Ultra-specific single-stranded oligonucleotide probes for differential detection of MPOX clades i and ii in clinical samples

Abstract

Embodiments relate to compositions, methods, and systems for screening and detecting Mpox, specifically Clade Ia Mpox, Clade Ib Mpox, and Clade II Mpox. In particular, embodiments relate to an amplification-free lateral flow assay configured to simultaneously detect the presence of one or more target gene sequences of Clade Ia, Clade Ib, and Clade II. Embodiments may utilize single-stranded oligonucleotides designed specifically to bind in complementary fashion to a target gene sequence of Clade Ia, Clade Ib, or Clade II.

Description

Atty. Ref. No. 0073605-001210ULTRA-SPECIFIC SINGLE-STRANDED OLIGONUCLEOTIDE PROBES FOR DIFFERENTIAL DETECTION OF MPOX CLADES I AND II IN CLINICAL SAMPLESCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 774,310, which was filed on March 19, 2025. The entirety of this application is incorporated by reference herein.INCORPORATION BY REFERENCE STATEMENT REGARDING SEQUENCE LISTINGS

[0002] A Sequence Listing using exXtensible Markup Language (XML) compliant with World Intellectual Property Organization (WIPO) Standard ST.26 is provided herewith and the entirety of this sequence listing is incorporated by reference herein. The Sequence Listing that is incorporated by reference herein is provided via e-filing at the United States Patent and Trademark Office (USPTO) via Patent Center as an XML file, named 0073605-000930. xml (12 KB in size, created on March 17, 2025).FIELD

[0003] Embodiments relate to compositions, methods, and systems for screening and detecting Clade la Mpox, Clade lb Mpox, and Clade II Mpox. In particular, embodiments relate to amplification-free lateral flow-based assays configured to simultaneously detect the presence of one or more target gene sequences of Clade la, Clade lb, and Clade II.BACKGROUND

[0004] Mpox (formerly known as monkeypox virus) garnered global attention in 2022 following a widespread outbreak in non-endemic regions, largely driven by sexual transmission. For overAtty. Ref. No. 0073605-00121050 years, Mpox has caused outbreaks in several African countries, primarily through zoonotic spillover with limited human-to-human spread.

[0005] Mpox is an enveloped, double-stranded DNA virus in the Poxviridae family, which includes variola (smallpox virus, now eradicated), vaccinia (used in smallpox vaccines), and cowpox viruses. In humans, Mpox presents symptoms such as fever, swollen lymph nodes, and a vesiculopapular rash.

[0006] The virus is divided into two clades: Clade I, found mainly in Central Africa (especially the Democratic Republic of the Congo (DRC)), is associated with severe disease and higher mortality (4-11%); Clade II, historically confined to West Africa until the 2022 global outbreak, causes milder illness with a mortality rate below 4%. Historically, Clade I Mpox accounted for 95% of cases. However, a 2017 outbreak of Clade lib in Nigeria marked sustained human-to-human transmission, including sexual contact. This was largely overlooked until the Clade lib B.l lineage triggered a global epidemic in May 2022, resulting in 95,226 confirmed cases across 117 countries by March 2024.

[0007] While Clade II outbreaks have waned, Clade I infections in Central Africa have risen, particularly in remote forested areas, likely due to zoonotic spillover and increased human-to-human transmission. The DRC reported a record 14,626 cases in 2023, signaling a potential shift toward greater human spread. In September 2023, the first Mpox cases were detected in Kamituga Health Zone, a densely populated mining area in South Kivu Province, eastern DRC — a region previously unaffected. This discovery highlights the evolving nature of Mpox and its potential for spreading in new regions. Moreover, the September 2023 outbreak was driven by a highly divergent Clade I virus now designated Clade lb, which revealed a deletion within the C3L gene target sequence.Atty. Ref. No. 0073605-001210SUMMARY

[0008] Traditional diagnostic methods, such as viral culture and serological assays, while valuable, are often time-consuming and labor-intensive. In contrast, molecular diagnostics, particularly nucleic acid-based techniques, have become the standard for viral detection due to their high sensitivity, specificity, and scalability.

[0009] In particular, single-stranded oligonucleotides (ssDNAs) have emerged as promising tools for viral diagnostics. ssDNAs are short, synthetic nucleic acid strands designed to bind specifically to complementary RNA or DNA sequences. Their inherent specificity allows for precise viral detection and differentiation of Mpox clades. This capability is essential for epidemiological surveillance, enabling real-time tracking of viral spread and evolution.

[0010] Several advantages drive the development of ssDNA-based diagnostics for Mpox.Chemically modified ssDNAs exhibit enhanced stability, binding affinity, and resistance to nucleases, ensuring reliable performance in complex biological samples. Their modular design enables multiplexed detection of multiple viral targets, distinguishing Mpox from other orthopoxviruses and co-infecting pathogens. Additionally, ssDNA-based assays can be adapted for point-of-care (POC) use, providing rapid and accurate results critical for timely clinical decision-making and outbreak control. Advances in nucleic acid chemistry, nanotechnology, and biosensing further enhance their potential to bridge the gap between laboratory-based testing and field-deployable solutions.

[0011] Despite these advantages, designing ssDNA-based diagnostics for Mpox presents challenges. The virus’s genetic variability necessitates careful target selection to ensure broad detection capabilities while minimizing assay failure due to mutations. Furthermore, optimizing ssDNA probes requires a deep understanding of the viral genome and the physicochemicalAtty. Ref. No. 0073605-001210properties of oligonucleotides. Advances in bioinformatics and computational modeling have facilitated rational probe design with optimal binding kinetics and specificity. Successfully integrating ssDNAs into user-friendly diagnostic platforms requires interdisciplinary collaboration across molecular biology, materials science, and engineering.

[0012] Accordingly, we developed a multiplexed, ssDNA-based diagnostic lateral flow assay for Mpox detection. The assay platform uses sequence specific antisense oligonucleotides for differential detection of Clades I and II Mpox viral DNA, targeting the Mpox C3L gene for Clade I and TNF alpha for Clade II selectively. The assay platform may also allow for differential detection of Clades la , lb, and II Mpox viral DNA, targeting the Mpox C3L gene for Clade la, the D14L gene for Clade lb, and TNF alpha for Clade II selectively.

[0013] The assay can be integrated into a lateral flow platform for POC detection. Notably, this platform may exhibit exhibits a limit of detection of 100 copies / pL without nucleic acid amplification, which is comparable with the current clinical approaches, and may further differentiate positive from negative samples within 10 minutes of sample addition. Compared to conventional molecular tests, this assay offers advantages such as ease of use, affordability, and portability, making it well-suited for POC applications.

[0014] In an exemplary embodiment, an apparatus for detecting the presence of one or more of Clade la Mpox, Clade lb Mpox, and Clade II Mpox comprises first ssDNAs functionalized with a first small molecule at their first ends, wherein the first ssDNAs have a sequence that is complementary to a first target gene sequence of a first Clade; second ssDNAs functionalized with a second small molecule at their second ends, wherein the second ssDNAs have a sequence that is complementary to a second target gene sequence of the first Clade; third ssDNAs functionalized with a third small molecule at their first ends, wherein the third small molecule isAtty. Ref. No. 0073605-001210the same as the first small molecule, wherein the third ssDNAs have a sequence that is complementary to a first target gene sequence of a second Clade; and fourth ssDNAs functionalized with a fourth small molecule at their second ends, wherein the fourth small molecule is different than the second small molecule, wherein the fourth ssDNAs have a sequence that is complementary to a second target gene sequence of the second Clade.

[0015] In some embodiments, the first and second Clades are two different Clades selected from the group consisting of Clade la, Clade lb, and Clade II.

[0016] In some embodiments, the apparatus further comprises fifth ssDNAs functionalized with a fifth small molecule at their first ends, wherein the fifth small molecule is the same as the first and third small molecules, wherein the fifth ssDNAs have a sequence that is complementary of a first target gene sequence of a third Clade; and sixth ssDNAs functionalized with a sixth small molecule at their second ends, wherein the sixth small molecule is different than the second and fourth small molecules, wherein the sixth ssDNAs have a sequence that is complementary of a second target gene sequence of the third Clade.

[0017] In some embodiments, the first, second, and third Clades are three different Clades selected from the group consisting of Clade la, Clade lb, and Clade II.

[0018] In some embodiments, when the first or second Clade is Clade la, either: the first target gene sequence of Clade la Mpox is CUGCCAAGAUAGCUUCAAAG and the second target gene sequence of Clade la Mpox is UGCCAAGAUAGCUUCAAAGU, or the first target gene sequence of Clade la Mpox is UUAACACUCUGCCAAGAUAG and the second target gene sequence of Clade la Mpox is UAACACUCUGCCAAGAUAGC.

[0019] In some embodiments, when the first or second Clade is Clade lb, either: the first target gene sequence of Clade lb Mpox is GCACUUCGAAAUGGAAAAGA and the second targetAtty. Ref. No. 0073605-001210gene sequence of Clade lb Mpox is CUUCCAAACUUAAUCACUCC, or the first target gene sequence of Clade lb Mpox is CCAAACUUAAUCACUCCUAG and the second target gene sequence of Clade lb Mpox is UCAGGCGCAUAUCCACCCAC.

[0020] In some embodiments, when the first or second Clade is Clade II, either: the first target gene sequence of Clade II Mpox is GGUAACAGGUGGCCAAACUC and the second target gene sequence of Clade II Mpox is GUAACAGGUGGCCAAACUCC, or the first target gene sequence of Clade II Mpox is GAGAAGCAAAUGAUGACUUG and the second target gene sequence of Clade II Mpox is UAUCUCCUCAAGGAAUACAC.

[0021] In some embodiments, the first small molecule and the third small molecule is a small molecule selected from the group consisting of biotin, 6-carboxyfluorescein (6-FAM) , fluorescein isothiocyanate (FITC), and digoxigenin (DIG).

[0022] In some embodiments, the second small molecule and fourth small molecule are two different small molecules selected from the group consisting of biotin, 6-carboxyfluorescein (6-FAM) , fluorescein isothiocyanate (FITC), and digoxigenin (DIG).

[0023] In some embodiments, the apparatus further comprises a testing strip comprising a sample application region, a control region, a first testing region configured to detect the presence of the first Clade, and a second testing region configured to detect the presence of the second Clade, wherein the first and second testing regions are positioned between the sample application region and the control region, and wherein the sample application region is configured to receive a sample, which is configured flow through the testing strip towards the first and second testing regions and the control region.Atty. Ref. No. 0073605-001210

[0024] In some embodiments, the first testing region has first capture compounds immobilized on the testing strip, wherein the first capture compounds are configured to capture the second small molecule of the second ssDNAs.

