Cell lines expressing proteins of interest and methods of making the same
Patent Information
- Application Number
- PCT/US2026/019539
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-03-17
- Filing Date
- 2026-03-17
- Publication Date
- 2026-09-24
Smart Images

Figure US2026019539_24092026_PF_FP_ABST
Abstract
Description
CELL LINES EXPRESSING PROTEINS OF INTEREST AND METHODS OF MAKING THE SAMECROSS-REFERENCE TO RELATED APPLICATIONThis application claims the benefit of U.S. Provisional Application No. 63 / 773,113 filed March 17, 2025, which is incorporated herein in its entirety.ELECTRONICALLY SUBMITTED SEQUENCE LISTINGThe Instant Application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on March 17, 2026, is named “EIC0084PCT” and is 7,949 bytes in size.BACKGROUND
[0001] Efforts to develop an effective vaccine for herpes simplex virus types 1 and 2 (HSV-1 and HSV-2) prevention and treatment have met with little success with disappointing results in clinical trials. These vaccines were predicated on the notion that neutralizing antibodies targeting glycoprotein D (gD) and / or other antigens would prove protective.However, while vaccination did elicit a neutralizing antibody response in study participants, the products failed to prevent HSV infection or disease. Recent work by the instant inventors challenges the notion that neutralizing antibodies are the correlate of immune protection. Rather, using optimized stringent preclinical models in which mice are challenged with lethal doses of clinical isolates of HSV-1 or HSV-2, the inventors recapitulated the failed clinical trial outcomes and demonstrated that antibodies mediating antibody-dependent cellular cytotoxicity (ADCC) provide protection (Aschner and Herold, 2021 , Curr Issues Mol Biol. 41 :469-50; Aschner, BC et al., 2020, NPJ Vaccines. 5(1 ):35; Aschner, BC et al. 2020, Sci Immunol. 5(50); Aschner, BC et al. 2020, Vaccines (Basel). 8(2); Burn C. et al., 2018, J Infect Dis. 217: 754-758; Mahant, AM et al., 2022, J Infect Dis. 226(9): 1489-98; Petro CD et al., 2016, JCI Insight.;l(12f). Clinical studies with patient samples supports this contention as none of the failed vaccine candidates elicited ADCC. (Mahant, AM et al., 2022, .Unfed Dis. 226(9): 1489-98, Kohl S etal. 1989, .1 Infect Dis.160(5):770-6). A single-cycle virus deleted in HSV-2 gD (gD-null), e.g. AgD-2, was engineered and the resulting vaccine was found to elicit high titer ADCC-mediating antibodies and provide complete protection against HSV-1 and HSV-2 in multiple small animal models and prevented the establishment of latency.
[0002] Glycoprotein D is required for HSV entry and cell-to-cell spread. Therefore, this vaccine strain must be grown on a complementing cell line that expresses the missing protein,such that it can be incorporated into the envelope of progeny virus. The newly synthesized viral particles are genetically gD-null but phenotypically express cellular gD and thus are restricted to a single round of infection following immunization. The original cell line that was used to grow and characterize this vaccine strain (VD60 cells) contained -110 copies of a plasmid expressing the BamHl J fragment of HSV-1 DNA, which includes HSV-1 gD under the control of its endogenous promoter as well as glycoprotein E (gE).(Ligas MW et al., 1988, J Virol.62(5): 1486-94). The VD60 cells do not express detectable levels of gD-1 prior to infection because the promoter is responsive to viral / ra / z.s-acti vating factors. While recombination was not observed when growing research stocks of virus, a single recombination event within gE was observed during preclinical safety testing when virus was repeatedly passaged on nonpermissive cells.
[0003] Therefore, there is a need to provide a cell line that expresses HSV-1 gD and complements the HSV-2 gD null vims without the risk of recombination events even after extended serial passage of vims or extended passage of cells.SUMMARY
[0004] This disclosure meets the need above. This disclosure provides a new engineered cell line that expresses HSV-1 gD driven by the CMV immediate early promoter (CMV-gD cell line). This new cell line complements the HSV-2 gD null vims as efficiently as VD60 cells and no recombination has been observed following serial passage of vims or extended passage on non-permissive cells using the same assay that identified a recombination event with the VD60 cells. Notably, there is little constitutive expression of gD but its expression is rapidly induced following viral infection thus also overcoming concerns that gD mediated interference might restrict the ability to grow high titers of the vims. Immunization of mice with vims grown on the CMV-gD cell line elicits similar titers of ADCC-mediating antibodies and provides comparable efficacy following lethal viral challenges. This new cell line can be used to advance the gD-null viral vaccine into clinical trials. In addition, the observation that the CMV promoter is rapidly induced by viral elements can be applied to engineer cell lines expressing other proteins of interest.
[0005] This disclosure also provides a method of producing a genetically modified mammalian cell comprising an expression cassette inserted in a cell genome, wherein the cassette comprises a heterologous gene operably linked to a CMV immediate early promoter (CMVIe), the method comprising: transfecting a mammalian cell with a DNA sequence comprising the expression cassette; and selecting cells stably transformed with the expression cassette to obtain the genetically modified mammalian cell.
[0006] This disclosure provides a transgenic mammalian cell comprising a heterologous nucleic acid stably integrated in the mammalian cell genome, wherein the heterologous nucleic comprises a heterologous gene operably linked to a CMV promoter.
[0007] This disclosure also provides a method of propagating a single cycle infectious virus comprising a genome having a deletion of an essential gene, the method comprising: providing a transgenic mammalian cell comprising at least one copy of the essential gene inserted in the mammalian cell genome operably linked to a CMV promoter, wherein the transgenic mammalian cell expresses a protein encoded by the essential gene; contacting the transgenic mammalian cell with the single cycle infectious virus; and complementing the single cycle infectious virus with the protein expressed by the transgenic mammalian cell to propagate the single cycle infectious virus.
[0008] This disclosure also provides a method of detecting and / or quantifying infectious virus in a sample, the method comprising: providing transgenic mammalian cells comprising a heterologous nucleic acid stably integrated in the genome of the mammalian cells, wherein the heterologous nucleic acid comprises a CMV promoter operably linked to a reporter gene; contacting the transgenic mammalian cells with the sample, wherein infectious virus present in the sample transactivates the CMV promoter and induces expression of the reporter gene in the transgenic mammalian cells; and quantifying the number of mammalian cells expressing the protein encoded by the reporter gene to quantify the infectious virus.
[0009] This disclosure also provides a method for producing a genetically modified mammalian cell for producing a recombinant protein, the method comprising transfecting the cell with an expression cassette, the cassette comprising a nucleic acid encoding the recombinant protein under the control of a CMV promoter, wherein upon infection with a virus, the CMV promoter is induced and the recombinant protein is produced.
[0010] The above described and other features are exemplified by the following figures and detailed description.BRIEF DESCRIPTION OF THE DRAWINGS
[0011] The above and other aspects, features, and advantages of certain embodiments of the disclosure will be more apparent from the following description taken in conjunction with the accompanying drawings, in which:
[0012] FIG. 1 is a schematic illustration of an expression cassette encoding the HSV-1 gD coding region which includes a signal peptide upstream of the HSV-1 coding region (HSVl_gD_ecto, gD_Tm_cyto) driven by the CMV immediate early promoter (CMVIe promoter 1), and a neomycin resistance marker (KAN / neoR) driven by an SV40 promoter.gD_Tm_cyto: gD transmembrane signal cytoplasmic, bghp(A): bovine growth hormone polyadenylation signal, SPA poly (A): synthetic polyA signal.
[0013] FTG. 2 shows results of plaque assays for serial dilutions of virus grown on passage 12 CMV-gD cell line C7 (upper panel) or Vero cells (lower panel).
[0014] FIGs. 3A-3C show AgD-2 virus grown on CMV-gD cell line C7 cells retains the immunogenicity and protective efficacy of virus grown on VD60 cells. (3 A) Immune serum was assayed for FcyRIV activation as a biomarker of ADCC activity; results are shown as fold induction for each mouse (mean of duplicates). (3B) Mice were prime-boost vaccinated (two doses administered intramuscularly, im) with indicated doses of AgD-2 vaccine grown on C7 cells (upper panels, left to right, AgD-2 10A4 C7, AgD-2 10A5 C7, AgD-2 10A6 C7, C7 Uninfected Cells Control Vaccine), VD60 (lower panels, left to right, AgD-2 10A4 VD60, AgD-2 10A5 VD60, AgD-2 10A6 VD60, VD60 Uninfected Cells Control Vaccine), or control vaccinated with VD60 or C7 uninfected lysates and then challenged on the skin with lOx the lethal dose of HSV-2(sd90). Mice were monitored daily for 2 weeks and scored for signs of disease as follows: 1) erythema at inoculation site; 2) spread to distant site, zosteriform lesions, edema; 3) ulceration, epidermal spread, limb paresis; 4) hind limb paralysis and 5) death. None of the vaccinated mice developed disease whereas mice that received uninfected cell lysate (C7 or VD60 cells) succumbed by Day 8. (3C) Neuronal tissue was isolated at time of euthanasia and assayed for viral DNA by PCR; the dotted line represents lower limit of detection in the assay. Controls included mice that were vaccinated with uninfected VD60 or C7 cell lysates. Little or no viral DNA was detected in AgD-2 vaccinated mice.DETAILED DESCRIPTION
[0015] Reference will now be made in detail to embodiments, examples of which are illustrated in the accompanying drawings, wherein like reference numerals refer to like elements throughout. In this regard, the present embodiments may have different forms and should not be construed as being limited to the descriptions set forth herein. Accordingly, the embodiments are merely described below, by referring to the figures, to explain aspects.
[0016] Disclosed herein are mammalian cell lines with an expression cassette in the cell genome, the expression cassette comprising a nucleic acid sequence encoding a heterologous protein operably linked to a CMV promoter. In particular, the present disclosure provides a genetically modified Vero cell (ATCC accession number CCL-81) including an expression cassette in the Vero cell genome, the cassette designed for expressing glycoprotein D of HSV-1 (gDl).
[0017] The mammalian cell lines including the expression cassette can be used, for example, to develop transgenic cell lines which (1) complement the growth and facilitate propagation of single cycle infectious viruses, (2) rapidly detect and / or quantify an amount of viable single cycle infectious vims present in a sample, or (3) can be used as antigen-specific reporter cells for measuring antibody dependent cell-mediated cytotoxicity (ADCC) and / or antibody-dependent cell-mediated phagocytosis. Also disclosed are transgenic mammalian cells derived from the genetically modified mammalian cells, which express at least one heterologous protein. Methods of producing the genetically modified mammalian cells and the transgenic mammalian cells are disclosed as are methods of using these cells.
[0018] A "nucleic acid construct" or “heterologous nucleic acid” or “vector” as used herein, refers to a nucleic acid sequence, and in particular a DNA sequence, that originates from a source foreign to the particular host cell, or, if from the same source, is modified from its original form. The nucleic acid construct or heterologous nucleic acid is constructed to comprise one or more functional units not found together in nature and is designed to transfer a nucleic acid (or nucleic acids) to a host cell. Examples include circular, double-stranded, extrachromosomal DNA molecules (plasmids), cosmids (plasmids containing COS sequences from lambda phage), viral genomes comprising heterologous (non-native) nucleic acid sequences, and the like. The heterologous nucleic acid can be a DNA sequence. The heterologous nucleic acid includes a DNA sequence of a transgene or heterologous gene. A host cell including the heterologous nucleic acid expresses the heterologous gene. The nucleic acid construct can also be referred to as a vector.
[0019] The term “nucleic acid”, “nucleic acid sequence”, “nucleotide sequence”, “polynucleotide", “polynucleotide sequence”, “RNA sequence" or “DNA sequence” as used herein refers to an oligonucleotide, nucleotide or polynucleotide and fragments and portions thereof and to DNA or RNA of genomic or synthetic origin, which may be single or double stranded and represent the sense or antisense strand. The sequence may be a non-coding sequence, a coding sequence or a mixture of both. The nucleic acid can be any nucleic acid, whether composed of phosphodiester linkages or modified linkages such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, bridged phosphoramidate, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sultone linkages, and combinations of such linkages. The terms "nucleic acid" and "polynucleotide" also specifically include nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine,cytosine and uracil). The nucleic acid sequences of the present invention can be prepared using standard techniques well known to one of skill in the art.
