Methods of treating or preventing heart failure or arrhythmias by modulating RAD binding to voltage-gated calcium channels in the heart
Patent Information
- Application Number
- PCT/US2026/019425
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-03-17
- Filing Date
- 2026-03-16
- Publication Date
- 2026-09-24
Smart Images

Figure US2026019425_24092026_PF_FP_ABST
Abstract
Description
Attorney Docket 44010.202WO-PCT / / CU24243METHODS OF TREATING OR PREVENTING HEART FAILURE OR ARRHYTHMIAS BY MODULATING RAD BINDING TO VOLTAGE-GATED CALCIUM CHANNELS IN THE HEART RELATED APPLICATIONS
[0001] This application claims the benefit of U. S. Provisional Application No. 63 / 773,293, filed March 17, 2025, to The Trustees of Columbia University, titled “METHODS OF TREATING OR PREVENTING HEART FAILURE OR ARRHYTHMIAS BY MODULATING RAD BINDING TO VOLTAGE-GATED CALCIUM CHANNELS IN THE HEART,” the entirety of the disclosure of which is hereby incorporated by this reference. The entire contents of the above-identified application are hereby fully incorporated herein by reference.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under HL146149, HL155377, HL121253, and HL164319 awarded by the National Institutes of Health. The government has certain rights in the invention.INCORPORATION-BY-REFERENCE OF MATERIAL ELECTRONICALLY FILED
[0003] The official copy of the sequence listing is submitted electronically in an.xml file format having the file name “202WO-PCT.xml” created on March 11, 2026, and having a size of 34,172 bytes, and is filed concurrently with the specification. The sequence listing is part of the specification and is herein incorporated by reference in its entirety.TECHNICAL FIELD
[0004] The subject matter disclosed herein is generally directed to treating a subject having or at risk for heart failure or arrhythmias with one or more agents capable of modulating Rad binding to voltage-gated calcium channels.BACKGROUND
[0005] Calcium is a critical second messenger in many cell types. Calcium enters into cells through voltage gated calcium channels. By regulating the amount of calcium that enters through these channels, cells can regulate downstream processes.
[0006] The strength of cardiac contraction (contractility) is regulated by the concentration of calcium within the cytoplasm of cardiac muscle cells (cardiomyocytes). During systoleAttorney Docket 44010.202WO-PCT / / CU24243(cardiac contraction), calcium enters the cytosol from the extracellular space through voltagegated L-type calcium channels (CaV1.2) as well as from intrinsic calcium storage compartments (the sarcoplasmic reticulum), through ryanodine receptor calcium channels (RyR2). As cytosolic calcium levels rapidly rise, the calcium binds to the contractile apparatus, enabling the cell to contract. The calcium is then removed from the cytosol and the cell relaxes.
[0007] Activation of the beta-adrenergic receptor cascade during exercise and stress causes more calcium to enter the cell through CaV1.2, resulting in increased contractility and improved cardiac output. However, in certain disease states, such as systolic heart failure, structural heart disease, atrial arrhythmias, ventricular arrhythmias, and catecholaminergic polymorphic ventricular tachycardia (CPVT), activation of the beta-adrenergic receptor system causes dysregulation of cytosolic calcium levels leading to clinical deterioration and death.
[0008] Beta-blockers are a ubiquitous class of medications that attenuate the effect of the beta-adrenergic receptor system on the heart and are a first line treatment for these conditions. Unfortunately, beta-blockers have numerous off-target effects that limit their use and tolerability by patients. Novel agents that specifically block the effects of beta-adrenergic receptor activation on calcium levels in cardiomyocytes may provide important therapeutic potential for many forms of heart disease.
[0009] Physiologic P-adrenergic activation of protein kinase A (PKA) during the “fight or flight” response increases Ca2+influx through CaV1.2 in cardiomyocytes, leading to increased cardiac contractility. In patients with heart disease, however, sustained adrenergic stimulation and the resultant increased Ca2+influx activate maladaptive pro-arrhythmic cellular processes including prolongation of the action potential duration (APD). PKA also acts on other key regulators of excitation-contraction (E-C) coupling, including ryanodine receptors (RyR2), phospholamban, KCNQ1ZE1 (IKS), and troponin I.
[0010] Selective attenuation of the incremental CaV1.2 current that is caused by activation of the P-adrenergic / PKA pathway, while at the same time preserving P-adrenergic stimulation of anti-arrhythmic targets, such as Kv channels, which shorten the APD, or SERCA would offer opportunities for novel targeted therapies. Thus, a great deal of research has been performed to define the molecular mechanisms of P-adrenergic regulation of CaV1.2 to provide tools for the development of targeted therapies. Such research is described, for example, in pending U. S. patent application Ser. No. 16 / 228,433, filed on Dec. 20, 2018, which is hereby incorporated by reference in its entirety.Attorney Docket 44010.202WO-PCT / / CU24243
[0011] Recent research, however, has revealed that protein kinase A (PKA) phosphorylates the Ras-related small G-protein, Rad, and that when Rad is released from the plasma membrane, calcium channel inhibition is decreased, resulting in increased calcium influx and increased contractility. Rad is a member of the RGK family of GTP-binding proteins, is an inhibitor of voltage-gated Ca2+channels and also is a PKA target.
[0012] In patients with heart failure (HF), persistent activation of the sympathetic nervous system, which compensates for decreased cardiac output, is cardiotoxic, exacerbating the failing heart and promoting life-threatening arrhythmias. Many current HF therapies augment or inhibit sympathetic nervous system input to the heart and vasculature but are suboptimal due to efficacy and tolerability concerns.
[0013] Patients with advanced systolic heart failure require urgent treatment with medications called inotropes which act on the heart to temporarily increase contractility and cardiac output. The major classes of inotropes, beta-adrenergic receptor agonists and phosphodiesterase-3 inhibitors, are limited by their effect on the cardiac conduction system, which results in increased heart rate or sinus tachycardia, and effects on systemic vasculature, which results in vasodilation and hypotension. There is an unmet clinical need for a drug that selectively increases cellular calcium levels in cardiac muscle cells without affecting the cardiac conduction system or systemic vasculature.
[0014] Citation or identification of any document in this application is not an admission that such a document is available as prior art to the present invention.SUMMARY
[0015] In one aspect, the present invention provides for a method of treating or preventing heart failure or arrhythmias in a subject in need thereof comprising administering to the subject one or more agents capable of disrupting Rad binding to voltage-gated calcium channels. In certain embodiments, the one or more agents comprise an RNAi, genetic modifying agent, antisense oligonucleotide, and / or small molecule. In certain embodiments, the one or more agents comprise an antisense oligonucleotide or RNAi targeting Rad mRNA. In certain embodiments, the genetic modifying agent comprises a CRISPR system targeting the Rad gene. In certain embodiments, CRISPR targets the RAD genomic sequence, such as exons, intron, or regulatory sequences. In certain embodiments, the CRISPR system targets Rad mRNA. In certain embodiments, the genetic modifying agent comprises a CRISPR system configured to edit Rad to reduce or eliminate Rad binding to Cavβ₂. In certain embodiments, the geneticAttorney Docket 44010.202WO-PCT / / CU24243modifying agent comprises a CRISPR system configured to edit the Rad gene to reduce or eliminate Rad expression or to reduce or eliminate Rad binding to Cavβ₂. In certain embodiments, Cavβ₂ mRNA is edited. In certain embodiments, Asp320 and Asp322 of Cavβ₂ are edited to Ala. In certain embodiments, the one or more agents increase Rad phosphorylation. In certain embodiments, the one or more agents comprise a Phosphorylation-Inducing Chimeric Small molecule (PHICS) that recruits a kinase to Rad. In certain embodiments, the one or more agents comprise a proteolysis targeting chimera (PROTAC) targeting Rad.
[0016] In certain embodiments, the one or more agents is a vector comprising one or more nucleotide sequences encoding for an RNAi, genetic modifying agent, or antisense oligonucleotide. In certain embodiments, the vector is a viral vector. In certain embodiments, the viral vector has tropism for cardiomyocytes. In certain embodiments, the vector is an AAV vector. In certain embodiments, the AAV vector is AAV9. In certain embodiments, the AAV is a chimeric AAV vector derived from AAV9, AAV1, and / or AAV6. In certain embodiments, the one or more nucleotide sequences encoding for an RNAi, genetic modifying agent, or antisense oligonucleotide are operably linked to a cardiomyocyte-specific promoter.
[0017] In certain embodiments, the one or more agents are administered to the heart. In certain embodiments, the one or more agents are administered in combination with one or more P-blockers.
[0018] In another aspect, the present invention provides for a method of reducing P-adrenergic-induced arrhythmias in a subject in need thereof comprising administering to the subject one or more agents capable of reducing or eliminating Rad phosphorylation. In certain embodiments, the one or more agents comprise a Phosphorylation-Inducing Chimeric Small molecule (PHICS) that recruits a phosphatase to Rad.
[0019] In another aspect, the present invention provides for a mouse model comprising one or more mutations that reduce binding of Rad to voltage-gated calcium channels.
[0020] These and other aspects, objects, features, and advantages of the example embodiments will become apparent to those having ordinary skill in the art upon consideration of the following detailed description of example embodiments.Attorney Docket 44010.202WO-PCT / / CU24243BRIEF DESCRIPTION OF THE DRAWINGS
[0021] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0022] An understanding of the features and advantages of the present invention will hereinafter be described in conjunction with the appended and / or included DRAWINGS, where like designations denote like elements, and:
[0023] FIG. 1 - Model of P-adrenergic regulation of Ca2+channels in the heart. PKA phosphorylation of Rad releases Rad from the membrane, reducing affinity to CavP, thereby increasing Ca2+influx. (See, Liu, G., et al. Mechanism of adrenergic CaV1.2 stimulation revealed by proximity proteomics. Nature. 2020;577(7792):695-700).
[0024] FIG. 2 - Model of progression to heart failure (HF) after index event such as myocardial infarction (MI).
[0025] FIGs. 3A-3D - Adrenergic agonist-induced stimulation of Ca2+current requires phosphorylation of Rad in ventricular cardiomyocytes. (FIGs. 3A and 3B) Current-voltage relationships of Ca2+channels from WT and 4SA-Rad cardiomyocytes in the absence (black trace) and presence of 200 nM isoproterenol (blue trace). Insets: Exemplar whole-cell CaV1.2 currents. Pulses from -60 mV to +10 mV before (black traces) and 3 minutes after (blue traces) 200 nM isoproterenol. (FIG. 3C) Fold-change at -20 mV in peak current caused by isoproterenol (ISO) or forskolin (FSK). Mean ± SEM. ****P <0.0001 by unpaired two-tailed / -test. (FIG. 3D) V50, before and after ISO or FSK. ****p <0.0001 by unpaired two-tailed t-test.
[0026] FIGs. 4A-4E - Rad phosphorylation is required for adrenergic agonist-induced augmentation of Ca2+transient and contractility. (FIG. 4A) Graph of isoproterenol (ISO)-induced fold-change of Ca2+transient amplitude (detected by Fura 2-AM) vs. basal amplitude in WT (black) and 4SA-Rad (red) ventricular myocytes. (FIG. 4B) Graph of ISO- and forskolin (FSK)-induced fold-change in amplitude of Ca2+transient. Mean ± SEM. P < 0.0001 by oneway ANOVA, **** P < 0.0001 by Sidak’s multiple comparison test. (FIG. 4C) Pacing-induced change in sarcomere length before and after superfusion of FSK-containing solution for WT or 4SA-Rad cardiomyocytes. (FIG. 4D) Field stimulation induced a % change in sarcomere length in the absence and presence of FSK. ****P < 0.0001 by two-tailed / -test. (FIG. 4E) Graph of ejection fraction before and after ISO by echocardiography in isoflurane-anesthetized mice.Attorney Docket 44010.202WO-PCT / / CU24243****P <o 0001 by unpaired two-tailed / -test. (See, Papa, A., et al. Rad regulation of CaV1.2 channels controls cardiac fight-or-flight response. Nat Cardiovasc Res. 2022; 1(11): 1022-1038)
[0027] FIGs. 5A-5D - Augmentation of contractility requires Rad-bound Ca2+channels under basal conditions. (FIG. 5A) Schematic depicting mutation of CavP subunit (DA-P) that prevents Rad binding. (FIG. 5B) Graph of basal Ca2+transient amplitude. The dashed blue line is the mean for WT + ISO. Data are mean ± SEM; ****p <0.0001 by unpaired two-tailed t-test. (FIG. 5C) Scatterplot of ISO-induced fold-change of Ca2+transient amplitude vs. basal transient amplitude in WT and 2DA-P2B (green) myocytes. The dashed black line is the singleexponential fit of WT data. (FIG. 5D) Representative M-mode recordings. Graph of fractional area of change. Dashed lines are means for WT mice without and with ISO. N = 5 mice from each group. (See, Papa, A., et al. Rad regulation of Ca(V)1.2 channels controls cardiac fight-or-flight response. Nat Cardiovasc Res. 2022; 1(11): 1022-1038)
[0028] FIG. 6 - Schematic of two populations of Ca2+channels.
[0029] FIGs. 7A and 7B - AAV9-Cas9 inactivation of Rad in ventricular myocytes. (FIG.7 A) Example of deep sequencing of genomic DNA from isolated cells demonstrating -50% frameshifting indels (red box). (FIG. 7B) Anti-Rad immunoblot of mouse ventricular cardiomyocytes isolated from three mice without and three mice with AAV9-Cas9 subcutaneous injection at P2-P5 days.
[0030] FIGs. 8A-8C - AAV9-Cas9-Rad inactivation increases Ca2+conductance and ejection fraction. (FIG. 8 A) Anti-Rad immunoblot of cardiac cells isolated from mice with different amounts of AAV9-Cas9 subcutaneous injection in pups. (FIG. 8B) Maximal conductance (Gmax) density for C57 without and with 5 XI 013vc / kg AAV9-Cas9-Rad. Oneway ANOVA and Sidak’s MCT, ****, P < 0.0001. (FIG. 8C) Graph of ejection fraction. Mean +SEM — unpaired two-tailed t-test.
[0031] FIGs. 9A and 9B - Glycine substitution of CavP Asp322by adenine base editor in ventricular myocytes. (FIG. 9A) Graph summarizing Kd, EFF for the binding of WT Rad and WT and mutant P2B-subunit. Representative of at least three similar experiments. (FIG. 9B) Example of deep sequencing of genomic DNA from isolated cells from mice injected with the editor demonstrating -50% of the reads with Gly substitution at Asp322and Ala substitution at residue 323.
[0032] FIGs. 10A-10C - AAV9-ABE-CavP editing increases Ca2+conductance, sarcomere contraction, and ejection fraction. (FIG. 10 A) Graph of maximal conductanceAttorney Docket 44010.202WO-PCT / / CU24243density for C57 mice without and with 5 x1013vc / kg AAV9-ABE-CavP. Anova and Sidak’s MCT, ****, P <0.0001. (FIG. 10B) Graph of field-stimulation-induced percentage change in sarcomere contraction. Mean + SEM. Anova and Sidak’s MCT, ****, P <0.0001 (FIG. 10C) Graph of ejection fraction. Mean + SEM.
[0033] FIG. 11 - The AAV9-Cas9-Rad editor does not cause increased fibrosis in C57BL / 6 mice. Three mice were injected with 5 xlO14vc / kg AAV9-Cas9-Rad editor. After 8 months, the mice were euthanized, and their hearts were sectioned and stained with Piero Sirius red / fast green stain. Ten sections were measured per heart at the level of papillary muscles and averaged to represent a single data point. Graph of mean ± SEM. Statistics: nested unpaired t-test.
[0034] FIGs. 12A and 12B - Cardiac function is improved with gene editing of Rad in R141W Tnnt2 mice. (FIG. 12A) Graph of EF in R141W Tnnt2 knock-in mice at 10, 20 and 35 weeks of age. Unpaired two-tailed t-test, ** P < 0.01, *** P <0.001, **** p < 0.0001. (FIG.12B) Survival curves for PBS and AAV9-Cas9-Rad injected mice.
[0035] FIGs. 13A and 13B - Cardiac function is improved with gene deletion of Rad in male H222P Lmna knock-in mice. (FIG. 13 A) Graph of EF; mean + SEM. Unpaired t-test, **** p <o 0001. (FIG. 13B) Survival curve in AAV9-Cas9-Rad edited mice. (N=5 in nontreated group, 3 in treated group).
[0036] FIGs. 14A-14C - Cardiac function is improved with CavP editing in male H222P Lmna knock-in mice. (FIG. 14A) Graph of EF; mean ± SEM. Unpaired t-test, **** P <0.0001, ** P <0.01. (FIGs. 14B and 14C) Histogram of the frequency of cells with the indicated basal Ca2+transient amplitude isolated from WT and Lmna mutant mice injected with AAV9-ABE-CavP-
[0037] FIG. 15 - AAV9-Cas9-Rad inactivation in atrial cardiomyocytes. Anti-Rad immunoblot of mouse atrial and ventricle tissue from mice with 5 xlO14vc / kg AAV9-Cas9-Rad subcutaneous injection at P2-P5 days.
[0038] FIGs. 16A-16D - Gene-editing of Rad in adult mice. Mice were injected with Rad editor at 2 months of age. (FIG. 16 A) Graph of EF in control and AAV9-Cas9-Rad injected mice 2 weeks and 4 weeks post-injection. Mouse #1 and #2 were euthanized at 2 weeks postinjection. Mouse #3 was euthanized at 4 weeks post-injection. (FIG. 16B) Graph of maximal conductance density in cells before and after perfusion of 100 nM isoproterenol. Anova and Sidak’s multiple comparison test, <0.0001. (FIG. 16C) Histogram of frequency of cellsAttorney Docket 44010.202WO-PCT / / CU24243with indicated basal Ca2+transient amplitude. n= 604 cells for no virus; 57 cells for AAV9-Cas9-Rad at 4 weeks post-injection. (FIG. 16D) Graph of field-stimulation-induced percentage change in sarcomere contraction. Mean + SEM. Anova and Sidak’s multiple comparison test, <0.0001.
[0039] FIG. 17 - Rad-CavP interface. Rad-CavP interface with residues (in red) on Rad and P that are base-editable and affect the basal Rad-P interaction, as assessed by FRET. Figure created using alpha-fold.
[0040] FIGs. 18A-18G - Preventing augmented Ca2+influx prevents CPVT -mediated arrhythmias. (FIG. 18 A) Triggered beats and DADs are induced by 10 mM epinephrine in CPVT mice. (FIG. 18B) Graph of number of cells from CPVT and CPVT / homozygous 4SA-Rad mice with DAD / triggered beats. (FIG. 18C) Ca2+transients in CPVT mice before and 1-and 2-minutes post-infusion of epinephrine. (FIG. 18D) Graph of the number of cells with triggered beats. (FIG. 18E) ECG from implanted telemeters. CPVT mice demonstrated bidirectional VT. (FIG. 18F) Graph of the number of mice with ventricular tachycardia defined as >3 beats of consecutive PVC (WT: 10 mice, CPVT / het 4SA-Rad eight mice, CPVT / homo 4SA-Rad eight mice). (FIG. 18G) Graph of the longest run of VT during 1-hour postepinephrine.
[0041] FIGs. 19A and 19B - Identification of adrenergic-agonist insensitive mutant Rad for gene-editing. (FIG. 19A) Graph of FRET analysis of mutant Rad in the absence and presence of forskolin and calyculin. (FIG. 19B) Deep sequencing of genomic Rad in C2C12 cells transfected with CBE and S300F guide.
[0042] FIG. 20 - Antisense oligonucleotide (ASO) in silico results.
[0043] FIG. 21 - Antisense oligonucleotide (ASO) in vitro screening results (Dualluciferase assay test twice).
[0044] FIG. 22 - Antisense oligonucleotide (ASO) western blot results. Experiment: cotransfection of VmRadWT (0.5 pg) and ASO (40 pmol); 48h incubation; performed Bradford assay loaded same amount of protein.
[0045] FIGs. 23A-23J - In vivo CRISPR-based genome editing ameliorates cardiomyopathy and improves survival in multiple mouse models. (FIG. 23A) Schematic of experimental design and representative immunoblot showing cardiac protein expression in Tnnt2R141W / R141Wmice treated with PBS or AAV9-Cas9-Rad. Cardiomyocyte lysates at 4-months of age were analyzed by anti-Rad immunoblotting. (FIG. 23B) Kaplan-Meier survivalAttorney Docket 44010.202WO-PCT / / CU24243curves of Tnnt2R141W / R141Wmice following treatment with PBS or AAV9-Cas9-Rad. Statistical significance was determined by log-rank test. **** P < 0.0001. (FIG. 23C) Left ventricular (LV) ejection fraction measured by echocardiography at the indicated time points after treatment in Tnnt2R141W / R141Wmice. Data are shown as mean ± SEM Ejection fraction was analyzed using a repeated-measures linear mixed-effects model with Tukey-adjusted post-hoc comparisons. (FIG. 23D) Representative ECG implantable telemetry tracings from PBS- and AAV9-Cas9-Rad-treated Tnnt2R141W / R141Wmice, showing premature ventricular complexes (PVCs), ventricular tachycardia (VT), and bigeminy. Scale bar, 100 ms. (FIG. 23E) Quantification of arrhythmic events (bigeminy and VT) in treated Tnnt2R141W / R141Wmice. Bars indicate mean ± SEM; two-tailed unpaired t-test. (FIG. 23F) Experimental schematic and representative anti-Rad immunoblot of cardiomyocyte lysates from 4-month-old mnct,,222l‘ / H222Pmice treated with PBS or AAV9-Cas9-Rad. (FIG. 23 G) Kaplan-Meier survival analysis of LmnaH222P / H222Pmice following treatment. Statistical significance was determined by log-rank test. (FIG. 23H) Serial assessment of LV ejection fraction in LmnaH222P / H222Pmice after treatment. Data are shown as mean ± SEM; Ejection fraction was analyzed using a repeated-measures linear mixed-effects model with Tukey-adjusted post-hoc comparisons. (FIG. 231) Kaplan-Meier survival curves of transgenic (Tg) Acsll mice treated with PBS or AAV9-Cas9-Rad. Statistical significance was determined by log-rank test. (FIG. 23J) LV ejection fraction over time in Tg Acsll mice following treatment. Data are shown as mean ± SEM; Ejection fraction was analyzed using a repeated-measures linear mixed-effects model with Tukey-adjusted post-hoc comparisons. For all panels, P values are denoted as follows: P < 0.05 (*), P < 0.01 (**), P < 0.001 (***), and P < 0.0001 (****).
[0046] FIGs. 24A-24N - AAV9-Cas9-Rad restores cardiomyocyte function and reduces pathological remodeling. (FIGs. 24A-24C) Representative barium current elicited by voltage ramp from -60 mV to +30 mV, with black traces obtained before and blue traces after isoproterenol in isolated 4-month-old ventricular cardiomyocytes. (FIG. 24A) WT 129S1 control myocytes. (FIG. 24B) I HHU"2222 / H222Pmyocytes treated with PBS. (FIG. 24C) mnct,,222l‘ / H222Pmyocytes treated with AAV9-Cas9-Rad. (FIG. 24D) Basal conductance in WT, Tnnt2R141W / R141W, and miian222l‘m22Vcardiomyocytes treated with PBS or AAV9-Cas9-Rad. Bars represent mean ± SEM Two-tailed unpaired t-test. (FIG. 24E) Cardiomyocytes from PBS or AAV9-Cas9-Rad treated Lm ncP2222 / H222Pmice were loaded with Fura2-AM and subsequently field stimulated at 1 Hz. Fluorescence was acquired for 10 s before and afterAttorney Docket 44010.202WO-PCT / / CU24243superfusion of 100 nM isoproterenol (Iso). (FIG. 24F) Quantification of basal calcium transient amplitude in WT, Tnnt2R141W / R141W, and mnct,,222l‘2222cardiomyocytes treated with PBS or AAV9-Cas9-Rad. Data are mean ± SEM; Two-tailed unpaired t-test. (FIGs. 24G-24I) Representative sarcomere length tracings from (FIG. 24G) WT 129S1, (FIG. 24H) PBS-treated miian222l‘m22V, and (FIG. 241) AAV9-Cas9-Rad-treated mna"222l‘ / H222Pcardiomyocytes under basal conditions and after Iso stimulation. (FIG. 24J) Quantification of basal sarcomere contraction (%) in WT, Tnnt2R141W / R141W, and 1.rnntr2222 / H222Pcardiomyocytes treated with PBS or AAV9-Cas9-Rad. Data are mean ± SEM; Two-tailed unpaired t-test. (FIG. 24K) Representative immunoblots of cardiomyocyte lysates from 4-month-old Zm2222 / H222Pmice treated with PBS or AAV9-Cas9-Rad, probed for anti-Myh7 and Nppa (ANP). (FIG. 24L) Densitometric quantification of Myh7 and Nppa (ANP) protein expression normalized to PBS-treated controls. Data are mean ± SEM; Two-tailed unpaired t-test. (FIG. 24M) Representative Masson’s trichrome staining of transverse heart sections from WT 129S1 and Zm2222 / H222Pmice treated with PBS or AAV9-Cas9-Rad. (FIG. 24N) Quantification of myocardial fibrosis (%) in WT and Zm2222 / H222Pmice following treatment. Data are mean ± SEM; Two-tailed unpaired t-test.
[0047] FIGs. 25A-25M - Postnatal AAV9-Cas9-Rad delivery improves survival and cardiac function in genetic and ischemic cardiomyopathy models. (FIG. 25A) Experimental design for treatment of I micr2222 m22Vmice. Animals were evaluated by echocardiography at ~3.5 months of age (EF 35-50%) and received retro-orbital injection of PBS or AAV9-Cas9-Rad, with follow-up analyses at 4-6 months. (FIG. 25B) Kaplan-Meier survival curves of / w / tf2222 112221’ mice treated with PBS or AAV9-Cas9-Rad. Statistical significance was determined by log-rank test. (FIG. 25C) Representative M-mode echocardiograms from PBS-and AAV9-Cas9-Rad treated LmnaH222P2W2222?mice. (FIG. 25D) Left ventricular ejection fraction (EF) measured by serial echocardiography before injection and at the indicated ages. Bars represent mean ± SEM n.s., not significant. (FIG. 25E) Experimental design for myocardial infarction (MI) studies. C57BL / 6 mice underwent left anterior descending (LAD) coronary artery ligation and were assessed by echocardiography 2-4 weeks later (EF <40%), followed by retro-orbital injection of PBS or AAV9-Cas9-Rad and longitudinal assessment up to 12 weeks post-injection. (FIG. 25F) Representative M-mode echocardiograms from MI mice pre- and post-injection with PBS or AAV9-Cas9-Rad. (FIG. 25G) Quantification of EF in MI mice before injection and at 2, 4, 8, and 12 weeks post-injection. Lines indicate mean ± SEMAttorney Docket 44010.202WO-PCT / / CU24243(FIG. 25H) Representative barium current elicited by voltage ramp from -60 mV to +30 mV, with black traces obtained before and blue traces after isoproterenol from ventricular cardiomyocytes isolated 12 weeks post-injection from MI mice treated with PBS or AAV9-Cas9-Rad. (FIG. 251) Basal conductance in cardiomyocytes from MI mice treated with PBS or AAV9-Cas9-Rad. (FIG. 25J) Isoproterenol (Iso)-induced fold change in conductance in cardiomyocytes from MI mice. (FIG. 25K) Representative calcium transient traces under basal conditions and following Iso stimulation in cardiomyocytes from PBS- or AAV9-Cas9-Rad-treated MI mice. (FIG. 25L) Quantification of basal calcium transient amplitude. (FIG. 25M) Iso-induced fold change in calcium transient amplitude.
[0048] FIGs. 26A-26C - Isoproterenol-induced cardiac dysfunction assessed by echocardiography. (FIG. 26A) Experimental timeline. Mice were subjected to chronic isoproterenol administration via osmotic pump for 28 days, followed by echocardiographic assessment 1 day after completion of treatment. (FIG. 26B) Representative M-mode echocardiographic images obtained before (pre-Iso) and after (post-iso) isoproterenol treatment. Post-Iso images show increased left ventricular internal dimensions and reduced systolic wall thickening compared with Pre-Iso. (FIG. 26C) Quantification of left ventricular (LV) ejection fraction (%) before and after isoproterenol treatment. Each dot represents an individual animal; horizontal lines indicate mean ± SEM. Statistical significance was determined by paired two-tailed Student’s t-test; P < 0.01.
[0049] FIGs. 27A-27H - AAV9-Cas9-mediated genome editing of Rad preserves cardiomyocyte function. (FIG. 27 A) Predicted structure of Rad protein showing the G-domain (blue) and C-terminal region. Serine residues targeted for mutagenesis are indicated (Ser25, Ser39, Ser272, Ser300). The engineered frameshift region is highlighted. (FIG. 27B) Target locus and editing outcomes. Schematic of sgRNA target sequence and protospacer adjacent motif (PAM) with predicted Cas9 cleavage site (dashed line). Amplicon sequencing of genomic DNA from treated hearts shows insertions (red boxes), deletions (dashes), and substitutions (bold), with frequencies and read counts indicated. (FIG. 27C) AAV9-Cas9-Rad or PBS control treatment was delivered via subcutaneous injection in pups. Representative immunoblots show Rad protein expression in atrial and ventricular tissue following PBS or AAV9-Cas9-Rad administration. (FIG. 27D) Dose-dependent reduction of Rad protein following systemic delivery of increasing AAV9-Cas9-Rad viral titers (×1013viral genomes / kg). (FIG. 27E) L-type CaV1.2 current density (conductance, nS / pF) in isolated cardiomyocytes under basal (Iso-Attorney Docket 44010.202WO-PCT / / CU24243) and isoproterenol-stimulated (Iso+) conditions from no-virus (PBS) and AAV9-Cas9-Rad-treated mice (5 × 1013vg / kg). Lines denote mean ± SEM. (FIG. 27F) Left ventricular ejection fraction (%) in no-virus and AAV9-Cas9-Rad-treated mice at indicated viral doses. (FIG. 27G) Cardiomyocyte CaV1.2 current density (conductance, nS / pF) in adult mice treated with AAV9-Cas9-Rad under basal and isoproterenol-stimulated conditions. (FIG. 27H) Sarcomere shortening (fractional contraction, %) in isolated cardiomyocytes from PBS and AAV9-Cas9-Rad-treated mice with or without isoproterenol stimulation.
[0050] FIGs. 28A-28G - AAV9-Cas9-Rad improves cardiac function and survival in genetic cardiomyopathy models. (FIG. 28A) Representative M-mode echocardiograms from Tnnt2R141W / R141Wmice at 10 and 20 weeks of age following treatment with PBS or AAV9-Cas9-Rad. Progressive left ventricular dilation and systolic dysfunction in PBS-treated mice are attenuated in AAV9-Cas9-Rad-treated littermates. (FIG. 28B) Representative M-mode echocardiogram from WT 129S1 control mice. (FIG. 28C) Representative M-mode echocardiograms from LmnaH222P / H222P mice treated with PBS or AAV9-Cas9-Rad, showing improved systolic performance with gene editing therapy. (FIG. 28D) Kaplan-Meier survival analysis of female LmnaH222P / H222Pmice treated with PBS or AAV9-Cas9-Rad. Statistical analyses were performed using log-rank (Mantel-Cox) test. ***P < 0.0001. (FIG. 28E) Longitudinal assessment of left ventricular (LV) ejection fraction (%) in female LmnaH222P / H222Pmice from 2-10 months of age following PBS or AAV9-Cas9-Rad treatment. Lines denote mean ± SEM. Ejection fraction was analyzed using a repeated-measures linear mixed-effects model with Tukey-adjusted post-hoc comparisons. ***P < 0.0001. (FIG. 28F) LV ejection fraction (%) in LmnaH222P / H222Pmice treated with N- or C-terminal single AAV9-Cas9-Rad vectors compared with dual AAV9-Cas9-Rad delivery. Dual-vector treatment restores systolic function relative to single-vector approaches. (FIG. 28G) Representative M-mode echocardiograms from WT FVB / N littermates and transgenic Acsll mice treated with PBS or AAV9-Cas9-Rad. AAV9-Cas9-Rad improves systolic performance in Tg Acsll mice compared with PBS-treated controls.
[0051] FIGs. 29A-29O - AAV9-Cas9-Rad editing attenuates P-adrenergic hyperresponsiveness and normalizes calcium handling and contractility in Tnnt2R141W / R141Wand LmnaH222P / H222Pcardiomyocytes. (FIGs. 29A and 29B) Representative whole-cell voltageclamp recordings of CavL2 current from Tnnt2R141W / R141Wcardiomyocytes treated with PBS (FIG. 29A) or AAV9-Cas9-Rad (FIG. 29B). Traces show currents before (black) and duringAttorney Docket 44010.202WO-PCT / / CU24243isoproterenol (Iso; blue) stimulation. (FIG. 29C) Quantification of Iso-induced fold-change in current in WT (129S1), Tnnt2R141W / R141W, and LmnaH222P / H222Pcardiomyocytes following PBS or AAV9-Cas9-Rad treatment. Lines denote mean ± SEM (FIG. 29D) V50 under basal and Iso conditions across genotypes and treatments. (FIG. 29E) Relationship between basal calcium transient amplitude (AFO) and Iso-induced fold-change in WT (129S1) cardiomyocytes. Insets show representative calcium transients at baseline and with Iso. (FIGs. 29F and 29G) Basal calcium transient amplitude versus Iso-induced fold-change in Tnnt2R141W / R141W(FIG. 29F) and mnct,,222l‘ / H222P(FIG. 29G) cardiomyocytes treated with PBS or AAV9-Cas9-Rad. Insets: representative traces. (FIG. 29H) Summary of Iso-induced fold-change in calcium transient amplitude across genotypes and treatments. (FIGs. 29I-29K) Representative sarcomere length recordings before and after isoproterenol during electrical pacing in WT (FIG. 291), PBS-treated Tnnt2R141W / R141Wcardiomyocytes (FIG. 29J), and AAV9-Cas9-Rad-treated Tnnt2R141W / R141Wcardiomyocytes (FIG. 29K). (FIGs. 29L-29N) Basal sarcomere shortening (percent contraction) versus Iso-induced fold-change in WT (L), Tnnt2R141W / R141Wmice (FIG.29M), and Lmiia"222l‘222V(FIG. 29N) cardiomyocytes with PBS or AAV9-Cas9-Rad treatment. (FIG. 290) Sarcomere contraction in the absence and presence of isoproterenol across genotypes and treatments. Collectively, AAV9-Cas9-Rad treatment increased basal contraction in Tnnt2R141W / R141Wand LmnaH222P / H222Pcardiomyocytes. Statistical comparisons were performed using two-way ANOVA with post hoc multiple-comparison testing; significance is indicated in panels.
[0052] FIGs. 30A-30I - Transcriptomic and proteomic remodeling after AAV9-Cas9-Rad treatment. (FIG. 30A) Volcano plot of differential gene expression (RNA-seq) comparing AAV9-Cas9-Rad-treated versus PBS-treated hearts, x-axis, log2 fold-change; y-axis, -loglO adjusted P value. Selected differentially expressed genes are labeled. (FIG. 30B) Heat map of representative differentially expressed genes in AAV9-Cas9-Rad and PBS groups. Color scale indicates log2 fold-change (red, upregulated; blue, downregulated relative to PBS). (FIG. 30C) Gene ontology (GO) enrichment analysis of differentially expressed genes highlighting significantly enriched pathways, including membrane components, ion transport, sarcomere, contractile fiber, and regulation of phosphatase activity. Fold enrichment and enrichment FDR values are shown. (FIG. 30D) Volcano plot of differential protein abundance determined by quantitative mass spectrometry comparing AAV9-Cas9-Rad and PBS-treated hearts. Axes as in (FIG. 30A); selected proteins are annotated. (FIG. 30E) GO enrichment analysis ofAttorney Docket 44010.202WO-PCT / / CU24243differentially abundant proteins showing overrepresentation of terms related to striated muscle contraction, actin filament organization, muscle structure morphogenesis, and contractile fiber components. P values, adjusted P values (pCorr), and hit counts are indicated. (FIG. 30F) Integrated transcriptomic-proteomic analysis showing correlation between RNA-seq and mass spectrometry log2 fold-changes for shared targets. Selected concordantly regulated genes / proteins are labeled. (FIG. 30G) Estimated gene counts for Myh7 and Nppa derived from bulk RNA-seq in WT (129S1) and LmnaH222P / H222Phearts treated with PBS or AAV9-Cas9-Rad. (FIG. 30H) Estimated gene counts (kallisto) for extracellular matrix and fibrosis-associated genes (Postn, Col lai, Colla2, Col3al) across genotypes and treatments. Statistical significance is indicated (P values; ns, not significant). (FIG. 301) Quantification of corresponding protein abundance (*103counts) for Postn, Collal, Colla2, and Col3al measured by mass spectrometry.