[0025] In some embodiments, the second testing region has second capture compounds immobilized on the testing strip, wherein the second capture compounds are configured to capture the fourth small molecule of the fourth ssDNAs.

[0026] In some embodiments, the testing strip has nanoparticles configured to flow through the testing strip, wherein some of the nanoparticles are configured to capture the first small molecule of the second ssDNAs, and wherein some of the nanoparticles are configured to capture the third small molecule of the fourth ssDNAs.

[0027] In some embodiments, the nanoparticles are configured to effectuate a color change when reacted and immobilized on the testing strip.

[0028] In some embodiments, the apparatus further comprises positively charged molecules configured to flow through the testing strip, wherein the positively charged molecules are configured to bind to the nanoparticles and augment the color change effectuated by the nanoparticles.

[0029] In some embodiments, the control region has fourth capture compounds immobilized on the testing strip, wherein the fourth capture compounds are configured to capture some of the nanoparticles.

[0030] In some embodiments, the target gene sequences are not amplified.

[0031] In an exemplary embodiment, a method for detecting the presence of one or more of Clade la Mpox, Clade lb Mpox, and Clade II Mpox comprises providing a sample solution comprising a collected sample including nucleic acid from a subject, first ssDNAs functionalizedAtty. Ref. No. 0073605-001210with a first small molecule at their first ends, wherein the first ssDNAs have a sequence that is complementary to a first target gene sequence of a first Clade, second ssDNAs functionalized with a second small molecule at their second ends, wherein the second ssDNAs have a sequence that is complementary to a second target gene sequence of the second Clade, third ssDNAs functionalized with a third small molecule at their first ends, wherein the third small molecule is the same as the first small molecule, wherein the third ssDNAs have a sequence that is complementary to a first target gene sequence of a second Clade, and fourth ssDNAs functionalized with a fourth small molecule at their second ends, wherein the fourth small molecule is different than the second small molecule, wherein the fourth ssDNAs have a sequence that is complementary to a second target gene sequence of the second Clade; providing a testing strip comprising a sample application region, a control region, a first testing region configured to detect the presence of the first respiratory disease, and a second testing region configured to detect the presence of the second respiratory disease, wherein the first and second testing regions are positioned between the sample application region and the control region; and applying the sample solution at the sample application region.

[0032] In some embodiments, the first and second Clades are two different Clades selected from the group consisting of Clade la, Clade lb, and Clade II.

[0033] In some embodiments, the sample solution further comprises fifth ssDNAs functionalized with a fifth small molecule at their first ends, wherein the fifth small molecule is the same as the first and third small molecules, wherein the fifth ssDNAs have a sequence that is complementary of a first target gene sequence of a third Clade; and sixth ssDNAs functionalized with a sixth small molecule at their second ends, wherein the sixth small molecule is different than theAtty. Ref. No. 0073605-001210second and fourth small molecules, wherein the sixth ssDNAs have a sequence that is complementary of a second target gene sequence of the third Clade.

[0034] In some embodiments, the first, second, and third Clades are three different Clades selected from the group consisting of Clade la, Clade lb, and Clade II.

[0035] In some embodiments, when the first or second Clade is Clade la, either: the first target gene sequences of Clade la Mpox is CUGCCAAGAUAGCUUCAAAG and the second target gene sequence of Clade la Mpox is UGCCAAGAUAGCUUCAAAGU, or the first target gene sequence of Clade la Mpox is UUAACACUCUGCCAAGAUAG and the second target gene sequence of Clade la Mpox is UAACACUCUGCCAAGAUAGC.

[0036] In some embodiments, when the first or second Clade is Clade lb, either: the first target gene sequence of Clade lb Mpox is GCACUUCGAAAUGGAAAAGA and the second target gene sequence of Clade lb Mpox is CUUCCAAACUUAAUCACUCC, or the first target gene sequence of Clade lb Mpox is CCAAACUUAAUCACUCCUAG and the second target gene sequence of Clade lb Mpox is UCAGGCGCAUAUCCACCCAC.

[0037] In some embodiments, either the first target gene sequence of Clade II Mpox is GGUAACAGGUGGCCAAACUC and the second target gene sequence of Clade II Mpox is GUAACAGGUGGCCAAACUCC, or the first target gene sequence of Clade II Mpox is GAGAAGCAAAUGAUGACUUG and the second target gene sequence of Clade II Mpox is UAUCUCCUCAAGGAAUACAC.

[0038] In some embodiments, the first testing region has first capture compounds immobilized on the testing strip, wherein the first capture compounds are configured to capture the second small molecule of the second ssDNAs.Atty. Ref. No. 0073605-001210

[0039] In some embodiments, the second testing region has second capture compounds immobilized on the testing strip, wherein the second capture compounds are configured to capture the fourth small molecule of the fourth ssDNAs.

[0040] In some embodiments, the testing strip has nanoparticles configured to flow through the testing strip, wherein some of the nanoparticles are configured to capture the first small molecule of the first ssDNAs, and wherein some of the nanoparticles are configured to capture the third small molecule of the third ssDNAs.

[0041] In some embodiments, the nanoparticles are configured to effectuate a color change when reacted and immobilized on the testing strip.

[0042] In some embodiments, the method further comprises applying positively charged molecules configured to flow through the testing strip, wherein the positively charged molecules are configured to bind to the nanoparticles and augment the color change effectuated by the nanoparticles.

[0043] In some embodiments, the method does not include a step of amplifying the target gene sequences.

[0044] Other details, objects, and advantages of our apparatuses for screening and detecting Mpox, methods for screening and detecting Mpox, and systems for screening and detecting Mpox will become apparent as the following description of certain exemplary embodiments thereof proceeds.BRIEF DESCRIPTION OF THE DRAWINGS

[0045] The above and other objects, aspects, features, advantages, and possible applications of embodiments of the present innovation will be more apparent from the following more particularAtty. Ref. No. 0073605-001210description thereof, presented in conjunction with the following drawings. Like reference numbers used in the drawings may identify like components.

[0046] FIG. 1 is an illustration of an exemplary lateral flow assay system for screening and detecting Clade la Mpox, Clade lb Mpox, and Clade II Mpox. The presence of a first target gene sequence relating to Clade la may be indicated by a test (T 1 ) line, the presence of a second target gene sequence relating to Clade lb may be indicated by a test (T2) line, and the presence of a third target gene sequence relating to Clade II may be indicated by a test (T3) line, along with a control (C) line.

[0047] FIG. 2 is an illustration of the Mpox virus and target gene schematic.

[0048] FIG. 3 is an illustration of an exemplary process for screening and detecting Clade la Mpox, Clade lb Mpox, and Clade II Mpox using a lateral flow assay. The illustration demonstrates that the process and lateral flow assay may be used as an amplification-free point-of-care (POC) test.

[0049] FIG. 4 is an illustration including identified target sequences and complimentary ssDNA sequences for Clades la, lb, and II of Mpox.

[0050] FIG. 5 is a table including identified target sequences and complimentary ssDNA sequences for Clades la, lb, and II of Mpox.

[0051] FIG. 6 is an illustration of various results of an exemplary lateral flow assay system for screening and detecting Clade la Mpox, Clade lb Mpox, and Clade II Mpox.

[0052] FIG. 7 is a schematic illustration of the proteins of Clade la, lb, and II.

[0053] FIG. 8 is a graph showing the target binding energy compared to the energy associated with the disruption of the binding site of Clade la.Atty. Ref. No. 0073605-001210

[0054] FIG. 9 is a graph showing the target binding energy compared to the energy associated with the disruption of the binding site of Clade lb.

[0055] FIG. 10 is a graph showing the target binding energy compared to the energy associated with the disruption of the binding site of Clade II.

[0056] FIG. 11 is an illustration showing ssDNA-AuNP agglomeration with target Mpox DNA.

[0057] FIG. 12 includes (top) transmission electron microscopy (TEM) images showing ssDNA-capped AuNPs before and after adding Mpox target DNA. Initially, the AuNPs were well-dispersed, but aggregation occurred upon target DNA addition across all Clades; (middle) TEM images corresponding to the top row, but with higher resolution; and (bottom) high-angle annular dark-field scanning transmission electron microscopy (HAADF-STEM) images.

[0058] FIG. 13 includes a photograph showing the color change of ssDNA-functionalized AuNPs, and UV-Vis spectra of ssDNA functionalized AuNPs in the presence of Mpox DNA. Dispersed GNP+ ssDNA shows a characteristic SPR peak dispersed without Target Mpox DNA, while hybridization with Clade I or Clade II DNA induces aggregation, causing a shifted SPR band.

[0059] FIG. 14 is a graph showing UV-visible absorbance spectra of as-synthesized AuNPs and AuNPs conjugated with ssDNA sequences at different concentrations.

[0060] FIG. 15 is a graph confirming the stability of AuNPs during the conjugation process using intensity measurements at 520 nm.

[0061] FIG. 16 is a graph showing UV-visible absorbance spectra with different concentrations of the ssDNA.

[0062] FIG. 17 is a gel electrophoresis picture for the ssDNA and AuNP conjugation stability.Atty. Ref. No. 0073605-001210

[0063] FIG. 18 is a graph showing normalized agglomeration intensity for Clade la Mpox DNA (0.25 ng ml1) vs. controls (mean ± SD).

[0064] FIG. 19 includes graphs showing (left) normalized intensity of ssDNA-AuNPs with Mpox DNA (0.25 ng mL ') compared to negative controls (mean ± SD, n = 3), and (right) normalized intensity of ssDNA AuNPs after incubation with Mpox DNA (0.25 ng mL ') at two temperatures.

[0065] FIG. 20 is a graph showing normalized absorbance for Clade la Mpox DNA (0.25 ng mL' vs. controls (mean ± SD).

[0066] FIG. 21 is a SEM characterization of the nano-assembly, (left) SEM images and (right) corresponding EDS maps of the nano-assembly on LFA test strips following exposure to Mpox target DNA (0.25 ng. ml'1) for Clades la, lb, and II.

[0067] FIG. 22 shows SEM EDS images of the nano-assembly. EDS image of the C profile of the surface after the addition of Mpox DNA of Clade la, lb, and II at 0.25 ng. ml'1concentration (left) and before the addition (left-center). O profile of the surface after the addition of Mpox DNA of Clade la, lb, and II at 0.05 ng. ml'1concentration (right-center) and before the addition (right).

[0068] FIG. 23 is a graph showing XPS carbon changes before and after Mpox DNA binding.

[0069] FIG. 24 is a graph showing AuNP peak shifts before and after Mpox DNA binding.

