Small interfering RNA compounds for targeting ferredoxin 2 (FDX2) and method of treating friedreich ataxia (FRDA)

WO2026198818A2PCT designated stage Publication Date: 2026-09-24THE GENERAL HOSPITAL CORP +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2026/019991
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-03-19
Filing Date
2026-03-19
Publication Date
2026-09-24

Smart Images

  • Figure US2026019991_24092026_PF_FP_ABST
    Figure US2026019991_24092026_PF_FP_ABST
Patent Text Reader

Abstract

Described herein are compositions and methods for treating subjects with disorders associated with mutations in the FXN gene and / or that have reduced expression of frataxin protein, e.g., Friedreich ataxia (FRDA), using inhibitors of ferredoxin 2 (FDX2) that decreases FDX2 protein expression.
Need to check novelty before this filing date? Find Prior Art

Description

WSGR Docket No. 71197-703.601SMALL INTEFERING RNA COMPOUNDS FOR TARGETING FERREDOXIN 2 (FDX2) AND METHOD OF TREATING FRIEDREICH ATAXIA (FRDA)CROSS-REFERENCE

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 774,543, filed March 19, 2025, which is incorporated herein by reference in its entirety.BACKGROUND OF THE DISCLOSURE

[0002] Friedreich (or Friedreich’s) ataxia (FRDA) is an autosomal recessive inherited disease that causes progressive damage to the nervous system, resulting in movement problems. FRDA affects approximately 1 in 50,000 people, making it the most common Mendelian monogenic mitochondrial disease. Symptoms typically first appear at 5-15 years of age, followed by progressive neurodegeneration. Typically, within 10 years following the onset of symptoms, the patient is wheelchair-bound. FRDA presents with ataxia, cardiomyopathy, and increased incidence of diabetes, and unfortunately patients have an average lifespan of 37.5 years with limited treatment options.INCORPORATION BY REFERENCE

[0003] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.SUMMARY OF THE DISCLOSURE

[0004] Provided herein are compounds (e.g., oligonucleotides, siRNAs) and methods for treating a subject having a disorder associated with a mutation in the frataxin (FXN) gene and / or having reduced expression of frataxin protein. The methods comprise administering to the subject a therapeutically effective amount of an inhibitor of human ferredoxin 2 (FDX2) that decreases FDX2 protein expression.

[0005] In some embodiments, the inhibitor of FDX2 comprises an inhibitory nucleic acid targeting the FDX2 gene. In some embodiments, the inhibitor of FDX2 comprises a modified double-stranded inhibitory oligonucleotide. In some embodiments, the inhibitory nucleic acid comprises an antisense strand targeting the FDX2 nucleic acid. In some embodiments, the inhibitory nucleic acid comprises a siRNA targeting the FDX2 nucleic acid.

[0006] Provided herein is a modified double-stranded inhibitory oligonucleotide comprising an antisense strand and a sense strand, wherein the antisense strand has at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 98%, or aboutWSGR Docket No. 71197-703.601100% identical to a reverse complementary sequence of nucleobases of positions 45-64, 136-184, 214-304, 331-400, 406-634, 646-709, 721-739, 766-831, 916-934, or 961-994 from the 5’ end of SEQ ID NO: 1.

[0007] Additionally provided herein is a modified double-stranded inhibitory oligonucleotide comprising an antisense strand and a sense strand, wherein the antisense strand comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of a reverse complementary sequence of nucleobases of positions 45-64, 136-184, 214-304, 331-400, 406-634, 646-709, 721-739, 766-831, 916-934, or 961-994from the 5’ end of SEQ ID NO: 1.

[0008] In some embodiments, the antisense strand comprises about 12 to about 30 linked nucleosides and having a nucleobase sequence comprising about 8 to about 19 consecutive nucleobases of any one of the nucleobase sequences of SEQ ID NOs: 9-75, 143-209, 277-343, 411-507, or 1007-1103; and the sense strand comprises about 12 to about 30 linked nucleosides and having a nucleobase sequence comprising about 8 to about 19 consecutive nucleobases of any one of the nucleobase sequences of SEQ ID NOs: 76-142, 210-276, 344-410, 508-604, or 1104-1200. In some embodiments, the antisense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleobases of any one of the nucleobase sequences of SEQ ID NOs: 9-75, 143-209, 277-343, 411-507, or 1007-1103, with no more than 1, 2, or 3 mismatches. In some embodiments, the antisense strand comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identity to any one of SEQ ID NOs: 9-75, 143-209, 277-343, 411-507, or 1007-1103. In some embodiments, the antisense strand consists of any one of the nucleobase sequences of SEQ ID NOs: 9-75, 143-209, 277-343, 411-507, or 1007-1103. In some embodiments, the sense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleobases of any one of the nucleobase sequences of SEQ ID NOs: 76-142, 210-276, 344-410, 508-604, or 1104-1200, with no more than 1, 2, or 3 mismatches. In some embodiments, the sense strand comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identity any one of SEQ ID NOs: 76-142, 210-276, 344-410, 508-604, or 1104-1200. In some embodiments, the sense strand consists of any one of the nucleobase sequences of SEQ ID NOs: 76-142, 210-276, 344-410, 508-604, or 1104-1200. In some embodiments, the antisense sense strand consists of 19 to 23 nucleosides. In some embodiments, the sense strand consists of 19 to 21 nucleosides. In some embodiments, the modified double-stranded inhibitory oligonucleotide is a small interfering RNA (siRNA). In some embodiments, the modified double-stranded inhibitory oligonucleotide comprises at least one modified sugar moiety, at least one modified internucleoside linkage, or at least one modified nucleobase. In some embodiments, the antisense strand and the sense strand each independently comprise one or more modified sugar moi eties selected from a 2’-F sugar moiety,WSGR Docket No. 71197-703.601a 2’-0Me sugar moiety, and a 2’-M0E sugar moiety, or a sugar surrogate selected from 2’-deoxy, UNA, and GNA. In some embodiments, the antisense strand comprises 21 nucleosides, and the antisense strand is modified with a modification pattern (5’ to 3’) of yfyyyfyffyyyyfyfyyyyy, wherein each ‘y’ represents a 2’-0Me modified nucleotide and each ‘f represents a 2’-F modified nucleotide. In some embodiments, the sense strand comprises 19 nucleosides, and the sense strand is modified with a modification pattern (5’ to 3’) of yyyyfyfffyyyyyyyyyy, wherein each ‘y’ represents a 2’-0Me modified nucleotide and each ‘f represents a 2’-F modified nucleotide. In some embodiments, the antisense strand or the sense strand comprise at least one modified internucleoside linkage. In some embodiments, the at least one modified internucleoside linkage is a phosphorothioate intemucleoside linkage, a phosphorodithioate intemucleoside linkage, a mesyl phosphoramidate intemucleoside linkage, a phosphotriester intemucleoside linkage, or a methoxypropyl phosphonate intemucleoside linkage. In some embodiments, the antisense strand comprises 21 nucleosides, and the antisense strand has an internuclsoside linkage motif (5’ to 3’) of ssooooooooooooooooss, wherein each ‘o’ represents a phosphodiester intemucleoside linkage and each ‘s’ represents a phosphorothioate intemucleoside linkage. In some embodiments, the sense strand comprises 19 nucleosides, and the sense strand has an intemucleoside linkage motif (5’ to 3’) of ssoooooooooooooooo, wherein each ‘o’ represents a phosphodiester intemucleoside linkage and each ‘s’ represents a phosphorothioate intemucleoside linkage. In some embodiments, the antisense strand comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleobases selected from SEQ ID NOs: 672-738, 873-1006, or 1298-1394. In some embodiments, the sense strand comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleobases selected from SEQ ID NOs: 605-671, 739-872, or 1201-1297. In some embodiments, the antisense strand comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identity to any one of SEQ ID NOs: 672-738, 873-1006, or 1298-1394. In some embodiments, the antisense strand consists of any one of SEQ ID NOs: 672-738, 873-1006, or 1298-1394. In some embodiments, the sense strand comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identity to any one of SEQ ID NOs: 605-671, 739-872, or 1201-1297. In some embodiments, the sense strand consists of any one of SEQ ID NOs: 605-671, 739-872, or 1201-1297.

[0009] Additionally provided herein is a modified double-stranded oligonucleotide comprising an antisense strand and a sense strand, wherein the antisense strand comprises about 12 to about 30 linked nucleosides and having a nucleobase sequence comprising about 8 to about 19 consecutive nucleobases of any one of the nucleobase sequences of SEQ ID NOs: 9-75, 143 -209, 277-343, 411-507, or 1007-1103; and the sense strand comprises about 12 to about 30WSGR Docket No. 71197-703.601linked nucleosides and having a nucleobase sequence comprising about 8 to about 19 consecutive nucleobases of any one of the nucleobase sequences of SEQ ID NOs: 76-142, 210-276, 344-410, 508-604, or 1104-1200. In some embodiments, the antisense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleobases of any one of the nucleobase sequences of SEQ ID NOs: 9-75, 143-209, 277-343, 411-507, or 1007-1103, with no more than 1, 2, or 3 mismatches. In some embodiments, the antisense strand comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identity to any one of SEQ ID NOs: 9-75, 143-209, 277-343, 411-507, or 1007-1103. In some embodiments, the antisense strand consists of any one of the nucleobase sequences of SEQ ID NOs: 9-75, 143-209, 277-343, 411-507, or 1007-1103. In some embodiments, the sense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleobases of any one of the nucleobase sequences of SEQ ID NOs: 76-142, 210-276, 344-410, 508-604, or 1104-1200, with no more than 1, 2, or 3 mismatches. In some embodiments, the sense strand comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identity any one of SEQ ID NOs: 76-142, 210-276, 344-410, 508-604, or 1104-1200. In some embodiments, the sense strand consists of any one of the nucleobase sequences of SEQ ID NOs: 76-142, 210-276, 344-410, 508-604, or 1104-1200. In some embodiments, the antisense sense strand consists of 19 to 23 nucleosides. In some embodiments, the sense strand consists of 19 to 21 nucleosides. In some embodiments, the modified double-stranded inhibitory oligonucleotide is a small interfering RNA (siRNA). In some embodiments, the modified double-stranded inhibitory oligonucleotide comprises at least one modified sugar moiety, at least one modified internucleoside linkage, or at least one modified nucleobase. In some embodiments, the antisense strand and the sense strand each independently comprise one or more modified sugar moi eties selected from a 2’-F sugar moiety, a 2’-OMe sugar moiety, and a 2’ -MOE sugar moiety, or a sugar surrogate selected from 2’ -deoxy, UNA, and GNA. In some embodiments, the antisense strand comprises 21 nucleosides, and the antisense strand is modified with a modification pattern (5’ to 3’) of yfyyyfyffyyyyfyfyyyyy, wherein each ‘y’ represents a 2’-OMe modified nucleotide and each ‘f represents a 2’-F modified nucleotide. In some embodiments, the sense strand comprises 19 nucleosides, and the sense strand is modified with a modification pattern (5’ to 3’) of yyyyfyfffyyyyyyyyyy, wherein each ‘y’ represents a 2’-OMe modified nucleotide and each ‘f represents a 2’-F modified nucleotide. In some embodiments, the antisense strand or the sense strand comprise at least one modified intemucleoside linkage. In some embodiments, the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage, a phosphorodithioate internucleoside linkage, a mesyl phosphoramidate internucleoside linkage, a phosphotriester internucleoside linkage, or a methoxypropyl phosphonate internucleoside linkage. In some embodiments, the antisense strand comprises 21WSGR Docket No. 71197-703.601nucleosides, and the antisense strand has an internuclsoside linkage motif (5’ to 3’) of ssooooooooooooooooss, wherein each ‘o’ represents a phosphodiester intemucleoside linkage and each ‘s’ represents a phosphorothioate internucleoside linkage. In some embodiments, the sense strand comprises 19 nucleosides, and the sense strand has an internucleoside linkage motif (5’ to 3’) of ssoooooooooooooooo, wherein each ‘o’ represents a phosphodiester internucleoside linkage and each ‘s’ represents a phosphorothioate internucleoside linkage. In some embodiments, the antisense strand comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleobases selected from SEQ ID NOs: 672-738, 873-1006, or 1298-1394. In some embodiments, the sense strand comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleobases selected from SEQ ID NOs: 605-671, 739-872, or 1201-1297. In some embodiments, the antisense strand comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identity to any one of SEQ ID NOs: 672-738, 873-1006, or 1298-1394. In some embodiments, the antisense strand consists of any one of SEQ ID NOs: 672-738, 873-1006, or 1298-1394. In some embodiments, the sense strand comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identity to any one of SEQ ID NOs: 605-671, 739-872, or 1201-1297. In some embodiments, the sense strand consists of any one of SEQ ID NOs: 605-671, 739-872, or 1201-1297.

[0010] Provided herein is a pharmaceutical composition comprising the modified doublestranded inhibitory oligonucleotide provided above and a pharmaceutically acceptable excipient. In some embodiments, the pharmaceutical composition is formulated for intravenous administration, subcutaneous administration, intramuscular administration, intrathecal administration, intracerebroventricular administration, parenteral administration, oral administration, nasal administration, or rectal administration.

[0011] Provided herein is a method for inhibiting FDX2 expression in a subject, the method comprising: providing any of the modified double-stranded inhibitory oligonucleotides provided herein or any of the pharmaceutical compositions provided herein; and administering the modified double-stranded inhibitory oligonucleotide to the subject, wherein the modified double-stranded inhibitory oligonucleotide reduced a quantity of an mRNA transcript of human FDX2. In some embodiments, the modified double-stranded inhibitory oligonucleotide mediates RNA interference against the mRNA transcript of human FDX2.

[0012] Provided herein is a method of treating, preventing, alleviating a symptom of, or ameliorating a disorder associated with a mutation in an FXN gene in a subject in need thereof, the method comprising: providing any of the modified double-stranded inhibitory oligonucleotides provided herein or any of the pharmaceutical compositions provided herein; and administering the modified double-stranded inhibitory oligonucleotide to the subject,WSGR Docket No. 71197-703.601wherein the modified double-stranded inhibitory oligonucleotide mediates RNA interference against an mRNA transcript of human FXN and thereby treats the disorder. In some embodiments, the disorder associated with the mutation in the FXN gene is Friedreich’s Ataxia.

[0013] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

[0014] Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.BRIEF DESCRIPTION OF DRAWINGS

[0015] FIG. 1 depicts exemplary designs of siRNAs. The top panel depicts an siRNA comprising a modified 23-mer antisense strand and a modified 21-mer sense strand. The bottom panel depicts an siRNA comprising a modified 21-mer antisense strand and a modified 19-mer sense strand. The following sugar modifications are shown: a 2’-0Me modified nucleotide (green boxes), a 2’-F modified nucleotide (blue boxes). Phosphorothioate (PTO) internucleoside linkages are shown (thick vertical lines).

[0016] FIG. 2 depicts a flow chart showing an exemplary in silico selection process for generating siRNAs against FDX2.

[0017] FIGs. 3A and 3B show data relating to testing of controls for the dual dose screen of the first set of exemplary siRNAs. FIG. 3A shows the relative remaining hsAHSAl mRNA expression determined for the SW1783 cells administered either 10 nM or 0.1 nM of an siRNA targeting AHSA1. FIG. 3B shows the relative remaining FXD2 mRNA expression determined for the SW1783 cells administered no siRNA (mock), non-targeting negative control siRNAs, and the AHSA1 siRNA.

[0018] FIG. 4 depicts the data from the dual dose screen of the first set of siRNAs developed, showing the expression level of FDX2 mRNA for the SW1783 cells administered the 67 exemplary siRNAs and the two positive control siRNAs administered at 10 nM and 0.1 nM concentrations.

[0019] FIG. 5 shows the expression level of FDX2 mRNA for the SW1783 cells administered 10 of the exemplary siRNAs that showed greater than 80% reduction of FDX2 mRNA levelsWSGR Docket No. 71197-703.601when provided at the high dose of 10 nM with a corresponding decrease in expression when administered at the low dose of 0.2 nM.

[0020] FIGs. 6A and 6B shows the alignment of 26 exemplary siRNAs on the human FDX2 mRNA sequence. FIG. 6A shows alignment of the exemplary siRNAs along positions 1 to about 400 on the human FDX2 mRNA sequence from the 5’ end, and FIG. 6B shows the alignment of the exemplary siRNAs along about position 400 to the end of the human FDX2 mRNA sequence from the 5’ end.

[0021] FIG. 7 depicts the dose-response curves for nine of the exemplary sRNAs of the first set of siRNAs and the positive control (XD-96292).

[0022] FIG. 8 depicts the data from a screen of the second set of siRNAs developed, showing the expression level of FDX2 mRNA for the SW1783 cells administered the 97 exemplary siRNAs administered at a 10 nM concentration

[0023] FIG. 9 depicts the dose-response curves for nine of the exemplary sRNAs of the second set of siRNAs.DETAILED DESCRIPTION

[0024] The present disclosure provides, among other things, compounds that are oligonucleotides, e.g., siRNAs, useful for inhibiting FDX2 expression or activity.Definitions

[0025] Unless otherwise indicated, the following terms have the following meanings:

[0026] The singular form “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a cell” includes one or more cells, including mixtures thereof. “A and / or B” is used herein to include all of the following alternatives: “A”, “B”, “A or B”, and “A andB.”

[0027] “Percent (%) sequence identity” or “Percent (%) identity” with respect to the nucleic acid sequences identified herein is defined as the percentage of nucleic acid in a candidate sequence that are identical with the nucleic acid sequence being compared, after aligning the sequences considering any conservative substitutions as part of the sequence identity.

[0028] As used herein, the term “sense strand” can be interchangeably used with the term “passenger strand,” and the tern “antisense strand” can be interchangeably used with the term “guide strand.”

[0029] “Approximately” or “about,” as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In general, those skilled in the art, familiar within the context, will appreciate the relevant degree of variance encompassed by “about” or “approximately” in that context. For example, in some embodiments, the term “approximately”WSGR Docket No. 71197-703.601or “about” may encompass a range of values that are within (i.e., ±) 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of the referred value.

[0030] “Alkyl”, used alone or as part of a larger moiety, refers to a saturated, optionally substituted straight or branched chain hydrocarbon group having (unless otherwise specified) 1-12, 1-10, 1-8, 1-6, 1-4, 1-3, or 1-2 carbon atoms (e.g., Cl-12, Cl-10, Cl-8, Cl-6, Cl-4, Cl-3, or Cl-2). Exemplary alkyl groups include methyl, ethyl, propyl, butyl, pentyl, hexyl, and heptyl.

[0031] “2’ -deoxynucleoside” means a nucleoside comprising a 2’-deoxy sugar moiety. Unless otherwise indicated, a 2 ’-deoxynucleoside is a 2’-D-deoxynucleoside which comprises a 2’-D-deoxyribosyl sugar moiety, which has the -D ribosyl configuration as found in naturally occurring deoxyribonucleic acid (DNA).

[0032] “2’ -deoxy sugar moiety” means a 2’-H(H) deoxyribosyl sugar moiety. Unless otherwise indicated, a 2’-deoxy sugar moiety is a 2’-D-deoxyribosyl sugar moiety, which has the -D ribosyl configuration as found in naturally occurring deoxyribonucleic acids (DNA). Herein, in the context of an oligomeric compound comprising a ribonucleic acid oligonucleotide (e.g., an siRNA), a 2’ -deoxy sugar moiety is considered e.g., a modified sugar moiety.

[0033] “2’-0Me nucleoside”, “2’-0Me modified nucleotide”, “2’-0Me” or “2’-OCH3” or “2’-O-methyl” each refers to a nucleoside or a nucleotide comprising a sugar comprising an -OCH3 group at the 2’position of the sugar ring.

[0034] “2’ -F” means a 2’ -fluoro group in place of the 2’ -OH group of a furanosyl sugar moiety. A “2’-F sugar moiety” (i.e., a “2’-fluoro sugar moiety”) means a sugar moiety with a 2’-F (i.e., a 2’-fluoro) group in place of the 2’-OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2’-F sugar moiety is in the -D-ribosyl configuration.

[0035] “2’-F nucleoside” or “2’-F modified nucleotide” means a nucleoside or a nucleotide comprising a 2’-F sugar moiety.

[0036] “Administering” means providing a pharmaceutical agent to an animal, and includes, but is not limited to administering by a medical professional and self-administering.

[0037] “Amelioration” refers to a lessening, slowing, stopping, or reversing of at least one indicator of the severity of a syndrome or condition. The severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.

[0038] “Animal” refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

[0039] “Antisense compound” means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisenseWSGR Docket No. 71197-703.601compounds include single-stranded and double-stranded compounds, such as, antisense strands, siRNAs and shRNAs.

[0040] “Antisense inhibition” or “inhibition” means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels or in the absence of the siRNA (or antisense strand of the siRNA).

[0041] “Bicyclic sugar” means a furanose ring modified by the bridging of two atoms. A bicyclic sugar is a modified sugar.

[0042] “Bicyclic nucleoside” (also BNA) means a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In some embodiments, the bridge connects the 4’ -carbon and the 2’ -carbon of the sugar ring.

[0043] “Blunt” or “blunt ended” in reference to an siRNA means that there are no terminal unpaired nucleotides (i.e., no overhanging nucleotides). One or both ends of an siRNA can be blunt.

[0044] “Cap structure” or “terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an antisense compound.

[0045] “Chemically distinct region” refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2’-O-Methoxyethyl nucleosides is chemically distinct from a region having nucleosides without 2’-O-Methoxyethyl modifications.

[0046] “ Co-administration” means administration of two or more pharmaceutical agents to an individual. The two or more pharmaceutical agents may be in a single pharmaceutical composition or may be in separate pharmaceutical compositions. Each of the two or more pharmaceutical agents may be administered through the same or different routes of administration. Co-administration encompasses parallel or sequential administration.

[0047] “Complementary” in reference to an oligonucleotide or portion thereof means that at least 70% of the nucleobases of such oligonucleotide or portion thereof and the nucleobases of another nucleic acid or portion thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. As used herein, “complementary nucleobases” means nucleobases that are capable of forming hydrogen bonds with one another. Complementary nucleobase pairs include adenine (A) and thymine (T); adenine (A) and uracil (U); cytosine (C) and guanine (G); and 5-methylcytosine (mC) and guanine (G). Certain modified nucleobases that pair with unmodified nucleobases or with other modified nucleobases are known in the art. For example, hypoxanthine (I), the nucleobase of the nucleoside inosine, can pair with adenine, cytosine,WSGR Docket No. 71197-703.601thymine, or uracil. Herein, hypoxanthine (I) is considered a complementary nucleobase to thymine (T), adenine (A), uracil (U), and cytosine (C). Complementary oligonucleotides and / or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. As used herein, “fully complementary” or “100% complementary” in reference to an oligonucleotide, or a portion thereof, means that the oligonucleotide, or portion thereof, is complementary to another oligonucleotide or nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length. “Complementarity” means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.

[0048] “Complementary region” in reference to an oligonucleotide or portion thereof is a range of nucleobases of the oligonucleotide that is complementary to a nucleobase sequence of an equal-length region of a second oligonucleotide or region thereof (e.g., an oligonucleotide and a target nucleic acid, or an antisense strand and a sense strand), or to a nucleobase sequence of an equal-length region within a second region of the oligonucleotide (e.g., in a “hairpin oligonucleotide”). A complementary region of an oligonucleotide may be a portion of an oligonucleotide or may include the entire oligonucleotide or may include substantially all of the oligonucleotide.

[0049] “Comprise,” “comprises,” and “comprising” will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.

[0050] “Contiguous nucleobases” means nucleobases immediately adjacent to each other. “Designing” or “designed to” refer to the process of designing an oligomeric compound that specifically hybridizes with a selected nucleic acid molecule.

[0051] “Diluent” means an ingredient in a composition that lacks pharmacological activity but is pharmaceutically necessary or desirable. For example, in drugs that are injected, the diluent may be a liquid, e.g., saline solution.

[0052] “Dose” means a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified time period. In some embodiments, a dose may be administered in one, two, or more boluses, tablets, or injections. For example, in some embodiments where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated by a single injection, therefore, two or more injections may be used to achieve the desired dose. In some embodiments, the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week, or month.WSGR Docket No. 71197-703.601

[0053] “Effective amount” in the context of modulating an activity or of treating or preventing a condition means the administration of that amount of pharmaceutical agent to an individual in need of such modulation, treatment, or prophylaxis, either in a single dose or as part of a series, that is effective for modulation of that effect, or for treatment or prophylaxis or improvement of that condition. The effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual’s medical condition, and other relevant factors.

[0054] “Efficacy” means the ability to produce a desired effect.

[0055] “Expression” includes all the functions by which a gene’s coded information is converted into structures present and operating in a cell. Such structures include but are not limited to the products of transcription and translation.

[0056] “FDX2 nucleic acid” means any nucleic acid encoding FDX2. For example, in some embodiments, a FDX2 nucleic acid includes a DNA sequence encoding FDX2 (“FDX2 DNA”), an RNA sequence transcribed from DNA encoding FDX2 (including genomic DNA comprising introns and exons) (“FDX2 RNA”), and an mRNA sequence encoding FDX2. “FDX2 mRNA” means any messenger RNA expression product of a DNA sequence encoding FDX2.

[0057] “FDX2 protein” means the polypeptide expression product of a FDX2 nucleic acid. “Mismatch” or “non-complementary nucleobase” refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid. “Modified internucleoside linkage” refers to a substitution or any change from a naturally occurring internucleoside bond (i.e., a phosphodiester intemucleoside bond).

[0058] “Fully complementary” or “100% complementary” means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid. In some embodiments, a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.

[0059] “Hybridization” means the annealing of complementary nucleic acid molecules. In some embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a target nucleic acid. In some embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense strand and a nucleic acid target.

[0060] “Immediately adjacent” means there are no intervening elements between the immediately adjacent elements.

[0061] “ Individual” means a human or non-human animal selected for treatment or therapy.

[0062] “Inhibiting FDX2” means reducing the level or expression of a FDX2 mRNA and / or protein. In some embodiments, FDX2 mRNA and / or protein levels are inhibited in the presence of an inhibitory oligonucleotide compound targeting FDX2, including an siRNA targetingWSGR Docket No. 71197-703.601FDX2, as compared to expression of FDX2 mRNA and / or protein levels in the absence of a FDX2 antisense compound, such as an antisense strand targeting FDX2.

[0063] “ Intemucleoside linkage” refers to the chemical bond between nucleosides.

[0064] “Linked nucleosides” means adjacent nucleosides linked together by an intemucleoside linkage.

[0065] “Mismatch” or “non-complementary” means a nucleobase of a first nucleic acid sequence that is not complementary with the corresponding nucleobase of a second nucleic acid sequence when the first and second nucleic acid sequences are aligned in opposing directions.

[0066] “Modified nucleobase” means any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An “unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0067] “Modified nucleoside” means a nucleoside having, independently, a modified sugar moiety and / or modified nucleobase.

[0068] “Modified nucleotide” or “modified oligonucleotide” or “modified strand” means a nucleotide having, independently, a modified sugar moiety, modified intemucleoside linkage, and / or modified nucleobase.

[0069] “Modified sugar” means substitution and / or any change from a natural sugar moiety.

[0070] “Motif’ means the pattern of unmodified and modified nucleosides in an antisense compound.

[0071] “Non-complementary nucleobase” refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.

[0072] “Nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), singlestranded nucleic acids, double-stranded nucleic acids, and small interfering ribonucleic acids (siRNA).

[0073] “Nucleobase” means a heterocyclic moiety capable of pairing with a base of another nucleic acid.