[0053] FIGs. 31A and 31B - Targeted deep sequencing demonstrates efficient on-target and minimal off-target editing of Rrad in vivo and in human cells. (FIG. 31 A) RhAmpSeq analysis of candidate on- and off-target loci in mouse hearts following AAV9-Cas9-Rad treatment. Percent sequencing reads with insertions / deletions (indels) are shown for untreated (light blue) and treated (red) samples at the on-target Rrad locus, and for predicted off-target (OT) sites in untreated (dark blue) and treated (dark red) samples. Robust editing was detected selectively at the intended Rrad target site in treated animals, with negligible indel frequencies at predicted off-target loci. Each point represents an individual biological replicate; bars denote mean ± SEM (FIG. 31B) RhAmpSeq analysis of on- and predicted off-target loci in human cells following AAV9-Cas9-Rad editing. Percent indels are plotted as in (FIG. 31 A). Efficient editing was observed at the human RRAD on-target site in treated cells, whereas indel frequencies at predicted off-target loci remained at background levels comparable to untreated controls.
[0054] FIGs. 32A-32D - AAV9-Cas9-Rad preserves cardiac function following MI. (FIG.32A) Fold-change in ejection fraction (EF) relative to pre-injection baseline in PBS- and AAV9-Cas9-Rad-treated LmnaH222P / H222Pmice at 4, 4.5, 5, and 6 months of age. PBS- and AAV9-Cas9-Rad were retroorbitally injected in 3.5 months old mice. (FIG. 32B) Absolute change in EF compared to pre-injection values at the same time points. (FIG. 32C) Fold-change in EF at 2, 4, 8, and 12 weeks after myocardial infarction (MI). (FIG. 32D) Sensitivity analysis showing absolute EF (%) before injection and at 2, 4, 8, and 12 weeks post-MI. Dotted linesAttorney Docket 44010.202WO-PCT / / CU24243indicate baseline (pre-injection) values. Lines indicate mean ± SEM. Statistical analysis was performed using a linear mixed-effects model with Satterthwaite-adjusted degrees of freedom and Tukey correction for multiple comparisons. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001.
[0055] FIGs. 33A-33I - Epinephrine-induced stimulation of CaV1.2 current and Ca2+transient requires phosphorylation of Rad in ventricular cardiomyocytes. (FIG. 33A) Ba2+current elicited by voltage ramp every 3 seconds, with black traces obtained before and blue traces obtained after 10 pM epinephrine in R2474S, R2474S / heterozygous 4SA-Rad, and R2474S / homozygous 4SA-Rad ventricular myocytes. (FIG. 33B) Fold-change at -20 mV in peak current caused by epinephrine (Epi). Mean + SEM. The dashed line is the mean fold change for WT C57 mice. P <0.01, nested one-way ANOVA; **P <0.01 by Sidak’s multiple comparison test, ns = not significant (P >0.05). R2474S, 15 cells, 3 mice; R2474S / heterozygous 4SA-Rad, 19 cells, 3 mice; R2474S / homozygous 4SA-Rad, 20 cells, 4 mice. (FIG. 33C) Boltzmann function parameter, V50, before and after epinephrine. Dashed black and blue lines are mean V50in the absence and presence of 10 pM epinephrine, respectively, for WT C57 cells. Nested two-tailed t-test, *P <0.05. Same sample size as (FIG.33B). (FIGs. 33D and 33E) Cardiomyocytes from R2474S and R2474S / homozygous 4SA-Rad were loaded with Fura2-AM and subsequently field stimulated at 1-Hz. Fluorescence was acquired for 10 seconds before and after superfusion with 100 nM epinephrine. (FIGs. 33F and 33G) Graph of epinephrine-induced fold-change of Ca2+transient amplitude vs. basal amplitude in R2474S (FIG. 33F) and R2474S / homozygous 4SA-Rad ventricular myocytes. N = 107 cells from 3 R2474S mice; N = 127 cells from 3 R2474S / homozygous 4SA-Rad mice. (FIG. 33H) Graph of epinephrine-induced fold-change in amplitude of Ca2+transient. Mean + SEM. Nested unpaired two-tailed t-test. *** P < 0.001. (FIG. 331) Amplitude of basal Ca2+transient for ventricular cardiomyocytes. Mean + SEM — nested unpaired two-tailed t-test.
[0056] FIGs. 34A-34H - Adrenergic signaling pathways are fully functional in R2474S-RyR2 / 4SA-Rad mice. (FIG. 34A) A model illustrating the phosphorylation targets of P-adrenergic agonist stimulation in cardiomyocytes. The schematic was created using Biorender.com. (FIG. 34B) A graph depicting the time constant of Ca2+transient relaxation in R2474S and R2474S / homozygous 4SA-Rad ventricular myocytes. Mean ± SEM. Nested unpaired two-tailed t-test. * P < 0.05, ** P < 0.01. (FIG. 34C) Immunoblots of protein lysates from cardiomyocytes showing anti-phospho-phospholamban (P-PLB) antibody (upper) andAttorney Docket 44010.202WO-PCT / / CU24243anti-β-actin antibody (lower). (FIG. 34D) A graph showing the epinephrine-induced fold change of P-PLB density normalized to P-actin density. Unpaired, two-tailed test. P > 0.05. (FIG. 34E) The same as in (FIG. 34C) except with anti-phospho-S2808 RyR2 antibody (upper) and anti-RyR2 antibody (lower) immunoblots. (FIG. 34F) The same as (FIG. 34D) but represents the graph of epinephrine-induced fold change of P-RyR2 density normalized to RyR2 density. (FIG. 34G) The same as in (FIG. 34C) but for the anti-S23 / S24 troponin I (Tnl) antibody (upper) and anti-Tnl antibody (lower) immunoblots. (FIG. 34H) A graph of epinephrine-induced fold change of P-Tnl density normalized to Tnl density.
[0057] FIGs. 35A-35F - Preventing Rad phosphorylation attenuates triggered activity. (FIGs. 35 A and 35B) Action potentials of isolated ventricular myocytes from R2474S-RyR2 and R2474S-RyR2 / homozygous 4SA-Rad mice were stimulated at 3 Hz at 33°C before and one minute after the superfusion of 30 nM isoproterenol or 100 nM epinephrine. (FIG. 35C) Graph showing the number of cells with triggered beats. N = 29 R2474S-RyR2 cells from 6 mice; N = 28 R2474S-RyR2 / homozygous 4SA-Rad cells from 5 mice **** P < 0.0001 by two-sided Fisher’s exact test. (FIG. 35D) Ca2+transients induced by electrical stimulation at 2 Hz and 33°C before and one minute after 10 pM epinephrine in R2474S cardiomyocytes. (FIG.35E) Graph of the number of cells with triggered beats after epinephrine infusion. Het= heterozygous, homo= homozygous. **** P < 0.0001 by two-sided Fisher’s exact test. (FIG.35F) The percentage of cells per mouse with triggered beats. Mean + SEM. P < 0.01 by oneway ANOVA; ** P < 0.01, * P < 0.05 by Sidak’s multiple comparison test.
[0058] FIGs. 36A-36E - Preventing Rad phosphorylation reduces epinephrine-induced arrhythmogenesis in CPVT mice. (FIGs. 36A and 36B) ECG examples were recorded using implantable telemeters in R2474S and R2474S / homozygous 4SA-Rad mice within 1 hour of intraperitoneal epinephrine injection. (FIG. 36C) A diary plot shows the number of VT episodes in 10-minute intervals for 6 out of 10 mice with VT. (FIG. 36D) Another diary plot displays the number of VT events during the 24 hours following epinephrine injection. The color coding is consistent with panel C. (FIG. 36E) A graph illustrates the percentage of mice with VT in the 30 minutes prior to the epinephrine injection, within 1 hour post-injection, between 1 and 24 hours post-injection, and across all time periods combined. **** P < 0.0001 by two-sided Fisher’s exact test. (FIG. 36F) A graph depicts the longest VT episode during the first hour following the epinephrine injection. P < 0.01 by one-way ANOVA, ** P < 0.01 by Sidak’s multiple comparison test.Attorney Docket 44010.202WO-PCT / / CU24243
[0059] FIGs. 37A-37E - Preventing Rad phosphorylation attenuates spontaneous arrhythmogenesis in CPVT mice. (FIGs. 37A and 37B) The number of spontaneous ventricular tachycardia (FIG. 37A) and ventricular bigeminy events (FIG. 37B) observed over 24 hours in a representative R2474S-RyR2 mouse. (FIG. 37C) Graph showing the percentage of mice with and without ventricular tachycardia or ventricular bigeminy over 24 hours. **** P < 0.0001 as determined by a two-sided Fisher’s exact test. (FIG. 37D) Graph displaying the number of arrhythmic episodes per mouse. ** P < 0.01 by the Mann-Whitney test. (FIG. 37E) We used the Animal Locomotion Index Smoothed to capture the activity of four R2474S and four R2474S / homozygous 4SA-Rad mice in the cage. This was aggregated for the light and dark phases-lower graph: Cumulative locomotion index for the six day / night cycles.
[0060] The figures herein are for illustrative purposes only and are not necessarily drawn to scale.DETAILED DESCRIPTION OF THE EXAMPLE EMBODIMENTSGeneral Definitions
[0061] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. Definitions of common terms and techniques in molecular biology may be found in Molecular Cloning: A Laboratory Manual, 2ndedition (1989) (Sambrook, Fritsch, and Maniatis); Molecular Cloning: A Laboratory Manual, 4thedition (2012) (Green and Sambrook); Current Protocols in Molecular Biology (1987) (F. M. Ausubel et al. eds.); the series Methods in Enzymology (Academic Press, Inc.): PCR 2: A Practical Approach (1995) (M. J. MacPherson, B. D. Hames, and G. R. Taylor eds.): Antibodies, A Laboratory Manual (1988) (Harlow and Lane, eds.): Antibodies A Laboratory Manual, 2ndedition 2013 (E. A. Greenfield ed.); Animal Cell Culture (1987) (R. I. Freshney, ed.); Benjamin Lewin, Genes IX, published by Jones and Bartlet, 2008 (ISBN 0763752223); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0632021829); Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 9780471185710); Singleton etal., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York, N. Y. 1994), March, Advanced Organic Chemistry Reactions,Attorney Docket 44010.202WO-PCT / / CU24243Mechanisms and Structure 4th ed., John Wiley & Sons (New York, N. Y. 1992); and Marten H. Hofker and Jan van Deursen, Transgenic Mouse Methods and Protocols, 2ndedition (2011).
[0062] As used herein, the singular forms “a”, “an”, and “the” include both singular and plural referents unless the context clearly dictates otherwise.
[0063] The term “optional” or “optionally” means that the subsequent described event, circumstance or substituent may or may not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.
[0064] The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges, as well as the recited endpoints.
[0065] The terms “about” or “approximately” as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, are meant to encompass variations of and from the specified value, such as variations of ±10% or less, ±5% or less, ±1% or less, and ±0.1% or less of and from the specified value, insofar such variations are appropriate to perform in the disclosed invention. It is to be understood that the value to which the modifier “about” or “approximately” refers is itself also specifically, and preferably, disclosed.
[0066] The terms “subject,” “individual,” and “patient” are used interchangeably herein to refer to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets. Tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro are also encompassed.
[0067] Various embodiments are described hereinafter. It should be noted that the specific embodiments are not intended as an exhaustive description or as a limitation to the broader aspects discussed herein. One aspect described in conjunction with a particular embodiment is not necessarily limited to that embodiment and can be practiced with any other embodiment s). Reference throughout this specification to “one embodiment”, “an embodiment,” “an example embodiment,” means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases “in one embodiment,” “in an embodiment,” or “an example embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment, but may. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to a personAttorney Docket 44010.202WO-PCT / / CU24243skilled in the art from this disclosure, in one or more embodiments. Furthermore, while some embodiments described herein include some but not other features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the invention. For example, in the appended claims, any of the claimed embodiments can be used in any combination.
[0068] Reference is made to US patent application 17 / 624,497 entitled “Novel approach for increasing contractility in patients with systolic heart failure,” and published as US patent application publication US20220397567A1.
[0069] All publications, published patent documents, and patent applications cited herein are hereby incorporated by reference to the same extent as though each individual publication, published patent document, or patent application was specifically and individually indicated as being incorporated by reference.Overview
[0070] Embodiments disclosed herein provide methods of treating or preventing of cardiac diseases, such as heart failure or arrhythmias, by modulating Rad binding to voltage-gated calcium channels in cardiomyocytes. The present invention provides proof of principle allowing innovative methodologies to identify and test novel targets for precise and effective arrhythmia and heart failure (HF) therapies.
[0071] In patients with heart failure (HF), the continual activation of the sympathetic nervous system, which compensates for lower cardiac output, harms the heart. This not only worsens HF but also increases the risk of life-threatening arrhythmias. Although P-adrenergic receptor agonists and phosphodiesterase (PDE) inhibitors were commonplace, seminal studies revealed reduced survival. P-adrenergic receptor agonists and PDE inhibitors are still utilized, although their use is limited by the need for intravenous administration and close monitoring due to potential arrhythmias. A notable gap exists in the understanding and treatment approaches for the short- and long-term management of HF, particularly regarding the safe, direct targeting of myocyte contractility by enhancing calcium influx and transient levels. The long-term aim is to deploy innovative strategies to identify and evaluate targets for targeted therapies for arrhythmias and HF. Over the last five years, Applicants have uncovered the mechanisms behind the adrenergic regulation of cardiac calcium channels. Recently, Applicants identified how the sympathetic nervous system regulates Ca2+influx in the heart.1Attorney Docket 44010.202WO-PCT / / CU24243Applicants discovered that the RGK G-protein Rad, which inhibits high-voltage activated calcium channels, is a crucial PKA target within the CaV1.2 complex.
[0072] The Ca2+channel inhibitor Rad2'5is enriched near CaV1.2 in cardiomyocytes. Upon exposure to a P-adrenergic agonist, protein kinase A (PKA) phosphorylates Rad, which releases this inhibition.1Disinhibition of Ca2+channels equates to augmented Ca2+influx, sufficient to enhance contractility.6Expression of Ca2+channel P-subunits in mice that cannot bind Rad due to mutations at the Rad-P binding interface is sufficient to enhance basal Ca2+influx and contractility to nearly augmented levels seen in WT mice with adrenergic activation without detrimental effects.6
[0073] Inotropic drugs increase cardiac contractility by activating PKA signaling pathways to increase Ca2+influx via Rad phosphorylation, increase Ca2+release via ryanodine receptor (RyR2) phosphorylation, and increase sarcoplasmic reticulum (SR) Ca2+reuptake via phospholamban (PLB) phosphorylation. Applicants proposed that enhancing Ca2+influx similarly to adrenergic stimulation- which Applicants term “Rad-otropy”- is more precise and efficacious than standard approaches because it avoids adrenergic agonist-induced SR Ca2+leak and overload, which are detrimental.
[0074] PKA phosphorylation at two Ser residues on Rad's C-terminus causes Rad to detach from the membrane, decreasing its affinity for CavP and relieving CaV1.2 inhibition. Unlike the pro-arrhythmic effects seen with the inotropic drug BayK 8644, which increases calcium influx by slowing the inactivation properties of CaV1.2, up-regulating calcium influx through the expression of a Cavβ₂ B subunit that does not interact with Rad does not appear to have any detrimental effects or induce arrhythmias. These results challenge the prevailing belief that all increased calcium influx is harmful or that all animal models featuring elevated calcium influx can inevitably suffer from HF or arrhythmias. Enhancing calcium influx, like adrenergic stimulation, may be more precise and effective than traditional methods, as it avoids harmful SR calcium leak and overload associated with adrenergic agonists.
[0075] To create specific “Rad-otropes”, Applicants have developed gene and base editors that introduce in cardiomyocytes either a frameshift insertion / deletion (indel) in Rad or a mutation in the Ca2+channel P-subunit (Cavβ₂) that prevents Rad binding in cardiomyocytes. The editors are delivered via AAV9 injection subcutaneously in pups or retro-orbitally in adult mice.Attorney Docket 44010.202WO-PCT / / CU24243
[0076] Additionally, Applicants have devised a base-editing strategy to significantly reduce adrenergic regulation of calcium (Ca2+) channels without affecting, sparing, the basal function / regulation of CaV1.2 channels. This strategy can help prevent arrhythmias induced by adrenergic agonists.
[0077] In some aspects, long-term augmentation of Ca2+influx can attenuate the development of HF or reverse it once established. The example gene editors provide powerful proof of principle for these hypotheses that challenge well-established dogma. The example gene editors provide powerful proof of principle for Rad targeting therapeutics.
[0078] Enhancing calcium influx through Rad or Cavβ₂ gene editing slows the decline of cardiac function in non-ischemic HF models. Increasing calcium influx restores cardiac function after HF onset. Restricting the sympathetic nervous system’s enhancement of Ca2+influx attenuates the cardiac dysfunctions associated with catecholaminergic polymorphic VT (CPVT) and hypertrophic cardiomyopathy (HCM).Terminology and Definitions
[0079] The terms “subject,” “individual,” and “patient” are used interchangeably herein to refer to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets. Tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro are also encompassed.
[0080] The terms “condition,” “disease,” and “disorder” are used interchangeably.
[0081] As used herein, “treatment” or “treating,” or “palliating” or “ameliorating” are used interchangeably. These terms refer to an approach for obtaining beneficial or desired results including but not limited to a therapeutic benefit and / or a prophylactic benefit. By therapeutic benefit is meant any therapeutically relevant improvement in or effect on one or more diseases, conditions, or symptoms under treatment. For prophylactic benefit, the compositions may be administered to a subject at risk of developing a particular disease, condition, or symptom, or to a subject reporting one or more of the physiological symptoms of a disease, even though the disease, condition, or symptom may not have yet been manifested. As used herein “treating” includes ameliorating, curing, preventing it from becoming worse, slowing the rate of progression, or preventing the disorder from re-occurring (i.e., to prevent a relapse).
[0082] The term “effective amount” or “therapeutically effective amount” refers to the amount of an agent that is sufficient to effect beneficial or desired results. The therapeuticallyAttorney Docket 44010.202WO-PCT / / CU24243effective amount may vary depending upon one or more of: the subject and disease condition being treated, the weight and age of the subject, the severity of the disease condition, the manner of administration and the like, which can readily be determined by one of ordinary skill in the art. The term also applies to a dose that will provide an image for detection by any one of the imaging methods described herein. The specific dose may vary depending on one or more of: the particular agent chosen, the dosing regimen to be followed, whether it is administered in combination with other compounds, timing of administration, the tissue to be imaged, and the physical delivery system in which it is carried.
[0083] A “pharmaceutical composition” refers to a composition that usually contains an excipient, such as a pharmaceutically acceptable carrier that is conventional in the art and that is suitable for administration to cells or to a subject.
[0084] A “control” condition or sample refers to a sample that serves as a reference, usually a known reference, for comparison to a test condition or sample. For example, a test sample can represent a patient sample, while a control can represent a sample from an individual known to have a disorder, or from an individual that is known to not have the disorder. In another example, a test sample can be taken from a test condition, e.g., in the presence of a test compound, and compared to samples from known conditions, e.g., in the absence of the test compound (negative control), or in the presence of a known compound (positive control). A control can also represent an average value gathered from a number of tests or results. One of skill in the art will recognize that controls can be designed for assessment of any number of parameters. For example, a control can be devised to compare therapeutic benefit based on pharmacological data (e.g., half-life) or therapeutic measures (e.g., comparison of benefit and / or side effects). One of skill in the art will understand which controls are valuable in a given situation and be able to analyze data based on comparisons to control values. Controls are also valuable for determining the significance of data. For example, if values for a given parameter are widely variant in controls, variation in test samples will not be considered as significant.
[0085] As used herein, the term “heart failure” or “congestive heart failure (CHF)” is a diseased condition in which the heart fails to function efficiently as a pump to provide sufficient blood flow and / or pressure to fulfill the normal circulatory needs of a patient.
[0086] As used herein, the term “arrhythmias”, also known as cardiac arrhythmias, are irregularities in the heartbeat, including when it is too fast or too slow.Attorney Docket 44010.202WO-PCT / / CU24243
[0087] As used herein, the term “Rad” refers to the RRAD gene (also known as, RRAD; Ras Related Glycolysis Inhibitor and Calcium Channel Regulator; RAD; REM3; Ras Related Glycolysis Inhibitor And Calcium Channel Regulator; Ras-Related Associated With Diabetes; Ras Associated With Diabetes; GTP-Binding Protein RAD; RAD1; RAS (RAD And GEM) Like GTP Binding 3). Rad is a member of the RGK family of GTP-binding proteins, is an inhibitor of voltage-gated Ca2+channels and is also a PKA target. Rad may regulate basal voltage-dependent L-type Ca(2+) currents and be required for beta-adrenergic augmentation of Ca(2+) influx in cardiomyocytes, thereby regulating increases in heart rate and contractile force. Rad may play an important role in cardiac anti arrhythmia via the strong suppression of voltage-gated L-type Ca(2+) currents. Rad regulates voltage-dependent L-type calcium channel subunit alpha-lC trafficking to the cell membrane. External Ids for RRAD Gene: HGNC: 10446; NCBI Gene: 6236; Ensembl: ENSG00000166592; OMIM®: 179503; and UniProtKB / Swiss-Prot: P55042. Exemplary sequences include: NM_001128850.2; NP_001122322.1; NM_004165.3; NP_004156.1.
[0088] As used herein, the term “voltage-gated calcium channels (VGCCs),” also known as “voltage-dependent calcium channels (VDCCs),” refers to a group of voltage-gated ion channels found in the membrane of excitable cells (e.g., muscle, glial cells, neurons) with a permeability to the calcium ion Ca2+. The L-type calcium channel (also known as the dihydropyridine channel, or DHP channel) is part of the high-voltage activated family of voltage-dependent calcium channel. “L” stands for long-lasting referring to the length of activation. This channel has four isoforms: Cavl.l, CaV1.2, Cavl.3, and Cavl.4. L-type calcium channels are responsible for the excitation-contraction coupling of skeletal, smooth, cardiac muscle, and for aldosterone secretion in endocrine cells of the adrenal cortex. In cardiac myocytes, the L-type calcium channel passes inward Ca2+current (ICaL) and triggers calcium release from the sarcoplasmic reticulum by activating ryanodine receptor 2 (RyR2) (calcium-induced-calcium-release). L-type Calcium Channels contain 5 different subunits, the α1(170–240 kDa), α2(150kDa), δ(17-25 kDa), β(50-78 kDa), and γ(32 kDa) subunits. The α2, δ, and β subunits are non-covalently bonded to the α1 subunit and modulate ion trafficking and biophysical properties of the α1 subunit. The α2 and δ subunits are in the extracellular space while the β and γ subunits are located in the cytosolic space.
[0089] As used herein, the term “Cav32” refers to the CACNB2 or Calcium Voltage-Gated Channel Auxiliary Subunit Beta 2 gene. The beta subunit of voltage-dependent calciumAttorney Docket 44010.202WO-PCT / / CU24243channels which contributes to the function of the calcium channel by increasing peak calcium current. External Ids for CACNB2 Gene: HGNC: 1402; NCBI Gene: 783; Ensembl: ENSG00000165995; OMIM®: 600003; and UniProtKB / Swiss-Prot: Q08289. Exemplary sequences include: NM_000724.4; NP_000715.2; NM_001167945.2; NP_001161417.1; NM_001330060.2; NP_001316989.1; NM_001410882.1; NP_001397811.1; NM_201570.3; NP_963864.1; NM_201571.4; NP_963865.2; NM_201572.4; NP_963866.2; NM_201590.3; NP_963884.2; NM_201593.3; NP_963887.2; NM_201596.3; NP_963890.2; NM_201597.3; NP_963891.1.
[0090] As used herein, the term “PKA” refers to protein kinase A (PKA), a family of serine-threonine kinase whose activity is dependent on cellular levels of cyclic AMP (cAMP). PKA is also known as cAMP-dependent protein kinase.
[0091] All gene name symbols refer to the gene as commonly known in the art. The examples described herein that refer to the mouse gene names are to be understood to also encompass human genes, as well as genes in any other organism (e.g., homologous, orthologous genes). Any reference to the gene symbol is a reference made to the entire gene or variants of the gene. Any reference to the gene symbol is also a reference made to the gene product (e.g., protein). Any reference to a gene (e.g., the Rad gene) is a reference to the polynucleotides encoding that gene, including both the genomic DNA (e.g., exons, introns, and regulatory regions) and the corresponding mRNA transcripts. The term, homolog, may apply to the relationship between genes separated by the event of speciation (e.g., ortholog). Orthologs are genes in different species that evolved from a common ancestral gene by speciation. Normally, orthologs retain the same function in the course of evolution. Gene symbols may be those referred to by the HUGO Gene Nomenclature Committee (HGNC) or National Center for Biotechnology Information (NCBI).Method of Treating Heart Failure
[0092] In example embodiments, methods of treatment include the treatment and prevention of cardiovascular disorders, and particularly to a method for increasing contractility in patients with systolic heart failure, by administering one or more agents that block or reduce interaction between Rad and a CaV1.2 / CavP2 complex, and / or Cavβ₂. In example embodiments, the method of treatment includes increasing contractility in patients with systolic heart failure by administering one or more agents that block the interaction between Rad and the CaV1.2 / Cavp2 complex, or between Rad and Cavβ2, in order to increase cardiac contractility.Attorney Docket 44010.202WO-PCT / / CU24243In example embodiments, the method of treatment includes preventing calcium overload and arrhythmias in heart disease by administering one or more agents that prevent the dissociation of Rad and the CaV1.2 / CavP complex, or between Rad and CavP2, during beta-adrenergic system activation.Therapeutic Agents
[0093] In example embodiments, the present invention provides for one or more therapeutic agents targeting Rad, Cavβ₂, or both. In example embodiments, the one or more agents for modulating Rad binding to voltage-gated calcium channels comprise an RNAi, genetic modifying agent, antisense oligonucleotide, and / or small molecule.Small molecules
[0094] In example embodiments, a method of modulating Rad binding to voltage-gated calcium channels comprises administering to a subject in need thereof one or more small molecules that modulate the expression, activity, or function of Rad, Cavβ₂, or both. In example embodiments, the one or more small molecules comprises a small molecule capable of inhibiting binding between Rad and Cavβ₂, small molecule degrader (e.g., ATTEC, AUTAC, LYTAC, or PROTAC), or a small molecule that brings a kinase or phosphatase into proximity with Rad, Cavβ₂, or both (e.g., PHICS). In example embodiments, a Rad-targeting PROTAC facilitates Rad ubiquitination and proteasomal degradation. In other embodiments, a Rad-targeting PHICS molecule recruits a kinase or phosphatase to Rad, thereby altering Rad phosphorylation at residues implicated in CaV1.2 regulation.
[0095] The term “small molecule” refers to compounds, preferably organic compounds, with a size comparable to those organic molecules generally used in pharmaceuticals. The term excludes biological macromolecules (e.g., proteins, peptides, nucleic acids, etc.). Preferred small organic molecules range in size up to about 5000 Da, e.g., up to about 4000, preferably up to 3000 Da, more preferably up to 2000 Da, even more preferably up to about 1000 Da, e.g., up to about 900, 800, 700, 600 or up to about 500 Da. In example embodiments, the small molecule may act as an antagonist or agonist.
[0096] In example embodiments, Rad-targeting PROTACs, PHICS molecules, or other small-molecule agents may be administered using any pharmaceutically acceptable route suitable for delivering small molecules to cardiac tissue. Non-limiting administration routes include intravenous administration, including bolus or infusion dosing, intraperitonealAttorney Docket 44010.202WO-PCT / / CU24243administration, oral administration, particularly for small-molecule degraders with adequate stability and bioavailability, subcutaneous administration, optionally via sustained-release formulations, direct myocardial or intracoronary administration, such as catheter-based local delivery for enhanced cardiac targeting, epicardial or intramyocardial injection, including administration via minimally invasive surgical approaches. In example embodiments, administration may be performed systemically with agents formulated to preferentially accumulate in the heart, or locally in situations requiring direct targeting.
[0097] In example embodiments, Rad-targeting PROTAC or PHICS molecules may be administered at dosages sufficient to achieve the desired modulation of Rad levels or phosphorylation state, while minimizing off-target effects. Because PROTACs and PHICS molecules act through catalytic target modulation rather than occupancy-driven inhibition, lower systemic doses may be sufficient relative to traditional small-molecule inhibitors. In example embodiments, dosages include 0.01 mg / kg to 100 mg / kg, 0.1 mg / kg to 50 mg / kg, or 1 mg / kg to 10 mg / kg per administration, depending on pharmacokinetics, bioavailability, and route of administration.PROTAC modulators
[0098] In one embodiment, a method of reducing Rad comprises administering one or more proteolysis targeting chimeras (PROTAC), or degraders to target Rad. One type of small molecule applicable to the present invention is a degrader molecule (see, e.g., Ding, et al., Emerging New Concepts of Degrader Technologies, Trends Pharmacol Sci. 2020 Jul;41(7):464-474). The terms “degrader” and “degrader molecule” refer to all compounds capable of specifically targeting a protein for degradation (e.g., ATTEC, AUTAC, LYTAC, or PROTAC, reviewed in Ding, et al. 2020). PROTAC technology employs small molecules that recruit target proteins for ubiquitination and removal by the proteasome (see, e.g., Zhou et al., Discovery of a Small-Molecule Degrader of Bromodomain and Extra- Terminal (BET) Proteins with Picomolar Cellular Potencies and Capable of Achieving Tumor Regression. J. Med. Chem. 2018, 61, 462-481; Bondeson and Crews, Targeted Protein Degradation by Small Molecules, Annu Rev Pharmacol Toxicol. 2017 Jan 6; 57: 107-123; and Lai et al., Modular PROTAC Design for the Degradation of Oncogenic BCR-ABL Angew Chem Int Ed Engl.2016 Jan 11; 55(2): 807-810).
[0099] PROTACs are bifunctional small molecules that induce the degradation of a target protein by targeting it to the ubiquitin-proteasome system (Gilbertson B, Subbarao K. A newAttorney Docket 44010.202WO-PCT / / CU24243route to vaccines using PROTACs. Nat Biotechnol. 2022;40(9): 1328-1329). They typically consist of two covalently linked moieties: one that binds to the protein of interest and another that binds to a cytosolic E3 ubiquitin ligase, such as von Hippel -Lindau or cereblon (Crunkhorn S. Developing antibody-based PROTACs. Nat Rev Drug Discov. 2022;21(11):795). By forming a ternary complex with the target protein and the E3 ligase, PROTACs facilitate the ubiquitination and subsequent degradation of the target protein. Id. This therapeutic strategy has gained significant interest in drug development as it enables the targeting of previously undruggable proteins, offering new possibilities for the treatment of various diseases, including cancer (Zografou-Barredo NA, Hallatt AJ, Goujon-Ricci J, Cano C. A beginner's guide to current synthetic linker strategies towards VHL-recruiting PROTACs. Bioorg Med Chem.2023;88-89:117334; and Gao H, Sun X, Rao Y. PROTAC Technology: Opportunities and Challenges. ACS Med Chem Lett. 2020;11(3):237-240). A number of known PROTAC may be found in the PROTAC -DB database found at cadd.zju.edu.cn / protacdb / about. (See also, Weng et al. (2020). PROTAC -DB: An online database of protacs. Nucleic Acids Research, 49(D1). doi.org / 10.1093 / nar / gkaa807) or any others known in literature.
[0100] In example embodiments, peptides or peptide-derived mimetics corresponding to Rad-interacting motifs of the Cavβ₂ subunit, or other Rad-binding proteins, may be engineered to bind Rad with high affinity. These peptides may serve as a targeting moiety directly or serve as starting points for small-molecule mimetic design. In example embodiments, macrocyclic compounds, constrained peptides, or small protein scaffolds (e.g., antibody-inspired scaffolds) may be used as Rad-binding targeting moieties when higher-surface-area recognition is required.
[0101] In addition to selection of the targeting moiety, design considerations include selection of the E3 ligase ligand and the linker that connects these two components. There are a large number of E3 ligases available (Zorba A, Nguyen C, Xu Y, et al. Delineating the role of cooperativity in the design of potent PROTACs for BTK. Proc Natl Acad Sci U S A.2018;115(31):E7285-E7292). However, the selection can be refined by focusing on target-ligase pairs that colocalize in similar cellular compartments and targets with accessible Lys residues for ubiquitination (Zorba, et al. 2018). Among the numerous E3 ligases, a few have been utilized for PROTAC technology, such as CRBN, VHL, IAP, and MDM2 (Bricelj A, Steinebach C, Kuchta R, Giitschow M, Sosic I. E3 Ligase Ligands in Successful PROTACs: An Overview of Syntheses and Linker Attachment Points. Front Chem. 2021;9:707317). AnAttorney Docket 44010.202WO-PCT / / CU24243important factor to consider when selecting the optimal E3 ligase is the structural perspective of the PROTAC targets. The target should have a small-molecule binding surface that can be approached by an E3 ligase and, ideally, have an unstructured region that can be threaded into the E3 ligase (Bekes M, Langley DR, Crews CM. PROTAC targeted protein degraders: the past is prologue. Nat Rev Drug Discov. 2022;21(3):181-200). There are computational tools and databases, such as PROTAC -DB (Weng et al. 2020), which can help in the design and optimization of PROTAC molecules, including the selection of the optimal E3 ligase.
[0102] Linker length is also an important design consideration, as it affects the ability of the two ligands to bind simultaneously to their respective proteins. If the linker is too short, steric clashes may prevent the formation of a ternary complex (Zagidullin A, Milyukov V, Rizvanov A, Bulatov E. Novel approaches for the rational design of PROTAC linkers. Explor Target Antitumor Ther. 2020;l(5):381-390). In PROTAC design, the optimal linker length may be determined based on the target's specific requirements (Zheng, S., Tan, Y., Wang, Z. et al. Accelerated rational PROTAC design via deep learning and molecular simulations. Nat Mach Intell 4, 739-748 (2022)). Flexibility and chemical properties of the linker may also be optimized. The proper combination of ligands and linker properties influences the polarity and flexibility of the molecule, laying the groundwork for designing an effective PROTAC (Zagidullin, et al., 2020). The linker composition may also impact the physicochemical properties and bioactivity of PROTACs (Troup RI, Fallan C, Baud MGJ. Current strategies for the design of PROTAC linkers: a critical review. Explor Target Antitumor Ther.2020; 1 (5):273-312). In some cases, employing polyethylene glycol (PEG) spacers in the linker can influence the properties of the PROTAC (Troup, et al., 2020). Molecular dynamics (MD) simulations can be used to prospectively rank cell permeability in the design of cereblon PROTACs, taking into account the chemical nature and flexibility of the linker (Poongavanam V, Atilaw Y, Siegel S, et al. Linker-Dependent Folding Rationalizes PROTAC Cell Permeability. J Med Chem. 2022;65(19):13029-13040). Additionally, computational methods, such as graph-based deep generative models, can incorporate three-dimensional structural information for rational compound design (Imrie F, Bradley AR, van der Schaar M, Deane CM. Deep Generative Models for 3D Linker Design. J Chem Inf Model. 2020;60(4):1983-1995).Other Bifunctional Molecules
[0103] In addition to PROTACS, other bi-functional molecules have been developed that may be used in the context of the present invention. In general, the E3 ligase binding portionAttorney Docket 44010.202WO-PCT / / CU24243is replaced with a binder of an enzyme capable of introducing a post-translational modification (PTM). For example, binders may be selected that bind to kinases, phosphatases, acetylases, deacetylases, methylases and demethylases. In example embodiments, the enzyme is a kinase or a phosphatase. As with PROTACS, these binders are then linked to a small molecular binding of the target protein to be modified via linker.PHICS
[0104] Phosphorylation-inducing chimeric molecules, also known as Phosphorylation-Inducing Chimeric Small molecules (PHICS), are a new class of small molecules designed to induce phosphorylation, a process that alters the structure and function of a protein by attaching a phosphate group to it (Siriwardena SU, Munkanatta Godage DNP, Shoba VM, et al. Phosphorylation-Inducing Chimeric Small Molecules. J Am Chem Soc. 2020; 142(33): 14052-14057). Traditionally, small molecules have been used to inhibit enzyme function, but PHICS represents a novel approach that endows new functions to enzymes via proximity-mediated effects (Siriwardena, et al. 2020).
[0105] PHICS function by bringing a kinase, an enzyme that transfers phosphate groups, into proximity with a target protein, which allows the kinase to phosphorylate the target protein (Siriwardena, et al. 2020). This process can enable a kinase to function at a new cellular location or phosphorylate non-native substrates or sites, otherwise known as neo- substrates or neo-phosphorylations (Shoba VM, Munkanatta Godage DNP, Chaudhary SK, Deb A, Siriwardena SU, Choudhary A. Synthetic Reprogramming of Kinases Expands Cellular Activities of Proteins. Angew Chem Int Ed Engl. 2022;61(29):e202202770).