[0070] FIG. 25 includes graphs showing XPS data before and after introducing Mpox DNA to ssDNA-capped AuNPs. Panels (top-left) display carbon, (top-right and bottom-left) the nitrogen component, and (bottom-right) the oxygen component. A and B indicates before and after the incorporation of the target Mpox DNA into the nano assembly.

[0071] FIG. 26 is a table indicating the components of the XPS analysis.Atty. Ref. No. 0073605-001210

[0072] FIG. 27 is an image showing an amplification-free nucleic acid lateral flow assay detecting Mpox Clades la, lb, and II on a single strip.

[0073] FIG. 28 shows strips and normalized signals with strong responses for la / II with no crossreactivity (1: Clade VII; 2: Vaccinia; 3: Chlamydia; 4: SARS-CoV-2).

[0074] FIG. 29 shows dose-response images for la, lb, and II (105— 101copies pL-1).

[0075] FIG. 30 includes graphs showing the analytical limit of detection for gonorrhea using Clade la, lb and II targeted ssDNA conjugated to AuNPs. The assay was tested using the genomic DNA serially diluted 10-fold times with concentrations ranging from 105copies / L to 10 copies / mL. The limit of detection was calculated using the equation 3.3 * (Sy / S) where (Sy) is the standard deviation of the response of the curve and (S) is the slope of the calibration curve. The absorbance measurements were recorded from three (n=3) independent experiments.

[0076] FIG. 31 shows calibration curves for la, lb, and II (105- 101copies pL-1).

[0077] FIG. 32 is a table showing the RT-PCR probe and primers for Clade la, lb, and II, and their PCR amplification conditions.

[0078] FIG. 33 is an image showing clinical testing: A-Ia, B-Ib, D-II; C, control line.

[0079] FIG. 34 is a graph showing the intensity bar chart for the clinical swab samples for the Clade II.

[0080] FIG. 35 is a confusion matrix chart for Mpox clinical swab samples (N=18).

[0081] FIG. 36 is a table showing a clinical swab samples list for the Mpox virus with respective Ct values.

[0082] FIG. 37 is a table showing competing diagnostic devices available on the market for detecting the Mpox virus variant.Atty. Ref. No. 0073605-001210

[0083] FIG. 38 shows the results of a stability test, (left) Images and their corresponding intensity bar chart for the 1, 2, 3, 4, 5 and 6 weeks at 4 °C storing strips, (right) Images and their corresponding intensity bar chart for the 1, 2, 3, 4, 5 and 6 weeks at 4 °C storing strips.

[0084] FIG. 39 shows the results of a stability test, (left) Images and their corresponding intensity bar chart for the 1, 2, 3, 4, 5 and 6 weeks at RT storing strips, (right) Images and their corresponding intensity bar chart for the 1, 2, 3, 4, 5 and 6 weeks at RT storing strips.

[0085] FIG. 40 shows the results of a gold conjugate stability test, specifically (top) images and (bottom) their corresponding intensity bar chart for the 1, 2, 3, 4, 5 and 6 weeks at 4C storing strips.DETAILED DESCRIPTION

[0086] The following description is of exemplary embodiments and methods of use that are presently contemplated for carrying out the present invention. This description is not to be taken in a limiting sense, but is made merely for the purpose of describing the general principles and features of various aspects of the present invention. The scope of the present invention is not limited by this description.

[0087] Embodiments generally relate to compositions, methods, and systems configured to accurately screen and detect Clade la Mpox, Clade lb Mpox, and Clade II Mpox. Exemplary compositions may comprise single-stranded oligonucleotide (ssDNA) probes configured to selectively detect a target gene sequence of Clade la, Clade lb, or Clade II.Lateral Flow Assay

[0088] Embodiments relate to a lateral flow assay system and method configured to receive and analyze a sample to determine if the sample comprises at least one target gene sequence related to at least one of Clade la Mpox, Clade lb Mpox, or Clade II Mpox. The lateral flow assayAtty. Ref. No. 0073605-001210system and method can be used as a point-of-care (POC) test, for example as a rapid lab test, for screening and detection of Mpox.

[0089] As seen in FIG. 1, a lateral flow system 100 may comprise a testing strip 102. The testing strip 102 may comprise a sample application region 104, at least one testing region (e.g., a first testing region 106a, a second testing region 106b, and a third testing region 106c), and a control region 108. A sample collected from a subject, or a solution comprising a sample collected from a subject, may be placed on or at the sample application region 104 and flow through the testing strip 102 (e.g., across the length of the testing strip 102) thereafter. The sample application region 104 may therefore be designated as the beginning of the test strip 102. It is contemplated that the at least one testing region may be positioned in between the sample application region 104 and the control region 108 such that the sample may flow from the sample application region 104, then to the at least one testing region, then to the control region 108.

[0090] In exemplary embodiments, the lateral flow system 100 may further comprise ssDNA probes configured to detect the presence of one, two, or all of Clade la Mpox, Clade lb Mpox, and Clade II Mpox in the sample (see FIGS. 2 and 3). The ssDNA probes are single-stranded DNA sequences designed specifically to bind in complementary fashion to a target gene sequence of Clade la, Clade lb, or Clade II. For example, the ssDNA probes have nucleotide sequences that complement the nucleotide sequence of a target gene (e.g., adenine (A) in an ssDNA sequence may complement and bind to thymine (T) in a target gene sequence, cytosine (C) in an ssDNA sequence may complement and bind to guanine (G) in a target gene sequence, thymine (T) in an ssDNA sequence may complement and bind to adenine (A) in a target gene sequence, and guanine (G) in an ssDNA sequence may complement and bind to cytosine (C) in a target gene sequence).Atty. Ref. No. 0073605-001210

[0091] The ssDNA probes may be functionalized with a moiety at either their first end or their second end such that their first end or their second end may bind to a small molecule. It is contemplated that the first end can be a five prime end (5’ end) and the second end can be a three prime end (3’ end). In some embodiments, the ssDNA probes are functionalized with an amine (-NH2) moiety or a thiol (-SH) moiety at either their first end or their second end, and the amine moiety or thiol moiety may then be used to couple to a small molecule. As the amine and thiol moieties may couple to both the ssDNA probes and the small molecules, when the ssDNA probes bind to their target gene sequences, the small molecules are also necessarily present at the target gene sequences.

[0092] In some embodiments, ssDNA probes may be functionalized at their first ends with first small molecules. In preferred embodiments, the first small molecule may be biotin, 6-carboxyfluorescein (6-FAM) , fluorescein isothiocyanate (FITC), digoxigenin (DIG), or any other suitable small molecule.

[0093] In some embodiments, ssDNA probes may alternatively be functionalized at their second ends with second small molecules. In preferred embodiments, the second small molecules may be biotin, 6-FAM, FITC, DIG, or any other suitable compound.

[0094] In exemplary embodiments, ssDNA probes may be chosen in pairs and may be configured to bind to two closely spaced regions of a target gene sequence. It is contemplated that each ssDNA probe of a pair may be differentially functionalized (e g., the first ssDNA probe functionalized at its first end and the second ssDNA probe functionalized at its second end) such that the functionalized ends of ssDNA probe are in close proximity to each other when the ssDNA probes are bound to their respective regions of the target gene sequence. For example, a first ssDNA probe functionalized at its first end may be complementary to a first region of aAtty. Ref. No. 0073605-001210target gene sequence, and a second ssDNA probe functionalized at its second end may be complementary to a second region of a target gene sequence that is in close proximity to the first region. It is contemplated that ssDNA probe pairs may ensure that the screening and detection will not fail even if one region of a target gene sequence undergoes mutation.

[0095] The ssDNA probes may be designed to target gene sequences that are less prone to mutation and / or antibiotic resistance. For example, ssDNA probes may be designed to target regions that may be conserved and less prone to antibiotic resistance. By targeting conserved regions, ssDNA probes may be used universally for diagnostic purposes, ensuring consistent and reliable results regardless of genetic variations among strains.

[0096] In some embodiments, the system may comprise multiple ssDNA probe pairs configured to complement and bind to multiple regions of a single target gene sequence. An advantage of using multiple ssDNA probe pairs is to ensure recognition of at least one region of the target gene sequence even if other regions of the target gene sequence undergo or are subject to mutations.

[0097] The system may comprise any number of ssDNA probe pairs. The system may comprise at least a first ssDNA probe pair configured to complement and bind to a first target gene sequence, a second ssDNA probe pair configured to complement and bind to a second target gene sequence, a third ssDNA probe pair configured to complement and bind to a third target gene sequence, a fourth ssDNA probe pair configured to complement and bind to a fourth target gene sequence, etc.

[0098] In some embodiments, the different target gene sequences may correspond to different gene sequences of the same Mpox clade. For example, the first target gene sequence may correspond to a first sequence of Mpox Clade la (or Clade Ib / Clade II), the second target geneAtty. Ref. No. 0073605-001210sequence may correspond to a second sequence of Mpox Clade la (or Clade Ib / Clade II), the third target gene sequence may correspond to a third sequence of Mpox Clade la (or Clade Ib / Clade II), the fourth target gene sequence may correspond to a fourth sequence of Mpox Clade la (or Clade Ib / Clade II), etc.

[0099] In other embodiments, the different target gene sequences may correspond to gene sequences of different Mpox clades. For example, the first target gene sequence may correspond to a first sequence of Mpox Clade la, the second target gene sequence may correspond to a second sequence of Mpox Clade la, the third target gene sequence may correspond to a first sequence of Mpox Clade lb, the fourth target gene sequence may correspond to a second sequence of Mpox Clade lb, the fifth target gene sequence may correspond to a first sequence of Mpox Clade II, the sixth target gene sequence may correspond to a second sequence of Mpox Clade II, etc. Accordingly, a single system may be used for screening and detection of one, two, or all of Clade la, Clade lb, and Clade II.

[0100] In some embodiments, the system is configured to detect the presence of one or both of two predetermined Clades. For example, the system may be configured to detect one or both of Clade la and Clade II, one or both of Clade la and lb, or one or both of Clade lb and II. In some embodiments, the system is configured to detect the presence of one, both, or all of three different Clades. For example, the system may be configured to detect one, both, or all of Clade la, Clade lb, and Clade II. Examples of such systems can be configured so that the detection of multiple Clades can be detected via the same detection mechanism having different probe pairs. For example, some embodiments can be configured to detect Clade la and / or Clade lb and / or Clade II via a single platform having multiple probe pairs.Atty. Ref. No. 0073605-001210

[0101] ssDNA probes configured to detect different clades may have unique second small molecules. For example, ssDNA probes configured to detect Mpox Clade la may have a different second small molecule than the second small molecules of ssDNA probes configured to detect Mpox Clade lb and Mpox Clade II, ssDNA probes configured to detect Mpox Clade lb may have a different second small molecule than the second small molecules of ssDNA probes configured to detect Mpox Clade la and Mpox Clade II, and ssDNA probes configured to detect Mpox Clade II may have a different second small molecule than the second small molecules of ssDNA probes configured to detect Mpox Clade la and Mpox Clade lb.