[0020] The term “encoding” or “coding” refers to the inherent property of specific sequences of nucleotides in a nucleic acid, such as a gene in chromosome or an mRNA, to serve as templates for in vitro or in vivo synthesis of other polymers and macromolecules in biological processes having a defined sequence of nucleotides (i.e. rRNA, tRNA, other RNA molecules) or amino acids and the biological properties resulting therefrom. Accordingly, a gene codes for a protein if the desired protein is produced in a cell or another biological system by transcription and subsequent translation of the mRNA whereby the boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxyl) terminus Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings of databanks, e.g. EMBL or GenBank, and non-coding strand, used as the template for the transcription, of a gene or cDNA can be referred to as encoding the protein or other product of that gene or cDNA. A nucleic acid that encodes a protein includes any nucleic acids that have different nucleotide sequences but encode the same amino acid sequence of the protein due to the degeneracy of the genetic code. Nucleic acids and nucleotide sequences that encode proteins may include introns. In the Sequence Listing the sequences are presented as DNA rather than RNA sequence. For example, when presented as DNA the start codon is presented as ATG rather than AUG.
[0021] The term "element" refers to a separate or distinct part of something, for example, a nucleic acid sequence with a separate function within a longer nucleic acid sequence. The term "regulatory element" and "expression control element" are used interchangeably herein and refer to nucleic acid molecules that can influence the expression of an operably linked coding sequence in a particular host organism. These terms are used broadly to and cover all elements that promote or regulate transcription, including promoters, core elements required for basic interaction of RNA polymerase and transcription factors, upstream elements, enhancers, and response elements. Exemplary regulatory elements in prokaryotes include promoters, operator sequences and a ribosome binding sites. Regulatory elements that are used in eukaryotic cells can include, without limitation, transcriptional and translational control sequences, such as promoters, enhancers, splicing signals, polyadenylation signals, terminators, protein degradation signals, internal ribosome-entry element (IRES), 2A sequences, and the like, that provide for and / or regulate expression of a coding sequence and / or production of an encoded polypeptide in a host cell.
[0022] The term "gene" refers to a nucleotide sequence associated with a biological function. Thus, a gene includes a coding sequence and / or the regulatory sequence required for itsexpression. A gene can also include non-coding DNA segments such as regulatory elements that, for example, form recognition sequences for other proteins. A gene can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters. A “transgene” or “heterologous gene” or “heterologous nucleic acid” refers to a gene or nucleic acid sequence or polynucleotide, in particular a DNA sequence, that originates from a source foreign to the host cell or, if from the same source, is modified from its original form. Thus, the terms refer to a DNA segment which is foreign or heterologous to the cell, or homologous to the cell but in a position within the host cell nucleic acid in which the element is not ordinarily found. The heterologous nucleic acid is constructed to comprise one or more functional units not found together in nature and is designed to transfer a nucleic acid (or nucleic acids) to a host genome. Examples include circular, double-stranded, extrachromosomal DNA molecules (plasmid, shuttle plasmid), cosmids (plasmids containing cos sequences from lambda phage), viral genomes comprising heterologous (non-native) nucleic acid sequences, and the like. A heterologous gene is expressed to yield a heterologous polypeptide. The term "stably integrated" refers to a heterologous nucleic acid that is incorporated into a host genome, replicates as the cell replicates, and is transferred to progeny. In the present disclosure, the host cell is a Vero cell, and the heterologous nucleic acid is integrated into the Vero cell genome and passed to progeny cells.
[0023] The terms “gene”, “gene of interest”, “desired sequence”, “polynucleotide of interest” or “desired gene” as used herein have the same meaning and refer to a polynucleotide sequence of any length that encodes a product of interest. The gene may further comprise regulatory sequences preceding (5' non-coding or untranslated sequences) and following (3' noncoding or untranslated sequences) the coding sequence. The selected sequence can be full length or a truncated gene, a fusion or tagged gene, and can be a cDNA, a genomic DNA, or a DNA fragment. It is generally understood that genomic DNA encoding for a polypeptide or RNA includes non-coding regions (i.e. introns) that are spliced from mature messenger RNA (mRNA) and are therefore not present in cDNA encoding for the same polypeptide or RNA. It can be the native sequence, i.e. naturally occurring form(s), or can be mutated, or comprising sequences derived from different sources or otherwise modified as desired. These modifications include codon optimizations to optimize codon usage in the selected host cell or tagging. Furthermore, they can include removal or additions of cis-acting sites such as (cryptic) splice donor, acceptor sites and branch points, polyadenylation signals, TATA-boxes, chi-sites, ribosomal entry sites, repeat sequences, secondary structures (e.g. stem loops), binding sites for transcription factors or other regulatory factors, restriction enzyme sites etc. to give just a few, but not limitingexamples. The selected sequence can encode a secreted, cytoplasmic, nuclear, membrane bound or cell surface polypeptide.
[0024] As used herein, the term "variant" refers to a polynucleotide or polypeptide having a sequence substantially similar to a reference polynucleotide or polypeptide. In the case of a polynucleotide, a variant can have deletions, substitutions, additions of one or more nucleotides at the 5' end, 3' end, and / or one or more internal sites in comparison to the reference polynucleotide. Similarities and / or differences in sequences between a variant and the reference polynucleotide can be detected using conventional techniques known in the art, for example polymerase chain reaction (PCR) and hybridization techniques. Variant polynucleotides also include synthetically derived polynucleotides, such as those generated, for example, by using site-directed mutagenesis. Generally, a variant of a polynucleotide, including, but not limited to, a DNA, can have at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more sequence identity to the reference polynucleotide as determined by sequence alignment programs known by skilled artisans. In the case of a polypeptide, a variant can have deletions, substitutions, additions of one or more amino acids in comparison to the reference polypeptide. Similarities and / or differences in sequences between a variant and the reference polypeptide can be detected using conventional techniques known in the art, for example Western blot. Generally, a variant of a polypeptide, can have at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more sequence identity to the reference polypeptide as determined by sequence alignment programs known by skilled artisans.
[0025] The term "% identity", as used throughout the specification, may for example be calculated as follows. The query sequence is aligned to the target sequence using the CLUSTAL W algorithm (Thompson et al, Nucleic Acids Research, 22: 4673-4680 (1994)). A comparison is made over the window corresponding to one of the aligned sequences, for example the shortest. The window may in some instances be defined by the target sequence. In other instances, the window may be defined by the query sequence. The amino acid residues at each position are compared, and the percentage of positions in the query sequence that have identical correspondences in the target sequence is reported as % identity.
[0026] A DNA segment (nucleotide sequence) is "operably linked" when placed into a functional relationship with another DNA segment. For example, DNA for a signal sequence is operably linked to DNA for a gene encoding a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to acoding sequence if it stimulates the transcription of the sequence. In general, DNA sequences that are operably linked are contiguous, and in the case of a signal sequence both contiguous and in reading phase. However, enhancers, for example, need not be contiguous with the coding sequences whose transcription they control. Linking is accomplished by ligation at convenient restriction sites or at adapters or linkers inserted in lieu thereof.
[0027] A “transcription unit’’, “expression unit” or “expression cassette” defines a region within a vector, construct or polynucleotide sequence that contains one or more genes or one or more nucleic acid of interest to be transcribed, wherein the genes or nucleic acids contained within the segment are operably linked to each other. They are transcribed from a single promoter and transcription is terminated by at least one polyadenylation signal. As a result, the different genes are at least transcriptionally linked. More than one protein or product can be transcribed and expressed from each transcription unit (multicistronic transcription unit). Each transcription unit will comprise the regulatory elements necessary for the transcription and translation of any of the selected sequences that are contained within the unit. And each transcription unit may contain the same or different regulatory elements. For example, each transcription unit may contain the same terminator. IRES element or introns may be used for the functional linking of the genes within a transcription unit. A vector or polynucleotide sequence may contain more than one transcription unit. The nucleic acid of interest may be expressed form the natural promoter or derivative thereof or an entirely heterologous promoter. The nucleic acid of interest can comprise introns or not. Similarly, it may be a cDNA or cDNA-like nucleic acid. The nucleic acid of interest may encode a protein. Alternatively, the nucleic acid of interest can encode an anti-sense RNA.
[0028] The “poly adenylation signal” or “poly A” is a signal sequence which causes cleavage at a specific site at the 3' end of the eukaryotic mRNA and post-transcriptional incorporation of a sequence of about 100-200 adenine nucleotides (polyA tail) at the cleaved 3' end. The poly adenylation signal comprises the sequence AATAAA about 10-30 nucleotides upstream of the cleavage site and a sequence located downstream. Various poly adenylation elements are known such as tk polyA, SV40 late and early polyA, BGH polyA (described for example in U.S. Pat. No. 5,122,458) or hamster growth hormone polyA.
[0029] Within the scope of the present description the terms “functional linking”, “functionally linked” or “operably linked” means that two or more nucleic acid sequences or sequence elements are positioned in a way that permits them to function in their intended manner. For example, a promoter / enhancer or terminator is functionally linked to a coding gene sequence if it is able to control or modulate the transcription of the linked gene sequence in the cis position. Generally, but not necessarily, the DNA sequences that are functionally linked arecontiguous and, where necessary to join two polypeptide coding regions or in the case of a secretion signal peptide, contiguous and in reading frame. However, although an operably linked promoter is generally located upstream or an operably linked terminator is generally located downstream of the coding sequence, it is not necessarily contiguous with it. Enhancers do not have to be contiguous as long as they increase the transcription of the coding sequence. For this they can be located upstream or downstream of the coding sequence and even at some distance. A polyadenylation site is operably linked to a coding sequence if it is located at the 3' end of the coding sequence in a way that transcription proceeds through the coding sequence into the polyadenylation signal. Linking is accomplished by recombinant methods known in the art, e.g. using PCR methodology, by ligation at suitable restrictions sites or by annealing. Synthetic oligonucleotide linkers or adaptors can be used in accord with conventional practice if suitable restriction sites are not present.
[0030] The term “expression” as used herein refers to transcription and / or translation of a heterologous nucleic acid sequence within a host cell. The level of expression of a desired product in a host cell may be determined on the basis of either the amount of corresponding RNA or mRNA that is present in the cell, or the amount of the desired polypeptide encoded by the selected sequence. For example, mRNA transcribed from a selected sequence can be quantitated by Northern blot hybridization, ribonuclease RNA protection, in situ hybridization to cellular RNA or by PCR. Proteins encoded by a selected sequence can be quantitated by various methods, e.g. by ELISA, by Western blotting, by radioimmunoassays, by immunoprecipitation, by assaying for the biological activity of the protein, or by immunostaining of the protein followed by FACS analysis PCR.
[0031] The term “polypeptide” is used interchangeably with “amino acid residue sequence”, “amino acid sequence” or the term “protein” and refers to polymers of amino acids of any length. These terms also include proteins that are post-translationally modified through reactions that include, but are not limited to glycosylation, glycation, acetylation, phosphorylation, oxidation, amidation or protein processing. Modifications and changes, for example fusions to other proteins, amino acid sequence substitutions, deletions or insertions, can be made in the structure of a polypeptide while the molecule maintains its biophysical properties and / or biological functional activity. For example, certain amino acid sequence substitutions can be made in a polypeptide or its underlying nucleic acid coding sequence and a protein can be obtained with like properties. Furthermore, modifications and changes can be made in the structure of a polypeptide to gain or improve biophysical properties and / or to modulate, introduce or abrogate biological functional activity. For example, modification and changes can be introduced to improve the solubility and / or stability of a protein, such as introducing theamino substitution Ser228Pro in the hinge region of an IgG4 molecule to stabilize the intermolecular disulfide bridge between the heavy chains and thus reducing the occurrence of half molecules. Amino acid modifications can be prepared for example by performing sitespecific mutagenesis or polymerase chain reaction mediated mutagenesis on its underlying nucleic acid sequence. The term “polypeptide" thus also includes, for example, fusion proteins. In addition, the polypeptides may multimerise and form homo- or heteromers.