[0106] In example embodiments, Rad is targeted with chimeric molecules that recruit enzymes (e.g., kinases or phosphatases) to the target protein by a similar mechanism as PROTACs (see, e.g., Shoba VM, Munkanatta Godage DNP, Chaudhary SK, Deb A, Siriwardena SU, Choudhary A. Synthetic Reprogramming of Kinases Expands Cellular Activities of Proteins. Angew Chem Int Ed Engl. 2022;61(29):e202202770; and International patent application publication No. WO2021142351 Al). Phosphorylation-inducing chimeric small molecules (PHICS) can enable a kinase to act at a new cellular location or phosphorylate non-native substrates (neo-substrates) / sites (neo-phosphorylations). PHICS are formed by linking small-molecule binders of the kinase or the phosphatase and the target protein. The molecule that binds the target protein is the same as for PROTACs described herein and can be rationally designed in the same way.Attorney Docket 44010.202WO-PCT / / CU24243
[0107] PHICS is formed by joining a kinase binder with a binder of the target protein-of-interest so that the kinase is brought into proximity to the target protein. The resulting increase in the effective concentration of the target protein around the kinase will result in target protein phosphorylation. The PHICS molecule should have sufficient stability to maintain its structure and function under physiological conditions. A target kinase should be selected based on its ability to effectively phosphorylate the site(s) of interest on the target protein. Selecting a kinase that is highly expressed in a cell type or tissue type of interest may also be desirable to ensure adequate levels of activity. A number of kinase-specific databases are known that may be used to select both the appropriate kinase and kinase binder, which include, but are not limited to, the following:• KinaseMD: This database presents information on mutations in kinase genes which can impact drug treatment sensitivity and resistance (Hu R, Xu H, Jia P, Zhao Z. KinaseMD: kinase mutations and drug response database. Nucleic Acids Res.2021;49(Dl): D552-D561).• Human Kinase Protein Pockets Database: This resource provides information on kinase pocket structures, which is crucial for drug discovery targeting cancer or other diseases (Wang H, Qiu J, Liu H, Xu Y, Jia Y, Zhao Y. HKPocket: human kinase pocket database for drug design. BMC Bioinformatics. 2019;20(l):617).Kinase-Ligand Interaction Fingerprints and Structure Database (KLIFS): KLIFS offers detailed information about kinase-ligand interaction derived from all structures of catalytic domains of human and mouse protein kinases deposited in the Protein Data Bank (van Linden OP, Kooistra AJ, Leurs R, de Esch IJ, de Graaf C. KLIFS: a knowledge-based structural database to navigate kinase-ligand interaction space. J Med Chem. 2014;57(2):249-277; Kooistra AJ, Kanev GK, van Linden OP, Leurs R, de Esch IJ, de Graaf C. KLIFS: a structural kinase-ligand interaction database. Nucleic Acids Res. 2016;44(Dl): D365-D371).KinBase: Available on Kinase.com, KinBase is a resource that includes genomic and evolutionary analyses (kinomes), classification, disease associations, and an extensive database of protein kinase genes.Kinase Knowledge Base (KKB): KKB is a kinase structural database that covers all human kinase domain structures that have been deposited in the Protein Data Bank (Brooijmans N, Chang YW, Mobilio D, Denny RA, Humblet C. An enriched structuralAttorney Docket 44010.202WO-PCT / / CU24243kinase database to enable kinome-wide structure-based analyses and drug discovery. Protein Sci. 2010; 19(4): 763-774).
[0108] There are several resources available to search for known binders of kinases. One resource is the Published Kinase Inhibitor Set (PKIS), which is a set of 367 small-molecule ATP-competitive kinase inhibitors that was made freely available to expand research in this field. Elkins, J., Fedele, V., Szklarz, M. etal. Comprehensive characterization of the Published Kinase Inhibitor Set. Nat Biotechnol 34, 95-103 (2016). Another resource is the use of databases such as NCI, NPD, and MLSMR, which are frequently used in the virtual screening of kinase inhibitors. Singh, N., Sun, H., Chaudhury, S. et al. A physicochemical descriptorbased scoring scheme for effective and rapid filtering of kinase-like chemical space. J Cheminform 4, 4 (2012). Computational approaches have also been developed to predict molecular targets for small-molecule drugs. R. Cao, Y. Wang, ChemMedChem 2016, 77, 1352.
[0109] As with PROTACS design linker selection is also a relevant design consideration and many if not all of the linker design considerations discussed above in the context of PROTACS may be considered when selecting an appropriate linker for PHICS molecule design.RNAi and antisense oligonucleotides (ASO)
[0110] In example embodiments, a method of modulating Rad binding to voltage-gated calcium channels comprises administering to a subject in need thereof one or more RNAi molecules that modulate the expression of Rad. In example embodiments, a method of modulating Rad binding to voltage-gated calcium channels comprises administering to a subject in need thereof one or more antisense oligonucleotides that modulate the expression of Rad.
[0111] As used herein, “gene silencing” or “gene silenced” in reference to an activity of an RNAi molecule, for example a siRNA or miRNA refers to a decrease in the mRNA level in a cell for a target gene by at least about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99%, about 100% of the mRNA level found in the cell without the presence of the miRNA or RNA interference molecule. In one preferred embodiment, the mRNA levels are decreased by at least about 70%, about 80%, about 90%, about 95%, about 99%, about 100%. Additionally, inhibitory nucleic acid molecules such as RNAi and ASOs can be used in vivo (see, e.g., Yan Y, Liu XY, Lu A,Attorney Docket 44010.202WO-PCT / / CU24243Wang XY, Jiang LX, Wang JC. Non-viral vectors for RNA delivery. J Control Release.2022;342:241-279).
[0112] As used herein, the term “RNAi” refers to any type of interfering RNA, including but not limited to, siRNAi, shRNAi, endogenous microRNA and artificial microRNA. For instance, it includes sequences previously identified as siRNA, regardless of the mechanism of down-stream processing of the RNA (i.e., although siRNAs are believed to have a specific method of in vivo processing resulting in the cleavage of mRNA, such sequences can be incorporated into the vectors in the context of the flanking sequences described herein). The term “RNAi” can include both gene silencing RNAi molecules, and also RNAi effector molecules which activate the expression of a gene.
[0113] As used herein, a “siRNA” refers to a nucleic acid that forms a double stranded RNA, which double stranded RNA has the ability to reduce or inhibit expression of a gene or target gene when the siRNA is present or expressed in the same cell as the target gene. The double stranded RNA siRNA can be formed by the complementary strands. In one embodiment, a siRNA refers to a nucleic acid that can form a double stranded siRNA. The sequence of the siRNA can correspond to the full-length target gene, or a subsequence thereof. Typically, the siRNA is at least about 15-50 nucleotides in length (e.g., each complementary sequence of the double stranded siRNA is about 15-50 nucleotides in length, and the double stranded siRNA is about 15-50 base pairs in length, preferably about 19-30 base nucleotides, preferably about 20-25 nucleotides in length, e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length).
[0114] As used herein “shRNA” or “small hairpin RNA” (also called stem loop) is a type of siRNA. In one embodiment, these shRNAs are composed of a short, e.g., about 19 to about 25 nucleotide, antisense strand, followed by a nucleotide loop of about 5 to about 9 nucleotides, and the analogous sense strand. Alternatively, the sense strand can precede the nucleotide loop structure and the antisense strand can follow.
[0115] The terms “microRNA” or “miRNA” are used interchangeably herein are endogenous RNAs, some of which are known to regulate the expression of protein-coding genes at the posttranscri phonal level. Endogenous microRNAs are small RNAs naturally present in the genome that are capable of modulating the productive utilization of mRNA. The term artificial microRNA includes any type of RNA sequence, other than endogenous microRNA, which is capable of modulating the productive utilization of mRNA. MicroRNAAttorney Docket 44010.202WO-PCT / / CU24243sequences have been described in publications such as Lim, et al., Genes & Development, 17, p. 991 - 1008 (2003), Lim et al Science 299, 1540 (2003), Lee and Ambros Science, 294, 862 (2001), Lau et al., Science 294, 858-861 (2001), Lagos-Quintana et al, Current Biology, 12, 735-739 (2002), Lagos Quintana et al, Science 294, 853- 857 (2001), and Lagos-Quintana et al, RNA, 9, 175- 179 (2003), which are incorporated herein by reference. Multiple microRNAs can also be incorporated into a precursor molecule. Furthermore, miRNA-like stem-loops can be expressed in cells as a vehicle to deliver artificial miRNAs and short interfering RNAs (siRNAs) for the purpose of modulating the expression of endogenous genes through the miRNA and or RNAi pathways.
[0116] As used herein, “double stranded RNA” or “dsRNA” refers to RNA molecules that are comprised of two strands. Double-stranded molecules include those comprised of a single RNA molecule that doubles back on itself to form a two-stranded structure. For example, the stem loop structure of the progenitor molecules from which the single-stranded miRNA is derived, called the pre-miRNA (Bartel et al. 2004. Cell 1 16:281 -297), comprises a dsRNA molecule.
[0117] Antisense therapy is a form of treatment that uses antisense oligonucleotides (ASOs) to target messenger RNA (mRNA). ASOs are capable of altering mRNA expression through a variety of mechanisms, including ribonuclease H mediated decay of the pre-mRNA, direct steric blockage, and exon content modulation through splicing site binding on pre-mRNA (see, e.g., Crooke ST, Liang XH, Baker BF, Crooke RM. Antisense technology: A review. J Biol Chem. 2021;296:100416. doi: 10.1016 / j.jbc.2021.100416). Antisense oligonucleotides (ASO) generally inhibit their target by binding target mRNA and sterically blocking expression by obstructing the ribosome. ASOs can also inhibit their target by binding target mRNA thus forming a DNA-RNA hybrid that can be a substrate for RNase H. Commonly used antisense mechanisms to degrade target RNAs include RNase Hl -dependent and RISC-dependent mechanisms. Preferred ASOs include Locked Nucleic Acids (LNA), Peptide Nucleic Acids (PNA), and morpholinos.Genetic modifying agents
[0118] In example embodiments, a method of modulating Rad binding to voltage-gated calcium channels comprises administering to a subject in need thereof one or more genetic modifying agents that modulate the expression, activity, or function of Rad, Cavβ₂, or both.Attorney Docket 44010.202WO-PCT / / CU24243
[0119] In example embodiments, the genetic modifying agent may comprise a programmable nuclease, such as, a CRISPR system, a zinc finger nuclease system, a TALE nuclease (TALEN), or a meganuclease, or an OMEGA system. In example embodiments, the genetic modifying agent may comprise a TIGR-Tas (see, e.g., Faure G, Saito M, Wilkinson ME, et al. TIGR-Tas: A family of modular RNA-guided DNA-targeting systems in prokaryotes and their viruses. Science. Published online February 27, 2025). In addition, a number of alternate gene modification systems have been developed by modifying Cas nuclease so that they are catalytically inactive (“dead Cas” or “dCas”) or cut only a single strand of DNA (“nickase”) and then coupling these modified Cas nuclease with a further functional domain such as base editors, reverse transcriptases, recombinases, transposases and retrotransposases. For sake of convenience these alternative systems (e.g., Base Editors, Prime Editors, CAST, Non-LTR Retrotransposon Systems) are described further below in the context of use with a modified Cas. However, it is further contemplated that the modified Cas could be substituted with another similarly modified programmable nuclease like a zinc finger nuclease, TALEN, Omega nuclease (e.g., Iscb, Isrb, TnpB, Fanzor), meganuclease. In example embodiments, the genetic modifying agent is administered using a vector, such as a viral vector or liposome.
[0120] Programmable nucleases may use two different cell repair pathways to effectuate edits to one or more target sequences, non-homologous end joining (NHEJ) or homology-directed repair (HDR).Example NHEJ-mediated Modifications
[0121] Programmable nuclease may be used to introduce insertions and deletions via NHEJ-mediated cell repair that control expression of Rad. The modifications may be made in a non-coding region that controls expression of Rad, in a coding region encoding a Rad. More than one programmable nuclease type may be used, for example and in the case of CRISPR-Cas, to maximize targets sites adjacent to different PAMs.
[0122] In one embodiment, the one or more programmable nucleases may be configured to introduce one or more insertions or deletion in a non-coding region controlling expression of Rad such that expression of Rad is reduced. In one embodiment, the insertions or deletions may disrupt the binding site in an enhancer of Rad, such as a transcription factor or other regulatory proteins, needed to initiation transcription of Rad. In one embodiment, the one or more insertions or deletions may disrupt one or more promoters controlling expression of Rad such that binding of transcription factors and / or RNA polymerase binding is blocked orAttorney Docket 44010.202WO-PCT / / CU24243reduced. In one embodiment, the one or more insertions or deletions may disrupt one or more insulator regions such that silencer regions or repressive chromatin structures controlling expression of Rad are no longer muted or blocked by the insulator region and can decrease gene expression.
[0123] In one embodiment, the programmable nuclease is used to introduce one or more insertions or deletions to coding sequence of Rad, such that one or more indels or insertions reduce expression or activity of Rad. For example, the insertion or deletion may cause a frame shift in the coding sequence such that expression is reduced or such that the resulting gene product is non-functional or exhibits reduced activity relative to an unmodified gene. In one embodiment, the insertion(s) or deletion(s) may alter a splice site such that transcription or translation is reduced or such a that resulting gene product is non-functional or exhibits reduced activity relative to an unmodified gene. The insertion or deletion may introduce a premature stop codon such that expression is reduced. The insertion or deletion may alter a post-translational modification site such that the activity of the resulting gene product is reduced.
[0124] In one example embodiment, a donor template is provided along with a programmable nuclease to facilitate homology direct repair (HDR) which results insertion of a donor sequence comprising one or more insertions, deletions, or substitutions relative to the target sequence it replaces. A donor template may comprise an insertion sequence flanked by two homology regions. The insertion sequence comprises an edited sequence to be inserted in place of the target sequence (e.g., a portion of genomic DNA to be edited). The homology regions comprise sequences that are homologous to the genomic DNA strands at the site of the CRISPR-Cas induced double-strand break. Cellular HDR mechanisms then facilitate insertion of the insertion sequence at the site of the DSB.Example Programmable Nucleases
[0125] The following provides further details and nuclease specific considerations for example programmable nucleases that may be used to make the NHEJ-mediated and HDR-mediated modifications described above.CRISPR-Cas
[0126] In one example embodiment, the genetic modifying agent is a CRISPR-Cas system. CRISPR-Cas systems comprise a Cas polypeptide and a guide sequence, wherein the guide sequence is capable of forming a CRISPR-Cas complex with the Cas polypeptide and directingAttorney Docket 44010.202WO-PCT / / CU24243site-specific binding of the CRISPR-Cas sequence to a target sequence in one or more of the target genes. The Cas polypeptide may induce a double- or single-stranded break at a designated site in the target sequence. The site of CRISPR-Cas cleavage, for most CRISPR-Cas systems, is dictated by distance from a protospacer-adjacent motif (PAM), discussed in further detail below. Accordingly, a guide sequence may be selected to direct the CRISPR-Cas system to a desired target site at or near the one or more target genes. Additionally, CRISPR systems can be used in vivo (see, e.g., Chen H, Shi M, Gilam A, et al. Hemophilia A ameliorated in mice by CRISPR-based in vivo genome editing of human Factor VIII. Sci Rep.2019;9(1):16838; Hana S, Peterson M, McLaughlin H, et al. Highly efficient neuronal gene knockout in vivo by CRISPR-Cas9 via neonatal intracerebroventricular injection of AAV in mice. Gene Ther. 2021;28(10-ll):646-658; and Rosenblum D, Gutkin A, Kedmi R, et al. CRISPR-Cas9 genome editing using targeted lipid nanoparticles for cancer therapy. Sci Adv.2020;6(47):eabc9450).
[0127] In general, a CRISPR-Cas or CRISPR system as used in herein and in documents, such as International Patent Publication No. WO 2014 / 093622 (PCT / US2013 / 074667), refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g. tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), or “RNA(s)” as that term is herein used (e.g., RNA(s) to guide Cas, such as Cas9, e.g. CRISPR RNA and transactivating (tracr) RNA or a single guide RNA (sgRNA) (chimeric RNA)) or other sequences and transcripts from a CRISPR locus. In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system). See, e.g., Shmakov et al. (2015) “Discovery and Functional Characterization of Diverse Class 2 CRISPR-Cas Systems”, Molecular Cell, DOI: dx.doi.org / 10.1016 / j.molcel.2015.10.008.
[0128] CRISPR-Cas systems can generally fall into two classes based on their architectures of their effector molecules, which are each further subdivided by type and subtype. The two class are Class 1 and Class 2. Class 1 CRISPR-Cas systems have effector modules composedAttorney Docket 44010.202WO-PCT / / CU24243of multiple Cas proteins, some of which form crRNA-binding complexes, while Class 2 CRISPR-Cas systems include a single, multi-domain crRNA-binding protein.
[0129] In some embodiments, the CRISPR-Cas system that can be used to modify a polynucleotide of the present invention described herein can be a Class 1 CRISPR-Cas system. In some embodiments, the CRISPR-Cas system that can be used to modify a polynucleotide of the present invention described herein can be a Class 2 CRISPR-Cas system.Class 1 CRISPR-Cas Systems
[0130] In some embodiments, the CRISPR-Cas system that can be used to modify a polynucleotide of the present invention described herein can be a Class 1 CRISPR-Cas system. Class 1 CRISPR-Cas systems are divided into types I, II, and IV. Makarova et al. 2020. Nat. Rev. 18: 67-83., particularly as described in Figure 1. Type I CRISPR-Cas systems are divided into 9 subtypes (I-A, I-B, I-C, I-D, I-E, I-Fl, I-F2, 1-F3, and IG). Makarova etal., 2020. Class 1, Type I CRISPR-Cas systems can contain a Cas3 protein that can have helicase activity. Type III CRISPR-Cas systems are divided into 6 subtypes (III-A, III-B, III-C, III-D, III-E, and III-F). Type III CRISPR-Cas systems can contain a Cas 10 that can include an RNA recognition motif called Palm and a cyclase domain that can cleave polynucleotides. Makarova etal., 2020. Type IV CRISPR-Cas systems are divided into 3 subtypes. (IV-A, IV-B, and IV-C). Makarova et al., 2020. Class 1 systems also include CRISPR-Cas variants, including Type I-A, I-B, I-E, I-F and I-U variants, which can include variants carried by transposons and plasmids, including versions of subtype I-F encoded by a large family of Tn7-like transposon and smaller groups of Tn7-like transposons that encode similarly degraded subtype I-B systems. Peters et al., PNAS 114 (35) (2017); DOI: 10.1073 / pnas.1709035114; see also, Makarova et al. 2018. The CRISPR Journal, v. 1, n5, Figure 5.
[0131] The Class 1 systems typically comprise a multi-protein effector complex, which can, in some embodiments, include ancillary proteins, such as one or more proteins in a complex referred to as a CRISPR-associated complex for antiviral defense (Cascade), one or more adaptation proteins (e.g., Casl, Cas2, RNA nuclease), and / or one or more accessory proteins (e.g., Cas 4, DNA nuclease), CRISPR associated Rossman fold (CARF) domain containing proteins, and / or RNA transcriptase.
[0132] The backbone of the Class 1 CRISPR-Cas system effector complexes can be formed by RNA recognition motif domain-containing protein(s) of the repeat-associated mysterious proteins (RAMPs) family subunits (e.g., Cas 5, Cas6, and / or Cas7). RAMP proteins areAttorney Docket 44010.202WO-PCT / / CU24243characterized by having one or more RNA recognition motif domains. In some embodiments, multiple copies of RAMPs can be present. In some embodiments, the Class I CRISPR-Cas system can include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more Cas5, Cas6, and / or Cas 7 proteins. In some embodiments, the Cas6 protein is an RNAse, which can be responsible for pre-crRNA processing. When present in a Class 1 CRISPR-Cas system, Cas6 can be optionally physically associated with the effector complex.
[0133] Class 1 CRISPR-Cas system effector complexes can, in some embodiments, also include a large subunit. The large subunit can be composed of or include a Cas8 and / or CaslO protein. See, e.g., Figures 1 and 2. Koonin EV, Makarova KS. 2019. Phil. Trans. R. Soc. B 374: 20180087, DOI: 10.1098 / rstb.2018.0087 and Makarova et al. 2020.
[0134] Class 1 CRISPR-Cas system effector complexes can, in some embodiments, include a small subunit (for example, Casll). See, e.g., Figures 1 and 2. Koonin EV, Makarova KS.2019 Origins and Evolution of CRISPR-Cas systems. Phil. Trans. R. Soc. B 374: 20180087, DOI: 10.1098 / rstb.2018.0087.
[0135] In some embodiments, the Class 1 CRISPR-Cas system can be a Type I CRISPR-Cas system. In some embodiments, the Type I CRISPR-Cas system can be a subtype I-A CRISPR-Cas system. In some embodiments, the Type I CRISPR-Cas system can be a subtype I-B CRISPR-Cas system. In some embodiments, the Type I CRISPR-Cas system can be a subtype I-C CRISPR-Cas system. In some embodiments, the Type I CRISPR-Cas system can be a subtype I-D CRISPR-Cas system. In some embodiments, the Type I CRISPR-Cas system can be a subtype I-E CRISPR-Cas system. In some embodiments, the Type I CRISPR-Cas system can be a subtype I-Fl CRISPR-Cas system. In some embodiments, the Type I CRISPR-Cas system can be a subtype I-F2 CRISPR-Cas system. In some embodiments, the Type I CRISPR-Cas system can be a subtype I-F3 CRISPR-Cas system. In some embodiments, the Type I CRISPR-Cas system can be a subtype I-G CRISPR-Cas system. In some embodiments, the Type I CRISPR-Cas system can be a CRISPR Cas variant, such as a Type I-A, I-B, I-E, I-F and I-U variants, which can include variants carried by transposons and plasmids, including versions of subtype I-F encoded by a large family of Tn7-like transposon and smaller groups of Tn7-like transposons that encode similarly degraded subtype I-B systems as previously described.
[0136] In some embodiments, the Class 1 CRISPR-Cas system can be a Type III CRISPR-Cas system. In some embodiments, the Type III CRISPR-Cas system can be a subtype III-AAttorney Docket 44010.202WO-PCT / / CU24243CRISPR-Cas system. In some embodiments, the Type III CRISPR-Cas system can be a subtype III-B CRISPR-Cas system. In some embodiments, the Type III CRISPR-Cas system can be a subtype III-C CRISPR-Cas system. In some embodiments, the Type III CRISPR-Cas system can be a subtype III-D CRISPR-Cas system. In some embodiments, the Type III CRISPR-Cas system can be a subtype III-E CRISPR-Cas system. In some embodiments, the Type III CRISPR-Cas system can be a subtype III-F CRISPR-Cas system.
[0137] In some embodiments, the Class 1 CRISPR-Cas system can be a Type IV CRISPR-Cas-system. In some embodiments, the Type IV CRISPR-Cas system can be a subtype IV-A CRISPR-Cas system. In some embodiments, the Type IV CRISPR-Cas system can be a subtype IV-B CRISPR-Cas system. In some embodiments, the Type IV CRISPR-Cas system can be a subtype IV-C CRISPR-Cas system.
[0138] The effector complex of a Class 1 CRISPR-Cas system can, in some embodiments, include a Cas3 protein that is optionally fused to a Cas2 protein, a Cas4, a Cas5, a Cas6, a Cas7, a Cas8, a CaslO, a Casl 1, or a combination thereof. In some embodiments, the effector complex of a Class 1 CRISPR-Cas system can have multiple copies, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14, of any one or more Cas proteins.Class 2 CRISPR-Cas Systems
[0139] The compositions, systems, and methods described in greater detail elsewhere herein can be designed and adapted for use with Class 2 CRISPR-Cas systems. Thus, in some embodiments, the CRISPR-Cas system is a Class 2 CRISPR-Cas system. Class 2 systems are distinguished from Class 1 systems in that they have a single, large, multi-domain effector protein. In certain example embodiments, the Class 2 system can be a Type II, Type V, or Type VI system, which are described in Makarova et al. “Evolutionary classification of CRISPR-Cas systems: a burst of class 2 and derived variants” Nature Reviews Microbiology, 18:67-81 (Feb 2020), incorporated herein by reference. Each type of Class 2 system is further divided into subtypes. See Markova et al. 2020, particularly at Figure. 2. Class 2, Type II systems can be divided into 4 subtypes: II-A, II-B, II-C1, and II-C2. Class 2, Type V systems can be divided into 17 subtypes: V-A, V-Bl, V-B2, V-C, V-D, V-E, V-Fl, V-F1(V-U3), V-F2, V-F3, V-G, V-H, V-I, V-K (V-U5), V-Ul, V-U2, and V-U4. Class 2, Type IV systems can be divided into 5 subtypes: VI-A, VI-B1, VI-B2, VI-C, and VI-D.
[0140] The distinguishing feature of these types is that their effector complexes consist of a single, large, multi-domain protein. Type V systems differ from Type II effectors (e.g., Cas9),Attorney Docket 44010.202WO-PCT / / CU24243which contain two nuclear domains that are each responsible for the cleavage of one strand of the target DNA, with the HNH nuclease inserted inside the Ruv-C like nuclease domain sequence. The Type V systems (e.g., Casl2) only contain a RuvC-like nuclease domain that cleaves both strands. Type VI (Casl3) are unrelated to the effectors of Type II and V systems and contain two HEPN domains and target RNA. Casl3 proteins also display collateral activity that is triggered by target recognition. Some Type V systems have also been found to possess this collateral activity with two single-stranded DNA in in vitro contexts.
[0141] In some embodiments, the Class 2 system is a Type II system. In some embodiments, the Type II CRISPR-Cas system is a II-A CRISPR-Cas system. In some embodiments, the Type II CRISPR-Cas system is a II-B CRISPR-Cas system. In some embodiments, the Type II CRISPR-Cas system is a II-C1 CRISPR-Cas system. In some embodiments, the Type II CRISPR-Cas system is a II-C2 CRISPR-Cas system. In some embodiments, the Type II system is a Cas9 system. In some embodiments, the Type II system includes a Cas9.
[0142] In some embodiments, the Class 2 system is a Type V system. In some embodiments, the Type V CRISPR-Cas system is a V-A CRISPR-Cas system. In some embodiments, the Type V CRISPR-Cas system is a V-Bl CRISPR-Cas system. In some embodiments, the Type V CRISPR-Cas system is a V-B2 CRISPR-Cas system. In some embodiments, the Type V CRISPR-Cas system is a V-C CRISPR-Cas system. In some embodiments, the Type V CRISPR-Cas system is a V-D CRISPR-Cas system. In some embodiments, the Type V CRISPR-Cas system is a V-E CRISPR-Cas system. In some embodiments, the Type V CRISPR-Cas system is a V-Fl CRISPR-Cas system. In some embodiments, the Type V CRISPR-Cas system is a V-Fl (V-U3) CRISPR-Cas system. In some embodiments, the Type V CRISPR-Cas system is a V-F2 CRISPR-Cas system. In some embodiments, the Type V CRISPR-Cas system is a V-F3 CRISPR-Cas system. In some embodiments, the Type V CRISPR-Cas system is a V-G CRISPR-Cas system. In some embodiments, the Type V CRISPR-Cas system is a V-H CRISPR-Cas system. In some embodiments, the Type V CRISPR-Cas system is a V-I CRISPR-Cas system. In some embodiments, the Type V CRISPR-Cas system is a V-K (V-U5) CRISPR-Cas system. In some embodiments, the Type V CRISPR-Cas system is a V-Ul CRISPR-Cas system. In some embodiments, the Type V CRISPR-Cas system is a V-U2 CRISPR-Cas system. In some embodiments, the Type V CRISPR-Cas system is a V-U4 CRISPR-Cas system. In someAttorney Docket 44010.202WO-PCT / / CU24243embodiments, the Type V CRISPR-Cas system includes a Casl2a (Cpfl), Casl2b (C2cl), Casl2c (C2c3), Casl2d (CasY), Casl2e (CasX), Casl4, and / or Cas.
[0143] In some embodiments the Class 2 system is a Type VI system. In some embodiments, the Type VI CRISPR-Cas system is a VI-A CRISPR-Cas system. In some embodiments, the Type VI CRISPR-Cas system is a VI-B1 CRISPR-Cas system. In some embodiments, the Type VI CRISPR-Cas system is a VI-B2 CRISPR-Cas system. In some embodiments, the Type VI CRISPR-Cas system is a VI-C CRISPR-Cas system. In some embodiments, the Type VI CRISPR-Cas system is a VI-D CRISPR-Cas system. In some embodiments, the Type VI CRISPR-Cas system includes a Casl3a (C2c2), Casl3b (Group 29 / 30), Casl3c, and / or Casl3d.Guide Molecules
[0144] The following include general design principles that may be applied to the guide molecule. The terms guide molecule, guide sequence and guide polynucleotide refer to polynucleotides capable of guiding Cas to a target genomic locus and are used interchangeably as in foregoing cited documents such as International Patent Publication No. WO 2014 / 093622 (PCT / US2013 / 074667). In general, a guide sequence is any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of a CRISPR complex to the target sequence. The guide molecule can be a polynucleotide.
[0145] The ability of a guide sequence (within a nucleic acid-targeting guide RNA) to direct sequence-specific binding of a nucleic acid-targeting complex to a target nucleic acid sequence may be assessed by any suitable assay. For example, the components of a nucleic acid-targeting CRISPR system sufficient to form a nucleic acid-targeting complex, including the guide sequence to be tested, may be provided to a host cell having the corresponding target nucleic acid sequence, such as by transfection with vectors encoding the components of the nucleic acid-targeting complex, followed by an assessment of preferential targeting (e.g., cleavage) within the target nucleic acid sequence, such as by Surveyor assay (Qui et al. 2004. BioTechniques. 36(4)702-707). Similarly, cleavage of a target nucleic acid sequence may be evaluated in a test tube by providing the target nucleic acid sequence, components of a nucleic acid-targeting complex, including the guide sequence to be tested and a control guide sequence different from the test guide sequence, and comparing binding or rate of cleavage at the targetAttorney Docket 44010.202WO-PCT / / CU24243sequence between the test and control guide sequence reactions. Other assays are possible and will occur to those skilled in the art.
[0146] In some embodiments, the guide molecule is an RNA. The guide molecule(s) (also referred to interchangeably herein as guide polynucleotide and guide sequence) that are included in the CRISPR-Cas or Cas based system can be any polynucleotide sequence having sufficient complementarity with a target nucleic acid sequence to hybridize with the target nucleic acid sequence and direct sequence-specific binding of a nucleic acid-targeting complex to the target nucleic acid sequence. In some embodiments, the degree of complementarity, when optimally aligned using a suitable alignment algorithm, can be about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more. Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting examples of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g., the Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies; available at www.novocraft.com), ELAND (Illumina®, San Diego, CA), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net).
[0147] A guide sequence, and hence a nucleic acid-targeting guide, may be selected to target any target nucleic acid sequence. The target sequence may be DNA. The target sequence may be any RNA sequence. In some embodiments, the target sequence may be a sequence within an RNA molecule selected from the group consisting of messenger RNA (mRNA), pre-mRNA, ribosomal RNA (rRNA), transfer RNA (tRNA), micro-RNA (miRNA), small interfering RNA (siRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), double stranded RNA (dsRNA), non-coding RNA (ncRNA), long non-coding RNA (IncRNA), and small cytoplasmatic RNA (scRNA). In some preferred embodiments, the target sequence may be a sequence within an RNA molecule selected from the group consisting of mRNA, pre-mRNA, and rRNA. In some preferred embodiments, the target sequence may be a sequence within an RNA molecule selected from the group consisting of ncRNA, and IncRNA. In some more preferred embodiments, the target sequence may be a sequence within an mRNA molecule or a pre-mRNA molecule.
[0148] In some embodiments, a nucleic acid-targeting guide is selected to reduce the degree secondary structure within the nucleic acid-targeting guide. In some embodiments, about or less than about 75%, 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 1%, or fewer of theAttorney Docket 44010.202WO-PCT / / CU24243nucleotides of the nucleic acid-targeting guide participate in self-complementary base pairing when optimally folded. Optimal folding may be determined by any suitable polynucleotide folding algorithm. Some programs are based on calculating the minimal Gibbs free energy. An example of one such algorithm is mFold, as described by Zuker and Stiegler (Nucleic Acids Res. 9 (1981), 133-148). Another example folding algorithm is the online webserver RNAfold, developed at Institute for Theoretical Chemistry at the University of Vienna, using the centroid structure prediction algorithm (see e.g., A. R. Gruber et al., 2008, Cell 106(1): 23-24; and PA Carr and GM Church, 2009, Nature Biotechnology 27(12): 1151-62).
[0149] In one example embodiment, a guide RNA or crRNA may comprise, consist essentially of, or consist of a direct repeat (DR) sequence and a guide sequence or spacer sequence. In another example embodiment, the guide RNA or crRNA may comprise, consist essentially of, or consist of a direct repeat sequence fused or linked to a guide sequence or spacer sequence. In another example embodiment, the direct repeat sequence may be located upstream (i.e., 5’) from the guide sequence or spacer sequence. In other embodiments, the direct repeat sequence may be located downstream (i.e., 3’) from the guide sequence or spacer sequence.
[0150] In one example embodiment, the crRNA comprises a stem loop, preferably a single stem loop. In one example embodiment, the direct repeat sequence forms a stem loop, preferably a single stem loop.
[0151] In one example embodiment, the spacer length of the guide RNA is from 15 to 35 nt. In another example embodiment, the spacer length of the guide RNA is at least 15 nucleotides. In another example embodiment, the spacer length is from 15 to 17 nt, e.g., 15, 16, or 17 nt, from 17 to 20 nt, e.g., 17, 18, 19, or 20 nt, from 20 to 24 nt, e.g., 20, 21, 22, 23, or 24 nt, from 23 to 25 nt, e.g., 23, 24, or 25 nt, from 24 to 27 nt, e.g., 24, 25, 26, or 27 nt, from 27 to 30 nt, e.g., 27, 28, 29, or 30 nt, from 30 to 35 nt, e.g., 30, 31, 32, 33, 34, or 35 nt, or 35 nt or longer.
[0152] The “tracrRNA” sequence or analogous terms includes any polynucleotide sequence that has sufficient complementarity with a crRNA sequence to hybridize. In some embodiments, the degree of complementarity between the tracrRNA sequence and crRNA sequence along the length of the shorter of the two when optimally aligned is about or more than about 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97.5%, 99%, or higher. In some embodiments, the tracr sequence is about or more than about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,Attorney Docket 44010.202WO-PCT / / CU2424316, 17, 18, 19, 20, 25, 30, 40, 50, or more nucleotides in length. In some embodiments, the tracr sequence and crRNA sequence are contained within a single transcript, such that hybridization between the two produces a transcript having a secondary structure, such as a hairpin.
[0153] In general, degree of complementarity is with reference to the optimal alignment of the spacer sequence and tracr sequence, along the length of the shorter of the two sequences. Optimal alignment may be determined by any suitable alignment algorithm and may further account for secondary structures, such as self-complementarity within either the spacer sequence or tracr sequence. In some embodiments, the degree of complementarity between the tracr sequence and spacer sequence along the length of the shorter of the two when optimally aligned is about or more than about 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97.5%, 99%, or higher.
[0154] In some embodiments, the degree of complementarity between a guide sequence and its corresponding target sequence can be about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or 100%; a guide or RNA or sgRNA can be about or more than about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides in length; or guide or RNA or sgRNA can be less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewer nucleotides in length; and tracr RNA can be 30 or 50 nucleotides in length. In some embodiments, the degree of complementarity between a guide sequence and its corresponding target sequence is greater than 94.5% or 95% or 95.5% or 96% or 96.5% or 97% or 97.5% or 98% or 98.5% or 99% or 99.5% or 99.9%, or 100%. Off target is less than 100% or 99.9% or 99.5% or 99% or 99% or 98.5% or 98% or 97.5% or 97% or 96.5% or 96% or 95.5% or 95% or 94.5% or 94% or 93% or 92% or 91% or 90% or 89% or 88% or 87% or 86% or 85% or 84% or 83% or 82% or 81% or 80% complementarity between the sequence and the guide, with it being advantageous that off target is 100% or 99.9% or 99.5% or 99% or 99% or 98.5% or 98% or 97.5% or 97% or 96.5% or 96% or 95.5% or 95% or 94.5% complementarity between the sequence and the guide.
