Method and kit for detecting the presence and / or quantity of animal material in a food or feed product

Abstract

The present invenon relates to a method for detecng the presence and / or quanty of animal material in a food or feed product, comprising the steps of: (a) providing at least one food or feed product sample to be analysed, wherein the food or feed product sample potenally comprises an RNA biomarker molecule having origin in animal material; (b) oponally extracng RNA material from the food or feed product sample; (c) contacng said sample or extracted RNA material with at least one biomarker detector probe comprising a nucleode sequence that is at least parally complementary to the nucleode sequence of the RNA biomarker, under condions allowing the biomarker detector probe to anneal to the RNA biomarker in case of presence of RNA biomarker; (d) amplifying the biomarker detector probe bound to the RNA biomarker; (e) detecng the presence and / or quanty of the biomarker detector probe as a measurement of the presence and / or quanty of the RNA biomarker and therefore animal material in the food or feed product. Further, the invenon relates to a kit suitable for use in the method of the invenon.

Description

[0001] Method and kit for detecting the presence and / or quantity of animal material in a food or feed product

[0002] Field of the invention

[0003] The present invention relates to a method and a kit for detecting the presence and / or quantity of animal material in a food or feed product, using RNA as a biomarker.

[0004] Background of the invention

[0005] The field of food quality control is important to all consumers, ensuring food safety and detecting food substitutions and fraud. For instance, around 230 million people today live as vegans for reasons related to personal health, climate concerns, animal welfare, food allergies or religious beliefs.

[0006] However, there are many examples of vegan food products being exposed to animal materials during production, transportation and preparation chains, compromising consumer confidence. In addition, there are now numerous 'plant-based meat' products available, that aim to closely resemble animal meat in terms of taste, appearance, texture and smell. These products tend to be more expensive than animal meat, incentivizing vegan food substitution and fraud.

[0007] To protect vegan consumers against exposure to animal materials, there exist public food control agencies and accreditation companies that perform vegan verification.

[0008] These agencies and companies typically use state-of-the-art (SOTA) PCR-based methods to detect animal DNA using barcoding genes such as the COI gene (see e.g. Wang et al., A multiplex PCR method for detection of five animal species in processed meat products using novel species-specific nuclear DNA sequences. Eur Food Res Technol 246, 1351-1360 (2020)). However, due to practical limitations these methods use distinct PCR primers for various animal groups, meaning that the presence of mammalian, bird, fish, insect, arachnid, crustacean and mollusc contamination must be tested independently. For example, the SOTA requires 5-7 different primer sets to cover different animal groups including mammalian, bird, fish, insect, arachnid, crustacean and mollusc. This is inefficient given that 5-7 distinct tests need to be performed, and the tests also give incomplete coverage of the animal kingdom (for instance not covering sea urchins, that can give life-threatening allergic reactions).

[0009] Importantly, the primers used might work sub-optimally for some specific species, and even testing for the above animal groups does not cover the entire animal kingdom. Next-generation sequencing can provide a more saturated overview of the presence of animal material, but preparing and performing the sequencing is time-consuming and expensive.

[0010] Moreover, there have been previous attempts at detection of nucleic acid material in food samples. For example, one method discloses testing the presence or absence of animal-derived ingredient(s) in food using DNA fragments which are highly conserved in specific animal species (see US20060099617A1). Another method aims at detecting whether a DNA fragment highly preserved among animals is present (see CN117418020A). Moreover, US-A1-2012252694 relates to microRNA markers for detection of biological material in cow milk, to measure fraudulent milk dilution with water. Cottenet et al., (Food Control, 2021. (125): 108001) relates to a real-time PCR method targeting the 16S mitochondrial rDNA gene to assess the presence of vertebrate material in plantbased products, such as vegan food. Measurements are done to DNA molecules, at the DNA level. Vishnuraj et al. (Trends in Food Science & Technology. 2023. (138): 164-177) relates to the use ofmiRNA-based techniques for detecting and quantifying offal / organ meat tissues in food products. Vishnuraj et al. (Food Control. 2021. (121):107593) relates to miRNA-based methods for rapid identification of offal meats in processed chicken meat products, using tissue-specific miRNA biomarkers. Dahm et al. (J. Diet. Suppl. 2022. 19(3): 381-394) relates to detection of liver tissue in food products using reverse transcription and real-time PCR testing for microRNA-122, while resolving the species origins using the DNA biomarker COI gene. Baraldo et al. (Molecules. 2024. 29(4): 748) discloses the use of miRNA (miR-21 and miR-126) as biomolecular markers for discerning two chicken strains.

[0011] In summary, food control agencies and food producers need a cheap and sensitive vegan verification test that can robustly detect the presence of any animal material, ensuring the safety of millions of consumers. Also, with regard to quality control of feed products, it is of high importance to be able to find any traces of undesired animal material, e.g. animal material stemming from one or more specific species.

[0012] Thus, there still remains a challenge of finding suitable biomarkers that allow detection of animal material from a chosen breadth of species, that is abundantly present in a broad or specific set of samples and that is suitable for industrial and commercial application. Also, there is a need for improved methods for detecting animal material in food or feed products, in order to guarantee purity and / or quality.

[0013] Summary of the invention

[0014] The present inventor has unexpectedly discovered that certain RNA molecules can be used as biomarkers of animal material, either as indicators of animal material in general or as indicators of animal material related to specific species, since said RNA molecules have shown to be abundant and surprisingly intact in food or feed samples. Based on the technical knowledge in the art, RNA would have been expected to be too unstable to serve as a robust biomarker in processed food matrices, and hence the present inventor has found use of this discovery.

[0015] The object of the present invention is therefore to use the discovery and stability of these RNA biomarker molecules for detecting the presence and / or absence of animal material in food or feed products by designing suitable detector probes that are contacted with said RNA biomarker molecules, thereby allowing detection and / or quantification of the presence of said RNA biomarker molecule, and therefore whether animal material is present in said food or feed product.

[0016] Therefore, in a first aspect, the invention relates to a method for detecting the presence and / or quantity of animal material in a processed vegan or vegetarian food or feed product, comprising the steps of:

[0017] (a) providing at least one food or feed product sample to be analysed, wherein the food or feed product sample potentially comprises an RNA biomarker molecule having origin in animal material;

[0018] (b) optionally extracting RNA material from the food or feed product sample;

[0019] (c) contacting said sample or extracted RNA material with at least one biomarker detector probe comprising a nucleotide sequence that is at least partially complementary to the nucleotide sequence of the RNA biomarker, under conditions allowing the biomarker detector probe to anneal to the RNA biomarker in case of presence of RNA biomarker; (d) amplifying the biomarker detector probe bound to the RNA biomarker;(e) detecting the presence and / or quantity of the amplified biomarker detector probe as a measurement of the presence and / or quantity of the RNA biomarker and therefore animal material in the food or feed product,

[0020] wherein the RNA biomarker is a conserved miRNA identical across at least one animal phyla and absent in plants.

[0021] Hereby, by measuring an RNA molecule that is abundant and intact in processed food or feed product samples, the presence or absence, as well as quantity, of animal material can be measured. Said method typically comprises three essential steps of (i) hybridising a probe to the RNA molecule biomarker, (ii) amplifying said probe and (iii) detecting the presence and / or quantity thereof. In its simplest versions, it is expected that a test based on the method of this disclosure will be substantially cheaper than currently used tests based on SOTA technology, such as around 10-20% of the cost, e.g. as a result of reduction in consumables and single-test multiplexing. In certain applications, such as e.g. when using a point of use test, the RNA material does not need to be extracted from the sample material, thereby further simplifying the method.

[0022] In embodiments, the method allows for detection of a plurality of animals from a single food or feed product sample, comprising phyla chosen from Xenoturbellida, Acoelomorpha, Platyhelminthes, Gastrotricha, Cycliophora, Mollusca, Annelida, Nemertea, Bryozoa, Entoprocta, Brachiopoda, Phoronida, Orthonectida, Dicyemida, Chaetognatha, Gnathostomulida, Micrognathozoa, Rotifera, Loricifera, Kinorhynca, Priapulida, Nematoda, Nematomorpha, Tardigrada, Onychophora, Arthropoda, Hemichordata, Echinodermata, and Chordata, comprising clade Eutheria (placental mammals), comprising families Bovidae, Suidae, Equidae, Anatidae and Phasianidae.

[0023] Hereby, a method providing a broad and up to universal animal kingdom coverage is provided, allowing detection of a large variety of different animals, including placental mammals and especially common farm animals. Further, by enabling detection of a broad coverage of phyla, clades, families and species from almost the entire animal kingdom in a single food or feed product sample, the method is both time and cost effective as more information can be collected from a single food or feed product sample. The method further provides the advantage of being applicable in multiple areas of food or feed products where the covered phyla or one or more species of the specific phylum is, or is expected to be, present in animal material.

[0024] In embodiments, the food or feed product sample comprises a vegan and / or vegetarian food product, or a feed product for animals.

[0025] Hereby, the purity and / or quality of vegan, vegetarian food and / or animal feed can be verified, and thereby the invention is specifically useful for vegan and vegetarian meat alternatives where animal-derived contamination must be excluded.