[0032] The “polypeptide of interest”, “protein of interest” or “product of interest” includes proteins, polypeptides, fragments thereof, peptides, fusion proteins all of which can be expressed in the selected host cell. Desired proteins can be for example antibodies, enzymes, cytokines, lymphokines, adhesion molecules, receptors and derivatives or fragments thereof, and any other polypeptides that can serve as agonists or antagonists and / or have therapeutic or diagnostic use. Other proteins of interest are, for example, proteins / polypeptides, which are used to change the properties of host cells within the scope of so-called “Cell Engineering”, such as e.g. anti-apoptotic proteins, chaperones, metabolic enzymes, glycosylation enzymes and the derivatives or fragments thereof, but are not restricted thereto.
[0033] The term "recombinant" when used with reference to a cell indicates that the cell replicates a heterologous nucleic acid, or expresses a peptide or protein encoded by a heterologous nucleic acid. Recombinant cells can contain polynucleotides that are not found within the native (non-recombinant) form of the cell.
[0034] A cell has been "transformed" or "transfected" by exogenous or heterologous DNA, e.g. a DNA construct, when such DNA has been introduced inside the cell. The transforming DNA may or may not be integrated (covalently linked) into the genome of the cell.
[0035] The term "transgenic" refers to a cell that includes a specific genetic modification that was introduced into the cell, or into an ancestor of the cell. Such modifications can include one or more point mutations, deletions, insertions, or combinations thereof. In the present disclosure, transgenic refers to a cell comprising a heterologous nucleic acid introduced into the cell.
[0036] The stability of complementation was tested for the CMV-gD cell line C7 of the present invention and found to be stable after at least 20 serial passages. “Serial passaging” cells refers to the process of transferring cells from one culture vessel to another to maintain their growth and viability. This is a routine procedure in cell culture that allows researchers to expand cell populations, maintain healthy cultures, and prevent over-confluence, which can lead to nutrient depletion and cell death. During passaging, cells are typically detached from the culture surface using enzymatic or mechanical methods, counted, and then reseeded into fresh culture vessels with new growth medium. This process is essential for maintaining cell lines overextended periods and for experimental applications requiring large numbers of cells. The stability of complementation in passaged cells is an important consideration, particularly in genetic studies or applications involving engineered cell lines. Complementation refers to the introduction of a functional gene or genetic element into cells to restore or enhance a specific function that may be deficient or absent. Ensuring the stability of this complementation over multiple serial passages is crucial for reducing or eliminating the risk of recombination events even after extended serial passage of virus or extended passage of cells.
[0037] “Passage of virus” refers to the process of growing and replicating a virus in a host system, such as cell cultures, embryonated eggs, or live animals, to produce more viral particles. This technique is commonly used in virology research to study viral behavior, develop vaccines, and produce viral stocks for various applications. During viral passage, the virus is introduced into a suitable host system where it can infect cells and replicate. After a period of incubation, the virus is harvested from the host system and can be used for further experimentation or additional passages. Each cycle of infection and replication is considered a passage. Repeated passage of a virus can lead to genetic changes, such as mutations or adaptations, which may alter its properties. Monitoring genetic stability is important, especially in vaccine development, to ensure the virus retains its desired characteristics.
[0038] The term "promoter" refers to a region of DNA that initiates transcription of a particular gene. The promoter includes the core promoter, which is the minimal portion of the promoter required to properly initiate transcription and can also include regulatory elements such as transcription factor binding sites. The regulatory elements may promote transcription or inhibit transcription. Regulatory elements in the promoter can be binding sites for transcriptional activators or transcriptional repressors. A promoter can be constitutive or inducible. A constitutive promoter refers to one that is always active and / or constantly directs transcription of a gene above a basal level of transcription. An inducible promoter is one which is capable of being induced by a molecule or a factor added to the cell or expressed in the cell. An inducible promoter may still produce a basal level of transcription in the absence of induction, but induction typically leads to significantly more production of the protein.
[0039] A “promoter-reporter construct” refers to a DNA vector or plasmid that contains a promoter that drives the transcription of a reporter gene, which in turn, is translated into a reporter protein. The “reporter” or “reporter protein” is a protein whose expression is correlated a cellular event such as to the cellular event, infection, etc. The expression of a reporter protein can be measured using various methods and depend on the type of reporter protein that is expressed.
[0040] The term "transactivation," as used herein refers to the activation of a gene sequence by factors encoded by a regulatory gene, and which is not necessarily contiguous with the gene sequence to which it binds and activates.
[0041] A “single cycle infectious vims” also referred to as disabled infectious single cycle (DISC) vims, is a vims defective for one or more essential functions involved in viral genome synthesis, assembly, and / or release of viral particles or re-infection of new host cells. Such vimses are propagated in complementing cell lines that provide the missing gene product or its function in trans.
[0042] Disclosed herein is a genetically modified mammalian cell comprising in its genome an expression cassette, the expression cassette comprising a heterologous gene or nucleic acid operably linked to a CMV promoter. In one embodiment, the cell is a Vero cell. A cell line comprising the genetically modified Vero cells is also disclosed.
[0043] The type of mammalian cell used is not particularly limited. The method of the present invention may be performed in all eukaryotic cells. Cells and cell lines may be present e.g. in a cell culture and include but are not limited to eukaryotic cells, such as yeast, plant, insect or mammalian cells. For example, the cells may be oocytes, embryonic stem cells, hematopoietic stem cells or any type of differentiated cells. A method is preferred wherein the eukaryotic cell is a mammalian cell. More preferred is a method wherein the mammalian cell is a rodent cell. Furthermore, preferred is a method wherein the mammalian cell is a human, simian, murine, rat, rabbit, hamster, goat, bovine, sheep or pig cell. Preferred cell lines or “host cells” for the production of biopharmaceuticals are human, mice, rat, monkey, or rodent cell lines. More preferred are hamster cells, preferably BHK21, BHK TK, CHO, CHO-K1, CHO-DUKX, CHO-DUKX B 1 , CHO-S and CHO-DG44 cells or the derivatives / progenies of any of such cell lines. Particularly preferred are CHO-DG44, CHO-DUKX, CHO-K1, CHO-S and BHK21, and even more preferred CHO-DG44 and CHO-DUKX cells. Furthermore, murine myeloma cells, preferably NS0 and Sp2 / 0 cells or the derivatives / progenies of any of such cell lines are also known as production cell lines for biopharmaceutical proteins. In an aspect, the cell is an epithelial cell or a lymphoma cell. In an aspect, the epithelial cell is a Vero cell. The Vero cell is a kidney epithelial from the Vero cell line that was isolated from the kidney of a normal adult African green monkey (Chlorocebus Sebaens) in 1962 by Yasamura and Kawakita at the Chiba University in Chiba, Japan.
[0044] The “transfection” of eukaryotic host cells with polynucleotide sequences or expression vectors, resulting in genetically modified cells, recombinant or transgenic cells, can be performed by any method well known to the skilled artisan. Transfection methods include but are not limited to liposome -mediated transfection, calcium phosphate co-precipitation,electroporation, polycation (e.g. DEAE dextran) -mediated transfection, protoplast fusion, microinjection and viral infections. Preferably, the transfection is a stable transfection. The transfection method that provides optimal transfection frequency and expression of the heterologous genes or polynucleotides in the particular host cell line and type is favored.Suitable methods can be determined by routine procedures. For stable transfectants the constructs are either integrated into the host cell's genome or an artificial chromosome / mini-chromosome or located episomally so as to be stably maintained within the host cell. For generation of genetically modified cells expressing the product(s) of interest all required heterologous genes can be located on a single vector or polynucleotide sequence in mono- or multicistronic transcription units. In this case the host cell is transfected with single vectors or polynucleotide sequences. The heterologous genes can also be positioned on different vectors or polynucleotide sequences. In this case host cells are either co-transfected with all vectors or polynucleotide sequences and / or are transfected in successive rounds with the vectors or polynucleotide sequences encoding the genes of interest. In case of co-transfection the ratios of the different vectors can be varied.
[0045] By definition, every polynucleotide sequence or every gene inserted in a host cell and the respective protein or RNA encoded thereby is referred to as “heterologous, “heterologous sequence”, “heterologous gene”, “heterologous coding sequence”, “transgene” or “heterologous protein” with respect to the host cell. This applies even if the sequence to be introduced or the gene to be introduced is identical to an endogenous sequence or an endogenous gene of the host cell. For example, a hamster actin gene introduced into a hamster host cell is by definition a heterologous gene. The term “recombinant” is used interchangeably with the term “heterologous" throughout the specification of this present invention, especially in the context with protein expression. Thus, a “recombinant” protein is a protein expressed from a heterologous or recombinant polynucleotide sequence.
[0046] The term “selection marker gene” refers to a gene that only allows cells carrying the gene to be specifically selected for or against in the presence of a corresponding selection agent. By way of illustration, an antibiotic resistance gene can be used as a positive selectable marker gene that allows the host cell transformed with the gene to be positively selected for in the presence of the corresponding antibiotic; a non-transformed host cell would not be capable of growth or survival under the selection culture conditions. Selectable markers can be positive, negative or bifunctional. Positive selectable markers allow selection for cells carrying the marker by conferring resistance to a drug or compensate for a metabolic or catabolic defect in the host cell. In contrast, negative selection markers allow cells carrying the marker to be selectively eliminated. For example, using the HSV-tk gene as a marker will make the cellssensitive to agents such as acyclovir and gancyclovir. The selectable marker genes used herein, including the amplifiable selectable genes, will include recombinantly engineered mutants and variants, fragments, functional equivalents, derivatives, homologs and fusions of the native selectable marker gene so long as the encoded product retains the selectable property. Useful derivatives generally have substantial sequence similarity (at the amino acid level) in regions or domains of the selectable marker associated with the selectable property. A variety of marker genes, well known to the skilled artisan, have been described, including bifunctional (i.e. positive / negative) markers (see e.g. WO 92 / 08796 and WO 94 / 28143), incorporated by reference herein. For example, selectable genes commonly used with eukaryotic cells include the genes for aminoglycoside phosphotransferase (APH), hygromycin phosphotransferase (HYG), dihydrofolate reductase (DHFR), thymidine kinase (TK), glutamine synthetase, asparagine synthetase, and genes encoding resistance to neomycin (G418), puromycin, histidinol D, bleomycin and phleomycin.
[0047] The expression cassette can be inserted into any site in the host cell genome, e.g. a Vero cell genome. The number of inserted expression cassettes are not limited. The expression cassette can be inserted in a single locus in the mammalian cell genome or in a plurality (i.e., more than one) of loci.
[0048] In an aspect, the CMV promoter in the expression cassette is selected from a constitutive CMV promoter, an immediate early CMV promoter, and early CMV promoter and a late CMV promoter. In particular embodiments, the promoter is the CMV immediate early promoter. The cytomegalovirus can be the human CMV, specifically from its major immediate-early region. This viral promoter is commonly used and known in the art.
[0049] In one aspect, the nucleic acid encoding the expression cassette can include additional sequences that make the expression construct or vector suitable for replication and integration in a eukaryotic or mammalian cell, for example, additional transcription and translation initiation sequences, such as promoters or enhancers, additional transcription and translation terminators, such as polyadenylation signals, and other sequences as known in the art.
[0050] In an aspect, the heterologous gene is herpes simplex vims type 1 (HSV-1) glycoprotein D (gDl). In one aspect, the gDl nucleic acid sequence has been altered to include silent mutations to minimize similarity to the HSV-2 viral genome. By silent mutations is meant mutations to the nucleic acid sequence that do not change the amino acid sequence of the protein coded for by the gene. Silent mutations are known in the art. Briefly, silent mutations are often found in the third nucleotide of a codon, which is known as the ‘wobble’ nucleotide. In oneaspect, about 1% to about 100% of the codons include silent mutations. In one aspect, the gDl sequence is identified in SEQ ID NO:1.
