed by a recombinant vector, etc. In the present invention, the parent strain may be a microorganism or strain of the genus Escherichia that has no L-histidine production capacity or has L-histidine production capacity, and may be a wild-type Escherichia or a mutated Escherichia from the wild-type.

[0030] According to one embodiment of the present invention, the mutant microorganism may be of the genus Escherichia.

[0031] Specifically, the genus Escherichia mentioned above may include, but is not limited to, Escherichia coli, Escherichia albertii, Escherichia blattae, Escherichia fergusonii, Escherichia hermannii, Escherichia vulneris, etc.

[0032] For example, the above-mentioned mutant microorganism may be Escherichia coli.

[0033] In the mutant microorganism according to the present invention, the supply of D-ribulose-5-phosphate, a major precursor of histidine, is increased by weakening the activity of D-arabinose-5-phosphate isomerase, and additionally, the activity of ATP phosphoribosyltransferase is enhanced, thereby improving the production capacity of L-histidine.

[0034] Specifically, the mutant microorganism with enhanced L-histidine production capacity exhibits increased L-histidine production capacity compared to the microorganism before mutation (parent strain), and in particular, compared to the parent strain, the L-histidine production increases by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or by 1.1 times, 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, It may be increased by 9, 9.5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 times, but is not limited thereto. For example, a mutant microorganism in which the activity of the above-mentioned D-arabinose-5-phosphate isomerase is weakened or the activity of ATP phosphoribosyltransferase is enhanced together with it may have an L-histidine production of 5% or more, specifically 5 to 80% (preferably 7 to 50%), compared to the parent strain.

[0035] The mutant microorganism according to the present invention can be used as a composition for producing L-histidine.

[0036] Specifically, the histidine production composition may include a mutant microorganism with weakened D-arabinose-5-phosphate isomerase activity, or a microorganism with weakened D-arabinose-5-phosphate isomerase activity and enhanced ATP phosphoribosyltransferase activity.

[0037]

[0038] A mutant microorganism with enhanced L-histidine production capacity according to one embodiment of the present invention may be realized through a gene inactivation method or a recombinant vector for deleting a gene encoding D-arabinose-5-phosphate isomerase in the microorganism prior to mutation, or introducing a gene encoding ATP phosphoribosyltransferase together with it.

[0039] The above gene inactivation method may be used without limitation as long as it is a method known in the art, such as, for example, the one-step inactivation method (Warner et al., PNAS, 6:6640-6645(2000)), the CaCl₂ method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114(1973)), the Hanahan method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114(1973); Hanahan, D., J. Mol. Biol., 166:557-580(1983)), and the electroporation method (Dower, WJ et al., Nucleic. Acids Res., 16:6127-6145(1988)), but is not limited thereto.

[0040] As used in the present invention, the term "vector" refers to any type of nucleic acid sequence carrier structure used as a means to deliver and express a target gene to a mutation target (host cell). Unless otherwise specified, the vector may mean a structure in which a carried nucleic acid sequence is inserted into the host cell genome to be expressed and / or expressed independently. Such a vector comprises an essential regulatory element operably linked to enable the expression of the gene insertion, where "operably linked" means that the target gene and its regulatory sequence are linked in a manner in which they are functionally coupled to enable gene expression, and the "regulatory element" or "regulatory sequence" includes a promoter for performing transcription, any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation, etc.

[0041] The vector used in the present invention is not particularly limited as long as it is capable of replicating within a host cell, and any vector known in the art may be used. Examples of such vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors, but are not limited thereto.

[0042] The above vector can typically be constructed as a vector for cloning or as a vector for expression. The vector for expression may be a conventional one used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and may be constructed through various methods known in the art.

[0043] The “recombinant vector” used in the present invention may be constructed using a prokaryotic or eukaryotic cell as a host, and may be capable of replication independently of the host cell’s genome or may be sealed to the genome itself. The host cell is capable of replication by the vector and may include a replication origin, which is a specific nucleotide sequence at which replication is initiated. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it generally includes a potent promoter capable of proceeding transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. When the host is a eukaryotic cell, the replication origins included in the vector that operate in eukaryotic cells include, but are not limited to, f1 replication origins, SV40 replication origins, pMB1 replication origins, adeno replication origins, AAV replication origins, and BBV replication origins. In addition, promoters derived from the genome of mammalian cells (e.g., metallothionine promoters) or promoters derived from mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, HSV tk promoter) may be used and generally have a polyadenylation sequence as a transcription termination sequence.