[0026] In embodiments, the RNA biomarker is a molecule that is highly conserved and abundant in a broad group of animals, such as essentially the entire animal kingdom, and thereby is used as a biomarker for the presence of animal material in general, wherein the RNA biomarker is identical across at least 5 animal phyla, preferably across at least 15 animal phyla, and more preferably across at least 25 animal phyla.

[0027] Thus, by using the method of the present invention, presence of essentially any animal material in a food or feed product sample can be detected.

[0028] In embodiments, the RNA biomarker is a molecule that is specific for limited number of animal species, such as one species.Thus, the method of the present invention can also be used for detecting traces of one or more specific species in a food or feed product sample.

[0029] Since miRNA is a well-known molecule comprising about 18-25 nucleotides, and surprisingly variants of miRNA has been shown by the inventor to be prevalent in a very broad range of animals and tissues, it is useful as biomarker in the present invention and enables through its size and structure efficient and reliable hybridization to a suitable probe in a food or feed product sample.

[0030] In embodiments, the RNA biomarker is chosen from the group comprising Mir-1, Let-7, Mir-133 and Mir- 10, and the method detects the taxonomic and tissue origin of animal material in a processed food matrix. These four miRNA molecules have similar features, being conserved in sequence between animal species and are present in the animal samples that the inventor has studied. Further, Mir-1 and Mir-133 have the additional advantage that they are highly abundant in muscle tissues, making them even more preferred as a biomarker for some applications.

[0031] In embodiments, the RNA biomarker is Let-7 and / or Mir-1, and the method detects the absence of any kind of animal material in food products.

[0032] Basically, this embodiment works as a "catch-all" vegan food certification test, i.e. a universal vertebrate and invertebrate detection assay. In contrast, the state-of-the-art in the field applies DNA tests to look for the absence of small groups of animals and thus require many separate tests (for separate groups) without getting good coverage of the animal kingdom.

[0033] In embodiments, the RNA biomarker is chosen from the group comprising Mir-2285, Mir-7177, Mir-9843, Mir-10383, Mir-10585 and Mir-12277, which are miRNA molecules suitable for detection of specific species, and the method detects the taxonomic and tissue origin of animal material in a processed food matrix.

[0034] Further, there are, currently 80 known Let-7 sequence variants and 97 Mir-1 sequence variants in animals. The present inventors have analyzed sequence data from 114 animal species and >3000 tissues to find the specific sequence variants that are present in the most species and the most tissues and thus actually function as useful biomarkers (as shown in the results in the attached figures).

[0035] In embodiments, the biomarker detector probe is complementary to at least a portion of 5 nucleotides of the RNA biomarker.

[0036] Hereby, providing a biomarker detector probe that is complementary to a specific, at least 5 nucleotide portion of the biomarker, enables the biomarker detector probe to bind precisely to its target and reducing the likelihood of non-specific interactions. This ensures accurate and reliable detection. The binding of an at least 5 nucleotide complementary portion provides sufficient stability for the probe-RNA complex, thereby maintaining the integrity of the detection process, especially in various biological conditions.

[0037] In embodiments, the biomarker detector probe is complementary to at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80 %, at least 90 % or at least 95% of the nucleotide sequence of at least one RNA biomarker molecule and / or any of the nucleotide molecules chosen from the group comprising SEQ. ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 and 28.Hereby, providing a biomarker detector probe with varying levels of complementarity (70%, 80%, 90%, or 95%) allows for a balance between specificity and flexibility, and allows a certain variation of RNA biomarkers to be detected.

[0038] SEQ ID NO: 17-28 refer to nucleotide molecules (RNA or DNA) for species-specific use.

[0039] In embodiments, the biomarker detector probe acts either (i) as a single primer, or (ii) comprises at least a pair of biomarker detection primers, acting as forward and reverse primers, in a subsequent amplification reaction.

[0040] Hereby, a probe set-up allowing for either (i) an amplification reaction only requiring one primer molecule, such as a rolling circle amplification, or (ii) a traditional PCR amplification requiring at least a forward and a reverse primer, is provided. Also, variations and combinations of these amplification schemes occur, e.g. where a RT primer is used as a biomarker detector probe, and where additional primers and probes are used to enable amplification and detection.

[0041] In embodiments, a plurality of biomarker detector probes is used, in order to detect the presence and / or quantity of a plurality of RNA biomarkers. For example, a probe set-up comprising 1, 2, 3, 4, 5, 6, 7 or 8 or more probes complementary to 1, 2, 3, 4, 5, 6, 7 or 8 or more of the RNA biomarkers represented by SEQ ID NO: 1-28 is included.

[0042] Hereby, providing a plurality of biomarker detector probes enables tailored detection, wherein a selected combination of biomarker detector probes is used for the detection of a specific combination of RNA biomarkers, wherein the specific combination of RNA biomarkers is characteristic of a desired target group of phyla or species of a specific type of food or feed product. For example, by using a plurality of biomarker detector probes designed for collecting a plurality of RNA biomarkers, a large variety of approaches are included, such as a combination of biomarker detector probes allowing a general detection across the entire animal kingdom, and / or allowing a specific detection of certain phyla or species, depending on the abundance of the detected biomarkers in various phyla and / or species.

[0043] In embodiments, the contacting step is performed by a hybridisation or ligation detection method such as stem-loop probes, padlock probes, split ligation probes, loop-mediated isothermal amplification primers, poly-adenylation combined with hybridization with poly-dT oligos, or ligation by small RNAseq 5' and 3' end adapters.

[0044] Hereby, the options of performing the contacting step of the method can be tailored to various situations and conditions, such as for application in a point-of-use test.

[0045] In embodiments, the amplification and / or detection step is performed by PCR, padlock probe detection comprising rolling circle amplification, RT-PCR, CRISPR-based amplification methods, or bridge amplification.

[0046] Hereby, the options of performing the amplification and / or detection step of the method can be tailored to various situations and conditions, such as for application in a point-of-use test.

[0047] In embodiments, the detection step (presence and / or quantity) is performed by colorimetric methods, colorimetry, fluorescence, next generation sequencing, Sanger sequencing, fluorescent hybridization to an array or other detection system, or detection of metallic particles.

[0048] Thus, one way to measure the RNA biomarker is to use PCR-based TaqMan detection, whereby one single test will replace 5-7 tests using current, conventional methods. Alternatively, RNA next-generation sequencing can be used, as well as a specifically designed point-of-use test for the RNA biomarker.

[0049] In embodiments, the method is performed as a point-of-use test.

[0050] In this context, a point-of-use test offers rapid results, convenience, and improved applicability by providing immediate detection information from a food or feed product sample. Such test is cost-effective, typically including the steps of (i) hybridization or ligation, (ii) amplification and (c) detection / read-out, thereby reducing overall costs of ensuring quality and safety, and enhance accessibility, especially in consumer or small-scale industrial applications.

[0051] In embodiments, the point-of-use test uses loop-mediated isothermal amplification (LAMP) to form a dumbbell structure and a colorimetric readout observed by eye.

[0052] In embodiments, the method further provides information on one or more of the following parameters: species origins, bacteria, bacterial pathogens, DNA viruses, RNA viruses and / or fungi. Hereby, by providing further information related to the food or feed product of which the sample is taken, the relevance of the method in contexts of e.g. quality control is even further improved.

[0053] In a second aspect, the invention relates to a kit for detecting the presence and / or quantity of animal material in a vegan or vegetarian food or feed product, comprising:

[0054] (i) at least one biomarker detector probe, or at least a pair of biomarker detector probes, comprising a nucleotide sequence that is at least partially complementary to the nucleotide sequence of at least one miRNA biomarker molecule, wherein the miRNA biomarker is a conserved miRNA identical across at least one animal phyla and absent in plants;

[0055] (ii) optionally necessary reagents and means for extracting RNA from a food product sample;

[0056] (iii) necessary reagents and means for annealing the biomarker detector probe(s) to the RNA biomarker(s);

[0057] (iv) necessary reagents and means for amplifying the biomarker detector probe(s) annealed to the RNA biomarker(s);

[0058] (v) necessary reagents and means for detecting the presence and / or quantity of the amplified biomarker detector probe(s); and

[0059] (vi) instructions for use.

[0060] In embodiments, the biomarker detector probe is designed to be at least partially complementary to any of the nucleotide molecules of the group chosen from SEQ. ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 and 28.

[0061] In embodiments, the kit comprises a plurality of biomarker detector probes in order to detect the presence and / or quantity of a plurality of RNA biomarkers.

[0062] In embodiments, the kit is designed as a point-of-use test.

[0063] In embodiments, the point-of-use test uses loop-mediated isothermal amplification (LAMP) to form a dumbbell structure and a colorimetric readout observed by eye.

[0064] Hereby, a kit is provided allowing for the test to be applied in a multitude of industries and both industrial and consumer related situations where the detection is needed.In embodiments, the food product is chosen from a vegan and / or vegetarian food product or a feed product for animals.