[0051] SEQ ID NO:! ATGGGAGTGCACGAGTGCCCTGCCTGGCTGTGGCTGCTGCTGAGCCTGCTGAGTCTA CCTCTCGGCCTGCCCGTGCTAGGCAAATATGCCTTGGCGGATGCCTCTCTCAAGATG GCTGACCCCAATCGCTTTCGCGGCAAAGACCTTCCGGTCCTGGATCAGCTGACCGAC CCTCCGGGGGTCCGGCGCGTGTACCACATCCAGGCGGGCCTACCGGACCCGTTCCA GCCtCCaAGCCTCCCGATCACGGTTTACTACGCTGTGTTGGAGCGCGCTTGCCGCAGC GTGCTCCTAAACGCACCGTCGGAGGCCCCCCAGATTGTCCGCGGAGCCTCCGAAGA CGTCCGGAAACAACCTTACAACCTGACCATCGCTTGGTTTCGGATGGGAGGCAACT GTGCTATCCCCATCACGGTCATGGAGTACACCGAATGCTCCTACAACAAGTCTCTGG GGGCCTGTCCCATCCGAACGCAGCCTCGCTGGAACTACTATGACAGCTTCAGCGCC GTCAGCGAGGATAACCTGGGGTTCCTGATGCACGCCCCCGCGTTTGAAACCGCCGG AACGTACCTGCGCCTCGTGAAAATAAACGACTGGACGGAGATTACACAGTTTATCC TGGAGCACCGAGCCAAGGGCTCCTGTAAGTACGCCCTCCCGCTGCGCATTCCGCCG TCAGCCTGCCTCTCCCCCCAGGCCTACCAGCAGGGGGTGACGGTGGACAGCATCGG GATGCTGCCCCGCTTCATCCCTGAGAATCAGCGCACCGTCGCCGTATACAGCTTGAA GATTGCCGGGTGGCATGGGCCCAAGGCCCCATACACGAGCACCCTCCTGCCTCCTG AGCTGTCCGAGACACCTAACGCCACGCAGCCAGAACTCGCCCCGGAAGACCCTGAG GATTCGGCCCTCTTGGAGGACCCCGTGGGAACGGTGGCGCCGCAAATCCCACCCAA CTGGCACATACCGTCGATTCAGGACGCCGCGACGCCTTACCATCCCCCTGCCACCCC GAACAACATGGGTctgatagcaggagcagtgggaggaagtttgctcgccgctctcgtcatctgcggcatagtgtatcggatgc ggcgaagaacacagaaggcccccaaacgcatcaggctgccacacatacgagaagacgatcagccgtccagccaccaacctttgttttatt ag
[0052] In another aspect, the expression cassette comprising a CMV promoter operably linked to a nucleic acid encoding gDl (as shown in FIG. 1) is identified in SEQ ID NO:2. The sequence includes 5’ to 3’: the CMV immediate early promoter 1 (21-616), human epo signal peptide (642-722), HSV-1 gD (723-1832), bGH polyadenylation signal sequence (1850-2074), SV40 promoter (2131-2474), Kan / neoR gene (2504-3298), and the SPA polyadenylation signal sequence (3425-3397).SEQ ID NO: 2 tgcaggGCGTAAATTGTAAGTAGTTATTAATAGTAATCAATTACGGGGTCATTA GTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATA GTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAAC TGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGT CAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTT TCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTT TTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCT CCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCC AAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGT GGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCCGCTAGCGCTAC CGGACTCAGATCTCGAGACCATGGGAGTGCACGAGTGCCCTGCCTGGCTGTGGCTG CTGCTGAGCCTGCTGAGTCTACCTCTCGGCCTGCCCGTGCTAGGCAAATATGCCTTG GCGGATGCCTCTCTCAAGATGGCTGACCCCAATCGCTTTCGCGGCAAAGACCTTCCG GTCCTGGATCAGCTGACCGACCCTCCGGGGGTCCGGCGCGTGTACCACATCCAGGC GGGCCTACCGGACCCGTTCCAGCCtCCaAGCCTCCCGATCACGGTTTACTACGCTGTG TTGGAGCGCGCTTGCCGCAGCGTGCTCCTAAACGCACCGTCGGAGGCCCCCCAGAT TGTCCGCGGAGCCTCCGAAGACGTCCGGAAACAACCTTACAACCTGACCATCGCTT GGTTTCGGATGGGAGGCAACTGTGCTATCCCCATCACGGTCATGGAGTACACCGAA TGCTCCTACAACAAGTCTCTGGGGGCCTGTCCCATCCGAACGCAGCCTCGCTGGAAC TACTATGACAGCTTCAGCGCCGTCAGCGAGGATAACCTGGGGTTCCTGATGCACGC CCCCGCGTTTGAAACCGCCGGAACGTACCTGCGCCTCGTGAAAATAAACGACTGGA CGGAGATTACACAGTTTATCCTGGAGCACCGAGCCAAGGGCTCCTGTAAGTACGCC CTCCCGCTGCGCATTCCGCCGTCAGCCTGCCTCTCCCCCCAGGCCTACCAGCAGGGG GTGACGGTGGACAGCATCGGGATGCTGCCCCGCTTCATCCCTGAGAATCAGCGCAC CGTCGCCGTATACAGCTTGAAGATTGCCGGGTGGCATGGGCCCAAGGCCCCATACA CGAGCACCCTCCTGCCTCCTGAGCTGTCCGAGACACCTAACGCCACGCAGCCAGAA CTCGCCCCGGAAGACCCTGAGGATTCGGCCCTCTTGGAGGACCCCGTGGGAACGGT GGCGCCGCAAATCCCACCCAACTGGCACATACCGTCGATTCAGGACGCCGCGACGC CTTACCATCCCCCTGCCACCCCGAACAACATGGGTctgatagcaggagcagtgggaggaagtttgctcg ccgctctcgtcatctgcggcatagtgtatcggatgcggcgaagaacacagaaggcccccaaacgcatcaggctgccacacatacgagaa gacgatcagccgtccagccaccaacctttgttttattagccgcagatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccct cccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcat tctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctcta tggAGGTCTGAAGAGGAGTTTACGTCCAGCCAAGCTAGCTTGGCTGCGAATCGTCGA AACTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGC AGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCA TAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATT CTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGG CCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCA AAGATCGATCAAGAGACAGGATGAGGACCGTTTCGCATGATTGAACAAGATGGATT GCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCAC AACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCACAGGGACGA CCGGTTCTTTTTGTCAAGACCGACCTGTCCGGGGCCCTGAATGAACTGCAAGACGA GGCAGCGCGGCTATCGTGGCTGGCTACGACGGGCGTTCCTTGCGCAGCTGTGCTCG ACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAG GATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCA ATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCTTTCGACCACCAAGCGAA ACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATG ATCTGGACGAAGAGCATCAGGGGCTCGCACCCGCAGAACTGTTCGCCAGGCTCAAG GCGAGCATGCCCGATGGCGAGGATCTGGTCGTGACCCATGGCGATGCCTGCTTGCC GAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGG AGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGC TTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATT CGCAGCGCATtGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGATGAATCTAGAGTCG ACCGAGCACCGGTTAGTAATGAGTTTAAACGgatccaataaaagatctttattttcattagatctgtgtgttggttt ttgtgtgCAAACTCATCAATGTATcccgggctgca
[0053] Disclosed herein also is a method of producing the genetically modified mammalian cell comprising an expression cassette inserted in a mammalian cell genome wherein the cassette comprises a heterologous gene operably linked to a CMV promoter, the method comprising: transfecting a mammalian cell with a DNA sequence comprising the expression cassette; and selecting cells stably transformed with the expression cassette to obtain the genetically modified mammalian cell.
[0054] Various techniques and reagents are available for introducing macromolecules into target cells in a process known as "transfection". Widely used reagentsinclude, for example, calcium phosphate, DEAE-dextran, and lipids. For detailed protocol examples for using these types of reagents, see numerous reference documents, such as the Current Protocols in Molecular Biology, Chapter 9, Ausubel, et al. Eds., John Wiley and Sons, 1998 are available. Additional methods for transfecting cells are known in the art, including electroporation, ultrasonic perforation, optical transfection, protoplast fusion, and impalefection), Magnetfection, or viral transduction.
[0055] A "reagent for the introduction of macromolecules" or a "transfection reagent" into a cell is any material, formulation, or composition known to those of skill in the art that facilitates the entry of macromolecules into the cell, is there. See, for example, US Pat. No. 5,279,833. In some embodiments, the reagent can be a "transfection reagent" and can be any compound and / or composition that increases the uptake of one or more nucleic acids into one or more target cells. Various transfection reagents are known to those of skill in the art. Suitable transfection reagents include cationic polymers such as polyethyleneimine (PEI), polymers of positively charged amino acids such as polylysine and polyarginine, positively charged and split dendrimers, and cationic P-cyclodextrin. One or more compounds and I or compositions, including, but not limited to, polymers (CD polymers), DEAE-dextran and the like. In some embodiments, reagents for the introduction of macromolecules into cells can include one or more lipids that can be cationic lipids and / or neutral lipids. Preferred lipids include N- [1- (2,3-dioreyloxy) propyl] -N, N, N-trimethylammonium chloride (DOTMA), dioleoylphosphatidylcholine (DOPE), 1,2-bis (olea). Oiloxy) -3- (4'-trimethylammonium) propane (DOTAP), 1,2-diore oil-3- (4' -trimethylammonium) butanoyl-sn-glycerol (DOTB), 1,2-diore oil- 3-Succinyl-sn-glycerol choline ester (DOSC), cholesteryl (4'-trimethylammonio) butanoate (ChoTB), cetyltrimethylammonium bromide (CTAB), l,2-dioleoyl-3-dimethyl-hydroxyethylammonium bromide (DOSC) DORI), l,2-diorailoxypropyl-3-dimethyl-hydroxy ethylammonium bromide (DORIE), l,2-dimyristyloxypropyl-3-dimethyl-hydroxyethylammonium bromide (DMRIE), O, O'- Didodecyl-N- [p (2-trimethylammonioethyloxy) benzoyl] -N, N, N-trimethylammonium chloride, spermine conjugated to one or more lipids (eg, 5-carboxyspermilglycin dioctadecylamide)l)()OS|-N-NI N II, N III - tetramethylN'N 1 N n’ N III - tetra palmityl spermine (TM-TPS), and dipalmitoyl Rufasu phosphatidyl ethanolamine 5-carboxyfluorescein spelling Milamined (DPPES)), lipopolylysine (polylysine conjugated to DOPE), TRIS (tris (hydroxymethyl) aminomethane, tromethamine) -conjugated fatty acids (TFA), and I or peptides such as trilysyl-alanyl-TRIS mono, Di and tripalmitate (3(1- [N- (N', N'-dimethylaminoethane) -carbamoyl] cholesterol (DC-Chol), N- (a-trimethylammonioacetyl) -didodecyl-D-glutamate Chloride (TMAG), Dioctadecylammonium bromide (DDAB), 2,3-dioreyloxy-N- [2 (spermine-carboxamide) ethyl] -N, N-dimethyl-1-propaneaminium trifluoroacetate (DOSPA) ), As well as combinations of these However, it is not limited to these.
[0056] Those skilled in the art will appreciate that certain combinations of lipids described above have been shown to be particularly suitable for the introduction of nucleic acids into cells, eg, DOSPA and DOPE 3: 1 (weight). / Weight) combination is Life Technologies Corporation, Carlsbad, California. Available from, under the trade name LIPOFECTAMINE ™,a 1 : 1 (weight / weight) combination of DOTMA and DOPE is available from Life Technologies Corporation, Carlsbad, California. Available from, under the trade name LIPOFECTIN®, a 1: 1 (M / M) combination of DMRIE and cholesterol is available from Life Technologies Coiporation, Carlsbad, California. Available from the brand name DMRIE-C Reagent, a l: 1.5 (M / M) combination of TM-TPS and DOPE is available from Life Technologies Corporation, Carlsbad, California. Available from, under the trade name CellFECTIN®, a 1: 2.5 (weight / weight) combination of DDAB and DOPE is available from Life Technologies Corporation, Carlsbad, California. It is available under the trade name LIPOFECTACE®. In addition to the above-mentioned lipid combinations, other preparations containing lipids in admixtures with other compounds, specifically in admixtures with peptides and proteins containing nuclear localization sequences, are available to those of skill in the art. It is known. See, for example, International Application No. PCT / US99 / 26825 published as WO 00 / 27795, all of which are incorporated herein by reference.