[0074] “Nucleobase complementarity” refers to a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In some embodiments, complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between theWSGR Docket No. 71197-703.601oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair.

[0075] “Nucleobase sequence” means the order of contiguous nucleobases independent of any sugar, linkage, and / or nucleobase modification.

[0076] “Nucleoside” means a nucleobase linked to a sugar.

[0077] “Mimetic” refers to groups that are substituted for a sugar, a nucleobase, and / or internucleoside linkage. Generally, a mimetic is used in place of the sugar or sugarinternucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.

[0078] “Nucleotide” means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

[0079] “Off-target effect” refers to an unwanted or deleterious biological effect associated with modulation of RNA or protein expression of a gene other than the intended target nucleic acid.

[0080] “Oligomeric compound” or “oligomer” means a polymer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.

[0081] “Oligonucleotide” means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.

[0082] “Parenteral administration” means administration through injection (e.g., bolus injection) or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g., intrathecal or intracerebroventri cul ar admini strati on .

[0083] “Pharmaceutical agent” means a substance that provides a therapeutic benefit when administered to an individual. For example, in some embodiments, an antisense strand targeted to FDX2 is a pharmaceutical agent.

[0084] “Pharmaceutical composition” means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition may comprise an antisense strand and a sterile aqueous solution.

[0085] “Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.

[0086] “Phosphorothioate linkage” means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified intemucleoside linkage.WSGR Docket No. 71197-703.601

[0087] “Portion” means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In some embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In some embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.

[0088] “Prevent” or “preventing” refers to delaying or forestalling the onset or development of a disorder or syndrome for a period of time from minutes to days, weeks to months, or indefinitely.

[0089] “Prophylactically effective amount” refers to an amount of a pharmaceutical agent that provides a prophylactic or preventative benefit to an animal.

[0090] “Region” is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.

[0091] “ Salt” means a physiologically and pharmaceutically acceptable salt(s) of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.

[0092] “Segments” are defined as smaller or sub-portions of regions within a target nucleic acid. “Shortened” or “truncated” versions of antisense strand s taught herein have one, two or more nucleosides deleted.

[0093] “ Side effects” means physiological responses attributable to a treatment other than desired effects. In some embodiments, side effects include, without limitation, injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, and myopathies.

[0094] “Specifically hybridizable” refers to an antisense compound having a sufficient degree of complementarity between an antisense strand and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays and therapeutic treatments.

[0095] “Stringent hybridization conditions” or “stringent conditions” refer to conditions under which an oligomeric compound will hybridize to its target sequence, but to a minimal number of other sequences.

[0096] “Targeting” or “targeted” means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.

[0097] “Target nucleic acid,” “target RNA,” and “target RNA transcript” and “nucleic acid target” all mean a nucleic acid capable of being targeted by antisense compounds. In some embodiments, the target nucleic acid is a FDX2 nucleic acid.WSGR Docket No. 71197-703.601

[0098] “Target region” means a portion of a target nucleic acid to which one or more antisense compounds is targeted.

[0099] “Target segment” means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted. “5’ target site” refers to the 5 ’-most nucleotide of a target segment. “3’ target site” refers to the 3 ’-most nucleotide of a target segment.

[0100] “Therapeutically effective amount” means an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual.

[0101] “ Treat” or “treating” or “treatment” refers administering a composition to effect an alteration or improvement of the disorder or syndrome.

[0102] “Unmodified nucleobases” mean the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).

[0103] “Unmodified nucleotide” means a nucleotide composed of naturally occurring nucleobases, sugar moieties, and intemucleoside linkages. In some embodiments, an unmodified nucleotide is an RNA nucleotide (i.e. -D-ribonucleosides) or a DNA nucleotide (i.e. -D-deoxyribonucleoside).siRNA target - FDX2

[0104] In humans, FRDA is caused by a GAA»TTC triplet repeat expansion in the first intron of the FXN gene (NCBI RefSeqGene NG_008845.2). FXN encodes a protein called frataxin, a ubiquitous, nuclear-encoded mitochondrial protein (Campuzano et al. 1996, Science 271:1423-1427). Unaffected individuals have 6-30 GAA»TTC repeats, whereas affected individuals have approximately 70-1000 repeats (Sharma et al. 2004, Ann Neurol 56:898-901; Pandolfo 2008, Arch Neurol 65:1296-1303). The GAA»TTC repeat expansion mutation represses FXN expression at the level of transcription, with the extent of FXN repression directly related to the length of the GAA»TTC repeat. Age of onset and disease severity are also correlated with the length of the GAA»TTC repeat (Chutake et al. 2014, Ann Neurol 76:522-528). Importantly, the TRE-FXN gene encodes functional frataxin, albeit at reduced levels.

[0105] The deficiency of frataxin is associated with impairment of iron-sulfur cluster (ISC)-containing enzymes, deficits of respiratory chain complex activities, and accumulation of iron.

[0106] Iron sulfur clusters (ISCs) are ancient and essential cofactors necessary for the activity of dozens of proteins in the cell, including those involved in the electron transport chain, TCA cycle, DNA repair and protein translation (Andreini et al. 2016, J. Proteome Res. 15:1308-1322). Synthesis of ISCs occurs in the mitochondrial matrix by an enzyme-mediated pathway consisting of the scaffold protein ISCU, the cysteine desulfurase NFS1 which provides sulfur from cysteine, LYRM4 and NDUFAB1 (the acyl carrier protein) which stabilize NFS1, the ferredoxin FDX2 which conveys electrons from FDXR / NADPH, and Frataxin (FXN). FrataxinWSGR Docket No. 71197-703.601is an allosteric activator of NFS1 (and accelerates the formation of 2Fe-2S clusters by promoting persulfide transfer from NSF1 to ISCU.

[0107] Reduced levels of Frataxin underlies Friedreich’s ataxia (FA), which affects 1 in 50,000 people, making it the most common monogenic mitochondrial disease and the most common recessive ataxia. FA presents with ataxia, cardiomyopathy, and increased incidence of diabetes; patients have an average lifespan of 37.5 years with no effective therapies to date.

[0108] The FDX2 protein is required for iron sulfur cluster synthesis, so it was surprising that knocking it down in the background of FXN mutation / deficiency was beneficial. This idea is further supported by the observation that although FDX2 loss causes a recessive disease in humans, the heterozygous parents are healthy, implying that some loss of FDX2 can be tolerated.

[0109] Thus, partial knockdown of FDX2, e.g., via inhibitory nucleic acids, e.g., RNAi (e.g., using small interfering RNA (siRNA) or short hairpin RNA (shRNA)) can be used as a therapeutic approach in subjects with disorders associated with mutations in the FXN gene, e.g., Friedreich ataxia (FRDA).Inhibitory Nucleic Acids

[0110] Described herein is an inhibitory oligonucleotide molecule for inhibiting expression or activity of FDX2. In some aspects, the oligonucleotide molecule described herein hybridizes to certain regions of human FDX2 transcript. In some aspects, the oligonucleotide molecule described herein hybridizes to certain regions of human FDX2 mRNA. In some instances, the oligonucleotide molecule comprises a sense strand and an antisense strand, and wherein the antisense strand hybridizes to a certain region of FDX2 mRNA or FDX2 transcript.[OHl] In some aspects, the inhibitory oligonucleotide (e.g., siRNA) hybridizes to a portion of FDX2 transcript (NM_001397406.1). In some instances, the inhibitory oligonucleotide (e.g., siRNA) hybridizes to a portion of a nucleic acid of SEQ ID NO: 1. As used in SEQ ID NO: 1, nucleotide “T” is interchangeable with nucleotide “U”.Table 1: FDX2 SequenceDescriptor GenBank SEQ SequenceRef IDNOGenBankHuman 1 GAGTCACGTGATGCATGTCATGGCCGCCTCCATGGCCCG RefSeqcDNA GGGAGGCGTGAGTGCCAGGGTTCTACTGCAGGCTGCCAG ID.sequence GGGCACCTGGTGGAACAGACCTGGGGGCACTTCCGGGTC NM_0013ofFDX2 GGGGGAGGGGGTGGCGCTGGGGACAACCAGAAAGTTTC 97406.1AAGCGACAGGCTCGCGCCCGGCTGGAGAGGAGGACGCG GGCGGCCCGGAGCGGCCCGGGGACGTGGTGAACGTGGTG TTCGTAGACCGCTCAGGCCAGCGGATCCCAGTGAGTGGCAGAGTCGGGGACAATGTTCTTCACCTGGCCCAGCGCCACWSGR Docket No. 71197-703.601GGGGTGGACCTGGAAGGGGCCTGTGAAGCCTCCCTGGCC TGCTCCACCTGCCATGTGTATGTGAGTGAAGACCACCTGG ATCTCCTGCCTCCTCCCGAGGAGAGGGAAGACGACATGC TAGACATGGCCCCCCTCCTCCAGGAGAACTCGCGGCTGG GCTGCCAGATTGTGCTGACACCGGAGCTGGAAGGAGCGG AATTCACCCTGCCCAAGATCACCAGGAACTTCTACGTGG ATGGCCATGTCCCCAAGCCCCACTGACATGAACACCTGG ACCATTCCACATTGCCATGGCCCCAGGGCCCAGATTGAG GGAATAGCCAGGTGCCAGCCCTGCCCAGAGTGCGGACAG GCCCGGGAGAGACGTGGAAGCCCCTGTGAAGGACAACAC CCCTGCTTGGGAGAGAGTCCCATGTCCAGGCTCTGGTGG GGACAGGGCCCCTAGTGGGGTGGCCTTCCCCAGGCCCCT GAGAATCAGGGTTTGAGTAGGAGTGGACTCATATTGGAG CTGCAATAAATCGATAACACAGGCCCCAGCATGTTGAGT GTCCTTGGGGGACAGATCTGGGGTCTACAGGTGGCTCAC ACCTGTAATCCTAGCACTTTGGGAAGCCAAGATGGGAGG ATCACTTGAGGCCAGGAGCTTAAGACCATCCTGGGCAAC ATGGCGAGACCTCGTCTCTATAAAAACAGTAAAAATTA

[0112] In some instances, the interfering RNA (e.g., siRNA) can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (i.e., each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double stranded structure); the antisense strand comprises nucleotide sequence that is complementary to a nucleotide sequence in a target nucleic acid molecule or a portion thereof (i.e., an undesired gene) and the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. Alternatively, interfering RNA is assembled from a single oligonucleotide, where the self-complementary sense and antisense regions are linked by means of nucleic acid based or non-nucleic acid-based linker(s). The interfering RNA can be a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises a nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The interfering can be a circular singlestranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siRNA molecule capable of mediating RNA interference.WSGR Docket No. 71197-703.601

[0113] In some embodiments, the interfering RNA coding region encodes a self-complementary RNA molecule having a sense region, an antisense region and a loop region. Such an RNA molecule when expressed desirably forms a “hairpin” structure and is referred to herein as an “shRNA.” The loop region is generally between about 2 and about 10 nucleotides in length. In some embodiments, the loop region is from about 6 to about 9 nucleotides in length. In some embodiments, the sense region and the antisense region are between about 15 and about 20 nucleotides in length. Following post-transcriptional processing, the small hairpin RNA is converted into a siRNA by a cleavage event mediated by the enzyme Dicer, which is a member of the RNase III family. The siRNA is then capable of inhibiting the expression of a gene with which it shares homology.

[0114] The target RNA cleavage reaction guided by siRNAs is highly sequence specific. In general, siRNA containing a nucleotide sequence identical to a portion of the target nucleic acid are preferred for inhibition. However, 100% sequence identity between the siRNA and the target gene is not required to practice the present invention. The siRNA has the advantage of being able to tolerate sequence variations that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence. For example, siRNA sequences with insertions, deletions, and single point mutations relative to the target sequence have also been found to be effective for inhibition. Alternatively, siRNA sequences with nucleotide analog substitutions or insertions can be effective for inhibition. In general, the siRNAs must retain specificity for their target, i.e., must not directly bind to, or directly significantly affect expression levels of, transcripts other than the intended target.

[0115] In some embodiments, a compound useful for inhibiting FDX2 is an siRNA. In some embodiments, an siRNA comprises an antisense strand or a “guide strand” and a complementary sense strand” or a “passenger strand”, wherein the antisense strand and the sense strand are hybridized and thereby form a “duplex”. Thus, in some embodiments, the siRNA comprises a first oligonucleotide and a second oligonucleotide. In some embodiments, the first oligonucleotide is a sense strand (passenger strand) and the second oligonucleotide is an antisense strand (guide strand) of the siRNA. In some embodiments, an oligonucleotide (e.g., an antisense strand or a sense strand) of an siRNA is between about 8 and about 50 nucleotides in length. In some embodiments, the oligonucleotide is between about 10 and about 50 nucleotides in length. In some embodiments, the oligonucleotide is between about 10 and about 45 nucleotides in length. In some embodiments, the oligonucleotide is between about 10 and about 40 nucleotides in length. In some embodiments, the oligonucleotide is between about 10 and about 35 nucleotides in length. In some embodiments, the oligonucleotide is between about 10 and about 30 nucleotides in length. In some embodiments, the oligonucleotide is between aboutWSGR Docket No. 71197-703.60110 and about 25 nucleotides in length. In some embodiments, the oligonucleotide is between about 10 and about 20 nucleotides in length. In some embodiments, the oligonucleotide is between about 12 and about 30 nucleotides in length. In some embodiments, the oligonucleotide is between about 15 and about 30 nucleotides in length. In some embodiments, the oligonucleotide is between about 15 and about 25 nucleotides in length. In some embodiments, the oligonucleotide is between about 20 and about 30 nucleotides in length. In some embodiments, the oligonucleotide is between about 18 and about 25 nucleotides in length. In some embodiments, the oligonucleotide is between about 19 and about 23 nucleotides in length. In some embodiments, the oligonucleotide is between about 21 and about 23 nucleotides in length. In some instances, the length of an oligonucleotide may be modified without eliminating activity.

[0116] In some embodiments, the nucleic acid sequence of an antisense strand of an siRNA is at least 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 99.5% complementary to a target sequence of FDX2 mRNA. In some embodiments, the target sequence of FDX2 mRNA is a nucleic acid sequence of about 10 to 50 nucleotides in length, about 15 to 50 nucleotides in length, about 15 to 40 nucleotides in length, about 15 to 30 nucleotides in length, about 15 to 25 nucleotides, about 18 to 23 nucleotides, about 19 to 23 nucleotides, or about 21-23 nucleotides in length, in which the first nucleotide of the target sequence begins at any nucleotide of the FDX2 mRNA transcript in the coding region, the 5’-untranslated region, or the 3 ’-untranslated region. In some embodiments, In some embodiments, the nucleobase sequence of the antisense strand of an siRNA is at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to SEQ ID NO: 1.

[0117] In some embodiments, a target region is a structurally defined region of the target nucleic acid. The structurally defined regions for FDX2 can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference. In some embodiments, a target region may encompass the sequence from a 5’ target site of one target segment within the target region to a 3’ target site of another target segment within the same target region.

[0118] Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs. In some embodiments, the desired effect is a reduction in mRNA target nucleic acid levels. In some embodiments, the desired effect isWSGR Docket No. 71197-703.601reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.

[0119] A target region may contain one or more target segments. Multiple target segments within a target region may be overlapping. Alternatively, they may be non-overlapping. In some embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In some embodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceding values. In some embodiments, target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In some embodiments, target segments are contiguous.

[0120] The determination of suitable target segments may include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome. For example, the BLAST algorithm may be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that may hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).

[0121] There may be variation in activity (e.g., as defined by percent reduction of target nucleic acid levels) of the siRNA within an active target region. In some embodiments, reductions in FDX2 mRNA levels are indicative of inhibition of FDX2 expression. Reductions in levels of an FDX2 protein are also indicative of inhibition of target mRNA expression. Phenotypic changes are indicative of inhibition of FDX2 expression. Improvement in neurological function is indicative of inhibition of FDX2 expression. Improved motor function, activity, social behavior, and memory are indicative of inhibition of FDX2 expression. Reduction of anxiety-like behaviors is indicative of inhibition of FDX2 expression.

[0122] In some embodiments, a modified double-stranded inhibitory oligonucleotide (e.g., siRNA) provided herein comprises an antisense strand having a nucleobase sequence complementary to a sequence in a FDX2 target nucleic acid paired with a sense strand to form an siRNA. Such siRNA comprises an antisense strand comprising a modified oligonucleotide having a portion complementary to a sequence in a FDX2 target nucleic acid and a sense strand comprising a modified oligonucleotide having a portion complementary to the antisense strand.

[0123] In some instances, the target region of an siRNA described herein is located between nucleotides or nucleobases of positions from 45 to 64 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the target region of an siRNA described herein is located between nucleotides or nucleobases of positions from 136 to 184 from the 5’ end ofWSGR Docket No. 71197-703.601NM_001397406.1 (SEQ ID NO: 1). In some instances, the target region of an siRNA described herein is located between nucleotides or nucleobases of positions from 214 to 304 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the target region of an siRNA described herein is located between nucleotides or nucleobases of positions from 331 to 400 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the target region of an siRNA described herein is located between nucleotides or nucleobases of positions from 406 to 634 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the target region of an siRNA described herein is located between nucleotides or nucleobases of positions from 646 to 709 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the target region of an siRNA described herein is located between nucleotides or nucleobases of positions from 721 to 739 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the target region of an siRNA described herein is located between nucleotides or nucleobases of positions from 766 to 831 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the target region of an siRNA described herein is located between nucleotides or nucleobases of positions from 916 to 934 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the target region of an siRNA described herein is located between nucleotides or nucleobases of positions from 961 to 994 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).

[0124] In some instances, the siRNA comprises at least 10, 11, 12, 13, or 14 contiguous nucleobases of a reverse complementary sequence of nucleobases of positions 45 to 64 from 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 45 to 64 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 16 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 45 to 64 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 17 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 45 to 64 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 18 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 45 to 64 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 19 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 45WSGR Docket No. 71197-703.601to 64 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 20 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 45 to 64 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches.

[0125] In some instances, the siRNA comprises at least 10, 11, 12, 13, or 14 contiguous nucleobases of a reverse complementary sequence of nucleobases of positions 136 to 184 from 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 136 to 184 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 16 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 136 to 184 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 17 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 136 to 184 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 18 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 136 to 184 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 19 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 136 to 184 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 20 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 136 to 184 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches.

[0126] In some instances, the siRNA comprises at least 10, 11, 12, 13, or 14 contiguous nucleobases of a reverse complementary sequence of nucleobases of positions 214 to 304 from 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 214 to 304 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 16 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 214 to 304 from 5’ end ofWSGR Docket No. 71197-703.601NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 17 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 214 to 304 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 18 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 214 to 304 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 19 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 214 to 304 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 20 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 214 to 304 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches.

[0127] In some instances, the siRNA comprises at least 10, 11, 12, 13, or 14 contiguous nucleobases of a reverse complementary sequence of nucleobases of positions 331 to 400 from 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 331 to 400 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 16 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 331 to 400 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 17 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 331 to 400 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 18 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 331 to 400 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 19 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 331 to 400 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 20 consecutive nucleic acid sequence or nucleobase sequence reverseWSGR Docket No. 71197-703.601complementary to nucleobase positions from 331 to 400 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches.

[0128] In some instances, the siRNA comprises at least 10, 11, 12, 13, or 14 contiguous nucleobases of a reverse complementary sequence of nucleobases of positions 406 to 634 from 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 406 to 634 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 16 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 406 to 634 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 17 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 406 to 634 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 18 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 406 to 634 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 19 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 406 to 634 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 20 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 406 to 634 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches.

[0129] In some instances, the siRNA comprises at least 10, 11, 12, 13, or 14 contiguous nucleobases of a reverse complementary sequence of nucleobases of positions 646 to 709 from 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 646 to 709 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 16 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 646 to 709 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 17 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 646 toWSGR Docket No. 71197-703.601709 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 18 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 646 to 709 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 19 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 646 to 709 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 20 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 646 to 709 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches.

[0130] In some instances, the siRNA comprises at least 10, 11, 12, 13, or 14 contiguous nucleobases of a reverse complementary sequence of nucleobases of positions 721 to 739 from 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 721 to 739 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 16 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 721 to 739 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 17 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 721 to 739 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 18 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 721 to 739 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 19 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 721 to 739 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 20 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 721 to 739 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches.

[0131] In some instances, the siRNA comprises at least 10, 11, 12, 13, or 14 contiguous nucleobases of a reverse complementary sequence of nucleobases of positions 766 to 831 fromWSGR Docket No. 71197-703.6015’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 766 to 831 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 16 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 766 to 831 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 17 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 766 to 831 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 18 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 766 to 831 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 19 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 766 to 831 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 20 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 766 to 831 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches.

[0132] In some instances, the siRNA comprises at least 10, 11, 12, 13, or 14 contiguous nucleobases of a reverse complementary sequence of nucleobases of positions 916 to 934 from 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 916 to 934 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 16 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 916 to 934 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 17 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 916 to 934 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 18 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 916 to 934 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more thanWSGR Docket No. 71197-703.6011, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 19 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 916 to 934 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 20 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 916 to 934 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches.

[0133] In some instances, the siRNA comprises at least 10, 11, 12, 13, or 14 contiguous nucleobases of a reverse complementary sequence of nucleobases of positions 961 to 994 from 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 961 to 994 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 16 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 961 to 994 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 17 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 961 to 994 from 5’ end of NM_001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 18 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 961 to 994 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 19 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 961 to 994 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches. In some instances, the antisense strand of the siRNA comprises at least 20 consecutive nucleic acid sequence or nucleobase sequence reverse complementary to nucleobase positions from 961 to 994 from 5’ end of NM 001397406.1 (SEQ ID NO: 1) with no more than 1, 2, 3, or 4 mismatches.

[0134] In some instances, the antisense strand of the siRNA is at least or about 80% identical to a reverse complementary sequence of nucleobase positions from 45 to 64 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 85% identical to a reverse complementary sequence of nucleobase positions from 45 to 64 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 90% identical to a reverse complementary sequence ofWSGR Docket No. 71197-703.601nucleobase positions from 45 to 64 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 95% identical to a reverse complementary sequence of nucleobase positions from 45 to 64 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 98% identical to a reverse complementary sequence of nucleobase positions from 45 to 64 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 100% identical to a reverse complementary sequence of nucleobase positions from 45 to 64 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).

[0135] In some instances, the antisense strand of the siRNA is at least or about 80% identical to a reverse complementary sequence of nucleobase positions from 136 to 184 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 85% identical to a reverse complementary sequence of nucleobase positions from 136 to 184 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 90% identical to a reverse complementary sequence of nucleobase positions from 136 to 184 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 95% identical to a reverse complementary sequence of nucleobase positions from 136 to 184 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 98% identical to a reverse complementary sequence of nucleobase positions from 136 to 184 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 100% identical to a reverse complementary sequence of nucleobase positions from 136 to 184 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).

[0136] In some instances, the antisense strand of the siRNA is at least or about 80% identical to a reverse complementary sequence of nucleobase positions from 214 to 304 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 85% identical to a reverse complementary sequence of nucleobase positions from 214 to 304 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 90% identical to a reverse complementary sequence of nucleobase positions from 214 to 304 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 95% identical to a reverse complementary sequence of nucleobase positions from 214 to 304 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 98% identical to a reverse complementary sequence of nucleobase positions from 214 to 304 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In someWSGR Docket No. 71197-703.601instances, the antisense strand of the siRNA is at least or about 100% identical to a reverse complementary sequence of nucleobase positions from 214 to 304 from the 5’ end of NM_001397406.1 (SEQ IDNO: 1).

[0137] In some instances, the antisense strand of the siRNA is at least or about 80% identical to a reverse complementary sequence of nucleobase positions from 331 to 400 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 85% identical to a reverse complementary sequence of nucleobase positions from 331 to 400 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 90% identical to a reverse complementary sequence of nucleobase positions from 331 to 400 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 95% identical to a reverse complementary sequence of nucleobase positions from 331 to 400 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 98% identical to a reverse complementary sequence of nucleobase positions from 331 to 400 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 100% identical to a reverse complementary sequence of nucleobase positions from 331 to 400 from the 5’ end of NM_001397406.1 (SEQ IDNO: 1).

[0138] In some instances, the antisense strand of the siRNA is at least or about 80% identical to a reverse complementary sequence of nucleobase positions from 406 to 634 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 85% identical to a reverse complementary sequence of nucleobase positions from 406 to 634 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 90% identical to a reverse complementary sequence of nucleobase positions from 406 to 634 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 95% identical to a reverse complementary sequence of nucleobase positions from 406 to 634 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 98% identical to a reverse complementary sequence of nucleobase positions from 406 to 634 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 100% identical to a reverse complementary sequence of nucleobase positions from 406 to 634 from the 5’ end of NM_001397406.1 (SEQ IDNO: 1).

[0139] In some instances, the antisense strand of the siRNA is at least or about 80% identical to a reverse complementary sequence of nucleobase positions from 646 to 709 from the 5’ end ofWSGR Docket No. 71197-703.601NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 85% identical to a reverse complementary sequence of nucleobase positions from 646 to 709 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 90% identical to a reverse complementary sequence of nucleobase positions from 646 to 709 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 95% identical to a reverse complementary sequence of nucleobase positions from 646 to 709 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 98% identical to a reverse complementary sequence of nucleobase positions from 646 to 709 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 100% identical to a reverse complementary sequence of nucleobase positions from 646 to 709 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).

[0140] In some instances, the antisense strand of the siRNA is at least or about 80% identical to a reverse complementary sequence of nucleobase positions from 721 to 739 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 85% identical to a reverse complementary sequence of nucleobase positions from 721 to 739 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 90% identical to a reverse complementary sequence of nucleobase positions from 721 to 739 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 95% identical to a reverse complementary sequence of nucleobase positions from 721 to 739 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 98% identical to a reverse complementary sequence of nucleobase positions from 721 to 739 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 100% identical to a reverse complementary sequence of nucleobase positions from 721 to 739 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).

[0141] In some instances, the antisense strand of the siRNA is at least or about 80% identical to a reverse complementary sequence of nucleobase positions from 766 to 831 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 85% identical to a reverse complementary sequence of nucleobase positions from 766 to 831 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 90% identical to a reverse complementary sequence of nucleobase positions from 766 to 831 from the 5’ end of NM 001397406.1 (SEQWSGR Docket No. 71197-703.601ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 95% identical to a reverse complementary sequence of nucleobase positions from 766 to 831 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 98% identical to a reverse complementary sequence of nucleobase positions from 766 to 831 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 100% identical to a reverse complementary sequence of nucleobase positions from 766 to 831 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).

[0142] In some instances, the antisense strand of the siRNA is at least or about 80% identical to a reverse complementary sequence of nucleobase positions from 916 to 934 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 85% identical to a reverse complementary sequence of nucleobase positions from 916 to 934 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 90% identical to a reverse complementary sequence of nucleobase positions from 916 to 934 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 95% identical to a reverse complementary sequence of nucleobase positions from 916 to 934 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 98% identical to a reverse complementary sequence of nucleobase positions from 916 to 934 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 100% identical to a reverse complementary sequence of nucleobase positions from 916 to 934 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).

[0143] In some instances, the antisense strand of the siRNA is at least or about 80% identical to a reverse complementary sequence of nucleobase positions from 961 to 994 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 85% identical to a reverse complementary sequence of nucleobase positions from 961 to 994 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 90% identical to a reverse complementary sequence of nucleobase positions from 961 to 994 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 95% identical to a reverse complementary sequence of nucleobase positions from 961 to 994 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA is at least or about 98% identical to a reverse complementary sequence of nucleobase positions from 961 to 994 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In someWSGR Docket No. 71197-703.601instances, the antisense strand of the siRNA is at least or about 100% identical to a reverse complementary sequence of nucleobase positions from 961 to 994 from the 5’ end of NM_001397406.1 (SEQ IDNO: 1).

