Methods for identifying t cell receptors
Patent Information
- Application Number
- PCT/US2026/019953
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-03-19
- Filing Date
- 2026-03-19
- Publication Date
- 2026-09-24
Smart Images

Figure US2026019953_24092026_PF_FP_ABST
Abstract
Description
Attorney Docket No 159423.624490METHODS FOR IDENTIFYING T CELL RECEPTORSCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 774,511, filed March 19, 2025, which is incorporated by reference herein in its entirety for all purposes.TECHNICAL FIELD
[0002] The present disclosure relates to methods for identifying a T cell receptor (TCR) or antigenbinding fragment thereof that binds to an antigen of interest associated with a disease or condition, an antigen of interest associated with a response to a therapeutic treatment, and / or to an antigen of interest associated with a recurrence of a disease or condition.BACKGROUND
[0003] T-cell receptor (TCR) discovery is fundamental to advancing TCR-based therapies, including TCR-T cell therapy and bispecific T cell engagers (BITE). Identifying antigen-specific TCRs remains highly challenging due to the exceedingly low frequency of each TCR specificity within the vast diversity of the naive T-cell precursor repertoire. Developing highly specific and potent TCRs requires robust methodologies that balance sensitivity, specificity, diversity, and throughput. Several key approaches are used for TC discovery, each with distinct advantages and limitations.
[0004] Traditional T-cell cloning is a well-established method that involves the following steps: 1) Isolating antigen-specific T cells from patient or donor samples; 2) Expanding and cloning these T cells; 3) Identifying specific TCRs using functional assays.
[0005] This approach generates naturally occurring, high-affinity TCRs and is effective for identifying highly reactive receptors. However, it is labor-intensive, time-consuming, has limited throughput and diversity coverage, and generally yields a lower success rate.
[0006] A more recent method employs single-cell RNA sequencing (scRNA-seq) along with TCR repertoire analysis, including scTCR-seq This approach captures the native pairing of alpha and beta TCR chains, providing high-resolution analysis with greater sensitivity and diversity coverage. Its drawbacks include the need for advanced bioinformatics and the potential to identify low-affinity or non-functional TCRs that require further optimization.Attorney Docket No 159423.624490SUMMARY
[0007] Provided herein is a method for identifying a T cell receptor (TCR) or antigen-binding fragment thereof that binds to an antigen of interest associated with a disease or condition, the method comprising:a) producing and enriching an antigen specific T cell population by:obtaining a population of mononuclear cells;dividing the mononuclear cells into monocyte and lymphocyte populations; obtaining mature dendritic cells from the monocyte population;pulsing the mature dendritic cells with antigenic peptide(s) to produce pulsed mature dendritic cells;co-culturing the pulsed mature dendritic cell population and the lymphocyte population to produce the antigen-specific T cell population or co-culturing the lymphocyte population with artificial antigen-presenting cells (APCs) to produce the antigen-specific T cell population;optionally co-culturing the antigen-specific T cell population and the pulsed mature dendritic cell population at least once or co-culturing the antigen-specific T cell population with the APCs at least once; andenriching the antigen specific T cell population,b) partitioning single cells,c) generating a single-cell V(D)J library, a single cell gene expression library, and a single-cell cell surface markers library, wherein the libraries comprise sequences that are tagged with a single-cell specific barcode and a unique molecular identifier (UMI) sequence,d) generating sequencing data by performing sequencing of the single-cell V(D)J, singlecell gene expression, and single cell surface markers libraries,e) using the sequencing data to identify distinct antigen specific T cell populations and their unique V(D)J nucleotide sequence,f) designing primer sequences for amplification of the TCR comprising the identified unique V(D)J nucleotide sequence, wherein the primer sequences are designed based on the partition specific barcode sequence and the UMI sequence,Attorney Docket No 159423.624490g) performing a two-round amplification procedure to obtain two amplification products, wherein the first amplification product comprises nucleic acid encoding a full-length β variable (Vβ) and a full-length β constant (Cβ) and the second amplification product comprises nucleic acid encoding a full-length α variable (Vα) and a full-length α constant (Cα), The amplification products are assembled into a nucleic acid vector to obtain an assembled nucleic acid vector for the TCR comprising the identified unique V(D)J nucleotide sequence, wherein the assembled nucleic acid vectors for the TCR comprising the identified unique V(D)J nucleotide sequence comprise a nucleic acid encoding a functional TCR.
[0008] Provided also herein is for identifying a T cell receptor (TCR) or antigen-binding fragment thereof that binds to an antigen of interest associated with a response to a therapeutic treatment and / or to an antigen of interest associated with a recurrence of a disease or condition, the method comprising:a) producing and enriching an antigen specific T cell population by:obtaining a population of mononuclear cells;dividing the mononuclear cells into monocyte and lymphocyte populations; obtaining mature dendritic cells from the monocyte population;pulsing the mature dendritic cells with antigenic peptide(s) to produce pulsed mature dendritic cells;co-culturing the pulsed mature dendritic cell population and the lymphocyte population to produce the antigen-specific T cell population or co-culturing the lymphocyte population with artificial antigen-presenting cells (APCs) to produce the antigen-specific T cell population;optionally co-culturing the antigen-specific T cell population and the pulsed mature dendritic cell population at least once or co-culturing the antigen-specific T cell population with the APCs at least once; andenriching the antigen specific T cell population,b) partitioning single cells,c) generating a single-cell V(D)J library, a single cell gene expression library, and a single-cell cell surface markers library, wherein the libraries comprise sequences that are tagged with a single-cell specific barcode and a unique molecular identifier (UMI) sequence.Attorney Docket No 159423.624490d) generating sequencing data by performing sequencing of the single-cell V(D)J, single-cell gene expression, and single cell surface markers libraries,e) using the sequencing data to identify distinct antigen specific T cell populations and their unique V(D)J nucleotide sequence,f) designing primer sequences for amplification of the TCR comprising the identified unique V(D)J nucleotide sequence, wherein the primer sequences are designed based on the partition specific barcode sequence and the UMI sequence,g) performing a two-round amplification procedure to obtain two amplification products, wherein the first amplification product comprises nucleic acid encoding a full-length β variable (Vβ) and a full-length β constant (Cβ) and the second amplification product comprises nucleic acid encoding a full-length α variable (Vα) and a full-length α constant (Cα). The amplification products are assembled into a nucleic acid vector to obtain an assembled nucleic acid vector for the TCR comprising the identified unique V(D)J nucleotide sequence, wherein the assembled nucleic acid vectors for the TCR comprising the identified unique V(D)J nucleotide sequence comprise a nucleic acid encoding a functional TCR.
[0009] In certain embodiments, of any of the methods of the present disclosure, obtaining the mature dendritic cells from the monocyte population comprises culturing the monocyte population under conditions to generate immature dendritic cells and differentiating the immature dendritic cells to produce mature dendritic cells.
[0010] In certain embodiments, of any of the methods of the present disclosure, enriching the antigen specific T cell population comprises using tetramer-peptide, dextramer staining and combinations thereof.
[0011] In certain embodiments, of any of the methods of the present disclosure, the dextramer comprises a barcoded oligonucleotide comprising a partition specific barcode sequence and a unique molecular identifier (UMI) sequence.