[0057] Lipid aggregates such as liposomes have been shown to be useful asagents for the delivery of macromolecules into cells. Specifically, lipid aggregates containing one or more cationic lipids have been shown to be extremely efficient in delivering anionic macromolecules (eg, nucleic acids) into cells. One of the widely used cationic lipids is N- [1-(2,3-dioreoiloxy) propyl] -N, N, N-trimethylammonium chloride (DOTMA). Liposomes containing DOTMA alone or as a 1: 1 mixture with dioleoil phosphatidylethanolamine (DOPE) have been used to introduce nucleic acids into cells. A 1: 1 mixture of DOTMA: DOPE is available from Life Technologies Corporation, Carlsbad, California. It is commercially available under the trade name LIPOFECTIN ™. Another cationic lipid used to introduce nucleic acids into cells is 1,2-bis (oleoyl-oxy) -3-3- (trimethylamonia) propane (DOTAP). DOTAP differs from DOTMA in that the oleoyl moiety is attached to the propylamine skeleton by an ether bond in DOTAP, while it is attached by an ester bond in DOTMA. DOTAP is believed to be more easily degraded by target cells. The structurally related group of compounds, in which one of the methyl groups of the trimethylammonium moiety is replaced with a hydroxyl group, are structurally similar to the Rosenthal inhibitor (RI) of phospholipase A (Rosenthal, et al., (1960) I. Biol. Chem. 233: 2202-2206). RI has a stearoyl ester attached to a propylamine core. Geore oil analogs of RI are commonly abbreviated as DORI -ether and DORI -ester, depending on the binding of the lipid moiety to the propylamine core. The hydroxyl group of the hydroxyethyl moiety may be further derivatized to carboxyspermine, for example by esterification.
[0058] Another class of compounds used to introduce macromolecules intothe cell contains lipid-bound carboxyspermine moieties (Behr, et al., (1989) Proceedings of the National Academy of Sciences, USA 86): 6982-6896 and European Patent No. 0394111).Examples of compounds of this type include dipalmitoylphosphatidylethanolamine 5-carboxyspermilamide (DPPES) and 5-carboxyspermilglycin dioctadecylamide (DOGS). DOGS is described in Promega, Madison, Wis. It is commercially available under the trade name TRANSFECTAM™.
[0059] Cationic derivatives of cholesterol (3[3- [N- (N', N'-dimethylaminoethane) -carbamoyl] cholesterol, DC-Chol) have been synthesized and formulated into liposomes with DOPE (Gao, et al., (1991) BBRC 179 (1): 280-285), used to introduce DNA into cells.Liposomes formulated in this way have been reported to efficiently introduce DNA into cells at low cytotoxic levels. Lipopolylysine (Zhou, et al., (1991) BBA 1065: 8-14) formed by conjugating polylysine to DOPE is effective in introducing nucleic acids into cells in the presence of serum. Has been reported.
[0060] Other types of cationic lipids used to introduce nucleic acids into cells are published in US Pat. Nos. 5,674,908 and 5,834,439, and WO 00 / 27795. Examples include highly packed polycationic ammonium, sulfonium, and phosphonium lipids, such as those described in International Application No. PCT / US99126825. One particularly preferred but non-limiting transfection reagent for delivery of macromolecules according to the invention is LIPOFECT AMINE 2000™, which is available from Life technologies (published as WO 00 / 27795). See US International Application No. PCT / US99 / 26825). Another preferred but non-limiting transfection reagent suitable for delivery of macromolecules to cells is EXPIFECT AMINE™. Other suitable transfection reagents include LIOFECTAMINE™ RNAiMAX, LIPOFECT AMINE™ LTX, ORIGFECTAMINE™, Cellfectin™, INVIVOFECTAMINE™, INVIVOFECT AMINE™ 2.0, and Yan et al. Included are any of the lipid reagents or formulations disclosed in Patent Application Publication No. 2012 / 0136073 (incorporated herein by reference). A variety of other transfection reagents are known to those of skill in the art and can be evaluated for their compatibility with the transient transfection systems and methods described herein.
[0061] Disclosed herein also is a genetically modified mammalian cell comprising a heterologous nucleic acid integrated on a chromosome of the mammalian cell genome, wherein the heterologous nucleic comprises a heterologous gene configured for expression by the mammalian cell. A cell line comprising the genetically modified mammalian cells is also disclosed. In an aspect, the genetically modified mammalian cell comprises at least one heterologous gene stably inserted in the mammalian cell genome. Expression of the heterologous nucleic acid in the genetically modified mammalian cell can be constitutive, inducible, or a combination thereof.
[0062] In one aspect, the genetically modified mammalian cell is a Vero cell. In one aspect, the genetically modified Vero cell containing an expression cassette encoding gDI as described above, and the corresponding cell line, are referred to herein as “CMV-gD cell” or “CMV-gD cell line.” In an aspect, a CMV-gD cell line comprising the CMV-gD cells is provided. In an aspect, the CMV-gD cell line consists essentially of, or consists of, the CMV-gD cells.
[0063] To facilitate selection of the genetically modified Vero cell, a selectable marker can be used. In one aspect, the selectable marker is part of the expression cassette. In yet another aspect, the selectable marker is neomycin resistance. In another aspect, the nucleic acid encoding the selectable marker contains silent mutations in order to minimize similarity to the HSV-2 viral genome.
[0064] The locus and / or site for insertion / integration of the expression cassette encoding the heterologous nucleic acid can be anywhere in the genome of the mammalian cell. In an aspect, the heterologous nucleic acid is inserted in a single locus or in a plurality of loci.
[0065] The heterologous nucleic acid is also designed to facilitate expression of the heterologous gene following integration in the genome of the mammalian cell. In an aspect, the heterologous nucleic acid comprises a promoter operably linked to the heterologous gene. The promoter drives the synthesis of a primary transcript from the heterologous gene. Exemplary promoters include inducible promoters, constitutive promoters, tissue-specific promoters, and synthetic promoters. In one aspect, the promoter is a CMV promoter.
[0066] Other useful elements can also be included in the heterologous nucleic acid. For example, the heterologous nucleic acid can further include a gene encoding a selectable marker, a bacterial origin of replication, a viral origin of replication, or a combination thereof. The heterologous nucleic acid can also include other sequences that can be used to modulate transgene expression or improve cloning of antigen, like a WPRE, an E. coli cosmid sequence (a cos sequence), a bacterial promoter, a transmembrane domain, and / or a polyadenylation (poly A) signal. A transmembrane domain, such as the platelet-derived growth factor receptor (PDGFR) transmembrane domain, may be fused to or used in conjunction with the heterologous gene to enable expression of the heterologous gene product on the cell membrane surface. A polyA signal sequence promotes polyadenylation and transcription termination and is located downstream of the heterologous gene. Exemplary polyA signal sequences include the SV40 poly(A) signal, the bovine growth hormone polyadenylation signal (bGHpA), human growth hormone polyadenylation signal (hGHpA), immunoglobulin kappa signal, and rabbit beta globin polyadenylation signal (rbGlob), but is not limited thereto.
[0067] Expression of the heterologous gene can be qualitatively and / or quantitatively assessed based on expression of a gene encoding a selectable marker (also referred to herein as “reporter gene” and “reporter protein”). In an aspect, the heterologous nucleic acid further comprises a selectable marker operably linked to the heterologous gene. The gene encoding the selectable marker can be inserted upstream and / or downstream of the gene encoding the heterologous polypeptide. In an aspect, the selectable marker gene is inserted downstream of the gene encoding the heterologous polypeptide. In an aspect, the selectable marker is operably linked to the promoter and to the gene encoding the heterologous polypeptide. In another aspect, the selectable marker is operably linked to a promoter different than the promoter of the heterologous polypeptide. The selectable marker can induce a visually identifiable characteristic distinguishable from the cell in which it is being expressed and which can be readily measured. Alternatively, the selectable marker can be one which confers a host cell with the ability to grow in the presence of a selective agent, or one which confers a host cell with the ability to grow in the absence of a required nutrient. In an aspect, the selectable marker is a gene encoding neomycin antibiotic resistance gene. In an aspect, the selectable marker can be the neomycin resistance gene operably linked to a promoter, e.g. an SV40 promoter.
[0068] In an aspect, the heterologous nucleic acid is part of a plasmid or cloning vector. Cloning vectors and plasmids are known in the art. In one aspect, the cloning vector is a pBluescrip plasmid. In another aspect, the cloning vector is pBluescrip II (KS(+) vector.
[0069] The present disclosure provides a genetically modified mammalian cell comprising an expression cassette stably integrated on a chromosome of the mammalian cell genome, wherein the expression cassette comprises a heterologous nucleic operably linked to a CMV promoter. In an aspect, the transgenic mammalian cell comprises at least one copy, at least 2 copies, at least 3 copies, at least 4 copies, at least 5 copies of the expression cassette. In an aspect, the genetically modified mammalian cell comprises 1 to 50 copies, or 1 to 20 copies, or 1 to 10 copies of the expression cassette inserted in the locus.
[0070] In an aspect, the expression cassette comprises a nucleic acid encoding a heterologous gene or a nucleic acid sequence encoding a heterologous protein or heterologous antigen. Proteins to be expressed in these cells and using the methods of the invention are well known to persons skilled in the art. They are preferably human proteins that preferably undergo some kind of processing in nature, such as secretion, chaperoned folding and / or transport, cosynthesis with other subunits, glycosylation, phosphorylation. Typical examples for therapeutic or diagnostic use include monoclonal antibodies that are comprised of several subunits, tissue specific Plasminogen Activator (tPA), granulocyte colony stimulating factor (G-CSF) and human erythropoietin (EPO). EPO is a typical product that, especially in vivo, heavilydepends on its glycosylation pattern for its activity and immunogenicity. Thus far, relatively high levels of EPO can be reached by the use of CHO cells which is differently glycosylated when compared to EPO purified from human urine, albeit equally active in the enhancement of erythrocytes production. The different glycosylation of such EPO, however, leads to immunogenicity problems and altered half-life problems in a recipient.
[0071] In one embodiment the invention provides a method of the invention wherein said cell is capable of producing 2 to 200-fold more recombinant protein and / or proteinaceous substance than conventional mammalian cell lines. Preferably, said conventional mammalian cell lines are selected from the group consisting of CHO, COS, Vero, Hela, BHK and Sp-2 cell lines.
[0072] In one aspect of the invention the proteinaceous substance or protein is a monoclonal antibody. Antibodies, or immunoglobulins (Igs), are serum proteins that play a central role in the humoral immune response, binding antigens and inactivating them or triggering the inflammatory response which results in their elimination. Antibodies are capable of highly specific interactions with a wide variety of ligands, including tumor-associated markers, viral coat proteins, and lymphocyte cell surface glycoproteins. They are, therefore, potentially very useful agents for the diagnosis and treatment of human diseases. Traditionally, recombinant monoclonal antibodies (immunoglobulins) are produced on B-cell hybridomas. Such hybridomas are produced by fusing an immunoglobulin-producing B-cell, initially selected for its specificity, to a mouse myeloma cell and thereby immortalizing the B-cell. The original strategy of immortalizing mouse B-cells was developed in 1975 (Kohler and Milstein).However, immunoglobuli ns produced in such hybridomas have the disadvantage that they are of mouse origin, resulting in poor antibody specificity, low antibody affinity and a severe host antimouse antibody response (HAMA). This HAMA response may lead to inflammation, fever, and even death of the patient. Mouse antibodies have a low affinity in humans and for reasons yet unknown have an extremely short half-life in human circulation (19-42 hours) as compared to human antibodies (21 days). That, together with the severity of the HAMA response, has prompted the development of alternative strategies for generating more human or completely humanized immunoglobulins. One such strategy makes use of the constant regions of the human immunoglobulin to replace its murine counterparts, resulting in a new generation of "chimeric" and "humanized" antibodies. This approach is taken since the HAMA response is mainly due to the constant domains. Partially humanized or human antibodies lack a parental B-cell that can be immortalized and therefore have to be produced in other systems like Chinese Hamster Ovary (CHO) cells or Baby Hamster Kidney (BHK) cells. It is also possible to use cells that are normally suited for immunoglobulin production like tumor-derived human- or mouse myelomacells. However, antibody yields obtained in myeloma cells are in general relatively low (±0.1 ug / ml) when compared to those obtained in the originally identified and immortalized B-cells that produce fully murine immunoglobulins. To circumvent these and other shortcomings, different systems are being developed to produce humanized or human immunoglobulins with higher yields.