[0144] In some instances, the antisense strand of the siRNA comprises a nucleic acid sequence or nucleobase sequence comprising at least 10, 11, 12, 13, 14, 15, or 16 nucleotides consecutive nucleotides, wherein the nucleic acid sequence or nucleobase sequence is reverse complementary to nucleobase positions from 45 to 64 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA comprises a nucleic acid sequence or nucleobase sequence comprising at least 17, 18, 19, or 20 nucleotides consecutive nucleotides, wherein the nucleic acid sequence or nucleobase sequence is reverse complementary to nucleobase positions from 45 to 64 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).

[0145] In some instances, the antisense strand of the siRNA comprises a nucleic acid sequence or nucleobase sequence comprising at least 10, 11, 12, 13, 14, 15, or 16 nucleotides consecutive nucleotides, wherein the nucleic acid sequence or nucleobase sequence is reverse complementary to nucleobase positions from 136 to 184 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA comprises a nucleic acid sequence or nucleobase sequence comprising at least 17, 18, 19, or 20 nucleotides consecutive nucleotides, wherein the nucleic acid sequence or nucleobase sequence is reverse complementary to nucleobase positions from 136 to 184 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1).

[0146] In some instances, the antisense strand of the siRNA comprises a nucleic acid sequence or nucleobase sequence comprising at least 10, 11, 12, 13, 14, 15, or 16 nucleotides consecutive nucleotides, wherein the nucleic acid sequence or nucleobase sequence is reverse complementary to nucleobase positions from 214 to 304 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA comprises a nucleic acid sequence or nucleobase sequence comprising at least 17, 18, 19, or 20 nucleotides consecutive nucleotides, wherein the nucleic acid sequence or nucleobase sequence is reverse complementary to nucleobase positions from 214 to 304 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).

[0147] In some instances, the antisense strand of the siRNA comprises a nucleic acid sequence or nucleobase sequence comprising at least 10, 11, 12, 13, 14, 15, or 16 nucleotides consecutive nucleotides, wherein the nucleic acid sequence or nucleobase sequence is reverse complementary to nucleobase positions from 331 to 400 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA comprises a nucleic acidWSGR Docket No. 71197-703.601sequence or nucleobase sequence comprising at least 17, 18, 19, or 20 nucleotides consecutive nucleotides, wherein the nucleic acid sequence or nucleobase sequence is reverse complementary to nucleobase positions from 331 to 400 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).

[0148] In some instances, the antisense strand of the siRNA comprises a nucleic acid sequence or nucleobase sequence comprising at least 10, 11, 12, 13, 14, 15, or 16 nucleotides consecutive nucleotides, wherein the nucleic acid sequence or nucleobase sequence is reverse complementary to nucleobase positions from 406 to 634 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA comprises a nucleic acid sequence or nucleobase sequence comprising at least 17, 18, 19, or 20 nucleotides consecutive nucleotides, wherein the nucleic acid sequence or nucleobase sequence is reverse complementary to nucleobase positions from 406 to 634 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).

[0149] In some instances, the antisense strand of the siRNA comprises a nucleic acid sequence or nucleobase sequence comprising at least 10, 11, 12, 13, 14, 15, or 16 nucleotides consecutive nucleotides, wherein the nucleic acid sequence or nucleobase sequence is reverse complementary to nucleobase positions from 646 to 709 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA comprises a nucleic acid sequence or nucleobase sequence comprising at least 17, 18, 19, or 20 nucleotides consecutive nucleotides, wherein the nucleic acid sequence or nucleobase sequence is reverse complementary to nucleobase positions from 646 to 709 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1).

[0150] In some instances, the antisense strand of the siRNA comprises a nucleic acid sequence or nucleobase sequence comprising at least 10, 11, 12, 13, 14, 15, or 16 nucleotides consecutive nucleotides, wherein the nucleic acid sequence or nucleobase sequence is reverse complementary to nucleobase positions from 721 to 739 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA comprises a nucleic acid sequence or nucleobase sequence comprising at least 17, 18, 19, or 20 nucleotides consecutive nucleotides, wherein the nucleic acid sequence or nucleobase sequence is reverse complementary to nucleobase positions from 721 to 739 from the 5’ end of NM_001397406.1 (SEQ ID NO: 1).

[0151] In some instances, the antisense strand of the siRNA comprises a nucleic acid sequence or nucleobase sequence comprising at least 10, 11, 12, 13, 14, 15, or 16 nucleotides consecutive nucleotides, wherein the nucleic acid sequence or nucleobase sequence is reverse complementary to nucleobase positions from 766 to 831 from the 5’ end of NM 001397406.1WSGR Docket No. 71197-703.601(SEQ ID NO: 1). In some instances, the antisense strand of the siRNA comprises a nucleic acid sequence or nucleobase sequence comprising at least 17, 18, 19, or 20 nucleotides consecutive nucleotides, wherein the nucleic acid sequence or nucleobase sequence is reverse complementary to nucleobase positions from 766 to 831 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1).

[0152] In some instances, the antisense strand of the siRNA comprises a nucleic acid sequence or nucleobase sequence comprising at least 10, 11, 12, 13, 14, 15, or 16 nucleotides consecutive nucleotides, wherein the nucleic acid sequence or nucleobase sequence is reverse complementary to nucleobase positions from 916 to 934 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA comprises a nucleic acid sequence or nucleobase sequence comprising at least 17, 18, 19, or 20 nucleotides consecutive nucleotides, wherein the nucleic acid sequence or nucleobase sequence is reverse complementary to nucleobase positions from 916 to 934 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1).

[0153] In some instances, the antisense strand of the siRNA comprises a nucleic acid sequence or nucleobase sequence comprising at least 10, 11, 12, 13, 14, 15, or 16 nucleotides consecutive nucleotides, wherein the nucleic acid sequence or nucleobase sequence is reverse complementary to nucleobase positions from 961 to 994 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1). In some instances, the antisense strand of the siRNA comprises a nucleic acid sequence or nucleobase sequence comprising at least 17, 18, 19, or 20 nucleotides consecutive nucleotides, wherein the nucleic acid sequence or nucleobase sequence is reverse complementary to nucleobase positions from 961 to 994 from the 5’ end of NM 001397406.1 (SEQ ID NO: 1).

[0154] In certain embodiments, the region from 45 to 64 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 136 to 184 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 214 to 304 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 331 to 400 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 406 to 634 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 646 to 709 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 721 to 739 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 766 to 831 in NM 001397406.1 (SEQ ID NO: Q is targeted by the siRNA. In certain embodiments, the region from 916 to 934 in NM_001397406.1WSGR Docket No. 71197-703.601(SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 961 to 994 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA.

[0155] In certain embodiments, the region from 45 to 63 in NM 001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 46 to 64 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 136 to 154 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 137 to 155 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 138 to 156 in NM 001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 139 to 157 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 147 to 165 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 148 to 166 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 149 to 167 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 150 to 168 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 151 to 169 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 152 to 170 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 166 to 184 in NM 001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 214 to 232 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 215 to 233 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 219 to 237 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 220 to 238 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 222 to 240 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 223 to 241 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 224 to 242 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 225 to 243 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 226 to 244 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 227 to 245 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 228 to 246 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 229 to 247 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 232 to 250 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 233 to 251WSGR Docket No. 71197-703.601in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 234 to 252 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 235 to 253 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 241 to 259 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 248 to 266 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 250 to 268 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 256 to 274 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 271 to 289 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 286 to 304 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 331 to 349 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 346 to 364 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 361 to 379 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 371 to 389 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 372 to 390 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 373 to 391 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 374 to 392 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 375 to 393 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 376 to 394 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 378 to 396 in NM 001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 379 to 397 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 382 to 400 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 406 to 424 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 409 to 427 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 410 to 428 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 411 to 429 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 412 to 430 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 413 to 431 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 414 to 432 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 415 to 433WSGR Docket No. 71197-703.601in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 416 to 434 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 420 to 438 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 421 to 439 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 436 to 454 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 445 to 463 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 447 to 465 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 448 to 466 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 449 to 467 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 450 to 468 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 451 to 469 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 452 to 470 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 453 to 471 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 455 to 473 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 456 to 474 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 466 to 484 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 481 to 499 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 492 to 510 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 493 to 511 in NM_001397406.1 (SEQ ID NO: Q is targeted by the siRNA. In certain embodiments, the region from 494 to 512 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 495 to 513 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 496 to 514 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 497 to 515 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 498 to 516 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 499 to 517 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 500 to 518 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 511 to 529 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 521 to 539 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 522 to 540WSGR Docket No. 71197-703.601in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 523 to 541 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 524 to 542 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 525 to 543 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 526 to 544 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 527 to 545 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 528 to 546 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 529 to 547 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 541 to 559 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 556 to 574 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 571 to 589 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 586 to 604 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 601 to 619 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 616 to 634 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 646 to 664 in NM 001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 661 to 679 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 662 to 680 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 663 to 681 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 664 to 682 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 665 to 683 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 666 to 684 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 667 to 685 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 676 to 694 in NM 001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 691 to 709 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 721 to 739 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 766 to 784 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 781 to 799 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 793 to 811 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 796 to 814WSGR Docket No. 71197-703.601in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 811 to 829 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 812 to 830 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 813 to 831 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 916 to 934 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 961 to 979 in NM_001397406.1 (SEQ ID NO: 1) is targeted by the siRNA. In certain embodiments, the region from 976 to 994 in NM 001397406.1 (SEQ ID NO: 1) is targeted by the siRNA.

[0156] In some embodiments, the antisense strand and / or the sense strand of the siRNA consist of 16, 17, or 18 linked nucleosides. In some embodiments, the antisense strand and / or the sense strand of the siRNA consist of 19 linked nucleosides. In some embodiments, the antisense strand and / or the sense strand of the siRNA consist of 20 linked nucleosides. In some embodiments, the antisense strand and / or the sense strand of the siRNA consist of 21 linked nucleosides. In some embodiments, the antisense strand and / or the sense strand of the siRNA consist of 22 linked nucleosides. In some embodiments, the antisense strand and / or the sense strand of the siRNA consist of 23 linked nucleosides.

[0157] In some embodiments, the antisense strand and / or the sense strand of the siRNA consists of 12-30 linked nucleosides. In some embodiments, the antisense strand and / or the sense strand of the siRNA consists of 17-25 linked nucleosides. In some embodiments, the antisense strand and / or the sense strand of the siRNA consists of 17-23 linked nucleosides. In some embodiments, the antisense strand and / or the sense strand of the siRNA consists of 17-21 linked nucleosides. In some embodiments, the antisense strand and / or the sense strand of the siRNA consists of 18-30 linked nucleosides. In some embodiments, the antisense strand and / or the sense strand of the siRNA consists of 20-30 linked nucleosides. In some embodiments, the antisense strand and / or the sense strand of the siRNA consists of 21-30 linked nucleosides. In some embodiments, the antisense strand and / or the sense strand of the siRNA consists of 23-30 linked nucleosides. In some embodiments, the antisense strand and / or the sense strand of the siRNA consists of 18-25 linked nucleosides. In some embodiments, the antisense strand and / or the sense strand of the siRNA consists of 20-22 linked nucleosides. In some embodiments, the antisense strand and / or the sense strand of the siRNA consists of 21-23 linked nucleosides. In some embodiments, the antisense strand and / or the sense strand of the siRNA consists of 23-24 linked nucleosides. In some embodiments, the antisense strand and / or the sense strand of the siRNA consists of 20 linked nucleosides. In some embodiments, the antisense strand and / or the sense strand of the siRNA consists of 21 linked nucleosides. In some embodiments, theWSGR Docket No. 71197-703.601antisense strand and / or the sense strand of the siRNA consists of 22 linked nucleosides. In some embodiments, the antisense strand and / or the sense strand of the siRNA consists of 23 linked nucleosides. In some embodiments, the antisense strand and / or the sense strand of the siRNA consists of 20 linked nucleosides having no more than 1 to 3 mismatches to a target sequence. In some embodiments, the antisense strand and / or the sense strand of the siRNA consists of 21 linked nucleosides having no more than 1 to 3 mismatches to a target sequence. In some embodiments, the antisense strand and / or the sense strand of the siRNA consists of 22 linked nucleosides having no more than 1 to 3 mismatches to a target sequence. In some embodiments, the antisense strand and / or the sense strand of the siRNA consists of 23 linked nucleosides having no more than 1 to 3 mismatches to a target sequence.

[0158] In some embodiments, the nucleobase sequence of the sense strand comprises a complementary region of at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases that is 100% complementary to the nucleobase sequence of an equal length portion of the antisense strand. In some embodiments, the nucleobase sequence of the sense strand is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the nucleobase sequence of an equal length portion of the antisense strand.FDX2 targeting siRNA Sequences

[0159] It is understood that the sequence set forth in each SEQ ID NO in the present disclosure contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. In addition, whenever a sequence set forth in a SEQ ID NO includes a thymidine (T) it is to be understood that each T may be independently and optionally replaced with a uracil (U), e.g., some or all of the Ts may be replaced with Us.

[0160] In some embodiments, the present disclosure provides siRNA molecules targeting FDX2. In some embodiments, the antisense strand of the siRNA comprises at least 12 nucleosides having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleobases as provided in Table A, Table B, Table C, Table D, Table E, or Table F. In some embodiments, the sense strand comprises at least 12 nucleosides having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleobases as provided in Table A, Table B, Table C, Table D, Table E, or Table F. In some embodiments, the antisense strand is selected from Table A, Table B, Table C, Table E, or Table F (see section “Tables” below). In some embodiments, the sense strand is selected from Table A, Table B, Table C, Table E, or Table F (see section “Tables” below).WSGR Docket No. 71197-703.601

[0161] In some embodiments, an antisense strand and sense strand of the siRNA is selected from Table A. In some embodiments, an antisense strand and a sense strand are selected from the same row in Table A to form an siRNA of the present disclosure. In some embodiments, an antisense strand and sense strand of the siRNA is selected from Table B. In some embodiments, an antisense strand and a sense strand are selected from the same row in Table B to form an siRNA of the present disclosure. In some embodiments, an antisense strand and sense strand of the siRNA is selected from Table C. In some embodiments, an antisense strand and a sense strand are selected from the same row in Table C to form an siRNA of the present disclosure. In some embodiments, an antisense strand and sense strand of the siRNA is selected from Table D. In some embodiments, an antisense strand and a sense strand are selected from the same row in Table D to form an siRNA of the present disclosure.

[0162] In some embodiments, an siRNA comprises an antisense strand / sense strand compound pair in which the nucleobase sequence of the antisense strand and the nucleobase sequence of the sense strand are a duplex comprising any one of the following pairs of SEQ ID NOs: 9-142. In some embodiments, an siRNA comprises an antisense strand / sense strand pair in which the nucleobase sequence of the antisense strand and the nucleobase sequence of the sense strand are a duplex comprising any one of the following pairs of SEQ ID NOs: 143-276. In some embodiments, an siRNA comprises an antisense strand / sense strand compound pair in which the nucleobase sequence of the antisense strand and the nucleobase sequence of the sense strand are a duplex comprising any one of the following pairs of SEQ ID NOs: 277-410. In some embodiments, an siRNA comprises an antisense strand / sense strand compound pair in which the nucleobase sequence of the antisense strand and the nucleobase sequence of the sense strand are a duplex comprising any one of the following pairs of SEQ ID NOs: 411-604.

[0163] In some embodiments, the nucleobase sequence of the region of the antisense strand having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 9-57, 143-209, 277-343, 411-507, or 1104-1200 is at least 80% complementary to the nucleobase sequence of an equal length region of a FDX2 nucleic acid. In some embodiments, the nucleobase sequence of the sense strand comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 76-142, 210-276, 344-410, 508-604, and 1007-1103.

[0164] Thus, in some instances, the antisense strand of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 consecutive nucleobases selectedWSGR Docket No. 71197-703.601from SEQ ID NOs: 143-309 or 277-343, with no more than 1, 2, or 3 mismatches. In some instances, the sense strand of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleobases selected from SEQ ID NOs: 210-276 or 344-410, with no more than 1, 2, or 3 mismatches. In some instances, the antisense strand of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 consecutive nucleobases selected from SEQ ID NOs: 143-309 or 277-343, with no more than 1, 2, or 3 mismatches, and the sense strand of an antisense as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleobases selected from SEQ ID NOs: 210-276 or 344-410, with no more than 1, 2, or 3 mismatches.

[0165] In some instances, the antisense strand of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleobases selected from SEQ ID NOs: 9-75, with no more than 1, 2, or 3 mismatches. In some instances, the sense strand of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 consecutive nucleobases selected from SEQ ID NOs: 76-142, with no more than 1, 2, or 3 mismatches. In some instances, the antisense strand of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleobases selected from SEQ ID NOs: 9-75 and 605-671, with no more than 1, 2, or 3 mismatches, and the sense strand of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 consecutive nucleobases selected from SEQ ID NOs: 76-142, with no more than 1, 2, or 3 mismatches.

[0166] Thus, in some instances, the antisense strand of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 consecutive nucleobases selected from SEQ ID NOs: 873-1006, with no more than 1, 2, or 3 mismatches. In some instances, the sense strand of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleobases selected from SEQ ID NOs: 739-872, with no more than 1, 2, or 3 mismatches. In some instances, the antisense strand of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 consecutive nucleobases selected from SEQ ID NOs: 873-1006, with no more than 1, 2, or 3 mismatches, and the sense strand of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleobases selected from SEQ ID NOs: 739-872, with no more than 1, 2, or 3 mismatches.

[0167] In some instances, the antisense strand of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 consecutive nucleobases selected from SEQ ID NOs: 411-507, with no more than 1, 2, or 3 mismatches. In some instances, the sense strand of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, or 18WSGR Docket No. 71197-703.601consecutive nucleotides selected from SEQ ID NOs: 508-604, with no more than 1, 2, or 3 mismatches. In some instances, the antisense strand of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 consecutive nucleobases selected from SEQ ID NOs: 411-507, with no more than 1, 2, or 3 mismatches, and the sense strand of an siRNA comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, or 18 consecutive nucleotides selected from SEQ ID NOs: 508-604, with no more than 1, 2, or 3 mismatches.

[0168] In some instances, the antisense strand of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleobases selected from SEQ ID NOs: 1104-1200, with no more than 1, 2, or 3 mismatches. In some instances, the sense strand of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleobases selected from SEQ ID NOs: 1007-1103, with no more than 1, 2, or 3 mismatches. In some instances, the antisense strand of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleobases selected from SEQ ID NOs: 1104-1200, with no more than 1, 2, or 3 mismatches, and the sense strand of an siRNA comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleobases selected from SEQ ID NOs: 1007-1103, with no more than 1, 2, or 3 mismatches.

[0169] In some instances, the antisense strand of an siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 143-309 or 277-343. In some instances, the sense strand of an siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 210-276 or 344-410. In some instances, the antisense strand of an siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 143-309 or 277-343, and the sense strand of an siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 210-276 or 344-410.

[0170] In some instances, the antisense strand of an siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 9-75. In some instances, the sense strand of an siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 76-142. In some instances, the antisense strand of an siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 9-75, and the sense strand of an siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 76-142.WSGR Docket No. 71197-703.601

[0171] In some instances, the antisense strand of an siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 411-507. In some instances, the sense strand of an siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 508-604. In some instances, the antisense strand of an siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 411-507, and the sense strand of an siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 508-604.

[0172] In some instances, the antisense strand of an siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 1104-1200. In some instances, the sense strand of an siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 1007-1103. In some instances, the antisense strand of an siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 1104-1200, and the sense strand of an siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 1007-1103.

[0173] In some embodiments, the antisense strand comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence from a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 9-75 with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the antisense strand comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence from a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 143-209 with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the antisense strand comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence from a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 277-343 with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the antisense strand comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence from a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 411-507 with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the antisense strand comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence from a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 1104-1200 with no more than 1, 2, 3, or 4 mismatches.

[0174] In some instances, the sense strand comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence from a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 76-142 with no more than 1, 2, 3, or 4 mismatches. In some instances, theWSGR Docket No. 71197-703.601sense strand comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence from a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 210-276 with no more than 1, 2, 3, or 4 mismatches. In some instances, the sense strand comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence from a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 344-410 with no more than 1, 2, 3, or 4 mismatches. In some instances, the sense strand comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence from a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 508-604 with no more than 1, 2, 3, or 4 mismatches. In some instances, the sense strand comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence from a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 1007-1103 with no more than 1, 2, 3, or 4 mismatches.

[0175] In some instances, the antisense strand is at least or about 80% identical to a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 9-75, 143-209, 277-343, 411-507, and 1104-1200. In some instances, the antisense strand is at least or about 85% identical to a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 9-75, 143-209, 277-343, 411-507, and 1104-1200. In some instances, antisense strand is at least or about 90% identical to a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 9-75, 143-209, 277-343, 411-507, and 1104-1200. In some instances, the antisense strand is at least or about 95% identical to a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 9-75, 143-209, 277-343, 411-507, and 1104-1200. In some instances, the antisense strand is at least or about 98% identical to a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 9-75, 143-209, 277-343, 411-507, and 1104-1200. In some instances, the antisense strand is at least or about 100% identical to a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 9-75, 143-209, 277-343, 411-507, and 1104-1200.

[0176] In some instances, the sense strand is at least or about 80% identical to a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 76-142, 210-276, 344-410, 508-604, and 1007-1103. In some instances, the sense strand is at least or about 85% identical to a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 76-142, 210-276, 344-410, 508-604, and 1007-1103. In some instances, the sense strand is at least or about 90% identical to a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 76-142, 210-276, 344-410, 508-604, and 1007-1103. In some instances, the sense strand is at least or about 95% identical to a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 76-142, 210-276, 344-410, 508-604, and 1007-1103. In some instances, the sense strand is at least or about 98% identical to a nucleic acid sequence or nucleobase sequence selected fromWSGR Docket No. 71197-703.601SEQ ID NOs: 76-142, 210-276, 344-410, 508-604, and 1007-1103. In some instances, the sense strand is at least or about 100% identical to a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 76-142, 210-276, 344-410, 508-604, and 1007-1103.

[0177] In some instances, the antisense strand comprises or consists of a nucleic acid sequence selected from SEQ ID NOs: 9-75, 143-209, 277-343, 411-507, and 1104-1200. In some instances, the sense strand comprises or consists of a nucleic acid sequence selected from SEQ ID NOs: 76-142, 210-276, 344-410, 508-604, and 1007-1103.Modified siRNAs

[0178] In some embodiments, the siRNA molecules described herein comprises a modified nucleotide in the antisense strand, sense strand, or both. In some embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety or sugar surrogate. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the siRNA compounds. In some embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In some embodiments, modified oligonucleotides comprise one or more modified internucleoside linkages. In certain such embodiments, the modified, unmodified, and differently modified sugar moieties, sugar surrogates, nucleobases, and / or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In some embodiments, the patterns of sugar moieties, sugar surrogates, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and / or intemucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the nucleobase sequence). Certain examples of modifications for oligonucleotides are described in WO2024 / 209394.

[0179] In some embodiments, modified oligonucleotides comprise one or more nucleosides comprising an unmodified nucleobase. In some embodiments, modified oligonucleotides comprise one or more nucleosides comprising a modified nucleobase. In some embodiments, modified oligonucleotides comprise one or more nucleosides that do not comprise a nucleobase, referred to as an abasic nucleoside. In some embodiments, modified oligonucleotides contain no abasic nucleosides. In some embodiments, modified oligonucleotides comprise one or more inosine nucleosides (i.e., nucleosides comprising a hypoxanthine nucleobase). An “unmodified nucleobase” is unmodified adenine (A), unmodified thymine (T), unmodified cytosine (C), unmodified uracil (U), or unmodified guanine (G). A modified nucleobase is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one other nucleobase. 5-methylcytosine and hypoxanthine are examples of modified nucleobases.WSGR Docket No. 71197-703.601

[0180] In some embodiments, the inhibitory nucleic acid comprises at least one nucleotide modified at the 2’ position of the sugar. As used herein, “2’-modified” or “2 ’-substituted” refers to a nucleoside comprising a sugar comprising a substituent at the 2’ position other than H or OH. As used herein, “2’-modified sugar moiety” or “2’-modified sugar” means a furanosyl sugar modified at the 2’ position.

[0181] One or more substituted sugar moieties can also be included, e.g., one of the following at the 2’ position: -OH, -SH, -SCH3, -F, -OCN, -OCH3, -O(CH2)nCH3, -O(CH2)nNH2 or -O(CH2)nCH3 where n is from 1 to about 10; Cl to CIO lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; -Cl; -Br; -CN; -CF3; -OCF3; -O-, -S-, or -N-alkyl; -O-, -S-, or -N-alkenyl; -SOCH3; -SO2CH3; -ONO2; -NO2; -N3; -NH2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving the pharmacokinetic properties of an oligonucleotide; or a group for improving the pharmacodynamic properties of an oligonucleotide and other substituents having similar properties. A preferred modification includes 2’ -methoxy ethoxy [2’-O-CH2CH2OCH3, also known as 2’-O-(2-methoxyethyl)] (Martin et al. 1995, Helv. Chim. Acta 78:486-504). Other preferred modifications include 2’-methoxy (2’-0Me), 2’-propoxy (2’-OCH2CH2CH3) and 2’-fluoro (2’-F). Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3’ position of the sugar on the 3’ terminal nucleotide and the 5’ position of 5’ terminal nucleotide.Oligonucleotides may also have sugar mimetics such as cyclobutyls in place of the pentofuranosyl group.

[0182] In some embodiments, such modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In some embodiments, 2’ modifications are selected from substituents including, but not limited to: -O[(CH2)nO]mCH3, -O(CH2)nNH2, -O(CH2)nCH3, -O(CH2)nF, -O(CH2)nONH2, -OCH2C(O)N(H)CH3, and -O(CH2)nON[(CH2)nCH3]2, where n and m are from 1 to about 10. Other 2 ’-substituent groups can also be selected from: C1-C12 alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, F, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, or a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties. In some embodiments, modified nucleosides comprise a 2’ -MOE side chain (BakerWSGR Docket No. 71197-703.601et al. 1997, J. Biol. Chem. 272: 11944-12000). Such 2’-MOE substitutions have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2’-O-methyl, O-propyl, and O-aminopropyl.

[0183] 2’ -modified nucleosides, include, but are not limited to, bicyclic nucleosides wherein the bridge connecting two carbon atoms of the sugar ring connects the 2’ carbon and another carbon of the sugar ring; and nucleosides with non-bridging 2’ substituents, such as allyl, amino, azido, thio, O-allyl, O-C1-C10 alkyl, -OCF3, O-(CH2)2-O-CH3, 2’-O(CH2)2SCH3, O-(CH2)2-0-N(Rm)(Rn), or 0-CH2-C(=0)-N(Rm)(Rn), where each Rm and Rn is, independently, H or substituted or unsubstituted C1-C10 alkyl. 2’-modifed nucleosides may further comprise other modifications, for example at other positions of the sugar and / or at the nucleobase.