[0044] The above recombinant vector may include a selection marker, which is intended to select transformants (host cells) transformed by the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, the selection of transformed cells is possible. Representative examples of the selection marker include ampicillin, kanamycin, streptomycin, and chloramphenicol, but are not limited thereto.

[0045] A transformant can be produced by inserting the above-mentioned recombinant vector into a host cell, and the transformant may be obtained by introducing the recombinant vector into a suitable host cell. Any host cell known in the art may be used as a cell capable of stably and continuously cloning or expressing the above-mentioned expression vector.

[0046] When transforming a prokaryotic cell to produce a recombinant microorganism, various intestinal bacteria such as Escherichia coli (E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli, E. coli X 1776, E. coli W3110, E. coli XL1-Blue), Corynebacterium, Bacillus subtilis, Bacillus thuringiensis, Salmonella typhimurium, Serratia marcescens, and Pseudomonas may be used as host cells, but are not limited thereto.

[0047] When transforming into a eukaryotic cell to produce a recombinant microorganism, host cells such as yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell lines, etc., may be used, but are not limited thereto.

[0048] As used in this invention, “transformation” refers to a phenomenon in which external DNA is introduced into a host cell to artificially induce a genetic change, and “transformant” refers to a host cell into which external DNA is introduced to stably maintain the expression of a target gene.

[0049] The above transformation may be performed by selecting a vector introduction technique suitable for the host cell to express the target gene or a recombinant vector containing it within the host cell. For example, vector introduction may be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene may be included without limitation, whether inserted into the chromosomes of the host cell or located extrachromosomally, as long as it can be expressed within the host cell.

[0050] The genes inserted into the recombinant vector for transformation of the present invention can be introduced into host cells through homologous recombination crossing.

[0051] The above transformant comprises cells that have been transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used interchangeably with recombinant host cells, recombinant cells, or recombinant microorganisms.

[0052] The transformant in the present invention may be one other than a human.

[0053] According to one embodiment of the present invention, the host cell may be of the genus Escherichia, for example Escherichia coli, but is not limited thereto.

[0054]

[0055] Another aspect of the present invention provides a method for producing L-histidine, comprising the steps of: culturing the mutant microorganism in a medium; and recovering L-histidine from the mutant microorganism or the medium in which the mutant microorganism is cultured.

[0056] The above culture may be carried out according to appropriate media and culture conditions known in the art, and a person skilled in the art can easily adjust and use the media and culture conditions. Specifically, the media may be liquid media, but is not limited thereto. The culture method may include, for example, batch culture, continuous culture, fed-batch culture, or a combination thereof, but is not limited thereto.

[0057] According to one embodiment of the present invention, the medium must satisfy the requirements of a specific strain in an appropriate manner and may be appropriately modified by a person skilled in the art. For culture media for strains of the genus Escherichia, reference may be made to the known literature (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but is not limited thereto.

[0058] According to one embodiment of the present invention, the culture medium may contain various carbon sources, nitrogen sources, and trace element components. Carbon sources that may be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These substances may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that may be used include peptone, yeast extract, meat broth, malt extract, corn steep liquid, soybean meal, and urea or inorganic compounds, such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that may be used may include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium-containing salts. Additionally, the culture medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth, but are not limited thereto. Furthermore, essential growth substances such as amino acids and vitamins may be included. In addition, suitable precursors may be used in the culture medium. The medium or individual components may be added to the culture solution in a batch or continuous manner in a manner suitable for the culture process, but are not limited thereto.

[0059] According to one embodiment of the present invention, the pH of the culture medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid to the microbial culture medium in an appropriate manner during cultivation. Additionally, bubble formation can be suppressed by using an antifoaming agent such as a fatty acid polyglycol ester during cultivation. Furthermore, oxygen or an oxygen-containing gas (e.g., air) can be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium can typically be 20 to 45°C, for example, 25 to 40°C. The cultivation period can continue until a desired amount of useful material is obtained, for example, 10 to 160 hours.

[0060] According to one embodiment of the present invention, the step of recovering L-histidine from the cultured mutant microorganism or the medium in which the mutant microorganism is cultured may involve collecting or recovering L-histidine from the medium using a suitable method known in the art according to the culture method. For example, methods such as centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), and chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but are not limited thereto.

[0061] According to one embodiment of the present invention, the step of recovering L-histidine may involve removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.