[0073] Nevertheless, human immunoglobulins produced thus far have the disadvantage of being produced in non-human cells, resulting in non-human post-translational modifications like glycosylation and / or folding of the subunits. All antibodies are glycosylated at conserved positions in their constant regions, and the presence of carbohydrates can be critical for antigen clearance functions such as complement activation. The structure of the attached carbohydrate can also affect antibody activity. Antibody glycosylation can be influenced by the cell in which it is produced, the conformation of the antibody and cell culture conditions. For instance, antibodies produced in mouse cells carry glycans containing the Gal alphal-3Gal residue, which is absent in proteins produced in human cells (Borrebaeck et al. 1993, Borrebaeck. 1999). A very high titer of anti-Gal alphal-3Gal antibodies is present in humans (100 ug / ml, Galili, 1993) causing a rapid clearance of (murine) proteins carrying this residue in their glycans.It soon became apparent that in order to exert an effect, patients need to be treated with very high doses of recombinant immunoglobulins for prolonged periods of time. It seems likely that post-translational modifications on human or humanized immunoglobulins that are not produced on human cells strongly affect the clearance rate of these antibodies from the bloodstream.
[0074] Thus, it would be an improvement in the art to provide a human cell that produces consistent human type protein processing like post-translational and peri-translational modifications, such as, but not limited to, for instance glycosylation. It would be further advantageous to provide a method for producing a recombinant mammalian cell and immunoglobulins from recombinant mammalian cells in large-scale production.
[0075] The present invention therefore further provides a method for producing at least one variable domain of an immunoglobulin in a recombinant mammalian cell, comprising a transgenic or modified mammalian cell with an expression cassette comprising a nucleic acid encoding the CMV promoter, or a functional derivative, homologue and / or fragment thereof, and further comprising a second nucleic acid encoding said immunoglobulin, in the genome thereof, and culturing said cell in a suitable medium and harvesting at least one monoclonal antibody from said cell and / or said medium.
[0076] The nucleic acid may encode a heavy chain, a variable heavy chain, a light chain, and / or a variable light chain of an immunoglobulin. Alternatively, a separate or distinct nucleic acid may encode one or more variable domain(s) of an Ig (or a functional derivative, homologueand / or fragment thereof), as a counterpart to the first nucleic acid (described above).One or more nucleic acid(s) described herein may encode an ScFv and may be human or humanized. The nucleic acid(s) of the present invention are preferably placed under the control of an inducible promoter (or a functional derivative thereof).
[0077] In one aspect, a method of using the invention, wherein said transgenic or genetically modified cell further comprises a trans-activating protein for the induction of said inducible promoter. The invention also provides immunoglobulins obtainable by a method according to the invention or by a use according to the invention.
[0078] The present invention further provides methods for producing at least one variable domain of an immunoglobulin in the transgenic or genetically modified mammalian cell of the invention, culturing the cell in a suitable medium, and harvesting at least one variable domain of a selected Ig from the transgenic cell and / or medium. Immunoglobulins, variable domains of the immunoglobulins, or derivatives thereof, may be used for the therapeutic treatment of mammals or the manufacture of pharmaceutical compositions.
[0079] In one aspect, the heterologous antigen gene encodes an antigen which induces an immune response specific for the target of interest e.g., virus, bacterium, parasite. As used herein an “antigen” refers to a polypeptide or protein capable of inducing an immune response, e.g., a humoral and / or cellular mediated response, to the target of interest in a subject.
[0080] The heterologous antigen gene can be from a virus, a bacterium, or a parasite. The virus can be a pathogenic virus, examples of which include adenovirus, cytomegalovirus (CMV), coxsackie virus, Crimean-Congo hemorrhagic fever virus, chikungunya virus, dengue virus, Dhori virus, Eastern equine encephalitis (EEE) virus, Ebola virus, Epstein Barr vims (EBV), Hanta vims, hepatitis viruses (e.g., hepatitis A, hepatitis B, hepatitis C, hepatitis D, hepatitis E), HSV-1, HSV-2, human immunodeficiency vims (HIV), human papilloma vims, human SARS corona vims, SARS CoV-2, human T lymphotropic vims (HTLV), influenza vims, Japanese encephalitis vims, Marburg vims, measles vims, mumps vims, poliovims, Norwalk vims, smallpox, parvovims, rabies vims, reovims, rhinovims, Rift Valley fever vims, rotavims, rubella vims, severe fever with thrombocytopenia syndrome (SFTS) vims, respiratory syncytial vims (RSV), varicella zoster vims, Western equine encephalitis vims, West Nile vims, yellow fever vims, Zika vims, or a combination thereof.
[0081] The bacterium can be a pathogenic bacterium, examples of which include Actinomyces sp, Bacillus sp., Bartonella sp., Bordatella sp., Boreilia sp., Brucella sp., Campylobacter sp., Chlamydia sp., Clostridium sp., Corynebacterium sp., Coxiella sp., Enterobacter sp., Enterococcus sp., Escherichia sp., Francisella sp, Gardnerella sp., Haemophilus sp., Helicobacter sp., Klebsiella sp., Legionella sp., Leptospira sp., Listeria sp.,Mycobacterium sp., Mycoplasma sp., Neisseria sp., Nocardia sp., Rickettsia sp., Pasteurella sp., Proteus sp., Pseudomonas sp., Salmonella sp., Serratia sp., Shigella sp., Staphylococcus sp., Streptococcus sp., Treponema sp., Vibrio sp., Yersinia sp., or a combination thereof.
[0082] The parasite can be a pathogenic parasite, examples of which include Acanthamoeba spp., Balamuthia spp., Babesia sp., Balantidium coli, Blastocystic sp., Cryptospiridium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia lamblia, Isospora bello, Leishmania sp., Naegleria foweri, Plasmodium sp., Rhinosporidium seeberi, Sarcocystis sp., Toxoplasma gondii, Trichomonas sp., Trypanosoma sp., or a combination thereof.
[0083] In an aspect the expression cassette comprises a nucleic acid encoding a heterologous gene comprising a virus gene, a reporter gene, or a combination thereof.
[0084] In an aspect, the heterologous nucleic acid comprises a virus gene. The virus gene can be from a DNA vims, an RNA vims, or a combination thereof. The vims gene can comprise a single vims gene or a combination of vims genes. The vims gene is operably linked to a CMV promoter which drives the synthesis of a primary transcript from the vims gene. The genetically modified mammalian cell and corresponding cell line stably express the vims gene or genes encoded by the heterologous nucleic acid. In an aspect, the promoter comprises a CMV promoter. The CMV promoter comprises binding sites for transcription factor regulatory elements that are ubiquitously expressed. Promoter activity in any host is regulated by a combination of interactions between the promoter’s binding sites and the host’s endogenous transcription factors. The expression of the gene under the CMV promoter is transactivated, by several transcriptional activators and transcriptional repressors. For example, the CMV promoter can be regulated by any vims or other molecule that activates the CMV promoter, including but not limited to, tumor necrosis factor (TNF), synthetic DNA analogs CpG oligodeoxynucleotides (CpG-ODs), dimethylsufoxide, 5’-Aza-2’-deoxycytidine, histone deacetylase (HDAC) inhibitor, e.g. OSU-HDAC42, and others known in the art. Notably, there is little constitutive expression of gD in CMV-gD Vero cells, but viral infection rapidly transactivates gD. This overcomes concerns that gD mediated interference might restrict the ability to grow high titers of the vims.
[0085] The vims gene can comprise a gene from herpes simplex virus-1 (HSV-1), herpes simplex virus-2 (HSV-2), cytomegalovims, rotavims, smallpox, poliovims, rabies vims, reovims, Japanese encephalitis vims, hemorrhagic fever vims, measles vims, influenza vims, Middle-Eastern respiratory syndrome coronavirus, Zika vims, dengue vims, SARS-CoV2, influenza A vims, or a combination thereof. The vims gene is not limited and can be any vims gene which can be expressed in a mammalian cell.
[0086] The virus gene can be an essential gene, a non-essential gene, or a combination of an essential gene and a non-essential gene. An “essential gene” refers to a gene encoded by the virus genome that is required for replication of the virus and production of new infectious viral particles or virions (growth of the virus). In an aspect, the virus gene is an essential gene.
[0087] In an aspect, the heterologous nucleic acid comprises an HSV gene. The HSV gene can be a single HSV gene or a combination of HSV genes. In an aspect, the heterologous nucleic acid comprises at least one HSV gene. In an aspect, the heterologous nucleic acid comprises at least two, or at least three, or at least four HSV genes. The HSV gene can be from herpes simplex virus-1 (HSV-1), heipes simplex virus-2 (HSV-2), or a combination thereof (e.g., a gene from HSV-1 and a gene from HSV-2). In an aspect, the HSV gene comprises an HSV essential gene or a combination of an HSV essential gene and an HSV non-essential gene. The HSV genome encodes approximately ninety different genes that can be classified as either essential or non-essential. In an aspect, the transgenic mammalian cell, as well as the corresponding cell line, stably expresses the HSV gene encoded by the heterologous nucleic acid and supports (complements) the replication of a single cycle infectious HSV virus comprising a genomic modification of the corresponding HSV gene. Tn an aspect, the genomic modification is a full or partial deletion of the HSV gene in the HSV genome.
[0088] Non-limiting examples of essential HSV genes comprise genes encoding for proteins contained in the lipid envelope of the virus, such as, glycoprotein B (gB), glycoprotein C (gC), glycoprotein D (gD), glycoprotein E (gE), glycoprotein G (gG), glycoprotein H (gH), glycoprotein I (gl), glycoprotein J (gj), glycoprotein K (gK), glycoprotein L (gL), glycoprotein M (gM), glycoprotein N (gN), UL20, UL45, US9, or a combination thereof. In an aspect, the HSV gene comprises gD gene, gG gene, gl gene, gJ gene, or a combination thereof. In an aspect, the HSV gene comprises glycoprotein D. In an aspect, the HSV gene comprises glycoprotein D gene, glycoprotein G gene, glycoprotein I gene, glycoprotein J gene, or a combination thereof. In an aspect, the HSV gene comprises a herpes simplex virus-1 (HSV-1) glycoprotein D gene, a herpes simplex virus-2 (HSV-2) glycoprotein D gene, or a combination thereof.
[0089] In an aspect, the genetically modified mammalian cell is a Vero cell and comprises the HSV-1 glycoprotein D gene, the HSV-2 glycoprotein D gene, or a combination thereof. These genetically modified Vero cells comprising the HSV-1 glycoprotein genes, and the corresponding cell line, are referred to herein as “CMV-gD” or “CMV-gD cell line.” In one aspect, the CMV-gD cell line is C7. In an aspect, the CMV-gD cell line consists essentially of, or consists of, CMV-gD cells. The CMV-gD cells stably express the HSV-1 glycoprotein genes and complements a genetically modified, single cycle infectious HSV-1 or HSV-2 strain containing a genomic deletion of one or more of these genes. The genomic deletion can be a fullor partial deletion. In an aspect, the CMV-gD cells complement a single cycle infectious HSV-2 strain containing a genomic deletion of the HSV-2 gD gene (AgD-2). Since the CMV-gD cells and corresponding cell line are produced and maintained under defined conditions, any potential safety concerns associated with production of the vims are minimized.
[0090] Disclosed herein is a method of propagating a single cycle infectious vims comprising a genome having a deletion of an essential gene, the method comprising: providing a genetically modified or a transgenic Vero cell comprising at least one copy of the essential gene inserted in a the Vero cell genome, wherein the genetically modified Vero cell expresses a protein encoded by the essential gene; contacting the Vero cell with the single cycle infectious vims: and complementing the single cycle infectious vims with the protein expressed in the Vero cell to propagate the single cycle infectious vims.
[0091] Single cycle infectious vimses are vimses that have been genetically modified to prevent the formation of mature virions capable of spreading to neighboring uninfected cells. Single cycle infectious vimses are unable to form infectious viral particles following initial infection of a host cell and undergo only a single round of replication and infection. The genetic modification is typically made to an essential viral gene and can be a complete or partial deletion of the viral gene, or a mutation thereto, which effectively prevents the formation of mature virions in a host cell. As a result, the single cycle infectious vims can only establish a lytic infection and propagate if the missing gene is supplied in trans by an engineered cell (complementing cell). In an aspect, the transgenic mammalian cell stably expresses a viral gene and phenotypically complements the replication of a single cycle infectious vims comprising a genome having a genetic modification (e.g., deletion) of the same gene. As a result of this complementation, the single cycle infectious vims is able to replicate and produce new infectious viral particles in the transgenic mammalian cell. Since the transgenic mammalian cells and corresponding transgenic mammalian cell line are produced and maintained under defined conditions, any potential safety concerns associated with production of a single cycle infectious vims are minimized.