[0012] In certain embodiments, of any of the methods of the present disclosure, the method comprises labeling the stained antigen specific T cell population with cell labeling molecules comprising a feature barcode oligonucleotide.
[0013] In certain embodiments, of any of the methods of the present disclosure, partitioning single cells comprises using gel beads-in-emulsions (GEMs).Attorney Docket No 159423.624490
[0014] In certain embodiments, of any of the methods of the present disclosure, designing primer sequences comprises using single molecule sequence extraction (SMSE).BRIEF DESCRIPTION OF THE DRAWINGS
[0015] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0016] FIG. 1 presents schematic of a workflow for end-to-end TCR discovery with known antigen.
[0017] FIGS. 2A-2B present a schematic of an antigen-specific T-cell enrichment processes.
[0018] FIGS. 3A-3B present antigen-specific CDS T-cells identification after enrichment process.
[0019] FIGS. 4A-4B present schematics of antigen-specific T cell labeling and single cell CITE sequencing analysis
[0020] FIG. 5 presents a single-cell CITE sequencing data analysis pipeline.
[0021] FIG. 6 presents T cell subtype clustering and TCR aP CDR3 sequence clonotype analysis from selected T cells.
[0022] FIGS. 7A-7C present Single Molecule Sequence Extraction (SMSE) workflow and Forward Primer Design from 10X Genomics single-cell sequencing data.
[0023] FIGS. 8A-8D present a schematic of TCR a expression vector construction.
[0024] FIG. 9 presents TCR functional validation.DETAILED DESCRIPTION
[0025] The present disclosure is based, at least in part, to the improvement of the efficiency and quality of TCR discovery by combining state-of-art technologies into an innovative end-to-end TCR discovery platform:1, Enhanced Antigen-Specific Priming and Activation: processes were developed herein that increase the frequency of antigen-specific TCRs from the source material by using antigen-specific APC priming followed by sequential activations.2. Antigen-Specific T Cell Enrichment: dual-color Dextramer / tetramer peptides were employed to enrich and label antigen-specific T cellsAttorney Docket No 159423.6244903. Integrated Single-Cell Profiling: single-cell CITE-sequencing was combined with multiplex molecular profiling technologies to:a. Directly extract TCR aP pair sequences from targeted cells with improved precision. b. Perform phenotype analysis to support the selection of optimal T cells and TCRs. 4. A novel single molecule sequence extraction (SMSE) technique was developed to integrate high-throughput construction of TCR a expression vectors for selected TCR VDJ sequences.Definitions
[0026] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains.
[0027] The term “a” and “an” refers to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.
[0028] An “antigen” includes molecules, such as polypeptides, peptides, or glyco- or lipo-peptides that are recognized by the immune system, such as by the cellular or humoral arms of the human immune system. The term “antigen” includes antigenic determinants, such as peptides with lengths of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or more amino acid residues that bind to MHC molecules, form parts of MHC Class I or II complexes, or that are recognized when complexed with such molecules. In some embodiments, cells described herein have been primed with selected peptides that are known to be highly antigenic In other embodiments, cells have been primed with a library of peptides, including commercially available overlapping peptides such as pepmixes.
[0029] An “antigen presenting cell (APC)” refers to a class of cells capable of presenting one or more antigens in the form of peptide-MHC complex recognizable by specific effector cells of the immune system, and thereby inducing an effective cellular immune response against the antigen or antigens being presented. Examples of professional APCs are dendritic cells and macrophages, though any cell expressing MHC Class 1 or II molecules can potentially present peptide antigen.
[0030] A “T cell receptor” or “TCR” is a molecule that contains an a chain and a P chain (also known as TCRa and TCRp, respectively) or a y chain and a 5 chain (also known as TCRy and TCRS, respectively), and is capable of specifically binding to an antigen (e.g., a peptide antigen orAttorney Docket No 159423.624490peptide epitope) bound to an MHC molecule. In some embodiments, the TCR is in the aP form. a TCRs and yd TCRs are structurally similar. However, T cells expressing o.p TCRs and yS TCRs may have distinct anatomical locations or functions. In some embodiments, the TCR is a aP TCR. In some embodiments, the TCR is a 76 TCR. Generally, a TCR is found on the surface of a T cell (i.e., T lymphocyte) where it recognized antigens (e.g., antigen or epitopes) bound to major histocompatibility complex (MHC) molecules.
[0031] A “TCR” can encompasses a full-length TCR or antigen-binding portion or antigenbinding fragment thereof. In some embodiments, the TCR is an intact or full-length TCR, such as a TCR containing an alpha (a) chain and a beta (P) chain, or a gamma (y) chain and a delta (5) chain. In some embodiments, the TCR is an antigen-binding portion that is less than a full- length TCR that retains the ability to bind to a specific peptide, such as an antigen or epitope, in association with an MHC molecule. In some embodiments, an antigen-binding portion or fragment of a TCR contains only a portion of the structural domains of a full-length or intact TCR, but yet retains the ability to bind to the same specific peptide, such as an antigen or epitope, in association with an MHC molecule as the full length TCR. In some embodiments, an antigen-binding portion contains the variable domains of a TCR, such as variable a ( Va.) and variable P (Vp) chains or the variable y (Vy) and variable 5 (V5) chains.
[0032] Typically, specific binding of a TCR to a peptide epitope, is determined by one or more complementarity determining regions (CDRs). Specific binding of a TCR to a peptide epitope (in the context of an MHC olecule) means that the TCR binds the peptide epitope with higher affinity than it binds to other peptides (in the context of an MHC molecule). Higher affinity can be at least about 2-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100-fold higher affinity.
[0033] The variable domains of a TCR contains CDRs (CDR-1, CDR-2, and CDR-3), which generally are contributors to antigen recognition and binding capabilities and specificity of the peptide, MHC molecule, and / or MHC-peptide complex. A CDR of a TCR or combination thereof forms all or substantially all of the antigen-binding site of a given TCR molecule. The various CDRs within a variable region of a TCR chain generally are separated by framework regions (FRs), which generally display less variability among TCRs as compared to the CDRs (see, e.g., Jores et al., Proc. Natl Acad. Sci. U. S. A. 87:9138, 1990; Chothia et al., EMBO J. 7:3745, 1988; see also Lefranc et al., Dev. Comp. Immunol. 27:55, 2003). CDR-3 is often predominantly responsible forAttorney Docket No 159423.624490antigen binding or specificity and / or interaction with the processed peptide portion of the peptide-MHC complex, CDR-1 of the alpha chain typically interacts with the N-tenninal part of certain antigenic peptides. CDR-1 of the beta chain often interacts with the C-temiinal part of the peptide. CDR-2 typically contributes most strongly to or is the primary CDR responsible for the interaction with or recognition of the MHC portion of the MHC-peptide complex. The variable region of the P-chain can contain a further hypervariable region (e.g., CDR4 or HVR4), which generally is involved in superantigen binding and not antigen recognition (Kotb (1995) Clinical Microbiology Reviews, 8:411-426).