[0065] Hereby, the purity and / or quality of vegan, vegetarian food and / or animal feed can be verified with rapid results, convenience, and improved applicability by providing immediate detection information from a food or feed product sample. Further, the point-of-use test for verifying vegan and / or vegetarian food products or feed product for animals is cost-effective, reducing overall costs of ensuring quality and safety, and enhances accessibility, especially in consumer or small-scale industrial applications, i.e. benefits making point-of-use tests valuable for efficient and effective food or feed quality control.

[0066] In embodiments, the kit is designed for use in performing the method of the first aspect.

[0067] Hereby, the kit enables the method to be performed by providing the means necessary to perform the quality control. Further, the kit enables a rapid performance and accurate results, aiding in efficient quality control, and is versatile for use across various food and feed products, making it essential for maintaining product integrity. Even further, a kit for detecting the presence and / or quantity of animal material in food or feed products ensures food safety and quality, helps manufacturers comply with regulations, and enhances consumer trust by verifying product authenticity.

[0068] Thus, the inventor has provided a method that is more sensitive than the SOTA technology, since the RNA biomarker molecule is highly abundant in animal material and allows for detection in a simplified manner. This means that less consumables might be needed for the test, lowering costs even further. Additionally, the method is suitable for use as a point-of-use-test that can be used by non-experts outside of lab environments, for instance by food or feed producers in their production lines, by high-end restaurants in their kitchens or by consumers in their homes or farmers at the farms. Thus, measuring the RNA biomarker can be used to detect the presence of animal material in food or feed products. This could for instance be part of a service to detect contamination and food substitutions in vegan products as part of food fraud (service provided to public food control agencies) or to accredit vegan food products for high-end vegan food producers or restaurants.

[0069] Effects and features of the second aspect are to a large extent analogous to those described above in connection with the first aspect. Embodiments mentioned in relation to the first aspect are largely compatible with the second aspect.

[0070] The present disclosure will become apparent from the detailed description given below. The detailed description and specific examples disclose preferred embodiments of the disclosure by way of illustration only. Those skilled in the art understand from the guidance in the detailed description that changes and modifications may be made within the scope of the disclosure.

[0071] Hence, it is to be understood that the herein disclosed disclosure is not limited to the particular component parts of the kit described or steps of the methods described since such kit and method may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. It should be noted that, as used in the specification and the appended claim, the articles "a", "an", "the", and "said" are intended to mean that there are one or more of the elements unless the context explicitly dictates otherwise. Thus, for example, reference to "a part or "the part" may include several elements, and the like.Furthermore, the words "comprising", "including", "containing" and similar wordings do not exclude other elements or steps.

[0072] Definitions

[0073] In the context of the present disclosure, the term "measure" refers to detecting the presence or quantity of a biomarker. The measurement of the food or feed product quality is based on the detection of the presence of animal material and / or the measurement of the quantity of the animal material present. In addition, various parameters may be used for characterising the information obtained from the kit and / or method. Parameters typically include one or more of the following: species origins, non-pathogenic bacteria, bacterial pathogens, DNA viruses, RNA viruses and fungi. In the context of this disclosure, a "point-of-use test" for food or feed products is a detection test typically suitable for being performed close to or directly at the location where the food or feed product is being processed, sold, or consumed, and thus where a sample easily can be taken from the food or feed product. Said tests are designed to quickly detect the presence or absence of a selected set of quality indicators in food or feed products, ensuring safety and compliance with health standards, and can typically be used directly by a consumer or food technician, without providing the sample(s) to a laboratory for analysis.

[0074] In the context of this disclosure, the term "processed" food refers to food being mechanically ground, fermented, pasteurized or otherwise heated. Typically, food products such as gelatine that have been treated with strong alkaline or acidic solutions could be considered "highly processed", as the presence of nucleic acids is uncertain.

[0075] In the context of this disclosure, the detector probe comprising a nucleotide sequence being "at least partially complementary" means that it is complementary to at least a portion (such as number or percentage) of the nucleotides of the RNA biomarker.

[0076] Brief description of the drawings

[0077] Figure 1 refers to vegan food verification and a comparison of state of the art (SOTA) DNA profiling of the COI gene vs the approach according to the invention profiling an RNA biomarker. A Mir-1 biomarker is profiled.

[0078] Figure 2 refers to biopsies from cow, pig and horse, and processed and packaged beef, pork and mixed meat as profiled by next-generation RNA sequencing. To the left: biopsies from recently slaughtered horse, cow and pig. To the right: processed and packaged meat from cow, pig and cow / meat.

[0079] Figure 3 refers to aspects of food quality and a comparison of testing using profiling of DNA and RNA, respectively., showing general advantages of RNA over DNA profiling.

[0080] Figure 4 refers to detection of the RNA biomarker (Mir-1) of the present invention in meat samples, in public RNA sequencing data from various animals, and absence of the molecule in public RNA nextgeneration sequencing data from various plants (in which the RNA sequencing data are from leaves and stem). "Sponge" refers to animal sponges. The vertical scale indicates the number of times that the RNA biomarker of the present invention was detected in a given sample (loglO scale).Figure 5 refers to examples of food products to be tested for the presence of the RNA biomarker of the invention.

[0081] Figure 6 refers to coverage of the animal kingdom and a comparison of state of the art (SOTA) tests vs tests involving the RNA biomarker of the invention.

[0082] Figure 7 refers to the general presence of RNA molecules of processed and packaged meat. In all meat samples that were profiled, hundreds of thousands of identifiable RNA molecules including at least tens of thousands of highly informative miRNA molecules were detected.

[0083] Figure 8 refers to a schematic view of probes and primers used in one example embodiment of the invention using the TaqMan approach (see example 6). Terms "3" and "5" refer to the 3' and 5'-ends, respectively.

[0084] Figure 9 refers to DNA and RNA alphabets for example miRNA sequences for use as biomarkers in the present invention, whereby Mir-1, Let-7, Mir-133 and Mir- 10 refers to biomarkers suitable for detection of animal material in general, whereas Mir-2285, Mir-7177, Mir-9843, Mir-10383, Mirl0585 and Mir-12277 represent example miRNA sequences suitable for detection of specific species. Term "5" in figure 10 refers to the 5'-end.

[0085] Figure 10 refers to a schematic view of primers used in one example embodiment of the invention using the custom qPCR approach (see example 12).

[0086] Figure 11 refers to the primers used for the custom qPCR approach as described in example 12. The reverse transcription product and the forward and reverse primers are exemplified in Figure 10. Figures 12-20 refers to the detection of sequences Mir-1, Let-7, Mir-133, Mir- 10 and Mir-9843 in food products, measured by next-generation RNA sequencing. In each figure, the red beet burger, the vegan burger ("Beyond burger") and the vegan caviar are "vegan" products, while the others are "meat".

[0087] Figure 21 refers to the detection of bacteria and bacterial pathogens in food products measured by next-generation RNA sequencing (exemplified in vegan burger).

[0088] Figure 22 refers to the detection of RNA viruses (Porcine Picobirnavirus) and DNA virus (Caudoviricetes) in food products measured by next-generation RNA sequencing (exemplified by pork meat).

[0089] Figure 23 refers to the detection of fungi in food products measured by next-generation RNA sequencing (exemplified by Ascomycota fungi in vegan burger)

[0090] Figure 24 refers to the detection of fungi in food products measured by next-generation RNA sequencing (exemplified by Basidiomycota fungi in vegan burger)

[0091] Figure 25 refers to the detection of Let-7 in 26 distinct food products plus homogenized fruit flies (Drosophila melanogaster females and males) using TaqMan qPCR (as described in example 6). The gelatin powder and gummy bears have been treated with strong acidic or alkaline solutions to separate out the collagen and are not expected to contain nucleic acids. These two are considered "highly processed" animal food products.Figure 26 refers to the detection of Mir-1 in 21 distinct food products using TaqMan qPCR (as described in example 6). The gelatin powder and gummy bears have been treated with strong acidic or alkaline solutions to separate out the collagen and are not expected to contain nucleic acids. These two are considered "highly processed animal" food products.

[0092] Figure 27 refers to the detection of Let-7 in four food products using TaqMan qPCR (as described in example 6). Here, Let-7 and Mir-1 have been reverse-transcribed and PCR amplified together, although only Let-7 is detected using TaqMan probes.

[0093] Figure 28 refers to the detection of Let-7 or Let-7+Mir-l in three food products. In the Let-7+Mir-l assay, the combined abundance of the two miRNAs in measured using a single SYBR Green readout, as described in example 13. The "Single Let-7 assay" measurements are to the left in the figure and the "Combined Let7+Mir-1 assay" measurements are to the right in the figure.

[0094] Figure 29 refers to the detection of Let-7 in cooked beef and coconut water using the Let-7 custom primer set in Figure 11, applied as described in example 12. In addition, the custom primers were used to detect a positive control sample, comprised of synthetic Let-7 added to a buffer solution. Figures 30 refers to the presence of Let-7-1, Let-7-2, Mir- 1-1, Mir- 1-2, Mir- 1-3, Mir- 10-1, Mir- 10-2 or Mir-133 in the genomes of animals belonging to broad evolutionary groups. The uppercase crosses "X" denote perfect matches (100% identical) to the sequences listed in Fig. 9, while the lowercase crosses "x" denote matches where a single nucleotide differs. The PCR approaches that are applied in examples 2, 6, 8, 9, 12 and 13 will typically still detect RNA molecules that differ by a single nucleotide.