[0184] In some embodiments, the 2’ modification is a 2’-O-alkyl, 2’-O-alkyl-O-alkyl or 2’-fluoro-modified nucleotide. In some embodiments, RNA modifications include 2’-fluoro, 2’-amino, and 2’-O-methyl modifications on the ribose of pyrimidines, abasic residues, or an inverted base at the 3’ end of the RNA. Such modifications are routinely incorporated into oligonucleotides and these oligonucleotides have been shown to have a higher Tm (i.e., higher target binding affinity) than 2’ -deoxy oligonucleotides against a given target.

[0185] In some embodiments, nucleosides comprise chemically modified ribofuranose ring moieties. Examples of chemically modified ribofuranose rings include without limitation, addition of substituent groups (including 5’ and 2’ substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(R1)(R2) (R, R1 and R2 are each independently H, C1-C12 alkyl or a protecting group) and combinations thereof. Examples of chemically modified sugars include 2 ’-F-5’ -methyl substituted nucleoside (see W02008 / 101157 for other disclosed 5’,2’-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2’-position (see US20050130923) or alternatively 5 ’-substitution of a BNA (see W02007 / 134181, wherein LNA is substituted with for example a 5’-methyl or a 5’-vinyl group).

[0186] Examples of nucleosides having modified sugar moieties include without limitation nucleosides comprising a morpholino nucleic acid modification, a cyclohexenyl nucleic acid modification, a 5’-vinyl modification, a 5’-methyl (R or S) modification, a 4’-S modification, a 2’-F modification, a 2’-OCH3 modification, a2’-OCH2CH3 modification, a2’-OCH2CH2F modification, and a 2’-O(CH2)2OCH3 modification. The substituent at the 2’ position can also be selected from allyl, amino, azido, thio, -O-allyl, -O-C1-C10 alkyl, -OCF3, -OCH2F, -O(CH2)2SCH3, -O(CH2)2O-N(Rm)(Rn), -O-CH2-C(=O)-N(Rm)(Rn), and -O-CH2-C(=O)-WSGR Docket No. 71197-703.601N(Rl)-(CH2)2-N(Rm)(Rn), where each Rl, Rm and Rn is, independently, H or substituted or unsubstituted Cl -CIO alkyl.

[0187] As used herein, “bicyclic nucleosides” refer to modified nucleosides comprising a bicyclic sugar moiety. Examples of bicyclic nucleosides include without limitation nucleosides comprising a bridge between the 4’ and the 2’ -ribosyl ring atoms. In some embodiments, antisense compounds provided herein include one or more bicyclic nucleosides comprising a 4’ to 2’ bridge. Examples of such 4’ to 2’ bridged bicyclic nucleosides, include but are not limited to one of the formulae: 4’-(CH2)-O-2’ (LNA); 4’-(CH2)-S-2’; 4’-(CH2)2-O-2’ (ENA); 4’-CH(CH3)-O-2’ and 4’-CH(CH2OCH3)-O-2’ (and analogs thereof see US7399845); 4’-C(CH3)(CH3)-O-2’ (and analogs thereof see W02009 / 006478); 4’-CH2-N(OCH3)-2’ (and analogs thereof see W02008 / 150729); 4’-CH2-O-N(CH3)-2’ (see US20040171570); 4’-CH2-N(R)-0-2’, wherein R is H, C1-C12 alkyl, or a protecting group (see US7427672); 4’-CH2-C(H)(CH3)-2’ (see Chattopadhyaya et al. 2009, J. Org. Chem. 74:118-134); and 4’-CH2-C-(=CH2)-2’ (and analogs thereof see W02008 / 154401).

[0188] In some embodiments, bicyclic sugar moi eties of BNA nucleosides include, but are not limited to, compounds having at least one bridge between the 4’ and the 2’ position of the pentofuranosyl sugar moiety wherein such bridges independently comprises 1 or from 2 to 4 linked groups independently selected from -[C(Ra)(Rb)]n-, wherein n is 1, 2, 3, or 4; and each Ra and Rb is, independently, H, or Cl -Cl 2 alkyl.

[0189] In some embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4’-2’ methyleneoxy bridge, may be in the a-L configuration or in the -D configuration.

[0190] In some embodiments, bicyclic nucleosides include, but are not limited to, (A) a-L-methyleneoxy (4’-CH2-O-2’) BNA, (B) -D-methyleneoxy (4’-CH2-O-2’) BNA, (C) ethyleneoxy (4’-(CH2)2-O-2’) BNA, (D) aminooxy (4’-CH2- O-N(R)-2’) BNA, (E) oxyamino (4’-CH2-N(R)-O-2’) BNA, and (F) methyl(methyleneoxy) (4’-CH(CH3)-O-2’) BNA, (G) methylene-thio (4’-CH2-S-2’) BNA, (H) methylene- amino (4’-CH2-N(R)-2’) BNA, (I) methyl carbocyclic (4’-CH2-CH(CH3)-2’) BNA, and (J) propylene carbocyclic (4’-(CH2)3-2’) BNA as depicted below:WSGR Docket No. 71197-703.601wherein Bx is the base moiety and R is independently H, a protecting group or C1-C12 alkyl.

[0191] In some embodiments, a sugar modification is an unlocked nucleic acid (UNA) or a glycerol nucleic acid (GNA). Exemplary sugar modifications are described by Hu et al. 2020, Signal Transduction and Targeted Therapy 5:101.

[0192] Many other bicyclo and tricyclo sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into inhibitory oligonucleotide compounds (see for example Leumann 2002, Bioorg. Med. Chem. 10:841-854). Such ring systems can undergo various additional substitutions to enhance activity.

[0193] In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.

[0194] siRNA molecules described herein can also include, additionally or alternatively, nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleobases include nucleobases found only infrequently or transiently in natural nucleic acids, e.g., xanthine, hypoxanthine, 6-methyladenine, 5-Me pyrimidines, particularly 5-methylcytosine (also referred to as 5-methyl-2’ -deoxy cytosine and often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, as well as synthetic nucleobases, e.g., 2-aminoadenine, 2- (m ethyl amino)adenine, 2-(imidazolylalkyl)adenine, 2-(aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudo-uracil), 4-thiouracil, 8-halo, 8-amino, 8-WSGR Docket No. 71197-703.601thiol, 8- thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5- bromo, 5 -trifluoromethyl and other 5-substituted uracils and cytosines, 7-deazaadenine, 3-deazaguanine, 3 -deazaadenine, 7-methylquanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl)adenine, methyl and other alkyl derivatives of adenine and guanine, 6-, 2-propyl and other alkyl derivatives of adenine and guanine, and 2,6- diaminopurine (Gebeyehu et al. 1987, Nucl. Acids Res. 15:4513-4534). A “universal” base known in the art, e.g., inosine, can also be included.

[0195] Further, nucleobases comprise those disclosed in US Patent No. US3687808, those disclosed in ‘The Concise Encyclopedia of Polymer Science and Engineering’, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, and those disclosed by Sanghvi, Y. S., in Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 28-302. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, comprising 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.

[0196] In some embodiments, an oligonucleotide (e.g., one or both of an antisense strand and a sense strand) of an siRNA is modified (and referred to as a modified oligonucleotide, e.g., a modified antisense strand or a modified sense strand) with one or more 2’-0Me sugar moiety (i.e., a 2’-0Me modified nucleoside) and / or one or more 2’-F sugar moiety (i.e., a 2’-F modified nucleoside).

[0197] In some instances, an siRNA described herein, comprises one or more modified sugar moieties selected from, but are not limited to, a bicyclic sugar moiety, e.g., a modified furanosyl sugar moiety containing a 2’-4’ bridge selected from -O-CH2-; and -O-CH(CH3)-, and a non-bicyclic sugar moiety, e.g., a 2’-M0E sugar moiety, a 2’-F sugar moiety, a 2’-0Me sugar moiety, a 2’-deoxy sugar moiety, a 2’- NMA sugar moiety, a UNA, or a GNA.

[0198] In some embodiments, the antisense strand comprises 21 nucleosides, and the antisense strand is modified with a modification pattern (from 5’ to 3’) of yfyyyfyffyyyyfyfyyyyy, wherein each ‘y’ represents a 2’-0Me modified nucleoside and each ‘f represents a 2’-F modified nucleoside. In some embodiments, a sugar moiety of a sense strand is modified, wherein the modified sugar moiety is selected from 2’-F, 2’-M0E, 2’-0Me, and 2’-deoxy.

[0199] In some embodiments, the sense strand comprises 19 nucleosides, and the sense strand is modified with a modification pattern (from 5’ to 3’) of yyyyfyfffyyyyyyyyyy, wherein each ‘y’ represents a 2’-0Me modified nucleotide, each ‘f represents a 2’-F modified nucleotide, and ‘d’ represents a 2’-deoxy nucleotide.WSGR Docket No. 71197-703.601

[0200] In some embodiments, the antisense strand is modified with a modification pattern (from 5’ to 3’) of yfyyyfyffyyyyfyfyyyyy, and the sense strand is modified with a modification pattern (from 5’ to 3’) of yyyyfyfffyyyyyyyyyy, wherein each ‘y’ represents a 2’-OMe modified nucleotide, and each ‘f represents a 2’-F modified nucleotide.

[0201] It is not necessary for all positions in a given oligonucleotide to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single strand or even at within a single nucleoside within an oligonucleotide.Modified Backbones

[0202] A number of nucleotide and nucleoside modifications have been shown to make the oligonucleotide into which they are incorporated more resistant to nuclease digestion than the native oligodeoxynucleotide; these modified oligos survive intact for a longer time than unmodified oligonucleotides. Specific examples of modified oligonucleotides include those comprising modified backbones, for example, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. Phosphorus-containing linkages include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising 3 ’-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates comprising 3 ’-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3’-5’ linkages, 2’-5’ linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3’-5’ to 5’-3’ or 2’-5’ to 5’-2’.

[0203] In some embodiments, oligomer duplexes targeted to a FDX2 nucleic acid comprise one or more modified internucleoside linkages. In some embodiments, the modified intemucleoside linkages are interspersed throughout the antisense strand and / or the sense strand. In some embodiments, the modified internucleoside linkages are phosphorothioate linkages. In some embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage. In some embodiments, the modified internucleoside linkages are phosphorodithioate linkages. In some embodiments, the modified internucleoside linkages are methoxypropyl phosphonate (MOP) linkages.

[0204] In some embodiments, in an siRNA provided herein, at least one intemucleoside linkage of the modified antisense strand and / or the modified sense strand comprises a modified intemucleoside linkage. In some embodiments, the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage. In some embodiments, at least one of the first, second, or third intemucleoside linkages from the 5’ end and / or the 3’ end of the modified antisenseWSGR Docket No. 71197-703.601strand comprises a phosphorothioate linkage. In some embodiments, at least one of the first, second, or third intemucleoside linkages from the 5’ end and / or the 3’ end of the modified sense strand comprises a phosphorothioate linkage. In some embodiments, the modified internucleoside linkage is a mesyl phosphoramidate intemucleoside linkage. In some embodiments, at least one of the intemucleoside linkages of the modified antisense strand comprises a mesyl phosphoramidate intemucleoside linkage. In some embodiments, at least one of the intemucleoside linkages of the modified sense strand comprises a mesyl phosphoramidate intemucleoside linkage.

[0205] In some embodiments, in an siRNA provided herein, each intemucleoside linkage of the modified antisense strand is independently selected from a phosphodiester, a phosphorothioate, or a mesyl phosphoramidate intemucleoside linkage, and each intemucleoside linkage of the modified sense strand is independently selected from a phosphodiester, a phosphorothioate, or a mesyl phosphoramidate intemucleoside linkage.

[0206] In some embodiments, in an siRNA provided herein, each intemucleoside linkage of the modified antisense strand is independently selected from a phosphodiester or a phosphorothioate intemucleoside linkage and each intemucleoside linkage of the modified sense strand is independently selected from a phosphodiester or a phosphorothioate intemucleoside linkage.

[0207] Modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl intemucleoside linkages, mixed heteroatom and alkyl or cycloalkyl intemucleoside linkages, or one or more short chain heteroatomic or heterocyclic intemucleoside linkages. These comprise those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.

[0208] In some embodiments, both a sugar and an intemucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, for example, an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. In some embodiments, in an siRNAWSGR Docket No. 71197-703.601provided herein, at least one internucleoside linkage of the modified antisense strand is a modified internucleoside linkage.

[0209] In some embodiments, the two 5 ’-most intemucleoside linkages of the modified antisense strand and / or the modified sense strand of an siRNA are modified. In some embodiments, the first one or 2 internucleoside linkages from the 3 ’-end of the modified antisense strand and / or the modified sense strand of an siRNA are modified. In some embodiments, the two 5’-most intemucleoside linkages of the modified antisense strand and / or the modified sense strand of an siRNA are modified and the first two intemucleoside linkages from the 3 ’-end of the modified antisense strand and / or the modified sense strand are modified. In some embodiments, the modified intemucleoside linkage is a phosphorothioate linkage. In some embodiments, the modified intemucleoside linkage is a mesyl phosphoramidate linkage. Modified Sequences

[0210] In some embodiments, a modified antisense strand comprises or consists of 12 to 50 linked nucleosides, wherein the modified antisense strand comprises a region having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 9-75, 143-209, 277-343, 411-507, or 1104-1200; and a modified sense strand consisting of 12 to 50 linked nucleosides that contains a region of at least 12 contiguous nucleosides, wherein the nucleobase sequence of the region of at least 12 contiguous nucleosides is at least 80%, at least 90%, at least 95%, or at least 99% or 100% complementary to the nucleobase sequence of an equal length region of the modified antisense strand.

[0211] In some instances, the antisense strand of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleobases selected from SEQ ID NOs: 672-738, with no more than 1, 2, or 3 mismatches. In some instances, the sense strand of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 consecutive nucleobases selected from SEQ ID NOs: 605-671, with no more than 1, 2, or 3 mismatches. In some instances, the antisense strand of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleobases selected from SEQ ID NOs: 672-738, with no more than 1, 2, or 3 mismatches, and the sense strand of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 consecutive nucleobases selected from SEQ ID NOs: 605-671, with no more than 1, 2, or 3 mismatches.

[0212] In some instances, the antisense strand of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleobases selected from SEQ ID NOs: 873-1006, with no more than 1, 2, or 3 mismatches. In some instances, the sense strandWSGR Docket No. 71197-703.601of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 consecutive nucleobases selected from SEQ ID NOs: 739-872, with no more than 1, 2, or 3 mismatches. In some instances, the antisense strand of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleobases selected from SEQ ID NOs: 873-1006, with no more than 1, 2, or 3 mismatches, and the sense strand of an siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 consecutive nucleobases selected from SEQ ID NOs: 739-872, with no more than 1, 2, or 3 mismatches.

[0213] In some embodiments, an siRNA comprises: a modified antisense strand consisting of 12 to 50 linked nucleosides, wherein the modified antisense strand comprises a region having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 9-75; and a modified sense strand consisting of 12 to 50 linked nucleosides that contains a region of at least 12 contiguous nucleosides, wherein the nucleobase sequence of the region of at least 12 contiguous nucleosides is at least 80%, at least 90%, at least 95%, or at least 99% or 100% complementary to the nucleobase sequence of an equal length region of the modified antisense strand.

[0214] In some embodiments, the nucleobase sequence of the region of the modified antisense strand having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 9-75 is at least 80% complementary to the nucleobase sequence of an equal length region of a FDX2 nucleic acid. In some embodiments, the nucleobase sequence of the modified sense strand comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 76-142.

[0215] In some embodiments, an siRNA comprises: a modified antisense strand consisting of 15 to 30 linked nucleosides, wherein the nucleobase sequence of the modified antisense strand comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 143-209 or 277-343 and a modified sense strand consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of the modified sense strand comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of the nucleobase sequence of any one ofWSGR Docket No. 71197-703.601SEQ ID NOs: 210-279 or 344-410. In some embodiments, an siRNA comprises a modified antisense strand consisting of 18 to 30 linked nucleosides, wherein the nucleobase sequence of the modified antisense strand comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 143-209 or 277-343 and a modified sense strand consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of the modified sense strand comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 210-276 or 344-410. In some embodiments, an siRNA comprises: a modified antisense strand consisting of 19 to 25 linked nucleosides, wherein the nucleobase sequence of the modified antisense strand comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 143-209 or 277-343; and a modified sense strand consisting of 16 to 24 linked nucleosides, wherein the nucleobase sequence of the modified sense strand comprises at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 210-276 or 344-410. In some embodiments, an siRNA comprises a modified antisense strand, wherein the modified antisense strand consists of 23, 22 or 21 linked nucleosides and has nucleobase sequence comprising at least a 19-mer nucleobase sequence of any one of SEQ ID NOs: 143-209 or 277-343 and having 0, 1, 2 or 3 nucleobases that are different from the corresponding nucleotide in any of SEQ ID NOs: 143-209 or 277-343; and a modified sense strand, wherein the modified sense strand consists of 21 linked nucleosides and has a nucleobase sequence comprising at least a 16-mer nucleobase sequence of any one of SEQ ID NOs: 210-276 or 344-410 and having 0, 1, 2 or 3 nucleobases that are different from the corresponding nucleotide in any of SEQ ID NOs: 210-276 or 344-410.

[0216] In some embodiments, an siRNA comprises a modified antisense strand, wherein the modified antisense strand consists of 23, 22 or 21 linked nucleosides and has a nucleobase sequence comprising at least a 19-mer nucleobase sequence of any one of SEQ ID NOs: 143 -209 or 277-343; and a modified sense strand, wherein the modified sense strand consists of 21 linked nucleosides and has a nucleobase sequence comprising at least a 19-mer nucleobase sequence of any one of SEQ ID NOs: 210-276 or 344-410. In some aspects, an siRNA (e.g., siRNA) provided herein comprises or consists of a modified antisense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 9-75 and a modified sense strand comprisingWSGR Docket No. 71197-703.601a nucleic acid sequence selected from SEQ ID NOs: 76-142. In some aspects, an siRNA (e.g., siRNA) provided herein comprises or consists of a modified antisense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 143-209 and a modified sense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 210-276. In some aspects, an siRNA (e.g., siRNA) provided herein comprises or consists of a modified antisense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 277-343 and a modified sense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 344-410.

[0217] In some embodiments, an siRNA comprises: a modified antisense strand consisting of 15 to 30 linked nucleosides, wherein the nucleobase sequence of the modified antisense strand comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 9-75 and a modified sense strand consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of the modified sense strand comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 76-142. In some embodiments, an siRNA comprises a modified antisense strand consisting of 18 to 30 linked nucleosides, wherein the nucleobase sequence of the modified antisense strand comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 9-75 and a modified sense strand consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of the modified sense strand comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 76-142. In some embodiments, an siRNA comprises a modified antisense strand consisting of 17 to 23 linked nucleosides, wherein the nucleobase sequence of the modified antisense strand comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 9-75; and a modified sense strand consisting of 14 to 22 linked nucleosides, wherein the nucleobase sequence of the modified sense strand comprises at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 76-142. In some embodiments, an siRNA comprises a modified antisense strand, wherein the modified sense strand consists of 21, 20 or 19 linked nucleosides and has a nucleobase sequence comprising at least a 19-mer nucleobase sequence of any one of SEQ ID NOs: 9-75 having 0, 1, 2 or 3WSGR Docket No. 71197-703.601mismatches with a sequence in a target FDX2 nucleic acid sequence; and a modified sense strand, wherein the modified sense strand consists of 19 linked nucleosides, comprising at least a 19-mer nucleobase sequence of any one of SEQ ID NOs: 76-142 having 0, 1, 2 or 3 mismatches to the modified antisense strand.

[0218] In some embodiments, an siRNA comprises a modified antisense strand, wherein the modified antisense strand consists of 21, 20 or 19 linked nucleosides and has a nucleobase sequence comprising at least a 19-mer nucleobase sequence of any one of SEQ ID NOs: 9-75; and a modified sense strand, wherein the modified sense strand consists of 19 linked nucleosides and has a nucleobase sequence comprising at least a 19-mer nucleobase sequence of any one of SEQ ID NOs:76-142. In some embodiments, an siRNA comprises a modified antisense strand, wherein the modified antisense strand consists of 21 linked nucleosides and has a nucleobase sequence comprising at least a 19-mer nucleobase sequence of any one of SEQ ID NOs: 9-75; and a modified sense strand, wherein the modified sense strand consists of 19 linked nucleosides and has a nucleobase sequence comprising at least a 16-mer nucleobase sequence of any one of SEQ ID NOs: 76-142, wherein the nucleobase sequence of the modified sense strand is at least 90% complementary to the nucleobase sequence of an equal length portion of the modified antisense strand.

[0219] In some aspects, an siRNA (e.g., siRNA) provided herein comprises or consists of an antisense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 411-507 and a sense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 508-604.

[0220] In some aspects, an siRNA (e.g., siRNA) provided herein comprises or consists of an antisense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1104-1200 and a sense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1007-1103.

[0221] In some embodiments, an siRNA comprises two or more regions each of which has a nucleobase sequence complementary to the nucleobase sequence of a different target region of the same nucleic acid target (FDX2 nucleic acid), or one of which has a nucleobase sequence complementary to the nucleobase sequence of a target region of a FDX2 nucleic acid (e.g., a FDX2 RNA such as described herein) and the other having a nucleobase sequence complementary to the nucleobase sequence of a target region of a different nucleic acid target (i.e., other than a FDX2 nucleic acid target). In some embodiments, the nucleobase sequence(s) complementary to a target region of a FDX2 nucleic acid targets a FDX2 nucleic acid region as described herein and / or comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 9-142. In some embodiments, the nucleobase sequence(s) complementary to a targetWSGR Docket No. 71197-703.601region of a FDX2 nucleic acid targets a FDX2 nucleic acid region as described herein and / or comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 143-276. In some embodiments, the nucleobase sequence(s) complementary to a target region of a FDX2 nucleic acid targets a FDX2 nucleic acid region as described herein and / or comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 277-410. In some embodiments, the nucleobase sequence(s) complementary to a target region of a FDX2 nucleic acid targets a FDX2 nucleic acid region as described herein and / or comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 411-604.

[0222] In some embodiments, such an siRNA comprises a modified antisense strand comprising (1) a first region having a nucleobase sequence complementary to a first sequence in a FDX2 target nucleic acid and (2) a second region having a nucleobase sequence complementary to (a) a different (i.e., second) sequence in a FDX2 target nucleic acid, or (b) a sequence in a target nucleic acid other than a FDX2 nucleic acid. In some such embodiments, the modified sense strand of the siRNA comprises (1) a region having a nucleobase sequence complementary to the first region of the modified antisense strand and (2) a region having a nucleobase sequence complementary to the second region of the modified antisense strand. In some embodiments, an siRNA comprises a modified antisense strand comprising a first region having a nucleobase sequence complementary to a first sequence in a FDX2 target nucleic acid and a modified sense strand comprising a second region having a nucleobase sequence complementary to: (a) the nucleobase sequence of a different (i.e., second) sequence in a FDX2 target nucleic acid, or (b) a sequence in a target nucleic acid other than a FDX2 nucleic acid. In some such embodiments, the modified antisense strand further comprises a region having a nucleobase sequence complementary to the nucleobase sequence of the second region in the modified sense strand. In some such embodiments, the modified sense strand further comprises a region having a nucleobase sequence complementary to the nucleobase sequence of the first region in the modified antisense strand (see, e.g., W02020 / 065602).

[0223] In some embodiments, the modified antisense strand of an siRNA comprises a conjugate group and / or terminal group; and the sense strand comprises a terminal group and / or a conjugate group. Either or both the antisense strand and sense strand of an siRNA may compriseWSGR Docket No. 71197-703.601a conjugate group. In some embodiments, the sense strand of an siRNA comprises a conjugate group attached at the 5’ or 3’ end of the sense strand. Either or both the antisense strand and sense strand of an siRNA may comprise a terminal group. In some embodiments, the antisense strand of an siRNA comprises a 5’-terminal group. One or both antisense strand and sense strand of an siRNA may include one or more (e.g., one, two, three, or more) terminal nucleosides that form an overhang at one (i.e., the 5’ end or 3’ end) or both ends of the siRNA. In some embodiments, an overhang is one or two nucleosides (e.g., of an antisense strand, sense strand) of an siRNA. In certain embodiments, the terminal one or two nucleosides at the 3’ end or at the 5’ end of an antisense or sense strand of an siRNA are overhang nucleosides. In some embodiments the overhang nucleosides are adenosine, inosine, uracil, or thymidine. In some embodiments, the overhang nucleosides have a sequence of TT, dTdT, or UU. In some embodiments, one or both ends of the siRNA are blunt ends.

[0224] In some embodiments, an overhang is one or two nucleosides of an antisense strand or a modified antisense strand of an siRNA. In some embodiments, the last two 3’ nucleosides (i.e., the 3 ’-terminal nucleoside and the nucleoside immediately 5’ of the 3 ’-terminal nucleoside) of an antisense strand or a modified antisense strand of an siRNA are overhang nucleosides. In some embodiments, a 3’ overhang nucleoside of an antisense strand or a modified antisense strand of an siRNA comprises an unmodified adenine, unmodified thymine, unmodified uracil or hypoxanthine nucleobase. In some embodiments, a 3’ overhang of an antisense strand or a modified antisense strand of an siRNA comprises two nucleosides, each comprising a nucleobase independently selected from an unmodified adenine, an unmodified thymine, an unmodified uracil and a hypoxanthine. In some embodiments, the last two nucleosides at the 3’ end of an antisense strand or a modified antisense strand of an siRNA having a 3’ overhang each comprise a nucleobase independently selected from an unmodified adenine, unmodified thymine, unmodified uracil and hypoxanthine. In some embodiments, a 3’ overhang nucleoside of an antisense strand or a modified antisense strand of an siRNA comprises an unmodified adenine nucleobase or hypoxanthine nucleobase. In some embodiments, a 3’ overhang of an antisense strand or a modified antisense strand of an siRNA comprises two nucleosides, each comprising a nucleobase independently selected from an unmodified adenine nucleobase or a hypoxanthine nucleobase. In some embodiments, the last two terminal nucleosides at the 3’ end of an antisense strand or a modified antisense strand of an siRNA having a 3’ overhang each independently comprise an unmodified adenine nucleobase or a hypoxanthine nucleobase. In some embodiments, the last two terminal nucleosides at the 3’ end of an antisense strand or a modified antisense strand of an siRNA having a 3’ overhang comprise an unmodified adenine nucleobase. In some embodiments, the last two terminal nucleosides at the 3’ end of an antisenseWSGR Docket No. 71197-703.601strand or a modified antisense strand of an siRNA having a 3’ overhang each comprise a hypoxanthine nucleobase. In some embodiments, the 3 ’-terminal nucleoside and the nucleoside immediately 5’ of the 3 ’-terminal nucleoside of an antisense strand or a modified antisense strand of an siRNA having a 3’ overhang comprise an unmodified adenine nucleobase and a hypoxanthine nucleobase, respectively. In some embodiments, the 3’ - terminal nucleoside and the nucleoside immediately 5’ of the 3 ’-terminal nucleoside of an antisense strand or a modified antisense strand of an siRNA having a 3’ overhang comprise a hypoxanthine nucleobase and an unmodified adenine nucleobase, respectively.

[0225] In some embodiments, an overhang of an siRNA is the 3 ’-terminal nucleoside of an antisense strand or a modified antisense strand of the siRNA. In some embodiments the 3’-terminal nucleoside of an antisense strand or a modified antisense strand of the siRNA having a 3’ overhang comprises an unmodified adenine, unmodified thymine, unmodified uracil or hypoxanthine nucleobase. In some embodiments, the 3 ’-terminal nucleoside of an antisense strand or a modified antisense strand of the siRNA having a 3’ overhang comprises an unmodified adenine nucleobase or hypoxanthine nucleobase. In some embodiments, the 3’-terminal nucleoside of an antisense strand or a modified antisense strand of the siRNA having a 3’ overhang comprises an unmodified adenine nucleobase. In some embodiments, the 3’-terminal nucleoside of an antisense strand or a modified antisense strand of the siRNA having a 3’ overhang comprises a hypoxanthine nucleobase.