[0155] In some embodiments according to the invention, the guide RNA (capable of guiding Cas to a target locus) may comprise (1) a guide sequence capable of hybridizing to a genomic target locus in the eukaryotic cell; (2) a tracr sequence; and (3) a tracr mate sequence. All of (1) to (3) may reside in a single RNA, i.e., an sgRNA (arranged in a 5’ to 3’ orientation), or the tracr RNA may be a different RNA than the RNA containing the guide and tracr sequence. The tracr hybridizes to the tracr mate sequence and directs the CRISPR / Cas complexAttorney Docket 44010.202WO-PCT / / CU24243to the target sequence. Where the tracr RNA is on a different RNA than the RNA containing the guide and tracr sequence, the length of each RNA may be optimized to be shortened from their respective native lengths, and each may be independently chemically modified to protect from degradation by cellular RNase or otherwise increase stability.
[0156] Many modifications to guide sequences are known in the art and are further contemplated within the context of this invention. Various modifications may be used to increase the specificity of binding to the target sequence and / or increase the activity of the Cas protein and / or reduce off-target effects. Example guide sequence modifications are described in International Patent Application No. PCT US2019 / 045582, specifically paragraphs
[0178] -
[0333] , which is incorporated herein by reference.Target Sequences, PAMs, and PFSs
[0157] In the context of formation of a CRISPR complex, “target sequence” refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. In other words, the target polynucleotide can be a polynucleotide or a part of a polynucleotide to which a part of the guide sequence is designed to have complementarity with and to which the effector function mediated by the complex comprising the CRISPR effector protein and a guide molecule is to be directed. In some embodiments, a target sequence is located in the nucleus or cytoplasm of a cell.
[0158] PAM elements are sequences that can be recognized and bound by Cas proteins. Cas proteins / effector complexes can then unwind the dsDNA at a position adjacent to the PAM element. It will be appreciated that Cas proteins and systems target RNA do not require PAM sequences (Marraffini et al. 2010. Nature. 463:568-571). Instead, many rely on PFSs, which are discussed elsewhere herein. In one example embodiment, the target sequence should be associated with a PAM (protospacer adjacent motif) or PFS (protospacer flanking sequence or site), that is, a short sequence recognized by the CRISPR complex. Depending on the nature of the CRISPR-Cas protein, the target sequence should be selected, such that its complementary sequence in the DNA duplex (also referred to herein as the non-target sequence) is upstream or downstream of the PAM. In the embodiments, the complementary sequence of the target sequence is downstream or 3’ of the PAM or upstream or 5’ of the PAM. The precise sequence and length requirements for the PAM differ depending on the Cas protein used, but PAMs are typically 2-5 base pair sequences adjacent the protospacer (that is, the target sequence). TheAttorney Docket 44010.202WO-PCT / / CU24243ability to recognize different PAM sequences depends on the Cas polypeptide(s) included in the system. See e.g., Gleditzsch et al. 2019. RNA Biology. 16(4):504-517.
[0159] In a preferred embodiment, the CRISPR effector protein may recognize a 3’ PAM. In one example embodiment, the CRISPR effector protein may recognize a 3’ PAM which is 5’H, wherein H is A, C or U.
[0160] Further, engineering of the PAM Interacting (PI) domain on the Cas protein may allow programing of PAM specificity, improve target site recognition fidelity, and increase the versatility of the CRISPR-Cas protein, for example as described for Cas9 in Kleinstiver BP et al. Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jul 23;523(7561):481-5. doi: 10.1038 / nature14592. As further detailed herein, the skilled person will understand that Casl3 proteins may be modified analogously. Gao et al, “Engineered Cpfl Enzymes with Altered PAM Specificities,” bioRxiv 091611; doi: http: / / dx.doi.org / 10.1101 / 091611 (Dec. 4, 2016). Doench etal. created a pool of sgRNAs, tiling across all possible target sites of a panel of six endogenous mouse and three endogenous human genes and quantitatively assessed their ability to produce null alleles of their target gene by antibody staining and flow cytometry. The authors showed that optimization of the PAM improved activity and also provided an on-line tool for designing sgRNAs.
[0161] PAM sequences can be identified in a polynucleotide using an appropriate design tool, which are commercially available as well as online. Such freely available tools include, but are not limited to, CRISPRFinder and CRISPRTarget. Mojica et al. 2009. Microbiol.155(Pt. 3):733-740; Atschul et al. 1990. J. Mol. Biol. 215:403-410; Biswass et al. 2013 RNA Biol. 10:817-827; and Grissa et al. 2007. Nucleic Acid Res. 35: W52-57. Experimental approaches to PAM identification can include, but are not limited to, plasmid depletion assays (Jiang et al. 2013. Nat. Biotechnol. 31:233-239; Esvelt et al. 2013. Nat. Methods. 10:1116-1121; Kleinstiver et al. 2015. Nature. 523:481-485), screened by a high-throughput in vivo model called PAM-SCNAR (Pattanayak et al. 2013. Nat. Biotechnol. 31:839-843 and Leenay et al. 2016. Mol. Cell. 16:253), and negative screening (Zetsche et al. 2015. Cell. 163:759-771).
[0162] As previously mentioned, CRISPR-Cas systems that target RNA do not typically rely on PAM sequences. Instead, such systems typically recognize protospacer flanking sites (PFSs) instead of PAMs Thus, Type VI CRISPR-Cas systems typically recognize protospacer flanking sites (PFSs) instead of PAMs. PFSs represents an analogue to PAMs for RNA targets. Type VI CRISPR-Cas systems employ a Casl3. Some Cas 13 proteins analyzed to date, suchAttorney Docket 44010.202WO-PCT / / CU24243as Casl3a (C2c2) identified from Leptotrichia shahii (LShCAsl3a) have a specific discrimination against G at the 3 ’end of the target RNA. The presence of a C at the corresponding crRNA repeat site can indicate that nucleotide pairing at this position is rejected. However, some Casl3 proteins (e.g., LwaCAsl3a and PspCasl3b) do not seem to have a PFS preference. See e.g., Gleditzsch et al. 2019. RNA Biology. 16(4):504-517.
[0163] Some Type VI proteins, such as subtype B, have 5 '-recognition of D (G, T, A) and a 3'-motif requirement of NAN or NNA. One example is the Casl3b protein identified in Bergeyella zoohelcum (BzCasl3b). See e.g., Gleditzsch et al. 2019. RNA Biology. 16(4):504-517.
[0164] Overall Type VI CRISPR-Cas systems appear to have less restrictive rules for substrate (e.g., target sequence) recognition than those that target DNA (e.g., Type V and type II).Sequences related to nucleus targeting and transportation
[0165] In some embodiments, one or more components (e.g., the Cas protein) in the composition for engineering cells may comprise one or more sequences related to nucleus targeting and transportation. Such sequences may facilitate the one or more components in the composition for targeting a sequence within a cell. In order to improve targeting of the CRISPR-Cas protein used in the methods of the present disclosure to the nucleus, it may be advantageous to provide one or both of these components with one or more nuclear localization sequences (NLSs).
[0166] In some embodiments, a component (e.g., the dead Cas protein, the functional domain protein or catalytic domain thereof, or a combination thereof) in the systems may comprise one or more nuclear export signals (NES), one or more nuclear localization signals (NLS), or any combinations thereof. In some cases, the NES may be an HIV Rev NES. In certain cases, the NES may be MARK NES. When the component is a protein, the NES or NLS may be at the C terminus of component. Alternatively, or additionally, the NES or NLS may be at the N terminus of component. In some examples, the Cas protein and optionally said functional domain protein or catalytic domain thereof comprise one or more heterologous nuclear export signal(s) (NES(s)) or nuclear localization signal(s) (NLS(s)), preferably an HIV Rev NES or MARK NES, preferably C-terminal.Attorney Docket 44010.202WO-PCT / / CU24243OMEGA systems
[0167] In one example embodiment, the programmable nuclease to modify the one or more target genes is a transposon-encoded RNA-guided nuclease system, referred to herein as OMEGA (obligate mobile element-guided activity). See, e.g., Altae-Tran H, Kannan S, Demircioglu FE, et al. The widespread IS200 / IS605 transposon family encodes diverse programmable RNA-guided endonucleases. Science. 2021;374(6563):57-65. OMEGA systems include, but are not limited to IscB, IsrB, TnpB systems.
[0168] In some embodiments, the nucleic acid-guided nucleases herein may be an IscB protein (see, e.g., International patent application publication No. WO2022087494A1; and Altae-Tran H, et al. 2021). An IscB protein may comprise an X domain and a Y domain as described herein. In some examples, the IscB proteins may form a complex with one or more guide molecules. In some cases, the IscB proteins may form a complex with one or more hRNA molecules which serve as a scaffold molecule and comprise guide sequences. In some examples, the IscB proteins are CRISPR-associated proteins, e.g., the loci of the nucleases are associated with an CRISPR array. In some examples, the IscB proteins are not CRISPR-associated. In some examples, the IscB protein may be homolog or ortholog of IscB proteins described in Kapitonov VV et al., ISC, a Novel Group of Bacterial and Archaeal DNA Transposons That Encode Cas9 Homologs, J Bacteriol. 2015 Dec 28;198(5):797-807. doi: 10.1128 / JB.00783-15, which is incorporated by reference herein in its entirety.
[0169] In some embodiments, the nucleic acid-guided nucleases herein may be an IsrB (Insertion sequence RuvC-like OrfB) protein (see, e.g., International patent application publication No. WO2022087494A1; and Altae-Tran H, et al. 2021). IsrB refers to a group of shorter, -350 aa IscB homologs that are also encoded in IS200 / 605 superfamily transposons. These proteins contain a PLMP domain and split RuvC but lack the HNH domain.
[0170] In some embodiments, the nucleic acid-guided nucleases herein may be a TnpB protein (see, e.g., International patent application publication No. WO2022159892A1; and Altae-Tran H, et al. 2021). TnpB is a putative endonuclease distantly related to IscB and thought to be the ancestor of Casl2, the type V CRISPR effector. The TnpB system comprises a TnpB polypeptide and a nucleic acid component capable of forming a complex with the TnpB polypeptide and directing the complex to a target polynucleotide. The TnpB systems and TnpB / nucleic acid component complexes may also be referred to herein as OMEGA (Obligate Mobile Element Guided Activity) systems or complexes, or W systems or complexes for short.Attorney Docket 44010.202WO-PCT / / CU24243TnpB systems are a distinct type of W system, which further include IscB, IsrB, and IshB systems. The nucleic acid component of W systems is structurally distinct from other RNA-guided nucleases, such as CRISPR-Cas systems, and may also be referred to as a wRNA. In certain example embodiments, the TnpB systems are RNA-predominate, that is the nucleic acid component makes a larger contribution to the overall size of the TnpB complex relative to other RNA-guided nuclease systems such as CRISPR-Cas. Also, given the more minimal structural features of TnpB relative other known programmable nucleases such as CRISPR-Cas, the polynucleotide binding pocket is open and more accessible, which can facilitate greater access to and ability to manipulate, modify, edit, remove, or delete nucleotides at a target region on the bound polynucleotide.
[0171] Accordingly, it is contemplated within the scope of the present invention that OMEGA systems may be used in place of CRISPR-Cas systems due to their reprogrammable nature. These embodiments include further modified versions of CRISPR-Cas systems such as base editing systems, prime editing systems, CAST systems, and non-LTR retrotransposons, as discussed below.Zinc Finger Nucleases
[0172] In some embodiments, the polynucleotide is modified using a zinc finger nuclease or system thereof. One type of programmable DNA-binding domain is provided by artificial zinc-finger (ZF) technology, which involves arrays of ZF modules to target new DNA-binding sites in the genome. Each finger module in a ZF array targets three DNA bases. A customized array of individual zinc finger domains is assembled into a ZF protein (ZFP).
[0173] ZFPs can comprise a functional domain. The first synthetic zinc finger nucleases (ZFNs) were developed by fusing a ZF protein to the catalytic domain of the Type IIS restriction enzyme Fokl. (Kim, Y. G. et al., 1994, Chimeric restriction endonuclease, Proc. Natl. Acad. Sci. U. S. A. 91, 883-887; Kim, Y. G. et al., 1996, Hybrid restriction enzymes: zinc finger fusions to Fok I cleavage domain. Proc. Natl. Acad. Sci. U. S. A. 93, 1156-1160). Increased cleavage specificity can be attained with decreased off target activity by use of paired ZFN heterodimers, each targeting different nucleotide sequences separated by a short spacer. (Doyon, Y. et al., 2011, Enhancing zinc-finger-nuclease activity with improved obligate heterodimeric architectures. Nat. Methods 8, 74-79). ZFPs can also be designed as transcription activators and repressors and have been used to target many genes in a wide variety of organisms. Exemplary methods of genome editing using ZFNs can be found forAttorney Docket 44010.202WO-PCT / / CU24243example in U. S. Patent Nos. 6,534,261, 6,607,882, 6,746,838, 6,794,136, 6,824,978, 6,866,997, 6,933,113, 6,979,539, 7,013,219, 7,030,215, 7,220,719, 7,241,573, 7,241,574, 7,585,849, 7,595,376, 6,903,185, and 6,479,626, all of which are specifically incorporated by reference.
[0174] Accordingly, it is contemplated within the scope of the present invention that Zn finger nucleases may be used in place of CRISPR-Cas systems due to their reprogrammable nature. These embodiments include further modified versions of CRISPR-Cas systems such as base editing systems, prime editing systems, CAST systems, and non-LTR retrotransposons, as discussed below.TALE Nucleases
[0175] In some embodiments, a TALE nuclease or TALE nuclease system can be used to modify a polynucleotide. In some embodiments, the methods provided herein use isolated, non-naturally occurring, recombinant or engineered DNA binding proteins that comprise TALE monomers or TALE monomers or half monomers as a part of their organizational structure that enable the targeting of nucleic acid sequences with improved efficiency and expanded specificity.
[0176] Naturally occurring TALEs or “wild type TALEs” are nucleic acid binding proteins secreted by numerous species of proteobacteria. TALE polypeptides contain a nucleic acid binding domain composed of tandem repeats of highly conserved monomer polypeptides that are predominantly 33, 34 or 35 amino acids in length and that differ from each other mainly in amino acid positions 12 and 13. In advantageous embodiments the nucleic acid is DNA. As used herein, the term “polypeptide monomers”, “TALE monomers” or “monomers” will be used to refer to the highly conserved repetitive polypeptide sequences within the TALE nucleic acid binding domain and the term “repeat variable di-residues” or “RVD” will be used to refer to the highly variable amino acids at positions 12 and 13 of the polypeptide monomers. As provided throughout the disclosure, the amino acid residues of the RVD are depicted using the TUPAC single letter code for amino acids. A general representation of a TALE monomer which is comprised within the DNA binding domain is Xi-n-(Xi2Xi3)-Xi4-33 or 34 or 35, where the subscript indicates the amino acid position and X represents any amino acid. X12X13 indicate the RVDs. In some polypeptide monomers, the variable amino acid at position 13 is missing or absent and in such monomers, the RVD consists of a single amino acid. In such cases the RVD may be alternatively represented as X*, where X represents X12 and (*) indicates that X13Attorney Docket 44010.202WO-PCT / / CU24243is absent. The DNA binding domain comprises several repeats of TALE monomers and this may be represented as (Xi-n-(Xi2Xi3)-Xi4-33 or 34 or 3s)z, where in an advantageous embodiment, z is at least 5 to 40. In a further advantageous embodiment, z is at least 10 to 26.
[0177] The TALE monomers can have a nucleotide binding affinity that is determined by the identity of the amino acids in its RVD. For example, polypeptide monomers with an RVD of NI can preferentially bind to adenine (A), monomers with an RVD of NG can preferentially bind to thymine (T), monomers with an RVD of HD can preferentially bind to cytosine (C) and monomers with an RVD of NN can preferentially bind to both adenine (A) and guanine (G). In some embodiments, monomers with an RVD of IG can preferentially bind to T. Thus, the number and order of the polypeptide monomer repeats in the nucleic acid binding domain of a TALE determines its nucleic acid target specificity. In some embodiments, monomers with an RVD of NS can recognize all four base pairs and can bind to A, T, G or C. The structure and function of TALEs is further described in, for example, Moscou et al., Science 326:1501 (2009); Boch et al., Science 326:1509-1512 (2009); and Zhang et al., Nature Biotechnology 29:149-153 (2011).
[0178] The polypeptides used in methods of the invention can be isolated, non-naturally occurring, recombinant or engineered nucleic acid-binding proteins that have nucleic acid or DNA binding regions containing polypeptide monomer repeats that are designed to target specific nucleic acid sequences.
[0179] As described herein, polypeptide monomers having an RVD of HN or NH preferentially bind to guanine and thereby allow the generation of TALE polypeptides with high binding specificity for guanine containing target nucleic acid sequences. In some embodiments, polypeptide monomers having RVDs RN, NN, NK, SN, NH, KN, HN, NQ, HH, RG, KH, RH and SS can preferentially bind to guanine. In some embodiments, polypeptide monomers having RVDs RN, NK, NQ, HH, KH, RH, SS and SN can preferentially bind to guanine and can thus allow the generation of TALE polypeptides with high binding specificity for guanine containing target nucleic acid sequences. In some embodiments, polypeptide monomers having RVDs HH, KH, NH, NK, NQ, RH, RN and SS can preferentially bind to guanine and thereby allow the generation of TALE polypeptides with high binding specificity for guanine containing target nucleic acid sequences. In some embodiments, the RVDs that have high binding specificity for guanine are RN, NH RH and KH. Furthermore, polypeptide monomers having an RVD of NV can preferentially bind to adenine and guanine. In someAttorney Docket 44010.202WO-PCT / / CU24243embodiments, monomers having RVDs of H*, HA, KA, N*, NA, NC, NS, RA, and S* bind to adenine, guanine, cytosine and thymine with comparable affinity.
[0180] The predetermined N-terminal to C-terminal order of the one or more polypeptide monomers of the nucleic acid or DNA binding domain determines the corresponding predetermined target nucleic acid sequence to which the polypeptides of the invention will bind. As used herein the monomers and at least one or more-half monomers are “specifically ordered to target” the genomic locus or gene of interest. In plant genomes, the natural TALE-binding sites always begin with a thymine (T), which may be specified by a cryptic signal within the non-repetitive N-terminus of the TALE polypeptide; in some cases, this region may be referred to as repeat 0. In animal genomes, TALE binding sites do not necessarily have to begin with a thymine (T) and polypeptides of the invention may target DNA sequences that begin with T, A, G or C. The tandem repeat of TALE monomers always ends with a half-length repeat or a stretch of sequence that may share identity with only the first 20 amino acids of a repetitive full-length TALE monomer and this half repeat may be referred to as a halfmonomer. Therefore, it follows that the length of the nucleic acid or DNA being targeted is equal to the number of full monomers plus two.
[0181] As described in Zhang et al., Nature Biotechnology 29:149-153 (2011), TALE polypeptide binding efficiency may be increased by including amino acid sequences from the “capping regions” that are directly N-terminal or C-terminal of the DNA binding region of naturally occurring TALEs into the engineered TALEs at positions N-terminal or C-terminal of the engineered TALE DNA binding region. Thus, in certain embodiments, the TALE polypeptides described herein further comprise an N-terminal capping region and / or a C-terminal capping region.
[0182] As used herein the predetermined “N-terminus” to “C terminus” orientation of the N-terminal capping region, the DNA binding domain comprising the repeat TALE monomers and the C-terminal capping region provide structural basis for the organization of different domains in the d-TALEs or polypeptides of the invention.
[0183] The entire N-terminal and / or C-terminal capping regions are not necessary to enhance the binding activity of the DNA binding region. Therefore, in certain embodiments, fragments of the N-terminal and / or C-terminal capping regions are included in the TALE polypeptides described herein.Attorney Docket 44010.202WO-PCT / / CU24243
[0184] In certain embodiments, the TALE polypeptides described herein contain a N-terminal capping region fragment that included at least 10, 20, 30, 40, 50, 54, 60, 70, 80, 87, 90, 94, 100, 102, 110, 117, 120, 130, 140, 147, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260 or 270 amino acids of an N-terminal capping region. In certain embodiments, the N-terminal capping region fragment amino acids are of the C-terminus (the DNA-binding region proximal end) of an N-terminal capping region. As described in Zhang et al., Nature Biotechnology 29:149-153 (2011), N-terminal capping region fragments that include the C-terminal 240 amino acids enhance binding activity equal to the full length capping region, while fragments that include the C-terminal 147 amino acids retain greater than 80% of the efficacy of the full length capping region, and fragments that include the C-terminal 117 amino acids retain greater than 50% of the activity of the full-length capping region.
[0185] In some embodiments, the TALE polypeptides described herein contain a C-terminal capping region fragment that included at least 6, 10, 20, 30, 37, 40, 50, 60, 68, 70, 80, 90, 100, 110, 120, 127, 130, 140, 150, 155, 160, 170, 180 amino acids of a C-terminal capping region. In certain embodiments, the C-terminal capping region fragment amino acids are of the N-terminus (the DNA-binding region proximal end) of a C-terminal capping region. As described in Zhang et al., Nature Biotechnology 29: 149-153 (2011), C-terminal capping region fragments that include the C-terminal 68 amino acids enhance binding activity equal to the full-length capping region, while fragments that include the C-terminal 20 amino acids retain greater than 50% of the efficacy of the full-length capping region.
[0186] In certain embodiments, the capping regions of the TALE polypeptides described herein do not need to have identical sequences to the capping region sequences provided herein. Thus, in some embodiments, the capping region of the TALE polypeptides described herein have sequences that are at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical or share identity to the capping region amino acid sequences provided herein. Sequence identity is related to sequence homology. Homology comparisons may be conducted by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs may calculate percent (%) homology between two or more sequences and may also calculate the sequence identity shared by two or more amino acid or nucleic acid sequences. In some preferred embodiments, the capping region of the TALE polypeptides described herein have sequencesAttorney Docket 44010.202WO-PCT / / CU24243that are at least 95% identical or share identity to the capping region amino acid sequences provided herein.
[0187] Sequence homologies can be generated by any of a number of computer programs known in the art, which include but are not limited to BLAST or FASTA. Suitable computer programs for carrying out alignments like the GCG Wisconsin Bestfit package may also be used. Once the software has produced an optimal alignment, it is possible to calculate % homology, preferably % sequence identity. The software typically does this as part of the sequence comparison and generates a numerical result.
[0188] In some embodiments described herein, the TALE polypeptides of the invention include a nucleic acid binding domain linked to the one or more effector domains. The terms “effector domain” or “regulatory and functional domain” refer to a polypeptide sequence that has an activity other than binding to the nucleic acid sequence recognized by the nucleic acid binding domain. By combining a nucleic acid binding domain with one or more effector domains, the polypeptides of the invention may be used to target the one or more functions or activities mediated by the effector domain to a particular target DNA sequence to which the nucleic acid binding domain specifically binds.
[0189] In some embodiments of the TALE polypeptides described herein, the activity mediated by the effector domain is a biological activity. For example, in some embodiments the effector domain is a transcriptional inhibitor (i.e., a repressor domain), such as an mSin interaction domain (SID). SID4X domain or a Kriippel-associated box (KRAB) or fragments of the KRAB domain. In some embodiments, the effector domain is an enhancer of transcription (i.e., an activation domain), such as the VP16, VP64 or p65 activation domain. In some embodiments, the nucleic acid binding is linked, for example, with an effector domain that includes but is not limited to a transposase, integrase, recombinase, resolvase, invertase, protease, DNA methyltransferase, DNA demethylase, histone acetylase, histone deacetylase, nuclease, transcriptional repressor, transcriptional activator, transcription factor recruiting, protein nuclear-localization signal or cellular uptake signal.
[0190] In some embodiments, the effector domain is a protein domain which exhibits activities which include but are not limited to transposase activity, integrase activity, recombinase activity, resolvase activity, invertase activity, protease activity, DNA methyltransferase activity, DNA demethylase activity, histone acetylase activity, histone deacetylase activity, nuclease activity, nuclear-localization signaling activity, transcriptionalAttorney Docket 44010.202WO-PCT / / CU24243repressor activity, transcriptional activator activity, transcription factor recruiting activity, or cellular uptake signaling activity. Other preferred embodiments of the invention may include any combination of the activities described herein.
[0191] Accordingly, it is contemplated within the scope of the present invention that TALE nucleases may be used in place of CRISPR-Cas systems due to their reprogrammable nature. These embodiments include further modified versions of CRISPR-Cas systems such as base editing systems, prime editing systems, CAST systems, and non-LTR retrotransposons, as discussed below.Meganucleases
[0192] In some embodiments, a meganuclease or system thereof can be used to modify a polynucleotide. Meganucleases, which are endodeoxyribonucleases characterized by a large recognition site (double-stranded DNA sequences of 12 to 40 base pairs). Exemplary methods for using meganucleases can be found in US Patent Nos. 8,163,514, 8,133,697, 8,021,867, 8,119,361, 8,119,381, 8,124,369, and 8,129,134, which are specifically incorporated herein by reference.
[0193] Accordingly, it is contemplated within the scope of the present invention that meganucleases may be used in place of CRISPR-Cas systems due to their reprogrammable nature. These embodiments include further modified versions of CRISPR-Cas systems such as base editing systems, prime editing systems, CAST systems, and non-LTR retrotransposons, as discussed below.Other Genetic Modification Systems
[0194] A number of alternative gene modification systems have been developed that utilize the target specificity of a programmable nuclease but that modify or replace that nuclease activity with another functional activity. For example, programmable nucleases may be modified such that they cleave only a single-strand as opposed to both strands of a target polynucleotide. Such “nickases” may then be paired with other functional domains such as reverse transcriptases, recombinases and non-LTR retrotransposon polypeptides to make genetic modifications that do not rely on creating double strand breaks. Similarly, programmable nucleases may also be modified to eliminate the nuclease activity altogether. These catalytically inactive or “dead” nucleases may then be combined with other functional domains like nucleotide deaminases, transposases, non-LTR retrotransposon polypeptides,Attorney Docket 44010.202WO-PCT / / CU24243methylases, deactylases, and acetylases, among other domains. The following provides further examples of gene modification systems that may be used in the context of the present invention. For ease of reference the gene modifications systems that follow will be discussed in the context of using CRISPR-Cas as the programmable nuclease system, but it is contemplated within the scope of this invention that the nickase or dead Cas versions described below could be replaced by a comparable nickase or dead nuclease variant of other programmable nucleases / systems such as OMEGA systems, Zn finger nucleases, TALE nucleases, and meganucleases.DNA and RNA Base Editing
[0195] In example embodiments, the method of disrupting Rad binding to voltage-gated calcium channels comprises administering a DNA or RNA base editing system to either decrease expression of Rad or modify either Rad and / or Cavβ₂. In one example embodiment, a catalytically inactive Cas protein is connected or fused to a nucleotide deaminase. As used herein, “base editing” refers generally to the process of polynucleotide modification via a CRISPR-Cas-based or Cas-based system that does not include excising nucleotides to make the modification. Base editing can convert base pairs at precise locations without generating excess undesired editing byproducts that can be made using traditional CRISPR-Cas systems. Accordingly, in one example embodiment, the base editing system edits the Rad to reduce or eliminate its expression or to increase its expression.
[0196] In one example embodiment, the nucleotide deaminase may be a DNA base editor used in combination with a DNA binding Cas protein such as, but not limited to, Class 2 Type II and Type V systems. Two classes of DNA base editors are generally known: cytosine base editors (CBEs) and adenine base editors (ABEs). CBEs convert a C•G base pair into a T•A base pair (Komor et al. 2016. Nature. 533:420-424; Nishida et al. 2016. Science. 353; and Li et al. Nat. Biotech. 36:324-327) and ABEs convert an A•T base pair to a G•C base pair. Collectively, CBEs and ABEs can mediate all four possible transition mutations (C to T, A to G, T to C, and Gto A). Rees and Liu. 2018. Nat. Rev. Genet. 19(12): 770-788, particularly at Figures lb, 2a-2c, 3a-3f, and Table 1. In some embodiments, the base editing system includes a CBE and / or an ABE. In some embodiments, a polynucleotide of the present invention described elsewhere herein can be modified using a base editing system. Rees and Liu. 2018. Nat. Rev. Gent. 19(12):770-788. Base editors also generally do not need a DNA donor template and / or rely on homology-directed repair. Komor et al. 2016. Nature. 533:420-424; Nishida etAttorney Docket 44010.202WO-PCT / / CU24243al. 2016. Science. 353; and Gaudeli et al. 2017. Nature. 551:464-471. Upon binding to a target locus in the DNA, base pairing between the guide RNA of the system and the target DNA strand leads to displacement of a small segment of ssDNA in an “R-loop”. Nishimasu et al. Cell. 156:935-949. DNA bases within the ssDNA bubble are modified by the enzyme component, such as a deaminase. In some systems, the catalytically disabled Cas protein can be a variant or modified Cas can have nickase functionality and can generate a nick in the nonedited DNA strand to induce cells to repair the non-edited strand using the edited strand as a template. Komor et al. 2016. Nature. 533:420-424; Nishida et al. 2016. Science. 353; and Gaudeli et al. 2017. Nature. 551:464-471.
[0197] Other Example Type V base editing systems are described in International Patent Publication Nos. WO 2018 / 213708, WO 2018 / 213726, and International Patent Applications No. PCT / US2018 / 067207, PCT / US2018 / 067225, and PCT / US2018 / 067307, each of which is incorporated herein by reference.
[0198] In one example embodiment, the base editing system may be an RNA base editing system. As with DNA base editors, a nucleotide deaminase capable of converting nucleotide bases may be fused to a Cas protein. However, in these embodiments, the Cas protein will need to be capable of binding RNA. Example RNA binding Cas proteins include, but are not limited to, RNA-binding Cas9s such as Francisella novicida Cas9 (“FnCas9”), and Class 2 Type VI Cas systems. The nucleotide deaminase may be a cytidine deaminase or an adenosine deaminase, or an adenosine deaminase engineered to have cytidine deaminase activity. In certain example embodiments, the RNA base editor may be used to delete or introduce a posttranslation modification site in the expressed mRNA. In contrast to DNA base editors, whose edits are permanent in the modified cell, RNA base editors can provide edits where finer, temporal control may be needed, for example in modulating a particular cardiomyocyte response. Example Type VI RNA-base editing systems are described in Cox et al. 2017. Science 358: 1019-1027, International Patent Publication Nos. WO 2019 / 005884, WO 2019 / 005886, and WO 2019 / 071048, and International Patent Application Nos. PCT / US2018 / 05179 and PCT / US2018 / 067207, which are incorporated herein by reference. An example FnCas9 system that may be adapted for RNA base editing purposes is described in International Patent Publication No. WO2016 / 106236, which is incorporated herein by reference. RNA base editors enable targeted RNA editing without modifying the underlying DNA sequence and may be useful where more temporal control of gene expression is desired.Attorney Docket 44010.202WO-PCT / / CU24243
[0199] An example method for delivery of base-editing systems, including use of a split-intein approach to divide CBE and ABE into reconstitutable halves, is described in Levy et al. Nature Biomedical Engineering doi.org / 10.1038 / s41441-019-0505-5 (2019), which is incorporated herein by reference.ARCUS Base Editing
[0200] In one example embodiment, a target gene is modified with an ARCUS base editing system. Exemplary methods for using ARCUS can be found in US Patent No. 10,851,358, US Publication No. 2020-0239544, and WIPO Publication No. 2020 / 206231 which are incorporated herein by reference.Prime Editors
[0201] In one example embodiment, a prime editing system is used to either decrease expression or modify Rad or Cavβ₂. Prime editing systems comprise a programable nuclease (e.g. Cas), most often a nickase, linked to a reverse transcriptase domain and a guide molecule (prime editing guide pegRNA), which comprises a target-specific spacer, a primer binding site, and RT template. See e.g., Anzalone et al. 2019. Nature. 576: 149-157; and International Patent Application Publication No. W02022150790A2. In some embodiments, the prime editing guide molecule can specify both the target polynucleotide information (e.g., sequence) and contain a new polynucleotide cargo that replaces target polynucleotides. To initiate transfer from the guide molecule to the target polynucleotide, the PE system can nick the target polynucleotide at a target side to expose a 3 ’hydroxyl group, which can prime reverse transcription of an edit-encoding extension region of the guide molecule (e.g., a prime editing guide molecule or peg guide molecule) directly into the target site in the target polynucleotide. See e.g., Anzalone et al. 2019. Nature. 576: 149-157, particularly at Figures lb, 1c, related discussion, and Supplementary discussion.
[0202] Prime editing systems can also be used in tandem such that, the two pegRNAs template the synthesis of complementary DNA flaps on opposing strands of genomic DNA, which replace the endogenous DNA sequence between the PE-induced nick sites. See, e.g., Anzalone AV, Gao XD, Podracky CJ, et al. Programmable deletion, replacement, integration, and inversion of large DNA sequences with twin prime editing. Nat Biotechnol.2022;40(5):731-740. Thus, use of two pegRNAs allows for larger insertions or deletions because of the two overlapping 3’ flaps created by the two nicked sites. In one exampleAttorney Docket 44010.202WO-PCT / / CU24243embodiment, the system can be used to insert or replace a sequence into one or more target genes. In example embodiments, the insertion or replacement results in an inactive target gene or less active form of the target gene. In one example embodiment, the system is used to replace all or a portion of the entire target gene. In one example embodiment, the system is used to replace all or a portion of an enhancer controlling the target gene expression.CRISPR Associated Transposase (CAST) Systems
[0203] CAST systems are able to insert DNA sequences at a target site in a DNA molecule without relying on host cell repair machinery. CAST systems can be Class 1 or Class 2 CAST systems. For example, a Class 1 system is described in Klompe et al. Nature, doi: 10.1038 / s41586-019- 1323, which is in incorporated herein by reference. An example Class 2 system is described in Strecker et al. Science. 10 / 1126 / science. aax9181 (2019), and PCT / US2019 / 066835 which are incorporated herein by reference. Suitable hybrid systems have also been described such as those described in Tou et al. bioRxiv 2022.01.07.475005, doi. org / 10.1101 / 2022.01.07.475005, which is incorporated herein by reference.Transcription Repressors and Transcription Activators
[0204] In some embodiments, the method includes modulating gene expression of Rad or Cavβ₂ by modifying DNA binding sites and / or methylation sites for one or more DNA binding or interaction molecules or complexes. In some embodiments, the DNA binding or interaction molecules comprise, transcriptional activators, and / or transcriptional repressors. In some embodiments, the method comprises administering or otherwise introducing an engineered transcriptional activator or repressor to one or more cells such that expression of Rad or Cavβ₂ is decreased or repressed.
[0205] CRISPR interference (CRISPRi) is a CRISPR-Cas system variant that allows selective silencing or repression of gene expression by sterically repressing transcription by blocking transcription initiation or elongation (see e.g., Li et al., Cell. 152 (5): 1173-1183 (2013) of a target gene that is targeted by the dCas component of the system. A CRISPRi system comprises a dCas (e.g., dCas9) fused or otherwise linked to a repressor protein or domain (e.g., a KRAB (Kriippel-associated box) domain, mSin3 A, NCoR (nuclear receptor corepressor, Lsdl (lysine-specific demethylase 1), MeCP2 (methyl-CpG-binding protein 2, HP1 (heterochromatin protein 1), and REST (RE 1 -silencing transcription factor)). In operation, the dCas portion is directed to a target gene whose expression is to be repressed, by a target geneAttorney Docket 44010.202WO-PCT / / CU24243specific guide RNA. The repressor domain then represses transcription by blocking initiation and / or elongation. In some embodiments, repression of gene transcription is greater than 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, up to and including 100%.Vectors for administering agents
[0206] In general, and throughout this specification, the term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Vectors include, but are not limited to, nucleic acid molecules that are single-stranded, double-stranded, or partially double-stranded; nucleic acid molecules that comprise one or more free ends, no free ends (e.g., circular); nucleic acid molecules that comprise DNA, RNA, or both; and other varieties of polynucleotides known in the art. There are no limitations regarding the type of vector that can be used. The vector can be a cloning vector, suitable for propagation and for obtaining polynucleotides, gene constructs or expression vectors incorporated to several heterologous organisms. Suitable vectors include eukaryotic expression vectors based on viral vectors (e.g., adenoviruses, adeno-associated viruses (AAV), as well as retroviruses and lentiviruses), as well as non-viral vectors such as plasmids.
[0207] In example embodiments, a vector comprises an expression cassette comprising a cardiomyocyte-specific regulatory region (e.g., promoter) operably linked to a polynucleotide encoding for the agent to be delivered, such as a genetic modifying agent or component thereof. Suitable cardiomyocyte-specific regulatory elements include, without limitation, promoters and enhancers derived from myosin heavy chain 6 (Myh6, also known as a-MHC), myosin heavy chain 7 (Myh7, P-MHC), cardiac troponin T (Tnnt2), cardiac troponin I (Tnni3), natriuretic peptide A (Nppa, ANF), natriuretic peptide B (Nppb, BNP), actinin alpha 2 (Actn2), and myocyte enhancer factor-2 (MEF2)-responsive regulatory elements. In example embodiments, the regulatory region comprises a composite promoter or enhancer-promoter cassette engineered to improve cardiomyocyte-specific expression, including ventricular-specific, atrial-specific, or maturation-dependent expression patterns. Any cardiomyocyte-specific regulatory region known in the art, or variants, derivatives, or functionally equivalent sequences thereof, may be used to drive expression of the disclosed agents in cardiomyocytes.