[0095] Detailed description of the invention

[0096] The present invention relies on the recent discovery that RNA is abundant and surprisingly intact in food products, such as minced and packaged meat from supermarkets (see examples). The inventor has discovered that in particular miRNA molecules are abundant in these samples. miRNA molecules are known and well-described as such but have never before been found in processed meat products or similar applications. miRNA is an ideal biomarker for the presence of animal material for at least the following reasons: (1) it is typically conserved in sequence throughout the animal kingdom, meaning that the presence of any animal material can be detected with a single test; (2) it is abundantly present so that tests using miRNA will be more sensitive than SOTA tests.

[0097] Method for detecting the presence and / or quantity of animal material in a food or feed product In a first aspect, the invention relates to a method the presence (or absence) and / or quantity of animal material in a food or feed product using RNA as a biomarker molecule.

[0098] The method comprises a first step of providing a sample from the food or feed product to be analysed. As discovered by the present inventor, should the sample, which typically is an essentially non-animal based food or feed product, such as a vegan food product, contain any animal material, such as traces, impurities or small amounts of animal material, an RNA biomarker, such as miRNA, will be present as part of or stemming from the traces, impurities or small amounts of animal material, and can subsequently be detected. Should there be no traces or impurities of animal material in the sample, i.e. should the sample be completely or at least essentially void of animal material, no detection of RNA biomarker will occur.Basically, the method will work for two situations: (i) for detecting any animal material, i.e. the presence and / or quantity of animal material in general, i.e. of any animal origin, and (ii) for detecting animal material related to one or more specific species.

[0099] In some cases, the RNA material may be extracted and / or concentrated and / or purified from the food or feed product sample, and in some cases this is not necessary, and the RNA biomarker can be detected directly from the sample. Typically, the need for extraction / concentration / purification will depend on the availability and abundance of the RNA biomarker in the sample material to be detected.

[0100] Thereafter, a biomarker detector probe is provided and contacted with the sample potentially comprising RNA biomarker (if the sample contained animal material). The biomarker detector probe is designed to be able to bind to the RNA biomarker (if RNA biomarker is present), and therefore the biomarker detector probe comprises a nucleotide sequence that is sufficiently complementary to the RNA biomarker to be detected. In embodiments, the biomarker detector probe may be designed to bind to a plurality of different RNA biomarkers, e.g. if the RNA biomarkers have similar RNA sequences, and a biomarker detector probe can be designed to anneal sufficiently to a variety of RNA biomarkers. Moreover, depending on whether the method is aimed for detecting animal material in general, or one or more specific animal species, the RNA biomarker and the probe is designed to take this into account.

[0101] As a next step, the biomarker detector probe bound to the RNA biomarker is typically amplified to obtain a larger amount of molecules to detect. The amplification step can be performed in different ways depending on the final detection, and depending on protocol used, of which there are several known protocols that would work. Typically, by varying temperatures in the amplification reaction (e.g. a PCR reaction), unspecific binding is removed as the temperature is increased as part of the typical amplification or PCR reaction.

[0102] In a final step, the amplified probes are detected for presence, quantity and / or other parameters of interest, to determine quality and / or purity of the food or feed product in terms of quantity of animal material. The detection step can be performed in different ways depending on the measurement method, and depending on protocol used, of which there are several known protocols that would work.

[0103] In embodiments, the biomarker detector probe may be identical to one or more primers to be used in a subsequent amplification reaction, such as a quantitative PCR process (such as TaqMan protocol) requiring a forward and a reverse primer, and a rolling circle amplification using padlock probes, wherein only one primer is required.

[0104] The primer (the biomarker detector probe) is designed to be sufficiently complementary to the miRNA sequence(s) to be profiled, and in the event of binding of the primer to the RNA biomarker a subsequent amplification reaction and following detection can be performed in order to detect presence and / or quantity of one or more RNA biomarkers.

[0105] Also, the biomarker detector probe may also be e.g. a RT (reverse transcriptase) primer used in a TaqMan miRNA assay (see e.g. example 6), which assay comprises additional primers and probes for the amplification and detection steps. Thus, as long as the miRNA biomarker can bind to a biomarkerdetector molecule, the subsequent steps, and any additional primers and probes, may vary depending on choice and design of the amplification and detection steps.

[0106] Food or feed product sample

[0107] A "food or feed product" refers to a product to be consumed primarily by a human or animal, respectively. Typical food products to be tested for the presence of animal material may include nonanimal items like fruit, vegetables, grains, meats or vegan and / or vegetarian meat alternatives. Feed products to be tested for the presence of animal material may include non-animal items pellets, hay, grains etc. The food or feed products referred to herein may or may not have been further processed, such as by heat treatment or the like.

[0108] A sample of a food or feed product to be used in the context of the present disclosure is typically taken by means of any tools or instruments that can provide the sample in a controlled and clean manner, and in a volume / amount that is sufficient to run the analysis. Typically, small samples are sufficient, and as small sample as one or a few cells is typically sufficient for the profiling, even though larger samples may also be used for practical reasons. Thus, typically the sample can be collected directly from the food or feed product to be analysed.

[0109] In some embodiments, mechanical grinding is used to prepare feed samples, followed by extended incubation times in CTAB buffers. This process typically releases the RNA from pellets, hay or grains.

[0110] Animals to be detected - phyla and species of the animal kingdom

[0111] By using the method or kit of the present disclosure, animal material from essentially the entire animal kingdom can be detected comprising phyla chosen from Xenoturbellida, Acoelomorpha, Platyhelminthes, Gastrotricha, Cycliophora, Mollusca, Annelida, Nemertea, Bryozoa, Entoprocta, Brachiopoda, Phoronida, Orthonectida, Dicyemida, Chaetognatha, Gnathostomulida, Micrognathozoa, Rotifera, Loricifera, Kinorhynca, Priapulida, Nematoda, Nematomorpha, Tardigrada, Onychophora, Arthropoda, Hemichordata, Echinodermata, and Chordata.

[0112] In embodiments, placental mammals (clade Eutheria of phyla Chordata) and specifically common farm animals are of particular interest. Thus, Bovidae (family of cloven-hoofed, ruminant animals, such as cattle bison, buffalo, antelopes, sheep and goats), Suidae (family of artiodactyl mammals, such as pigs, hogs or swine), Equidae (family of horses, such as horses, asses, donkeys and zebras), Anatidae (family of water birds, such as ducks, geese and swans) and Phasaianidae (family of heavy, ground-living birds, such as pheasants, grouse, partridges, junglefowl, chickens, turkeys, Old World quail and peafowl) are of special interest for applications of the method of the present disclosure. The wide range of phyla detectable by the method provides a broad coverage of the animal kingdom from a single food or feed product sample meaning that the method may cover more species in a single test than previously shown by other methods. This is especially interesting for applications where a large number of phyla needs to be traceable from a single sample, e.g. for quality control to ensure food safety. Even further, the available phyla selection allows for tailoring for detection of specific species. Depending on the food or feed product the sample is collected from, different species may be of specific interest to be detectable.

[0113] Figure 30 shows animal groups where the presence of Let-7-1, Let-7-2, Mir- 1-1, Mir- 1-2, Mir- 1-3, Mir-10-1, Mir- 10-2 or Mir-133 in the genomes of animals belonging to broad evolutionary groups. The table of figure 30 shows the animal groups where the sequences are present. The uppercase crosses"Y” denote perfect matches (100% identical) to the sequences listed in Fig. 9, while the lowercase crosses "x" denote sequences that differ by one nucleotide (likely still detectable by PCR). The animal groups covered by Figure 30 represent millions of animal species and represent basically all animals relevant to the food industry.

[0114] RNA biomarker molecule

[0115] An RNA biomarker molecule of interest is typically present in the food or feed product sample if the sample comprises animal material, or at least traces of animal material, and if so, it is typically highly conserved and highly abundant, making it suitable for detection and profiling.

[0116] Being highly conserved across animal species and phyla enables the biomarker to be able to identify various types of animals The high abundance provides the detection method with an improved level of sensitivity since even smaller samples provides a sufficient detectable level of the molecules, as it may be sufficient with as little as single cells or smaller parts or traces of animal tissue to enable detection, i.e. detection of a biomarker detector probe having annealed to a RNA biomarker.

[0117] Typically, the method of the invention can detect as small samples as single cells, e.g. using sequencing or TaqMan PCR in single cells to detect abundant miRNAs.