[0102] However, ssDNA probes configured to detect different clades may have the same first small molecules. For example, ssDNA probes configured to detect Mpox Clade la may have the same first small molecules as the first small molecules of ssDNA probes configured to detect Mpox Clade lb and Mpox Clade II, ssDNA probes configured to detect Mpox Clade lb may have the same first small molecules as the first small molecules of ssDNA probes configured to detect Mpox Clade la and Mpox Clade II, and ssDNA probes configured to detect Mpox Clade II may have the same first small molecules as the first small molecules of ssDNA probes configured to detect Mpox Clade la and Mpox Clade lb.

[0103] Exemplary methods and systems for screening and detecting Mpox may comprise collecting a sample (e.g., a DNA sample) from a subject. It is contemplated that the sample may be collected using any suitable means, including but not limited to, an oral swab, a nasal swab, a cervical swab, a blood collecting swab, urine collection, or any other suitable means for collecting nucleic acid from the subject. It is further contemplated that the sample may be collected using any suitable instrument, including but not limited to, a cotton swab or any other suitable instrument for collecting nucleic acid from the subject.Atty. Ref. No. 0073605-001210

[0104] The collected sample may then be introduced to a sensing solution to form an aqueous mixture. The sensing solution may comprise a plurality of ssDNA probe pairs (e.g., targeting a plurality of different gene sequences, as described above). For example, the sensing solution may comprise a first ssDNA probe pair configured to target a first target gene sequence corresponding to Mpox Clade la, a second ssDNA probe pair configured to target a second target gene sequence corresponding to Mpox Clade lb, a third ssDNA probe pair configured to target a third target gene sequence corresponding to Mpox Clade II, etc. It is contemplated that the first ssDNA probe pair, the second ssDNA probe pair, the third ssDNA probe pair, etc. may have the same first small molecules but have unique / different second small molecules.

[0105] In embodiments wherein the sensing solution comprises at least a first ssDNA probe pair configured to target a first target gene sequence corresponding to Mpox Clade la, at least a second ssDNA probe pair configured to target a second target gene sequence corresponding to Mpox Clade lb, and at least a third ssDNA probe pair configured to target a third target gene sequence corresponding to Mpox Clade II, when the collected sample comprises a first target gene sequence corresponding to Mpox Clade I, the first ssDNA probe pair may bind to the complementary gene sequence. Similarly, when the collected sample comprises a second target gene sequence corresponding to Mpox Clade lb, the second ssDNA probe pair may bind to the complementary gene sequence. Similarly, when the collected sample comprises a third target gene sequence corresponding to Mpox Clade II, the third ssDNA probe pair may bind to the gene sequence. However, when the collected sample does not comprise any of the target gene sequences, the ssDNA probes may not bind to the nucleic acid of the sample.

[0106] In some embodiments, the sensing solution may further comprise a nucleic acid extraction buffer configured to extract nucleic acids from the collected sample. In alternativeAtty. Ref. No. 0073605-001210embodiments, nucleic acids may not be extracted from the collected sample prior to detection of a target gene sequence. Extraction of nucleic acid and amplification of nucleic acid may be performed but are not requirements for using the lateral flow system, thus allowing sensing of a target gene sequence directly from the collected sample.

[0107] In some embodiments, the aqueous mixture may be incubated prior to application to the testing strip 102. Incubation may include maintaining the aqueous mixture for a period of time under predetermined conditions. For example, the aqueous mixture may be incubated for at least 5 minutes at or near a predetermined temperature, such as room temperature, 37°C, etc.

[0108] In some embodiments, nanoparticles may be added to the sensing solution and / or aqueous mixture. The nanoparticles may be functionalized with a compound (e.g., streptavidin) configured to bind to the first small molecules (e.g., biotin) of the ssDNA probe pairs.

[0109] After formation of the aqueous mixture, the aqueous mixture may be placed at or near the sample application region 104. The aqueous mixture may then flow via capillary action through the test strip 102 in a flow direction and towards the testing regions 106a, 106b, 106c and control region 108. The speed of the flow may be affected by a number of factors, such as the types, quality and size of the flow strip used.

[0110] In exemplary embodiments, the system may optionally comprise an augmentation solution configured to be placed at or near the sample application region 104 with or after application of the aqueous mixture. The augmentation solution may include positively charged molecules configured to augment a signal produced by the ssDNA probes such that test results may be more clearly seen by a user. The positively charged molecules may be cationic nanoparticles selected from the group consisting of cysteine capped plasmonic (e.g., gold) nanoparticles, cysteamine capped plasmonic (e.g., gold) nanoparticles, and tris (2-Atty. Ref. No. 0073605-001210aminoethyl)amine capped plasmonic (e.g., gold) nanoparticles, or may be cationic small molecules (e.g., methylene blue). The augmentation solution and positively charged molecules are described in further detail below.

[0111] The first testing region 106a may correspond to a first Clade (e.g., Clade la) and may comprise first capture compounds, such as first capture antibodies (e.g., anti-FITC, anti-DIG, etc ). The first capture compounds may be immobilized at the first testing region 106a such that the first capture compounds may not flow with the aqueous mixture as it flows through the testing strip 102. The first capture compounds are configured to capture the second small molecules of the first ssDNA probe pair corresponding to a first Clade. Accordingly, in embodiments wherein the mixture has target gene sequences corresponding to a first Clade and ssDNA probes coupled to the target gene sequences, the first capture compounds may bind to the ssDNA probes, thereby immobilizing the ssDNA probes at the first testing region 106a.

[0112] The second testing region 106b may correspond to a second Clade (e.g., Clade lb) and may comprise second capture compounds, such as second capture antibodies (e.g., anti-FITC, anti-DIG, etc.). The second capture compounds may be immobilized at the second testing region 106b such that the second capture compounds may not flow with the aqueous mixture as it flows through the testing strip 102. The second capture compounds are configured to capture the second small molecules of the second ssDNA probe pair corresponding to a second Clade. Accordingly, in embodiments wherein the mixture has target gene sequences corresponding to a second Clade and ssDNA probes coupled to the target gene sequences, the first capture compounds may bind to the ssDNA probes, thereby immobilizing the ssDNA probes at the second testing region 106c.Atty. Ref. No. 0073605-001210

[0113] The third testing region 106c may correspond to a third Clade (e.g., Clade II) and may comprise third capture compounds, such as third capture antibodies (e.g., anti-FITC, anti-DIG, etc.). The third capture compounds may be immobilized at the third testing region 106c such that the third capture compounds may not flow with the aqueous mixture as it flows through the testing strip 102. The third capture compounds are configured to capture the second small molecules of the third ssDNA probe pair corresponding to a third Clade. Accordingly, in embodiments wherein the aqueous mixture has target gene sequences corresponding to a third Clade and ssDNA probes coupled to the target gene sequences, the third capture compounds may bind to the ssDNA probes, thereby immobilizing the ssDNA probes at the third testing region 106c.

[0114] As ssDNA probe pairs may have unique / different second small molecules and the testing regions may have different capture compounds corresponding to different second small molecules, the testing regions may accurately correspond to different clades. For example, in embodiments with two testing regions, the first ssDNA probe pair and the second ssDNA pair have unique / different second small molecules and the first and second testing regions 106a, 106b have different capture compounds corresponding to the different second small molecules, such that the first and second testing regions 106a, 106b may accurately correspond to different respiratory diseases. As another example, in embodiments with three testing regions, the first ssDNA probe pair, the second ssDNA pair, and the third ssDNA pair may each have unique / different second small molecules and the first, second, and third testing regions 106a, 106b, 106c have different capture compounds corresponding to the different second small molecules, such that the first, second, and third testing regions 106a, 106b, 106c may accurately correspond to different respiratory diseases.Atty. Ref. No. 0073605-001210

[0115] The testing strip 102 may further comprise nanoparticles temporarily immobilized on the testing strip 102. The nanoparticles may only mobilize / flow as the aqueous mixture flows through the testing strip 102. For example, the nanoparticles may be dehydrated on the testing strip 102 and may only mobilize / flow after being rehydrated by the aqueous mixture. In other embodiments, as previously described, nanoparticles may be added to the sensing solution and / or aqueous mixture prior to applying the solution to the testing strip.

[0116] The nanoparticles may be configured to couple to the first small molecules of the ssDNA probe pairs. As the ssDNA probes may be immobilized by the first capture compounds at the first testing region 106a and / or by the second capture compounds at the second testing region 106b and / or by the third capture compounds at the third testing region 106c, it is contemplated that at least some of the nanoparticles may also be immobilized at the first testing region 106a and / or the second testing region 106b and / or the third testing region 106c as the nanoparticles flow through the test strip. It is further contemplated that at least some of the nanoparticles may not bind to the ssDNA probes and flow with the aqueous mixture as it flows through the testing strip 102 past the testing regions 106a and / or 106b and / or 106c (e.g., towards the control region 108). In embodiments wherein the aqueous mixture does not have target gene sequences, the nanoparticles may flow freely with the aqueous mixture as it flows through the testing strip 102 past the testing regions 106a and / or 106b and / or 106c (e.g., towards the control region 108).

[0117] The nanoparticles may further be configured to effectuate a color change when reacted and immobilized at a region. In some embodiments, when the nanoparticles are immobilized at the first testing region 106a due to the presence of a first target gene sequence in the sample, the nanoparticles may effectuate a color change at the first testing region 106a. In some embodiments, the color change may appear as a visible line or mark at the first testingAtty. Ref. No. 0073605-001210region 106a. It is therefore contemplated that the presence of a line or mark at the first testing region 106a signals the presence of a first Clade. However, no line or mark at the first testing region 106a signals the absence of the first Clade in the sample. Similarly, when the nanoparticles are immobilized at the second testing region 106b due to the presence of a second target gene sequence in the sample, the nanoparticles may effectuate a color change at the second testing region 106b. In some embodiments, the color change may appear as a visible line or mark at the second testing region 106b. It is therefore contemplated that the presence of a line or mark at the second testing region 106b signals the presence of a second Clade. However, no line or mark at the second testing region 106b signals the absence of the second Clade in the sample. Similarly, when the nanoparticles are immobilized at the third testing region 106c due to the presence of a third target gene sequence in the sample, the nanoparticles may effectuate a color change at the third testing region 106c. In some embodiments, the color change may appear as a visible line or mark at the third testing region 106c. It is therefore contemplated that the presence of a line or mark at the third testing region 106c signals the presence of a third Clade. However, no line or mark at the third testing region 106c signals the absence of the third Clade in the sample.