[0208] In example embodiments, the vector has tropism for cardiomyocytes. Suitable vectors include, without limitation, viral and non-viral vectors known in the art. Viral vectors may comprise adeno-associated viruses (AAV), including AAV1, AAV6, AAV8, AAV9, andAttorney Docket 44010.202WO-PCT / / CU24243engineered or chimeric AAV capsids with enhanced cardiac tropism; adenoviral vectors, including helper-dependent (gutless) adenoviral vectors; lentiviral vectors; and retroviral vectors. Non-viral vectors may include plasmid DNA vectors, self-replicating RNA vectors, synthetic mRNA formulated in lipid nanoparticles (LNPs), polymer-based nanoparticles, peptide-based delivery systems, minicircle DNA vectors, and exosome-based delivery vehicles. Any vector capable of preferentially delivering or expressing its payload in cardiomyocytes may be used.
[0209] In one example embodiment, the vector is a viral vector, wherein virally-derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g., retroviruses, replication defective retroviruses, adenoviruses, replication defective adenoviruses, and adeno-associated viruses). Viral vectors also include polynucleotides carried by a virus for transfection into a host cell. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they encode. Such vectors are referred to herein as “expression vectors.” Vectors for and that result in expression in a eukaryotic cell can be referred to herein as “eukaryotic expression vectors.” In another example embodiment, the vector integrates the gene into the cell genome or is maintained episomally.
[0210] In one example embodiment, by means of an AAV viral vector. The terms “adeno-associated virus”, “AAV virion”, and “AAV particle”, as used interchangeably herein, refer to a virion composed of at least one AAV capsid protein (preferably all capsid proteins of a particular AAV serotype) and an encapsidated polynucleotide AAV genome. If the particle comprises a heterologous polynucleotide flanked by AAV inverted terminal repeats (i.e., a polynucleotide that is not a wild-type AAV genome, e.g., a transgene is delivered to a mammalian cell), it is often referred to as an “AAV vector particle” or “AAV vector”. AAV refers to a virus belonging to the genus Dependovirus in the Parvoviridae family. The AAV genome is approximately 4.7 kilobases long and consists of single-stranded deoxyribonucleic acid (ssDNA), which can be in either the positive or negative orientation. The genome comprises Inverted Terminal Repeats (ITRs), and two Open Reading Frames (ORFs), at both ends of the DNA strand: rep and cap. The Rep framework is formed by four overlapping genesAttorney Docket 44010.202WO-PCT / / CU24243encoding the Rep proteins required for the AAV life cycle. The cap framework contains overlapping nucleotide sequences of the capsid proteins: VP1, VP2, and VP3, which interact together to form an icosahedral symmetric capsid (see, e.g., Carter B, Adeno-assisted viruses and ado-assisted viruses vectors for genetic drive, Lassie D, et al, eds., “Gene Therapy: Therapeutic Mechanisms and Strategies” (Marcel Dekker, Inc., New York, NY, US, 2000); and Gao G, et al, J. Virol.2004; 78(12):6381-6388). The term “adeno-associated virus ITR” or “AAV ITR” as used herein refers to inverted terminal repeats present at both ends of the DNA strand of the genome of an adeno-associated virus. The ITR sequences are required for efficient proliferation of the AAV genome. Another characteristic of these sequences is their ability to form hairpins. This property contributes to its own priming, which allows synthesis of the second DNA strand independent of the priming enzyme. It has also been shown that ITRs are essential for integration and rescue of wild-type AAV DNA into the host cell genome (i.e., chromosome 19 of humans) and for efficient encapsidation of AAV DNA that binds to the resulting fully assembled, DNase-resistant AAV particles.
[0211] The term “AAV vector” as used herein further refers to a vector comprising one or more polynucleotides of interest (or transgenes) flanked by AAV terminal repeats (ITRs). Such AAV vectors can be replicated and packaged as infectious viral particles when present in a host cell that has been transfected with a vector that can encode and express Rep and Cap gene products (i.e., AAV Rep and Cap proteins), and wherein the host cell has been transfected with a vector that encodes and expresses proteins from adenovirus open reading frame E4orf6. When an AAV vector is incorporated into a larger polynucleotide (e.g., a chromosome or another vector, such as a plasmid for cloning or transfection), then the AAV vector is typically referred to as a “protein-vector”. This protein-vector can be “rescued” by replication and encapsidation in the presence of AAV packaging functions and the necessary helper functions provided by E4orf6.
[0212] In one example embodiment, gene therapy uses an adeno-associated viral (AAV) vector comprising a recombinant viral genome wherein said recombinant viral genome comprises an expression cassette comprising a cardiomyocyte-specific regulatory region (e.g., promoter) operably linked to a polynucleotide encoding for the agent to be delivered, such as a genetic modifying agent or component thereof. AAV according to the present invention can include any serotype of the 42 serotypes of AAV known or an engineered hybrid serotype. InAttorney Docket 44010.202WO-PCT / / CU24243example embodiments the AAV has tropism for cardiomyocytes (e.g., AAV9, AAV1, and / or AAV6, preferably, AAV9).
[0213] The genome of the AAV according to the invention typically comprises the cisacting 5' and 3' inverted terminal repeat sequences and an expression cassette (see, e.g., Tijsser P, Ed., “Handbook of Parvoviruses” (CRC Press, Boca Raton, FL, US, 1990, pp. 155-168)). The polynucleotide of the invention can comprise ITRs derived from any one of the AAV serotypes.
[0214] In another particular embodiment, the AAV vector is a pseudotyped AAV vector (i.e., the vector comprises sequences or components originating from at least two distinct AAV serotypes). In a particular embodiment, the pseudotyped AAV vector comprises an AAV genome derived from one AAV serotype (e.g., AAV9), and a capsid derived at least in part from a distinct AAV serotype. The AAV of the invention comprises a capsid from any serotype.
[0215] In one embodiment the AAV vector contains one promoter with the addition of at least one target sequence of at least one miRNA. In some embodiments, the miRNA is endogenous to cells in which it is undesirable to express the polynucleotide cargo of the AAV. Without being bound by theory, the endogenous miRNA would bind to its target sequence in a transcript produced from the polynucleotide cargo of the AAV and result in degradation of that transcript in the non-target cells.
[0216] In one example embodiment, the vector is a “plasmid,” which refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques.
[0217] In one example embodiment, the vector is an mRNA vector (see, e.g., Sahin, U, Kariko, K and Tureci, O (2014). mRNA-based therapeutics - developing a new class of drugs. Nat Rev Drug Discov 13: 759-780; Weissman D, Kariko K. mRNA: Fulfilling the Promise of Gene Therapy. Mol Ther. 2015;23(9):1416-1417. doi:10.1038 / mt.2015.138; Kowalski PS, Rudra A, Miao L, Anderson DG. Delivering the Messenger: Advances in Technologies for Therapeutic mRNA Delivery. Mol Ther. 2019;27(4):710-728. doi:10.1016 / j.ymthe.2019.02.012; Magadum A, Kaur K, Zangi L. mRNA-Based Protein Replacement Therapy for the Heart. Mol Ther. 2019;27(4):785-793. doi:10.1016 / j.ymthe.2018.11.018; Reichmuth AM, Oberli MA, Jaklenec A, Langer R, Blankschtein D. mRNA vaccine delivery using lipid nanoparticles Ther Deliv. 2016;7(5):319-334. doi:10.4155 / tde-2016-0006; and Khalil AS, Yu X, Umhoefer JM, et al. Single-doseAttorney Docket 44010.202WO-PCT / / CU24243mRNA therapy via biomaterial-mediated sequestration of overexpressed proteins. Sci Adv.2020;6(27):eaba2422). In an exemplary embodiment, mRNA encoding for an agent is delivered using lipid nanoparticles (see, e.g., Reichmuth, et al., 2016) and administered directly to heart tissue. In an exemplary embodiment, mRNA encoding for an agent is delivered using biomaterial-mediated sequestration (see, e.g., Khalil, et al., 2020) and administered directly to heart tissue.
[0218] In one example embodiment, a non-viral vector for use in gene transfer and / or nanoparticle formulations is a lipid. In one example embodiment the non-viral lipid vector may comprise: l,2-Dioleoyl-sn-glycero-3 -phosphatidylcholine; l,2-Dioleoyl-sn-glycero-3-phosphatidylethanolamine; Cholesterol; N-[l-(2,3-Dioleyloxy)propyl]N, N, N-trimethylammonium chloride; l,2-Dioleoyloxy-3 -trimethylammonium -propane; Dioctadecylamidoglycylspermine; N-(3-Aminopropyl)-N, N-dimethyl-2,3-bis(dodecyloxy)-l-propanaminium bromide; Cetyltrimethylammonium bromide; 6-Lauroxyhexyl ornithinate; 1-(2,3-Dioleoyloxypropyl)-2,4,6-trimethylpyridinium; 2, 3 -Dioleyloxy -N- [2(sperminecarboxamido-ethyl]-N, N-dimethyl-l-propanaminium trifluoroacetate; 1,2-Dioleyl-3-trimethylammonium-propane; N-(2 -Hydroxy ethyl)-N, N-dimethyl-2, 3-bis(tetradecyloxy)-l-propanaminium bromide; Dimyristooxypropyl dimethyl hydroxyethyl ammonium bromide; 3P-[N-(N', N'-Dimethylaminoethane)-carbamoyl]cholesterol; Bis-guanidium-tren-cholesterol; l,3-Diodeoxy-2-(6-carboxy-spermyl)-propylamide; Dimethyloctadecylammonium bromide; Dioctadecylamidoglicylspermidin; rac-[(2,3-Dioctadecyloxypropyl)(2-hydroxyethyl)]-dimethylammonium chloride; rac-[2(2,3-Dihexadecyloxypropyl-oxymethyloxy)ethyl]trimethylammonium bromide; Ethyldimyristoylphosphatidylcholine; l,2-Distearyloxy-N, N-dimethyl-3-aminopropane; 1,2-Dimyristoyl-trimethylammonium propane; O, O'-Dimyristyl-N-lysyl aspartate; 1,2-Distearoyl-sn-glycero-3 -ethylphosphocholine; N-Palmitoyl D-erythro-sphingosyl carbamoyl-spermine; N-t-Butyl-N0-tetradecyl-3-tetradecylaminopropionamidine; Octadecenolyoxy[ethyl-2-heptadecenyl-3 hydroxyethyl] imidazolinium chloride; N1 -Cholesteryloxy carbonyl-3, 7-diazanonane-l,9-diamine; 2-(3-[Bis(3-amino-propyl)-amino]propylamino)-N-ditetradecylcarbamoylme-ethyl-acetamide; l,2-dilinoleyloxy-3 -dimethylaminopropane; 2,2-dilinoleyl-4-dimethylaminoethyl-[l,3]-di oxolane; and dilinoleyl-methyl-4-dimethylaminobutyrate.Attorney Docket 44010.202WO-PCT / / CU24243
[0219] In one example embodiment, the non-viral vector for use in gene transfer and / or nanoparticle formulations is a polymer. In one example embodiment the non-viral polymer vector may comprise: Poly(ethylene)glycol; Polyethylenimine; Dithiobis(succinimidylpropionate); Dimethyl-3,3 '-dithiobispropionimidate; Poly(ethylene imine) biscarbamate; Poly(L-lysine); Histidine modified PLL; Poly(N-vinylpyrrolidone); Poly(propylenimine); Poly(amidoamine); Poly(amido ethylenimine); Triethylenetetramine; Poly(P-aminoester); Poly(4-hydroxy-L-proline ester); Poly(allylamine); Poly(a-[4-aminobutyl]-L-glycolic acid); Poly(D, L-lactic-co-glycolic acid); Poly(N-ethyl-4-vinylpyridinium bromide); Poly(phosphazene)s; Poly(phosphoester)s; Poly(phosphoramidate)s; Poly(N-2-hydroxypropylmethacrylamide); Poly (2-(dimethylamino)ethyl methacrylate); Poly(2-aminoethyl propylene phosphate); Chitosan; Galactosylated chitosan; N-Dodacylated chitosan; Histone; Collagen; and Dextran-spermine.Combination Therapy
[0220] In example embodiments, the treatments disclosed herein can be used in combination with any other therapies used for treating heart disease. In example embodiments, agents used for disrupting Rad binding to voltage-gated calcium channels or increasing contractility are used in combination with one or more P-blockers (beta-blockers).
[0221] Beta-blockers are a ubiquitous class of medications that attenuate the effect of the beta-adrenergic receptor system on the heart and are a first line treatment for these conditions. Beta blockers, also spelled P-blockers, are a class of medications that are predominantly used to manage abnormal heart rhythms (arrhythmia), and to protect the heart from a second heart attack after a first heart attack (secondary prevention). They are also widely used to treat high blood pressure, although they are no longer the first choice for initial treatment of most people. Beta blockers are competitive antagonists that block the receptor sites for the endogenous catecholamines epinephrine (adrenaline) and norepinephrine (noradrenaline) on adrenergic beta receptors, of the sympathetic nervous system, which mediates the fight-or-flight response. P-adrenergic receptor blockers (beta-blockers) are commonly used to treat arrhythmias, as they reduce the effects of sympathetic stimulation on the heart. Common beta blockers include: atenolol (brand names include Tenormin®), bisoprolol (brand names include Cardicor®, Congescor®), carvedilol, metoprolol (brand names include Betaloe®, Lopresor®), nebivolol (brand names include Nebilet®), and propranolol (brand names include Inderal®).Attorney Docket 44010.202WO-PCT / / CU24243
[0222] Further embodiments are illustrated in the following Examples which are given for illustrative purposes only and are not intended to limit the scope of the invention.EXAMPLESExample 1 - Augmenting Ca2+influx via either Rad or Cavβ2
[0223] We expect that augmenting Ca2+influx via either Rad or Cavβ₂ gene editing can attenuate the progressive reduction of cardiac function in non-ischemic HF models. A longstanding dogma is that persistently increased Ca2+influx via CaV1.2 channels in the heart is maladaptive.7'9Applicants expect that the physiological enhancement of Ca2+influx by preventing Rad from inhibiting CaV1.2 is beneficial in HF.6’10-12Using knock-in mice expressing either a mutant lamin A / C protein (H222P Lmna)13or a mutant cardiac troponin T (R141W Tnnt2)14, mutations causing dilated cardiomyopathy in humans13’15, deleting Rad or base-editing Cavβ₂ significantly improved cardiac contractility without noticeable side effects. Applicants can (a) expand these mouse cohorts to analyze survival rates, cardiac function using echocardiography, histological examination, arrhythmogenesis potential, and off-target editing; (b) evaluate whether these gene editing techniques can halt HF development in additional non-ischemic HF models, such as Acsll transgenic mice, which overexpress acyl-CoA synthetase leading to lipid overload16, and a transgenic mouse that overexpresses myocyte enhancer factor 2C (Mef2c)17. Applicants expect that for specific HF models, increased Ca2+influx may be advantageous, while in others, it could have neutral or detrimental effects.
[0224] We expect that augmented Ca2+influx can restore cardiac function after HF develops. Current treatments for chronic HF consist of P-adrenergic agonists for acute decompensated HF and P-blockers for the long-term management of stable HF.18-20Applicants can (a) investigate whether lasting increases in Ca2+influx can improve cardiac function after HF has manifested in non-ischemic models. Applicants can use the H222P Lmna and R141W Tnnt2 knock-in mice, which demonstrate significant cardiac dysfunction at roughly 14-20 weeks and 10 weeks of age, respectively. After HF onset, Applicants can utilize AAV9 gene editors to increase Ca2+influx and monitor survival rates, heart function, and the risk of developing ventricular arrhythmias. Applicants can (b) explore if enhancing Ca2+influx by eliminating Rad can augment cardiac function following ischemic-induced HF. (c) Despite long-term clinical evidence supporting P-blockers for chronic HF, their tolerability is oftenAttorney Docket 44010.202WO-PCT / / CU24243questioned. Applicants can investigate whether adding “Rad-otropy” along with P-blockers is feasible and effective in non-ischemic and ischemic HF models.
[0225] We expect that restricting the sympathetic nervous system’s enhancement of Ca2+influx can lessen arrhythmogenesis in catechol aminergic polymorphic VT (CPVT) and hypertrophic cardiomyopathy (HCM). In patients with heart disease or genetic predispositions to arrhythmias, adrenergic stimulation induces pro-arrhythmic Ca2+-dependent afterdepolarizations.21'31Selective reduction of the increased CaV1.2 current while maintaining P-adrenergic activation of anti-arrhythmic factors like Kv channels presents a potential pathway for innovative arrhythmia treatments. Before phosphorylation by PKA, Rad binds to and inhibits a portion of CaV1.2 channels. Applicants have created a base editor that introduces a Phe residue in place of Ser300, effectively eliminating most adrenergic responsiveness. Applicants can evaluate whether base-editing Rad to render it less responsive to adrenergic agonists can reduce arrhythmias in CPVT mice (mutant Ryr2 and Casq-2 (calsequestrin-2) null) and HCM mice.
[0226] A. Introduction
[0227] A.l. Ca2+channel regulation. Ca2+influx through CaV1.2 channels is obligatory for cardiac excitation-contraction coupling and other cellular functions.32Abnormal CaV1.2 expression or function is linked to cardiac pathophysiology, too much CaV1.2 due to mutations that slow inactivation or overexpression of auxiliary P2a, which is different from the P2B variant typically expressed in the heart33, causes ventricular arrhythmias, cardiomyocyte necrosis, and HF34'36. Conversely, too little CaV1.2 is associated with arrhythmia37and HF.38
[0228] The ability to increase heart pumping function is central to the evolutionarily conserved, adrenaline-driven fight-or-flight survival instinct. In cardiomyocytes, agonist binding to P-adrenergic receptors initiates a signaling cascade that activates PKA, increasing Ca2+current amplitude and shifting the channel activation’s voltage-dependence in a hyperpolarizing direction.39’40The molecular mechanism underlying PKA regulation of CaV1.2, chiefly the relevant PKA target, had been elusive despite decades of intensive investigation.41'49Studies showed that Rad is the key PKA target in the CaV1.2 complex.1’6> 50’51Rad holds CaV1.2 in a low open probability gating mode. PKA phosphorylation of two serine (Ser or S) residues in Rad releases Rad from the membrane, reduces affinity for CavP, and relieves CaV1.2 inhibition (FIG. 1).Attorney Docket 44010.202WO-PCT / / CU24243
[0229] Using knock-in mice with alanine (Ala or A) substitutions of the four PKA-phosphorylated Ser residues in Rad (4SA-Rad mice), Applicants demonstrated that the phosphorylation of Rad is essential for augmenting both Ca2+influx and the contractile response to either P-adrenergic agonists or phosphodiesterase inhibitors.6’52Conversely, expression in mice of Ca2+channel P-subunits that cannot bind Rad due to Ala substitutions of two aspartic acid (Asp or D) residues (2DA-P2B knock-in mice) at the putative Rad-P binding interface is sufficient to enhance basal Ca2+influx and contractility to nearly augmented levels seen in WT mice with adrenergic activation.6
[0230] A.2. Gaps addressed:
[0231] A.2.1. Roles of sympathetic nervous system in HF progression and treatment.HF affects over 6 million people in the United States and accounts for -400,000 deaths each year. The most common cause of HF with reduced ejection fraction (HFrEF) is ischemic heart disease. An index event, such as MI, causes a reflex increase in compensatory mechanisms, including augmented sympathetic outflow to the heart to restore cardiac contractility and blood pressure.53Though initially compensatory, the hyperadrenergic state causes a vicious cycle that inevitably leads to worsened HF (FIG. 2), perhaps caused, at least in part, by altered Ca2+handling and changes in sarcomere Ca2+sensitivity. Increased phosphorylation of RyR254and other proteins may contribute to this downward cycle.
[0232] Inotropes, such as dobutamine and milrinone, boost intracellular Ca2+levels and contractility, but seminal studies revealed reduced survival.18As such, inotropes are typically used in a critical care or palliative setting. Paradoxically, treatments have shifted to P-adrenergic antagonists, which improve survival and LV function.18Nevertheless, these drugs are still used infrequently and are often prescribed in lower doses than recommended, partly due to tolerability issues. Calcium sensitizers (myotropes) acting on regulatory troponin and tropomyosin independently of Ca2+fluxes have also been studied.55However, the FDA recently declined to approve omecamtiv mecarbil due to a lack of survival benefits or improved quality-of-life measures. A significant gap in the understanding and treatment options for HF is the safe and direct targeting of myocyte contractility through increased Ca2+influx and Ca2+transients.
[0233] In contrast to the pro-arrhythmic effects of the failed inotropic drug BayK 864456'58, which increases Ca2+influx by slowing the inactivation of CaV1.2, Applicants showed that increasing Ca2+influx through the expression of a CavP2B subunit that cannot bind Rad isAttorney Docket 44010.202WO-PCT / / CU24243without apparent pathological arrhythmogenic or contractile consequences.6These findings challenge the paradigm that all increased Ca2+influx is toxic and that animal models with enhanced Ca2+influx can develop HF and arrhythmias.7’9’59Instead, how Ca2+influx increases may be critical. Applicants expect that increasing inotropy by relieving Rad inhibition of Ca2+channels while not affecting the expression or electrophysiological characteristics of Ca2+channels or promoting RyR2 or PLB phosphorylation is beneficial. Combining such a cardiacspecific physiological activator of Ca2+influx with a P-blocker is a novel HF inotropic cocktail.
[0234] A.2.2. Adrenergic-induced arrhythmias: Sympathetic activity increases early after-depolarizations (EADs) and delayed after-depolarizations (DADs) via the activation of PKA and Ca2+-calmodulin dependent kinase (CaMKII).60Although the activities of these kinases are beneficial under physiological conditions, in other states like HF or carriers of ion channel mutations, increased kinase activity promotes arrhythmias.61'65
[0235] Although it is a rare disease, studying CPVT enables insights into how altered Ca2+handling initiates and promotes arrhythmias. Dominant mutations in RYR2 or recessive mutations in CASQ2 cause CPVT.66'69Combining a Ca2+channel blocker (verapamil) and P-blocker was more effective than a P-blocker alone in preventing exercise-induced arrhythmias in CPVT patients70, suggesting that reducing Ca2+influx is antiarrhythmic. Verapamil dosing is limited because it targets basal Ca2+influx and Ca2+channels in other organs. In CPVT mice with either homozygous or heterozygous 4SA-Rad, Applicants found a marked attenuation of epinephrine and spontaneous arrhythmias.
[0236] After substantial experimentation, Applicants have identified a substitution that can be gene-edited at one of the Rad phosphorylation sites, which prevents most adrenergic-induced disruption of Rad and CavP. Applicants can test the gene-editing approach in CPVT mice (mutant Ryr2 and Casq2-null) and then test mouse models of HCM and ischemic HF, which are also prone to adrenergically-induced arrhythmias. A Rad-based, CaV1.2 targeted strategy may be more effective than P-blockers since preventing Rad phosphorylation (unlike P-blockers) neither prevents adrenergic stimulation of K+channels and the consequent reduction in arrhythmic risk by enhancing repolarization30’31, nor does it inhibit HCN activation in the sinus node. This strategy may also be more effective than therapies that blunt basal Ca2+current, such as non-dihydropyridine Ca2+channel blockers because dosing is limited since they target Ca2+channels in other organs.
[0237] A.3. Results:Attorney Docket 44010.202WO-PCT / / CU24243
[0238] A.3.1. Adrenergic regulation of Ca2+influx, Ca2+transient, and contractility.Applicants created and tested 4SA-Rad knock-in mice. The stimulatory effect of isoproterenol on Ca2+current amplitude (FIG. 3 A-C) and the hyperpolarizing shift in F50 for activation (FIG.3D) are eliminated when Rad can no longer be phosphorylated in ventricular myocytes.
[0239] The increase in Ca2+transient amplitude by P-adrenergic agonists was markedly attenuated by 70% in 4SA-Rad ventricular myocytes compared to WT (FIG. 4A-B). Preventing Rad phosphorylation blunted sarcomere contraction in response to forskolin, which increased from 3.4% to 11.3% (absolute difference: 7.9%) in WT cardiomyocytes compared to an increase from 2.7% to 5.3% (absolute difference 2.6%) in 4SA-Rad cardiomyocytes (FIG. 4C-D). It dampened the isoproterenol-induced increase in the ejection fraction (EF): 81% (absolute increase: 38%) in WT mice vs. only 9% (absolute increase: 3%) in 4SA-Rad mice (FIG. 4E). Other fundamental adrenergic signaling pathways, however, remained fully functional in the 4SA-Rad mice.6
[0240] A.3.2. Eliminating Rad interaction with the Ca2+channel is sufficient for enhanced i Applicants studied mice in which the interaction between Cavβ₂ and Rad is reduced (FIG. 5A). Prior studies showed that substituting three Asp residues, Asp244, Asp320, and Asp322, in the human P2B isoform with Ala attenuated Rad binding to the Ca2+channel P subunit.71’72To facilitate the generation of a knock-in, Applicants determined that Ala-substitutions of only the two Asp residues in exon 11 are sufficient to reduce Rad-P2B interaction. Applicants then introduced via CRISPR / Cas9 gene-editing Ala-substitutions of these two Asp residues in exon 11 of the endogenous murine Cacnb2 locus (2DA-P2B mice). Ca2+transient amplitudes were increased under basal conditions to nearly the levels of isoproterenol -treated WT cardiomyocytes (FIG. 5B). They did not significantly change after isoproterenol administration (FIG. 5C). Basal cardiac contractility, assessed by echocardiography, was increased. The augmentation of contractility by isoproterenol was blunted compared to WT mice (FIG. 5D). Thus, cardiac contractility can be enhanced without adrenergic signaling by releasing the Rad-inhibited subpopulation of Ca2+channels.
[0241] A.4. Scientific premise:
[0242] Mouse models have limitations, especially regarding repolarizing currents, reflecting differences in the ion channels responsible for repolarization in humans and mice. However, the roles and regulation of depolarizing currents, including Na+and Ca2+, are fully conserved in mice. Differentiated human iPSC-derived cardiomyocytes offer translationalAttorney Docket 44010.202WO-PCT / / CU24243advantages, but immaturity and consequent relevance to adult excitation-contraction coupling and arrhythmogenesis are limitations.73‘74
[0243] Numerous prior studies have identified Ca2+mishandling in arrhythmias associated with HFrEF and, in some cases, treatments aimed at correcting these abnormalities.61’75‘76A case in point: a hallmark of human and animal models of HF is a reduction in SERCA2a.77The long-standing dogma of decreased SERCA2a expression led to clinical trials treating patients with SERCA2a-expressing AAV.78These trials, however, failed to show a clinical benefit.79Subsequently, a state-of-the-art proteomics study involving 114 patients with HF due to dilated cardiomyopathy, 65 patients with HF and ischemic heart disease, and 57 patients with nonfailing hearts showed no differences in SERCA2a and PLB protein abundances compared with control hearts.80Studies of RyR2 phosphorylation are also controversial.81'83Irrespective of these controversies, Applicants propose that these approaches may have failed because the phosphorylation of RyR2 and PLB has relatively minor effects on systolic function, as shown in modeling studies of rabbit84and mouse ventricular myocytes.85'87In these models, specific removal of PKA stimulation of CaV1.2 caused a profound reduction in both Ca2+transient amplitude and force, suggesting that controlling Ca2+influx is dominant. Likewise, the results herein support a principal role in modulating Ca2+influx.
[0244] There are two dynamic pools of Ca2+channels: Rad-bound and Rad-less channels (FIG. 6). The Rad-less channels are required for basal excitation-contraction coupling, whereas Rad-bound channels are the adrenergic reserve. PKA phosphorylation of Rad releases its inhibition of Rad-bound channels. Applicants believe that “Rad-otropy” can be safer than standard inotropes because the potentially harmful effects of SR Ca2+leak and overload are avoided, and removing Rad inhibition does not change the intrinsic properties of Ca2+channels but recruits “silent” Ca2+channels (FIG. 6). Applicants can identify compounds that act similarly.
[0245] B. Technical Advantages
[0246] B.l. This example describes an approach for increasing Ca2+influx by activating “silent” Ca2+channels and assessing its safety and efficacy in heart failure. The 2DA-P2B knock-in mice exhibit hypercontractile function and do not demonstrate any arrhythmias or signs of HF for at least 24 months. The release of Rad inhibition may be well-tolerated because of its “physiological” characteristics, as it does not alter the biophysical properties of the native channels. This finding introduces a novel and potentially transformative approach forAttorney Docket 44010.202WO-PCT / / CU24243enhancing cardiac function in vivo. Without a specific Rad-modulatory agent, Applicants have developed various methods to rigorously test this hypothesis, which focuses on preventing HF in non-ischemic models or reversing it once established in both ischemic and non-ischemic settings. The evaluation can determine whether the enhanced contractility persists or if maladaptive remodeling occurs as the mice age with heritable cardiomyopathies age.
[0247] B.2. Gene editing for cardiovascular disease treatment. Applicants have created gene editors that selectively delete Rad or alter CavP so it cannot bind Rad in cardiomyocytes. The Rad and CavP editors have shown effectiveness in mice through subcutaneous injections at days P2-P5 and retro-orbital injection in adults. These edits enhance Ca2+influx, increase Ca2+transient amplitude, improve cardiomyocyte contraction, and boost LV contractility in WT animals. Early evidence suggests they boost contractility in two non-ischemic HF mouse models. Applicants can broaden the research using these two models and investigate whether efficacy can be demonstrated in transgenic Acsll and Mef2c mice. Additionally, Applicants can explore the ability to reverse HF once it has developed in non-ischemic and ischemic settings.
[0248] Somatic gene editing surmounts several experimental challenges, including (1) the need to crossbreed and identify mice possessing four or five mutant alleles; (2) ensuring the correct genetic background, as certain mouse models require specific backgrounds (for example, the phenotype of H222P Lmna is considerably more severe in the 129 / svJ background compared to the C57BL / 6)88; and (3) the capability to regulate timing. A strategy that utilizes a single gene editor to address multiple causes of HF could be more effective than creating targeted gene therapies for individual causes, particularly since, at advanced stages of HF, remedying the underlying cause may not bring therapeutic benefits.
[0249] B.3. Clarifying the role of B-adrenergic regulation of Ca2+influx in catecholamine-induced Applicants can expand on the findings that halting Rad phosphorylation significantly decreases adrenergic-induced arrhythmias in the Ryr2 mutant CPVT mouse model by employing a gene editor to prevent Ser300phosphorylation. This therapeutic strategy offers enhanced specificity compared to current treatments. Although infrequent, CPVT is an excellent model for assessing this therapeutic potential, presenting a relatively clean “background” without confounding myocardial disturbances like fibrosis or reduced EF. Since creating specific gene editors for every RyR2 mutation is unlikely, the novel approach represents a “universal” solution for reducing P-adrenergic-induced arrhythmias.Attorney Docket 44010.202WO-PCT / / CU24243
[0250] C. APPROACH
[0251] C.l. We expect that augmenting Ca2+influx via either Rad or Cavβ₂ gene editing can attenuate the progressive reduction of cardiac function in non-ischemic HF models.
[0252] C.1.1. Administering isoproterenol via an osmotic pump for one month to WT mice leads to worsened cardiac function.89Notably, the 2DA-P2B mice, which experience enhanced Ca2+influx and contractility, do not show signs of HF even after 24 months, suggesting that the harm from inotropes is separate from Ca2+influx. Applicants investigated whether enhancing Ca2+influx by alleviating Rad inhibition protects mice from developing HF and whether it is safe without increasing arrhythmias. The preliminary research concentrated on two HF mouse models: (1) Applicants employed knock-in mice expressing a mutant cardiac troponin T (R141W Tnnt2 which induces dilated cardiomyopathy by reducing the sarcomere's Ca2+sensitivity through the increased affinity of cardiac troponin for tropomyosin.15(2) Applicants examined mice with a missense lamin A / C mutation (H222P Lmnd) found in a family with autosomal dominant Emery-Dreifuss muscular dystrophy.13’90Inactivating Rad or mutating Cavβ₂ significantly boosted cardiac contractility in both animal models.
[0253] It is expected that in specific HF models, enhancing Ca2+influx might yield neutral or adverse outcomes, particularly in hypertrophy-associated models. Applicants can broaden the research to encompass transgenic Acsll mice, which overexpress acyl-CoA synthetase, leading to lipid overload, and transgenic mice overexpressing myocyte enhancer 2C (Mef2c).17Long-chain acyl-CoA synthetase plays a crucial role in the directional transport of fatty acids across the plasma membrane. These mice show significant triglyceride accumulation in cardiomyocytes, which initially results in cardiac hypertrophy, followed by LV dysfunction and premature mortality.16An increase in cardiomyocyte lipid deposits is noted in obese and diabetic individuals, potentially contributing to arrhythmias. The Mef2c transgenic mice also start with hypertrophy, soon experiencing a rapid decline in cardiac function.17
[0254] C.1.2. Results
[0255] C.1.2.a. Development of gene-editors. Applicants inactivated Rad by introducing frameshift insertions / deletions (indels) with the humanized S. pyogenes Cas9 nuclease expressed via a Tnnt2 promoter. The guide sequence for mice and humans is identical. Applicants used a split-intein design, requiring the co-transduction of two AAV vectors, each expressing half of the base editor and trans-splicing reconstitution of the full-length base editorAttorney Docket 44010.202WO-PCT / / CU24243within cells as previously described.91'93Initially, Applicants injected 5 x 1014vc / kg subcutaneously into three P2-P5 pups. After 6 weeks, Applicants enzymatically dissociated cardiomyocytes and performed deep sequencing of genomic DNA and western blots. In -50% of the reads, Applicants detected frameshift indels (FIG. 7A). Since the editor has a Tnnt2 promoter, the indels are likely from the cardiomyocyte fraction. Anti-Rad immunoblot showed near-complete loss of Rad (FIG. 7B). Applicants suspect that the “isolated” cardiomyocytes have a substantial non-cardiomyocyte fraction.
[0256] Reducing the dose of AAV9-Cas9-Rad editor by 10-fold to 5 x1013and 50-fold to 1 x1013vc / kg was still quite effective in inactivating Rad. The extent of indels in dissociated cardiac cells isolated from mice injected with 1 x1013vc / kg or 5 x1013vc / kg was 39% and 50%, respectively, which was confirmed by immunoblotting of Rad (FIG. 8A). Applicants interrogated the electrophysiological properties of Ca2+channels in ventricular cardiomyocytes isolated from C57 mice, without and with subcutaneous injection of 5 x1013vc / kg in pups. The basal conductance was substantially increased in the AAV9-injected mice, like the isoproterenol-augmented conductance (FIG. 8B). Inactivating Rad increased the EF in mice (FIG. 8C).
[0257] Applicants investigated the possibility of utilizing base editing to create a mutant CavP with diminished Rad-P binding, similar to the previous results with knock-in mice. Using an in vitro FRET-based assay, Applicants discovered that replacing Asp322with Gly significantly decreased the Rad-P interaction, although not to the extent of the triple or double substitutions (FIG. 9A). The adenine base editor (ABE8e NRCH V106W) facilitated the A to G base change at Asp322’ along with a bystander Thr to Ala alteration at residue 323, which does not affect CavP function. Applicants engineered a dual AAV9 vector that carried the mouse CavP guide RNA and the ABE under a promoter. Applicants administered 5 x1013vc / kg subcutaneously to C57 pups. Using deep sequencing of the genomic DNA from isolated cardiac cells, Applicants observed an average Gly substitution at Asp322 of 40% ± 5.4% (N=6 mice, range 20-53.6%) (FIG. 9B).
[0258] The glycine substitution of Asp322led to a significant rise in basal Ca2+conductance (Gmax), evaluated through patch-clamp experiments on ventricular myocytes (FIG. 10A). This modification also resulted in enhanced basal sarcomere contraction (FIG. 10B) and improved EF (FIG. 10C).Attorney Docket 44010.202WO-PCT / / CU24243
[0259] Applicants examined 8-month-old C57 AAV9-Cas9-Rad-injected mice to assess if AAV9-mediated Rad gene deletion would lead to fibrosis. No differences were observed between control and AAV9-injected mice (FIG. 11).
[0260] C.1.2.b. Gene-editing in HF models. Applicants administered 5 x 1014vc / kg AAV9-Cas9-Rad editor (or PBS control) to R141W Tnnt2 pups. These mice experience progressive HF due to decreased Ca2+sensitivity in the sarcomere, with mortality commencing between 10 and 20 weeks. At 10, 20, and 35 weeks, mice injected with AAV9-Cas9-Rad editor showed significantly improved LV function compared to the control group (FIG. 12A). Within the PBS-injected cohort, one mouse died during the 10 to 20-week period with substantial additional mortality in subsequent weeks (FIG. 12B). No mice have died during the follow up period in the AAV9-Cas9-Rad group. Thus, enhancing Ca2+influx in a mouse line with impaired sarcomere function is effective, at least in the short term.