[0034] The a chain and / or the 0 chain of a full length TCR, or the y chain and / or the 8 chain of a full length TCR further contains a constant domain, a transmembrane domain and a short cytoplasmic tail (see, e.g., Janeway et al., Immunobiology: The Immune System in Health and Disease, 3rd Ed., Current Biology Publications, p. 4:33, 1997). Each chain of the TCR can possess one N-terminal immunoglobulin variable domain, one immunoglobulin constant domain, a transmembrane region, and a short cytoplasmic tail at the C -terminal end. TCRs can associate, via their cytoplasmic tails, with invariant proteins of the CD3 complex involved in mediating signal transduction or with other CD3-like molecules.Antigen(s) of Interest
[0035] Described herein are methods for identifying a T cell receptor (TCR) or antigen-binding fragment thereof that binds to an antigen of interest associated with a disease or condition. Described herein are also methods for identifying a T cell receptor (TCR) or antigen-binding fragment thereof that binds to an antigen of interest associated with a response to a therapeutic treatment and / or to an antigen of interest associated with a recurrence of a disease or condition.
[0036] In some embodiments, the disease or condition is a cancer, an infection, a viral infection, a bacterial infection, an allergy, or an autoimmune disorder.
[0037] In some embodiments, the antigen of interest can be a tumor- or a cancer-associated antigen, such as a tumor antigen. The tumor antigen can be, but is not limited to, an antigen that is expressed in a tumor from a particular subject, such as a patient- specific tumor antigen A tumor antigen can comprise a full-length protein or a fragment thereof containing, for example, a mutant amino acid, insertion, or deletion. In some embodiments, the tumor antigen comprises an epitope (e.g., an epitope or tumor epitope). In some embodiments, the peptide epitope can be presented complexed with a major histocompatibility complex (MHC) on the surface of an antigenAttorney Docket No 159423.624490presenting cell (APC), for recognition by a T cell receptor (TCR) or TCR-expressing cell In some embodiments, an antigen contains an amino acid mutation (substitution, deletion, and / or insertion) relative to the corresponding peptide from normal, non-cancerous or non-tumorous cells or tissue in the subject or from a control subject that does not have cancer. In some embodiments, a antigen is expressed at a higher level in cancerous tissue relative to expression of the corresponding peptide from normal, non-cancerous or non-tumorous cells or tissue in the subject or a control subject that does not have cancer. In some embodiments, the expression of antigen promotes cancer growth.
[0038] In some embodiments, the antigen of interest is an antigen involved in the tumor or cancer, or a disease associated with malignancy or transformation of cells. In some embodiments, the antigen of interest is an intracellular protein antigen from a tumor or cancer cell. In some embodiments, the antigen of interest is a tumor-associated antigen, and / or an antigen derived from a viral pathogen or a bacterial pathogen that is associated with a tumor or a cancer. In some embodiments, a tumor or cancer antigen is an antigen that can be found on a malignant cell, found inside a malignant cell or is a mediator of tumor cell growth. In some embodiments, a tumor or cancer antigen is one that is predominantly expressed by a tumor cell or cancer cell compared to normal, non-cancerous or non-tumorous cells or tissue in the subject or a control subject that does not have cancer. In some embodiments, a tumor or cancer antigen is overexpressed in the subject’s tumor, compared to normal, non-cancerous or non-tumorous cells or tissue in the subject or a control subject that does not have cancer. In some embodiments, the antigen is a viral-associated cancer antigen The described methods are able to identify and screen viral or cancer antigens derived from intracellular proteins that can only be targeted at the cell surface in the context of an MHC molecule by a TCR. In some embodiments, tumor antigens include, but are not limited to, mutated peptides, differentiation antigens, and overexpressed antigens, all of which could serve as targets for immune therapies, such as, but not limited to, ACT.
[0039] In some embodiments, an antigen of interest binds or is predicted to bind MHC with an IC50 or Kd value of less than 500 nM, less than 400 nM, less than 300 nM, less than 200 nM, less than 100 nM, less than 80 nM, less than 50 nM, less than 20 nM, or less than 10 nM.
[0040] In some embodiments, an antigen of interest that binds to MHC Class I is a polypeptide about 8 to about 15 amino acids in length. In some embodiments, an antigen of interest that binds to MHC Class I is a polypeptide about 8, 9, 10, 11, 12, 13, 14, or 15 amino acids in length. In some embodiments, an antigen of interest that binds to MHC Class I is a polypeptide about 8 to aboutAttorney Docket No 159423.62449011 amino acids in length. In some embodiments, an antigen of interest that binds to MHC Class I is a polypeptide about 8 to about 25 amino acids in length. In some embodiments, an antigen of interest that binds to MHC Class I is a polypeptide about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids in length. In some embodiments, an antigen of interest that binds to MHC Class I is a polypeptide that, in its native protein context contains or is located near a sequence motif that promotes proteasome cleavage, or a sequence motif that promotes Transporter Associated With Antigen Processing (TAP) transport. In some embodiments, an antigen of interest that binds to MHC Class I is a polypeptide that, in its native protein context contains or is located near a sequence motif that promotes cleavage by extracellular or lysosomal proteases (e.g., cathepsins). In some embodiments, an antigen of interest that binds to MHC Class I is a polypeptide that, in its native protein context contains or is located near a sequence motif that promotes HLA-DM catalyzed HLA binding.
[0041] In some embodiments, the antigen of interest or a peptide epitope thereof (e.g., epitope) is presented on the surface of a tumor. The antigen of interest can be immunogenic in a subject having a tumor, e.g., capable of eliciting a T-cell response or a B cell response in the subject The peptide epitope of a tumor antigen of interest can be about 5 to about 30 amino acids or longer in length. In some embodiments, the peptide epitope of a tumor antigen of interest is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids in length,
[0042] In some embodiments, the antigen of interest or a peptide epitope thereof (e.g., epitope) is presented on an HLA protein. In some embodiments, the antigen of interest or epitope binds an HLA molecule with greater affinity than the corresponding peptide identified from the normal, non-cancerous tissue or cells. In some embodiments, the antigen of interest or epitope binds to the HLA protein with an IC50 of less than 500 nM, less than 400 nM, less than 300 nM, less than 200 nM, less than 100 nM, less than 80 nM, less than 50 nM, less than 20 nM, or less than 10 nM.