[0062] According to one embodiment of the present invention, the step of recovering L-histidine may include a process of purifying L-histidine.

[0063] In the mutant microorganism according to the present invention, the supply of D-ribulose-5-phosphate, a major precursor of histidine, is increased by weakening the activity of D-arabinose-5-phosphate isomerase, and additionally, the activity of ATP phosphoribosyltransferase is enhanced, so the production yield of L-histidine can be improved compared to the microorganism before mutation.

[0064] The present invention will be described in more detail below. However, this description is provided merely as an example to aid in understanding the invention, and the scope of the invention is not limited by this exemplary description.

[0065]

[0066] Example 1. Preparation of a mutant strain with weakened D-arabinose-5-phosphate isomerase activity

[0067] To produce a strain with reduced activity of D-arabinose-5-phosphate isomerase, the gene kdsD encoding D-arabinose-5-phosphate isomerase was disrupted using a one-step inactivation method (Warner et al., PNAS, 6:6640-6645(2000)) on L-histidine-producing Escherichia coli DS9H (MG1655) (accession number KCTC14419BP).

[0068] First, to obtain the forward and backward fragments of the kdsD gene for homologous recombination, the kdsD_HF and kdsD_HR fragments were amplified by PCR using the genomic DNA of E. coli DS9H as a template and primer pairs kdsD_HF-F / kdsD_HF-R and kdsD_HR-F / kdsD_HR-R, respectively. Then, to obtain a cassette containing the kanamycin antibiotic marker and FRT, the cassette fragment was obtained by amplifying via PCR using the pKD13 plasmid (GenBank AY048744) as a template and primer pairs FRT(kdsD_HF)-F / FRT(kdsD_HR)-R. Finally, these three amplified PCR fragments were ligated into a single fragment using overlapping PCR with primer pairs kdsD_HF-F / kdsD_HR-R as a template. Here, Bioneer AccuPower® PCR Pfu PreMix was used as the polymerase, and the PCR amplification conditions consisted of denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, and polymerization at 72°C for 1 minute / Kb, repeated 30 times.

[0069] A single linked DNA fragment was introduced into E. coli DS9H containing the pKD46 plasmid (GenBank AY048746) via electrolysis. Subsequently, PCR was performed on cell lines exhibiting kanamycin resistance using the primer pair kdsD-CF / kdsD-CR to identify strains in which the kanamycin cassette had been introduced. A process to remove the kanamycin marker, an antibiotic resistance gene, was performed on the strains in which the introduction was confirmed. After inducing FLP recombination by introducing the pCP20 plasmid (Cherepanov and Wackerneagel, 1995; Datsenko and Wanner, 2000) into the strains in which the kanamycin cassette had been introduced, the removal of the antibiotic was confirmed by observing growth on LB plates with and without the antibiotic (kanamycin). It was confirmed that strains with the antibiotic resistance gene removed grew on LB agar plates but failed to grow on LB agar plates supplemented with the antibiotic (kanamycin). Finally, the sequences were verified using the primer pair kdsD-CF / kdsD-CR, and the mutant strain with the deleted kdsD gene was named DS9H_△kdsD. Bioneer AccuPower® PCR PreMix was used as the polymerase, and the PCR amplification conditions consisted of 30 cycles of denaturation at 95°C for 30 seconds, annealing at 57°C for 30 seconds, and polymerization at 72°C for 1 minute / Kb.

[0070] The primer used in Example 1 is as shown in Table 1 below.

[0071] Sequence No. Primer Name Primer Sequence (5'-3')7kdsD_HF-FGCAAAGGTGAAAACGACATTGCTG8kdsD_HF-RCGTTTCCAGTTATTCAACGAGTATTGGC9FRT(kdsD_HF)-FTCGTTGAATAACTGGAAACGGTGTAGGCTGGAGCTGCTTC10FRT(kdsD_HR)-RCGCAAATGACAGTCATACCACTGTCAAACATGAGAATTAATTCCGGG11kdsD_HR-FTGGTATGACTGTCATTTGCGATGAC12kdsD_HR-RCCTGCTTTGCTCATTGTTGTTTATCC13kdsD-CFATTGCGCTTATCATCATGCC14kdsD-CRATGCCATAACCGTCACGAAC

[0072]

[0073] Example 2. Preparation of a mutant strain with weakened D-arabinose-5-phosphate isomerase activity and enhanced ATP phosphoribosyltransferase activity

[0074] To produce a strain with weakened D-arabinose-5-phosphate isomerase activity and enhanced ATP phosphoribosyltransferase activity, the gene hisG (Trc-hisG, SEQ 6), which encodes ATP phosphoribosyltransferase derived from Corynebacterium glutamicum and has a trc promoter (SEQ 5), was introduced into L-histidine-producing Escherichia coli DS9H (MG1655) (accession number KCTC14419BP) while disrupting the gene kdsD, which encodes D-arabinose-5-phosphate isomerase, using a one-step inactivation method (Warner et al., PNAS, 6:6640-6645(2000)).