[0261] In humans, LMNA mutations exhibit autosomal-dominant inheritance, leading to cardiomyopathy marked by LV enlargement, diminished systolic function, conduction system issues, and arrhythmias. The H222P- / . / w / a model, which simulates Emery-Dreifuss muscular dystrophy, reflects these characteristics; however, the condition in mice necessitates homozygosity.13Homozygous male H222P Lmna mutant mice experience significantly more severe cardiac disease at younger ages compared to female mice and develop progressive HF.13By the age of 4 to 5 months, mortality is observed with a mean EF below 20%, varying from under 10% to approximately 30% (FIGs. 13A and 13B). Applicants examined these mice as a model for severe and progressive HF.13Applicants do not expect to achieve a “definitive” cure for cardiomyopathy because the persistent and rapid decline in cardiac function in these mice results from multiple factors; however, Applicants expected a significant improvement in cardiac function and prolonged survival.
[0262] Applicants injected a litter of Lmna mutant mice with 2.5 x 1013vc / kg of AAV9-Cas9-Rad editor. This litter included three homozygous H222P Lmna mutant male mice. At 4, 5, 6 and 7 months, their ejection fraction exceeded 60%, significantly higher than the control group's average of around 30% at 3 months and less than 20% at 5 months (FIG. 13A). At 8 months, the mean EF is 53%. No mortality has been observed in the Rad-edited cohort whereas 4 / 5 mice have died in the non-treated cohort by ~ 6 months of age. Applicants plan to monitor this group and increase the sample size in future experiments.Attorney Docket 44010.202WO-PCT / / CU24243
[0263] The AAV9-ABE-CavP was injected into pups as well. Applicants noted a significantly higher EF in comparison to the mice without the virus at 3, 4, and 5 months when evaluated against the control group (FIG. 14A). At 5 months, the mean EF for the untreated group was 18% compared to 37% for the AAV9 injected group (N=6). Notably, two mice exhibited near-normal EF at 5 and 6 months. Applicants euthanized the AAV9-injected mouse with low EF at 5 months (indicated with “a” in FIG. 14A). In this mouse, Cacnb2 was edited at only 3.5%, based on sequencing of genomic DNA. At 6 months, the EF declined in 3 mice, which were euthanized, and Applicants are now awaiting genomic sequencing results. Applicants are developing methods to evaluate the functional impacts of base-editing of Cavβ. One strategy involves examining the distribution of basal Ca2+transient amplitude. In WT mice, the amplitude of the basal transients typically does not exceed 0.2. In mouse a, Applicants observed a few cells with amplitudes exceeding 0.3, likely indicating limited editing (FIG.14B). In contrast, mouse c exhibited a higher number of cells with amplitudes greater than 0.3, suggesting a greater extent of editing (FIG. 14C).
[0264] The initial results indicate that cardiac function significantly improved in the β-edited mice, although some mice experienced a gradual decline around the 5 and 6-month marks. Applicants can assess whether the two mice that displayed relatively normal EF at 6 months exhibit greater degrees of gene editing. These findings also suggest possible variability in editing effectiveness, likely stemming from the difficulties encountered when injecting the pups with the virus. Applicants can incorporate this variability into the power calculations.
[0265] Rad is likely a limiting factor in cardiomyocytes. Inactivating Rad may be more effective than editing Cavβ since reducing Rad can directly impact the Rad-bound fraction. The mutant P-subunit is expected to be distributed to CaV1.2 in both Rad-bound and Rad-less channel populations, potentially making the functional effects of mutating P subtler at low editing frequencies. However, modifying the P-subunit to block Rad binding is a more targeted approach. Applicants have identified mutations in Rad, which could be as effective as Rad deletion (see C.2.4).
[0266] C.1.3. Experimental methodology:
[0267] C.1.3.a. We expect that increasing Ca2+influx by modifying Rad or Cavβ reduces HF progression and enhances survival in Lmna and Tnnt2 mutant knock-in mice. For H222P Lmna mice, Applicants can use male mice as they exhibit significantly worse HF that develops earlier than in females. Both sexes can be used for Tnnt2 mice. Each group can consist of atAttorney Docket 44010.202WO-PCT / / CU24243least 20 mice; all studies can include blinded PBS-control groups. Applicants can inject Lmna and Tnnt2 mutant knock-in pups subcutaneously with 5 x 1013vc / kg of Rad or Cavβ editors. Applicants aim to correlate results across all subjects based on the extent of Rad and Cavβ editing. The endpoints Applicants can assess include:
[0268] i. Survival study: The preliminary data suggest Applicants need 15 mice in both the treatment and PBS-injected groups to demonstrate a survival advantage. This group can be followed until death or euthanasia criteria are met, without echocardiograms, due to potential anesthesia impacts on survival in low EF mice. Upon death, Applicants can analyze the cardiac genomic DNA of Rad or Cavβ and a Rad immunoblot.
[0269] ii. Cardiac biomarkers and contractility: A separate group can focus on cardiac biomarkers and contractility, with monthly assessments of cardiac function beginning at 2 months of age. Applicants can utilize echocardiography with a VisualSonics Vevo® 3100 Imaging Station to gather high-frequency speckle tracking echocardiography-derived EF, mass, volume, and global and regional strain analyses. Applicants can include ten mice in each group to detect a minimum 10% improvement in EF at later time points with a power of 0.8, an alpha of 0.05, and a standard deviation of 8. Furthermore, Applicants can use 5-month-old mice for analyses of contractility and biomarkers. In vivo conductance volumetry can be conducted to generate LV pressure-volume loops, thereby evaluating LV contractile function and P-adrenergic contractility. Each analysis group can use ten mice. Applicants can document pressure-volume loops under different preload conditions with transient inferior vena cava compression to establish the end-systolic pressure-volume relationship (ESPVR) and derive end-systolic elastance (Ees), an independent measure of myocardial contractility. Applicants can examine clinical biomarkers of HF, including a) pulmonary congestion - the ratio of dry-to-wet lung weight and intrathoracic fluid volume (pleural effusion); b) heart weight relative to body weight and tibial lengths; c) plasma BNP / ANP concentrations; d) catecholamine concentrations; e) histological staining to assess cardiac dimensions and fibrosis. It is important to note that Lmna mutant mice show significant fibrosis; Applicants aim to determine if the extent of fibrosis changes.
[0270] iii. Safety of increasing Ca2+influx: Mice with higher Ca2+influx might develop arrhythmias, particularly in HF. Homozygous Lmna mice in the 129 / svJ background experience PR prolongation, heart block, and fibrosis. Therefore, Applicants can have a separate group of mutant Lmna and Tnnt2 mice with implantable telemetry. This cohort can beAttorney Docket 44010.202WO-PCT / / CU24243monitored for spontaneous arrhythmias for 24 hours every 2 weeks for at least 6 months, starting at 3 months. If spontaneous arrhythmias are absent, Applicants can administer an intraperitoneal injection of isoproterenol at 5 months of age to evaluate if increased sympathetic tone contributes to arrhythmogenesis
[0271] iv. Mechanistic studies: If Applicants observe reduced mortality or delayed progression to HF in the gene editor-treated group, Applicants can determine whether there is a reduction in the maladaptive effects of catecholamines. Applicants can measure RyR2 phosphorylation and PLB-SERCA expression and phosphorylation. Applicants can isolate cardiomyocytes and measure Ca2+currents, Ca2+transients, and SR Ca2+load in the absence and presence of isoproterenol. Applicants can also assess HF -induced structural remodeling, including the presence of t-tubules.
[0272] C.1.3.b. Investigate whether enhancing basal Ca2+influx can reduce HF development in other non-ischemic HF models, including transgenic and mice. In the transgenic Acsll model (Jackson Laboratory #029825), cardiac abnormalities can appear as early as 4-6 weeks, followed by progressive remodeling.16Previous studies report an EF of about 45% at 12 weeks and around 30% at 18 weeks.94These mice typically develop HF at around four months, most succumbing by 5-6 months. Applicants can subcutaneously administer Rad or CavP editors to pups between P2 and P5. From 6 weeks onward, Applicants can monitor cardiac function monthly by echocardiography. A sample size of 10 mice per treatment group and ten mice in the PBS-injected group should provide sufficient power to demonstrate a survival benefit based on the observed cardiac dysfunction. Additionally, Applicants can utilize a separate cohort of mice to assess contractility via echocardiography. Should Applicants observe improvements in contractility and survival, Applicants can advance with several of the outlined experiments in C.1.3.a. Transgenic Mef2c mice (Jackson Laboratory #010586) exhibit progressive cardiac dysfunction beginning at 1 month of age, with fractional shortening dropping to 30% at 1 month, 20% at 2 months, and approximately 15% at 3 months, in contrast to -40% in WT mice.17Applicants can establish distinct survival and contractility cohorts, with ten mice per group (20 total for the treatment group and 20 in the PBS control group). For both and mice, Applicants can correlate cardiac function and survival with the degree of gene editing, evaluated through deep sequencing and Rad western blot.Attorney Docket 44010.202WO-PCT / / CU24243
[0273] Additionally, Mef2c transgenic mice show the formation of atrial thrombi. Since the injection of the AAV9-Cas9-Rad editor effectively deletes Rad in both the atria and ventricles (FIG. 15), Applicants can investigate whether enhancing LV or atrial function can help prevent atrial clot formation.
[0274] C.1.3.c. Gene editing at extra-cardiac tissues: Applicants can compare on-target and bystander editing in genomic DNA from the liver, skeletal muscle, lungs, and gonads from treated mice. Initial studies showed <0.1% on-target editing in extra-cardiac tissues, consistent with Tnnt2 promoter’s cardiomyocyte-specific expression.
[0275] C.1.3.d. Assessment of off-target gene editing for Rad and Cavβ. Although the primary goals are to test whether enhanced Ca2+entry can attenuate HF, Applicants must assess for off-target editing.93Distinct from bystander editing near the target, off-target editing occurs when ABE8 or Cas9 binds distinct genomic loci with homology to the guide sequence. Applicants can use CIRCLE-seq to nominate potential off-target loci engaged by ABE8 / Cas9 domain and guide RNAs used in the experiments (Rad and Cavβ) and then measure off-target edits by high-throughput sequencing of the nominated sites in edited mice. Applicants can perform CIRCLE-seq using an optimized epegRNA, a sgRNA surrogate containing the identical protospacer, or an NG1 nicking sgRNA. Applicants can use RNase H-dependent amplification and sequencing (rhAmpSeq) to perform multiplex-targeted DNA sequencing of the top 50 sites for each category.
[0276] C.1.4. Alternative approaches. Rescuing or at least attenuating the development of HF provides alternative treatment approaches. For instance, the pathways underlying cardiomyopathy from LMNA mutation have been dissected for years. Modulating cardiac contractility may influence signaling pathways associated with cardiomyopathy, including pathways implicated in LMNA-related disease, fibrosis, or maladaptive remodeling. Although the present disclosure is not limited to any particular mechanism, additional studies may be conducted to evaluate whether increasing contractility through Rad modulation affects downstream signaling abnormalities. Alternative approaches may be employed in models in which “Rad-otropy” enhancement of Ca2+influx does not provide a functional benefit in a specific model of HF. There are challenges in translating gene editing to humans. Alternative non-editing modalities may also be used. Applicants pursued Rad-modulatory compounds and have identified effective siRNA and anti-sense oligonucleotides. Applicants have also identified sites for gene editing at the Rad-CavP interface (see C.2.4).Attorney Docket 44010.202WO-PCT / / CU24243
[0277] C.2. We expect that augmented Ca2+influx can restore cardiac function post-HF development.
[0278] C.2.1. It is expected that reversal of HF can be achieved by increasing Ca2+influx. Applicants can test the effectiveness of gene editing in adult mice. The initial focus can be on non-ischemic HF, particularly in mutant Tnnt2 and Lmna mice, where Applicants have data indicating a significant reduction in HF after gene editors were administered to young pups. Following this, Applicants can evaluate the safety and efficacy of enhancing Ca2+influx in mice with ischemic HF caused by left anterior descending (LAD) artery ligation. After HF onset, Applicants expect that boosting cardiac contractility through increased CaV1.2 current might offer protection by reducing reliance on the compensatory hyperadrenergic response that exacerbates cardiac dysfunction. This could also lead to a lower incidence of arrhythmias due to diminished sympathetic nervous system activity. Applicants can examine both survival rates and the occurrence of arrhythmias.
[0279] HF is marked by a hyperadrenergic state, and P-blockers are reasonably effective, albeit limited by a lack of compliance and side effects. One intriguing strategy might involve inducing Ca2+influx through “Rad-otropy” while simultaneously administering P-blockers to mitigate the hyperadrenergic state. It is expected that this strategy is more effective than using a Rad or Cavβ gene editor by itself. Applicants can evaluate this in both ischemic HF models and non-ischemic cardiomyopathy models.
[0280] C.2.2. Results: Gene editing in adults. Applicants retro-orbitally injected 5 x 1013vc / kg AAV9-Cas9-Rad into 2-month-old mice. Echocardiograms were conducted on the isoflurane-anesthetized mice. Two weeks after injection, two mice displayed increased EF compared to the control group, while one mouse exhibited a “normal” EF. Applicants euthanized the mice with both “normal” and the highest EF, then enzymatically dissociated the cells using Langendorff perfusion. Upon deep sequencing of the Rad genomic DNA, Applicants found that the cells had 31.4% and 34.1% indels (FIG. 16A). Applicants subsequently performed another echocardiogram at four weeks post-injection on the third mouse, where the EF significantly increased to approximately 80%. The percentage of indels in the dissociated cells was 44.2%. These findings are comparable to the level of editing observed following subcutaneous injection in pups.
[0281] In cardiomyocytes, the basal current through CaV1.2 channels increased at 2 and 4 weeks after the injection of the Rad deletion editor, similar to the heightened current observedAttorney Docket 44010.202WO-PCT / / CU24243following isoproterenol infusion (FIG. 16B). Electrical field-stimulation-induced Ca2+transients in ventricular cardiomyocytes, measured using the ratiometric Ca2+indicator Fura2-AM, were evaluated. Applicants categorized basal Ca2+transient amplitudes into 0.02 bins. The average amplitude in control cardiomyocytes was nearly 0.1. In contrast, the mean amplitude in those injected with AAV9-Cas9-Rad was 0.2, with approximately 50% of the cells showing higher amplitudes (FIG. 16C). Applicants assessed pacing-induced sarcomere lengths before and after isoproterenol exposure. After Rad deletion, mean sarcomere contraction was at 9.3% (2 weeks post-injection) and 13.8% (4 weeks post-injection), in contrast to 4.5% in control mice (FIG. 16D). The findings indicate that gene editing of Rad is achievable in adult mice.
[0282] C.2.3. Experimental methodologies
[0283] C2.3.a. We expect that increasing Ca2+influx can reverse established HF in nonischemic Lmna and Tnnt2 mice models. The initial studies can concentrate on the Rad editor in adult mice. Applicants can inject ten male mutant Lmna mice at 3 months old when the EF is approximately 30%. Applicants can use ten mice for the control group who were given a PBS injection. All male homozygous H222P Lmna mice perish by 9 months. The endpoints can include evaluating cardiac function by echocardiography and survival. Should Applicants see improvements in function and survival, Applicants can extend the study by injecting mice at 4 months of age, at which point the EF is around 20-25%. This group can be monitored throughout their lifespan, though early euthanasia may be necessary if the EF drops below 10-15% or the animal shows illness. Changes in cardiac contractility and survival rates can be correlated with each mouse's indels percentage. If cardiac function and survival improvements are noted, Applicants can broaden the studies to include histopathological examinations and cardiac electrophysiology / arrhythmias assessments with implantable telemeters.
[0284] For the mutant Tnnt2 mouse model, the AAV9 Rad editor or a PBS control can be retro-orbitally injected into male and female mice at 10 weeks old. Applicants can assess cardiac function via echocardiography every 4 weeks and monitor survival. If Applicants observe improvements after the 10-week injection, Applicants can administer the Rad editor in a cohort of mice at 20 weeks to evaluate more advanced stages of HF.
[0285] C.2.3.b. It is expected that enhanced Ca2+influx can alleviate cardiacin an ischemic HF model. The perioperative mortality rate following LAD artery ligation is approximately 25%. This procedure induces significant MI, leading to theAttorney Docket 44010.202WO-PCT / / CU24243development of HF.95’96HF is characterized by an EF of less than 35% with pronounced anterior wall hypokinesis. Applicants can utilize WT C57BL / 6 mice for this study. After LAD ligation and LV function evaluation in one week, mice exhibiting EF below 35% can be separated into two groups: one receiving PBS treatment and the other receiving a Rad editor injection retro-orbitally. LV function can be tracked monthly by echocardiography starting four weeks post-MI, along with monitoring mouse survival throughout their lifespan. Should Applicants observe improved LV function and prolonged survival, Applicants can replicate the experiments to validate the findings and euthanize the mice at earlier intervals for mechanistic investigations. Applicants expect that increased Ca2+influx and potentially enhanced LV function can diminish neurohormonal activation, leading to reduced phosphorylation of RyR2 and PLB. Following post-mortem examinations, HF severity can be assessed by measuring lung, heart, and body weight ratios and histological analyses.97A potential issue is the variability of Rad inactivation within the ischemic myocardium and its possible contribution to arrhythmias. Regardless of the outcomes related to survival and LV function improvements, Applicants can also evaluate arrhythmic risk post-MI using telemeters.
[0286] C.2.3. C. It is expected that the addition of B-blocker to increasing Ca2+influx is beneficial. Applicants expect that pairing a P ■blocker with “Rad-otropy,” is more effective and safer. Applicants can use an ischemic mouse model, divided into four experimental groups: no virus, no virus + P-blocker, Rad editor, and Rad editor + P-blocker. Using an osmotic pump, Applicants can deliver the P-blocker metoprolol (30 mg / kg / d). The study can mirror the design of C.2.3.b, concentrating first on survival and LV function. Should Applicants observe positive outcomes, Applicants can replicate the study for validation and subsequently euthanize the subjects sooner to investigate the underlying mechanism. If the Rad-edited mice from C.2.3.b. exhibit increased arrhythmias, Applicants can implant telemeters to assess whether administering a P-blocker can reduce arrhythmia development
[0287] C.2.4. The primary experimental risk involves decreased viral infection efficacy due to HF-induced fibrosis. Applicants can inject the mice earlier, before fibrosis becomes too advanced, if necessary. The AAV9-ABE-CavP editor is effective even when administered to adult mice. While Applicants have not detected adverse effects from deleting Rad in a global Rad knockout mouse generated through homologous recombination or cardiac gene editing, Rad may have unknown functions beyond CavL2 in the heart. Therefore, a base editor aimed at Rad’ s binding site might be more advantageous. Applicants have pinpointed several residuesAttorney Docket 44010.202WO-PCT / / CU24243(highlighted in red in FIG. 17) at this interface that significantly lessen Rad-P binding, as determined by FRET, and can be modified using base editing. Applicants have assessed different options, and in one case, dual AAV9 viruses are being created for testing in vivo.
[0288] C.3. It is expected that restricting the sympathetic nervous system’s enhancement of Ca2+influx can lessen arrhythmogenesis in CPVT and HCM mouse models.
[0289] C.3.1. Rationale: While P-blockers can decrease the occurrence of arrhythmias, patients still face a considerable risk of cardiac arrest, partly because P-blockers also diminish K+channel protection98'101. A more effective treatment strategy would involve selectively inhibiting P-adrenergic stimulation of CaV1.2 while maintaining P-adrenergic stimulation of Kv and PLB / SERCA. There are inherent challenges in applying findings from rodent studies to humans due to variations in ion channel profiles (in mice, IKS and Hr do not serve as the main repolarization currents) and baseline heart rate differences. Nonetheless, the P-adrenergic regulation of CaV1.2 remains consistent across species, and the research explores whether Applicants can specifically target this process.
[0290] Dominant mutations in RYR2 or recessive mutations in CASQ2 lead to CPVT. Multiple factors, including SR Ca2+load, leak, and NCX activity, influence the development of arrhythmias in CPVT.102’103An increase in SR Ca2+load, even without P-adrenergic stimulation, can significantly augment the likelihood of arrhythmias in RyR2-R4496C heterozygous mice.104Current treatments for CPVT are not optimal.68’105-111p-blockers may lower arrhythmia rates but do not prevent sudden cardiac death and have limitations due to side effects and dosing.69Verapamil can synergize with P-blockers in some patients, but dosing is limited.69The results herein indicate a near-total reduction in arrhythmogenesis in CPVT mice with decreased Rad phosphorylation. Applicants have created a gene editor for Rad that alters Ser300to Phe, effectively minimizing the impact of PKA-induced disruption of the Rad-CavP interaction. This gene editor can be utilized in CPVT-RyR2 mutant mice and CPVT-Casq2 null mice to evaluate basal and epinephrine-induced arrhythmogenesis.
[0291] Hypercontractility and arrhythmias are significant characteristics of HCM. P-adrenergic antagonists are the first-line treatments for HCM; however, they are often poorly tolerated due to heart rate reduction and non-cardiac side effects. Applicants propose that a therapy that specifically blocks P-adrenergic stimulation of CaV1.2 would be more effective than P-blockers, as P-blockers inhibit PLB phosphorylation, which enhances relaxation rates and IKS phosphorylation, thereby shortening action potentials and decreasing Ca2+influx.Attorney Docket 44010.202WO-PCT / / CU24243Applicants can use aMHC HCM mice112. While Applicants could cross these mice with 4SA-Rad mice, they are on different genetic backgrounds, and the HCM phenotype requires a 129Sv background. Gene editing of Rad in the 129Sv background overcomes this issue. Applicants can evaluate cardiac function with and without adrenergic agonists and assess arrhythmogenesis in the absence and presence of isoproterenol.
[0292] C.3.2. Results.
[0293] C.3.2.a. Preventing Rad phosphorylation attenuates triggered activity andin CPVT- mice. Applicants crossed CPVT-RyR2 R2474S mice113with 4SA-Rad mutant mice. Applicants isolated ventricular myocytes from both CPVT and CPVT-homozygous 4SA-Rad mice. Cells exhibiting spontaneous or electrically stimulated delayed after-depolarizations (DADs) under basal conditions were excluded. Applicants analyzed the action potentials of these ventricular myocytes stimulated at 3 Hz at room temperature. In the presence of 100 nM epinephrine, 62% (18 out of 29 cells, N=6 mice) of CPVT cells demonstrated triggered beats, compared to 11% (3 out of 28 cells, N=6) of CPVT / homozygous 4SA-Rad cells (FIGs. 18A and 18B). Similar findings were noted 2 minutes after epinephrine administration (FIGs. 18A and 18B). Applicants measured Ca2+transients, induced by electrical stimulation at 2 Hz and 33°C, in CPVT, CPVT / heterozygous 4SA-Rad, and CPVT / homozygous 4SA-Rad ventricular cardiomyocytes, both before and 2 minutes post-10 pM epinephrine. Triggered beats were observed in 36% of CPVT cells at 1 minute and 56% at 2 minutes after epinephrine. In contrast, the incidence of triggered beats was significantly lower in CPVT / heterozygous and homozygous 4SA-Rad cells (FIGs. 18C and 18D).
[0294] Applicants implanted ECG telemeters in CPVT, CPVT / heterozygous 4S A-Rad, and CPVT / homozygous 4SA-Rad mice. Applicants monitored their ECGs for 30 minutes before the epinephrine injection, an hour afterward, and an additional 23 hours. The VT occurrence in CPVT mice during the initial 30 minutes may have resulted from handling the mice to activate the telemeter with the magnet. In the CPVT group, 6 out of 10 mice experienced VT in the hour following epinephrine (FIGs. 18E and 18F), with the longest VT episode lasting between 63 to 201 seconds (FIG. 18G). No VT was recorded in the CPVT / heterozygous or homozygous 4S A-Rad mice during the 1-hour observation (N=8 mice in each group). Among the 4 CPVT mice that did not exhibit arrhythmias in the 1-hour timeframe, 3 developed VT over the following 23 hours. In CPVT / heterozygous 4S A-Rad, 1 of 8 mice experienced VT for 23 hours,Attorney Docket 44010.202WO-PCT / / CU24243while no arrhythmias were observed in homozygous 4SA-Rad mice. Applicants conclude that catecholamine-induced increased Ca2+influx is essential for triggering activities in CPVT VT.
[0295] C.3.2.b. Development of a gene-editor to attenuate phosphorylation of Rad.Initially, Applicants created a knock-in mouse with Ala-substitution of all four phosphorylation sites (4SA-Rad).6Subsequently, Applicants created N-terminal S25A, S38A knock-in mice, in which adrenergic augmentation of Ca2+current was preserved114, implying instead that the C-terminal sites are essential. Recently, Applicants completed generating an inducible S272A / S300A knock-in mouse that has a complete absence of Ca2+current augmentation.
[0296] While substituting Ala for Ser272and Ser300represents an ideal set of mutations, these modifications are currently unachievable with existing gene editing tools. Applicants evaluated phosphorylation site mutations that are feasible for base editing. Using a FRET -based assay, Applicants aimed to identify Rad mutations that would preserve the basal Rad-P interaction while mitigating the phosphorylation-induced disruption of this interaction. The mutation set of S272N / S300F meets the FRET-based requirements (FIG. 19A). However, targeting S272N and S300F with base editors requires modifying opposite strands, resulting in two nicks roughly 100 nt apart, which may cause deletion of the intervening region. Consequently, opting for the S300F mutation is the superior choice (FIG. 19B). Applicants transfected C2C12 cells (a mouse myoblast cell line) with the cytosine base editor (CBE) and guide RNA, followed by genomic DNA sequencing. The results showed over 80% editing and a bystander mutation of H302Y (SEQ ID NO: 7), which does not alter Rad-P interaction. Applicants have prepared dual AAV9-CBE-S300F vectors, and the dual AAV9s are currently being created.
[0297] C.3.3. Experimental methodology
[0298] C.3.3.a It is expected that base-editing of Rad to prevent Rad phosphorylation can attenuate arrhythmias in CPVT-RyR2 and Casq2 null mice. Applicants can inject AAV9-CBE-S300F into C57 pups between P2 and P5. Multiple doses of the virus can be tested, as Applicants showed for the Rad-deletion editor. Upon reaching 6-8 weeks of age, Applicants can isolate cardiomyocytes to assess the degree of editing and the adrenergic regulation of Ca2+channels and transient amplitude. The previous findings indicate that adrenergic regulation on Ca2+channels and transient amplitude correlates linearly with Rad phosphorylation; heterozygous 4SA-Rad mice exhibit -50% regulation of these channels.6Since the heterozygous 4SA-Rad mice protect against adrenergic-induced arrhythmias (FIGs. 18E andAttorney Docket 44010.202WO-PCT / / CU2424318F), approximately 50% editing may be adequate to reduce arrhythmias. Subsequently, Applicants can investigate heterozygous RyR2-R2474S mice and homozygous Casq2-null mice. Applicants can perform initial injections as pups and evaluate if this editing can inhibit triggered beats and arrhythmogenesis both in vitro and in vivo. Similar experiments can be conducted, as illustrated in FIGs. 18A-18G. Applicants can use ten mice per group with PBS controls.
[0299] C.3.3.b. Determining the effects of preventing augmented Ca2+influx in mice with HCM. Applicants investigated the effect of Rad phosphorylation and increased Ca2+influx on the stress-related negative impacts on inotropy, heart rate increase, and arrhythmogenesis in HCM mice. The HCM phenotype of aMHC-R403Q appears in the 129SvEv genetic background.112Initially, Applicants can inject the AAV9-CBE-S300F or a PBS-control into heterozygous aMHC-R403Q between postnatal days 2 and 5. Applicants can start monitoring the subjects monthly using echocardiograms from 4 months of age. Previous research indicates severe hypertrophy develops between 30 and 50 weeks of age.112Applicants can assess cardiac function and survival over one year, at which point the animals can be euthanized for histopathological analysis.
[0300] In distinct groups of mice, Applicants can conduct in vivo hemodynamic analysis (pressure-volume loops) both with and without dobutamine, as previously described.115In the R403Q mice, 10 pg / kg / min of intravenously administered dobutamine enhanced cardiac contractility, heart rate, and stroke volume.115Conversely, metoprolol lowered stroke volume and cardiac output to below baseline levels while significantly increasing LV end-diastolic pressure.115Applicants expect that metoprolol is not the best option as it may inhibit the phosphorylation of PLB and the adrenergic facilitation of K+current (noting that IKS channels are absent in mice). In contrast, mice edited with AAV9-CBE-S300F should exhibit decreased catecholamine-induced inotropy while allowing adrenergic regulation of PLB / SERCA. Consequently, by avoiding P-blockers but inhibiting Ca2+influx, Applicants anticipate an enhancement in myocardial relaxation.
[0301] Applicants can also evaluate the inducibility of arrhythmias using implantable telemeters and programmed stimulation, both in the presence and absence of isoproterenol. Programmed stimulation has induced ventricular ectopy and ventricular tachycardia in five out of eight aMHC-R403Q mice, compared to 0 out of eight in WT mice.116Applicants can employ mice aged between seven and nine months. Should preventing Rad phosphorylation and theAttorney Docket 44010.202WO-PCT / / CU24243consequent reduced Ca2+influx mitigate the hypertrophic phenotype or arrhythmias, Applicants can test whether injecting the AAV9-CBE-S300F editor in adult mice can prevent arrhythmias or enhance hemodynamics. The fibrosis present in the HCM mice may limit the extent of effective gene editing.
[0302] C.3.4. In sections C.2.3.b and C.2.3. C, the main objectives were to investigate how increased Ca2+influx affects cardiac function and arrhythmias in ischemic cardiomyopathy. Applicants proposed that this enhanced Ca2+influx would be effective, safe, and possibly more beneficial along with P-blockers. Preventing catecholamine-induced Rad phosphorylation and reducing the increased Ca2+influx can also be effective in ischemic HF, particularly for arrhythmias, as P-blockers are known to diminish ventricular arrhythmias.117Until now, no experimental tools have been available to sort through these possibilities. Applicants can examine the impact of reducing Rad phosphorylation in ischemic cardiomyopathy. Heart failure can be induced in 2-month-old C57 mice via LAD ligation. After stable HF has developed (approximately four weeks post-MI), mice exhibiting an ejection fraction below 35% can be divided into two groups: one receiving a retro-orbital injection of AAV9-CBE-S300F and the other receiving PBS. Applicants can monitor mortality rates, and LV function can be assessed through monthly echocardiograms over the next three months. In another group, ECG telemeters can be implanted to monitor for arrhythmias. Editing Rad to inhibit its phosphorylation and stop the resulting increased Ca2+influx allows Applicants to investigate other disease models, such as heart failure with preserved ejection fraction (HFpEF), where P-blockers may offer limited effectiveness, potentially due to constraints on chronotropic responses or the inhibition of phosphorylation of K+channels or PLN, which can diminish relaxation.Example 2 - Antisense oligonucleotides (ASO)
[0303] Applicants generated ASO’s to eliminate Rad expression. Exemplary ASO sequences:1. ASO-895’AGCGTCACTATTGGTC3’ (SEQ ID NO: 1)2. ASO-6425’GATAGAACCCACTCGT3’ (SEQ ID NO: 2)3. ASO-9505’TCGAATAGTGCCTGGA3’ (SEQ ID NO: 3)
[0304] Applicants tested the ASOs in silico (FIG. 20), in vitro using a dual-luciferase assay (FIG. 21), and by western blotting for transfected VmRadWT (FIG. 22).Attorney Docket 44010.202WO-PCT / / CU24243Example 3 - Base Editing
[0305] Applicants created a gene-editing approach to delete Rad from cardiomyocytes. The guide RNA is GCGCCAGATACGCCTGCGCA (SEQ ID NO: 4) (GGG PAM). (Note: that this guide RNA is same for mice and humans.)
[0306] Applicants used the cardiomyocyte-specific chicken cardiac troponin T promoter (Tnnt2).
[0307] Applicants used a split-intein design, requiring co-transduction of two AAV vectors, each expressing half of the editor, and trans-splicing reconstitution within cells. The AAV9 contained cloned plasmids, Cas9 and the guide RNA.