[0043] Provided herein are methods that involve identification of candidate TCR or antigenbinding fragments thereof that bind to an antigen of interest. In some embodiments, the methods involve computational or bioinformatics analysis of sequences from a biological sample from a subject, for example a patient that has a tumor or a cancer. The sequences analyzed can be RNA and / or DNA sequences. The RNA and / or DNA sequences can be obtained using various high- throughput sequencing methods. The biological sample can be, but is not limited to, a tumor sample or a non-tumor from a subject. For computational or bioinformatics analysis, the sequencesAttorney Docket No 159423.624490from the tumor sample from the subject are compared to sequences obtained from a normal, non-tumorous sample from the subject or from a control subject that does not have cancer. In some aspects, the methods comprise obtaining DNA and / or RNA sequences from a tumor sample from a subject, and comparing the DNA and / or RNA sequences to corresponding DNA and / or RNA sequences from a normal, non-tumorous sample from the same subject and / or from a control sample from a subject that does not have a tumor or cancer.Producing and Enriching an Antigen Specific T Cell Population
[0044] Described herein are methods comprising producing and enriching an antigen specific T cell population. In some embodiments, producing and enriching an antigen specific T cell population comprises: obtaining a population of mononuclear cells; dividing the mononuclear cells into monocyte and lymphocyte populations; obtaining mature dendritic cells from the monocyte population; pulsing the mature dendritic cells with antigenic peptide(s) to produce pulsed mature dendritic cells; co-culturing the pulsed mature dendritic cell population and the lymphocyte population to produce the antigen-specific T cell population or co-culturing the lymphocyte population with artificial antigen-presenting cells (APCs) to produce the antigen-specific T cell population; optionally co-culturing the anti gen- specific T cell population and the pulsed mature dendritic cell population at least once or co-culturing the antigen-specific T cell population with the APCs at least once; and enriching the antigen specific T cell population. APCs can be prepared with any method known in the art and with any method described in PCT Publication No. WO 2024 / 137907
[0045] In some embodiments, the population of mononuclear cells comprise peripheral blood mononuclear cells (PBMCs). In some embodiments, the PBMCs can undergo cell subtype isolation, including T, both CD4 and CD8, cells and CD 14 monocytes. In some embodiments, monocytes can be differentiated into dendritic cells and pulsed with peptides before co-culture with T cells for antigen priming. In some embodiments, repetitive stimulation of T-cells by peptide-DC can be performed. In some embodiments, the antigen-specific T cells can be enriched by bulk-sorting after tetramer-peptide staining, which can be followed by single cell analysis.
[0046] In some embodiments, artificial antigen-presenting cells (APCs) can be used instead of DC.
[0047] In some embodiments, activated antigen-specific T cells can undergo single-cell CITE-seq for downstream analysis.Attorney Docket No 159423.624490
[0048] In some embodiments, obtaining the mature dendritic cells from the monocyte population comprises culturing the monocyte population under conditions to generate immature dendritic cells and differentiating the immature dendritic cells to produce mature dendritic cells.
[0049] In some embodiments, enriching the antigen specific T cell population comprises using tetramer-peptide, dextramer staining and combinations thereof. In some embodiments, the antigenspecific T cells can be analyzed using, but not limited to, tetramer staining conjugated to PE and APC.
[0050] In some embodiments the dextramer can be, but not limited to, dCODE Dextramer®. In some embodiments, the dextramer consists of MHC-peptide complexes conjugated to DNA barcodes. In some embodiment, DNA barcode enables precise antigen recognition and downstream sequencing analysis while integrating unique molecular identifier (UMI) sequence to enhance transcriptomic accuracy
[0051] In some embodiments, the dextramer comprises a barcoded oligonucleotide comprising a partition specific barcode sequence and a unique molecular identifier (UMI) sequence.
[0052] In some embodiments, the methods of the present disclosure comprise labeling the stained antigen specific T cell population with cell labeling molecules comprising a feature barcode oligonucleotide.
[0053] In some embodiments, labeling the stained antigen specific T cell population can be made, but not limited to, by any method disclosed in PCT Publication No. WO 2018 / 140966, PCT Publication No. WO 2018 / 075693, PCT Publication No. WO 2018 / 102473, PCT Publication No WO 2019 / 157529, PCT Publication No. WO 2021 / 222301, PCT Publication No. WO 2021 / 222302.Partitioning Single Cells
[0054] Described herein are methods comprising partitioning single cells. In some embodiments, partitioning single cells comprises using gel beads-in-emulsions (GEMs). In some embodiments, partitioning single cells can be made by, but not limited to, any of the methods disclosed in PCT Publication No. WO 2018 / 140966, PCT Publication No. WO 2018 / 102473, PCT Publication No. WO 2019 / 157529, PCT Publication No. WO 2021 / 222301, and PCT Publication No. WO 2021 / 222302.
[0055] In some embodiments, the TCR discovery platform of the present disclosure combines gene expression, VDJ capture and surface protein analysis with feature barcode technology.Attorney Docket No 159423.624490
[0056] In some embodiments, the methods of the present disclosure comprising the preparation of single-cell suspensions may contain labeling the cells with dextramers for known antigen(s) and barcoded antibodies, i.e., anti-CD4 and anti-CD8, to enable multimodal analysis.
[0057] In some embodiments, the labeled cells can be partitioned into Gel Bead-in-Emulsions (GEMs) using a Chromium Controller (10x Genomics). In some embodiments, each GEM encapsulates a single cell along with barcoded beads and reverse transcription (RT) reagents, including reverse transcriptase, template switch oligos, and barcoded primers.
[0058] In some embodiments, reverse transcription can be performed within the GEMs to generate cell- and feature-barcoded cDNA. In some embodiments, amplification of the cDNA can be performed. In some embodiments, the amplified cDNA can be divided into two fractions. In some embodiments, the supernatant fraction, containing surface protein barcodes, can be processed to construct a cell surface marker library using a standard library preparation kit (I Ox Genomics). In some embodiments, the pellet fraction can be processed to construct a gene expression (GEX) library using a standard library preparation kit (10x Genomics). In some embodiments, the pellet fraction, enriched for T-cell (TCR) sequences, can be subjected to additional amplification. In some embodiments, the pellet fraction, enriched for T-cell receptor (TCR) sequences, can be subjected to additional amplification using TCR-specific primers. In some embodiments, the pellet fraction, enriched for T-cell receptor (TCR) sequences, can be processed to construct a TCR library using a standard library preparation kit (10x Genomics). In some embodiments, the GEX, TCR and cell surface marker libraries can be pooled at a 4.1: 1 molar ratio and sequenced on an Illumina NovaSeq 6000 platform, generating 150-bp paired-end reads.Single Cell Libraries
[0059] Described herein are methods comprising generating a single-cell V(D)J library, a single cell gene expression library, and a single-cell cell surface markers library, wherein the libraries comprise sequences that are tagged with a single-cell specific barcode and a unique molecular identifier (UMI) sequence. The single cell libraries can be prepared by any method known in the art and by any method disclosed in PCT Publication No. WO 2018 / 075693, PCT Publication No WO 2020 / 047010, PCT Publication No. WO 2020 / 047002, and PCT Publication No. WO 2021 / 236929.Attorney Docket No 159423.624490
[0060] Described herein are methods comprising generating sequencing data by performing sequencing of the single-cell V(D)J, single-cell gene expression, and single cell surface markers libraries.
[0061] Described herein are methods comprising using sequencing data to identify distinct antigen specific T cell populations and their unique V(D)J nucleotide sequence.
[0062] In some embodiments, Single Molecule Sequence Extraction (SMSE) can be used for Forward Primer Design from 10X Genomics single-cell sequencing data. In some embodiments, V(D)J sequencing data can be first realigned using Bwa-mem, followed by custom Python scripts to organize and associate each cell barcode with its unique molecular identifiers (UMIs).
[0063] In some embodiments, critical selection criteria are applied for the selection of selection of high-abundance candidates, including abundance (top 5 most frequent barcodes), primer design viability, uniqueness (minimum 12nt length), melting temperature (target Tm within 1–2°C of target), and GC content (42-60% with an ideal 50%). In some embodiments, these parameters guide the SMSE Forward Primer Design Workflow, which optimizes primer selection using Primer3 software to ensure efficient amplification.