[0118] Even further, since the RNA biomarker molecule may be present in many types of animal material tissues, the detection method provides a high sensitivity for even relatively small traces of the RNA biomarker. Typically, the method used in the present disclosure, such as qPCR, can detect miRNAs in about 10 picograms (1012g) of RNA material, corresponding to a single cell. This in turn enables the method to still be applicable to a broad range of samples, which opens up a number of applications that have previously been unattainable using larger and less accessible nucleic acid molecules, such as nuclear DNA. For example, miRNAs can be detected in fresh (unprocessed), processed and cooked meat products, as well as meat offal products. Also, the method is applicable to vegan and vegan meat-substitute products, as well as to detect miRNAs in grains. Moreover, the method is applicable in fresh vegetable and fruit products, as well as most other products where miRNA is available and preserved.

[0119] In embodiments, the RNA biomarker molecule is a miRNA molecule, thereby typically being of a length of about 18-25 nucleotides, such as about 22 nucleotides. For example, the miRNA molecule may be chosen from the group comprising Mir-1, Let-7, Mir-133 and Mir- 10 (SEQ ID NO: 1-8 (RNA) and SEQ ID NO: 9-16 (DNA)). However, other miRNA molecules are also included, as well as variants and derivatives thereof, as long as the biomarker molecule is an RNA molecule and has the necessary properties to be used as a biomarker for the presence of animal material in general or specifically (see also below in this disclosure) according to the aspects of the present invention.

[0120] In general, small-sized RNA molecules (such as miRNAs) are advantageous, since they are less exposed to endonucleases that can cleave them compared to longer RNAs. Also, miRNAs are typically covered by Argonaute proteins that typically provide some protection and may result in higher preservation of miRNAs compared to other RNAs.

[0121] The sequence of the miRNA to be detected, and its specificity for certain species and / or general abundance, combined with the design of the biomarker detector probe, and its complementarity to the RNA biomarker (the miRNA), are parameters that determine how specific or how general the present method can be used.The biomarker detector probe

[0122] In embodiments, the biomarker detector probe is designed to anneal to an RNA biomarker to be detected as an indicator of the presence of animal material in a sample. The biomarker detector probe comprises a nucleotide sequence (DNA or RNA) that is at least partially complementary to the nucleotide sequence of the RNA biomarker to be detected. In some embodiments the biomarker detector probe is a DNA molecule that may provide higher stability, and in some embodiments it is an RNA molecule. In some embodiments there may be more than one RNA biomarkers to be detected, and in some embodiments more than one biomarker detector probe may be designed to anneal to more than one RNA biomarker. Typically, the biomarker detector probe is complementary to at least about 5 nucleotides, such as about 5 consecutive nucleotides of the RNA biomarker to be detected, thereby allowing a sufficiently specific binding to the RNA biomarker molecule to be detected. In embodiments, the biomarker detector probe is complementary to more than 5 nucleotides of the RNA biomarker to be detected, such as about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 23, 24 or 25 nucleotides of the RNA biomarker to be detected. Thus, the biomarker detector probe may overlap with its target (the miRNA biomarker molecule typically having a length of about 22 nucleotides) with only about 5 nucleotides, i.e. around 20% of the RNA biomarker length. In embodiments where the RNA biomarker is a miRNA molecule, the biomarker detector probe may be complementary up to about the entire nucleotide sequence of the RNA biomarker, such as about 22 nucleotides, or it may be complementary to about at least 5 nucleotides or more. In embodiments, the biomarker detector probe is complementary to about at least 20%, at least 30%, at least 40%, at least 50%, at least 60 %, at least 70%, at least 80 %, at least 90 % or at least 95% of the nucleotide sequence of at least one RNA biomarker molecule to be detected, such as a nucleotide molecule chosen from the RNA or DNA molecules of the group comprising SEQ. ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 and 28. In embodiments, the biomarker detector probe is complementary to a stretch of the RNA biomarker, so that a sufficient binding is obtained, such a complementarity of at least 50%, at least 60%, at least 70%, at least 70% or at least 90% to a stretch of e.g. at least 5-10 nucleotides of the RNA biomarker.

[0123] Thus, the biomarker detector probe is typically chosen so that is complementary to the RNA biomarker molecule(s) that are expected to be found in the sample.

[0124] In embodiments, the biomarker detector probe comprises at least a first and a second biomarker detection primer, acting as forward and reverse primers in a subsequent amplification reaction. Hence, by designing the biomarker detector probe this way, a subsequent amplification reaction by PCR is facilitated.

[0125] In embodiments the biomarker detector probe is a single primer molecule, that is suitable for use in a rolling circle amplification protocol, e.g. including padlock probes.

[0126] In embodiments, a plurality of biomarker detector probes is used, in order to detect the presence and / or quantity of a plurality of RNA biomarkers.

[0127] In embodiments, the biomarker detector probe is used directly as a primer in a subsequent amplification reaction.

[0128] In embodiments, the biomarker detector probe is a RT (reverse transcriptase) primer and additional primers and probes are used in the amplification and detection steps.Figure 11 refers to the design of primers designed for a custom qPCR approach (as exemplified in example 12). The primers of figure 11 are designed for Mir-1, Let-7, Mir-133, Mir- 10, Mir-2285, Mir-7177, Mir-9843, Mir-10383, Mir-10585 and Mir-12277. The principles of the design (as outlined in example 6) can be applied for any other miRNA biomarkers.

[0129] In embodiments, the biomarker detector probe is a DNA or RNA molecule that is to be able to anneal to a part, such as at least 5 nucleotides, of the intended RNA biomarker, and serve as a starting point for synthesis of a new strand in a reverse transcription reaction or similar reaction, subsequently followed by amplification and detection.

[0130] Thus, the design of the biomarker detector probe (or molecule) may be varied in many different ways depending on the chosen amplification and / or detection protocol. The present invention can be realized using any amplification and / or detection protocol, as long as the at least one biomarker detector probe (or molecule) has the capacity to bind to the RNA biomarker(s) that is / are intended to be detected, and that biomarker detector probes (molecules) that have bound to the intended RNA biomarker can be used in a subsequent amplification and / or detection protocol.

[0131] Extraction of RNA material

[0132] The food or feed product sample may be isolated and optionally prepared by using a method step of lysing and purification for extracting and / or purifying and / or concentrating the RNA material from the sample.

[0133] Contacting step - hybridization / ligation

[0134] In embodiments, the method comprises a contacting step wherein the food or feed product sample, or the extracted RNA material, is contacted with at least one biomarker detector probe under conditions allowing the biomarker detector probe to anneal to an RNA biomarker in case of presence of RNA biomarker in the sample. Requirements to be met to enable the biomarker detector probe to anneal to an RNA biomarker are e.g. (i) sufficient abundance of the RNA biomarker, (ii) a sufficiently complementary sequence of the biomarker detector probe visavi the RNA biomarker, as well as (iii) suitable conditions in the solution or liquid wherein the contacting step is performed, such as a suitable pH, temperature, salt concentrations and the like. Typically, during this step, the temperature will be varied from about 50 to 90°C. Also, typically the KCI concentration varies in the interval from about 35 to 100 mM, whereas the pH typically varies in the interval from about 8.0-9.5. Hereby, the following steps of amplification and subsequent detection to provide a correct measurement of the presence and / or quantity of the RNA biomarker in the sample are enabled.

[0135] In embodiments, the contacting step may be performed by a hybridisation or ligation detection method such as stem-loop probes, padlock probes, split ligation probes, loop-mediated isothermal amplification primers, poly-adenylation combined with hybridization with poly-dT oligos, or ligation by small RNAseq 5' and 3' end adapters, and / or any other conventionally used method or protocol.

[0136] Amplification step

[0137] After the contacting step, any biomarker detector probe bound to an RNA biomarker to be detected is typically amplified, so that a detectable amount of molecules are produced. Amplification and subsequent detection can be performed in various ways depending on sample type, RNA biomarker(s) to be detected as well as the information to be provided upon detection. In embodiments, the amplification and / or detection step is performed by PCR, TaqMan-based assays,padlock probe detection comprising rolling circle amplification, RT-PCR, CRISPR-based amplification methods, bridge amplification and / or combinations of these methods. Also, multiplex PCR may be used, in order to profile a plurality of biomarkers in a single test.

[0138] Detection step

[0139] Subsequent to amplification, or as a step integrated in amplification, detection is performed. In embodiments, the detection step, measuring presence and / or quantity and / or other parameters, is performed by colorimetric methods, colorimetry, fluorescence, next generation sequencing, Sanger sequencing, fluorescent hybridization to an array or other detection system, or detection of metallic particles, or any other suitable method.

[0140] In embodiments, the method can provide information upon other parameters than presence and / or quantity of animal material, such as species origins, bacteria, bacterial pathogens, DNA viruses, RNA viruses and / or fungi in food products.

[0141] With regard to bacteria, some bacteria that are not pathogenic may be undesired in food, and therefore of interest to detect using the present invention.

[0142] In embodiments, the entire method, from sample taking to detection may be performed as a point-of-use test.

[0143] Detection of specific species

[0144] In some embodiments, the invention is aimed for detecting the presence and / or quantity of specific animal species in food or feed products. For example, in halal and kosher products it would be of primary interest to detect the presence of pig.