[0308] Names of two AAV9:AAV9.cTNT. CLSV40NLS-NRradCas9-SV40NLS.bGH.gRNA. U6 AAV9.cTNT. CI. SV40NLS-CRradCas9-SV40NLS.bGH.gRNA. U6
[0309] Mice (pups 2-5 days old) were injected with the dual AAV9 subcutaneously.References:1. Liu, G., A. Papa, A. N. Katchman, S. I. Zakharov, D. Roybal, J. A. Hennessey, J. Kushner, L. Yang, B. X. Chen, A. Kushnir, K. Dangas, S. P. Gygi, G. S. Pitt, H. M. Colecraft, M. Ben-Johny, M. Kalocsay, and S. O. Marx. Mechanism of adrenergic CaV1.2 stimulation revealed by proximity proteomics. Nature. 2020;577(7792):695-700. PMCID: PMC7018383.2. Reynet, C. and C. R. Kahn. Rad: a member of the Ras family overexpressed in muscle of type II diabetic humans. Science. 1993;262(5138): 1441-4.3. Finlin, B. S., S. M. Crump, J. Satin, and D. A. Andres. Regulation of voltage-gated calcium channel activity by the Rem and Rad GTPases. Proc Natl Acad Sci U S A.2003; 100(24): 14469-74. PMCID: PMC283615.4. Yang, T. and H. M. Colecraft. Regulation of voltage-dependent calcium channels by RGK proteins. Biochim Biophys Acta. 2013;1828(7):1644-54. PMCID: PMC4190112.5. Beguin, P., K. Nagashima, T. Gonoi, T. Shibasaki, K. Takahashi, Y. Kashima, N. Ozaki, K. Geering, T. Iwanaga, and S. Seino. Regulation of Ca2+ channel expression at the cell surface by the small G-protein kir / Gem. Nature. 2001;411 (6838):701 -6.6. Papa, A., S. I. Zakharov, A. N. Katchman, J. S. Kushner, B. X. Chen, L. Yang, G. Liu, A. S. Jimenez, R. J. Eisert, G. A. Bradshaw, W. Dun, S. R. Ali, A. Rodriques, K. Zhou, V. Topkara, M. Yang, J. P. Morrow, E. J. Tsai, A. Karlin, E. Wan, M. Kalocsay, G. S. Pitt, H. M.Attorney Docket 44010.202WO-PCT / / CU24243Colecraft, M. Ben-Johny, and S. O. Marx. Rad regulation of Ca(V)l.2 channels controls cardiac fight-or-flight response. Nat Cardiovasc Res. 2022;l(ll):1022-1038. PMCID: PMC9681059.7. Chen, X., X. Zhang, H. Kubo, D. M. Harris, G. D. Mills, J. Moyer, R. Berretta, S. T. Potts, J. D. Marsh, and S. R. Houser. Ca2+ influx-induced sarcoplasmic reticulum Ca2+ overload causes mitochondrial-dependent apoptosis in ventricular myocytes. Circ Res.2005;97(10):1009-17.8. Muth, J. N., I. Bodi, W. Lewis, G. Varadi, and A. Schwartz. A Ca(2+)-dependent transgenic model of cardiac hypertrophy: A role for protein kinase Calpha. Circulation.2001;103(l):140-7.9. Splawski, I., K. W. Timothy, L. M. Sharpe, N. Decher, P. Kumar, R. Bloise, C. Napolitano, P. J. Schwartz, R. M. Joseph, K. Condouris, H. Tager-Flusberg, S. G. Priori, M. C. Sanguinetti, and M. T. Keating. Ca(V)1.2 calcium channel dysfunction causes a multisystem disorder including arrhythmia and autism. Cell. 2004; 119(1): 19-31.10. Ahern, B. M., B. M. Levitan, S. Veeranki, M. Shah, N. Ali, A. Sebastian, W. Su, M. C. Gong, J. Li, J. E. Stelzer, D. A. Andres, and J. Satin. Myocardial-restricted ablation of the GTPase RAD results in a pro-adaptive heart response in mice. J Biol Chem.2019;294(28): 10913-10927. PMCID: PMC6635439.11. Manning, J. R., L. Chelvarajan, B. M. Levitan, C. N. Withers, P. R. Nagareddy, C. M. Haggerty, B. K. Fomwalt, E. Gao, H. Tripathi, A. Abdel-Latif, D. A. Andres, and J. Satin. Rad GTPase deletion attenuates post-ischemic cardiac dysfunction and remodeling. JACC Basic Transl Sci. 2018;3(l):83-96. PMCID: PMC5931223.12. Manning, J. R., G. Yin, C. N. Kaminski, J. Magyar, H. Z. Feng, J. Penn, G. Sievert, K. Thompson, J. P. Jin, D. A. Andres, and J. Satin. Rad GTPase deletion increases L-type calcium channel current leading to increased cardiac contraction. J Am Heart Assoc.2013;2(6):e000459. PMCID: PMC3886777.13. Arimura, T., A. Helbling-Leclerc, C. Massart, S. Varnous, F. Niel, E. Lacene, Y. Frames, M. Toussaint, A. M. Mura, D. I. Keller, H. Amthor, R. Isnard, M. Malissen, K. Schwartz, and G. Bonne. Mouse model carrying H222P-Lmna mutation develops muscular dystrophy and dilated cardiomyopathy similar to human striated muscle laminopathies. Hum Mol Genet. 2005; 14(1): 155-69.14. Ramratnam, M., G. Salama, R. K. Sharma, D. W. Wang, S. H. Smith, S. K. Banerjee, X. N. Huang, L. M. Gifford, M. L. Pruce, B. E. Gabris, S. Saba, S. G. Shroff, and F. Ahmad.Attorney Docket 44010.202WO-PCT / / CU24243Gene-Targeted Mice with the Human Troponin T R141W Mutation Develop Dilated Cardiomyopathy with Calcium Desensitization. PLoS One. 2016;l l(12):e0167681. PMCID: PMC5147943.15. Lu, Q. W., S. Morimoto, K. Harada, C. K. Du, F. Takahashi -Yanaga, Y. Miwa, T. Sasaguri, and I. Ohtsuki. Cardiac troponin T mutation R141W found in dilated cardiomyopathy stabilizes the troponin T-tropomyosin interaction and causes a Ca2+ desensitization. J Mol Cell Cardiol. 2003;35(12): 1421-7.16. Chiu, H. C., A. Kovacs, D. A. Ford, F. F. Hsu, R. Garcia, P. Herrero, J. E. Saffitz, and J. E. Schaffer. A novel mouse model of lipotoxic cardiomyopathy. J Clin Invest. 2001;107(7):813-22. PMCID: PMC199569.17. Xu, J., N. L. Gong, I. Bodi, B. J. Aronow, P. H. Backx, and J. D. Molkentin. Myocyte enhancer factors 2A and 2C induce dilated cardiomyopathy in transgenic mice. J Biol Chem.2006;281(14):9152-62.18. Packer, M. Beta-adrenergic blockade in chronic heart failure: principles, progress, and practice. Prog Cardiovasc Dis. 1998;41(1 Suppl l):39-52.19. Packer, M., M. R. Bristow, J. N. Cohn, W. S. Colucci, M. B. Fowler, E. M. Gilbert, and N. H. Shusterman. The effect of carvedilol on morbidity and mortality in patients with chronic heart failure. U. S. Carvedilol Heart Failure Study Group. N Engl J Med. 1996;334(21):1349-55.20. Packer, M., J. R. Carver, R. J. Rodeheffer, R. J. Ivanhoe, R. DiBianco, S. M. Zeldis, G. H. Hendrix, W. J. Bommer, U. Elkayam, M. L. Kukin, and et al. Effect of oral milrinone on mortality in severe chronic heart failure. The PROMISE Study Research Group. N Engl J Med.1991;325(21): 1468-75.21. Best, J. M. and T. J. Kamp. A sympathetic model of L-type Ca2+ channel-triggered arrhythmias. Am J Physiol Heart Circ Physiol. 2010;298(l): H3-4. PMCID: PMC2806129. 22. Marban, E., S. W. Robinson, and W. G. Wier. Mechanisms of arrhythmogenic delayed and early afterdepolarizations in ferret ventricular muscle. J Clin Invest. 1986;78(5): 1185-92. PMCID: PMC423803.23. January, C. T. and J. M. Riddle. Early afterdepolarizations: mechanism of induction and block. A role for L-type Ca2+ current. Circ Res. 1989;64(5):977-90.Attorney Docket 44010.202WO-PCT / / CU2424324. Anderson, M. E., A. P. Braun, Y. Wu, T. Lu, Y. Wu, H. Schulman, and R. J. Sung. KN-93, an inhibitor of multifunctional Ca++ / calmodulin-dependent protein kinase, decreases early afterdepolarizations in rabbit heart. J Pharmacol Exp Ther. 1998;287(3):996-1006.25. Zeng, J. and Y. Rudy. Early afterdepolarizations in cardiac myocytes: mechanism and rate dependence. Biophys J. 1995;68(3):949-64. PMCID: PMC1281819.26. Yamada, M., K. Ohta, A. Niwa, N. Tsujino, T. Nakada, and M. Hirose. Contribution of L-type Ca2+ channels to early afterdepolarizations induced by I Kr and I Ks channel suppression in guinea pig ventricular myocytes. J Membr Biol. 2008;222(3):151-66.27. Shimizu, W., T. Noda, H. Takaki, N. Nagaya, K. Satomi, T. Kurita, K. Suyama, N. Aihara, K. Sunagawa, S. Echigo, Y. Miyamoto, Y. Yoshimasa, K. Nakamura, T. Ohe, J. A. Towbin, S. G. Priori, and S. Kamakura. Diagnostic value of epinephrine test for genotyping LQT1, LQT2, and LQT3 forms of congenital long QT syndrome. Heart Rhythm.2004;1(3):276-83.28. Shimizu, W., T. Noda, H. Takaki, T. Kurita, N. Nagaya, K. Satomi, K. Suyama, N. Aihara, S. Kamakura, K. Sunagawa, S. Echigo, K. Nakamura, T. Ohe, J. A. Towbin, C. Napolitano, and S. G. Priori. Epinephrine unmasks latent mutation carriers with LQT1 form of congenital long-QT syndrome. J Am Coll Cardiol. 2003;41(4):633-42.29. Tomaselli, G. F. and D. P. Zipes. What causes sudden death in heart failure? Circ Res.2004;95(8):754-63.30. Jost, N., L. Virag, M. Bitay, J. Takacs, C. Lengyel, P. Biliczki, Z. Nagy, G. Bogats, D. A. Lathrop, J. G. Papp, and A. Varro. Restricting excessive cardiac action potential and QT prolongation: a vital role for IKs in human ventricular muscle. Circulation. 2005; 112(10): 1392-9.31. Terrenoire, C., C. E. Clancy, J. W. Cormier, K. J. Sampson, and R. S. Kass. Autonomic control of cardiac action potentials: role of potassium channel kinetics in response to sympathetic stimulation. Circ Res. 2005;96(5):e25-34.32. Bers, D. M. Cardiac excitation-contraction coupling. Nature. 2002;415(6868): 198-205.33. Colecraft, H. M., B. Alseikhan, S. X. Takahashi, D. Chaudhuri, S. Mittman, V. Yegnasubramanian, R. S. Alvania, D. C. Johns, E. Marban, and D. T. Yue. Novel functional properties of Ca(2+) channel beta subunits revealed by their expression in adult rat heart cells. J Physiol. 2002;541(Pt 2):435-52. PMCID: PMC2290333.Attorney Docket 44010.202WO-PCT / / CU2424334. Splawski, I., K. W. Timothy, N. Decher, P. Kumar, F. B. Sachse, A. H. Beggs, M. C. Sanguinetti, and M. T. Keating. Severe arrhythmia disorder caused by cardiac L-type calcium channel mutations. Proc Natl Acad Sci U S A. 2005;102(23):8089-96; discussion 8086-8. PMCID: PMC1149428.35. Nakayama, H., X. Chen, C. P. Baines, R. Klevitsky, X. Zhang, H. Zhang, N. Jaleel, B. H. Chua, T. E. Hewett, J. Robbins, S. R. Houser, and J. D. Molkentin. Ca2+- and mitochondrial-dependent cardiomyocyte necrosis as a primary mediator of heart failure. J Clin Invest.2007; 117(9):2431-44. PMCID: PMC1937500.36. Chen, X., H. Nakayama, X. Zhang, X. Ai, D. M. Harris, M. Tang, H. Zhang, C. Szeto, K. Stockbower, R. M. Berretta, A. D. Eckhart, W. J. Koch, J. D. Molkentin, and S. R. Houser. Calcium influx through CaV1.2 is a proximal signal for pathological cardiomyocyte hypertrophy. J Mol Cell Cardiol. 2011;50(3):460-70. PMCID: PMC3035763.37. Zhang, Q., J. Chen, Y. Qin, J. Wang, and L. Zhou. Mutations in voltage-gated L-type calcium channel: implications in cardiac arrhythmia. Channels (Austin). 2018;12(1):201-218. PMCID: PMC6104696.38. Goonasekera, S. A., K. Hammer, M. Auger-Messier, I. Bodi, X. Chen, H. Zhang, S. Reiken, J. W. Elrod, R. N. Correll, A. J. York, M. A. Sargent, F. Hofmann, S. Moosmang, A. R. Marks, S. R. Houser, D. M. Bers, and J. D. Molkentin. Decreased cardiac L-type Ca(2)(+) channel activity induces hypertrophy and heart failure in mice. J Clin Invest. 2012;122(1):280-90. PMCID: PMC3248289.39. Reuter, H. and H. Scholz. The regulation of the calcium conductance of cardiac muscle by adrenaline. J Physiol. 1977;264(1):49-62. PMCID: PMC1307747.40. Kamp, T. J. and J. W. Hell. Regulation of cardiac L-type calcium channels by protein kinase A and protein kinase C. Circ Res. 2000;87(12): 1095-102.41. Weiss, S., S. Oz, A. Benmocha, and N. Dascal. Regulation of cardiac L-type Ca(2)(+) channel CaV1.2 via the beta-adrenergic-cAMP-protein kinase A pathway: old dogmas, advances, and new uncertainties. Circ Res. 2013; 113(5):617-31.42. Gao, T., A. Yatani, M. L. Dell'Acqua, H. Sako, S. A. Green, N. Dascal, J. D. Scott, and M. M. Hosey. cAMP-dependent regulation of cardiac L-type Ca2+ channels requires membrane targeting of PKA and phosphorylation of channel subunits. Neuron. 1997; 19(1): 185-96.Attorney Docket 44010.202WO-PCT / / CU2424343. Lemke, T., A. Welling, C. J. Christel, A. Blaich, D. Bernhard, P. Lenhardt, F. Hofmann, and S. Moosmang. Unchanged beta-adrenergic stimulation of cardiac L-type calcium channels in Ca v 1.2 phosphorylation site S1928A mutant mice. J Biol Chem. 2008;283(50):34738-44.44. Brandmayr, J., M. Poomvanicha, K. Domes, J. Ding, A. Blaich, J. W. Wegener, S. Moosmang, and F. Hofmann. Deletion of the C-terminal phosphorylation sites in the cardiac beta-subunit does not affect the basic beta-adrenergic response of the heart and the Ca(v)1.2 channel. J Biol Chem. 2012;287(27):22584-92. PMCID: PMC3391128.45. Perez-Reyes, E., W. Yuan, X. Wei, and D. M. Bers. Regulation of the cloned L-type cardiac calcium channel by cyclic- AMP-dependent protein kinase. FEBS Lett.1994;342(2): 119-23.46. Charnet, P., P. Lory, E. Bourinet, T. Collin, and J. Nargeot. cAMP-dependent phosphorylation of the cardiac L-type Ca channel: a missing link? Biochimie.1995;77(12):957-62.47. Fu, Y., R. E. Westenbroek, T. Scheuer, and W. A. Catterall. Basal and beta-adrenergic regulation of the cardiac calcium channel CaV1.2 requires phosphorylation of serine 1700. Proc Natl Acad Sci U S A. 2014;111(46):16598-603. PMCID: PMC4246329.48. Fuller, M. D., M. A. Emrick, M. Sadilek, T. Scheuer, and W. A. Catterall. Molecular mechanism of calcium channel regulation in the fight-or-flight response. Sci Signal.2010;3(141):ra70. PMCID: PMC3063709.49. Bunemann, M., B. L. Gerhardstein, T. Gao, and M. M. Hosey. Functional regulation of L-type calcium channels via protein kinase A-mediated phosphorylation of the beta(2) subunit. JBiol Chem. 1999;274(48):33851-4.50. Kushner, J. S., G. Liu, R. J. Eisert, G. A. Bradshaw, G. S. Pitt, J. T. Hinson, M. Kalocsay, and S. O. Marx. Detecting Cardiovascular Protein-Protein Interactions by Proximity Proteomics. Circ Res. 2022;130(2):273-287. PMCID: PMC8852690.51. Papa, A., J. Kushner, J. A. Hennessey, A. N. Katchman, S. I. Zakharov, B. X. Chen, L. Yang, R. Lu, S. Leong, J. Diaz, G. Liu, D. Roybal, X. Liao, P. J. Del Rivero Morfin, H. M. Colecraft, G. S. Pitt, O. Clarke, V. Topkara, M. Ben-Johny, and S. O. Marx. Adrenergic CaV1.2 Activation via Rad Phosphorylation Converges at alphalC I-II Loop. Circ Res.2021;128(l):76-88. PMCID: PMC7790865.52. Katchman, A. N., S. I. Zakharov, M. S. Bohnen, A. Sanchez Jimenez, J. S. Kushner, L. Yang, B. X. Chen, A. Nasari, G. Liu, D. E. Rabbani, J. Han, C. S. Leu, G. S. Pitt, and S. O. Marx.Attorney Docket 44010.202WO-PCT / / CU24243Augmented Cardiac Inotropy by Phosphodiesterase Inhibition Requires Phosphorylation of Rad and Increased Calcium Current. Circulation. 2024; 149(20): 1617-1620.53. Lymperopoulos, A., G. Rengo, and W. J. Koch. Adrenergic nervous system in heart failure: pathophysiology and therapy. Circ Res. 2013;113(6):739-53. PMCID: PMC3843360.54. Marx, S. O., S. Reiken, Y. Hisamatsu, T. Jayaraman, D. Burkhoff, N. Rosemblit, and A. R. Marks. PKA phosphorylation dissociates FKBP12.6 from the calcium release channel (ryanodine receptor): defective regulation in failing hearts. Cell. 2000;101(4):365-76.55. Teerlink, J. R., R. Diaz, G. M. Felker, J. J. V. McMurray, M. Metra, S. D. Solomon, K. F. Adams, I. Anand, A. Arias-Mendoza, T. Biering-Sorensen, M. Bohm, D. Bonderman, J. G. F. Cleland, R. Corbalan, M. G. Crespo-Leiro, U. Dahlstrom, L. E. Echeverria, J. C. Fang, G. Filippatos, C. Fonseca, E. Goncalvesova, A. R. Goudev, J. G. Howlett, D. E. Lanfear, J. Li, M. Lund, P. Macdonald, V. Mareev, S. I. Momomura, E. OMeara, A. Parkhomenko, P. Ponikowski, F. J. A. Ramires, P. Serpytis, K. Sliwa, J. Spinar, T. M. Suter, J. Tomcsanyi, H. Vandekerckhove, D. Vinereanu, A. A. Voors, M. B. Yilmaz, F. Zannad, L. Sharpsten, J. C. Legg, C. Varin, N. Honarpour, S. A. Abbasi, F. I. Malik, C. E. Kurtz, and G.-H. Investigators. Cardiac Myosin Activation with Omecamtiv Mecarbil in Systolic Heart Failure. N Engl J Med.2021;384(2): 105-116.56. January, C. T., J. M. Riddle, and J. J. Salata. A model for early afterdepolarizations: induction with the Ca2+ channel agonist Bay K 8644. Circ Res. 1988;62(3):563-71.57. Asano, M., K. Aoki, and T. Matsuda. Contractile effects of Bay k 8644, a dihydropyridine calcium agonist, on isolated femoral arteries from spontaneously hypertensive rats. J Pharmacol Exp Ther. 1986;239(l):198-205.58. Aoki, K. and M. Asano. Effects of Bay K 8644 and nifedipine on femoral arteries of spontaneously hypertensive rats. Br J Pharmacol. 1986;88(l):221-30. PMCID: PMC1917113.59. Santulli, G., W. Xie, S. R. Reiken, and A. R. Marks. Mitochondrial calcium overload is a key determinant in heart failure. Proc Natl Acad Sci U S A. 2015; 112(36): 11389-94. PMCID: PMC4568687.60. Xie, Y., E. Grandi, J. L. Puglisi, D. Sato, and D. M. Bers. beta-adrenergic stimulation activates early afterdepolarizations transiently via kinetic mismatch of PKA targets. J Mol Cell Cardiol. 2013;58:153-61. PMCID: PMC3628092.61. Hegyi, B., R. P. Polonen, K. T. Hellgren, C. Y. Ko, K. S. Ginsburg, J. Bossuyt, M. Mercola, and D. M. Bers. Cardiomyocyte Na(+) and Ca(2+) mishandling drives vicious cycleAttorney Docket 44010.202WO-PCT / / CU24243involving CaMKII, ROS, and ryanodine receptors. Basic Res Cardiol. 2021;116(1):58. PMCID: PMC8516771.62. Dridi, H., A. Kushnir, R. Zalk, Q. Yuan, Z. Melville, and A. R. Marks. Intracellular calcium leak in heart failure and atrial fibrillation: a unifying mechanism and therapeutic target. Nat Rev Cardiol. 2020; 17(11):732-747. PMCID: PMC8362847.63. Kushnir, A., B. Wajsberg, and A. R. Marks. Ryanodine receptor dysfunction in human disorders. Biochim Biophys Acta Mol Cell Res. 2018; 1865(11 Pt B): 1687-1697.64. Marx, S. O. and A. R. Marks. Dysfunctional ryanodine receptors in the heart: new insights into complex cardiovascular diseases. J Mol Cell Cardiol. 2013;58:225-31. PMCID: PMC4042628.65. Anderson, M. E., J. H. Brown, and D. M. Bers. CaMKII in myocardial hypertrophy and heart failure. J Mol Cell Cardiol. 2011;51(4):468-73. PMCID: PMC3158288.66. Skinner, J. R., A. Winbo, D. Abrams, J. Vohra, and A. A. Wilde. Channelopathies That Lead to Sudden Cardiac Death: Clinical and Genetic Aspects. Heart Lung Circ. 2019;28(l):22-30.67. Marks, A. R., S. Priori, M. Memmi, K. Kontula, and P. J. Laitinen. Involvement of the cardiac ryanodine receptor / calcium release channel in catecholaminergic polymorphic ventricular tachycardia. J Cell Physiol. 2002; 190(1): 1-6.68. Watanabe, H. and B. C. Knollmann. Mechanism underlying catecholaminergic polymorphic ventricular tachycardia and approaches to therapy. J Electrocardiol.2011;44(6):650-5.69. van derWerf, C., A. H. Zwinderman, and A. A. Wilde. Therapeutic approach for patients with catecholaminergic polymorphic ventricular tachycardia: state of the art and future developments. Europace. 2012;14(2):175-83.70. Rosso, R., J. M. Kalman, O. Rogowski, S. Diamant, A. Birger, S. Biner, B. Belhassen, and S. Viskin. Calcium channel blockers and beta-blockers versus beta-blockers alone for preventing exercise-induced arrhythmias in catecholaminergic polymorphic ventricular tachycardia. Heart Rhythm. 2007;4(9): 1149-54.71. Yang, T., A. Puckerin, and H. M. Colecraft. Distinct RGK GTPases differentially use alphal- and auxiliary beta-binding-dependent mechanisms to inhibit CaV1.2 / CaV2.2 channels. PLoS One. 2012;7(5):e37079. PMCID: PMC3349659.Attorney Docket 44010.202WO-PCT / / CU2424372. Beguin, P., Y. J. Ng, C. Krause, R. N. Mahalakshmi, M. Y. Ng, and W. Hunziker. RGK small GTP-binding proteins interact with the nucleotide kinase domain of Ca2+-channel betasubunits via an uncommon effector binding domain. J Biol Chem. 2007;282(15): 11509-20.73. Paci, M., K. Penttinen, M. Pekkanen-Mattila, and J. T. Koivumaki. Arrhythmia Mechanisms in Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes. J Cardiovasc Pharmacol. 2020;77(3):300-316.74. Wu, P., G. Deng, X. Sai, H. Guo, H. Huang, and P. Zhu. Maturation strategies and limitations of induced pluripotent stem cell-derived cardiomyocytes. Biosci Rep. 2021;41(6). PMCID: PMC8209171.75. Wagner, S., L. S. Maier, and D. M. Bers. Role of sodium and calcium dysregulation in tachyarrhythmias in sudden cardiac death. Circ Res. 2015; 116(12): 1956-70. PMCID: PMC4458704.76. Ko, C. Y., C. E. R. Smith, and E. Grandi, Calcium-Dependent Signaling in Cardiac Myocytes, in Cardiovascular Signaling in Health and Disease, N. L. Parinandi and T. J. Hund, Editors. 2022: Cham (CH), p. 3-37.77. del Monte, F., S. E. Harding, U. Schmidt, T. Matsui, Z. B. Kang, G. W. Dec, J. K. Gwathmey, A. Rosenzweig, and R. J. Hajj ar. Restoration of contractile function in isolated cardiomyocytes from failing human hearts by gene transfer of SERCA2a. Circulation.1999;100(23):2308-11. PMCID: PMC1249502.78. Lyon, A. R., D. Babalis, A. C. Morley-Smith, M. Hedger, A. Suarez Barrientos, G. Foldes, L. S. Couch, R. A. Chowdhury, K. N. Tzortzis, N. S. Peters, E. A. Rog-Zielinska, H. Y. Yang, S. Welch, C. T. Bowles, S. Rahman Haley, A. R. Bell, A. Rice, T. Sasikaran, N. A. Johnson, E. Falaschetti, J. Parameshwar, C. Lewis, S. Tsui, A. Simon, J. Pepper, J. J. Rudy, K. M. Zsebo, K. T. Macleod, C. M. Terracciano, R. J. Hajjar, N. Banner, and S. E. Harding. Investigation of the safety and feasibility of AAVl / SERCA2a gene transfer in patients with chronic heart failure supported with a left ventricular assist device - the SERCA-LVAD TRIAL. Gene Ther. 2020;27(12):579-590. PMCID: PMC7744277.79. Greenberg, B., J. Butler, G. M. Felker, P. Ponikowski, A. A. Voors, A. S. Desai, D. Barnard, A. Bouchard, B. Jaski, A. R. Lyon, J. M. Pogoda, J. J. Rudy, and K. M. Zsebo. Calcium upregulation by percutaneous administration of gene therapy in patients with cardiac disease (CUPID 2): a randomised, multinational, double-blind, placebo-controlled, phase 2b trial. Lancet. 2016;387(10024): 1178-86.Attorney Docket 44010.202WO-PCT / / CU2424380. Ragone, I., J. Barallobre-Barreiro, K. Takov, K. Theofilatos, X. Yin, L. E. Schmidt, N. Domenech, M. G. Crespo-Leiro, S. M. van der Voorn, A. Vink, T. A. B. van Veen, C. Bodor, B. Merkely, T. Radovits, and M. Mayr. SERCA2a Protein Levels Are Unaltered in Human Heart Failure. Circulation. 2023;148(7):613-616. PMCID: PMC10417319.81. Marks, A. R. Targeting ryanodine receptors to treat human diseases. J Clin Invest.2023; 133(2). PMCID: PMC9843046 biotechnology company focused on developing RyR-targeted therapeutics, and both he and Columbia University have stock in the company.82. Eschenhagen, T. Is ryanodine receptor phosphorylation key to the fight or flight response and heart failure? J Clin Invest. 2010;120(12):4197-203. PMCID: PMC2994341. 83. Janicek, R., E. M. Camors, D. M. Potenza, M. Fernandez-Tenorio, Y. Zhao, H. C. Dooge, R. Loaiza, F. J. Alvarado, M. Egger, H. H. Valdivia, and E. Niggli. Dual ablation of the RyR2-Ser2808 and RyR2-Ser2814 sites increases propensity for pro-arrhythmic spontaneous Ca(2+) releases. J Physiol. 2024;602(20):5179-5201. PMCID: PMC11493507.84. Negroni, J. A., S. Morotti, E. C. Lascano, A. V. Gomes, E. Grandi, J. L. Puglisi, and D. M. Bers. beta-adrenergic effects on cardiac myofilaments and contraction in an integrated rabbit ventricular myocyte model. J Mol Cell Cardiol. 2015;81:162-75. PMCID: PMC4380575. 85. Bondarenko, V. E. A compartmentalized mathematical model of the b eta 1 -adrenergic signaling system in mouse ventricular myocytes. PLoS One. 2014;9(2):e89113. PMCID: PMC3931689.86. Mullins, P. D. and V. E. Bondarenko. Mathematical model for b eta 1 -adrenergic regulation of the mouse ventricular myocyte contraction. Am J Physiol Heart Circ Physiol.2020;318(2): H264-H282.87. Morotti, S., A. G. Edwards, A. D. McCulloch, D. M. Bers, and E. Grandi. A novel computational model of mouse myocyte electrophysiology to assess the synergy between Na+ loading and CaMKII. J Physiol. 2014;592(6): 1181-97. PMCID: PMC3961080.88. Vignier, N., N. Mougenot, G. Bonne, and A. Muchir. Effect of genetic background on the cardiac phenotype in a mouse model of Emery-Dreifuss muscular dystrophy. Biochem Biophys Rep. 2019; 19: 100664. PMCID: PMC6630059.89. Werhahn, S. M., J. S. Kreusser, M. Hagenmuller, J. Beckendorf, N. Diemert, S. Hoffmann, J. H. Schultz, J. Backs, and M. Dewenter. Adaptive versus maladaptive cardiac remodelling in response to sustained beta-adrenergic stimulation in a new TSO on / off model'. PLoS One. 2021;16(6):e0248933. PMCID: PMC8211211Attorney Docket 44010.202WO-PCT / / CU2424390. Worman, H. J. Nuclear lamins and laminopathies. J Pathol. 2012;226(2):316-25. PMCID: PMC6673656.91. Miller, S. M., T. Wang, P. B. Randolph, M. Arbab, M. W. Shen, T. P. Huang, Z. Matuszek, G. A. Newby, H. A. Rees, and D. R. Liu. Continuous evolution of SpCas9 variants compatible with non-GPAMs. Nat Biotechnol. 2020;38(4):471-481. PMCID: PMC7145744.92. Nishimasu, H., X. Shi, S. Ishiguro, L. Gao, S. Hirano, S. Okazaki, T. Noda, O. O. Abudayyeh, J. S. Gootenberg, H. Mori, S. Oura, B. Holmes, M. Tanaka, M. Seki, H. Hirano, H. Aburatani, R. Ishitani, M. Ikawa, N. Yachie, F. Zhang, and O. Nureki. Engineered CRISPR-Cas9 nuclease with expanded targeting space. Science. 2018;361(6408): 1259-1262. PMCID: PMC6368452.93. Reichart, D., G. A. Newby, H. Wakimoto, M. Lun, J. M. Gorham, J. J. Curran, A. Raguram, D. M. DeLaughter, D. A. Conner, J. D. C. Marsiglia, S. Kohli, L. Chmatal, D. C. Page, N. Zabaleta, L. Vandenberghe, D. R. Liu, J. G. Seidman, and C. Seidman. Efficient in vivo genome editing prevents hypertrophic cardiomyopathy in mice. Nat Med. 2023;29(2):412-421. PMCID: PMC9941048.94. Pedersen, L. N., C. Valenzuela Ripoil, M. Ozcan, Z. Guo, A. Lotfinaghsh, S. Zhang, S. Ng, C. Weinheimer, J. Nigro, A. Kovacs, A. Diab, A. Klaas, F. Grogan, Y. Cho, A. Ataran, H. Luehmann, A. Heck, K. Kolb, L. Strong, R. Navara, G. M. Walls, G. Hugo, P. Samson, D. Cooper, F. J. Reynoso, J. K. Schwarz, K. Moore, K. Lavine, S. L. Rentschler, Y. Liu, P. K. Woodard, C. Robinson, P. S. Cuculich, C. Bergom, and A. Javaheri. Cardiac radiation improves ventricular function in mice and humans with cardiomyopathy. Med. 2023;4(12):928-943 e5. PMCID: PMC10994563.95. Michael, L. H., M. L. Entman, C. J. Hartley, K. A. Youker, J. Zhu, S. R. Hall, H. K. Hawkins, K. Berens, and C. M. Ballantyne. Myocardial ischemia and reperfusion: a murine model. Am J Physiol. 1995;269(6 Pt 2): H2147-54.96. Kumar, D., T. A. Hacker, J. Buck, L. F. Whitesell, E. H. Kaji, P. S. Douglas, and T. J. Kamp. Distinct mouse coronary anatomy and myocardial infarction consequent to ligation. Coron Artery Dis. 2005;16(l):41-4.97. Wan, E., J. S. Kushner, S. Zakharov, X. W. Nui, N. Chudasama, C. Kelly, M. Waase, D. Doshi, G. Liu, S. Iwata, T. Shiomi, A. Katchman, J. D'Armiento, S. Homma, and S. O. Marx. Reduced vascular smooth muscle BK channel current underlies heart failure-induced vasoconstriction in mice. FASEB J. 2013;27(5):1859-67. PMCID: PMC3633822.Attorney Docket 44010.202WO-PCT / / CU2424398. Moss, A. J., W. Zareba, W. J. Hall, P. J. Schwartz, R. S. Crampton, J. Benhorin, G. M. Vincent, E. H. Locati, S. G. Priori, C. Napolitano, A. Medina, L. Zhang, J. L. Robinson, K. Timothy, J. A. Towbin, and M. L. Andrews. Effectiveness and limitations of beta-blocker therapy in congenital long-QT syndrome. Circulation. 2000;101(6):616-23.99. Goldenberg, I., J. Bradley, A. Moss, S. McNitt, S. Polonsky, J. L. Robinson, M. Andrews, W. Zareba, and L. R. I. International. Beta-blocker efficacy in high-risk patients with the congenital long-QT syndrome types 1 and 2: implications for patient management. J Cardiovasc Electrophysiol. 2010;21(8):893-901. PMCID: PMC4005824.100. Donahue, J. K. Advice for management of the long-QT patient. J Cardiovasc Electrophysiol. 2010;21 (8): 902-4.101. Priori, S. G., C. Napolitano, P. J. Schwartz, M. Grillo, R. Bloise, E. Ronchetti, C. Moncalvo, C. Tulipani, A. Veia, G. Bottelli, and J. Nastoli. Association of long QT syndrome loci and cardiac events among patients treated with beta-blockers. JAMA. 2004;292(l 1): 1341-4.102. Jiang, D., R. Wang, B. Xiao, H. Kong, D. J. Hunt, P. Choi, L. Zhang, and S. R. Chen. Enhanced store overload-induced Ca2+ release and channel sensitivity to luminal Ca2+ activation are common defects of RyR2 mutations linked to ventricular tachycardia and sudden death. Circ Res. 2005;97(l 1): 1173-81.103. Lakatta, E. G. Functional implications of spontaneous sarcoplasmic reticulum Ca2+ release in the heart. Cardiovasc Res. 1992;26(3): 193-214.104. Sedej, S., F. R. Heinzel, S. Walther, N. Dybkova, P. Wakula, J. Groborz, P. Gronau, L. S. Maier, M. A. Vos, F. A. Lai, C. Napolitano, S. G. Priori, J. Kockskamper, and B. Pieske. Na+-dependent SR Ca2+ overload induces arrhythmogenic events in mouse cardiomyocytes with a human CPVT mutation. Cardiovasc Res. 2010;87(l):50-9.105. Swan, H., P. Laitinen, K. Kontula, and L. Toivonen. Calcium channel antagonism reduces exercise-induced ventricular arrhythmias in catecholaminergic polymorphic ventricular tachycardia patients with RyR2 mutations. J Cardiovasc Electrophysiol.2005; 16(2): 162-6.106. Alcalai, R., H. Wakimoto, M. Arad, D. Planer, T. Konno, L. Wang, J. G. Seidman, C. E. Seidman, and C. I. Berul. Prevention of ventricular arrhythmia and calcium dysregulation in a catecholaminergic polymorphic ventricular tachycardia mouse model carrying calsequestrin-2 mutation. J Cardiovasc Electrophysiol. 2011;22(3):316-24. PMCID: PMC3053436.Attorney Docket 44010.202WO-PCT / / CU24243107. Liu, N., M. Denegri, Y. Ruan, J. E. Avelino-Cruz, A. Perissi, S. Negri, C. Napolitano, W. A. Coetzee, P. A. Boyden, and S. G. Priori. Short communication: flecainide exerts an anti arrhythmic effect in a mouse model of catecholaminergic polymorphic ventricular tachycardia by increasing the threshold for triggered activity. Circ Res. 2011; 109(3):291 -5.108. Hayashi, M., I. Denjoy, F. Extramiana, A. Maltret, N. R. Buisson, J. M. Lupoglazoff, D. Klug, M. Hayashi, S. Takatsuki, E. Villain, J. Kamblock, A. Messali, P. Guicheney, J. Lunardi, and A. Leenhardt. Incidence and risk factors of arrhythmic events in catecholaminergic polymorphic ventricular tachycardia. Circulation. 2009;119(18):2426-34.109. Sumitomo, N., K. Harada, M. Nagashima, T. Yasuda, Y. Nakamura, Y. Aragaki, A. Saito, K. Kurosaki, K. Jouo, M. Koujiro, S. Konishi, S. Matsuoka, T. Oono, S. Hayakawa, M. Miura, H. Ushinohama, T. Shibata, and I. Niimura. Catecholaminergic polymorphic ventricular tachycardia: electrocardiographic characteristics and optimal therapeutic strategies to prevent sudden death. Heart. 2003;89(l):66-70. PMCID: PMC1767500.110. Watanabe, H., N. Chopra, D. Laver, H. S. Hwang, S. S. Davies, D. E. Roach, H. J. Duff, D. M. Roden, A. A. Wilde, and B. C. Knollmann. Flecainide prevents catecholaminergic polymorphic ventricular tachycardia in mice and humans. Nat Med. 2009;15(4):380-3. PMCID: PMC2904954.111. Wilde, A. A., Z. A. Bhuiyan, L. Crotti, M. Facchini, G. M. De Ferrari, T. Paul, C. Ferrandi, D. R. Koolbergen, A. Odero, and P. J. Schwartz. Left cardiac sympathetic denervation for catecholaminergic polymorphic ventricular tachycardia. N Engl J Med.2008;358(19):2024-9.112. Geisterfer-Lowrance, A. A., M. Christe, D. A. Conner, J. S. Ingwall, F. J. Schoen, C. E. Seidman, and J. G. Seidman. A mouse model of familial hypertrophic cardiomyopathy. Science. 1996;272(5262):731-4.113. Lehnart, S. E., M. Mongillo, A. Bellinger, N. Lindegger, B. X. Chen, W. Hsueh, S. Reiken, A. Wronska, L. J. Drew, C. W. Ward, W. J. Lederer, R. S. Kass, G. Morley, and A. R. Marks. Leaky Ca2+ release channel / ryanodine receptor 2 causes seizures and sudden cardiac death in mice. J Clin Invest. 2008;118(6):2230-45. PMCID: PMC2381750.114. Papa, A., P. J. Del Rivero Morfin, B. X. Chen, L. Yang, A. N. Katchman, S. I. Zakharov, G. Liu, M. S. Bohnen, V. Zheng, M. Katz, S. Subramaniam, J. A. Hirsch, S. Weiss, N. Dascal, A. Karlin, G. S. Pitt, H. M. Colecraft, M. Ben Johny, and S. O. Marx. A membrane-associatedAttorney Docket 44010.202WO-PCT / / CU24243phosphoswitch in Rad controls adrenergic regulation of cardiac calcium channels. J Clin Invest.2024.115. Seo, K., Y. Yamamoto, A. Kirillova, M. Kawana, S. Yadav, Y. Huang, Q. Wang, K. V. Lane, B. L. Pruitt, M. V. Perez, D. Bernstein, J. C. Wu, M. T. Wheeler, V. N. Parikh, and E. A. Ashley. Improved Cardiac Performance and Decreased Arrhythmia in Hypertrophic Cardiomyopathy With Non-beta-Blocking R-Enantiomer Carvedilol. Circulation.2023;148(21):1691-1704.116. Berul, C. I., M. E. Christe, M. J. Aronovitz, C. E. Seidman, J. G. Seidman, and M. E. Mendelsohn. Electrophysiological abnormalities and arrhythmias in alpha MHC mutant familial hypertrophic cardiomyopathy mice. J Clin Invest. 1997;99(4):570-6. PMCID: PMC507836.117. Exner, D. V., J. A. Reiffel, A. E. Epstein, R. Ledingham, M. J. Reiter, Q. Yao, H. J. Duff, D. Follmann, E. Schron, H. L. Greene, M. D. Carlson, M. A. Brodsky, T. Akiyama, C. Baessler, and J. L. Anderson. Beta-blocker use and survival in patients with ventricular fibrillation or symptomatic ventricular tachycardia: the Antiarrhythmics Versus Implantable Defibrillators (AVID) trial. J Am Coll Cardiol. 1999;34(2):325-33.Example 2 - In vivo gene editing of Rad prevents heart failure and improves survival in mice
[0310] Heart failure (HF) remains a leading cause of morbidity and mortality worldwide, causing substantial clinical and socioeconomic burden despite advances in contemporary therapy. Persistent activation of the sympathetic nervous system, which compensates for reduced cardiac output, further damages the heart, worsens HF, and raises the risk of serious arrhythmias (7). Inotropic drugs, such as P-adrenergic agonists and phosphodiesterase inhibitors, boost heart contractility by increasing intracellular calcium levels, thereby promoting the interaction between actin and myosin filaments, proteins responsible for muscle contraction. Despite providing short-term, acute hemodynamic benefits, long-term use of inotropic drugs can reduce survival rates (2-4).