[0064] Described herein are methods comprising designing primer sequences for amplification of the TCR comprising the identified unique V(D)J nucleotide sequence, wherein the primer sequences are designed based on the partition specific barcode sequence and the UMI sequence. In some embodiments, designing primer sequences comprises using single molecule sequence extraction (SMSE)
[0065] Described herein are methods performing a two-round amplification procedure to obtain two amplification products, wherein the first amplification product comprises nucleic acid encoding a full-length β variable (Vβ) and a full-length β constant (Cβ) and the second amplification product comprises nucleic acid encoding a full-length α variable (Vα) and a full-length α constant (Cα). The amplification products are assembled into a nucleic acid vector to obtain an assembled nucleic acid vector for the TCR comprising the identified unique V(D)J nucleotide sequence, wherein the assembled nucleic acid vectors for the TCR comprising the identified unique V(D)J nucleotide sequence comprise a nucleic acid encoding a functional TCR.
[0066] In some embodiments, two nucleic acids, one encoding a full-length β variable (Vβ) and a full-length β constant (Cβ) and one encoding a full-length α variable (Vα) and a full-length α constant (Cα), is synthesized (e.g., by chemical synthesis (e.g., gene block) or amplification (e.g.,Attorney Docket No 159423.624490PCR)) as linear nucleic acids containing, at the 5' and 3' ends, sequences suitable for use in Gibson cloning into a vector to obtain an assembled nucleic acid vector for the TCR comprising the identified unique V(D)J nucleotide sequence. The sequences suitable for use in Gibson cloning comprise sequences about 20 to about 40 nucleotides in length that overlap with (are complementary to) sequences in the nucleic acids or sequences in the vector into which the nucleic acid encoding the TCR is to be cloned (inserted).. The overlapping sequences facilitate seamless (e.g., Gibson) cloning. In some embodiments, the vector for the TCR contains, a promoter, a first 2A element, and a first marker. The first marker can be, but is not limited to, a selectable marker suitable for use in mammalian cells The selectable marker can be, but is not limited to, a resistance gene. The resistance gene can be, but is not limited to, an antibiotic resistance gene. The antibiotic resistance gene can be, but is not limited to, a puromycin resistance gene. In some embodiments, the vector further comprises a second 2A element and second marker in frame with the first selectable marker. The second marker can be, but is not limited to, a detectable marker that is detectable in mammalian cells. The detectable marker can be, but is not limited to, a cell surface protein (e.g., tNGFR) or a fluorescent protein. In some embodiments, the vector further comprises a posttranscriptional regulatory element downstream of the first and / or second markers. The posttranscriptional regulatory element can be, but is not limited to, a Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE). In some embodiments, the vector further comprises a bacterial selectable marker (e.g., an ampicillin resistance gene). In some embodiments, the vector further comprises a TRAC-targeted integration site, a T2A-linked RQR8 safety marker, a WPRE for enhanced expression, an origin of replication (Ori), and kanamycin resistance (KanR) for bacterial selection.
[0067] To insert the nucleic acids encoding the full-length p variable (Vp), full-length constant (CP), full-length a variable (Va) and full-length a constant (Ca) into the vector by seamless cloning, the vector is first linearized (either through digestion of a circular plasmid or synthesis (e.g., by PCR) of a linear vector) such that the vector contains a gap (e.g., double strand break) between the sequence encoding the promoter and the first 2A element. The nucleic acids encoding the full-length variable (VP), full-length 3 constant (CP), full-length P2A, full-length a variable (Va) and full-length a constant (Ca) are incubated with the linearized vector, enzymes (e.g., exonuclease, DNA polymerase, and DNA ligase) and other components suitable for performing seamless (e g., Gibson) cloning. Following seamless cloning, the vectors for the TCR areAttorney Docket No 159423.624490transformed into bacteria. In some embodiments, plasmid is isolated from the bacteria without plating or isolating bacterial colonies. In some embodiments, multiple nucleic acids encoding different unique V(D)J nucleotide sequences are cloned into the vector in parallel. In some embodiments, about 1 to about 500 TCR expression vectors are cloned in parallel. In some embodiments, about 1 to about 100 TCR expression vectors are cloned in parallel. In some embodiments, the cloning reaction is performed in about 0.1 to about 500 µL. In some embodiments, the cloning reaction is performed in less than 1 µL. In some embodiments, the cloning reaction is performed in about 0.1 µL, about 0.15 µL, about 0.2 µL, about 0.25 µL, about 0.3 µL, about 0.35 µL, about 0.4 µL, about 0.45 µL, about 0.5 pL, about 0.55 pL, about 0.6 µL, about 0.65 pL, about 0.7 pL, about 0.75 pL, about 0.8 pL, about 0.85 pL, about 0.9 pL, or about 0.95 pL. In some embodiments, the cloning reaction is performed in about I to about 50 pL. In some embodiments, the cloning reaction is performed in about 1 pL, about 1.5 pL, about 2 pL, about 2.5 pL, about 3 pL, about 4 pL, about 5 pL, about 6 pL, about 7 pL, about 8 pL, about 9 pL, about 10 pL, about 15 pL, about 20 pL, about 25 pL, about 30 pL, about 40 pL, or about 50 pL.
[0068] The identified TCRs can be used to generate engineered cells that express heterologous TCRs. Compositions and methods of treatment involving administering such TCRs and / or engineered cells are also described. In some embodiments, the engineered cells that express the identified TCRs, or antigen-binding fragments thereof, exhibit cytotoxic activity against target cells expressing the tumor neoantigen or an epitope thereof, such as cancer cells or tumor cells.
[0069] In some embodiments, TCRs, including tumor antigen-targeting TCRs, identified by any of the embodiments described herein are provided. In some embodiments, such identified TCRs can be used in a method of treatment or as a therapeutic.
[0070] In some embodiments, also provided herein are nucleic acids, such as polynucleotides, that encode any of the identified TCRs, such as tumor neoantigen-targeting TCRs.
[0071] The identified TCRs can be used to engineer cells, such as T cells, for use in therapy, such as, but not limited to, adoptive cell therapy (ACT). Also provided are compositions comprising the engineered cells described herein. The T cell can be, but is not limited to, a CD4+ T cell, a CD8+ T cell, or a CD4+ / CD8+ T cell, a naive T (TN) cell, an effector T (TEFF) cell, a memory T cell, a stem cell memory T (TSCM) cell, a central memory T (TCM) cell, an effector memory T (TEM) cell, a terminally differentiated effector memory T cell, tumor-infiltrating lymphocyte (TIL), an immature T cell, a mature T cell, a helper T cell (including TH1, TH2, TH3, THI7, TH9,Attorney Docket No 159423.624490and TH22 ceils), follicular helper T cells, a cytotoxic T cell, a mucosa-associated invariant T (MAIT) cell, an adaptive regulatory T (Treg) cell, alpha / beta T cells, or delta / gamma T cells. In some embodiments, the cells are NK cells.