[0118] In preferred embodiments, the nanoparticles are streptavidin capped plasm onic (e.g., gold) nanoparticles configured to couple to a small molecules, such as biotin, or any other suitable nanoparticles.

[0119] The control region 108 may comprise fourth capture compounds, such as fourth capture antibodies. The fourth capture compounds may be immobilized at the control region 108 such that the fourth capture compounds may not flow with the aqueous mixture as it flows through the testing strip 102. The fourth capture compounds are configured to capture theAtty. Ref. No. 0073605-001210nanoparticles flowing through the testing strip 102. As described above, in embodiments wherein the aqueous mixture has target gene sequences and ssDNA probes coupled to the target gene sequences, at least some of the nanoparticles may nevertheless not bind to the ssDNA probes and may flow with the aqueous mixture as it flows through the testing strip 102 past the testing regions 106a and / or 106b and / or 106c. These remaining nanoparticles may be captured by the fourth capture compounds and immobilized at the control region 108. Similarly, in embodiments wherein the aqueous mixture does not have any target gene sequences, the fourth capture compounds may flow freely with the aqueous mixture as it flows through the testing strip 102 and may be captured by the fourth capture compounds and immobilized at the control region 108.

[0120] It is contemplated that the fourth capture compounds may include the first small molecules functionalized on the ssDNA probes.

[0121] As the nanoparticles may be configured to effectuate a color change when reacted and immobilized at a region, when the nanoparticles are immobilized at the control region 108, the nanoparticles may effectuate a color change at the control region 108. In some embodiments, the color change may appear as a visible line or mark at the control region 108. It is contemplated that all proper tests and samples should result in a line or mark at the control region 108, such that the control region 108 ensures the system 100 is working properly.

[0122] As seen in FIG. 6, a negative test (e.g., a sample without Clade la, Clade lb, and / or Clade II) may result in a line or mark only at the control region. As seen in FIG. 1, the control region 108 may be designated by a “C ” A test positive for Clade la but negative for Clade lb and Clade II may result in a line or mark at the first testing region and a line of mark at the control region. As seen in FIG. 1, the first testing region 106a may be designated by a “Tl.”Atty. Ref. No. 0073605-001210A test positive for Clade lb but negative for Clade la and Clade II may result in a line or mark at the second testing region and a line of mark at the control 108. As seen in FIG. 1, the second testing region 106b may be designated by a “T2.” A test positive for Clade II but negative for Clade la and Clade lb may result in a line or mark at the third testing region and a line of mark at the control region . As seen in FIG. 1, the third testing region 106c may be designated by a “T3 ” A test positive for each of Clade la, Clade lb, and Clade II may result in a line or mark at the first testing region, a line or mark at the second testing region, a line or mark at the third testing region, and a line of mark at the control region.

[0123] As can be appreciated by the above, the lateral flow system 100 may be configured to detect the presence of one, two, or all of Clade la, Clade lb, and Clade II in a collected sample. The lateral flow system 100 may therefore serve as a one step, simultaneous detection method for Mpox in a POC setting.

[0124] As there is an ongoing and immediate need to develop approaches that are low-cost, rapid, do not require the use of advanced equipment, and can be used as a screening tool for the diagnosis of Mpox at POC, it is contemplated that embodiments described herein may provide one or more advantages over currently available screening and detecting techniques. For example, embodiments described herein: (i) do not need prior nucleic acid extraction; (ii) do not demand the use of advanced equipment (e.g., centrifuge, thermocycler, etc.); (iii) do not use conventional pH sensitive dyes; and / or (iv) has a short turnaround time. In some embodiments, the presently described system provides for rapid turnaround time for detection of Mpox.

[0125] The detection of Mpox may be performed within about 5, 10, 15, 20, 25, or 30 minutes. In one embodiment, detection may be completed within about 10 minutes of applying a sample to a testing strip.Atty. Ref. No. 0073605-001210

[0126] In some embodiments, the system is capable of achieving limits of detection for Clades la, lb, and II as low as 103copies pl'1.

[0127] The system is further capable of achieving high specificity for Clades la, lb, and II with minimal or no cross-interference from other bacterial species.Design of ssDNAs

[0128] Embodiments may be configured to detect one or more Clades of Mpox, including one, two, or all of Clade la Mpox, Clade lb Mpox, and Clade II Mpox. In particular, embodiments of the lateral flow assay may utilize ssDNAs to detect the presence of one or more Clades in a sample. The ssDNAs are each designed specifically to bind in complementary fashion to a target gene sequence of a Clade.

[0129] In exemplary embodiments, the ssDNAs preferably have a GC content between 40-60%. The ssDNAs also preferably have no tetraplexes (e.g., GGGG runs), as a sequence containing either single GGGG runs or repeated GG or GGG runs in close proximity may form intra-strand tetraplexes. Additionally, ssDNAs preferably have a probability threshold above 0.5 and / or a binding energy cutoff of less than or equal to 8 kcal / mol.

[0130] To detect Clade la, at least one target gene sequence correlating to Clade la must first be identified such that ssDNAs can be designed to complement and bind to the sequence. In some embodiments, a target gene sequence correlating to Clade la may be chosen from SEQ ID NO 1 (CUGCCAAGAUAGCUUCAAAG), SEQ ID NO 2 (UGCCAAGAUAGCUUCAAAGU), SEQ ID NO 3 (UUAACACUCUGCCAAGAUAG), SEQ ID NO 4 (UAACACUCUGCCAAGAUAGC). SEQ ID NO 1 and SEQ ID NO 2 represent two closely spaced apart regions of a target sequence, and SEQ ID NO 3 and SEQ ID NO 4 represent two closely spaced apart regions of a target sequence (see FIGS. 4 and 5).Atty. Ref. No. 0073605-001210

[0131] It is contemplated that these sequences may correlate to the C3L gene. Although the genomes of Clade la, Clade lb, and Clade II Mpox viruses are highly conserved, significant sequence variations exist in the terminal regions of their genomes, these differences are particularly pronounced in genes such as the TNF receptor gene, located in the terminal inverted repeat (ITR) region. Notably, Clades la and Clade lb lack the TNF receptor gene, and Clade lb lacks the C3L gene, making the complement-binding protein C3L gene a unique marker for Clade la-specific assay development.

[0132] ssDNAs may then be designed to bind in complementary fashion to target gene sequences of Clade la. In some embodiments, ssDNAs may have sequences chosen from a sequence complementary to and configured to bind to SEQ ID NO 1, a sequence complementary to and configured to bind to SEQ ID NO 2, a sequence complementary to and configured to bind to SEQ ID NO 3, and a sequence complementary to and configured to bind to SEQ ID NO 4.

[0133] To detect Clade lb, at least one target gene sequence correlating to Clade lb must first be identified such that ssDNAs can be designed to complement and bind to the sequence. In some embodiments, a target gene sequence correlating to Clade lb may be chosen from SEQ ID NO 5 (GCACUUCGAAAUGGAAAAGA), SEQ ID NO 6 (CUUCCAAACUUAAUCACUCC), SEQ ID NO 7 (CCAAACUUAAUCACUCCUAG), SEQ ID NO 8 (UCAGGCGCAUAUCCACCCAC). SEQ ID NO 5 and SEQ ID NO 6 represent two closely spaced apart regions of a target sequence, and SEQ ID NO 7 and SEQ ID NO 8 represent two closely spaced apart regions of a target sequence (see FIGS. 4 and 5).

[0134] It is contemplated that these sequences may correlate to the D14L gene.

[0135] ssDNAs may then be designed to bind in complementary fashion to target gene sequences of Clade lb. In some embodiments, ssDNAs may have sequences chosen from aAtty. Ref. No. 0073605-001210sequence complementary to and configured to bind to SEQ ID NO 5, a sequence complementary to and configured to bind to SEQ ID NO 6, a sequence complementary to and configured to bind to SEQ ID NO 7, and a sequence complementary to and configured to bind to SEQ ID NO 8.

[0136] To detect Clade II, at least one target gene sequence correlating to Clade II must first be identified such that ssDNAs can be designed to complement and bind to the sequence. In some embodiments, a target gene sequence correlating to Clade II may be chosen from SEQ ID NO 9 (GGUAACAGGUGGCCAAACUC), SEQ ID NO 10 (GUAACAGGUGGCCAAACUCC), SEQ ID NO 11 (GAGA AGC A A AUGAUGACUUG), SEQ ID NO 12 (UAUCUCCUCAAGGAAUACAC). SEQ ID NO 9 and SEQ ID NO 10 represent two closely spaced apart regions of a target sequence, and SEQ ID NO 11 and SEQ ID NO 12 represent two closely spaced apart regions of a target sequence (see FIGS. 4 and 5).

[0137] It is contemplated that these sequences may correlate to the TNF receptor gene. As noted above, although the genomes of Clade la, Clade lb and Clade II Mpox viruses are highly conserved, significant sequence variations exist in the terminal regions of their genomes. These differences are particularly pronounced in genes such as the TNF receptor gene, located in the terminal inverted repeat (ITR) region.

[0138] ssDNAs may then be designed to bind in complementary fashion to target gene sequences of Clade II. In some embodiments, ssDNAs may have sequences chosen from a sequence complementary to and configured to bind to SEQ ID NO 9, a sequence complementary to and configured to bind to SEQ ID NO 10, a sequence complementary to and configured to bind to SEQ ID NO 11, and a sequence complementary to and configured to bind to SEQ ID NO 12.EXAMPLEAtty. Ref. No. 0073605-001210

[0139] Below are examples of specific embodiments for carrying out the present invention. The examples are offered for illustrative purposes only and are not intended to limit the scope of the present invention in any way. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), but some experimental error and deviation should, of course, be allowed for.

[0140] Materials: All the chemicals were purchased from commercial vendors. Custom-made oligonucleotides (ssDNAs) with biotin and FAM / DIG for the LFIA and RT-PCR primers and reagents were bought from Sigma-Aldrich (Saint Louis, MO). A viral Swab DNA isolation kit was ordered from Sigma-Aldrich (Saint Louis, MO).