[0311] A major gap in HF therapies is the lack of safe and effective methods to directly increase calcium influx, thereby boosting myocyte contractility. Administering isoproterenol, a pi- and P2-adrenergic agonist, initially increases contractility, but long-term administration via an osmotic pump for 4 weeks worsens cardiac function in WT mice (FIGs. 26A-26C), as previously noted (5). This harmful effect likely stems from prolonged and excessive proteinAttorney Docket 44010.202WO-PCT / / CU24243phosphorylation, which leads to sarcoplasmic reticulum calcium overload and ryanodine receptor leak (6), as well as mitochondrial dysfunction (7), oxidative stress (8) and transcriptional reprogramming (9).
[0312] The rise in intracellular systolic calcium caused by adrenergic stimulation depends on the phosphorylation of Rad (10-12), an endogenous inhibitor of voltage-gated calcium channels (13, 14). Removing Rad (15) or mutating the calcium channel so it can no longer bind Rad (11) is sufficient to increase contractility to levels close to those observed with adrenergic stimulation. Thus, by enhancing contractility through somatic AAV9-mediated delivery of gene-editing components to induce Rad deletion in cardiomyocytes, thereby mimicking adrenergic stimulation of calcium influx, cardiac contractility would improve with fewer adverse effects than traditional inotropes.Design and testing of dual-AAV9-Cas9-Rad in heart
[0313] We selectively and permanently disrupted Rrad in cardiomyocytes via postnatal delivery of a humanized S. pyogenes Cas9 nuclease and single-guide RNA expressed under the Tnnt2 promoter, resulting in frameshift insertions / deletions (indels). The guide sequence for mice and humans is identical and is set forth in SEQ ID NO: 4. The frame shift was introduced at Arg252, which deletes the C-terminus (FIGs. 27A and 27B). Rad is tethered to the plasma membrane via its C-terminus, enabling an effective interaction between Rad and the calcium channel P subunit (13, 16). We used a split-intein design, requiring co-transduction with two AAV vectors, each expressing half of the gene editor, and trans-splicing reconstitution of the full-length editor within cells, as described (17-19). To test the efficacy of this approach for deleting Rad in cardiomyocytes, we injected 5 x 1014vc / kg subcutaneously into three P2-P5 C57BL / 6 pups. After 6 weeks, we enzymatically dissociated cardiomyocytes and assessed the extent of editing by sequencing the genomic DNA and performing an anti-Rad western blot. In -50% of reads, we detected frameshift indels (FIG. 27B). Since the editor has a Tnnt2 promoter, the indels are likely from the cardiomyocyte fraction. An immunoblot of homogenates of atrial and ventricular tissue, using an antibody targeting the N-terminus of Rad showed near-complete loss of full-length Rad, with the appearance of truncated proteins (FIG.27C). Reducing the dose of AAV9-Cas9-Rad editor by 10-fold to 5 x 1013and 50-fold to 1 x 1013vc / kg was still quite effective in inactivating Rad, with the extent of indels in dissociated cardiac cells being 39% and 50%, respectively. This was confirmed by immunoblotting of Rad (FIG. 27D). We interrogated the electrophysiological properties of calcium channels inAttorney Docket 44010.202WO-PCT / / CU24243ventricular cardiomyocytes isolated from 2-month-old C57 mice that were subcutaneously injected as pups with 5 x 1013vc / kg AAV9-Cas9-Rad editor. The basal calcium channel conductance was increased in the AAV9-injected mice, similar to the effects of isoproterenol in WT mice (FIG. 27E). Deleting Rad using the AAV9-Cas9-Rad editor increased the left ventricular ejection fraction (LVEF) in Rad-deleted mice compared to non-edited mice (FIG.27F).Improved survival and cardiac function in three models of non-ischemic cardiomyopathy
[0314] Dilated cardiomyopathy (DCM), characterized by ventricular chamber dilation and systolic dysfunction, arises from both genetic defects in cardiomyocyte structure and function and diverse acquired insults, including viral myocarditis, toxic injury, metabolic disease, and immune dysregulation (20). Because most DCM cases are acquired or idiopathic, genetic precision therapies could address only a limited fraction of the disease burden. We hypothesized that therapeutic gene editing to augment calcium influx by deleting Rad could improve cardiac function independently of the initiating non-ischemic etiology. We tested this concept in a mouse model of DCM caused by impaired myofilament calcium sensitivity due to the R141W mutation in Tnnt2 (21), which disrupts thin-filament function within the sarcomere (22). We reasoned that this would be an ideal model to test whether long-term augmentation of intracellular calcium levels could safely prevent the development of HF, since increased calcium influx could compensate for the reduced myofilament calcium sensitivity. PBS or AAV9-Cas9-Rad editor (5 x 1014vc / kg) was injected via intrathoracic injection in one-day-old Tnnt2R141W / R141Wpups. At 4 months of age, the average extent of indels in dissociated cardiac cells was 33%. An anti-Rad immunoblot of isolated cells showed near-complete loss of Rad in cardiomyocytes (FIG. 23 A). Since Rad is expressed only in cardiomyocytes, an immunoblot is a better indicator of editing efficacy. In contrast to PBS-injected mice, in which the median survival was 6.2 months, Rad-deleted Tnnt2R141W / R141Wmice exhibited markedly longer survival, without mortality through 17 months of age, at which time the mice were euthanized (FIG. 23B). At 10 weeks of age, AAV9-Cas9-Rad-treated mice demonstrated increased LVEF compared to mice in the PBS-treated group (FIGs. 23C, 28A, and 28B). Over the ensuing months, the LVEF steadily decreased in the surviving mice in the control, PBS-treated group, whereas cardiac function remained stable in the Rad-deleted animals.Attorney Docket 44010.202WO-PCT / / CU24243
[0315] Although no mortality was observed in Rad-deleted animals, a potential concern is the risk of calcium-dependent arrhythmias in HF, which could theoretically be exacerbated by Rad deletion and increased calcium influx. To assess the arrhythmic risk, ECG telemeters were implanted at 4 months of age in mice injected as pups with either PBS or AAV9-Cas9-Rad. Continuous ECG recordings were obtained once a week for 24 hours over a 5-week period, and episodes of ventricular bigeminy and ventricular tachycardia (VT) were quantified (FIG.23D). Tnnt2R141W / R141Wmice exhibited a mean of 8 episodes of non-sustained VT and 11.3 episodes of ventricular bigeminy per 24-hour recording (FIG. 23E). In contrast, AAV9-Cas9-Rad editor-treated Tnnt2R141W / R141Wmice displayed no detectable arrhythmic events across all five 24-hour recording periods.
[0316] In humans, LMNA mutations follow an autosomal-dominant inheritance pattern, resulting in cardiomyopathy characterized by LV enlargement, reduced systolic function, conduction system abnormalities, and arrhythmias (23). The H222P- / . / w / a model, which simulates Emery-Dreifuss muscular dystrophy, reflects these characteristics; however, the condition in mice requires homozygosity (24). Male LmnaH222P / H222Pmice experience significantly more severe cardiac disease at younger ages compared to female mice and develop progressive HF. We injected the AAV9-Cas9-Rad editor subcutaneously (5xl013vc / kg) into male and female A / w / a112221’II222I>mice. At 4 months of age, the extent of indels in dissociated cardiac cells was 32%. An anti-Rad immunoblot of isolated cells showed near-complete loss of Rad in cardiomyocytes (FIG. 23F). Rad deletion significantly extended median survival by 3 months in both male and female mice (FIGs. 23 G and 28D). Rad deletion normalized LV function in male and female mice from the earliest timepoint that echocardiograms were performed (2 months) through at least 7 months of age, when LV function began to decline (FIGs. 23H, 27C, and 27E). Subcutaneous injection in male LmnaH222P / H222pups of either N-or C-terminal AAV9-Cas9-Rad editor, lacking the complementary pair, failed to increase LV function (FIG. 28F), demonstrating that deletion of Rad is required for the inotropic effects. The etiology of the decline in cardiac function in the Rad-deleted male and female mice is unclear but may be related to progressive fibrosis. We implanted ECG telemeters at 4 months of age in mice injected with PBS or AAV9-Cas9-Rad editor as pups. We recorded 24 hours of ECG telemetry each week for 5 weeks and quantified the number of ventricular bigeminy and ventricular tachycardia episodes, as we did for the Tnnt2R141W / R141Wmice. In both PBS andAttorney Docket 44010.202WO-PCT / / CU24243AAV9-Cas9-Rad injected L / W2221’II222Pmice, we did not detect ventricular arrhythmias, implying that increased calcium influx via Rad deletion is not pro-arrhythmic in these animals.
[0317] Obesity and diabetes are associated with myocardial lipid accumulation and an increased risk of HF (25). Transgenic over-expression of long-chain acyl-CoA synthetase (Acsll) in cardiomyocytes leads to excessive cardiomyocyte fatty acid uptake, cardiac steatosis, inflammation, and altered mitochondrial dynamics, causing cardiac hypertrophy, dilatation, systolic function, and premature death by ~ 4 months of age (26). We injected AAV9-Cas9-Rad subcutaneously in transgenic Acsll pups and began monitoring LV function by echocardiography at 2 months of age. Rad-deletion led to a greater than 2-fold (~5 month) increase in median survival (FIG. 231) and improvement in LV function (FIGs. 23 J and 28G). Thus, targeted deletion of Rad restores cardiac contractile function across genetically, structurally, and metabolically distinct forms of DCM, improving survival without increasing arrhythmias.Improved LV function dependent on augmented calcium influx and transient amplitude
[0318] We assessed the electrophysiological properties of calcium channels in ventricular myocytes isolated from 4-month-old wild-type (WT) 129S1 mice and from non-edited and Rad-deleted Tnnt2R141W / R141Wand LmnaH222P / H222Pmice, at a time point when LV function was significantly impaired in the non-edited groups. In cardiomyocytes from unedited Tnnt2R141W / R141Wand LmnaH222P / H222Pmice, basal maximal calcium channel conductance was not reduced compared with WT controls (FIGs. 24A, 24B, 24D, and 29A), indicating that diminished calcium influx is not the primary cause of impaired cardiac function in these HF models. In cardiomyocytes isolated from WT 129S1 mice as well as unedited Tnnt2R141W / R141Wand L / W2221’II222Pmice, adrenergic regulation of calcium handling was preserved. Isoproterenol increased calcium channel conductance (FIGs. 24A, 24B, 29A, and 29C), shifted channel activation to more negative membrane potentials (FIG. 29D), and augmented both calcium transient amplitude (FIGs. 24B and 29E-29H) and sarcomere shortening (FIGs. 291-290). Cardiomyocytes isolated from Rad-deleted Tnnt2R141W / R141Wand / .m / w112221’ll222l>mice displayed increased basal calcium channel conductance with activation at more negative potentials, resulting in elevated basal calcium transient amplitude and sarcomere contraction. The adrenergic modulation of calcium infux, transient amplitude and contractility was markedly blunted in the Rad-deleted cardiomyocytes. Thus, in the absence of adrenergicAttorney Docket 44010.202WO-PCT / / CU24243agonists, cardiomyocytes isolated from AAV9-Cas9-Rad-injected mice displayed electrophysiological and calcium-handling features that phenocopied adrenergic stimulation.
[0319] To unravel the molecular mechanisms underlying the improvement in cardiac function in the LmnaH222P / H222Pmice, we performed RNA sequencing and quantitative mass spectrometry on ventricular homogenates from 4-month-old WT 129S1 mice, and unedited and Rad-edited A / w / a112221’II222Pmice (FIGs. 30A, 30B, and 30D). Pathway analyses of differentially expressed mRNAs and proteins in Rad-edited versus non-edited LmnaH222P / H222Pmice revealed regulation of muscle contraction, the membrane, and ion channel activity and transport (FIGs. 30C and 30E). In HF, the heart reactivates genes normally expressed during fetal development, such as Nppa (27) and Myh7. Gene-editing of Rad was associated with significantly downregulated P-myosin heavy chain (Myh7) and atrial natriuretic factor (Nppa) RNA transcripts and protein levels, compared to non-edited mice (FIGs. 24K-24L, 30A, 30D, 30F, and 30G), consistent with the marked improvement in cardiac function. The shift in myosin heavy chain isoforms impacts cardiac function, as Myh7 is less efficient in mediating sarcomere contractility. Among the upregulated RNA transcripts and proteins in the Rad-deleted LmnaH222P / H222Pmice were D-beta-hydroxybutyrate dehydrogenase (Bdhl) and osteocrin (Ostri) (FIG. 30F). Bdhl is a mitochondrial enzyme that initiates the oxidation of ketone bodies, primarily 3- hydroxybutyrate (28). The rise in Bdhl suggests that the hearts in the Rad-deleted mice are compensating for reduced fatty acid utilization, a hallmark of HF, by using ketone bodies as a substitute fuel. Overexpression of Bdhl in the heart can reduce oxidative stress and improve cardiac function, possibly by enhancing ketone oxidation (29). Osteocrin, which is a peptide secreted by bone, muscle, and heart, likely functions by preventing the clearance of natriuretic peptides from the circulation. Overexpression of osteocrin is associated with improvement of HF after myocardial infarction (MI) in mice (30). Increased osteocrin may improve cardiac function by decreasing preload or inhibiting inflammatory cell infiltration via increased C-natriuretic peptide.
[0320] The H222P-Lmna mutation causes extensive cardiac fibrosis through extracellular matrix remodeling (FIGs. 24M and 24N). Despite improvement in cardiac function, gene editing of Rad did not attenuate the increased expression of the major cardiac collagens, type I and type III, or the increased fibrosis (FIGs. 24M, 24N, 3 OH, and 301). These findings demonstrate that selective enhancement of basal calcium channel activity is sufficient to restoreAttorney Docket 44010.202WO-PCT / / CU24243ventricular contractile function in genetic heart failure, accompanied by suppression of fetal gene reactivation (Nppa, Myh7 consistent with reduced neurohormonal activation.Off-target editing
[0321] We used experimental methods to extensively characterize off-target editing induced by treatment with the Cas9 nuclease and our Rrad sgRNA. We used the sensitive CHANGE-seq3 experimental off-target identification method and identified 82 candidate off-target sites in the human genome and 89 in the mouse genome. Of these candidate off-target sites, primers for 88 mouse and all human sites were pooled for multiplex-targeted DNA sequencing using rhAmpseq (- / , 5). High on-target editing was observed in treated samples, but no editing at any candidate off-target sites was detectable at levels above background sequencing error in untreated controls (FIGs. 31 A and 3 IB).
[0322] One candidate off-target site in the mouse genome and 11 in the human genome failed to amplify. The single mouse candidate site and three of the human sites that did not amplify are in unannotated intergenic regions. Six of the human sites are intronic, in regions not near canonical splice sites and with annotated common variants, many of which are indels. The last two human candidate off-target sites that did not amplify are exonic: one in HS3ST1 and the other in MIR219A2HG. MIR219A2HG is not well studied but is predicted to be a IncRNA involved in miRNA processing. HS3ST1 encodes an essential Golgi enzyme with annotated variants associated with diseases such as Alzheimer’s and atherosclerosis.Rad-deletion reverses non-ischemic and ischemic cardiomyopathy
[0323] We retro-orbitally injected 5xl013vc / kg AAV9-Cas9-Rad into three 2-month-old WT C57 mice. After 2 weeks, the extent of indels in dissociated cardiac cells was 31.4% and 34.1% indels. At 4 weeks, the extent of indels in dissociated cells was 44.2%. These findings are comparable to the level of editing observed following subcutaneous injection in pups. In cardiomyocytes, the basal current through CaV1.2 channels increased at 2 and 4 weeks after the injection of the Rad deletion editor, similar to the heightened current observed following isoproterenol infusion (FIG. 27G). We assessed pacing-induced sarcomere length before and after isoproterenol exposure. After Rad deletion, mean basal sarcomere contraction was substantially increased, and the isoproterenol-induced augmentation in sarcomere contraction was reduced (FIG. 27H). These findings indicate that AAV9-based gene editing of Rad is achievable in adult mice.Attorney Docket 44010.202WO-PCT / / CU24243
[0324] To determine whether gene-editing of Rad can attenuate the progression of HF once it has developed, we treated male L / W2221’II222Pmice with either PBS or AAV9-Cas9-Rad, which were injected retro-orbitally at ~3.5 months, when the LVEF was -35-50% and substantial fibrosis was (FIG. 25A). Median survival was significantly increased in the AAV9-Cas9-Rad injected mice, from 5.6 months to 7 months (FIG. 25B). In PBS-injected mice, the EF progressively decreased, whereas in AAV9-Cas9-Rad-treated mice, the EF increased compared to pre-injection, delaying the development of cardiac dysfunction (FIG. 25C, 25D, 32 A, and 32B). Pairwise comparisons showed that the treatment effect emerged after the first measurement.
[0325] We also tested whether Rad deletion improves LV function after left anterior descending artery (LAD) ligation-induced myocardial infarction and HF. When LV function decreased to less than 40%, 2 to 6 weeks after LAD ligation, the mice were randomly assigned to either the treatment (retro-orbital injection with either AAV9-Cas9-Rad) or control (retro-orbital injection of PBS) (FIG. 25E). One mouse in each group died during the 3-month observation period and was excluded from echocardiographic analysis. Baseline EF was highly variable across mice (range 15-40%) but did not differ significantly between groups. Echocardiograms were performed at 2, 4, 8, and 12 weeks post-injection (FIG. 25F). Overtime, the treatment group demonstrated a 20-25% absolute EF difference compared with the control group, with significant differences emerging at 2 weeks post-injection, and sustained improvement through 12 weeks (FIG. 25G). To confirm that effects were not driven by baseline variability, we analyzed the change in EF. These results match the baseline-adjusted model, confirming robust, baseline-independent improvement in EF by the Rad editor (FIG. 32C). A sensitivity analysis excluding the highest responder confirmed the persistence of the treatment effect, indicating that the observed effect was not driven by a single animal (FIG. 32D).
[0326] At 12 weeks after gene editing, the mice were euthanized, and ventricular cardiomyocytes were isolated. The extent of indels in dissociated cardiac cells was 23%. In the AAV9-Cas9-Rad injected mice, the basal calcium channel conductance and calcium transient amplitude were increased compared to PBS-injected mice (FIGs. 25H, 251, 25K, and 25L). The effects of isoproterenol on the conductance and calcium transient amplitude were substantially blunted in the Rad-deleted cardiomyocytes, in contrast to the non-edited cardiomyocytes (FIGs.25J and 25M). Thus, increased calcium influx and transient amplitude via Rad deletion can significantly alter post-MI ventricular remodeling compared with controls.Attorney Docket 44010.202WO-PCT / / CU24243Inactivation of Rad in humans
[0327] Rare-variant burden in RRAD was significantly associated with resting pulse rate in the UK Biobank WGS cohort, with a consistent direction and magnitude of effect across multiple collapsing models (minimum p = 4.99 x 10-12) (FIGs. 29A-29O). This signal exceeded exome-wide significance thresholds and was supported by concordant findings across damaging- and ultra-rare-variant models, strengthening the robustness of the association. The increase in heart rate is consistent with recent findings showing the role of Rad in sinus node function (31, 32).Discussion
[0328] We reasoned that specifically enhancing calcium influx via adrenergic stimulation would be more efficacious and precise than current inotropic drugs, as it avoids the detrimental adrenergic agonist-induced sarcoplasmic reticulum (SR) calcium leak and overload. Developing a strategy that uses a single gene editor to address multiple causes of HF could be more effective than creating targeted gene therapies for individual causes, particularly because, at advanced stages of HF, remedying the underlying cause may not yield therapeutic benefits. Remarkably, a single gene therapy holds the potential to broadly restore cardiac function in diverse etiologies of HF, representing a potentially transformative and paradigm-shifting advance in cardiovascular medicine. In contrast to prolonged exposure to adrenergic agonists, therapeutic delivery of a gene editor to the heart that introduces frameshift insertions / deletions in Rad can improve survival and attenuate the development of cardiac dysfunction in three distinct non-ischemic models of HF and improve cardiac function after the development of non-ischemic and ischemic cardiomyopathy. In contrast to the pro-arrhythmic effects of the failed inotropic drug BayK 8644 (33-33), which increases calcium influx by slowing the inactivation of CaV1.2, gene editing of Rad is sufficient to enhance basal calcium influx, transient amplitude and contractility without inducing arrhythmias in two non-ischemic cardiomyopathy models. The guide RNA is effective for mouse and human cells, with very low off-target editing.
[0329] The R141W mutation in Tnnt2 drives DCM by decreasing myofilament Ca2+sensitivity, due to enhanced affinity of cardiac troponin for tropomyosin (36). The Rad gene editor is ideally suited to restore contractile function due to diseases associated with myofilament hyposensitivity, fully restoring survival to levels indistinguishable from WTAttorney Docket 44010.202WO-PCT / / CU24243controls. Several other sarcomeric mutations directly decrease calcium sensitivity of force development, such as mutations of Troponin I3 (Tnni3), Troponin C (Tnnc1) and a-actin (Actcl) and selected mutants of Myh7 that reduce cross-bridge force production. Decreased Ca2+sensitivity often develops secondary to remodeling in acquired HF due to chronic b-adrenergic activation of troponin I, oxidative stress-induced troponin modifications, altered myosin regulatory light chain phosphorylation and changes in tropomyosin isoform expression. Anthracyclines can induce oxidative modifications of sarcomeric proteins, reducing calcium responsiveness and contributing to systolic dysfunction. Inflammatory signaling and nitric oxide-mediated modifications of contractile proteins also reduce myofilament calcium sensitivity, contributing to acute systolic depression in sepsis. Thus, inhibiting Rad may be a convergent approach to treat systolic dysfunction associated with myofilament calcium hyposensitivity.
[0330] In mice with more complex causes of nonischemic HF, such as transgenic Acsll mice or / . / W222P II222P, or ischemic cardiomyopathy after MI, reduced basal and adrenergic regulation of calcium influx and transient amplitude are not the primary cause of the cardiac dysfunction. Yet, increasing calcium influx, as a preventive therapy or after HF is established, improves cardiac function and survival without apparent detrimental effects. We speculate that the mechanisms underlying improvement are multifactorial: a direct effect on cardiac output and an indirect effect on reducing the hyperadrenergic and activated neurohormonal state, thereby breaking the vicious cycle that worsens HF. The marked reduction in Myh7 and Nppa expression in Rad-deleted hearts indicates suppression of the fetal gene program. Because induction of these genes is a conserved response to chronic P-adrenergic and renin-angiotensin signaling, their downregulation suggests that Rad deletion may blunt maladaptive stress-responsive pathways at the transcriptional level.
[0331] Rare-variant burden in RRAD demonstrated a robust association with resting pulse rate in the UK Biobank whole-genome sequencing cohort, surpassing exome-wide significance and replicating across multiple collapsing models with concordant directionality. The consistency of signal across damaging and ultra-rare variant architectures argues against model-specific artifact and supports a gene-level effect. Importantly, phenome-wide interrogation of the same variant set did not reveal associations with HF.
[0332] Calcium mishandling occurs in HF, and, in some cases, treatments aimed at correcting these abnormalities have been proposed. A long-standing dogma is that human andAttorney Docket 44010.202WO-PCT / / CU24243animal models of HF have reduced SERCA2a expression (37), prompting clinical trials targeting patients with SERCA2a-expressing adeno-associated virus (38). These trials, however, failed to show a clinical benefit (39). Subsequently, a state-of-the-art proteomics study showed no differences in SERCA2a and phospholamban protein abundances in nonischemic and ischemic cardiomyopathic hearts compared with control hearts (40). These approaches may have failed because phospholamban and SERCA have relatively minor effects on systolic function (41-44).
[0333] Together, these findings redefine the therapeutic landscape of HF by demonstrating that precise, gene editor-mediated enhancement of calcium influx, through targeted disruption of Rad, can safely augment contractility, suppress maladaptive neurohormonal signaling, and restore function across diverse genetic and acquired cardiomyopathies. By challenging the prevailing dogma that increased cytosolic calcium is intrinsically deleterious, this work establishes mechanism-specific tuning of calcium entry as a unifying and potentially transformative strategy for the treatment of systolic HF.MethodsTargeted high-throughput sequencing:
[0334] Genomic sites of interest were amplified by PCR with primers containing homology to the region of interest and the appropriate Illumina® forward and reverse adapters. Specifically, 25 pL of a given PCR1 reaction was assembled containing 0.5 pM of each forward and reverse primer, 1 pL genomic DNA extract (50-200 ng), and 12.5 pL Phusion® U Multiplex PCR Master Mix. PCR reactions were carried out as follows: 95°C for 2 min, then 30 cycles of (95°C for 15 s, 62°C for 20 s, and 72°C for 20 s), followed by a final 72°C extension for 2 min. PCR products were verified by comparison with DNA standards (Quick-Load 100 bp DNA ladder) on a 2% agarose gel supplemented with SYBR® green. Unique Illumina® barcoding primer pairs were added to each sample in a secondary PCR reaction (PCR 2). Specifically, 25 pL of a given PCR 2 reaction was assembled containing 0.5 pM of each unique forward and reverse Illumina® barcoding primer pair, 2 pL unpurified PCR 1 reaction mixture, and 12.5 pL Q5® Hot Start High-Fidelity 2* Master Mix. The barcoding PCR 2 reactions were carried out as follows: 95°C for 2 min, then 15 cycles of (95°C for 15 s, 61 °C for 20 s, and 72° C for 20 s), followed by a final 72° C extension for 2 min. PCR products were purified by electrophoresis with a 2% agarose gel using a QIAquick® Gel Extraction Kit, eluting with 30 pL H2O. DNA concentration was quantified with Qubit™ (ThermoFisher®)Attorney Docket 44010.202WO-PCT / / CU24243and the KAPA™ Library Quantification Kit-Illumina® (KAPA Biosystems®) and sequenced on an Illumina® MiSeq™ or MiSeq™ ilOO instrument according to the manufacturer’s protocols. Alignment of fastq files and quantification of editing frequency were performed using CRISPResso2 (45) in batch mode with default parameters (https: / / github.com / pinellolab / CRISPResso2). Indel frequency was calculated as the sum of aligned reads harboring only a deletion, only an insertion, or only a combination of these with one another or with a substitution, divided by the total number of aligned reads and reported as a percentage of the total.CHANGE-seq off-target editing analysis:
[0335] Genomic DNA from mice was isolated. To nominate off-target sites in the human genome, genomic DNA from KOLF2.1J iPSCs was extracted as previously described (46). CHANGE-seq was performed as previously described (47). In brief, purified DNA was randomly fragmented to an average size of ~400bp with a Tn5-transposome with an uracil-containing adapter. Tn5-generated gaps were then filled in with a high-fidelity uracil-tolerant polymerase and sealed with T4 DNA ligase. Overhangs were then released with a mixture of USER® enzyme and T4 PNK and DNA molecules were subsequently circularized at low concentrations that favor intramolecular ligation. Unwanted linear DNA was degraded with an exonuclease cocktail. Purified circular DNA was then treated with Cas9:sgRNA RNP and cleaved DNA ends at on- and off-target sites were released for NGS library preparation, PCR amplification, and paired-end high-throughput sequencing on an Illumina MiSeq ilOO instrument. CHANGE-seq data analyses were performed using open-source CHANGE-seq analysis software and default recommended parameters (https: / / github.com / tsailabSJ / changeseq).Targeted amplicon sequencing by rhAmpSeq:
[0336] On- and off-target sites identified by CHANGE-seq were amplified from genomic DNA of edited and unedited controls using the rhAmpSeq system (IDT). Template DNA from treated and untreated mice was isolated. Template DNA was extracted as previously described (46) from KOLF2.1 J iPSCs that were transfected via nucleofection with Cas9 nuclease mRNA and our sgRNA. Briefly, 1 million cells per replicate were electroporated using buffer P3 and pulse code CM-137 with the Lonza® 4D-nucleofector™. Per replicate, 1.5 pL of 2 pg / pL Cas9 mRNA and 0.5 pL of 100 pM sgRNA was added to cells in P3 solution for a total volume ofAttorney Docket 44010.202WO-PCT / / CU2424320 pL. Cas9 mRNA was prepared by IVT as previously described (46). The synthetic sgRNA contained 2’-O-methyl modifications in the first three and last three nucleotides, and phosphorothioate bonds between the first three and last three nucleotides (48), and was purchased from Genscript®. Cells were recovered in a total volume of 200 pL media. Cells were grown to approximately 70% confluency and washed three times with PBS before transfection. KOLF2.1J iPSCs were cultured with SF+ media (StemFlex™ Basal medium + 10X StemFlex™ supplement Gibco® A3349401) and Ultimatrix™ coating (1:100 dilution of Cultrex™ Ultimatrix™ Reduced Growth Factor Basement Membrane Extract Bio-Techne BME001-05 in DMEMZF-12 Gibco® 11320033). When plated after thawing or transfection, SF+ media was supplemented with a 1:1000 dilution of CEPT following manufacturer’s instructions (CEPT Cocktail Kit Bio-Techne 7991). Cells were grown for 72 hours posttransfection before DNA extraction. Sequencing libraries were generated according to the manufacturer’s instructions and sequenced with 150-bp paired-end reads on an Illumina® MiSeq™ ilOO instrument. Analysis of editing on- and off-target sites amplified by rhAmpseq™ was performed using the rhAmpSeq™ CRISPR Analysis Tool (IDT® & Illumina®) following the manufacturer’s instructions using default parameters.Mass spectrometry protein preparation:
[0337] Mice heart or cardiomyocytes were lysed in buffer: 50 mM Tris (pH 8.5), 150 mM NaCl, 2% SDS, 1 EDTA-free complete protease inhibitor tablet (11836170001) and 1 PhosSTOP™ tablet (Sigma™, 4906845001) to 50 mL of buffer. Samples were lysed with a hand-held tip homogenizer Omni TissueMaster, lysates were centrifuged at 20K x g for 5 minutes at room temperature. Proteins were quantified using a BCA assay (Pierce™ BCA Protein Assay Kits #23227). To reduce disulfides, TCEP-HC1 (Thermo Fisher Scientific® PG82089) in Milli-Q® water titrated to pH 7.5 with NaOH was added. To alkylate free Cys, freshly prepared 400 mM iodoacetamide (Thermo Fisher Scientific® 90034) was added in 50 mM ammonium bicarbonate was added to the supernatant to a final concentration of 20 mM, immediately vortexed, and incubated in the dark for 25 minutes at room temperature. After alkylation, freshly prepared DTT (dithiothreitol) stock solution was added to 50 mM final concentration to quench alkylation. Transfer the alkylated lysate to 15ml tubes, add 3x volume of ice-cold methanol, vertex, add 2x chloroform, mix, add 2.5x water, mix, centrifuge 4000g at 4°C for 10 minutes, discard top layer. Add 3x ice cold methanol, mix, centrifuge 4000g atAttorney Docket 44010.202WO-PCT / / CU242434°C for 10 minutes. Discard the supernatant. Add ice cold methanol to wash the pellet 2 more times. Keep the pellet at -80°C until run mass spectrometry.Virus production and administration:
[0338] A dual AAV vector system were used to deliver large Cas9 gene, Rrad sgRNA GCGCCAGATACGCCTGCGCA (SEQ ID NO: 4) (GGG PAM) were inserted in the gRNA scaffold for both N term cTNT Cas9 and C term cTNT Cas9 vectors in order to create Rrad indel Cas9 virus. The N terminal Rrad Cas9 and C terminal Rrad Cas9 virus were mixed 1: 1 ratio base on titer, add saline to a total volume of 40ul for each pup injection. Injected the mixture subcutaneously into pups 3-6 days old with desired dosage.Immunoblotting:
[0339] Cardiomyocytes or heart tissue were lysed with a hand-held tip homogenizer in a 1% (v / v) Triton™ X-100 buffer containing (in mM): 50 Tris-HCl (pH 7.4) 150 NaCl, 10 EDTA, 10 EGTA and protease inhibitors. The lysates were centrifuged at 14,000 RPM at 4°C for 10 minutes and supernatants collected. Proteins were size-separated on SDS-PAGE, transferred to nitrocellulose membranes, and probed with anti-MYH7 Polyclonal Antibody (Thermo Fisher®, 22280-1-AP; 1:1000 dilution), a custom-made polyclonal anti-Rrad antibody (YenZym™, epitope mouse Rrad amino acid 11-24, GSRGAGRERDRRRG (SEQ ID NO: 37), 1:1000 dilution), an anti- ANP Polyclonal Antibody (Thermo Fisher®, PAS-29559; 1:1000 dilution), followed by HRP-conjugated secondary goat anti-rabbit antibody. ECL Substrate (Thermo Fisher® #34096) were added before imaging with Azure™ imaging system.References:1. F. Triposkiadis et al., The sympathetic nervous system in heart failure physiology, pathophysiology, and clinical implications. J Am Coll Cardiol 54,...
Claims
Attorney Docket 44010.202WO-PCT / / CU24243CLAIMSWhat is claimed:
1. A method of treating or preventing heart failure or arrhythmias in a subject in need thereof comprising administering to the subject one or more agents capable of disrupting Rad binding to voltage-gated calcium channels.
2. The method of claim 1, wherein the one or more agents comprise an RNAi, genetic modifying agent, antisense oligonucleotide, and / or small molecule.
3. The method of claim 2, wherein the one or more agents comprise an antisense oligonucleotide or RNAi targeting Rad mRNA.
4. The method of claim 2, wherein the genetic modifying agent comprises a CRISPR system targeting the Rad gene.
5. The method of claim 4, wherein the CRISPR system targets Rad genomic DNA.
6. The method of claim 4, wherein the CRISPR system targets Rad mRNA.
7. The method of any of claims 4 to 6, wherein the genetic modifying agent comprises a CRISPR system configured to edit the Rad gene to reduce or eliminate Rad expression or to reduce or eliminate Rad binding to CavP2.
8. The method of claim 2, wherein the genetic modifying agent comprises a CRISPR system configured to edit Rad binding sites in CavP2 to reduce or eliminate Rad binding.
9. The method of claim 8, wherein CavP2 genomic DNA is edited.
10. The method of claim 8, wherein CavP2 mRNA is edited.
11. The method of any of claims 8 to 10, wherein Asp320 and Asp322 in CavP2 are edited to Ala.
12. The method of claim 2, wherein the one or more agents increase Rad phosphorylation.
13. The method of claim 12, wherein the one or more agents comprise a phosphorylationinducing chimeric small molecule (PHICS) that recruits a kinase to Rad.Attorney Docket 44010.202WO-PCT / / CU2424314. The method of claim 2, wherein the one or more agents comprise a proteolysis targeting chimera (PROTAC) targeting Rad.
15. The method of claim 1 or 2, wherein the one or more agents is a vector comprising one or more nucleotide sequences encoding for an RNAi, genetic modifying agent, or antisense oligonucleotide.
16. The method of claim 15, wherein the vector is a viral vector.
17. The method of claim 16, wherein the viral vector has tropism for cardiomyocytes.
18. The method of any of claims 15 to 17, wherein the vector is an AAV vector.
19. The method of claim 18, wherein the AAV vector is AAV9.
20. The method of claim 18, wherein the AAV is a chimeric AAV vector derived from AAV9, AAV1, and / or AAV6.
21. The method of any of claims 15 to 20, wherein the one or more nucleotide sequences encoding for an RNAi, genetic modifying agent, or antisense oligonucleotide are operably linked to a cardiomyocyte-specific promoter.
22. The method of any one of claims 1-21, wherein the one or more agents are administered to the heart.
23. The method of any one of claims 1 -22, wherein the one or more agents are administered in combination with one or more P-blockers.
24. A method of reducing P-adrenergic-induced arrhythmias in a subject in need thereof comprising administering to the subject one or more agents capable of reducing or eliminating Rad phosphorylation.
25. The method of claim 24, wherein the one or more agents comprise a phosphorylationinducing chimeric small molecule (PHICS) that recruits a phosphatase to Rad.
26. The method of claim 24 or 25, wherein the subject has catecholaminergic polymorphic VT (CPVT) or hypertrophic cardiomyopathy (HCM).Attorney Docket 44010.202WO-PCT / / CU2424327. A mouse model comprising one or more mutations that reduce binding of Rad to voltage-gated calcium channels.