[0092] In an aspect, the single cycle infectious vims comprises herpes simplex virus- 1 (HSV-1), herpes simplex virus-2 (HSV-2), cytomegalovims, rotavims, smallpox, poliovims, rabies vims, reovims, Japanese encephalitis vims, hemorrhagic fever vims, measles vims, influenza vims, Middle Eastern respiratory syndrome coronavirus, Zika vims, SARS-CoV2, or a combination thereof.
[0093] In an aspect, the single cycle infectious vims is a single cycle infectious HSV (HSV-1 or HSV-2), comprising a partial or complete deletion of an essential gene or a combination of an essential gene and a non-essential gene. In an aspect, the deleted HSVessential gene comprises gB, gC, gD, gE, gG, gH, gl, gj, gK, gL, gM, gN, UL20, UL45, US9, or a combination thereof. In an aspect, the deleted HSV gene comprises gD, gG, gl, gJ, or a combination thereof. Tn an aspect, the HSV gene comprises glycoprotein D. In an aspect, the HSV gene comprises gD, gG, gl, and gJ. In an aspect, the HSV gene comprises a herpes simplex virus-1 (HSV-1) glycoprotein D gene, a herpes simplex virus-1 (HSV-2) glycoprotein D gene, or a combination thereof.
[0094] In an aspect, the single cycle infectious HSV is a single cycle infectious HSV-1 or HSV-2 comprising a deletion of the glycoprotein D gene in the genome of the HSV-1 or HSV-2. In an aspect, the single cycle infectious HSV is a single cycle infectious HSV-2. In an aspect, the single cycle infectious virus comprises HSV-2 comprising a deletion of the gD gene in the genome of the HSV-2, referred to as AgD-2. In an aspect, the single cycle infectious vims HSV is the AgD-2 vaccine strain, having a genomic deletion of the gD gene. In preclinical murine studies, this vaccine strain, AgD-2, elicited high-titer non-neutralizing Abs that activate Fc gamma receptors (FcyRs) to induce antibody-dependent cell-mediated cytotoxicity (ADCC). Two doses administered subcutaneously completely protected female and / or male mice against lethal vaginal or skin challenge with clinical isolates of HSV-1 and HSV-2 and prevented the establishment of latency (US202103698381; Petro, C., et al., eLife 2015; Petro, C. D., et al., JCI Insight 2016, 1, 1-15; Burn, C., et al., Journal oflnfectious Diseases 2017, 1-5; Kao, C. M., et al., Journal oflnfectious Diseases 2019, 42, 47-10). Moreover, vaccination of female mice protected their pups from subsequent HSV challenge in the first week of life (Kao, C. M., et al., Journal oflnfectious Diseases 2019, 42, 47-10). In contrast to adjuvanted recombinant gD, AgD-2 boosted the total and the ADCC Ab responses in HSV-1 seropositive mice and prevented subsequent lethal HSV-2 superinfection (Bum Aschner, C., et al., npj Vaccines 2020, 1-33).
[0095] In an aspect, the heterologous nucleic acid gene is stably integrated in the genome of transfected Vero cell and comprises a herpes simplex virus-1 (HSV-1) glycoprotein D gene, a heipes simplex virus-1 (HSV-2) glycoprotein D gene, or a combination thereof. A VD60 cell line capable of complementing a single cycle infectious vims HSV such as the AgD-2 strain, was first developed by David Johnson in 1988 (Ligas MW & Johnson DC (1988), J Virol 62(5): 1486-1494). In brief, a 6 kb BamHl fragment from the KOS strain of HSV-1 was ligated into an E. coli plasmid containing a hisD gene and then transfected into Vero cells. A histidinol-resistant clone was isolated that allowed for facile complementation of the AgD-2: :GFP vims (Cheshenko N, et al. (2014) J Virol 88(17): 10026-10038; Petro C, et al. (2015), Elife 4).Although VD60 cells complement the AgD-2 vims, advantageously, the herein described new cell line (CMV-gD) not only complements, but also minimizes the likelihood of illegitimate or homologous recombination. The CMV-gD cells can be used both to propagate the AgD-2 vimsas well as to detect the number of viable single cycle virus infectious particles (e.g., AgD-2) present in a sample (e.g., an aliquot of a vaccine preparation).
[0096] The AgD-2 propagated in the transgenic Vero cell line CMV-gD can be formulated for administration to a subject. The efficacy of the AgD-2 strain cultured in the VD60 cell line as a vaccine to elicit sterilizing immunity against HSV-1 and HSV-2 has been demonstrated (Petro, C. et al, Elife, 2015, 4; Petro, C.D. et al., JCI Insight, 2016, 1(12); WO 2015 / 134368). Accordingly, the AgD-2 propagated in the CMV-gD cell line can be used to treat or prevent an HSV-1 infection, an HSV-2 infection, or an HSV-1 and HSV-2 coinfection in a subject. In an aspect, the AgD-2 propagated in the transgenic CMV-gD Vero cell line can be used to treat or prevent a disease caused by an HSV-1 infection, an HSV-2 infection, or an HSV-1 and HSV-2 coinfection in a subject.
[0097] In an aspect, the contacting of the cultivated (cultured) transgenic mammalian cell with the single cycle infectious virus comprises adding the single cycle infectious virus to the cultivated transgenic mammalian cells under conditions that facilitate infection of the transgenic mammalian cells with the single cycle infectious virus. The conditions used to infect the transgenic mammalian cells with the single cycle infectious virus are not limited, and any suitable conditions can be used. In an aspect, the transgenic mammalian cells are CMV-gD cells.
[0098] In an aspect, the propagating of the single cycle infectious virus in the transgenic mammalian cells further comprises culturing the infected transgenic mammalian cells for a period of time and under conditions (e.g., temperature, relative humidity, CO2 atmosphere) suitable to maximize production of the single cycle infectious HSV. The conditions resulting in maximum production of the single cycle infectious vims vary and are not limited, and can comprise, for example, culturing the infected cells at a temperature of 37°C, in a 5% CO2 atmosphere, for a determined time period.
[0099] In an aspect, the transgenic mammalian cell comprises a selection marker encoded by the inserted heterologous nucleic acid. In an aspect, the method further comprises cultivating the transgenic mammalian cell in a selection medium. In an aspect, the transgenic mammalian cell comprises neomycin as a selection marker and the selection medium comprises G418. The amount of G418 in the culture medium is not limited and can be determined by the person of skill in the art without undue experimentation.
[0100] The transgenic mammalian cell comprising a reporter gene as the heterologous gene can be used to detect and / or quantify virus present in a sample and / or to determine the infectivity of a stored virus sample. The present disclosure provides a method of detecting and / or quantifying infectious virus in a sample using a cell-based reporter assay. The cell-based reporter assay and detection method utilize, for example, transgenic mammalian cellscomprising a heterologous nucleic acid stably integrated in the genome of the mammalian cell, wherein the heterologous nucleic acid comprises a CMV promoter operably linked to a reporter gene.
[0101] The present disclosure provides a cell-based reporter assay for quantifying infectious virus in a sample, for example HSV-1 or HSV-2. The cell-based reporter assay utilizes transgenic mammalian cells comprising a heterologous nucleic acid comprising a promoter-reporter construct. The cell-based reporter assay can be used to detect the presence of infectious virus in a sample and for measuring virus infectivity (potency). The cell-based reporter assay can also be used to test a biological sample for the presence of infectious vims. The cell-based reporter assay can also be used as a potency assay. Also disclosed herein is a method for detecting infectious vims in a biological sample from a subject. The assay and methods disclosed herein can be conducted in a short period of time and are capable of accurately quantifying the amount of vims present in the sample.
[0102] In an aspect, the transgenic mammalian cells used in the assay and / or method are contacted with a sample comprising the vims or suspected of comprising the vims. In an aspect, the sample is taken from a batch of bulk vims before, during, or after storage of the bulk vims. The infectivity of a vims can potentially decrease during storage, and thus it is beneficial to have a quick and effective method of determining whether the expected amount of vims is present in a test sample after storage, i.e., a method to measure vims stability during storage over time. The assay results can be used to determine the fate of the bulk vims, for example, whether it is suitable for further use (e.g. manufacturing), or whether it should instead be modified or discarded. The assay can also be performed on a sample taken from a batch of vaccine comprising a live vims, such as a single cycle infectious vims, in which case the assay results can be used to determine the fate of the batch, e.g. whether the batch is suitable for release for use by healthcare professionals.
[0103] In an aspect, the sample is a biological sample from a subject. In an aspect, the vims is present in the biological sample or is suspected of being present in the biological sample. An assay capable of quickly and accurately testing (screening) a biological sample from a subject for the presence of infectious vims would be advantageous in providing a quick diagnosis and treatment of the subject. The biological sample can comprise, but is not limited to, semm, saliva, plasma, whole blood, nasopharyngeal swab, urine, stool, respiratory fluid, cerebrospinal fluid, or a combination thereof.
[0104] In an aspect, the contacting comprises infecting the transgenic mammalian cells with vims present in the sample. Following infection of the transgenic mammalian cells, thevirus transactivates the CMV promoter which induces expression of the reporter gene in the mammalian cells.
[0105] In an aspect, a cell based reporter assay method for measuring virus infectivity, comprises: providing transgenic mammalian cells comprising a heterologous nucleic acid stably integrated on a chromosome of the genome of the mammalian cells, wherein the heterologous nucleic acid comprises a CMV promoter operably linked to a reporter gene; contacting the transgenic mammalian cells with the sample, wherein infectious virus present in the sample transactivates the CMV promoter which induces expression of the reporter gene in the mammalian cells; and quantifying the number of mammalian cells expressing protein encoded by the reporter gene to quantify the infectious virus.
[0106] In an aspect, a method of detecting infectious vims in a biological sample from a subject comprises: contacting the biological sample from the subject with transgenic mammalian cells comprising a heterologous nucleic acid stably integrated in a target locus on a chromosome of the genome of the mammalian cells, wherein the heterologous nucleic acid comprises a CMV promoter operably linked to a reporter gene; contacting the transgenic mammalian cells with the biological sample, wherein infectious virus present in the sample transactivates the CMV promoter which induces expression of the reporter gene in the mammalian cells; and quantifying the number of mammalian cells expressing protein encoded by the reporter gene to quantify the infectious virus.
[0107] In an aspect, the contacting comprises infecting the transgenic mammalian cells with the vires. In an aspect, the cell-based reporter assay and / or method further comprises inducing expression of the reported gene in the transgenic mammalian cell by introducing an activator of the CMV promoter as described herein. In an aspect, the transgenic mammalian cell is a Vero cell.
[0108] This disclosure is further illustrated by the following examples, which are nonlimiting.EXPERIMENTAL DETAILS MATERIALS AND METHODS:
[0109] An expression cassette was synthesized and cloned into the pBluescrip II KS(+) vector (Genscript). The cassette (see FIG. 1) encoded the HSV-1 gD coding region driven by the CMV immediate early promoter, and neomycin resistance marker driven by an SV40 promoter. Silent mutations were incorporated into the gD and neomycin resistance genes in order to minimize similarity to the HSV-2 viral genome. The expression cassette was released from theplasmid backbone by restriction digest (Notl-HF® and EcoRI-HF®, New England Biolabs®) and gel purified.
[0110] VERO cells (ATCC®, CCL-81 , lot# 70016956), were maintained in EMEM (ATCC 30-2003) supplemented with 5% FBS (Sigma) at 37°C, 5% CO2. Cells were plated at E2xl06cells per 6cm plate ~18 hours prior to transfection and media exchanged for fresh EMEM / 10% FBS immediately prior to transfection. Cells were transfected with the purified linear DNA fragment using PEI (polyethyenimine, a transfection reagent, Polysciences®, Inc.); transfection mix contained 7pg linearized DNA and 14pg of linear PEI in a final volume of 500pl in OptiPro SFM (Gibco), which was incubated at room temperature for 5 minutes, and then added to the cells. Cells were incubated for four hours, and media was replaced with fresh Eagle’s Minimum Essential Medium (EMEM )+ 10% Fetal Bovine Serum (FBS).