[0226] In some embodiments, one or both ends of an siRNA are blunt ends. In some embodiments, one end of an siRNA is blunt. In some embodiments, both ends of an siRNA are blunt. In some embodiments, the 5 ’-terminal nucleoside of an antisense strand or a modified antisense strand of an siRNA having at least one blunt end comprises an unmodified thymine nucleobase. In some embodiments, the 3 ’-terminal nucleoside of an antisense strand or a modified antisense strand of an siRNA having at least one blunt end comprises an unmodified guanine or unmodified uracil nucleobase. In some embodiments, the 5 ’-terminal nucleoside of an antisense strand or a modified antisense strand of an siRNA having two blunt ends comprises an unmodified thymine nucleobase and the 3 ’-terminal nucleoside of an antisense strand or a modified antisense strand comprises an unmodified guanine or unmodified uracil nucleobase.

[0227] In some embodiments, an overhang is one or two nucleosides of a sense strand or a modified sense strand of an siRNA. In some embodiments, the last two 3’ nucleosides (i.e., the 3 ’-terminal nucleoside and the nucleoside immediately 5’ of the 3 ’-terminal nucleoside) of a sense strand or a modified sense strand of an siRNA are overhang nucleosides. In some embodiments, a 3’ overhang nucleoside of a sense strand or a modified sense strand of an siRNA comprises an unmodified adenine, unmodified thymine, unmodified uracil orWSGR Docket No. 71197-703.601hypoxanthine nucleobase. In some embodiments, a 3’ overhang of a sense strand or a modified sense strand of an siRNA comprises two nucleosides, each comprising a nucleobase independently selected from an unmodified adenine, an unmodified thymine, an unmodified uracil and a hypoxanthine. In some embodiments, the last two nucleosides at the 3’ end of a sense strand or a modified sense strand of an siRNA having a 3’ overhang each comprise a nucleobase independently selected from an unmodified adenine, unmodified thymine, unmodified uracil and hypoxanthine. In some embodiments, a 3’ overhang nucleoside of a sense strand or a modified sense strand of an siRNA comprises an unmodified adenine nucleobase or hypoxanthine nucleobase. In some embodiments, a 3’ overhang of a sense strand or a modified sense strand of an siRNA comprises two nucleosides, each comprising a nucleobase independently selected from an unmodified adenine nucleobase or a hypoxanthine nucleobase. In some embodiments, the last two terminal nucleosides at the 3’ end a sense strand or a modified sense strand of an siRNA having a 3’ overhang each independently comprise an unmodified adenine nucleobase or a hypoxanthine nucleobase. In some embodiments, the last two terminal nucleosides at the 3’ end of a sense strand or a modified sense strand of an siRNA having a 3’ overhang comprise an unmodified adenine nucleobase. In some embodiments, the last two terminal nucleosides at the 3’ end of a sense strand or a modified sense strand of an siRNA having a 3’ overhang each comprise a hypoxanthine nucleobase. In some embodiments, the 3 ’-terminal nucleoside and the nucleoside immediately 5’ of the 3 ’-terminal nucleoside of a sense strand or a modified sense strand of an siRNA having a 3’ overhang comprise an unmodified adenine nucleobase and a hypoxanthine nucleobase, respectively. In some embodiments, the 3’ - terminal nucleoside and the nucleoside immediately 5’ of the 3 ’-terminal nucleoside of a sense strand or a modified sense strand of an siRNA having a 3’ overhang comprise a hypoxanthine nucleobase and an unmodified adenine nucleobase, respectively.

[0228] In some embodiments, an overhang of an siRNA is the 3 ’-terminal nucleoside of a sense strand or a modified sense strand of the siRNA. In some embodiments the 3 ’-terminal nucleoside of a sense strand or a modified sense strand of the siRNA having a 3’ overhang comprises an unmodified adenine, unmodified thymine, unmodified uracil or hypoxanthine nucleobase. In some embodiments, the 3 ’-terminal nucleoside of a sense strand or a modified sense strand of the siRNA having a 3’ overhang comprises an unmodified adenine nucleobase or hypoxanthine nucleobase. In some embodiments, the 3 ’-terminal nucleoside of a sense strand or a modified sense strand of the siRNA having a 3’ overhang comprises an unmodified adenine nucleobase. In some embodiments, the 3 ’-terminal nucleoside of a sense strand or a modified sense strand of the siRNA having a 3’ overhang comprises a hypoxanthine nucleobase.WSGR Docket No. 71197-703.601

[0229] In some embodiments, one or both ends of an siRNA are blunt ends. In some embodiments, one end of an siRNA is blunt. In some embodiments, both ends of an siRNA are blunt. In some embodiments, the 5 ’-terminal nucleoside of a sense strand or a modified sense strand of an siRNA having at least one blunt end comprises an unmodified thymine nucleobase. In some embodiments, the 3 ’-terminal nucleoside of a sense strand or a modified sense strand of an siRNA having at least one blunt end comprises an unmodified guanine or unmodified uracil nucleobase. In some embodiments, the 5’-terminal nucleoside of a sense strand or a modified sense strand of an siRNA having two blunt ends comprises an unmodified thymine nucleobase and the 3 ’-terminal nucleoside of a sense strand or a modified sense strand comprises an unmodified guanine or unmodified uracil nucleobase.

[0230] In some embodiments, the present disclosure provides an siRNA that comprises a modified antisense strand consisting of 23 to 30 linked nucleosides and having a nucleobase sequence comprising 23 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 143-209 or 277-343 and a modified sense strand consisting of 21 to 29 linked nucleosides and having a nucleobase sequence comprising 21 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 210-276 or 344-410, wherein the modified antisense strand and modified sense strand are complementary. In some embodiments, the modified antisense strand comprises at least one 2’-OMe modified nucleotide. In some embodiments, the modified antisense strand comprises at least one 2’-F modified nucleotide. In some embodiments, the modified antisense strand comprises at least one phosphodiester linkage. In some embodiments, the modified antisense strand comprises at least one phosphorothioate internucleoside linkage. In some embodiments, each cytosine residue is a non-methylated cytosine. In some embodiments, each antisense strand has a terminal phosphate at the 5 ’-end. In some embodiments, the modified antisense strand comprises at least one phosphodiester linkage. In some embodiments, the modified antisense strand comprises at least one phosphorothioate internucleoside linkage. In some embodiments, each cytosine residue is a non-methylated cytosine. In some embodiments, the modified antisense strand and the modified sense strand are based on a pair of antisense / sense sequences that are in the same row of Table A, Table B, Table C, Table D, Table E, or Table F (e.g., the antisense sequence of SEQ ID NO: 143 and the sense sequence of SEQ ID NO: 210 form an antisense / sense sequence pair, etc., e.g., the antisense sequence of SEQ ID NO: 277 and the sense sequence of SEQ ID NO: 344 form an antisense / sense sequence pair, etc.).

[0231] In some embodiments, the present disclosure provides an siRNA that comprises a modified antisense strand consisting of 21 to 28 linked nucleosides and having a nucleobase sequence comprising 21 consecutive nucleobases of any of the nucleobase sequences of SEQ IDWSGR Docket No. 71197-703.601NOs: 9-75, 411-507, or 1104-1200 and a modified sense strand consisting of 19 to 27 linked nucleosides and having a nucleobase sequence comprising 19 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 76-142, 508-604, or 1007-1103, wherein the modified antisense strand and modified sense strand are complementary. In some embodiments, the modified antisense strand is 21 nucleotides in length and is modified with a modification pattern (from 5’ to 3’) yfyyyfyffyyyyfyfyyyyy wherein each ‘y’ represents a 2’-OMe modified nucleotide, and each ‘f represents a 2’-F modified nucleotide. In some embodiments, the modified antisense strand also has an internucleoside linkage motif is (from 5’ to 3’) ssooooooooooooooooss wherein each ‘o’ represents a phosphodiester internucleoside linkage and each ‘s’ represents a phosphorothioate internucleoside linkage. In some embodiments, each cytosine residue is a non-methylated cytosine. In some embodiments, each antisense strand has a terminal phosphate at the 5 ’-end. In some embodiments, the modified sense strand is 19 nucleotides in length and is modified with a modification pattern (from 5’ to 3’) yyyyfyfffyyyyyyyyyy wherein each ‘y’ represents a 2’-OMe modified nucleotide, each ‘f represents a 2’-F modified nucleotide, and ‘d’ represents a 2’-deoxy nucleotide. In some embodiments, the modified sense strand also has an intemucleoside linkage motif is (from 5’ to 3’) ssoooooooooooooooo wherein each ‘o’ represents a phosphodiester internucleoside linkage and each ‘s’ represents a phosphorothioate internucleoside linkage. In some embodiments, each cytosine residue is a non-methylated cytosine. In some embodiments, the modified antisense strand and the modified sense strand are based on a pair of antisense / sense sequences that are in the same row of Table A, B, C, or D (e.g., a modified antisense strand based on the sequence of SEQ ID NO: 9 and a modified sense strand based on the sequence of SEQ ID NO: 76, etc.).

[0232] In some embodiments, an antisense strand is selected from Table E and a sense strand is selected from Table E. In some embodiments, an antisense strand and a sense strand are selected from the same row in Table E to form an siRNA of the present disclosure.

[0233] In some embodiments, an antisense strand is selected from Table F and a sense strand is selected from Table F. In some embodiments, an antisense strand and a sense strand are selected from the same row in Table F to form an siRNA of the present disclosure.

[0234] In some embodiments, the antisense strand comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence from a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 672-738 with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the antisense strand comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence from a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 873-1006 with no more than 1, 2, 3, or 4 mismatches. In some embodiments, theWSGR Docket No. 71197-703.601antisense strand comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence from a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 1298-1394 with no more than 1, 2, 3, or 4 mismatches.

[0235] In some instances, the sense strand comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence from a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 605-671 with no more than 1, 2, 3, or 4 mismatches. In some instances, the sense strand comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence from a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 739-872 with no more than 1, 2, 3, or 4 mismatches. In some instances, the sense strand comprises at least 15 consecutive nucleic acid sequence or nucleobase sequence from a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 1201-1297 with no more than 1, 2, 3, or 4 mismatches.

[0236] In some instances, the antisense strand is at least or about 80% identical to a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 672-738, 873-1006, and 1298-1394. In some instances, the antisense strand is at least or about 85% identical to a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 672-738, 873-1006, and 1298-1394. In some instances, the antisense strand is at least or about 90% identical to a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 672-738, 873-1006, and 1298-1394. In some instances, the antisense strand is at least or about 95% identical to a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 672-738, 873-1006, and 1298-1394. In some instances, the antisense strand is at least or about 98% identical to a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 672-738, 873-1006, and 1298-1394. In some instances, the antisense strand is at least or about 100% identical to a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 672-738, 873-1006, and 1298-1394.

[0237] In some instances, the sense strand is at least or about 80% identical to a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 605-671, 739-872, and 1201-1297. In some instances, the sense strand is at least or about 85% identical to a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 605-671, 739-872, and 1201-1297. In some instances, the sense strand is at least or about 90% identical to a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 605-671, 739-872, and 1201-1297. In some instances, the sense strand is at least or about 95% identical to a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 605-671, 739-872, and 1201-1297. In some instances, the sense strand is at least or about 98% identical to a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 605-671, 739-872, and 1201-WSGR Docket No. 71197-703.6011297. In some instances, the sense strand is at least or about 100% identical to a nucleic acid sequence or nucleobase sequence selected from SEQ ID NOs: 605-671, 739-872, and 1201-1297.

[0238] In some instances, the antisense strand comprises or consists of a nucleic acid sequence selected from SEQ ID NOs: 672-738, 873-1006, and 1298-1394.

[0239] In some instances, the antisense strand comprises or consists of a nucleic acid sequence selected from SEQ ID NOs: 605-671, 739-872, and 1201-1297.

[0240] In some aspects, an siRNA provided herein comprises or consists of an antisense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 672-738 and a sense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 305-671. In some aspects, an siRNA provided herein comprises or consists of an antisense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 873-1006 and a sense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 739-872. In some aspects, an siRNA provided herein comprises or consists of an antisense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1298-1394 and a sense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1201-1297.

[0241] Thus, in some instances, the siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleobases selected from SEQ ID NOs: 873-1006, with no more than 1, 2, or 3 mismatches. In some instances, the siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleobases selected from SEQ ID NOs: 739-872, with no more than 1, 2, or 3 mismatches. In some instances, the siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleobases selected from SEQ ID NOs: 873-1006, with no more than 1, 2, or 3 mismatches, and at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleobases selected from SEQ ID NOs: 739-872, with no more than 1, 2, or 3 mismatches.

[0242] In some instances, the siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleobases selected from SEQ ID NOs: 605-671, with no more than 1, 2, or 3 mismatches. In some instances, the siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleobases selected from SEQ ID NOs: 672-738, with no more than 1, 2, or 3 mismatches. In some instances, the siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleobases selected from SEQ ID NOs: 605-671, with no more than 1, 2, or 3 mismatches, and at least 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleobases selected from SEQ ID NOs: 672-738, with no more than 1, 2, or 3 mismatches.WSGR Docket No. 71197-703.601

[0243] In some instances, the siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleobases selected from SEQ ID NOs: 1298-1394, with no more than 1, 2, or 3 mismatches. In some instances, the siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleobases selected from SEQ ID NOs: 1201-1297, with no more than 1, 2, or 3 mismatches. In some instances, the siRNA as disclosed herein comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleobases selected from SEQ ID NOs: 1298-1394, with no more than 1, 2, or 3 mismatches, and at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleobases selected from SEQ ID NOs: 1201-1297, with no more than 1, 2, or 3 mismatches.

[0244] In some instances, the siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 873-1006. In some instances, the siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 739-872. In some instances, the siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 873-1006, and a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 739-872.

[0245] In some instances, the siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 605-671. In some instances, the siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 672-738. In some instances, the siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 605-671, and a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 672-738.

[0246] In some instances, the siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 1298-1394. In some instances, the siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 1201-1297. In some instances, the siRNA as disclosed herein comprises a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 1298-1394, and a nucleobase sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NOs: 1201-1297.WSGR Docket No. 71197-703.601Ligand Conjugation

[0247] In some instances, siRNAs can be coupled to, or covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the siRNAs. Typical conjugate groups include cholesterol moieties and lipid moieties. Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. In some embodiments, an antisense compound may be covalently linked to one or more moieties that target the antisense compound to the central nervous system (CNS), e.g., via conjugation to 2’-O-hexadecyl (C16) (e.g., see Brown et al. 2002, Nature Biotechnol. 40:1500-1508).

[0248] siRNAs can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation and can help in delivery and / or localization within a cell. The cap can be present at the 5 ’-terminus (5 ’-cap), or at the 3 ’-terminus (3 ’-cap) or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps.Further 3’ and 5 ’-stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in W003 / 004602.

[0249] In some embodiments, the siRNAs are chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Such moieties comprise but are not limited to, lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl- S-tritylthiol, a thiocholesterol), an aliphatic chain, e.g., dodecanediol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium l,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety. These moieties or conjugates can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this invention, include groups that improve uptake, enhance resistance to degradation, and / or strengthen sequence-specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic properties,WSGR Docket No. 71197-703.601in the context of this invention, include groups that improve uptake, distribution, metabolism or excretion of the compounds of the present invention. Conjugate moieties include, but are not limited to, lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-5-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecanediol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxy cholesterol moiety.

[0250] In some embodiments, the siRNAs may be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting inhibitory nucleic acids. In the case of a double stranded siRNA these moieties or conjugates may be covalently linked to one or both ends and / or at an internal position of the antisense strand and / or the sense strand. In some embodiments, the inhibitory nucleic acids covalently linked one or more moieties or conjugates may be administered to a subject via a specific administration route (e.g., subcutaneously or intravenously).

[0251] Exemplary conjugate groups include cholesterol moieties and lipid moieties. Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. In some embodiments, an inhibitory nucleic acid may be covalently linked to one or more moieties that target the inhibitory nucleic acid to the central nervous system (CNS), e.g., via inclusion of a 2’-O-hexadecyl (C16) moiety. In some embodiments, the inhibitory nucleic acid is a double stranded siRNA and a saturated or unsaturated hydrocarbon chain (e.g., a C12-C22 hydrocarbon chain, such as a C12-C20 hydrocarbon chain, a C14-C22 hydrocarbon chain, a C16-C22 hydrocarbon chain, or a C16-C20 hydrocarbon chain) is conjugated to the sense strand, e.g., at the 2’-0 position of a sugar ring. In some embodiments, the hydrocarbon chain is a saturated C16 hydrocarbon chain. In some embodiments, the inhibitory nucleic acid is a double stranded siRNA that includes 2’-O-hexadecyl (Cl 6) conjugated to the sense strand.

[0252] In some embodiments, an siRNA may be covalently linked to a targeting moiety that targets the inhibitory nucleic acid to a particular tissue or cell type. In some embodiments, the siRNA covalently linked to the targeting moiety can be administered to the subject to specifically deliver the inhibitory nucleic acid to the central nervous system (CNS) or to cardiac tissues. In some embodiments, a targeting moiety binds to one or more cellular membrane polypeptides. In some embodiments, a targeting moiety facilitates cellular uptake of an siRNA. In some embodiments, a targeting moiety facilitates passage of an siRNA across one or more membranes (e.g., cell membrane, blood-brain barrier). In some embodiments, a targeting moiety is or comprises a peptide, a protein, an aptamer, or an antibody or antigen binding fragment orWSGR Docket No. 71197-703.601region thereof, e.g., a single-domain antibody (e.g., VNAR, VHH), F(ab')2, Fab, Fab’, Fv, or scFv.

[0253] In some embodiments, a targeting moiety binds to human Transferrin receptor protein 1 (TfRl), also known as Cluster of Differentiation 71 (CD71). In some embodiments, a targeting moiety is or comprises an anti-TfRl antibody or antigen binding fragment or region thereof, e.g., a single-domain antibody (e.g., VNAR, VHH), F(ab')2, Fab, Fab’, Fv, or scFv. In some embodiments, the anti-TfRl antibody or antigen binding fragment or region thereof is any known in the art including but not limited to those described in WO1991 / 004753;W02013 / 103800; W02014 / 144060; WO2016 / 081643; WO2016 / 179257; WO2016 / 207240; WO2017 / 221883; WO2018 / 129384; WO2018 / 124121; WO2019 / 151539; WO2020 / 132584; W02020 / 028864; W02020 / 056327; US7208174; US9034329; and US10550188. In some embodiments, a targeting moiety is or comprises a peptide or protein that binds TfRl. In some embodiments, the peptide or protein that binds TfRl is any known in the art including but not limited to those described in W02019 / 140050; W02020 / 037150; W02020 / 124032; and US10138483. In certain embodiments, the peptide is a cyclic peptide, e.g., any known in the art including but not limited to those described in EP4108676; WO2023 / 027125; and WO2023 / 022234. In some embodiments, a targeting moiety is or comprises an aptamer that binds TfRl. In some embodiments, the aptamer capable of binding TfRl is any known in the art including but not limited to those described in WO2013 / 163303; W02019 / 033051; and WO2020 / 245198.

[0254] In some embodiments, a targeting moiety binds to CD98 heavy chain (CD98hc). In some embodiments, a targeting moiety is or comprises an anti-CD98hc antibody or antigen binding fragment or region thereof, e.g., a single-domain antibody (e.g., VNAR, VHH), F(ab')2, Fab, Fab’, Fv, or scFv. In some embodiments, the anti-CD98hc antibody or antigen binding fragment or region thereof is any known in the art including but not limited to those described in WO2024 / 026471A1; WO2019 / 246288 Al; and WO2021 / 102276 Al. In some embodiments, a targeting moiety is or comprises a peptide or protein that binds CD98hc. In some embodiments, the peptide or protein that binds CD98hc is any known in the art including but not limited to those described in WO2020 / 193316A1 and WO2023 / 114499A1. In some embodiments, a targeting moiety is or comprises an aptamer that binds CD98hc.Pharmaceutical Compositions

[0255] The methods described herein can include the administration of pharmaceutical compositions and formulations comprising siRNA molecules to target a FDX2 nucleic acid.

[0256] In some instances, siRNAs can be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations.WSGR Docket No. 71197-703.601Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disorder, or dose to be administered.

[0257] An siRNA targeted to a FDX2 nucleic acid can be utilized in pharmaceutical compositions by combining the siRNA with a suitable pharmaceutically acceptable diluent or carrier (e.g., cerebral spinal fluid). In some embodiments, a pharmaceutical composition comprises an antisense compound described herein and cerebral spinal fluid (CSF) e.g., artificial CSF. In some embodiments, a pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS). PBS is a diluent suitable for use in compositions to be delivered parenterally. In some embodiment, employed in the methods described herein is a pharmaceutical composition comprising an siRNA targeted to a FDX2 nucleic acid and a pharmaceutically acceptable diluent. In some embodiments, the pharmaceutically acceptable diluent is PBS.

[0258] Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0259] A prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active siRNA.

[0260] In some embodiments, the compositions are formulated with a pharmaceutically acceptable carrier. The pharmaceutical compositions and formulations can be administered parenterally (e.g., intrathecal), topically, orally or by local administration, such as by aerosol or transdermally. The pharmaceutical compositions can be formulated in any way and can be administered in a variety of unit dosage forms depending upon the condition or disease and the degree of illness, the general medical condition of each patient, the resulting preferred method of administration and the like. Details on techniques for formulation and administration of pharmaceuticals are well described in the scientific and patent literature, see, e.g., Remington: The and Practice of Pharmacy, 21st ed., 2005.

[0261] In some embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal, intracerebroventricular, etc.).WSGR Docket No. 71197-703.601

[0262] In some embodiments, a pharmaceutical composition comprises a composition described herein and cerebral spinal fluid (CSF) e.g., artificial CSF.

[0263] siRNA molecules can be administered alone or as a component of a pharmaceutical formulation (composition). The compounds may be formulated for administration, in any convenient way for use in human or veterinary medicine. Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.

[0264] Formulations of the compositions can include those suitable for intradermal, inhalation, oral / nasal, topical, parenteral, rectal, and / or intravaginal administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient (e.g., nucleic acid sequences of this invention) which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration, e.g., intradermal or inhalation. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound that produces a therapeutic effect.

[0265] Pharmaceutical formulations can be prepared according to any method known to the art for the manufacture of pharmaceuticals. Such drugs can contain sweetening agents, flavoring agents, coloring agents and preserving agents. A formulation can be admixtured with nontoxic pharmaceutically acceptable excipients which are suitable for manufacture. Formulations may comprise one or more diluents, emulsifiers, preservatives, buffers, excipients, etc. and may be provided in such forms as liquids, powders, emulsions, lyophilized powders, sprays, creams, lotions, controlled release formulations, tablets, pills, gels, on patches, in implants, etc.

[0266] Pharmaceutical formulations for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in appropriate and suitable dosages. Such carriers enable the pharmaceuticals to be formulated in unit dosage forms as tablets, pills, powder, dragees, capsules, liquids, lozenges, gels, syrups, slurries, suspensions, etc., suitable for ingestion by the patient. Pharmaceutical preparations for oral use can be formulated as a solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable additional compounds, if desired, to obtain tablets or dragee cores. Suitable solid excipients are carbohydrate or protein fillers include, e.g., sugars, including lactose, sucrose, mannitol, or sorbitol; starch from com, wheat, rice, potato, or other plants; cellulose such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxy-methylcellulose; and gums including arabic and tragacanth; and proteins, e.g., gelatin and collagen. Disintegrating orWSGR Docket No. 71197-703.601solubilizing agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate. Push-fit capsules can contain active agents mixed with a filler or binders such as lactose or starches, lubricants such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active agents can be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycol with or without stabilizers.

[0267] Aqueous suspensions can contain an active agent (e.g., nucleic acid sequences or RNPs as described herein) in admixture with excipients suitable for the manufacture of aqueous suspensions, e.g., for aqueous intradermal injections. Such excipients include a suspending agent, such as sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia, and dispersing or wetting agents such as a naturally occurring phosphatide (e.g., lecithin), a condensation product of an alkylene oxide with a fatty acid (e.g., polyoxyethylene stearate), a condensation product of ethylene oxide with a long chain aliphatic alcohol (e.g., heptadecaethylene oxycetanol), a condensation product of ethylene oxide with a partial ester derived from a fatty acid and a hexitol (e.g., polyoxyethylene sorbitol mono-oleate), or a condensation product of ethylene oxide with a partial ester derived from fatty acid and a hexitol anhydride (e.g., polyoxyethylene sorbitan mono-oleate). The aqueous suspension can also contain one or more preservatives such as ethyl or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents and one or more sweetening agents, such as sucrose, aspartame or saccharin.Formulations can be adjusted for osmolarity.

[0268] In some embodiments, oil-based pharmaceuticals are used for administration of nucleic acid sequences or RNPs. Oil-based suspensions can be formulated by suspending an active agent in a vegetable oil, such as arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin; or a mixture of these. See e.g., US5716928 describing using essential oils or essential oil components for increasing bioavailability and reducing inter- and intra-individual variability of orally administered hydrophobic pharmaceutical compounds. The oil suspensions can contain a thickening agent, such as beeswax, hard paraffin or cetyl alcohol. Sweetening agents can be added to provide a palatable oral preparation, such as glycerol, sorbitol or sucrose. These formulations can be preserved by the addition of an antioxidant such as ascorbic acid. As an example of an injectable oil vehicle.

[0269] Pharmaceutical formulations can also be in the form of oil-in-water emulsions. The oily phase can be a vegetable oil or a mineral oil, described above, or a mixture of these. Suitable emulsifying agents include naturally-occurring gums, such as gum acacia and gum tragacanth, naturally occurring phosphatides, such as soybean lecithin, esters or partial esters derived fromWSGR Docket No. 71197-703.601fatty acids and hexitol anhydrides, such as sorbitan mono-oleate, and condensation products of these partial esters with ethylene oxide, such as polyoxyethylene sorbitan mono-oleate. The emulsion can also contain sweetening agents and flavoring agents, as in the formulation of syrups and elixirs. Such formulations can also contain a demulcent, a preservative, or a coloring agent. In alternative embodiments, these injectable oil-in-water emulsions comprise a paraffin oil, a sorbitan monooleate, an ethoxylated sorbitan monooleate and / or an ethoxylated sorbitan trioleate.

[0270] The pharmaceutical compounds can also be administered by in intranasal, intraocular and intravaginal routes including suppositories, insufflation, powders and aerosol formulations (for examples of steroid inhalants, see e.g., Rohatagi 1995, J. Clin. Pharmacol. 35:1187-1193; Tjwa 1995, Ann. Allergy Asthma Immunol. 75: 107-111). Suppositories formulations can be prepared by mixing the drug with a suitable non-irritating excipient which is solid at ordinary temperatures but liquid at body temperatures and will therefore melt in the body to release the drug. Such materials are cocoa butter and polyethylene glycols.

[0271] In some embodiments, the pharmaceutical compounds can be delivered transdermally, by a topical route, formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols.