[0075] First, to obtain the hisG gene fragment, the genomic DNA of Corynebacterium glutamicum ATCC13032 was used as a template, and the fragments were amplified by PCR using the primer pairs hisG_C.gF / hisG_C.gR. For the PCR, Bioneer AccuPower® PCR Pfu PreMix was used, and the process was performed under the conditions of denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, and 30 cycles of polymerization at 72°C for 1 minute / Kb. Subsequently, the amplified PCR fragment and the pTRC99A plasmid (GE Healthcare) were treated with the restriction enzymes EcoRI and HindIII (NEB), respectively, and then ligated with T4 ligase (Takara) to construct the pTRC99A-hisG_C.glu plasmid. Finally, the sequence was verified using the primer pairs pTRC99A-CF / pTRC99A-CR.

[0076] To obtain the forward and backward fragments of the kdsD gene for homologous recombination, the kdsD_HF and kdsD_HR fragments were amplified by PCR using the genomic DNA of E. coli DS9H as a template and primer pairs kdsD_HF-F / kdsD_HF-R and kdsD_HR-F / kdsD_HR-R, respectively. Additionally, to obtain a cassette containing the kanamycin antibiotic marker and FRT, the cassette fragment was obtained by PCR amplification using the pKD13 plasmid (GenBank AY048744) as a template and primer pairs FRT(kdsD_HF)-F / FRT(hisG_C.glu)-R. Finally, to obtain Trc-hisG, Trc-hisG fragments were obtained via PCR using the pTRC99A-hisG_C.glu plasmid as a template and the primer pair hisG_C.glu+FRT-F / hisG_C.glu+kdsD_HR-R. Finally, these four amplified PCR fragments were ligated into a single fragment using overlapping PCR with the primer pair kdsD_HF-F / kdsD_HR-R as a template. Bioneer AccuPower® PCR Pfu PreMix was used as the polymerase, and the PCR amplification conditions consisted of 30 cycles of denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, and polymerization at 72°C for 1 minute / Kb.

[0077] A single linked DNA fragment was introduced into E. coli DS9H containing the pKD46 plasmid (GenBank AY048746) via electrolysis. Subsequently, PCR was performed on kanamycin-resistant cell lines using the primer pair kdsD-CF / kdsD-CR to identify strains with the introduction of Trc-hisG. A process to remove the antibiotic resistance gene, the kanamycin marker, was performed on the strains in which the introduction was confirmed. After inducing FLP recombination by introducing the pCP20 plasmid (Cherepanov and Wackerneagel, 1995; Datsenko and Wanner, 2000) into the strains confirmed to have Trc-hisG, the removal of the antibiotic was verified by observing growth on LB plates with and without the antibiotic (kanamycin). It was confirmed that strains with the antibiotic resistance gene removed grow on LB agar plates but not on LB agar plates supplemented with the antibiotic (kanamycin). Finally, the sequence was verified using the primer pair kdsD-CF / kdsD-CR, and the mutant strain with the kdsD gene deleted and Trc-hisG introduced was named DS9H_△kdsD::hisG_C.glu. Bioneer AccuPower® PCR PreMix was used as the polymerase, and the PCR amplification conditions consisted of 30 cycles of denaturation at 95°C for 30 seconds, annealing at 57°C for 30 seconds, and polymerization at 72°C for 1 minute / Kb.

[0078] The primer used in Example 2 is as shown in Table 2 below.