[0145] Typically, the detection of miRNA species biomarkers (i.e. miRNA biomarkers specific for certain species) is largely the same as the detection for pan-animal biomarkers. One difference is in the specific miRNA sequences that are profiled. For instance, the same food product could be profiled for the presence of pan-animal biomarkers and for e.g., pig biomarkers. In principle these two tests could even be performed simultaneously using a multiplex PCR reaction. Thus, the sequence of the miRNA to be detected, and its specificity for certain species and / or general abundance, combined with the design of the biomarker detector probe, and its complementarity to the RNA biomarker (the miRNA), are parameters that determine how specific or how general the present method can be used.

[0146] The sequences identified by SEQ ID NO: 17-22 (RNA) and SEQ ID NO: 23-28 (DNA) are examples of biomarkers to be used to identify meat traces of specific species. Thus, SEQ ID NO: 17 and 23 can be used to detect cow, SEQ ID NO: 18 and 24 can be used to detect horse, SEQ ID NO: 19-20 and 25-26 to detect pig and SEQ ID NO: 21-22 and 27-28 to detect chicken.

[0147] Detection of microorganisms

[0148] In some embodiments the invention is also aimed for detection of various microorganisms in the food or feed sample. This can e.g. include bacteria, bacteria pathogens, viral DNA, viral RNA and / or fungi. Thus, one or more microorganisms can be detected together with the presence and / or quantity of animal material, in one single test. Examples 14-15 provide specific examples.Kit

[0149] In a second aspect, the invention relates to a kit for detecting the presence and / or quantity of animal material in a food or feed product. The kit typically comprises the components that are required to detect the presence and / or quantity of animal material in a food or feed product sample comprising:

[0150] at least one biomarker detector probe, or at least a pair of biomarker detector probes, comprising a nucleotide sequence that is at least partially complementary to the nucleotide sequence of an RNA biomarker molecule. In embodiments, the at least one biomarker detector probe is a miRNA molecule, which for example is chosen from Mir-1, Let-7, Mir-133 and Mir- 10 (SEQ ID NO: 1, 2, 3, 4, 5, 6, 7 and 8), or from Mir-2285, Mir-7177, Mir-9843, Mir- 10383, Mir-10585 and Mir-12277 (SEQ ID NO: 17-22).

[0151] optionally necessary reagents and means for extracting RNA from a food product sample. In embodiments, extracting RNA from the food or feed product sample for subsequent handling (annealing, amplification and detection) may be necessary, and the kit may therefore include the proper reagents. In other embodiment, extraction of RNA from the sample may not be necessary, and thus inclusion of reagents for extraction is not necessary.

[0152] necessary reagents and means for annealing the biomarker detector probe(s) to the RNA biomarker. In embodiments, it is essential to allow the biomarker detector probe(s) to bind to the RNA biomarker, if present (as an indication of presence of animal material in general or specifically). Hence, necessary reagents, such as buffers and or other reagents to obtain the necessary conditions may be included in the kit.

[0153] necessary reagents and means for amplifying the biomarker detector probe(s). In order to obtain sufficient material to detect, amplification of the biomarker detector probe(s) that has / have annealed to the RNA biomarker(s) to be detected, is typically necessary, and for this purpose necessary reagents, such as buffers, nucleotides and enzymes may be included in the kit, depending on the amplification protocol to use.

[0154] necessary reagents and means for detecting the presence and / or quantity of the RNA biomarker. As a final step, the presence and / or quantity, and / or other parameters are determined, and, depending on detection protocol to use, necessary reagents, such as buffers and enzymes for this purpose may be included in the kit.

[0155] instructions for use. The kit may also include written instructions for use of the kit, which typically are adapted to the specific protocol that the kit is designed for, if any.

[0156] Thus, the kit of the invention may be used to verify the quality of a food or feed product sample with rapid results, convenience, and improved applicability by providing immediate detection information. The kit is cost-effective while reducing overall costs of ensuring quality and safety, and enhance accessibility, especially in consumer or small-scale industrial applications.

[0157] In embodiments, the kit comprises a plurality of biomarker detector probes in order to detect the presence and / or quantity of a plurality of RNA biomarkers, thereby e.g. combining detection of biomarkers covering animals in general with biomarkers for one or more specific species.

[0158] In embodiments, the kit is designed as a point-of-use test, which typically is valuable for efficient and effective food or feed quality control.

[0159] In embodiments, the food product is chosen from a vegan and / or vegetarian food product or a feed product for animals.

[0160] In embodiments, the kit is designed specifically for use in the method of the first aspect.Applications and uses

[0161] The method and kit of the first and second aspects may be used in many different applications for detecting the presence and / or quantity of animal material in food or feed products. For example:

[0162] Detection of the presence of bacterial and viral pathogens, which may be of interest especially in the livestock industry for food or feed products such as feed products for the animals to consume or in final meat products for consumer.

[0163] Ensuring that levels of insects and / or pest, as found in and around crops, do not exceed levels of consumption safety. This could be applicable for example in agricultural industry for food or feed products such as fruit, vegetables, grains among others. In embodiments, grains or the like can be broken up in order to profile the RNA inside. This could be done in seeds that are very old (such as thousands of years old).

[0164] Quality control of meat or vegan and / or vegetarian meat alternatives, to trace specific species for quality control to ensure food safety since food substitutions and fraud become detectable by using the method and kit of the present invention. For example, this could be applicable to ensure that a minced meat product only contains the claimed meat origin, or to specify if a meat product is safe to eat for reasons of dietary or allergy related food restriction.

[0165] More specifically, the method can be applied in a point-of-use test. This would provide detection of food or feed products performed directly at the location where the food or feed is being processed, sold, or consumed. With the benefit of these tests being designed to quickly detect the presence or absence of a selected set of quality indicators in food or feed products, ensuring safety and compliance with health standards.

[0166] The method may be further tailored to other applications, since it can be designed to provide a wide range of information on one or more of the following parameters: species origins, non-pathogenic bacteria, bacterial pathogens, DNA viruses, RNA viruses and fungi. This may further improve the quality control of the food or feed product.

[0167] The invention will now be further described by way of the following examples, which are not intended to limit to scope of the invention, but to exemplify some embodiments.

[0168] EXAMPLES

[0169] Example 1

[0170] The inventor has demonstrated that the Mir-1 molecule is abundantly present in six packages of minced meat from pig and cow, representing different food producers and supermarkets. The inventor has also demonstrated that Mir-1 is present in seven fresh biopsies from pig, cow and horse and that it is present in public RNA next-generation sequencing data from nine important animal species and completely absent in public RNA next-generation sequencing data from six important food plants.

[0171] In practice, the inventor applied sensitive wet and dry-lab methods to profile RNA in packaged meat from 3 minced beef samples, 3 minced pork samples and one mixed (beef / pork) sample. These samples were all obtained from separate regular supermarkets for end consumers. In addition, the inventor obtained muscle needle biopsies from 3 cows, 3 pigs and 1 horse that had been freshlyslaughtered (figure 2). The inventor profiled RNA from these samples using a next-sequencing protocol for small RNAs, which is optimized for detecting microRNAs and fragments of longer transcripts such as mRNAs. Specifically, RNA was extracted from the samples using TRIzol reagent, and sequencing libraries were prepared using the NEXTflex Small RNA-Seq Kit v3. Small RNAs were sequenced from these libraries using the Illumina NextSeq 500 instrument. The data were quality controlled and processed using the miRTrace software, and processed sequences were searched for the presence of specific RNA molecules using custom scripts.

[0172] The inventor found that RNA profiles in processed meat look surprisingly intact, yielding millions of sequencing reads that could be reliably traced to the genomes of origin. This is surprising, given that RNA is assumed to be an unstable molecule that would not be expected to persist in processed and packaged meat. From the RNA sequences, the inventor could unambiguously resolve the taxonomic and tissue origin of the meat products, and the presence of bacterial pathogens Streptococcus and Acinetobacter as well as the presence of Porcine Endogenous Retrovirus E in several pork samples were detected. The presence of RNA that can yield gene expression information in food products opens up for a number of applications that are unattainable using DNA, such as those listed in figure 3.

[0173] Importantly, it was found that the miRNA molecule Mir-1 (SEQ ID NO:1 or 2) was abundant on both the muscle biopsies and the processed and packaged meat (figure 4). To further extend the study, public RNA sequencing data from various animals and plants were also analyzed. While the Mir-1 sequence was consistently detected in all animal samples, it was not detected a single time in the plant data, showing that it is a conserved and ideal marker for the presence or absence of animal material in food products.

[0174] Based on these tests, miRNA biomarkers, e.g. Mir-1, is developed into a test for various applications.

[0175] Example 2

[0176] Firstly, a small sample is taken from the food material, and RNA is isolated using column-based extraction. The RNA material is hybridized to stem-loop probes specific for Mir-133 that are designed to match part of the 3' end of the RNA biomarkers. A primer reaction synthesizes the first cDNA strand, after which the second cDNA strand is synthesized using primers that hybridize specifically to the first strand (cycling 16°C for 30 minutes, 42°C for 30 minutes and 85°C for 5 minutes). The cDNA products are then amplified using PCR reaction (using 13 cycles each of 95°C for 15 seconds and 60°C for 4 minutes and a final step of 99.9°C for 10 minutes), and the levels of the products are detected using fluorescent probes that hybridize to the products following standard RT-PCR approach (using 40 cycles each of 95°C for 1 second to denature and 60°C for 20 seconds to anneal / extend and record fluorescence). The detection of the fluorescent signal is done using the PCR instrument readout software.