[0072] Also provided herein are methods of administering and uses, such as therapeutic and prophylactic uses, of the TCRs and antigen-binding fragments thereof identified or isolated in accordance with the provided embodiments and / or engineered cells expressing the TCRs or antigen-binding fragments thereof. Such methods and uses include therapeutic methods and uses, for example, involving administration of the molecules, cells, or compositions containing the same, to a subject having a tumor or a cancer. In some embodiments, the molecule, cell, and / or composition is administered in an effective amount to effect treatment of the tumor or cancer. Uses include uses of the TCRs and cells in such methods and treatments, and in the preparation of a medicament in order to carry out such therapeutic methods. In some embodiments, the methods are carried out by administering the TCRs or cells, or compositions comprising the same, to the subject having, having had, or suspected of having the tumor or cancer. In some embodiments, the methods thereby treat the tumor or cancer or disorder in the subject.
[0073] Among the diseases to be treated are cancers or tumors, or a disease associated with malignancy or transformation of cells.
[0074] The disclosure will be further clarified by the following examples, which are intended to be purely exemplary of the disclosure and in no way limiting.EXAMPLESExample 1: Workflow for end-to-end TCR discovery with known antigen
[0075] An exemplary schematic outline of the workflow for TCR discovery platform is provided in FIG. 1. This process begun with antigen-specific T cell enrichment, followed by T cell labeling to distinguish antigen-reactive populations. Next, single-cell library construction was performed using 10x genomics system followed by NGS and data analysis to identify candidate TCR sequences. DNA synthesis was then employed to generate TCR expressing viral vector constructs. The final step, TCR functional screening, assessed the ability of identified TCRs to recognize and respond to their target antigens in cell-based assays.Example 2: Antigen-specific T-cell enrichment processesAttorney Docket No 159423.624490
[0076] The workflow for antigen-specific priming and activation of human T-cells processes to enrich antigen-specific T cells is illustrated in FIGS. 2A-2B. Peripheral blood mononuclear cells (PBMCs) underwent cell subtype isolation, including T, both CD4 and CD8, cells and CD14 monocytes (FIG. 2A). Monocytes were differentiated into dendritic cells (DCs) and pulsed with peptides before co-culture with T cells for antigen priming. Repetitive stimulation of T-cells by peptide-DC was performed until it reached the level of detection by flow cytometry. Then the antigen-specific T cells were enriched by bulk-sorting after tetramer-peptide staining, which was followed by single cell analysis. In an alternative approach (FIG.2B), artificial antigen-presenting cells (APCs) were used instead of DCs. This alternative approach was at least 1-2 weeks faster. Activated antigen-specific T cells underwent single-cell CITE-seq for downstream analysis. Example 3: Antigen-specific CDS T-cells identification after enrichment process
[0077] FIGS.3A-3B demonstrate how antigen-Specific T Cells were enriched and identified after priming and stimulation by peptide-Loaded artificial APCs (aAPCs) aAPCs were generated using K562 cells expressing HLA-A*02:01 and CD86, which were thawed, expanded through three passages, and treated with Mitomycin C before pulsing with peptide (10 pg / mL). These peptide- pulsed aAPCs were co-cultured with T cells isolated from PBMCs at a 1:1 ratio in media supplemented with IL-21, IL-7, and IL-15. On Day 8, freshly peptide-pulsed aAPCs were added again to the CDS’ T cell culture at a 1:1 ratio with continued IL-7 and IL-15 supplementation. On Day 13, antigen-specific T cells were analyzed using tetramer staining conjugated to PE and APC. By Day 16, the cells were harvested, stained with dextramer and tetramer, and antigen-specific T cells were identified and enriched through bulk sorting of tetramer-positive cells. FIG.3A presents T cell growth performance after priming and stimulation by peptide-Loaded artificial APCs (aAPCs). FIG. 3B presents antigen-Specific T Cells evaluation on DI 3 through flow cytometry analysis, highlighting 0.05% antigen-specific CD8+T cells identified.Example 4: Antigen-specific T cell labeling and single cell CITE sequencing analysis
[0078] Schematic representation of the workflow for antigen-specific T-cell identification using dCODE Dextramer® technology and single-cell sequencing is provided in FIGS. 4A-4B. The stained cells were labeled with TotalSeq™ antibodies for phenotypic characterization and analyzed via fluorescence-activated cell sorting (FACS). Sorted cells underwent Chromium single-cell analysis, where unique DNA barcodes from dCODE Dextramers®, TCR sequences (V(D)J), surface markers (CITE-seq), and gene expression profiles were captured. Next-generationAttorney Docket No 159423.624490sequencing (NGS) was performed, allowing for the identification of antigen-specific T cells and their phenotype based on integrated sequencing data (FIG. 4A) FIG. 4B illustrates the structure of the dCODE Dextramer® reagents, consisting of MHC -peptide complexes conjugated to DNA barcodes, used to stain antigen-specific T cells. Its DNA barcode enables precise antigen recognition and downstream sequencing analysis while integrating UMIs to enhance transcriptomic accuracy.
[0079] This immune profiling workflow used in the TCR discovery platform combines gene expression and surface protein analysis with feature barcode technology. Single-cell suspensions were prepared, and cells were labeled with dextramers for known antigen and barcoded antibodies, i.e., anti-CD4 and anti-CD8, to enable multimodal analysis. Labeled cells were partitioned into Gel Bead-in-Emulsions (GEMs) using a Chromium Controller (10x Genomics). Each GEM encapsulated a single cell along with barcoded beads and reverse transcription (RT) reagents, including reverse transcriptase, template switch oligos, and barcoded primers. Reverse transcription was performed at 48°C for 45 minutes within the GEMs to generate cell- and feature- barcoded cDNA. Following RT, GEMs were disrupted using a recovery agent, and cDNA was purified using Dynabeads™ MyOne™ Silane (Thermo Fisher). Amplification of cDNA was performed using the following thermal cycling conditions: 98°C for 45 seconds, followed by 12 cycles of 98°C for 20 seconds, 63°C for 30 seconds, and 72°C for 1 minute, and a final extension at 72°C for 1 minute. The amplified cDNA was incubated with SPRIselect beads (Beckman Coulter) to produce two fractions, a supernatant fraction and a pellet fraction, which contain DNA fragments of different sizes. The supernatant fraction, containing surface protein barcodes, was processed to construct a cell surface marker library using a standard library' preparation kit (10x Genomics). The pellet fraction, enriched for T-cell receptor (TCR) sequences, was processed to construct a gene expression (GEX) library using a standard library preparation kit (10x genomics) and was subjected to additional amplification using TCR-specific primers for construction of a TCR library using a standard library’ preparation kit (10x genomics). The GEX, TCR and cell surface marker libraries were pooled at a 4.1: 1 molar ratio and sequenced on an Illumina NovaSeq 6000 platform, generating 150-bp paired-end reads.Example 5: Single-cell CITE sequencing data analysis pipeline.
[0080] The single-cell RNA sequencing data analysis pipeline used in the TCR discovery platform is outlined in FIG. 5. Raw sequencing data were processed using Cell Ranger (v6.1, lOxAttorney Docket No 159423.624490Genomics), where sequencing reads were demultiplexed, aligned to the reference genome (GRCh38), and quantified to generate a feature-barcode matrix. Data preprocessing included the generation of a barcode rank plot and sequencing saturation analysis to assess library complexity and sequencing depth. High-quality cells were identified based on a minimum of 500 unique molecular identifiers (UMIs) per cell and mitochondrial RNA content below 10%.