[0141] Mpox Lesion Swab Samples for LFA Strip Validation: Lesion swab specimens were purchased from Boca Biolistics, LLC. Control genomic DNA for Mpox Clade I and Clade II from Twist Bioscience (San Francisco, CA 94080), and the isolated DNA for Clade la from the Centers for Disease Control and Prevention (CDC; Atlanta, GA, USA) repository under a Material Transfer Agreement (MTA). For Clade la, a CDC validated DNA sample originally isolated from a clinical specimen (stock concentration 105copies / pL) was obtained through authorized sources. This DNA was serially diluted in nuclease-free water, and its concentration was independently verified by quantitative PCR prior to use in the lateral flow assay. Due to biosafety level-3 (BSL-3) requirements and regulatory restrictions, no clinical samples for Clade lb were accessible. Therefore, sequence-verified synthetic DNA corresponding to the Mpox D14L gene (Clade lb) was designed based on reference genomic sequences and procured from Twist Bioscience. All synthetic targets were resuspended in nuclease-free water and stored at -20°C until use. All experiments involving clinical derived DNA were conducted in accordance with institutional biosafety guidelines and applicable regulatory approvals.Atty. Ref. No. 0073605-001210

[0142] Preparation of Citrate-Stabilized Gold Nanoparticles (AuNPs): Gold nanoparticles (AuNPs) were synthesized using a literature protocol. Briefly, 1 mM chloroauric acid (20 mL) was boiled while stirring, followed by adding one percent of sodium citrate solution. After the addition, the solution turned from yellow to red. At this point, stop boiling and allow it to cool for 10 minutes in a shaded area. The red wine solution of the AuNPs was centrifuged and resuspended in Milli-Q water.

[0143] Design of Single-Stranded Oligonucleotides (ssDNA): Mpox virus genome sequences were analyzed to design ssDNAs for Clades la, lb, and II using S. Oligo software. Selected ssDNAs sequences were functionalized with thiol moi eties at the 5’ or 3’ end for enhanced agglomeration with gold nanoparticles for the UV-vis Spectroscopy studies.

[0144] Functionalization of AuNPs with ssDNA: Citrate-stabilized AuNPs (2 mL) were treated with ssDNAs (0.25-2 pM) and 0.5 mM TCEP, stirred for 2 hours, and kept at 4°C for further use.

[0145] Limit of Detection (LOD) Calculation: Control genomic DNA for Clades la, lb, and II was titrated in nanocomposite suspensions. The intensity change was measured using an ESI Quant Instrument, and LOD was determined using the formula LOD = 3.3 (Sy / S). Mpox DNA standards (105and 101copies / pL) were prepared in nuclease-free buffer. LFIA test strips were fabricated in-house and consisted of a sample pad, conjugate pad, nitrocellulose membrane with immobilized test and control antibodies, and an absorbent pad. Gold nanoparticle-antibody conjugates were prepared and subsequently lyophilized for reagent-stability assessments. All buffers and consumables were of analytical grade.Atty. Ref. No. 0073605-001210

[0146] Cross-Reactivity Assessment: Selectivity was tested by introducing 0.25 ng. ml / 1of genomic DNA obtained from SARS-CoV-2, Neisseria gonorrhoeae, and Chlamydia trachomatis into the nanocomposite formulation.

[0147] RT-PCR Protocol: The RT-PCR was performed according to the CDC guidelines. In summary, 0.25 pl of each 10 pM forward primer and 0.25 pl of each 10 pM reverse primer, 1 pl of a 10 pM Probe, 5 pl of isolated or extracted DNA, 10 pl of Taq 2 x master mix, and 4.5 pl of DI water were combined in a PCR 96-well plate. A quick spin was applied following a gentle mix to ensure all liquids were at the bottom of the tube. The PCR plate was sealed and placed in an Applied Biosystems™ MiniAmp™ Thermal Cycler, which had been preheated to 95°C. The specified thermocycling parameters were utilized to amplify the DNA: the resulting amplified products were stored at 4°C until further use.

[0148] Determination of Cross-Reactivity: To determine the selectivity of the optimized oligonucleotide strands (1st ssDNA and 2nd ssDNA) were mixed in 10 pM concentration with the AuNps, and then the nanocomposite formulation was added to the genomic Mpox DNA at the concentration of 0.25 ng mL1to test against the other pathogenic DNA at the same concentration, Chlamydia trachomatis, Neisseria gonorrhoeae bacteria, and RNA from the SARS-CoV-2 virus. The change in absorbance at 540 nm was observed with the use of UV-Vis spectroscopy.

[0149] Transmission Electron Microscopy: Twenty microliters of each suspension of the nanocomposite were applied to a formvar-coated copper grid. After ten minutes, the surplus solution was wiped off the grid and air dried. Transmission electron microscopy (TEM) data was acquired from Thermo Scientific Talos F200X G2 (S)TEM operating at 200 kV. Furthermore, STEM-EDS mapping was performed on this equipment utilizing the four in-column SDD Super-Atty. Ref. No. 0073605-001210X detectors. EDS maps were recorded for approximately five minutes at a beam current of 0.12 nA and analyzed using Thermo Scientific Velox software.

[0150] Scanning Electron Microscopy: The nanocomposites before and after the addition of genomic DNA from the monkeypox virus samples were mounted on SEM stubs using doublesided carbon tape, air-dried, and then sputter-coated with an 80:20 platinum / palladium alloy to enhance conductivity. Surface topography was examined using a FEI Nova NanoSEM 450 fieldemission scanning electron microscope (FE-SEM). High-resolution images were captured for each sample, and corresponding energy dispersive X-ray spectroscopy (EDS) spectra were acquired to assess elemental composition.

[0151] X-ray photoelectron spectroscopy: (XPS) analyses were performed using a Physical Electronics Versa Probe III system, equipped with a monochromatic Al Ka X-ray source (hv = 1,486.6 eV) and a concentric hemispherical analyzer. Charge neutralization was facilitated by a dual-beam system employing low-energy electrons (<5 eV) and argon ions. The binding energy scale was calibrated using reference standards: gold (Au 4f? / 2 = 83.96 eV) and sputter-cleaned copper (Cu 2p3 / 2 = 932.62 eV, Cu 3p3 / 2= 75.1 eV). All binding energies were referenced to the C is hydrocarbon peak (CHX) set at 284.8 eV. Spectra were acquired at a 45° takeoff angle concerning the sample surface, providing a sampling depth of approximately 3-6 nm, from which 95% of the signal originates. Quantification was conducted using instrument-provided relative sensitivity factors (RSFs), incorporating corrections for photoionization crosssections and the inelastic mean free path of electrons. For homogeneous samples, the standard deviation for major elemental concentrations (>5 at. %) was typically below 3%, while greater variability was observed for trace elements. The analysis area was approximately 200 pm in diameter.Atty. Ref. No. 0073605-001210

[0152] UV-vis Spectroscopy: For absorbance measurements, 10 pL of target DNA samples (0.25 ng / mL) were mixed with 150 pL of AuNPs functionalized with ssDNA sequences la+lb and 2a+2b for Clade la, 3a+3b and 4a+4b for Clade II, and 5a+5b and 6a+6b for Clade lb. The concentration of Mpox DNA was determined using aNanoDrop. Absorbance readings were recorded in 96-well plates using a Biotek Synergy Microplate Reader for both kinetic and spectral analysis. Each experiment was conducted at least three times, and the average spectra was reported. The normalized data were used to compare and standardize assay parameters independent of experimental conditions.

[0153] Preparation of the Multiplex Lateral Flow Assay Strips (in-house): The lateral flow assay (LFA) strip consisted of four sequentially assembled membranes with partial overlaps: a sample pad, a conjugate pad, a nitrocellulose (NC) membrane, and an absorbent pad. The sample pad was pretreated with lx PBS containing 0.5% BSA, 0.15% Tween-20, and 1% sucrose, then dried at room temperature for 1 hour. The conjugate pad was treated with 100 mM phosphate buffer (PB, pH 7.4) containing 0.1% Triton X-100, 0.1% BSA, 20% sucrose, and 5% HAMA blocker. On the NC membrane, the test lines were dispensed at 1 pL / cm using 0.5 mg / mL of antibodies: Anti-FITC antibody for Tl, Anti-DIG antibody for T2, and Biotin-BSA for the control line. The spacing between the test and control lines was maintained at 3.5 mm, defining the reaction zone. The NC membrane was 25 mm long, with Tl positioned 10 mm from the sample application end, T2 located 3.5 mm downstream, and the control line 3.5 mm beyond T2. An additional 10 mm space was kept after the control line to avoid cross-signaling from backflow. Finally, the sample, conjugate, NC, and absorbent pads were assembled with a 2 mm overlap, cut into 4 mm-wide strips, and stored in a desiccator until use. The antibody dispensing on the NC membrane was performed using the Claremont dispenser.Atty. Ref. No. 0073605-001210

[0154] Preparation of the ASOs for the development of the Lateral flow assay: The antisense single-stranded DNA (ASO-ssDNA) was incubated with RecA protein (New England Biolabs) at a molar ratio of 3 : 1 (bases to protein) in the presence of 1 mM ATPyS (Sigma Aldrich), 10 U / mL pyruvate kinase, 3 mM phosphoenolpyruvate (PEP), and single stranded binding protein (SSB; Abeam). All reagents were prepared in RecA reaction buffer consisting of 70 mM Tris-HCl, 10 mM MgCE, and 5 mM dithiothreitol (DTT), pH 7.6. The reaction mixture was incubated at 37°C for 10 minutes to allow RecA to form a stable nucleoprotein filament along the ssDNA. Subsequently, 10 pM of Mpox double stranded DNA (dsDNA) was introduced to the reaction to facilitate strand invasion and hybridization, and the mixture was maintained at 37°C for an additional 15 minutes. This process enabled RecA-mediated unwinding of the dsDNA and promoted the exposure of complementary single-stranded regions for efficient hybridization. Following this reaction, the mixture was immediately transferred to ice for 2 minutes to halt RecA activity and stabilize the newly formed DNA complexes, thereby preventing any nonspecific reannealing. To the cooled mixture, 2 pL of each 10 pM oligonucleotide was added to obtain a final 1 x working concentration. These oligonucleotides were specifically designed to hybridize with target sequences within the Mpox genome, ensuring sequence-selective recognition during subsequent hybridization. A 1 x SSC buffer was freshly prepared by diluting 5 mL of 20x SSC stock with 95 mL of deionized water. This buffer provided the necessary ionic strength and pH conditions to support stable nucleic acid duplex formation while minimizing nonspecific binding events. The hybridization reaction was then performed at 30°C for 10 minutes, a temperature optimized to maintain hybridization efficiency under moderately stringent conditions. After the hybridization step, 50 pL of the reaction mixture was mixed with 50 pL of 1 x PBS containing gold nanoparticles (GNPs). The GNPs acted asAtty. Ref. No. 0073605-001210optical reporters, enabling downstream visual signal generation through plasmonic enhancement during lateral flow immunoassay (LFIA) analysis. Finally, the prepared mixture was applied onto the LFIA strip, where the migration and capture of hybridized complexes were evaluated. The resulting colorimetric signal on the strip confirmed the specific detection of the target Mpox DNA.