[0079] Sequence No. Primer Name Primer Sequence (5'-3')15hisG_C.g-FATATGAATTCATGTTGAAAATCGCTGTCCCAAAC16hisG_C.g-RATATAAGCTTCTAGATGCGGGCGATGCGGA17pTRC99A-CFATATTCTGAAATGAGCTGTTGACAA18pTRC99A-CRTACTGCCGCCAGGCAAATTC7kdsD_HF-FGCAAAGGTGAAAACGACATTGCTG8kdsD_HF-RCGTTTCCAGTTATTCAACGAGTATTGGC9FRT(kdsD_HF)-FTCGTTGAATAACTGGAAACGGTGTAGGCTGGAGCTGCTTC19FRT(hisG_C. glu)-RGGGACAGCGATTTTCAACATGGTCTGTTTCCTGTGTGAAAATTG20hisG_C.glu+FRT-FTTTCACACAGGAAACAGACCATGTTGAAAATCGCTGTCCCAAAC21hisG_C.glu+kdsD_HR-RCGCAAATGACAGTCATACC ACTAGATGCGGGCGATGCGGA11kdsD_HR-FTGGTATGACTGTCATTTGCGATGAC12kdsD_HR-RCCTGCTTTGCTCATTGTTGTTTATCC13kdsD-CFATTGCGCTTATCATCATGCC14kdsD-CRATGCCATAACCGTCACGAAC

[0080]

[0081] Experimental Example 1. Evaluation of L-histidine production capacity

[0082] The L-histidine production ability of the mutant strains produced in Examples 1 and 2 was evaluated in comparison with the parent strain E. coli DS9H.

[0083] 10 mL of the medium from Table 3 below was placed in a 100 mL flask, and each strain (parent strain or mutant strain) was inoculated at 1% and cultured at 34°C at 200 rpm for 72 hours. After the culture was finished, the concentration of L-histidine in the medium was measured using HPLC (Agilent), and the results are shown in Table 4 below.

[0084] Ingredient Content: Glucose 8%, Magnesium Sulfate 0.1%, Ammonium Sulfate 2.0%, MSG 0.1%, Potassium Monophosphate 0.1%, Yeast Extract 0.1%, Potassium Sulfate 0.02%, Thiamine-HCl 20 ppm, Nicotinic Acid 10 ppm, Iron Sulfate 5 ppm, Zinc Sulfate 5 ppm, Manganese Sulfate 5 ppm, Calcium Carbonate (Separately Sterilized) 0.5%

[0085] L-histidine concentration (g / L)DS9H7.8DS9H_△kdsD8.9DS9H_△kdsD::hisG_C.glu9.6

[0086]

[0087] As shown in Table 4 above, when the activity of D-arabinose-5-phosphate isomerase was weakened, L-histidine production increased by approximately 14.1% compared to the parent strain, and when the activity of D-arabinose-5-phosphate isomerase was weakened and the activity of ATP phosphoribosyltransferase was strengthened, L-histidine production increased by approximately 23% compared to the parent strain. These results suggest that the histidine biosynthetic pathway is strengthened due to the increased supply of D-ribulose-5-phosphate resulting from the deletion of the gene encoding D-arabinose-5-phosphate isomerase and the introduction of the gene encoding ATP phosphoribosyltransferase, thereby improving the production capacity of the target product of the strain.

[0088]

[0089] The present invention has been described above with reference to its preferred embodiments. Those skilled in the art will understand that the present invention may be embodied in modified forms without departing from the essential characteristics of the invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the invention is defined by the claims, not by the foregoing description, and all variations within the scope of the claims should be interpreted as being included in the invention.

[0090] [Consignment Number]

[0091] Depository Name: Korea Research Institute of Biotechnology and Bioengineering Biological Resource Center (KCTC)

[0092] Trustee Number: KCTC14419BP

[0093] Date of Trust: 20201228

[0094]

Claims

1. A mutant microorganism with enhanced L-histidine production ability and weakened D-arabinose-5-phosphate isomerase activity.

2. In Claim 1, A mutant microorganism in which the weakening of the activity of the above-mentioned D-arabinose-5-phosphate isomerase is a nucleotide modification, a regulatory region modification, or a combination thereof of the gene encoding D-arabinose-5-phosphate isomerase.

3. In Claim 1, The above mutant microorganism is a mutant microorganism in which the activity of ATP phosphoribosyltransferase is further enhanced.

4. In Claim 3, A mutant microorganism in which the enhancement of the activity of the above ATP phosphoribosyltransferase is a nucleotide modification, copy number increase, regulatory region modification, or a combination thereof of the gene encoding ATP phosphoribosyltransferase.

5. In Claim 1, The above mutant microorganism is a mutant microorganism of the genus Escherichia.

6. A step of culturing the variant microorganism of Claim 1 in a culture medium; and A method for producing L-histidine comprising the step of recovering L-histidine from the above-mentioned mutant microorganism or a medium in which the mutant microorganism is cultured.

Images