[0081] Quality control metrics, such as total RNA counts, feature RNA counts, and mitochondrial percentages, were visualized using violin plots and scatterplots. Doublets were identified computationally and excluded from downstream analysis. Normalization of gene expression data was performed using the “LogNormalize” method, where expression measurements were scaled to a standard factor of 10,000 and log-transformed. This process ensured accurate comparison of expression levels across cells while minimizing technical variation. Cell cycle scoring and regression were applied to remove cell cycle-related effects from the data. Each cell was assigned a phase (Gl, S, or G2 / M) based on the expression of canonical markers (e.g., MKI67, TOP2A). Dimensionality reduction was performed using principal component analysis (PCA) and Uniform Manifold Approximation and Projection (UMAP) to visualize distinct cell populations
[0082] Clusters were identified using graph-based clustering algorithms, and cell types were annotated based on known marker genes. Differentially expressed genes were analyzed to identify markers unique to each cluster, Dextramer-labeled antigen-specific T cells were identified and evaluated for clonal diversity through analysis of T-cell receptor (TCR) sequences. The resulting UM AP plots and feature plots revealed distinct immune cell subsets and their antigen specificity.Example 6: Figure 6 T cell subtype clustering and TCR a CDR3 sequence clonotype analysis from selected T cells.
[0083] A representative UMAP plot (left) from single-cell transcriptomic and CITE-seq data, identifying distinct immune cell populations, including CD8+ effector memory T cells, CD8+ central memory T cells, residual naive B cells, and natural killer cells is shown in FIG, 6. Specific T cell clusters of interest are highlighted with blue and green annotations. The corresponding tables (FIG. 6, right) list TCR aP clonotypes, displaying V(D)J gene segments, CDR3 sequences, and the number of cells sharing each clonotype. Clonotypes were ranked based on cell frequency. This integration of single-cell CITE-seq and TCR sequencing enables the identification of antigen-specific T cells and their associated TCR repertoires.Attorney Docket No 159423.624490Example 7: Single Molecule Sequence Extraction (SMSE) workflow and Forward Primer Design from 1 OX Genomics single-cell sequencing data.[00841 The workflow for Single Molecule Sequence Extraction (SMSE) to design Forward Primer Design from 10X Genomics single-cell sequencing data is illustrated in FIG. 7A. Sequencing data from the V(D)J workflow were first realigned using Bwa-mem, followed by custom Python scripts to organize and associate each cell barcode with its unique molecular identifiers (UMIs). A major challenge here was the presence of up to 10,000 candidate sequences sharing the same VDJ region but differing in barcode and UMI, necessitating the selection of high-abundance candidates for sufficient and effective amplification followed by DNA vector construction. To address this, an innovative computational workflow applied critical selection criteria, including abundance (top 5 most frequent barcodes), primer design viability, uniqueness (minimum 12nt length), melting temperature (target Tm within 1-2°C of target), and GC content (42-60% with an ideal 50%). These parameters guided the SMSE Forward Primer Design Workflow, which optimizes primer selection using Primer3 software to ensure efficient amplification. The distribution of high- and low-abundance TCR sequences, showing that <0.05% of identified sequences are high-abundance is illustrated in FIG. 7B Table 1 and FIG. 7C summarize selected high-abundance TCR barcodes through SMSE method with their respective primer sequences, Tm, and GC content. This comprehensive approach enabled precise TCR candidate selection, facilitating cloning, expression, and functional validation for downstream applications.Table 1.Tm GC Barcode Abundance Primer Sequence(°C) (%) ATTACAATCGCCATGGATACT2627 ACAATCGCCATGGATACTAGGG 59.7 50 AGGGACT GTC AATCCA AC AG AATTA A CC2106 TCAATCCAACAGAATTAACCTCGG 59.06 41.67 TCGGGTT A CGTATTAGATGACGGGG CG1952 ACGTATTAGATGACGGGGCG 59.69 55 GCCGTATG GTAGCACTCAAACCATGCTAC1942 GCACTCAAACCATGCTACATCG 60.22 50 ATCGGTAAttorney Docket No 159423.624490GCATGAACAACACGCCAGGT1932 GCATGAACAACACGCCAGG 60.08 57.89 ATTACGGCExample 8: Figure 8 TCR αβ expression vector construction.
[0085] A schematic representation of the TCR αβ chains sequence amplification and expression vector construction is presented in FIGS. 8A-8D. Illustration of two-round PCR for the TCR ap transgene amplification, including TRBV (TCR β variable), TRBC (TCR β constant), P2A self¬ cleaving peptide, TRAV (TCR α variable) and TRAC (TCR α constant) components is provided in FIG. 8A. F1 primer was designed using SMSE approach as mentioned above. The amplicons from 1st round of PCR were followed by 2nd round of PCR with gene-specific specific primers, F2 and Rev2, and synthesized TCR o. sequences were assembled into expression cassette under the MNDU3 promoter, with overlaps on 5’ and 3’ ends for seamless cloning of fragments (FIG.8B). Additional vector elements include T2A-linked RQR8 safety marker, WPRE for enhanced expression, origin of replication (Ori), and kanamycin resistance (KanR) for bacterial selection. Two-rounds PCR generated the targeted alpha and beta chains, as shown by electrophoresis (FIG.8C), with sequences confirmed via Sanger sequencing (FIG. 8D and Table 2).Table 2.- 2-Attorney Docket No 159423.624490TRAViAiY F ft A 1 £ A 2. Y 8 8 ft R ft 5 F & %T T Aft T T C T G Tft CTAC G ft A GftftftC T AT AT A AC CA ftft GA ft ft A AA 8 C T T A T C T TO 8G AC AT T A C T T C T G T 6 C T A 0 S G A ft Q C C C T A T A T A A C C A ft ft ft A 86 A A A ft ft T T A T C I I C ft ft A C AT T A C T T C T 0 T G ft 1 A C ft G A ft ft C ft ft T A T AT A A C C A G ft ft A G G A A A ft C T T A T C T T C ft ft A G AT T A ft T T ft T ft T ft ft T A C ft ft A ft ft ft ft C T A T A T A A ft ft A ft ft ft A ft G A A A ft ft T 7 A T ft T T ft ft ft A ft AT r A C T T ft T G T ft C T A C G ft A G G ft ft C T A T A T A A ft ft A 6 ft G A ft ft A A A G C T T A T ft I T ft G G A ft ATR8V4-1I ft A & ft ft ft I ft T ft Y? ft CTCT8CGCCAGCASCCAASATCT6SATA£6CA$TATT TTS®‘ft T ft T ft ft G ft ft A ft ft A 8 ft C A A G A T ft T ft GA T A C ft GAG T A T T T T ft ft <C f ft T ft ft G C G A ft ft A G G G A A G A T G T ft G A T A C ft ft A G T A T T T T G ft <C r C T ft ft G ft ft A G ft A ft ft C A A ft A T C T ft ft A T A C ft C A ft T A T T I T G G *C T ft T G C ft ft C A G C A ft C ft A A ft A T ft T ft ft A T A ft ft ft A ft T A T 11 T G G >Example 9: TCR functional validation.