[0272] In some embodiments, the pharmaceutical compounds can also be delivered as microspheres for slow release in the body. For example, microspheres can be administered via intradermal injection of drug which slowly release subcutaneously; see Rao 1995, J. Biomater Sci. Polym. Ed. 7:623-645; as biodegradable and injectable gel formulations, see, e.g., Gao 1995, Pharm. Res. 12:857-863; or, as microspheres for oral administration, see, e.g., Eyles 1997, J. Pharm. Pharmacol. 49:669-674.

[0273] In some embodiments, the pharmaceutical compounds can be parenterally administered, such as by intravenous (IV) administration or administration into a body cavity or lumen of an organ. These formulations can comprise a solution of active agent dissolved in a pharmaceutically acceptable carrier. Acceptable vehicles and solvents that can be employed are water and Ringer’s solution, an isotonic sodium chloride. In addition, sterile fixed oils can be employed as a solvent or suspending medium. For this purpose, any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can likewise be used in the preparation of injectables. These solutions are sterile and generally free of undesirable matter. These formulations may be sterilized by conventional, well known sterilization techniques. The formulations may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents, e.g., sodium acetate, sodium chloride, potassiumWSGR Docket No. 71197-703.601chloride, calcium chloride, sodium lactate and the like. The concentration of active agent in these formulations can vary widely, and will be selected primarily based on fluid volumes, viscosities, body weight, and the like, in accordance with the particular mode of administration selected and the patient’s needs. For IV administration, the formulation can be a sterile injectable preparation, such as a sterile injectable aqueous or oleaginous suspension. This suspension can be formulated using those suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation can also be a suspension in a nontoxic parenterally-acceptable diluent or solvent, such as a solution of 1,3 -butanediol. The administration can be by bolus or continuous infusion (e.g., substantially uninterrupted introduction into a blood vessel for a specified period of time).

[0274] In some embodiments, the pharmaceutical compounds and formulations can be lyophilized. Stable lyophilized formulations comprising an inhibitory nucleic acid or RNP can be made by lyophilizing a solution comprising an active agent and a bulking agent, e.g., mannitol, trehalose, raffinose, and sucrose or mixtures thereof. A process for preparing a stable lyophilized formulation can include lyophilizing a solution of about 2.5 mg / mL protein, about 15 mg / mL sucrose, about 19 mg / mL NaCl, and a sodium citrate buffer having a pH greater than 5.5 but less than 6.5.

[0275] The compositions and formulations can be delivered by the use of liposomes. By using liposomes, particularly where the liposome surface carries ligands specific for target cells, or are otherwise preferentially directed to a specific organ, one can focus the delivery of the active agent into target cells in vivo. As used in the present invention, the term “liposome” means a vesicle composed of amphiphilic lipids arranged in a bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered.

[0276] Liposomes can also include “sterically stabilized” liposomes, i.e., liposomes comprising one or more specialized lipids. When incorporated into liposomes, these specialized lipids result in liposomes with enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety.

[0277] The formulations can be administered for prophylactic and / or therapeutic treatments. In some embodiments, for therapeutic applications, compositions are administered to a subject who is known to have a mutation in the FXN gene and that have reduced expression of frataxin protein but has not yet developed any of the symptoms of FRDA, in an amount sufficient toWSGR Docket No. 71197-703.601treat, alleviate, slow, delay development, or partially arrest the clinical manifestations of the disorder or its complications; this can be called a therapeutically effective amount.

[0278] The amount of pharmaceutical composition adequate to accomplish this is a therapeutically effective dose. The dosage schedule and amounts effective for this use, i.e., the dosing regimen, will depend upon a variety of factors, including the stage of the disease or condition, the severity of the disease or condition, the general state of the patient’s health, the patient’s physical status, age and the like. In calculating the dosage regimen for a patient, the mode of administration also is taken into consideration.

[0279] The dosage regimen also takes into consideration pharmacokinetics parameters well known in the art, i.e., the active agents’ rate of absorption, bioavailability, metabolism, clearance, and the like

[0280] Single or multiple administrations of formulations can be given depending on for example: the dosage and frequency as required and tolerated by the patient, the degree and amount of therapeutic effect generated after each administration, and the like. The formulations should provide a sufficient quantity of active agent to effectively treat, prevent or ameliorate conditions, diseases or symptoms.

[0281] In some embodiments, the methods described herein can include co-administration with other drugs or pharmaceuticals, e.g., compositions for providing cholesterol homeostasis. For example, the siRNAs can be co-administered with drugs for treating or reducing risk of a disorder described herein.Dosage

[0282] In some instances, an effective amount is an amount sufficient to effect beneficial or desired results. For example, a therapeutic amount is one that achieves the desired therapeutic effect. This amount can be the same or different from a prophylactically effective amount, which is an amount necessary to prevent onset of disease or disease symptoms. An effective amount can be administered in one or more administrations, applications or dosages. A therapeutically effective amount of a therapeutic compound (i.e., an effective dosage) depends on the therapeutic compounds selected. The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and / or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of the therapeutic compounds described herein can include a single treatment or a series of treatments.

[0283] Dosage, toxicity and therapeutic efficacy of the therapeutic compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g.,WSGR Docket No. 71197-703.601for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50 / ED50. Compounds which exhibit high therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.

[0284] In some instances, the data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to determine useful doses more accurately in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.Methods

[0285] The methods described herein include methods for inhibiting expression of FDX2. Generally, the methods include administering a therapeutically effective amount of an agent that decreases levels of FDX2 protein as described herein, to a subject who is in need of, or who has been determined to be in need of, such treatment. In some embodiments, the agent comprises an antisense compound (e.g., siRNA) described herein.

[0286] The methods described herein include methods for the treatment of disorders associated with mutations in the FXN gene. In some embodiments, the disorder is Friedreich ataxia (FRDA). Generally, the methods include administering a therapeutically effective amount of an agent that decreases levels of FDX2 protein as described herein, to a subject who is in need of, or who has been determined to be in need of, such treatment. In some embodiments, the agent comprises an antisense compound (e.g., siRNA) described herein. Methods known in the art can be used to diagnose or identify a subject as having a disorder associated with a mutation in the FXN gene that reduces expression of the frataxin protein, e.g., sequencing or identification of the presence of trinucleotide repeat expansion, e.g., using a commercially available assay such as the Friedreich ataxia (FXN) Repeat Expansion Test (Athena Diagnostics); a quantitative immunoassay to measure frataxin levels, e.g., as described in Plasterer et al. 2013, PLoS OneWSGR Docket No. 71197-703.6018(5):e63958, or a lateral flow test as described in Willis et al. 2008, Mol. Genet. Metab.94(4):491-497 or commercially available kits such as the dipstick kit from Abeam (abl09881); MRI to detect atrophy of the cervical spinal cord with minimal evidence of cerebellar atrophy; transcranial sonography for assessment of both cerebellar and noncerebellar abnormalities, e.g., dentate hyperechogenicity. Typically, subjects present with gait ataxia (e.g., tabetocerebellar gait), with ataxia progressing to the legs, trunk, and arms; development of tremors; titubation; and trembling. To determine severity, any of three scales can be used, e.g., The International Cooperative Ataxia Rating Scale (ICARS), the Friedreich Ataxia Rating Scale (FARS), and the Scale for the Assessment and Rating of Ataxia (SARA), see, e.g., Burk et al. 2013, J.Neurochem. 126 Suppl. 1:118-24.

[0287] As used in this context, to “treat” means to ameliorate at least one symptom of the disorder associated with mutations in the FXN gene that reduce expression. FRDA is an autosomal recessive neurodegenerative disorder that results in progressive gait and limb ataxia with associated limb muscle weakness, absent lower limb reflexes, extensor plantar responses, dysarthria, and decreased vibratory sense and proprioception, as well as cardiac manifestations including cardiac dysfunction and heart failure; visual field defects; and diabetes. Thus, a treatment can result in a reduction in the severity of these deficits or a reduction in the rate of decline or degeneration. Administration of a therapeutically effective amount of an antisense compound described herein for the treatment of a condition associated with mutations in the FXN gene that reduce expression, e.g., FRDA, will result in improvement in one or more symptoms, e.g., reduction in the severity or rate of decline in gait and limb ataxia, limb muscle weakness, deficits in lower limb reflexes, extensor plantar responses, dysarthria, and vibratory sense and proprioception, and a return or approach to normal gait and limb movements, a return or approach to normal muscle strength and reflexes, a return or approach to normal (flexor) plantar responses, reduced dysarthria / improved speech, and a return or approach to normal vibratory sense and proprioception, as well as a reduction in the severity or risk of cardiac dysfunction and / or heart failure or diabetes. In some embodiments, the treatment results in decreased morbidity or mortality, e.g., a delayed loss of ambulation, an increased life span (average age of death is 37.7 ± 14.4 years, range 21-69, Harding et al. 1981, J. Med Genet. 18(4):285-287) and / or an improved quality of life. In some embodiments, the treatment results in an improvement or long-term stabilization in the Friedreich Ataxia Rating Scale, see, e.g., Friedman et al. 2010, Mov. Disord. 25(4):426-432.Cell culture and siRNA treatment

[0288] The effects of siRNAs on the level, activity or expression of FDX2 nucleic acids can be tested in vitro in a variety of cell types. Cell types used for such analyses are available fromWSGR Docket No. 71197-703.601commercial vendors (e.g., American Type Culture Collection, Manassus, VA; Zen-Bio, Research Triangle Park, NC; Clonetics, Walkersville, MD) and are cultured according to the vendor’s instructions using commercially available reagents (e.g., Invitrogen, Carlsbad, CA). Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, and primary hepatocytes. In some embodiments, cells are patient cells, such as B-lymphoblast cells.In vitro testing of siRNAs

[0289] Cells may be treated with siRNAs when the cells reach approximately 60-80% confluency in culture. One reagent commonly used to introduce siRNAs into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, CA). siRNAs may be mixed with LIPOFECTIN in OPTI-MEM 1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of siRNA and a LIPOFECTIN concentration that may range from 2 to 12 ug / mL per 100 nM siRNA. Another reagent used to introduce siRNAs into cultured cells includes LIPOFECTAMINE (Invitrogen, Carlsbad, CA). The siRNA is mixed with LIPOFECTAMINE in OPTI-MEM 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of siRNA and a LIPOFECTAMINE concentration that may range from 2 to 12 ug / mL per 100 nM siRNA. Another reagent used to introduce siRNAs into cultured cells includes TURBOFECT (Thermo Scientific, Carlsbad, CA). Another technique used to introduce siRNAs into cultured cells includes electroporation.

[0290] Cells are treated with siRNAs by routine methods. Cells may be harvested 16-24 hours after siRNA treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.

[0291] The concentration of siRNA used varies from cell line to cell line. Methods to determine the optimal siRNA concentration for a particular cell line are well known in the art. SiRNAs are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE. siRNAs are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation.RNA Isolation

[0292] RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s recommended protocols.Analysis of inhibition of target levels or expression

[0293] Inhibition of levels or expression of a FDX2 nucleic acid can be assayed in a variety of ways known in the art. For example, target nucleic acid levels can be quantitated by, e.g.,WSGR Docket No. 71197-703.601Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitative real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art.Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM 7600, 7700, or 7900 Sequence Detection System, available from Applied Biosystems, Foster City, CA and used according to manufacturer’s instructions.Quantitative Real-Time PCR Analysis of Target RNA Levels

[0294] Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM 7600, 7700, or 7900 Sequence Detection System (Applied Biosystems, Foster City, CA) according to manufacturer’s instructions. Methods of quantitative real-time PCR are well known in the art.

[0295] Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification. The RT and real-time PCR reactions are performed sequentially in the same sample well. RT and real-time PCR reagents may be obtained from Invitrogen (Carlsbad, CA). RT real-time-PCR reactions are carried out by methods well known to those skilled in the art.

[0296] Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN (Invitrogen, Carlsbad, CA). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN RNA quantification reagent (Invitrogen, Carlsbad, CA). Methods of RNA quantification by RIBOGREEN are taught in Jones et al. 1998, Analytical Biochemistry 265:368-374. A CYTOFLUOR 4000 instrument (Applied Biosystems, Foster City, CA) is used to measure RIBOGREEN fluorescence.

[0297] Probes and primers are designed to hybridize to a FDX2 nucleic acid. Methods for designing real-time PCR probes and primers are well known in the art and may include the use of software such as PRIMER EXPRESS Software (Applied Biosystems, Foster City, CA). Analysis of Protein Levels

[0298] Inhibition of FDX2 by siRNA molecules can be assessed by measuring FDX2 protein levels. Protein levels of FDX2 can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS). Antibodies directed to a target can be identified and obtainedWSGR Docket No. 71197-703.601from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art.In vivo testing of siRNAs

[0299] siRNAs are tested in animals to assess their ability to inhibit expression of FDX2 and produce phenotypic changes, such as, improved behavior, motor function, and cognition. In some embodiments, motor function is measured by walking initiation analysis, rotarod, grip strength, pole climb, open field performance, balance beam, hindpaw footprint testing in the animal. In some embodiments, behavior is measured by elevated plus maze and three-chamber social interaction. Testing may be performed in normal animals, or in experimental models. For administration to animals, siRNAs are formulated in a pharmaceutically acceptable diluent, such as e.g., phosphate-buffered saline, e.g., cerebral spinal fluid (CSF). Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, subcutaneous, and intrathecal. Calculation of siRNA dosage and dosing frequency is within the abilities of those skilled in the art and depends upon factors such as route of administration and animal body weight. Fallowing a period of treatment with siRNAs, RNA is isolated from CNS tissue or CSF and changes in FDX2 nucleic acid expression are measured.Tables