[0155] Results

[0156] The central objective of this example was to establish a clade-specific, amplification-free molecular lateral flow platform for Mpox detection. Rapid discrimination between clades la, lb, and II is vital for effective surveillance and outbreak management, especially given the recent emergence of the more virulent clade lb in Central Africa and the widespread dissemination of clade II during the 2022 outbreak. The Mpox virus genome encodes approximately 190 open reading frames and three major clades (FIG. 4). While clade II infections are typically self-limiting (case fatality <1%), clades la and lb are linked to more severe disease and higher mortality rates (<10%). To achieve precise clade discrimination, three genomic loci — C3L (la), D14L (lb), and TNF receptor (II) — were chosen as diagnostic targets. Twelve thiolated ssDNA probes were designed and computationally screened for optimal melting temperature, high target affinity, and minimal cross-reactivity (FIGS. 5 and 7-10).Before initiating the LFA experiment, streptavidin nanoparticles (AuNPs) were functionalized with single-stranded DNA (ssDNA) probes via Au-S bonding to facilitate sequence-specific target recognition and produce a visible color change through hybridization-induced aggregation (FIG. 11).

[0157] This design exploits the principle that complementary target DNA bridges multiple ssDNA-functionalized AuNPs, driving their aggregation and resulting in a detectableAtty. Ref. No. 0073605-001210color shift. Larger-scale TEM distribution maps show that ssDNA-AuNPs are monodisperse without target DNA but form extensive clusters upon hybridization with complementary Mpox sequences from each clade (FIG. 12), further supported by HAADF imaging (FIG. 12).Correspondingly, FIG. 13 presents photographic images of ssDNA-functionalized AuNPs in the presence and absence of target DNA, along with the corresponding UV-vis spectra showing clearly labeled peak positions and aggregation-induced spectral shifts and the UVvis spectra displayed a red shift in the localized surface plasmon resonance (LSPR) peak (-523 nm), consistent with aggregation behavior. Gel electrophoresis and A260 / A280 absorbance analysis confirmed the structural integrity of the oligonucleotides and stable surface modification of the AuNPs (FIGS. 14-17). UV-vis spectroscopy was used to identify optimal ssDNA probe pairs for clades la, lb, and II Mpox detection. Control Mpox DNA (0.25 ng mF'1) from Twist synthetic virus was used as the target. For clade la, ssDNA pairs (la + lb), (2a + 2b), and their combination were tested at 10 pM, with (la + lb) showing the highest absorbance change at 523 nm, targeting the C3L gene. Clade lb pairs (3a + 3b), (4a + 4b), and combined sets were assessed, and (3a + 3b), targeting DI 4L, displayed the strongest signal (FIGS. 18 and 19). For clade II, pairs (5a + 5b), (6a + 6b), and their combination were tested, with (5a + 5b), targeting the TNF receptor gene, showing the highest sensitivity. Incubation temperatures of 23°C and 37°C were evaluated (FIGS. 19 and 20). Across all clades, 37°C produced the greatest absorbance changes, enhancing ssDNA-target hybridization. Negative controls showed minimal signal changes. Complementary scanning electron microscopy (SEM) imaging of the nitrocellulose membranes showed uniformly dispersed nanoparticles in the negative controls, while pronounced aggregation was observed following hybridization with the target DNA (FIGS.21 and 22). Energy-dispersive X-ray spectroscopy (EDS) further corroborated these results byAtty. Ref. No. 0073605-001210revealing elevated C and O atomic signals consistent with nucleotide deposition on the membrane surface (FIGS. 23-25). X-ray photoelectron spectroscopy (XPS) was used to verify ssDNA functionalization on AuNPs and their hybridization with Mpox target DNA. In the Cis spectra, the CHX(C-C, C-H) components increased while the C-O-C components decreased, indicating DNA attachment, with minor changes in CQO and COO reflecting subtle chemical modifications. The Au4f peak shifted from 83.40 eV to 83.04 eV, suggesting partial surface coverage by DNA. No N(ls) signal was detected before DNA addition, but a clear peak appeared afterward, confirming nitrogen from the DNA. Oxygen content decreased after DNA binding, consistent with surface coverage. Collectively, these changes in carbon, nitrogen, oxygen, and gold signals confirm successful ssDNA functionalization and target hybridization46 (FIGS. 25 and 26). These results established optimal probe pairs and assay conditions for sensitive and specific Mpox detection.

[0158] For multiplex molecular lateral flow assay development, the optimized probe sets were integrated into a nucleic acid lateral flow assay (NALFA) platform, designed for multiplexed and power-free detection (FIG. 3). Two complementary formats were fabricated: a dual-strip targeting clades la and lb and a single-strip format for clade II. Probes were labelled with biotin / FAM (clade la) and biotin / DIG (clades lb and II), enabling specific capture by immobilized anti-FITC or anti-DIG antibodies on the test line. Sample addition initiated capillary -driven flow, with visible color development on the nitrocellulose membrane within 10-15 minutes. Validation using synthetic targets and genomic controls (Twist Bioscience) demonstrated clear and distinct colorimetric readouts for each clade. The entire workflow from crude extraction to results was completed in under 30 minutes without the need for amplification, specialized instrumentation, or trained personnel. Spectroscopic and imaging evidence supports aAtty. Ref. No. 0073605-001210hybridizationinduced AuNP aggregation mechanism, where complementary DNA binding decreases surface charge, disrupts citrate stabilization, and induces van der Waals-driven clustering. This aggregation leads to a measurable LSPR red-shift and a visible color transition, forming the basis for molecular recognition in the lateral flow format. The approach combines the molecular specificity of DNA hybridization with the simplicity and portability of conventional LFA platforms. FIG. 27 shows the complete multiplex NALFA strip layout. The NALFA was designed to contain two spatially distinct test lines, T1 and T2, and a single control line (C) for clades la and lb, and the right one is for clade II. Each test line was immobilized with an antisense oligonucleotide (ASO) probe specific to different Mpox clades, allowing simultaneous detection and differentiation within a single assay. The control line served as an internal procedural control to confirm proper sample flow and reagent functionality. Upon the application of the sample containing the extracted gDNA, the ASOs target DNA hybridization led to the accumulation of AuNP-labeled complexes at the respective test zones, producing visually distinct red lines. Cross-reactivity testing showed strong signals only for Mpox clades la and II, with no response from Vaccinia virus, C. gonorrhoeae, or SARSCoV-2, confirming high assay specificity (FIG. 28). Only the corresponding complementary targets generated visible test line signals, whereas no cross-reactivity or nonspecific binding was observed with non-target DNAs.

[0159] These results confirm that the designed ASOs maintained high sequence discrimination ability under the assay conditions. FIG. 29 shows the analytical sensitivity evaluation, where serial dilutions of Mpox DNA ranging from 0 to 105copies per mb were analyzed to determine the detection limit and signal response behavior. A gradual decrease in band intensity at both test lines was observed with decreasing target concentration. The distinctAtty. Ref. No. 0073605-001210visual signal was retained up to 102copies per mL, establishing the visual limit of detection. The control line remained consistently visible across all concentrations, ensuring reliable fluidic and conjugate release performance. The assay LOD for Mpox clades la, lb, and II was re-evaluated using genomic DNA (Twist controls CB and WA) and calculated as 3.3 x (Sy / S) from n = 3 blanks. Serial 10-fold dilutions (103— 10 copies per mL) were tested with 10 mL added to 200 mL ssDNA. Replicates (n = 3) confirmed reproducibility, with detectable signals down to 100 copies per mL. Calibration curves for each clade (FIG. 30) showed consistent detection with >95% confidence, validating assay sensitivity. FIG. 31 shows the quantitative calibration curves. The signal intensity ratios (T / C) for both the T1 and T2 lines were plotted against DNA concentration, yielding highly linear relationships (R.2-- 0.99) across the 101- 105copies per mL range. This sensitivity was maintained consistently across all Mpox clades. The near-identical slopes for T1 and T2 indicate comparable hybridization kinetics and uniform signal development, confirming the quantitative reliability of the multiplex platform. Clinical validation was performed with clade II clinical swab samples. The NALFA was assessed using both CDC generic and clade-specific primers (FIG. 32). Out of 18 RT-PCR-confirmed clade II samples (FIG. 33), with the intensity graph (FIGS. 34 and 36) and the confusion matrix chart for the clinical samples given in FIG. 35, 14 tested positive by NALFA. To strengthen clade validation, a CDC-verified clade la clinical DNA sample was serially diluted, PCR-verified, and tested on the lateral flow assay (FIG. 33). Due to BSL-3 restrictions and lack of clade lb specimens, sequence-verified synthetic clade lb DNA (D14L, Twist Bioscience) was used for probe design and assay testing (FIG. 28). Methods and results now clarify these constraints. Validation using clade II, clade la, and synthetic clade lb DNA demonstrates robust clade-specific performance across all three lineages. These results were fully consistent with RTPCR outcomes (FIG. 36).Atty. Ref. No. 0073605-001210

[0160] Overall, the multiplex NALFA system exhibited high sensitivity, exceptional target specificity, and reproducible quantitative behavior, providing a rapid and visual platform for clade specific detection of Mpox DNA. The integration of multiple ASO probes on a single lateral flow strip enables efficient differentiation between Mpox variants, making the assay a promising tool for point-of-care molecular diagnostics. This confirmed its strong diagnostic reliability for clinical detection. Overall, it outperformed existing bulky and costly POC systems like GeneXperts and QIAStat-Dx (FIG. 37).

[0161] The amplification-free lateral flow platform enables rapid, on-site Mpox detection within 30 min at 100 copies per mb and provides clade-specific identification (la, lb, II). Unlike PCR or LAMP assays, it requires no laboratory infrastructure, thermal cycling, or amplification, offering a simple, portable, contamination-free solution superior to existing antigen tests. LFIA strip and gold conjugate stability were tested over six weeks at RT and 4°C with high (105copies per mL) and low (101copies per mL) Mpox DNA (FIGS. 38-40). Strips at 4°C retained higher signals, while RT showed a slight decline, likely from partial antibody degradation, yet clear, reproducible test lines were observed at all time points and concentrations. Lyophilized gold conjugates stored at 4°C showed minimal signal change, demonstrating the stability and reliability of both strips and conjugates for long-term storage and field-deployable diagnostics.

[0162] It should be understood that modifications to the embodiments disclosed herein can be made to meet a particular set of design criteria. For instance, the number of or configuration of components or parameters may be used to meet a particular objective.