[0086] TCR-containing LVVs were produced and transduced into Jurkat cells for TCR function validation (FIG. 9). Jurkat cells expressing the identified TCRs were co-cultured with peptide-pulsed K562 antigen-presenting cells, and CD69 expression, a marker of TCR activation, was assessed by flow cytometry and plotted as a function of peptide concentration. The blue squares and purple circles represent the two validated TCRs, both exhibiting dose-dependent CD69 upregulation, confirming antigen-specific TCR activation. The green triangles indicate the negative control, where no significant CD69 expression was observed. These results validate the functionality of the identified TCRs, demonstrating their ability to recognize antigen and trigger downstream activation.Attorney Docket No 159423.624490INCORPORATION BY REFERENCE
[0087] All references, articles, publications, patents, patent publications, and patent applications cited herein are incorporated by reference in their entireties for all purposes. However, mention of any reference, article, publication, patent, patent publication, and patent application cited herein is not, and should not be taken as an acknowledgment or any form of suggestion that they constitute valid prior art or form part of the common general knowledge in any country in the world.
Claims
Attorney Docket No 159423.624490CLAIMSWhat is claimed is:
1. A method for identifying a T cell receptor (TCR) or antigen-binding fragment thereof that binds to an antigen of interest associated with a disease or condition, the method comprising:a) producing and enriching an antigen specific T cell population by:obtaining a population of mononuclear cells,dividing the mononuclear cells into monocyte and lymphocyte populations; obtaining mature dendritic cells from the monocyte population;pulsing the mature dendritic cells with antigenic peptide(s) to produce pulsed mature dendritic cells;co-culturing the pulsed mature dendritic cell population and the lymphocyte population to produce the antigen-specific T cell population or co-culturing the lymphocyte population with artificial antigen-presenting cells (APCs) to produce the antigen-specific T cell population;optionally co-culturing the antigen-specific T cell population and the pulsed mature dendritic cell population at least once or co-culturing the antigen-specific T cell population with the APCs at least once; andenriching the antigen specific T cell population,b) partitioning single cells,c) generating a single-cell V(D)J library, a single cell gene expression library, and a single-cell cell surface markers library, wherein the libraries comprise sequences that are tagged with a single-cell specific barcode and a unique molecular identifier (UMI) sequence,d) generating sequencing data by performing sequencing of the single-cell V(D)J, single-cell gene expression, and single cell surface markers libraries,Attomey Docket No 159423.624490e) using the sequencing data to identify distinct antigen specific T cell populations and their unique V(D)J nucleotide sequence,f) designing primer sequences for amplification of the TCR comprising the identified unique V(D)J nucleotide sequence, wherein the primer sequences are designed based on the partition specific barcode sequence and the UMI sequence,g) performing a two-round amplification procedure to obtain two amplification products, wherein the first amplification product comprises nucleic acid encoding a full-length P variable (VP) and a full-length constant (Cp) and the second amplification product comprises nucleic acid encoding a full-length a variable (Ya) and a full-length a constant (Ca). The amplification products are assembled into a nucleic acid vector to obtain an assembled nucleic acid vector for the TCR comprising the identified unique V(D)J nucleotide sequence, wherein the assembled nucleic acid vectors for the TCR comprising the identified unique V(D)J nucleotide sequence comprise a nucleic acid encoding a functional TCR.
2. The method of claim 1, wherein obtaining the mature dendritic cells from the monocyte population comprises culturing the monocyte population under conditions to generate immature dendritic cells and differentiating the immature dendritic cells to produce mature dendritic cells.
3. The method of claim 1, wherein enriching the antigen specific T cell population comprises using tetramer-peptide, dextramer staining and combinations thereof.
4. The method of claim 3, wherein the dextramer comprises a barcoded oligonucleotide comprising a partition specific barcode sequence and a unique molecular identifier (UMI) sequence.Attorney Docket No 159423.6244905. The method of claim 1, comprising labeling the stained antigen specific T cell population with cell labeling molecules comprising a feature barcode oligonucleotide,6. The method of claim 1, wherein partitioning single cells comprises using gel beads-in- emulsions (GEMs).
7. The method of claim 1, wherein designing primer sequences comprises using single molecule sequence extraction (SMSE).
8. A method for identifying a T cell receptor (TCR) or antigen-binding fragment thereof that binds to an antigen of interest associated with a response to a therapeutic treatment and / or to an antigen of interest associated with a recurrence of a disease or condition, the method comprising:a) producing and enriching an antigen specific T cell population by:obtaining a population of mononuclear cells;dividing the mononuclear cells into monocyte and lymphocyte populations; obtaining mature dendritic cells from the monocyte population;pulsing the mature dendritic cells with antigenic peptide(s) to produce pulsed mature dendritic cells;co-culturing the pulsed mature dendritic cell population and the lymphocyte population to produce the antigen-specific T cell population or co-culturing the lymphocyte population with artificial antigen-presenting cells (APCs) to produce the antigen-specific T cell population;optionally co-culturing the antigen-specific T cell population and the pulsed mature dendritic cell population at least once or co-culturing the antigen-specific T cell population with the APCs at least once; andenriching the antigen specific T cell population,b) partitioning single cells,Attorney Docket No 159423.624490c) generating a single-cell V(D)J library, a single cell gene expression library, and a single-cell cell surface markers library, wherein the libraries comprise sequences that are tagged with a single-cell specific barcode and a unique molecular identifier (UMI) sequence,d) generating sequencing data by performing sequencing of the single-cell V(D)J, single-cell gene expression, and single cell surface markers libraries,e) using the sequencing data to identify distinct antigen specific T cell populations and their unique V(D)J nucleotide sequence,f) designing primer sequences for amplification of the TCR comprising the identified unique V(D)J nucleotide sequence, wherein the primer sequences are designed based on the partition specific barcode sequence and the UMI sequence,g) performing a two-round amplification procedure to obtain two amplification products, wherein the first amplification product comprises nucleic acid encoding a full-length P variable (VP) and a full-length constant (Cp) and the second amplification product comprises nucleic acid encoding a full-length a variable (Va) and a full-length a constant (Co.). The amplification products are assembled into a nucleic acid vector to obtain an assembled nucleic acid vector for the TCR comprising the identified unique V(D)J nucleotide sequence, wherein the assembled nucleic acid vectors for the TCR comprising the identified unique V(D)J nucleotide sequence comprise a nucleic acid encoding a functional TCR.
9. The method of claim 8, wherein obtaining the mature dendritic cells from the monocyte population comprises culturing the monocyte population under conditions to generate immature dendritic cells and differentiating the immature dendritic ceils to produce mature dendritic cells.Attorney Docket No 159423.62449010. The method of claim 8, wherein enriching the antigen specific T cell population comprises using tetramer-peptide, dextramer staining and combinations thereof11. The method of claim 10, wherein the dextramer comprises a barcoded oligonucleotide comprising a partition specific barcode sequence and a unique molecular identifier (UMI) sequence.
12. The method of claim 8, comprising labeling the stained antigen specific T cell population with cell labeling molecules comprising a feature barcode oligonucleotide.
13. The method of claim 8, wherein partitioning single cells comprises using gel beads-in- emulsions (GEMs).
14. The method of claim 8, wherein designing primer sequences comprises using single molecule sequence extraction (SMSE).