[0300] The present section provides Tables that are referred to throughout the present disclosure. Each T in any sequence in any Table below may be independently and optionally replaced with U. In some embodiments, all Ts in any sequence in any Table below are replaced with Us. In Tables B, D, and E-l, E-2, and F antisense / sense sequence pairs are shown in the same row (e.g., the antisense sequence of SEQ ID NO: 4719 and the sense sequence of SEQ ID NO: 4786 form an antisense / sense sequence pair, etc., e.g., the antisense sequence of SEQ ID NO: 4853 and the sense sequence of SEQ ID NO: 4920 form an antisense / sense sequence pair, etc., e.g., the antisense sequence of SEQ ID NO: 4987 and the sense sequence of SEQ ID NO: 5054 form an antisense / sense sequence pair, etc., e.g., the antisense sequence of SEQ ID NO: 5121 and the sense sequence of SEQ ID NO: 5218 form an antisense / sense sequence pair, etc.).Table ASEQ ID Antisense Sequence (from 5’ to 3’) SEQ IDSense Sequence (from 5’ to 3’) NO. NO.9 UUGACAUGCAUCACGUGACUC 76 GUCACGUGAUGCAUGUCAA 10 UCCAUGGAGGCGGCCAUGACA 77 UCAUGGCCGCCUCCAUGGA 11 UUCACGCCUCCCCGGGCCAUG 78 UGGCCCGGGGAGGCGUGAA 12 UGUAGAACCCUGGCACUCACG 79 UGAGUGCCAGGGUUCUACA 13 UCCCUGGCAGCCUGCAGUAGA 80 UACUGCAGGCUGCCAGGGA14 UUGUUCCACCAGGUGCCCCUG81 GGGGCACCUGGUGGAACAAWSGR Docket No. 71197-703.601SEQID Antisense Sequence (from 5’ to 3’) SEQIDSense Sequence (from 5’ to 3’) NO. NO.15 UAAGUGCCCCCAGGUCUGUUC 82 ACAGACCUGGGGGCACUUA 16 UCCUCCCCCGACCCGGAAGUG 83 CUUCCGGGUCGGGGGAGGA 17 UUCCCCAGCGCCACCCCCUCC 84 AGGGGGUGGCGCUGGGGAA 18 UGAAACUUUCUGGUUGUCCCC 85 GGACAACCAGAAAGUUUCA 19 UGCGAGCCUGUCGCUUGAAAC 86 UUCAAGCGACAGGCUCGCA 20 UCCUCUCCAGCCGGGCGCGAG 87 CGCGCCCGGCUGGAGAGGA 21 UGGCCGCCCGCGUCCUCCUCU 88 AGGAGGACGCGGGCGGCCA 22 UCCCCGGGCCGCUCCGGGCCG 89 GCCCGGAGCGGCCCGGGGA 23 UCCACGUUCACCACGUCCCCG 90 GGGACGUGGUGAACGUGGA 24 UAGCGGUCUACGAACACCACG 91 UGGUGUUCGUAGACCGCUA 25 UGGAUCCGCUGGCCUGAGCGG 92 GCUCAGGCCAGCGGAUCCA 26 UCUCUGCCACUCACUGGGAUC 93 UCCCAGUGAGUGGCAGAGA 27 UGAACAUUGUCCCCGACUCUG 94 GAGUCGGGGACAAUGUUCA 28 UGCUGGGCCAGGUGAAGAACA 95 UUCUUCACCUGGCCCAGCA 29 UGGUCCACCCCGUGGCGCUGG 96 AGCGCCACGGGGUGGACCA 30 UCACAGGCCCCUUCCAGGUCC 97 ACCUGGAAGGGGCCUGUGA 31 UAGGCCAGGGAGGCUUCACAG 98 GUGAAGCCUCCCUGGCCUA 32 UCAUGGCAGGUGGAGCAGGCC 99 CCUGCUCCACCUGCCAUGA 33 UCUUCACUCACAUACACAUGG 100 AUGUGUAUGUGAGUGAAGA 34 UGGAGAUCCAGGUGGUCUUCA 101 AAGACCACCUGGAUCUCCA 35 UCCUCGGGAGGAGGCAGGAGA 102 UCCUGCCUCCUCCCGAGGA 36 UUGUCGUCUUCCCUCUCCUCG 103 AGGAGAGGGAAGACGACAA 37 UGGGCCAUGUCUAGCAUGUCG 104 ACAUGCUAGACAUGGCCCA 38 UUCUCCUGGAGGAGGGGGGCC 105 CCCCCCUCCUCCAGGAGAA 39 UAGCCCAGCCGCGAGUUCUCC 106 AGAACUCGCGGCUGGGCUA 40 UUCAGCACAAUCUGGCAGCCC 107 GCUGCCAGAUUGUGCUGAA 41 UCUUCCAGCUCCGGUGUCAGC 108 UGACACCGGAGCUGGAAGA 42 UGGGUGAAUUCCGCUCCUUCC 109 AAGGAGCGGAAUUCACCCA 43 UUGGUGAUCUUGGGCAGGGUG 110 CCCUGCCCAAGAUCACCAA 44 UCCACGUAGAAGUUCCUGGUG 111 CCAGGAACUUCUACGUGGA 45 UUGGGGACAUGGCCAUCCACG 112 UGGAUGGCCAUGUCCCCAA 46 UCAUGUCAGUGGGGCUUGGGG 113 CCAAGCCCCACUGACAUGA 47 UAAUGGUCCAGGUGUUCAUGU 114 AUGAACACCUGGACCAUUA 48 UGCCAUGGCAAUGUGGAAUGG 115 AUUCCACAUUGCCAUGGCA 49 UAAUCUGGGCCCUGGGGCCAU 116 GGCCCCAGGGCCCAGAUUA 50 UCCUGGCUAUUCCCUCAAUCU 117 AUUGAGGGAAUAGCCAGGA 51 UUGGGCAGGGCUGGCACCUGG 118 AGGUGCCAGCCCUGCCCAA 52 UGGCCUGUCCGCACUCUGGGC 119 CCAGAGUGCGGACAGGCCA 53 UUCCACGUCUCUCCCGGGCCU 120 GCCCGGGAGAGACGUGGAA 54 UUCCUUCACAGGGGCUUCCAC 121 GGAAGCCCCUGUGAAGGAA 55 UCAAGCAGGGGUGUUGUCCUU 122 GGACAACACCCCUGCUUGA 56 UCAUGGGACUCUCUCCCAAGC 123 UUGGGAGAGAGUCCCAUGA 57 UCCACCAGAGCCUGGACAUGG 124 AUGUCCAGGCUCUGGUGGA 58 UCUAGGGGCCCUGUCCCCACC 125 UGGGGACAGGGCCCCUAGA 59 UGGGAAGGCCACCCCACUAGG 126 UAGUGGGGUGGCCUUCCCA 60 UAUUCUCAGGGGCCUGGGGAA 127 CCCCAGGCCCCUGAGAAUA 61 UCCUACUCAAACCCUGAUUCU 128 AAUCAGGGUUUGAGUAGGA 62 UCAAUAUGAGUCCACUCCUAC 129 AGGAGUGGACUCAUAUUGA63 UGAUUUAUUGCAGCUCCAAUA130 UUGGAGCUGCAAUAAAUCAWSGR Docket No. 71197-703.601SEQID Antisense Sequence (from 5’ to 3’) SEQIDSense Sequence (from 5’ to 3’) NO. NO.64 UGGGGCCUGUGUUAUCGAUUU 131 AUCGAUAACACAGGCCCCA 65 UGACACUCAACAUGCUGGGGC 132 CCCAGCAUGUUGAGUGUCA 66 UGAUCUGUCCCCCAAGGACAC 133 GUCCUUGGGGGACAGAUCA 67 UCACCUGUAGACCCCAGAUCU 134 AUCUGGGGUCUACAGGUGA 68 UAUUACAGGUGUGAGCCACCU 135 GUGGCUCACACCUGUAAUA 69 UUCCCAAAGUGCUAGGAUUAC 136 AAUCCUAGCACUUUGGGAA 70 UCCUCCCAUCUUGGCUUCCCA 137 GGAAGCCAAGAUGGGAGGA 71 UCUGGCCUCAAGUGAUCCUCC 138 AGGAUCACUUGAGGCCAGA 72 UGAUGGUCUUAAGCUCCUGGC 139 CAGGAGCUUAAGACCAUCA 73 UCGCCAUGUUGCCCAGGAUGG 140 AUCCUGGGCAACAUGGCGA 74 UAUAGAGACGAGGUCUCGCCA 141 GCGAGACCUCGUCUCUAUA75 UAAUUUUUACUGUUUUUAUAG142 AUAAAAACAGUAAAAAUUA Table BSEQID Antisense Sequence (from 5’ to 3’) SEQID Sense Sequence (from 5’ to 3’) NO. NO.143 UUGACAUGCAUCACGUGACUC 210 GAGUCACGUGAUGCAUGUCAA 144 UCCAUGGAGGCGGCCAUGACAUG 211 UGUCAUGGCCGCCUCCAUGGA 145 UUCACGCCUCCCCGGGCCAUGGA 212 CAUGGCCCGGGGAGGCGUGAA 146 UGUAGAACCCUGGCACUCACGCC 213 CGUGAGUGCCAGGGUUCUACA 147 UCCCUGGCAGCCUGCAGUAGAAC 214 UCUACUGCAGGCUGCCAGGGA 148 UUGUUCCACCAGGUGCCCCUGGC 215 CAGGGGCACCUGGUGGAACAA 149 UAAGUGCCCCCAGGUCUGUUCCA 216 GAACAGACCUGGGGGCACUUA 150 UCCUCCCCCGACCCGGAAGUGCC 217 CACUUCCGGGUCGGGGGAGGA 151 UUCCCCAGCGCCACCCCCUCCCC 218 GGAGGGGGUGGCGCUGGGGAA 152 UGAAACUUUCUGGUUGUCCCCAG 219 GGGGACAACCAGAAAGUUUCA 153 UGCGAGCCUGUCGCUUGAAACUU 220 GUUUCAAGCGACAGGCUCGCA 154 UCCUCUCCAGCCGGGCGCGAGCC 221 CUCGCGCCCGGCUGGAGAGGA 155 UGGCCGCCCGCGUCCUCCUCUCC 222 AGAGGAGGACGCGGGCGGCCA 156 UCCCCGGGCCGCUCCGGGCCGCC 223 CGGCCCGGAGCGGCCCGGGGA 157 UCCACGUUCACCACGUCCCCGGG 224 CGGGGACGUGGUGAACGUGGA 158 UAGCGGUCUACGAACACCACGUU 225 CGUGGUGUUCGUAGACCGCUA 159 UGGAUCCGCUGGCCUGAGCGGUC 226 CCGCUCAGGCCAGCGGAUCCA 160 UCUCUGCCACUCACUGGGAUCCG 227 GAUCCCAGUGAGUGGCAGAGA 161 UGAACAUUGUCCCCGACUCUGCC 228 CAGAGUCGGGGACAAUGUUCA 162 UGCUGGGCCAGGUGAAGAACAUU 229 UGUUCUUCACCUGGCCCAGCA 163 UGGUCCACCCCGUGGCGCUGGGC 230 CCAGCGCCACGGGGUGGACCA 164 UCACAGGCCCCUUCCAGGUCCAC 231 GGACCUGGAAGGGGCCUGUGA 165 UAGGCCAGGGAGGCUUCACAGGC 232 CUGUGAAGCCUCCCUGGCCUA 166 UCAUGGCAGGUGGAGCAGGCCAG 233 GGCCUGCUCCACCUGCCAUGA 167 UCUUCACUCACAUACACAUGGCA 234 CCAUGUGUAUGUGAGUGAAGA 168 UGGAGAUCCAGGUGGUCUUCACU 235 UGAAGACCACCUGGAUCUCCA 169 UCCUCGGGAGGAGGCAGGAGAUC 236 UCUCCUGCCUCCUCCCGAGGA 170 UUGUCGUCUUCCCUCUCCUCGGG 237 CGAGGAGAGGGAAGACGACAA 171 UGGGCCAUGUCUAGCAUGUCGUC 238 CGACAUGCUAGACAUGGCCCA 172 UUCUCCUGGAGGAGGGGGGCCAU 239 GGCCCCCCUCCUCCAGGAGAA 173 UAGCCCAGCCGCGAGUUCUCCUG 240 GGAGAACUCGCGGCUGGGCUA 174 UUCAGCACAAUCUGGCAGCCCAG 241 GGGCUGCCAGAUUGUGCUGAA175 UCUUCCAGCUCCGGUGUCAGCAC242 GCUGACACCGGAGCUGGAAGAWSGR Docket No. 71197-703.601SEQID Antisense Sequence (from 5’ to 3’) SEQID Sense Sequence (from 5’ to 3’) NO. NO.176 UGGGUGAAUUCCGCUCCUUCCAG 243 GGAAGGAGCGGAAUUCACCCA 177 UUGGUGAUCUUGGGCAGGGUGAA 244 CACCCUGCCCAAGAUCACCAA 178 UCCACGUAGAAGUUCCUGGUGAU 245 CACCAGGAACUUCUACGUGGA 179 UUGGGGACAUGGCCAUCCACGUA 246 CGUGGAUGGCCAUGUCCCCAA 180 UCAUGUCAGUGGGGCUUGGGGAC 247 CCCCAAGCCCCACUGACAUGA 181 UAAUGGUCCAGGUGUUCAUGUCA 248 ACAUGAACACCUGGACCAUUA 182 UGCCAUGGCAAUGUGGAAUGGUC 249 CCAUUCCACAUUGCCAUGGCA 183 UAAUCUGGGCCCUGGGGCCAUGG 250 AUGGCCCCAGGGCCCAGAUUA 184 UCCUGGCUAUUCCCUCAAUCUGG 251 AGAUUGAGGGAAUAGCCAGGA 185 UUGGGCAGGGCUGGCACCUGGCU 252 CCAGGUGCCAGCCCUGCCCAA 186 UGGCCUGUCCGCACUCUGGGCAG 253 GCCCAGAGUGCGGACAGGCCA 187 UUCCACGUCUCUCCCGGGCCUGU 254 AGGCCCGGGAGAGACGUGGAA 188 UUCCUUCACAGGGGCUUCCACGU 255 GUGGAAGCCCCUGUGAAGGAA 189 UCAAGCAGGGGUGUUGUCCUUCA 256 AAGGACAACACCCCUGCUUGA 190 UCAUGGGACUCUCUCCCAAGCAG 257 GCUUGGGAGAGAGUCCCAUGA 191 UCCACCAGAGCCUGGACAUGGGA 258 CCAUGUCCAGGCUCUGGUGGA 192 UCUAGGGGCCCUGUCCCCACCAG 259 GGUGGGGACAGGGCCCCUAGA 193 UGGGAAGGCCACCCCACUAGGGG 260 CCUAGUGGGGUGGCCUUCCCA 194 UAUUCUCAGGGGCCUGGGGAAGG 261 UUCCCCAGGCCCCUGAGAAUA 195 UCCUACUCAAACCCUGAUUCUCA 262 AGAAUCAGGGUUUGAGUAGGA 196 UCAAUAUGAGUCCACUCCUACUC 263 GUAGGAGUGGACUCAUAUUGA 197 UGAUUUAUUGCAGCUCCAAUAUG 264 UAUUGGAGCUGCAAUAAAUCA 198 UGGGGCCUGUGUUAUCGAUUUAU 265 AAAUCGAUAACACAGGCCCCA 199 UGACACUCAACAUGCUGGGGCCU 266 GCCCCAGCAUGUUGAGUGUCA 200 UGAUCUGUCCCCCAAGGACACUC 267 GUGUCCUUGGGGGACAGAUCA 201 UCACCUGUAGACCCCAGAUCUGU 268 AGAUCUGGGGUCUACAGGUGA 202 UAUUACAGGUGUGAGCCACCUGU 269 AGGUGGCUCACACCUGUAAUA 203 UUCCCAAAGUGCUAGGAUUACAG 270 GUAAUCCUAGCACUUUGGGAA 204 UCCUCCCAUCUUGGCUUCCCAAA 271 UGGGAAGCCAAGAUGGGAGGA 205 UCUGGCCUCAAGUGAUCCUCCCA 272 GGAGGAUCACUUGAGGCCAGA 206 UGAUGGUCUUAAGCUCCUGGCCU 273 GCCAGGAGCUUAAGACCAUCA 207 UCGCCAUGUUGCCCAGGAUGGUC 274 CCAUCCUGGGCAACAUGGCGA 208 UAUAGAGACGAGGUCUCGCCAUG 275 UGGCGAGACCUCGUCUCUAUA209 UAAUUUUUACUGUUUUUAUAGAG276 CUAUAAAAACAGUAAAAAUUATable CSEQID Antisense Sequence (from 5’ to 3’) SEQID Sense Sequence (from 5’ to 3’) NO. NO.277 UGCGGCCAUGACAUGCAUCACGU 344 GUGAUGCAUGUCAUGGCCGCA 278 UCCCCGGGCCAUGGAGGCGGCCA 345 GCCGCCUCCAUGGCCCGGGGA 279 UCUGGCACUCACGCCUCCCCGGG 346 CGGGGAGGCGUGAGUGCCAGA 280 UGCCUGCAGUAGAACCCUGGCAC 347 GCCAGGGUUCUACUGCAGGCA 281 UCAGGUGCCCCUGGCAGCCUGCA 348 CAGGCUGCCAGGGGCACCUGA 282 UCCAGGUCUGUUCCACCAGGUGC 349 ACCUGGUGGAACAGACCUGGA 283 UGACCCGGAAGUGCCCCCAGGUC 350 CCUGGGGGCACUUCCGGGUCA 284 UGCCACCCCCUCCCCCGACCCGG 351 GGGUCGGGGGAGGGGGUGGCA 285 UCUGGUUGUCCCCAGCGCCACCC 352 GUGGCGCUGGGGACAACCAGA 286 UGUCGCUUGAAACUUUCUGGUUG 353 ACCAGAAAGUUUCAAGCGACA287 UGCCGGGCGCGAGCCUGUCGCUU354 GCGACAGGCUCGCGCCCGGCAWSGR Docket No. 71197-703.601SEQID Antisense Sequence (from 5’ to 3’) SEQID Sense Sequence (from 5’ to 3’) NO. NO.288 UGCGUCCUCCUCUCCAGCCGGGC 355 CCGGCUGGAGAGGAGGACGCA 289 UCGCUCCGGGCCGCCCGCGUCCU 356 GACGCGGGCGGCCCGGAGCGA 290 UACCACGUCCCCGGGCCGCUCCG 357 GAGCGGCCCGGGGACGUGGUA 291 UACGAACACCACGUUCACCACGU 358 GUGGUGAACGUGGUGUUCGUA 292 UUGGCCUGAGCGGUCUACGAACA 359 UUCGUAGACCGCUCAGGCCAA 293 UCUCACUGGGAUCCGCUGGCCUG 360 GGCCAGCGGAUCCCAGUGAGA 294 UUCCCCGACUCUGCCACUCACUG 361 GUGAGUGGCAGAGUCGGGGAA 295 UAGGUGAAGAACAUUGUCCCCGA 362 GGGGACAAUGUUCUUCACCUA 296 UCCGUGGCGCUGGGCCAGGUGAA 363 CACCUGGCCCAGCGCCACGGA 297 UCCUUCCAGGUCCACCCCGUGGC 364 CACGGGGUGGACCUGGAAGGA 298 UGAGGCUUCACAGGCCCCUUCCA 365 GAAGGGGCCUGUGAAGCCUCA 299 UGUGGAGCAGGCCAGGGAGGCUU 366 GCCUCCCUGGCCUGCUCCACA 300 UACAUACACAUGGCAGGUGGAGC 367 UCCACCUGCCAUGUGUAUGUA 301 UAGGUGGUCUUCACUCACAUACA 368 UAUGUGAGUGAAGACCACCUA 302 UGGAGGCAGGAGAUCCAGGUGGU 369 CACCUGGAUCUCCUGCCUCCA 303 UUCCCUCUCCUCGGGAGGAGGCA 370 CCUCCUCCCGAGGAGAGGGAA 304 UUCUAGCAUGUCGUCUUCCCUCU 371 AGGGAAGACGACAUGCUAGAA 305 UAGGAGGGGGGCCAUGUCUAGCA 372 CUAGACAUGGCCCCCCUCCUA 306 UCGCGAGUUCUCCUGGAGGAGGG 373 CUCCUCCAGGAGAACUCGCGA 307 UAUCUGGCAGCCCAGCCGCGAGU 374 UCGCGGCUGGGCUGCCAGAUA 308 UUCCGGUGUCAGCACAAUCUGGC 375 CAGAUUGUGCUGACACCGGAA 309 UUCCGCUCCUUCCAGCUCCGGUG 376 CCGGAGCUGGAAGGAGCGGAA 310 UUUGGGCAGGGUGAAUUCCGCUC 377 GCGGAAUUCACCCUGCCCAAA 311 UAAGUUCCUGGUGAUCUUGGGCA 378 CCCAAGAUCACCAGGAACUUA 312 UUGGCCAUCCACGUAGAAGUUCC 379 AACUUCUACGUGGAUGGCCAA 313 UUGGGGCUUGGGGACAUGGCCAU 380 GGCCAUGUCCCCAAGCCCCAA 314 UAGGUGUUCAUGUCAGUGGGGCU 381 CCCCACUGACAUGAACACCUA 315 UAAUGUGGAAUGGUCCAGGUGUU 382 CACCUGGACCAUUCCACAUUA 316 UCCCUGGGGCCAUGGCAAUGUGG 383 ACAUUGCCAUGGCCCCAGGGA 317 UUUCCCUCAAUCUGGGCCCUGGG 384 CAGGGCCCAGAUUGAGGGAAA 318 UGCUGGCACCUGGCUAUUCCCUC 385 GGGAAUAGCCAGGUGCCAGCA 319 UCGCACUCUGGGCAGGGCUGGCA 386 CCAGCCCUGCCCAGAGUGCGA 320 UUCUCCCGGGCCUGUCCGCACUC 387 GUGCGGACAGGCCCGGGAGAA 321 UAGGGGCUUCCACGUCUCUCCCG 388 GGAGAGACGUGGAAGCCCCUA 322 UGGUGUUGUCCUUCACAGGGGCU 389 CCCCUGUGAAGGACAACACCA 323 UUCUCUCCCAAGCAGGGGUGUUG 390 ACACCCCUGCUUGGGAGAGAA 324 UGCCUGGACAUGGGACUCUCUCC 391 AGAGAGUCCCAUGUCCAGGCA 325 UCCUGUCCCCACCAGAGCCUGGA 392 CAGGCUCUGGUGGGGACAGGA 326 UCACCCCACUAGGGGCCCUGUCC 393 ACAGGGCCCCUAGUGGGGUGA 327 UGGGCCUGGGGAAGGCCACCCCA 394 GGGUGGCCUUCCCCAGGCCCA 328 UAACCCUGAUUCUCAGGGGCCUG 395 GGCCCCUGAGAAUCAGGGUUA 329 UGUCCACUCCUACUCAAACCCUG 396 GGGUUUGAGUAGGAGUGGACA 330 UGCAGCUCCAAUAUGAGUCCACU 397 UGGACUCAUAUUGGAGCUGCA 331 UUGUUAUCGAUUUAUUGCAGCUC 398 GCUGCAAUAAAUCGAUAACAA 332 UACAUGCUGGGGCCUGUGUUAUC 399 UAACACAGGCCCCAGCAUGUA 333 UCCCCAAGGACACUCAACAUGCU 400 CAUGUUGAGUGUCCUUGGGGA 334 UGACCCCAGAUCUGUCCCCCAAG 401 UGGGGGACAGAUCUGGGGUCA 335 UUGUGAGCCACCUGUAGACCCCA 402 GGGUCUACAGGUGGCUCACAA336 UUGCUAGGAUUACAGGUGUGAGC403 UCACACCUGUAAUCCUAGCAAWSGR Docket No. 71197-703.601SEQID Antisense Sequence (from 5’ to 3’) SEQID Sense Sequence (from 5’ to 3’) NO. NO.337 UCUUGGCUUCCCAAAGUGCUAGG 404 UAGCACUUUGGGAAGCCAAGA 338 UAAGUGAUCCUCCCAUCUUGGCU 405 CCAAGAUGGGAGGAUCACUUA 339 UUAAGCUCCUGGCCUCAAGUGAU 406 CACUUGAGGCCAGGAGCUUAA 340 UUGCCCAGGAUGGUCUUAAGCUC 407 GCUUAAGACCAUCCUGGGCAA 341 UGAGGUCUCGCCAUGUUGCCCAG 408 GGGCAACAUGGCGAGACCUCA 342 UUGUUUUUAUAGAGACGAGGUCU 409 ACCUCGUCUCUAUAAAAACAA343 UAAUUUUUACUGUUUUUAUAGAG410 CUAUAAAAACAGUAAAAAUUA Table DSEQ Antisense Sequence (from 5’ to 3’) SEQID Sense Sequence (from 5’ to 3’) ID NO. NO.411 AGAACCCUGGCACUCACGC 508 GCGUGAGUGCCAGGGUUCU 412 UAGAACCCUGGCACUCACG 509 CGUGAGUGCCAGGGUUCUA 413 GAAACUUUCUGGUUGUCCC 510 GGGACAACCAGAAAGUUUC 414 UGAAACUUUCUGGUUGUCC 511 GGACAACCAGAAAGUUUCA 415 UUGAAACUUUCUGGUUGUC 512 GACAACCAGAAAGUUUCAA 416 CCUGUCGCUUGAAACUUUC 513 GAAAGUUUCAAGCGACAGG 417 GCCUGUCGCUUGAAACUUU 514 AAAGUUUCAAGCGACAGGC 418 AGCCUGUCGCUUGAAACUU 515 AAGUUUCAAGCGACAGGCU 419 GAGCCUGUCGCUUGAAACU 516 AGUUUCAAGCGACAGGCUC 420 CGAGCCUGUCGCUUGAAAC 517 GUUUCAAGCGACAGGCUCG 421 GCGAGCCUGUCGCUUGAAA 518 UUUCAAGCGACAGGCUCGC 422 CGCGAGCCUGUCGCUUGAA 519 UUCAAGCGACAGGCUCGCG 423 GCGCGAGCCUGUCGCUUGA 520 UCAAGCGACAGGCUCGCGC 424 ACCACGUUCACCACGUCCC 521 GGGACGUGGUGAACGUGGU 425 CACCACGUUCACCACGUCC 522 GGACGUGGUGAACGUGGUG 426 ACACCACGUUCACCACGUC 523 GACGUGGUGAACGUGGUGU 427 ACGAACACCACGUUCACCA 524 UGGUGAACGUGGUGUUCGU 428 UACGAACACCACGUUCACC 525 GGUGAACGUGGUGUUCGUA 429 CUACGAACACCACGUUCAC 526 GUGAACGUGGUGUUCGUAG 430 UCUACGAACACCACGUUCA 527 UGAACGUGGUGUUCGUAGA 431 GUCUACGAACACCACGUUC 528 GAACGUGGUGUUCGUAGAC 432 GGUCUACGAACACCACGUU 529 AACGUGGUGUUCGUAGACC 433 CGGUCUACGAACACCACGU 530 ACGUGGUGUUCGUAGACCG 434 GCGGUCUACGAACACCACG 531 CGUGGUGUUCGUAGACCGC 435 AGCGGUCUACGAACACCAC 532 GUGGUGUUCGUAGACCGCU 436 GAGCGGUCUACGAACACCA 533 UGGUGUUCGUAGACCGCUC 437 UGAGCGGUCUACGAACACC 534 GGUGUUCGUAGACCGCUCA 438 CUGAGCGGUCUACGAACAC 535 GUGUUCGUAGACCGCUCAG 439 CCUGAGCGGUCUACGAACA 536 UGUUCGUAGACCGCUCAGG 440 GCCUGAGCGGUCUACGAAC 537 GUUCGUAGACCGCUCAGGC 441 GGCCUGAGCGGUCUACGAA 538 UUCGUAGACCGCUCAGGCC 442 UGGCCUGAGCGGUCUACGA 539 UCGUAGACCGCUCAGGCCA 443 CUGGCCUGAGCGGUCUACG 540 CGUAGACCGCUCAGGCCAG 444 UCACUGGGAUCCGCUGGCC 541 GGCCAGCGGAUCCCAGUGA 445 ACUCACUGGGAUCCGCUGG 542 CCAGCGGAUCCCAGUGAGU 446 CCAGGUGGUCUUCACUCAC 543 GUGAGUGAAGACCACCUGG 447 UCCAGGUGGUCUUCACUCA 544 UGAGUGAAGACCACCUGGA448 AUCCAGGUGGUCUUCACUC545 GAGUGAAGACCACCUGGAUWSGR Docket No. 71197-703.601SEQ Antisense Sequence (from 5’ to 3’) SEQ ID Sense Sequence (from 5’ to 3’) ID NO. NO.449 GAUCCAGGUGGUCUUCACU 546 AGUGAAGACCACCUGGAUC 450 AGAUCCAGGUGGUCUUCAC 547 GUGAAGACCACCUGGAUCU 451 GAGAUCCAGGUGGUCUUCA 548 UGAAGACCACCUGGAUCUC 452 AGGAGAUCCAGGUGGUCUU 549 AAGACCACCUGGAUCUCCU 453 CAGGAGAUCCAGGUGGUCU 550 AGACCACCUGGAUCUCCUG 454 GCAGGAGAUCCAGGUGGUC 551 GACCACCUGGAUCUCCUGC 455 GGCAGGAGAUCCAGGUGGU 552 ACCACCUGGAUCUCCUGCC 456 AGGCAGGAGAUCCAGGUGG 553 CCACCUGGAUCUCCUGCCU 457 CAUGUCGUCUUCCCUCUCC 554 GGAGAGGGAAGACGACAUG 458 GCAUGUCGUCUUCCCUCUC 555 GAGAGGGAAGACGACAUGC 459 AGCAUGUCGUCUUCCCUCU 556 AGAGGGAAGACGACAUGCU 460 UAGCAUGUCGUCUUCCCUC 557 GAGGGAAGACGACAUGCUA 461 CUAGCAUGUCGUCUUCCCU 558 AGGGAAGACGACAUGCUAG 462 UCUAGCAUGUCGUCUUCCC 559 GGGAAGACGACAUGCUAGA 463 GUCUAGCAUGUCGUCUUCC 560 GGAAGACGACAUGCUAGAC 464 UGUCUAGCAUGUCGUCUUC 561 GAAGACGACAUGCUAGACA 465 GCCAUGUCUAGCAUGUCGU 562 ACGACAUGCUAGACAUGGC 466 GGGCCAUGUCUAGCAUGUC 563 GACAUGCUAGACAUGGCCC 467 CCGCGAGUUCUCCUGGAGG 564 CCUCCAGGAGAACUCGCGG 468 GCCGCGAGUUCUCCUGGAG 565 CUCCAGGAGAACUCGCGGC 469 AGCCGCGAGUUCUCCUGGA 566 UCCAGGAGAACUCGCGGCU 470 CAGCCGCGAGUUCUCCUGG 567 CCAGGAGAACUCGCGGCUG 471 CCAGCCGCGAGUUCUCCUG 568 CAGGAGAACUCGCGGCUGG 472 CCCAGCCGCGAGUUCUCCU 569 AGGAGAACUCGCGGCUGGG 473 GCCCAGCCGCGAGUUCUCC 570 GGAGAACUCGCGGCUGGGC 474 AGCCCAGCCGCGAGUUCUC 571 GAGAACUCGCGGCUGGGCU 475 CAGCCCAGCCGCGAGUUCU 572 AGAACUCGCGGCUGGGCUG 476 GCAGCCCAGCCGCGAGUUC 573 GAACUCGCGGCUGGGCUGC 477 GGCAGCCCAGCCGCGAGUU 574 AACUCGCGGCUGGGCUGCC 478 UGGCAGCCCAGCCGCGAGU 575 ACUCGCGGCUGGGCUGCCA 479 AAUUCCGCUCCUUCCAGCU 576 AGCUGGAAGGAGCGGAAUU 480 GAAUUCCGCUCCUUCCAGC 577 GCUGGAAGGAGCGGAAUUC 481 UGAAUUCCGCUCCUUCCAG 578 CUGGAAGGAGCGGAAUUCA 482 GUGAAUUCCGCUCCUUCCA 579 UGGAAGGAGCGGAAUUCAC 483 GGUGAAUUCCGCUCCUUCC 580 GGAAGGAGCGGAAUUCACC 484 GGGUGAAUUCCGCUCCUUC 581 GAAGGAGCGGAAUUCACCC 485 AGGGUGAAUUCCGCUCCUU 582 AAGGAGCGGAAUUCACCCU 486 CAGGGUGAAUUCCGCUCCU 583 AGGAGCGGAAUUCACCCUG 487 GCAGGGUGAAUUCCGCUCC 584 GGAGCGGAAUUCACCCUGC 488 GAAGUUCCUGGUGAUCUUG 585 CAAGAUCACCAGGAACUUC 489 AGAAGUUCCUGGUGAUCUU 586 AAGAUCACCAGGAACUUCU 490 UAGAAGUUCCUGGUGAUCU 587 AGAUCACCAGGAACUUCUA 491 GUAGAAGUUCCUGGUGAUC 588 GAUCACCAGGAACUUCUAC 492 CGUAGAAGUUCCUGGUGAU 589 AUCACCAGGAACUUCUACG 493 ACGUAGAAGUUCCUGGUGA 590 UCACCAGGAACUUCUACGU 494 CACGUAGAAGUUCCUGGUG 591 CACCAGGAACUUCUACGUG 495 CCACGUAGAAGUUCCUGGU 592 ACCAGGAACUUCUACGUGG 496 UCCACGUAGAAGUUCCUGG 593 CCAGGAACUUCUACGUGGA497 AUCCACGUAGAAGUUCCUG594 CAGGAACUUCUACGUGGAUWSGR Docket No. 71197-703.601SEQ Antisense Sequence (from 5’ to 3’) SEQ ID Sense Sequence (from 5’ to 3’) ID NO. NO.498 CCACGUCUCUCCCGGGCCU 595 AGGCCCGGGAGAGACGUGG 499 UCCACGUCUCUCCCGGGCC 596 GGCCCGGGAGAGACGUGGA 500 UUCCACGUCUCUCCCGGGC 597 GCCCGGGAGAGACGUGGAA 501 CUUCCACGUCUCUCCCGGG 598 CCCGGGAGAGACGUGGAAG 502 GCUUCCACGUCUCUCCCGG 599 CCGGGAGAGACGUGGAAGC 503 GGCUUCCACGUCUCUCCCG 600 CGGGAGAGACGUGGAAGCC 504 GGGCUUCCACGUCUCUCCC 601 GGGAGAGACGUGGAAGCCC 505 AUGAGUCCACUCCUACUCA 602 UGAGUAGGAGUGGACUCAU 506 GAUUUAUUGCAGCUCCAAU 603 AUUGGAGCUGCAAUAAAUCCGAUUUAUUGCAGCUCCAA507604 UUGGAGCUGCAAUAAAUCG Table EDescription SEQ ID Sense Strand (5’-3’) SEQ ID NO Antisense Strand (5’-3’) NOl_19 / 21mer 605 gsuscaCfgUfGfAfugcaugucaa 672 usUfsgacAfuGfCfaucaCfgUfgacsusc 16_19 / 21mer 606 uscsauGfgCfCfGfccuccaugga 673 usCfscauGfgAfGfgcggCfcAfugascsa 31_19 / 21mer 607 usgsgcCfcGfGfGfgaggcgugaa 674 usUfscacGfcCfUfccccGfgGfccasusg 46_19 / 21mer 608 usgsagUfgCfCfAfggguucuaca 675 usGfsuagAfaCfCfcuggCfaCfucascsg 61_19 / 21mer 609 usascuGfcAfGfGfcugccaggga 676 usCfsccuGfgCfAfgccuGfcAfguasgsa 76_19 / 21mer 610 gsgsggCfaCfCfUfgguggaacaa 677 usUfsguuCfcAfCfcaggUfgCfcccsusg 91_19 / 21mer 611 ascsagAfcCfUfGfggggcacuua 678 usAfsaguGfcCfCfccagGfuCfugususc 106_19 / 21mer 612 csusucCfgGfGfUfcgggggagga 679 usCfscucCfcCfCfgaccCfgGfaagsusg 121_19 / 21mer 613 asgsggGfgUfGfGfcgcuggggaa 680 usUfscccCfaGfCfgccaCfcCfccuscsc 136_19 / 21mer 614 gsgsacAfaCfCfAfgaaaguuuca 681 usGfsaaaCfuUfUfcuggUfuGfuccscsc 151_19 / 21mer 615 ususcaAfgCfGfAfcaggcucgca 682 usGfscgaGfcCfUfgucgCfuUfgaasasc 166_19 / 21mer 616 csgscgCfcCfGfGfcuggagagga 683 usCfscucUfcCfAfgccgGfgCfgcgsasg 181_19 / 21mer 617 asgsgaGfgAfCfGfcgggcggcca 684 usGfsgccGfcCfCfgcguCfcUfccuscsu 196_19 / 21mer 618 gscsccGfgAfGfCfggcccgggga 685 usCfscccGfgGfCfcgcuCfcGfggcscsg 211_19 / 21mer 619 gsgsgaCfgUfGfGfugaacgugga 686 usCfscacGfuUfCfaccaCfgUfcccscsg 226_19 / 21mer 620 usgsguGfuUfCfGfuagaccgcua 687 usAfsgcgGfuCfUfacgaAfcAfccascsg 241_19 / 21mer 621 gscsucAfgGfCfCfagcggaucca 688 usGfsgauCfcGfCfuggcCfuGfagcsgsg 256_19 / 21mer 622 uscsccAfgUfGfAfguggcagaga 689 usCfsucuGfcCfAfcucaCfuGfggasusc 271_19 / 21mer 623 gsasguCfgGfGfGfacaauguuca 690 usGfsaacAfuUfGfucccCfgAfcucsusg 286_19 / 21mer 624 ususcuUfcAfCfCfuggcccagca 691 usGfscugGfgCfCfagguGfaAfgaascsa 301_19 / 21mer 625 asgscgCfcAfCfGfggguggacca 692 usGfsgucCfaCfCfccguGfgCfgcusgsg 316_19 / 21mer 626 ascscuGfgAfAfGfgggccuguga 693 usCfsacaGfgCfCfccuuCfcAfgguscsc 331_19 / 21mer 627 gsusgaAfgCfCfUfcccuggccua 694 usAfsggcCfaGfGfgaggCfuUfcacsasg 346_19 / 21mer 628 cscsugCfuCfCfAfccugccauga 695 usCfsaugGfcAfGfguggAfgCfaggscsc 361_19 / 21mer 629 asusguGfuAfUfGfugagugaaga 696 usCfsuucAfcUfCfacauAfcAfcausgsg 376_19 / 21mer 630 asasgaCfcAfCfCfuggaucucca 697 usGfsgagAfuCfCfagguGfgUfcuuscsa 391_19 / 21mer 631 uscscuGfcCfUfCfcucccgagga 698 usCfscucGfgGfAfggagGfcAfggasgsa 406_19 / 21mer 632 asgsgaGfaGfGfGfaagacgacaa 699 usUfsgucGfuCfUfucccUfcUfccuscsg 421_19 / 21mer 633 ascsauGfcUfAfGfacauggccca 700 usGfsggcCfaUfGfucuaGfcAfuguscsg 436_19 / 21mer 634 cscsccCfcUfCfCfuccaggagaa 701 usUfscucCfuGfGfaggaGfgGfgggscsc 451_19 / 21mer 635 asgsaaCfuCfGfCfggcugggcua 702 usAfsgccCfaGfCfcgcgAfgUfucuscsc 466_19 / 21mer 636 gscsugCfcAfGfAfuugugcugaa 703 usUfscagCfaCfAfaucuGfgCfagcscsc 481_19 / 21mer 637 usgsacAfcCfGfGfagcuggaaga 704 usCfsuucCfaGfCfuccgGfuGfucasgsc 496_19 / 21mer 638 asasggAfgCfGfGfaauucaccca 705 usGfsgguGfaAfUfuccgCfuCfcuuscsc511_19 / 21mer 639 cscscuGfcCfCfAfagaucaccaa 706 usUfsgguGfaUfCfuuggGfcAfgggsusgWSGR Docket No. 71197-703.601526_19 / 21mer 640 cscsagGfaAfCfUfucuacgugga 707 usCfscacGfuAfGfaaguUfcCfuggsusg 541_19 / 21mer 641 usgsgaUfgGfCfCfauguccccaa 708 usUfsgggGfaCfAfuggcCfaUfccascsg 556_19 / 21mer 642 cscsaaGfcCfCfCfacugacauga 709 usCfsaugUfcAfGfugggGfcUfuggsgsg 571_19 / 21mer 643 asusgaAfcAfCfCfuggaccauua 710 usAfsaugGfuCfCfagguGfuUfcausgsu 586_19 / 21mer 644 asusucCfaCfAfUfugccauggca 711 usGfsccaUfgGfCfaaugUfgGfaausgsg 601_19 / 21mer 645 gsgsccCfcAfGfGfgcccagauua 712 usAfsaucUfgGfGfcccuGfgGfgccsasu 616_19 / 21mer 646 asusugAfgGfGfAfauagccagga 713 usCfscugGfcUfAfuuccCfuCfaauscsu 631_19 / 21mer 647 asgsguGfcCfAfGfcccugcccaa 714 usUfsgggCfaGfGfgcugGfcAfccusgsg 646_19 / 21mer 648 cscsagAfgUfGfCfggacaggcca 715 usGfsgccUfgUfCfcgcaCfuCfuggsgsc 661_19 / 21mer 649 gscsccGfgGfAfGfagacguggaa 716 usUfsccaCfgUfCfucucCfcGfggcscsu 676_19 / 21mer 650 gsgsaaGfcCfCfCfugugaaggaa 717 usUfsccuUfcAfCfagggGfcUfuccsasc 691_19 / 21mer 651 gsgsacAfaCfAfCfcccugcuuga 718 usCfsaagCfaGfGfggugUfuGfuccsusu 706_19 / 21mer 652 ususggGfaGfAfGfagucccauga 719 usCfsaugGfgAfCfucucUfcCfcaasgsc 721_19 / 21mer 653 asusguCfcAfGfGfcucuggugga 720 usCfscacCfaGfAfgccuGfgAfcausgsg 736_19 / 21mer 654 usgsggGfaCfAfGfggccccuaga 721 usCfsuagGfgGfCfccugUfcCfccascsc 751_19 / 21mer 655 usasguGfgGfGfUfggccuuccca 722 usGfsggaAfgGfCfcaccCfcAfcuasgsg 766_19 / 21mer 656 cscsccAfgGfCfCfccugagaaua 723 usAfsuucUfcAfGfgggcCfuGfgggsasa 781_19 / 21mer 657 asasucAfgGfGfUfuugaguagga 724 usCfscuaCfuCfAfaaccCfuGfauuscsu 796_19 / 21mer 658 asgsgaGfuGfGfAfcucauauuga 725 usCfsaauAfuGfAfguccAfcUfccusasc 811_19 / 21mer 659 ususggAfgCfUfGfcaauaaauca 726 usGfsauuUfaUfUfgcagCfuCfcaasusa 826_19 / 21mer 660 asuscgAfuAfAfCfacaggcccca 727 usGfsgggCfcUfGfuguuAfuCfgaususu 841_19 / 21mer 661 cscscaGfcAfUfGfuugaguguca 728 usGfsacaCfuCfAfacauGfcUfgggsgsc 856_19 / 21mer 662 gsusccUfuGfGfGfggacagauca 729 usGfsaucUfgUfCfccccAfaGfgacsasc 871_19 / 21mer 663 asuscuGfgGfGfUfcuacagguga 730 usCfsaccUfgUfAfgaccCfcAfgauscsu 886_19 / 21mer 664 gsusggCfuCfAfCfaccuguaaua 731 usAfsuuaCfaGfGfugugAfgCfcacscsu 901_19 / 21mer 665 asasucCfuAfGfCfacuuugggaa 732 usUfscccAfaAfGfugcuAfgGfauusasc 916_19 / 21mer 666 gsgsaaGfcCfAfAfgaugggagga 733 usCfscucCfcAfUfcuugGfcUfuccscsa 931_19 / 21mer 667 asgsgaUfcAfCfUfugaggccaga 734 usCfsuggCfcUfCfaaguGfaUfccuscsc 946_19 / 21mer 668 csasggAfgCfUfUfaagaccauca 735 usGfsaugGfuCfUfuaagCfuCfcugsgsc 961_19 / 21mer 669 asusccUfgGfGfCfaacauggcga 736 usCfsgccAfuGfUfugccCfaGfgausgsg 976_19 / 21mer 670 gscsgaGfaCfCfUfcgucucuaua 737 usAfsuagAfgAfCfgaggUfcUfcgcscsa 992_19 / 21mer 671 asusaaAfaAfCfAfguaaaaauua 738 usAfsauuUfuUfAfcuguUfuUfuausasg;‘s” refers to a phosphorothioate internucleoside linkage; “Nf” refers to a 2’ -fluoro modifiednucleosideTable FDescription SEQ Sense Strand (5'-3') SEQ Antisense Strand (5'-3') ID ID NO: NO:l_21 / 23mer 739 gsasgucaCfgUfGfAfugcaugucaa 873 usUfsgacAfuGfCfaucaCfgUfgacucss 16_21 / 23mer 740 usgsucauGfgCfCfGfccuccaugga 874 usCfscauGfgAfGfgcggCfcAfugacasusg 31_21 / 23mer 741 csasuggcCfcGfGfGfgaggcgugaa 875 usUfscacGfcCfUfccccGfgGfccaugsgsa 46_21 / 23mer 742 csgsugagUfgCfCfAfggguucuaca 876 usGfsuagAfaCfCfcuggCfaCfucacgscsc 61_21 / 23mer 743 uscsuacuGfcAfGfGfcugccaggga 877 usCfsccuGfgCfAfgccuGfcAfguagasasc 76_21 / 23mer 744 csasggggCfaCfCfUfgguggaacaa 878 usUfsguuCfcAfCfcaggUfgCfcccugsgsc 91_21 / 23mer 745 gsasacagAfcCfUfGfggggcacuua 879 usAfsaguGfcCfCfccagGfuCfuguucscsa 106_21 / 23mer 746 csascuucCfgGfGfUfcgggggagga 880 usCfscucCfcCfCfgaccCfgGfaagugscsc 121_21 / 23mer 747 gsgsagggGfgUfGfGfcgcuggggaa 881 usUfscccCfaGfCfgccaCfcCfccuccscsc 136_21 / 23mer 748 gsgsggacAfaCfCfAfgaaaguuuca 882 usGfsaaaCfuUfUfcuggUfuGfuccccsasg151_21 / 23mer 749 gsusuucaAfgCfGfAfcaggcucgca 883 usGfscgaGfcCfUfgucgCfuUfgaaacsusuWSGR Docket No. 71197-703.601166_21 / 23mer 750 csuscgcgCfcCfGfGfcuggagagga 884 usCfscucUfcCfAfgccgGfgCfgcgagscsc 181_21 / 23mer 751 asgsaggaGfgAfCfGfcgggcggcca 885 usGfsgccGfcCfCfgcguCfcUfccucuscsc 196_21 / 23mer 752 csgsgcccGfgAfGfCfggcccgggga 886 usCfscccGfgGfCfcgcuCfcGfggccgscsc 211_21 / 23mer 753 csgsgggaCfgUfGfGfugaacgugga 887 usCfscacGfuUfCfaccaCfgUfccccgsgsg 226_21 / 23mer 754 csgsugguGfuUfCfGfuagaccgcua 888 usAfsgcgGfuCfUfacgaAfcAfccacgsusu 241_21 / 23mer 755 cscsgcucAfgGfCfCfagcggaucca 889 usGfsgauCfcGfCfuggcCfuGfagcggsusc 256_21 / 23mer 756 gsasucccAfgUfGfAfguggcagaga 890 usCfsucuGfcCfAfcucaCfuGfggaucscsg 271_21 / 23mer 757 csasgaguCfgGfGfGfacaauguuca 891 usGfsaacAfuUfGfucccCfgAfcucugscsc 286_21 / 23mer 758 usgsuucuUfcAfCfCfuggcccagca 892 usGfscugGfgCfCfagguGfaAfgaacasusu 301_21 / 23mer 759 cscsagcgCfcAfCfGfggguggacca 893 usGfsgucCfaCfCfccguGfgCfgcuggsgsc 316_21 / 23mer 760 gsgsaccuGfgAfAfGfgggccuguga 894 usCfsacaGfgCfCfccuuCfcAfgguccsasc 331_21 / 23mer 761 csusgugaAfgCfCfUfcccuggccua 895 usAfsggcCfaGfGfgaggCfuUfcacagsgsc 346_21 / 23mer 762 gsgsccugCfuCfCfAfccugccauga 896 usCfsaugGfcAfGfguggAfgCfaggccsasg 361_21 / 23mer 763 cscsauguGfuAfUfGfugagugaaga 897 usCfsuucAfcUfCfacauAfcAfcauggscsa 376_21 / 23mer 764 usgsaagaCfcAfCfCfuggaucucca 898 usGfsgagAfuCfCfagguGfgUfcuucascsu 391_21 / 23mer 765 uscsuccuGfcCfUfCfcucccgagga 899 usCfscucGfgGfAfggagGfcAfggagasusc 406_21 / 23mer 766 csgsaggaGfaGfGfGfaagacgacaa 900 usUfsgucGfuCfUfucccUfcUfccucgsgsg 421_21 / 23mer 767 csgsacauGfcUfAfGfacauggccca 901 usGfsggcCfaUfGfucuaGfcAfugucgsusc 436_21 / 23mer 768 gsgsccccCfcUfCfCfuccaggagaa 902 usUfscucCfuGfGfaggaGfgGfgggccsasu 451_21 / 23mer 769 gsgsagaaCfuCfGfCfggcugggcua 903 usAfsgccCfaGfCfcgcgAfgUfucuccsusg 466_21 / 23mer 770 gsgsgcugCfcAfGfAfuugugcugaa 904 usUfscagCfaCfAfaucuGfgCfagcccsasg 481_21 / 23mer 771 gscsugacAfcCfGfGfagcuggaaga 905 usCfsuucCfaGfCfuccgGfuGfucagcsasc 496_21 / 23mer 772 gsgsaaggAfgCfGfGfaauucaccca 906 usGfsgguGfaAfUfuccgCfuCfcuuccsasg 511_21 / 23mer 773 csascccuGfcCfCfAfagaucaccaa 907 usUfsgguGfaUfCfuuggGfcAfgggugsasa 526_21 / 23mer 774 csasccagGfaAfCfUfucuacgugga 908 usCfscacGfuAfGfaaguUfcCfuggugsasu 541_21 / 23mer 775 csgsuggaUfgGfCfCfauguccccaa 909 usUfsgggGfaCfAfuggcCfaUfccacgsusa 556_21 / 23mer 776 cscsccaaGfcCfCfCfacugacauga 910 usCfsaugUfcAfGfugggGfcUfuggggsasc 571_21 / 23mer 777 ascsaugaAfcAfCfCfuggaccauua 911 usAfsaugGfuCfCfagguGfuUfcauguscsa 586_21 / 23mer 778 cscsauucCfaCfAfUfugccauggca 912 usGfsccaUfgGfCfaaugUfgGfaauggsusc 601_21 / 23mer 779 asusggccCfcAfGfGfgcccagauua 913 usAfsaucUfgGfGfcccuGfgGfgccausgsg 616_21 / 23mer 780 asgsauugAfgGfGfAfauagccagga 914 usCfscugGfcUfAfuuccCfuCfaaucusgsg 631_21 / 23mer 781 cscsagguGfcCfAfGfcccugcccaa 915 usUfsgggCfaGfGfgcugGfcAfccuggscsu 646_21 / 23mer 782 gscsccagAfgUfGfCfggacaggcca 916 usGfsgccUfgUfCfcgcaCfuCfugggcsasg 661_21 / 23mer 783 asgsgcccGfgGfAfGfagacguggaa 917 usUfsccaCfgUfCfucucCfcGfggccusgsu 676_21 / 23mer 784 gsusggaaGfcCfCfCfugugaaggaa 918 usUfsccuUfcAfCfagggGfcUfuccacsgsu 691_21 / 23mer 785 asasggacAfaCfAfCfcccugcuuga 919 usCfsaagCfaGfGfggugUfuGfuccuuscsa 706_21 / 23mer 786 gscsuuggGfaGfAfGfagucccauga 920 usCfsaugGfgAfCfucucUfcCfcaagcsasg 721_21 / 23mer 787 cscsauguCfcAfGfGfcucuggugga 921 usCfscacCfaGfAfgccuGfgAfcauggsgsa 736_21 / 23mer 788 gsgsugggGfaCfAfGfggccccuaga 922 usCfsuagGfgGfCfccugUfcCfccaccsasg 751_21 / 23mer 789 cscsuaguGfgGfGfUfggccuuccca 923 usGfsggaAfgGfCfcaccCfcAfcuaggsgsg 766_21 / 23mer 790 ususccccAfgGfCfCfccugagaaua 924 usAfsuucUfcAfGfgggcCfuGfgggaasgsg 781_21 / 23mer 791 asgsaaucAfgGfGfUfuugaguagga 925 usCfscuaCfuCfAfaaccCfuGfauucuscsa 796_21 / 23mer 792 gsusaggaGfuGfGfAfcucauauuga 926 usCfsaauAfuGfAfguccAfcUfccuacsusc 811_21 / 23mer 793 usasuuggAfgCfUfGfcaauaaauca 927 usGfsauuUfaUfUfgcagCfuCfcaauasusg 826_21 / 23mer 794 asasaucgAfuAfAfCfacaggcccca 928 usGfsgggCfcUfGfuguuAfuCfgauuusasu 841_21 / 23mer 795 gscscccaGfcAfUfGfuugaguguca 929 usGfsacaCfuCfAfacauGfcUfggggcscsu 856_21 / 23mer 796 gsusguccUfuGfGfGfggacagauca 930 usGfsaucUfgUfCfccccAfaGfgacacsusc 871_21 / 23mer 797 asgsaucuGfgGfGfUfcuacagguga 931 usCfsaccUfgUfAfgaccCfcAfgaucusgsu 886_21 / 23mer 798 asgsguggCfuCfAfCfaccuguaaua 932 usAfsuuaCfaGfGfugugAfgCfcaccusgsu901_21 / 23mer 799 gsusaaucCfuAfGfCfacuuugggaa 933 usUfscccAfaAfGfugcuAfgGfauuacsasgWSGR Docket No. 71197-703.601916_21 / 23mer 800 usgsggaaGfcCfAfAfgaugggagga 934 usCfscucCfcAfUfcuugGfcUfucccasasa 931_21 / 23mer 801 gsgsaggaUfcAfCfUfugaggccaga 935 usCfsuggCfcUfCfaaguGfaUfccuccscsa 946_21 / 23mer 802 gscscaggAfgCfUfUfaagaccauca 936 usGfsaugGfuCfUfuaagCfuCfcuggcscsu 961_21 / 23mer 803 cscsauccUfgGfGfCfaacauggcga 937 usCfsgccAfuGfUfugccCfaGfgauggsusc 976_21 / 23mer 804 usgsgcgaGfaCfCfUfcgucucuaua 938 usAfsuagAfgAfCfgaggUfcUfcgccasusg 992_21 / 23mer 805 csusauaaAfaAfCfAfguaaaaauua 939 usAfsauuUfuUfAfcuguUfuUfuauagsasg 8_21 / 23mer 806 gsusgaugCfaUfGfUfcauggccgca 940 usGfscggCfcAfUfgacaUfgCfaucacsgsu 23_21 / 23mer 807 gscscgccUfcCfAfUfggcccgggga 941 usCfscccGfgGfCfcaugGfaGfgcggcscsa 38_21 / 23mer 808 csgsgggaGfgCfGfUfgagugccaga 942 usCfsuggCfaCfUfcacgCfcUfccccgsgsg 53_21 / 23mer 809 gscscaggGfuUfCfUfacugcaggca 943 usGfsccuGfcAfGfuagaAfcCfcuggcsasc 68_21 / 23mer 810 csasggcuGfcCfAfGfgggcaccuga 944 usCfsaggUfgCfCfccugGfcAfgccugscsa 83_21 / 23mer 811 ascscuggUfgGfAfAfcagaccugga 945 usCfscagGfuCfUfguucCfaCfcaggusgsc 98_21 / 23mer 812 cscsugggGfgCfAfCfuuccggguca 946 usGfsaccCfgGfAfagugCfcCfccaggsusc 113_21 / 23mer 813 gsgsgucgGfgGfGfAfggggguggca 947 usGfsccaCfcCfCfcuccCfcCfgacccsgsg 128_21 / 23mer 814 gsusggcgCfuGfGfGfgacaaccaga 948 usCfsuggUfuGfUfccccAfgCfgccacscsc 143_21 / 23mer 815 ascscagaAfaGfUfUfucaagcgaca 949 usGfsucgCfuUfGfaaacUfuUfcuggususg 158_21 / 23mer 816 gscsgacaGfgCfUfCfgcgcccggca 950 usGfsccgGfgCfGfcgagCfcUfgucgcsusu 173_21 / 23mer 817 cscsggcuGfgAfGfAfggaggacgca 951 usGfscguCfcUfCfcucuCfcAfgccggsgsc 188_21 / 23mer 818 gsascgcgGfgCfGfGfcccggagcga 952 usCfsgcuCfcGfGfgccgCfcCfgcgucscsu 203_21 / 23mer 819 gsasgcggCfcCfGfGfggacguggua 953 usAfsccaCfgUfCfcccgGfgCfcgcucscsg 218_21 / 23mer 820 gsusggugAfaCfGfUfgguguucgua 954 usAfscgaAfcAfCfcacgUfuCfaccacsgsu 233_21 / 23mer 821 ususcguaGfaCfCfGfcucaggccaa 955 usUfsggcCfuGfAfgcggUfcUfacgaascsa 248_21 / 23mer 822 gsgsccagCfgGfAfUfcccagugaga 956 usCfsucaCfuGfGfgaucCfgCfuggccsusg 263_21 / 23mer 823 gsusgaguGfgCfAfGfagucggggaa 957 usUfscccCfgAfCfucugCfcAfcucacsusg 278_21 / 23mer 824 gsgsggacAfaUfGfUfucuucaccua 958 usAfsgguGfaAfGfaacaUfuGfuccccsgsa 293_21 / 23mer 825 csasccugGfcCfCfAfgcgccacgga 959 usCfscguGfgCfGfcuggGfcCfaggugsasa 308_21 / 23mer 826 csascgggGfuGfGfAfccuggaagga 960 usCfscuuCfcAfGfguccAfcCfccgugsgsc 323_21 / 23mer 827 gsasagggGfcCfUfGfugaagccuca 961 usGfsaggCfuUfCfacagGfcCfccuucscsa 338_21 / 23mer 828 gscscuccCfuGfGfCfcugcuccaca 962 usGfsuggAfgCfAfggccAfgGfgaggcsusu 353_21 / 23mer 829 uscscaccUfgCfCfAfuguguaugua 963 usAfscauAfcAfCfauggCfaGfguggasgsc 368_21 / 23mer 830 usasugugAfgUfGfAfagaccaccua 964 usAfsgguGfgUfCfuucaCfuCfacauascsa 383_21 / 23mer 831 csasccugGfaUfCfUfccugccucca 965 usGfsgagGfcAfGfgagaUfcCfaggugsgsu 398_21 / 23mer 832 cscsuccuCfcCfGfAfggagagggaa 966 usUfscccUfcUfCfcucgGfgAfggaggscsa 413_21 / 23mer 833 asgsggaaGfaCfGfAfcaugcuagaa 967 usUfscuaGfcAfUfgucgUfcUfucccuscsu 428_21 / 23mer 834 csusagacAfuGfGfCfcccccuccua 968 usAfsggaGfgGfGfggccAfuGfucuagscsa 443_21 / 23mer 835 csusccucCfaGfGfAfgaacucgcga 969 usCfsgcgAfgUfUfcuccUfgGfaggagsgsg 458_21 / 23mer 836 uscsgcggCfuGfGfGfcugccagaua 970 usAfsucuGfgCfAfgcccAfgCfcgcgasgsu 473_21 / 23mer 837 csasgauuGfuGfCfUfgacaccggaa 971 usUfsccgGfuGfUfcagcAfcAfaucugsgsc 488_21 / 23mer 838 cscsggagCfuGfGfAfaggagcggaa 972 usUfsccgCfuCfCfuuccAfgCfuccggsusg 503_21 / 23mer 839 gscsggaaUfuCfAfCfccugcccaaa 973 usUfsuggGfcAfGfggugAfaUfuccgcsusc 518_21 / 23mer 840 cscscaagAfuCfAfCfcaggaacuua 974 usAfsaguUfcCfUfggugAfuCfuugggscsa 533_21 / 23mer 841 asascuucUfaCfGfUfggauggccaa 975 usUfsggcCfaUfCfcacgUfaGfaaguuscsc 548_21 / 23mer 842 gsgsccauGfuCfCfCfcaagccccaa 976 usUfsgggGfcUfUfggggAfcAfuggccsasu 563_21 / 23mer 843 cscsccacUfgAfCfAfugaacaccua 977 usAfsgguGfuUfCfauguCfaGfuggggscsu 578_21 / 23mer 844 csasccugGfaCfCfAfuuccacauua 978 usAfsaugUfgGfAfauggUfcCfaggugsusu 593_21 / 23mer 845 ascsauugCfcAfUfGfgccccaggga 979 usCfsccuGfgGfGfccauGfgCfaaugusgsg 608_21 / 23mer 846 csasgggcCfcAfGfAfuugagggaaa 980 usUfsuccCfuCfAfaucuGfgGfcccugsgsg 623_21 / 23mer 847 gsgsgaauAfgCfCfAfggugccagca 981 usGfscugGfcAfCfcuggCfuAfuucccsusc 638_21 / 23mer 848 cscsagccCfuGfCfCfcagagugcga 982 usCfsgcaCfuCfUfgggcAfgGfgcuggscsa653_21 / 23mer 849 gsusgcggAfcAfGfGfcccgggagaa 983 usUfscucCfcGfGfgccuGfuCfcgcacsuscWSGR Docket No. 71197-703.601668_21 / 23mer 850 gsgsagagAfcGfUfGfgaagccccua 984 usAfsgggGfcUfUfccacGfuCfucuccscsg 683_21 / 23mer 851 cscsccugUfgAfAfGfgacaacacca 985 usGfsgugUfuGfUfccuuCfaCfaggggscsu 698_21 / 23mer 852 ascsacccCfuGfCfUfugggagagaa 986 usUfscucUfcCfCfaagcAfgGfggugususg 713_21 / 23mer 853 asgsagagUfcCfCfAfuguccaggca 987 usGfsccuGfgAfCfauggGfaCfucucuscsc 728_21 / 23mer 854 csasggcuCfuGfGfUfggggacagga 988 usCfscugUfcCfCfcaccAfgAfgccugsgsa 743_21 / 23mer 855 ascsagggCfcCfCfUfagugggguga 989 usCfsaccCfcAfCfuaggGfgCfccuguscsc 758_21 / 23mer 856 gsgsguggCfcUfUfCfcccaggccca 990 usGfsggcCfuGfGfggaaGfgCfcacccscsa 773_21 / 23mer 857 gsgsccccUfgAfGfAfaucaggguua 991 usAfsaccCfuGfAfuucuCfaGfgggccsusg 788_21 / 23mer 858 gsgsguuuGfaGfUfAfggaguggaca 992 usGfsuccAfcUfCfcuacUfcAfaacccsusg 803_21 / 23mer 859 usgsgacuCfaUfAfUfuggagcugca 993 usGfscagCfuCfCfaauaUfgAfguccascsu 818_21 / 23mer 860 gscsugcaAfuAfAfAfucgauaacaa 994 usUfsguuAfuCfGfauuuAfuUfgcagcsusc 833_21 / 23mer 861 usasacacAfgGfCfCfccagcaugua 995 usAfscauGfcUfGfgggcCfuGfuguuasusc 848_21 / 23mer 862 csasuguuGfaGfUfGfuccuugggga 996 usCfscccAfaGfGfacacUfcAfacaugscsu 863_21 / 23mer 863 usgsggggAfcAfGfAfucugggguca 997 usGfsaccCfcAfGfaucuGfuCfccccasasg 878_21 / 23mer 864 gsgsgucuAfcAfGfGfuggcucacaa 998 usUfsgugAfgCfCfaccuGfuAfgacccscsa 893_21 / 23mer 865 uscsacacCfuGfUfAfauccuagcaa 999 usUfsgcuAfgGfAfuuacAfgGfugugasgsc 908_21 / 23mer 866 usasgcacUfuUfGfGfgaagccaaga 1000 usCfsuugGfcUfUfcccaAfaGfugcuasgsg 923_21 / 23mer 867 cscsaagaUfgGfGfAfggaucacuua 1001 usAfsaguGfaUfCfcuccCfaUfcuuggscsu 938_21 / 23mer 868 csascuugAfgGfCfCfaggagcuuaa 1002 usUfsaagCfuCfCfuggcCfuCfaagugsasu 953_21 / 23mer 869 gscsuuaaGfaCfCfAfuccugggcaa 1003 usUfsgccCfaGfGfauggUfcUfuaagcsusc 968_21 / 23mer 870 gsgsgcaaCfaUfGfGfcgagaccuca 1004 usGfsaggUfcUfCfgccaUfgUfugcccsasg 983_21 / 23mer 871 ascscucgUfcUfCfUfauaaaaacaa 1005 usUfsguuUfuUfAfuagaGfaCfgagguscsu 992_21 / 23mer 872 csusauaaAfaAfCfAfguaaaaauua 1006 usAfsauuUfuUfAfcuguUfuUfuauagsasg “s” refers to a phosphorothioate intemucleoside linkage; “Nf” refers to a 2’ -fluoro modifiednucleosideEXAMPLES