[0163] It will be apparent to those skilled in the art that numerous modifications and variations of the described examples and embodiments are possible in light of the above teachings of the disclosure. The disclosed examples and embodiments are presented for purposesAtty. Ref. No. 0073605-001210of illustration only. Other alternative embodiments may include some or all of the features of the various embodiments disclosed herein. For instance, it is contemplated that a particular feature described, either individually or as part of an embodiment, can be combined with other individually described features, or parts of other embodiments. The elements and acts of the various embodiments described herein can therefore be combined to provide further embodiments.

[0164] It is the intent to cover all such modifications and alternative embodiments as may come within the true scope of this invention, which is to be given the full breadth thereof.Additionally, the disclosure of a range of values is a disclosure of every numerical value within that range, including the end points. Thus, while certain exemplary embodiments of the apparatus and process and / or utilization and methods of making and using the same have been discussed and illustrated herein, it is to be distinctly understood that the invention is not limited thereto but may be otherwise variously embodied and practiced within the scope of the following claims.

Claims

Atty. Ref. No. 0073605-001210What is claimed is:

1. An apparatus for detecting the presence of one or more of Clade la Mpox, Clade lb Mpox, and Clade II Mpox, the apparatus comprising:first ssDNAs functionalized with a first small molecule at their first ends, wherein the first ssDNAs have a sequence that is complementary to a first target gene sequence of a first Clade;second ssDNAs functionalized with a second small molecule at their second ends, wherein the second ssDNAs have a sequence that is complementary to a second target gene sequence of the first Clade;third ssDNAs functionalized with a third small molecule at their first ends, wherein the third small molecule is the same as the first small molecule, wherein the third ssDNAs have a sequence that is complementary to a first target gene sequence of a second Clade; and fourth ssDNAs functionalized with a fourth small molecule at their second ends, wherein the fourth small molecule is different than the second small molecule, wherein the fourth ssDNAs have a sequence that is complementary to a second target gene sequence of the second Clade.

2. The apparatus of claim 1, wherein the first and second Clades are two different Clades selected from the group consisting of Clade la, Clade lb, and Clade II.

3. The apparatus of claim 1, further comprising:Atty. Ref. No. 0073605-001210fifth ssDNAs functionalized with a fifth small molecule at their first ends, wherein the fifth small molecule is the same as the first and third small molecules, wherein the fifth ssDNAs have a sequence that is complementary of a first target gene sequence of a third Clade; and sixth ssDNAs functionalized with a sixth small molecule at their second ends, wherein the sixth small molecule is different than the second and fourth small molecules, wherein the sixth ssDNAs have a sequence that is complementary of a second target gene sequence of the third Clade.

4. The apparatus of claim 3, wherein the first, second, and third Clades are three different Clades selected from the group consisting of Clade la, Clade lb, and Clade II.

5. The apparatus of claim 1, wherein when the first or second Clade is Clade la, either: the first target gene sequence of Clade la Mpox is CUGCCAAGAUAGCUUCAAAG and the second target gene sequence of Clade la Mpox is UGCCAAGAUAGCUUCAAAGU, or the first target gene sequence of Clade la Mpox is UUAACACUCUGCCAAGAUAG and the second target gene sequence of Clade la Mpox is UAACACUCUGCCAAGAUAGC.

6. The apparatus of claim 1, wherein when the first or second Clade is Clade lb, either: the first target gene sequence of Clade lb Mpox is GCACUUCGAAAUGGAAAAGA and the second target gene sequence of Clade lb Mpox is CUUCCAAACUUAAUCACUCC, or the first target gene sequence of Clade lb Mpox is CCAAACUUAAUCACUCCUAG and the second target gene sequence of Clade lb Mpox is UCAGGCGCAUAUCCACCCAC.Atty. Ref. No. 0073605-0012107. The apparatus of claim 1, wherein when the first or second Clade is Clade II, either: the first target gene sequence of Clade II Mpox is GGUAACAGGUGGCCAAACUC and the second target gene sequence of Clade II Mpox is GUAACAGGUGGCCAAACUCC, or the first target gene sequence of Clade II Mpox is GAGAAGCAAAUGAUGACUUG and the second target gene sequence of Clade II Mpox is UAUCUCCUCAAGGAAUACAC.

8. The apparatus of claim 1, wherein the first small molecule and the third small molecule is a small molecule selected from the group consisting of biotin, 6-carboxyfluorescein (6-FAM) , fluorescein isothiocyanate (FITC), and digoxigenin (DIG).

9. The apparatus of claim 1, wherein the second small molecule and fourth small molecule are two different small molecules selected from the group consisting of biotin, 6-carboxyfluorescein (6-FAM) , fluorescein isothiocyanate (FITC), and digoxigenin (DIG).

10. The apparatus of claim 1, further comprising:a testing strip comprising a sample application region, a control region, a first testing region configured to detect the presence of the first Clade, and a second testing region configured to detect the presence of the second Clade, wherein the first and second testing regions are positioned between the sample application region and the control region, andwherein the sample application region is configured to receive a sample, which is configured flow through the testing strip towards the first and second testing regions and the control region.Atty. Ref. No. 0073605-00121011. The apparatus of claim 10, wherein the first testing region has first capture compounds immobilized on the testing strip, wherein the first capture compounds are configured to capture the second small molecule of the second ssDNAs.

12. The apparatus of claim 11, wherein the second testing region has second capture compounds immobilized on the testing strip, wherein the second capture compounds are configured to capture the fourth small molecule of the fourth ssDNAs.

13. The apparatus of claim 12, wherein the testing strip has nanoparticles configured to flow through the testing strip, wherein some of the nanoparticles are configured to capture the first small molecule of the second ssDNAs, and wherein some of the nanoparticles are configured to capture the third small molecule of the fourth ssDNAs.

14. The apparatus of claim 13, wherein the nanoparticles are configured to effectuate a color change when reacted and immobilized on the testing strip.

15. The apparatus of claim 14, further comprising positively charged molecules configured to flow through the testing strip, wherein the positively charged molecules are configured to bind to the nanoparticles and augment the color change effectuated by the nanoparticles.Atty. Ref. No. 0073605-00121016. The apparatus of claim 10, wherein the control region has fourth capture compounds immobilized on the testing strip, wherein the fourth capture compounds are configured to capture some of the nanoparticles.

17. The apparatus of claim 10, wherein the target gene sequences are not amplified.

18. A method for detecting the presence of one or more of Clade la Mpox, Clade lb Mpox, and Clade II Mpox, the method comprising:providing a sample solution comprising:a collected sample including nucleic acid from a subject,first ssDNAs functionalized with a first small molecule at their first ends, wherein the first ssDNAs have a sequence that is complementary to a first target gene sequence of a first Clade,second ssDNAs functionalized with a second small molecule at their second ends, wherein the second ssDNAs have a sequence that is complementary to a second target gene sequence of the second Clade,third ssDNAs functionalized with a third small molecule at their first ends, wherein the third small molecule is the same as the first small molecule, wherein the third ssDNAs have a sequence that is complementary to a first target gene sequence of a second Clade, andfourth ssDNAs functionalized with a fourth small molecule at their second ends, wherein the fourth small molecule is different than the second small molecule, whereinAtty. Ref. No. 0073605-001210the fourth ssDNAs have a sequence that is complementary to a second target gene sequence of the second Clade;providing a testing strip comprising a sample application region, a control region, a first testing region configured to detect the presence of the first respiratory disease, and a second testing region configured to detect the presence of the second respiratory disease, wherein the first and second testing regions are positioned between the sample application region and the control region; andapplying the sample solution at the sample application region.

19. The method of claim 18, wherein the first and second Clades are two different Clades selected from the group consisting of Clade la, Clade lb, and Clade II.

20. The method of claim 18, wherein the sample solution further comprises:fifth ssDNAs functionalized with a fifth small molecule at their first ends, wherein the fifth small molecule is the same as the first and third small molecules, wherein the fifth ssDNAs have a sequence that is complementary of a first target gene sequence of a third Clade; and sixth ssDNAs functionalized with a sixth small molecule at their second ends, wherein the sixth small molecule is different than the second and fourth small molecules, wherein the sixth ssDNAs have a sequence that is complementary of a second target gene sequence of the third Clade.

21. The method of claim 20, wherein the first, second, and third Clades are three different Clades selected from the group consisting of Clade la, Clade lb, and Clade II.Atty. Ref. No. 0073605-00121022. The method of claim 18, wherein when the first or second Clade is Clade la, either: the first target gene sequences of Clade la Mpox is CUGCCAAGAUAGCUUCAAAG and the second target gene sequence of Clade la Mpox is UGCCAAGAUAGCUUCAAAGU, or the first target gene sequence of Clade la Mpox is UUAACACUCUGCCAAGAUAG and the second target gene sequence of Clade la Mpox is UAACACUCUGCCAAGAUAGC.

23. The method of claim 18, wherein when the first or second Clade is Clade lb, either: the first target gene sequence of Clade lb Mpox is GCACUUCGAAAUGGAAAAGA and the second target gene sequence of Clade lb Mpox is CUUCCAAACUUAAUCACUCC, or the first target gene sequence of Clade lb Mpox is CCAAACUUAAUCACUCCUAG and the second target gene sequence of Clade lb Mpox is UCAGGCGCAUAUCCACCCAC.

24. The method of claim 18, wherein when the first or second Clade is Clade II, either:the first target gene sequence of Clade II Mpox is GGUAACAGGUGGCCAAACUC and the second target gene sequence of Clade II Mpox is GUAACAGGUGGCCAAACUCC, or the first target gene sequence of Clade II Mpox is GAGAAGCAAAUGAUGACUUG and the second target gene sequence of Clade II Mpox is UAUCUCCUCAAGGAAUACAC.

25. The method of claim 18, wherein the first testing region has first capture compounds immobilized on the testing strip, wherein the first capture compounds are configured to capture the second small molecule of the second ssDNAs.Atty. Ref. No. 0073605-00121026. The method of claim 25, wherein the second testing region has second capture compounds immobilized on the testing strip, wherein the second capture compounds are configured to capture the fourth small molecule of the fourth ssDNAs.

27. The method of claim 26, wherein the testing strip has nanoparticles configured to flow through the testing strip, wherein some of the nanoparticles are configured to capture the first small molecule of the first ssDNAs, and wherein some of the nanoparticles are configured to capture the third small molecule of the third ssDNAs.

28. The method of claim 27, wherein the nanoparticles are configured to effectuate a color change when reacted and immobilized on the testing strip.

29. The method of claim 28, further comprising applying positively charged molecules configured to flow through the testing strip, wherein the positively charged molecules are configured to bind to the nanoparticles and augment the color change effectuated by the nanoparticles.

30. The method of claim 18, wherein the method does not include a step of amplifying the target gene sequences.

Images