[0177] Example 3

[0178] Firstly, a small sample is taken from the food material, and RNA is isolated using phenol-chloroform or column-based extraction. Then, NextFlex smallRNAseq adapters are ligated on to the RNA molecules, a first strand synthesis takes place, and the captured cDNA molecules are amplified using PCR reaction. A part - aliquot - of the amplified cDNA library is loaded into an Illumina NextSeq 2000 flow-cell, where it is sequenced by sequencing-by-synthesis reactions. The data are transferred fromthe Illumina instrument and analyzed on a computer using software dedicated for smallRNAseq analyses. The presence of marker genes is identified computationally.

[0179] Example 4

[0180] Firstly, a small sample is taken from the food material and is inserted into a testing tube without prior RNA isolation. Here, loop-mediated isothermal amplification (LAMP) primers hybridize to Mir-133, forming the characteristic dumbbell structure. The design and experimental details are similar to the ones described in Wu et al. (International Journal of Analytical Chemistry, 2023:6624884) except the probes complementary to the Mir-133 miRNA target are:

[0181] 5' probes: ACAGCTGGTTG

[0182] 3' probes: AAGGGGACCAA

[0183] The product is amplified using primers specific to the dumbbell structure as described in the above study, and the product abundance is read out using colorimetry. Since no RNA extraction is needed, and the colorimetric readout can with sufficient amplification be observed by eye, this use case is suitable for point-of-use.

[0184] Example 5 - Detection of occurrence of specific species.

[0185] While some miRNAs are conserved between all bilaterian animals, there are others that are only found in specific species, including relevant farm animals such as cow, horse, pig and chicken. Firstly, a small sample is taken from the food material, and RNA is isolated using column-based extraction. The RNA material is hybridized to stem-loop primers specific for Mir-9843 that are designed to match part of the 3’ end of the RNA biomarker. A primer reaction synthesizes the first cDNA strand, after which the second cDNA strand is synthesized using primers that hybridize specifically to the first strand. The cDNA products are then amplified using PCR reaction, and the levels of the products are detected using fluorescent probes that hybridize to the products following standard RT-PCR approach. The detection of the fluorescent signal is done using the PCR instrument readout software. The presence of a fluorescent signal above background levels indicate that the food samples contain pig tissue.

[0186] Example 6 - profiling of mir-10

[0187] For profiling of mir-10, which is one of the main miRNAs of interest according to the present disclosure, a TaqMan protocol could be used (see fig. 8 for probe and primer designs and how they anneal to each other). The TaqMan probe and primer design could e.g. look like this (5' to 3' direction):

[0188] miR-10: TACCCTGTAGATCCGAATTTGT

[0189] RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACAAAT

[0190] Forward primer: TCGGGTACCCTGTAGAACCG

[0191] Reverse primer: GTGCAGGGTCCGAGGT

[0192] TaqMan probe: (6-FAM)-TACGACACAAATTCG-(MGB)

[0193] In this example, the TaqMan probe comprises a dye label (FAM) on the 5' end and a minor groove binder (MGB) on the 3' end.Thus, this example represents one alternative embodiment for performing the amplification and detection steps of the present invention.

[0194] Schematically, the TaqMan-based real-time quantification of miRNAs (see Chen et al., Nucleic Acids Res. 2005 Nov 27;33(20)) includes two steps, (i) stem-loop RT and (ii) real-time PCR. Stem-loop RT primers bind to at the 3'portion of miRNA molecules and are reverse transcribed with reverse transcriptase to form a cDNA sequence (RT product). Then, the RT product is quantified using conventional TaqMan PCR that includes miRNA-specific forward primer, reverse primer and a dye-labeled TaqMan probe (see figure 8 for a schematic example of how the respective primers / sequences bind to each other (due to complementary sequences)). The purpose of using a tailed forward primer at 5' is to increase its melting temperature (Tm) depending on the sequence composition of miRNA molecules.

[0195] In this example, the RT primer has the function of a biomarker detector probe, as defined in the present disclosure, and detection of a signal is obtained as the TaqMan probe (comprising a fluorescent reporter and a quencher, quenching any fluorescent signal as long as the TaqMan probe molecule is intact) is degraded as a result of the polymerase reaching the probe during polymerisation of a new DNA strand, thereby physically separating the fluorescent reporter from the quencher. Fluorescence can e.g. be detected and measured in a real-time PCR machine.

[0196] In this example, the mir-10 sequence has been written out with DNA letters, even though the miRNA molecule would typically be an RNA molecule.

[0197] Example 7 - computational evolutionary analyses

[0198] In addition, there exists at least 80 sequence variants of Let-7 and 97 sequence variants of Mir-1 in the animal kingdom. The inventors have performed extensive computational evolutionary analyses across 114 animal species and >30 tissues (in total >3,000 combinations of species and tissues) to find the sequence variants that are most widely present in animal species and tissues.

[0199] Example 8 - proof-of-principle experiments

[0200] The inventors have performed proof-of-principle experiments to show that these miRNA sequence variants can indeed be detected in consumer food products, including processed, minced, baked and packaged products, using next-generation sequencing and quantitative RT-PCR (qPCR) (Figures 12-20 and 25-29). This is non-trivial since RNA in consumer food products are expected to be much more degraded than in fresh tissues or cell cultures that qPCR is normally applied to. This particularly holds when food is processed, minced and / or baked, as are several of the food products that the inventors tested (see below).

[0201] Specifically, the inventors have performed in-house experiments to detect the presence of these Let-7 and Mir-1 miRNA sequence variants in 18 consumer products using next-generation sequencing and in 27 consumer food products using qPCR.

[0202] The consumer food products that the inventors profiled by qPCR to successfully verify the presence of Let-7 and / or Mir-1 include these mammalian products: pig liver pate, minced beef, beef (cooked / fried) and semi-skimmed milk (Figures 25-29). In addition, the inventors verified thepresence of Let-7 and Mir-1 in these mammalian products using next-generation sequencing: duck liver pate, minced pork, minced beef and mixed minced pork and beef (Figures 12-20).

[0203] The consumer food products that the inventors profiled by qPCR to successfully verify the presence of Let-7 and / or Mir-1 include these non-mammalian animal products: duck liver pate, chicken breast, minced chicken, octopus, squid, scampi and sea urchin (Figures 25-28).

[0204] Example 9 - absence demonstration

[0205] Lastly, the inventors have applied qPCR to demonstrate the absence of the Let-7 and / or Mir-1 sequence variants in vegan food products including: Max vegan burger, the Beyond burger, Oatley oat milk, plant (red beet) beef, vegetarian pate, vegan caviar, lemon, nectarine, clementine, coconut water, cucumber (Figures 25-29).

[0206] Example 10 - next-generation sequencing data

[0207] For Mir-1, Let-7, Mir-133, Mir- 10, Mir-9843 the inventors have demonstrated in-house nextgeneration sequence data that these miRNAs are present in cow, horse and / or pig consumer food products. (Figures 12-20).

[0208] Example 11 - detection of bacterial pathogens, RNA viruses, DNA viruses and fungi

[0209] When applying next-generation RNA sequencing to food products, the inventors detect bacteria, including human pathogens such as Clostridium, Enterococcus and Streptococcus (in vegan burger, Figure 21). In pork the inventors also detect RNA viruses such as Porcine Picobirnavirus and DNA viruses such Caudoviricetes (Fig. 22). In vegan burger the inventors also detect the presence of fungi, including Ascomycota fungi (Fig. 23) and Basiodiomycota fungi (Fig. 24).

[0210] Example 12 - custom qPCR primers

[0211] The inventors have designed custom qPCR primers for the 14 RNA sequences listed in Fig 9 (design overview in Fig 10, list of primer sequences in Fig 11). These primers will be applied as described under Example 6, but using SYBR Green fluorescence to detect the PCR product, rather than using a TaqMan detection probe.

[0212] Example 13 - detecting Let-7 and Mir-1 in a combined qPCR assay

[0213] In this use case, Let-7 and Mir-1 are extracted from a food product and reverse-transcribed and amplified in parallel using the primers in Figure 11 within the same reaction volume (multiplex assay). Then the combined abundance of Let-7 and Mir-1 is measured using a SYBR Green fluorescent readout. The inventors have performed a proof-of-concept experiment to demonstrate this setup on three food products (Figure 28).