[0111] 24 hours post-transfection cells were split into 3 6cm plates (labeled A, B, C), and selection was initiated by addition of G418 (Invivogen) to 800pg / ml. Following 13 days of selection the untransfected control plate was cleared, and ~12 colonies were observed on each of plates A and B, and 6 colonies on C. Colonies on plate B were released using TryplE and resuspended to 1 xl 05 / ml in EMEM / 10% FBS / 200pg / ml G418. Single cells were dispensed to each well of 3x96 well plates using a Hana single cell dispenser (Namocell) and cultured for 18 days. Each 96-well plate was split in an 80:20 ratio to two fresh 96-well plates. The 80% plate was assessed for complementation of the gD deleted HSV-2 virus, 20% maintained as a stock plate. Four wells were identified as potential complementing lines and were transferred from the stock plate to 10cm plates. Cells in 10cm plates were expanded for 15 days, and complementation assayed. The clone that complemented with the highest efficiency was diluted to 5000 cells / ml and re-sorted using the Hana single cell dispenser in EMEM / 10% FBS / 200pg / ml G418. 12 wells from this second sort were expanded, and four were assayed for complementation. The clone corresponding to the highest complementation efficiency was plated in a 15cm plate in VP-SFM (Gibco™) a serum-free, animal-origin-free culture medium designed for growth of Vero cells and virus production, expanded in VP-SFM for 8 days, and tested again for complementation. Research cell bank of this line, named C7, was frozen down following a total of 17 days expansion in VP-SFM.CHARACTERIZATION OF THE CELL LINE
[0112] 1. Plaque purification of virus on C7 cells to generate lab master viral stock.
[0113] Serial dilutions of a prior stock of AgD-2 (diluted in DMEM) were plated on C7 or Vero cells in 12-well dishes. After 1 h incubation, the inoculum was removed, and the cells were overlaid with 1% agarose supplemented with VP-SFM (Gibco™). After 72 h incubation, cells were examined for evidence of plaque formation. No plaques were seen on the Vero cellsat any dilution (lowest dilution 101). From the C7 cells, 2 plaques were isolated from the 10’5well and one from the ICT6well using cloning rings. The individual plaques were freeze -thawed three times in 0.5 ml VP-SFM. The process was repeated 4 times and each time, no plaques were observed on Vero cells and individual plaques were picked, subjected to freeze-thawing, and replated. One of the plaques was selected for expansion first in a T25 flask. The cellular lysate was harvested after 72 h and again retested by plaque assay on C7 and Vero cells in parallel. The titer was 5 xlO7on C7 (and on VD60 cells) and 0 on Vero cells. A lab working viral stock was then grown in T150 flasks and used for studies in mice. (Titer ~8 x 107).
[0114] 2. STABILITY OF COMPLEMENTATION
[0115] To assess for stability of complementation, C7 cells were serially passaged in VP-SFM and after each passage, plaque assays were conducted on the C7 and Vero cells in parallel. VD60 cells were included for comparison. Results for the first 10 passages are shown below and demonstrate that C7 cells are stable over time and complement at least as well as the original VD60 cells. Similar results were obtained through passage 15. Shown below in Table 1 are serial dilutions of virus grown on passage 12 C7 cells (upper panel) or Vero cells (lower panel). No virus is detected on Vero cells.TABLE 1Cells P3 P4 P5 P6 P7 P8 P9 P10C7 7 x 1072x 1071 x 1072 x 1075 x 1073 x 1071 x 1084 x 107VD60 5 x 1074 x 1064 x 1062 x 1074 x 1079 x 1066 x 1076 x 107Vero 0 0 0 0 0 0 0 0
[0116] To further test for recombination risk, we conducted extend passage studies as previously performed with the VD60 cells. Vero cells (noncomplementing) were infected with the AgD-2 virus that had been grown on C7 cells at a multiplicity of infection (MOI) of 1 pfu / cell and incubated for 7 days. The infected cells were harvested, subjected to freeze-thaw three times to release any intracellular virus, and replated on fresh Vero cells. This process was repeated for 4 weeks. Controls included wild-type HSV-2(G) (the parental strain). No virus or cytopathic effect was ever detected.
[0117] 3. MOUSE STUDIES
[0118] To assess immunogenicity and efficacy of AgD-2 grown on the new C7 cell line, mouse studies were performed with virus grown on C7 versus VD60 cells for comparison. 6-8 weeks old C57 / BL6 mice were vaccinated with 104, 105, and 106pfu / mouse of virus (5 mice / group) administered intramuscularly, and then received a 2ndbooster dose three weeks later. Blood was collected one-week post-boost and assayed for ADCC-mediating antibodyresponses (FIG. 3A). No differences in ADCC response at any of the 3 doses were observed when comparing virus grown on VD60 versus C7 cells.
[0119] Mice were then challenged one week later with lOx the lethal dose of HSV-2(sd90), a clinical isolate, on the skin and monitored for signs of disease. Neuronal tissue was isolated at time of euthanasia (or death in controls) and assayed for presence of HSV DNA by PCR. Controls included mice that were vaccinated with uninfected VD60 or C7 cell lysates. Disease scores are shown in FIG. 3B and quantification of latent virus in neuronal tissue in FIG.3C. No differences were observed comparing virus grown on VD60 vs C7 cells; virus completely prevented any signs of disease at all three doses and latent vims was only detected in the control vaccinated mice. Note that the dotes line in FIG. 3C indicates lower limit of detection.
[0120] The compositions, methods, and articles can alternatively comprise, consist of, or consist essentially of, any appropriate materials, steps, or components herein disclosed. The compositions, methods, and articles can additionally, or alternatively, be formulated so as to be devoid, or substantially free, of any materials (or species), steps, or components, that are otherwise not necessary to the achievement of the function or objectives of the compositions, methods, and articles.
[0121] All ranges disclosed herein are inclusive of the endpoints, and the endpoints are independently combinable with each other (e.g., ranges of “up to 25 wt.%, or, more specifically, 5 wt.% to 20 wt.%”, is inclusive of the endpoints and all intermediate values of the ranges of “5 wt.% to 25 wt.%,” etc.). “Combinations” is inclusive of blends, mixtures, alloys, reaction products, and the like. The terms “first,” “second,” and the like, do not denote any order, quantity, or importance, but rather are used to distinguish one element from another. The terms “a” and “an” and “the” do not denote a limitation of quantity and are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. “Or” means “and / or” unless clearly stated otherwise. Reference throughout the specification to “some embodiments”, “an embodiment”, and so forth, means that a particular element described in connection with the embodiment is included in at least one embodiment described herein, and may or may not be present in other embodiments. In addition, it is to be understood that the described elements may be combined in any suitable manner in the various embodiments. A “combination thereof’ is open and includes any combination comprising at least one of the listed components or properties optionally together with a like or equivalent component or property not listed.
[0122] Unless defined otherwise, technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which this applicationbelongs. All cited patents, patent applications, and other references are incorporated herein by reference in their entirety. However, if a term in the present application contradicts or conflicts with a term in the incorporated reference, the term from the present application takes precedence over the conflicting term from the incorporated reference.
[0123] While embodiments have been described, alternatives, modifications, variations, improvements, and substantial equivalents that are or may be presently unforeseen may arise to applicants or others skilled in the art. Accordingly, the appended claims as filed and as they may be amended are intended to embrace all such alternatives, modifications variations, improvements, and substantial equivalents.
Claims
CLAIMS1. A genetically modified mammalian cell comprising an expression cassette in the genome thereof, the expression cassette comprising a heterologous gene operably linked to a cytomegalovirus (CMV) immediate early promoter, wherein the mammalian cell is a Vero cell and the heterologous gene encodes herpes simplex virus type 1 (HSV-1) glycoprotein D (gDl).
2. The genetically modified mammalian cell of claim 1, wherein the gDl comprises a sequence identified in SEQ ID NO: 1.
3. The genetically modified mammalian cell of any one of claims 1 or 2, wherein the cassette further comprises a selectable marker.
4. The genetically modified mammalian cell according to Claim 3, wherein the selectable marker is an antibiotic resistance marker.
5. The genetically modified mammalian cell according to Claim 4, wherein the antibiotic resistance marker is aminoglycoside phosphotransferase (APH), hygromycin phosphotransferase (HYG), dihydrofolate reductase (DHFR), thymidine kinase (TK), glutamine synthetase, asparagine synthetase, and genes encoding resistance to neomycin (G418), puromycin, histidinol D, bleomycin and phleomycin, or a combination thereof.
6. The genetically modified mammalian cell according to Claim 4 or 5, wherein the antibiotic resistance marker is neomycin.
7. A cell line comprising the genetically modified cell of any one of Claims 1 to 6.
8. A method of producing a genetically modified mammalian cell comprising an expression cassette inserted in a cell genome, wherein the cassette comprises a heterologous gene operably linked to a CMV immediate early promoter, the method comprising:transfecting a mammalian cell with a DNA sequence comprising the expression cassette; andselecting cells stably transformed with the expression cassette to obtain the genetically modified mammalian cell.
9. The method of Claim 8, wherein the mammalian cell is a Vero cell and wherein the heterologous gene is gDl.
10. The method according to Claim 9, wherein the gDl is identified in SEQ ID NO: 1.
11. The method of any one of Claims 8-10, wherein the expression cassette further comprises a nucleic acid encoding a selectable marker.
12. The method of claim 11, wherein the selectable marker is aminoglycoside phosphotransferase (APH), hygromycin phosphotransferase (HYG), dihydrofolate reductase (DHFR), thymidine kinase (TK), glutamine synthetase, asparagine synthetase, and genes encoding resistance to neomycin (G418), puromycin, histidinol D, bleomycin and phleomycin, or a combination thereof.
13. The method of claim 12, wherein the nucleic acid encoding neomycin is operably linked to a simian virus 40 (SV40) promoter.
14. The method of claim 11, wherein selecting cells stably transformed with the expression cassette is by using G418 resistance.
15. A cell line according to claim 7, wherein the cell line is complementing for production of herpes simplex viruses (HSV) having mutation(s) that result in deletion in the expression of glycoprotein D16. The cell line according to claim 15, wherein the HSV is HSV-1 or HSV-2.
17. The cell line of claim 15 or 16, wherein no reversion of the mutation in the replicated HSV is detected following extended passaging.
18. A method of propagating a single cycle infectious virus comprising a genome having a deletion of an essential gene, the method comprising:providing a transgenic mammalian cell comprising at least one copy of the essential gene inserted in the mammalian cell genome, wherein the essential gene is operably linked to a CMV promoter, and wherein the transgenic mammalian cell expresses a protein encoded by the essential gene;contacting the transgenic mammalian cell with the single cycle infectious virus; andcomplementing the single cycle infectious virus with the protein expressed by the transgenic mammalian cell to propagate the single cycle virus.
19. A method of detecting and / or quantifying infectious virus in a sample, the method comprising:(i) providing transgenic mammalian cells comprising a heterologous nucleic acid stably integrated in the genome of the mammalian cells, wherein the heterologous nucleic acid comprises a CMV promoter operably linked to a reporter gene;(ii) contacting the transgenic mammalian cells with the sample, wherein infectious virus present in the sample transactivates the CMV promoter, inducing expression of the reporter gene in the transgenic mammalian cells; and(iii) quantifying the number of mammalian cells expressing protein encoded by the reporter gene to quantify the infectious virus.
20. A method for producing a genetically modified cell for producing a recombinant protein, the method comprising transfecting a cell with an expression cassette, the expression cassette comprising a nucleic acid encoding the protein operably linked to a CMV promoter, wherein upon contacting the cell with a CMV promoter activating factor, the recombinant protein is produced.
21. The method of claim 20, wherein the cell is a mammalian cell.
22. The method of claim 20 and 21, wherein the CMV promoter activating factor is a virus, tumor necrosis factor (TNF), synthetic DNA analogs CpG oligodeoxynucleotides (CpG-ODs), dimethylsufoxide, 5’ -Aza-2’ -deoxy cytidine, histone deacetylase (HDAC) inhibitor, e.g. OSU-HDAC42, or a combination thereof.
23. The method of any of claims 20 to 22, wherein the activating factor is HSV, adenovirus, lentivirus, rotavirus.
24. The method of any one of claims 20-23, wherein the protein is an antibody, an enzyme, a cytokine, a lymphokine, an adhesion molecule, a receptor and derivatives or fragments thereof, a therapeutic protein, a viral protein, an antigen, an antibody, a human protein.