[0214] Example 14 - verifying the absence of microbial pathogen and animal material in a vegan food product

[0215] In this use case, RNA is extracted from a vegan food product using the extraction protocol described in example 2. Half of the extracted RNA is subjected to reverse transcription using the primers specificto Clostridium perfringens 16S rRNA primers described in Matsuda et al. (Sensitive Quantitative Detection of Commensal Bacteria by rRNA-Targeted Reverse Transcription-PCR, Applied and Environmental Microbiology, 2007 Jan;73(l):32-9):

[0216] Forward primer: AGATGGCATCATCATTCAAC

[0217] Reverse primer: GCAAGGGATGTCAAGTGT

[0218] The other half of the extracted RNA is reverse transcribed using the custom primers for Mir- 10 listed in Fig. 9. The reverse transcribed products are pooled and measured using TaqMan qPCR as described in example 6, but using two distinct fluorescent probes (6-FAM and Texas Red reporters) for multiplexing. In this manner, the vegan food product can be tested for the absence of a bacterial pathogen and animal material in a single test.

[0219] Example 15 - verifying the absence of RNA virus and animal material in a vegan food product

[0220] In this use case, RNA is extracted from a vegan food product using the extraction protocol described in example 2. Half of the extracted RNA is subjected to reverse transcription using the primers specific to Hepatitis E virus as described in Persson et al. (Validation of an Optimised Method for Quantitative Detection of Hepatitis E Virus in Pork Sausage, Food and Environmental Virology. 2025 Jun 2;17(2):33):

[0221] Forward primer: GGTGGTTTCTGGGGTGAC

[0222] Reverse primer: AGGGGTTGGTTGGATGAATATAG

[0223] The other half of the extracted RNA is reverse transcribed using the custom primers for Mir-10 listed in Fig. 9. The reverse transcribed products are pooled and measured using TaqMan qPCR as described in example 6, but using two distinct fluorescent probes (6-FAM and Texas Red reporters) for multiplexing:

[0224] Hepatitis E virus probe: (TxR)-TGATTCTCAGCCCTTCGC-(MGB)

[0225] Mir- 10 TaqMan probe: (6-FAM)-TACGACACAAATTCG-(MGB)

[0226] In this manner, the vegan food product can be tested for the absence of a viral pathogen and animal material in a single test.

[0227] The person skilled in the art realizes that the present disclosure is not limited to the preferred embodiments described above. The person skilled in the art further realizes that modifications and variations are possible within the scope of the appended claims. For example, alternative designs of the method depending on context may be contemplated, as well as alternative kits, as long as the overall effects are achieved. Additionally, variations to the disclosed embodiments can be understood and effected by the skilled person in practicing the claimed disclosure, from a study of the drawings, the disclosure, and the appended claims.

Claims

CLAIMS1. A method for detecting the presence and / or quantity of animal material in a processed vegan or vegetarian food or feed product, comprising the steps of:(a) providing at least one food or feed product sample to be analysed, wherein the food or feed product sample potentially comprises an RNA biomarker molecule having origin in animal material;(b) optionally extracting RNA material from the food or feed product sample;(c) contacting said sample or extracted RNA material with at least one biomarker detector probe comprising a nucleotide sequence that is at least partially complementary to the nucleotide sequence of the RNA biomarker, under conditions allowing the biomarker detector probe to anneal to the RNA biomarker in case of presence of RNA biomarker;(d) amplifying the biomarker detector probe bound to the RNA biomarker; and(e) detecting the presence and / or quantity of the biomarker detector probe as a measurement of the presence and / or quantity of the RNA biomarker and therefore animal material in the food or feed product;wherein the RNA biomarker is a conserved miRNA identical across at least one animal phyla and absent in plants.

2. The method according to claim 1, allowing for detection of a plurality of animal phyla, clades, families or species from a single food or feed product sample, comprising phyla chosen from Xenoturbellida, Acoelomorpha, Platyhelminthes, Gastrotricha, Cycliophora, Mollusca, Annelida, Nemertea, Bryozoa, Entoprocta, Brachiopoda, Phoronida, Orthonectida, Dicyemida, Chaetognatha, Gnathostomulida, Micrognathozoa, Rotifera, Loricifera, Kinorhynca, Priapulida, Nematoda, Nematomorpha, Tardigrada, Onychophora, Arthropoda, Hemichordata, Echinodermata, and Chordata, comprising clade Eutheria (placental mammals), comprising families Bovidae, Suidae, Equidae, Anatidae and Phasianidae.

3. The method according to claim 1 or 2, wherein the food or feed product sample comprises a vegan and / or vegetarian food product, or a feed product for animals.

4. The method according to any one of the preceding claims, wherein the RNA biomarker is a molecule that is highly conserved and abundant in animals and thereby is used as a biomarker for the presence of animal material in general, wherein the RNA biomarker is identical across at least 5 animal phyla, preferably across at least 15 animal phyla, and more preferably across at least 25 animal phyla.

5. The method according to any one of the preceding claims, wherein the RNA biomarker is a molecule that is specific for limited number of animal species, such as one species.

6. The method according to any one of the preceding claims, wherein the RNA biomarker is chosen from the group comprising Mir-1, Let-7, Mir-133, Mir- 10, and the method detects the taxonomic and tissue origin of animal material in a processed food matrix.

7. The method according to any one of the preceding claims, wherein the RNA biomarker is Let- 7 and / or Mir-1, and the method detects the absence of any kind of animal material in food products.

8. The method according to any one of the preceding claims, wherein the RNA biomarker is Mir- 1 or Mir-133 (SEQ ID NO: 1, 2, 3 or 6), and the method detects the taxonomic and tissue origin of animal material in a processed food matrix, wherein the tissue comprises muscle tissue.

9. The method according to any one of the preceding claims, wherein the RNA biomarker is chosen from the group comprising Mir-2285, Mir-7177, Mir-9843, Mir-10383, Mir-10585 and Mir-12277 and the method detects the taxonomic and tissue origin of animal material in a processed food matrix.

10. The method according to any one of the preceding claims, wherein the biomarker detector probe is complementary to at least a portion of 5 nucleotides of the RNA biomarker.

11. The method according to any one of the preceding claims, wherein the biomarker detector probe is complementary to at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80 %, at least 90 % or at least 95% of any of the nucleotide molecules chosen from the group comprising SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 and 28.

12. The method according to any one of the preceding claims, wherein the biomarker detector probe acts either (i) as a single primer, or (ii) comprises at least a pair of biomarker detection primers, acting as forward and reverse primers, in a subsequent amplification reaction.

13. The method according to any one of the preceding claims, wherein a plurality of biomarker detector probes are used, in order to detect the presence and / or quantity of a plurality of RNA biomarkers.

14. The method according to any one of the preceding claims, wherein the contacting step is performed by a hybridisation or ligation detection method such as stem-loop probes, padlock probes, split ligation probes, loop-mediated isothermal amplification primers, polyadenylation combined with hybridization with poly-dT oligos, or ligation by smallRNAseq 5' and 3' end adapters.

15. The method according to any one of the preceding claims, wherein the amplification and / or detection step is performed by PCR, padlock probe detection comprising rolling circle amplification, RT-PCR, CRISPR-based amplification methods, or bridge amplification.

16. The method according to any one of the preceding claims, wherein the detection step (presence and / or quantity) is performed by colorimetric methods, colorimetry, fluorescence, next generation sequencing, Sanger sequencing, fluorescent hybridization to an array or other detection system, or detection of metallic particles.

17. The method according to any one of the preceding claims, wherein the method is performed as a point-of-use test.

18. The method according to claim 17, wherein the point-of-use test uses loop-mediated isothermal amplification (LAMP) to form a dumbbell structure and a colorimetric readout observed by eye.

19. The method according to any one of the preceding claims, further providing information on one or more of the following parameters: species origins, bacteria, bacterial pathogens, DNA viruses, RNA viruses and / or fungi.

20. A kit for detecting the presence and / or quantity of animal material in a processed vegan or vegetarian food or feed product, comprising:(i) at least one biomarker detector probe, or at least a pair of biomarker detector probes, comprising a nucleotide sequence that is designed to be at least partially complementary to the nucleotide sequence of at least one miRNA biomarker molecule, wherein the miRNA biomarker is a conserved miRNA identical across at least one animal phyla and absent in plants;(ii) optionally necessary reagents and means for extracting RNA from a food or feed product sample;(iii) necessary reagents and means for annealing the biomarker detector probe(s) to the RNA biomarker(s);(iv) necessary reagents and means for amplifying the biomarker detector probe(s);(v) necessary reagents and means for detecting the presence and / or quantity of the amplified biomarker detector probe(s); and(vi) instructions for use.

21. The kit according to claim 20, wherein the biomarker detector probe is designed to be at least partially complementary to any of the nucleotide molecules of the group chosen from SEO. ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 and 28.

22. The kit according to any one of claims 20-21, comprising a plurality of biomarker detector probes in order to detect the presence and / or quantity of a plurality of RNA biomarkers.

23. The kit according to any one of claims 20-22, wherein the kit is designed as a point-of-use test.

24. The kit according to any one of claims 20-23, wherein the point-of-use test uses loop- mediated isothermal amplification (LAMP) to form a dumbbell structure and a colorimetric readout observed by eye.

25. The kit according to any one of claims 20-24, wherein the food product is chosen from a vegan and / or vegetarian food product or a feed product for animals.

26. The kit according to any one of claims 20-25, for use in performing the method of claims 1- 19.

Images