[0301] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.Materials and Methods

[0302] The following materials and methods were used in the Examples below.Example 1. FDX2 Screening of siRNAs (23mer / 21mer) targeting FDX2

[0303] siRNA comprising an antisense / sense sequence pairs were designed. In Table B and Table C antisense / sense sequence pairs are shown in the same row (e.g., the antisense sequence of SEQ ID NO: 143 and the sense sequence of SEQ ID NO: 210 form an antisense / sense sequence pair, etc., e.g., the antisense sequence of SEQ ID NO: 277 and the sense sequence of SEQ ID NO: 344 form an antisense / sense sequence pair, etc.).

[0304] As shown in Table F, the modified antisense strand is 23 nucleotides in length, the sugar motif is (from 5’ to 3’) yfyyyfyffyyyyfyfyyyyyyy wherein each ‘y’ represents a 2’-OMe modified nucleotide and each ‘f represents a 2’-F modified nucleotide, and the internucleoside linkage motif (from 5’ to 3’) is ssooooooooooooooooooss wherein each ‘o’ represents a phosphodiester internucleoside linkage and each ‘s’ represents a phosphorothioate internucleoside linkage. In some experiments, each cytosine residue is a non-methylatedWSGR Docket No. 71197-703.601cytosine. In some experiments, each antisense strand has a terminal phosphate at the 5 ’-end. In some experiments, a modified antisense strand comprises an uracil “U” or a thymine “T” at the 5’ end (e.g., see FIG. 1). As shown in Table F, the modified sense strand is 21 nucleotides in length, the sugar motif is (from 5’ to 3’) yyyyyyfyfffyyyyyyyyyy wherein each ‘y’ represents a 2’-0Me modified nucleotide and each ‘f represents a 2’-F modified nucleotide, and the internucleoside linkage motif (from 5’ to 3’) is ssoooooooooooooooooo wherein each ‘o’ represents a phosphodiester internucleoside linkage and each ‘s’ represents a phosphorothioate internucleoside linkage. In some experiments, each cytosine residue is a non-methylated cytosine. In some experiments, a modified sense strand comprises an adenine “A” at the 3’ end of sense strand (e.g., see FIG. 1).

[0305] The siRNAs were analyzed for their effects on target mRNA levels. Briefly, SW1783 cells are plated in 96-well plates in Leibovitz’s L15 Medium (Gibco Invitrogen Ref. 11415-049) supplemented with 10% Fetal calf serum (Sigma) and 1% Pen / Strep, and transfected with (i) a modified siRNA, (ii) no siRNA for untreated control, (iii) a non-targeting negative control siRNA, or (iv) a positive control siRNA using Lipofectamine 2000 transfection agent (Invitrogen Thermo Fisher). After approximately 24 hours, RNA was isolated from the cells, and FDX2 mRNA levels are measured by specific branched DNA (bDNA) assay (Quantigene Singleplex). Results are presented as relative remaining FDX2-mRNA expression normalized to mean mRNA value in cells transfected with negative control siRNAs. The levels of FDX2 mRNA in untreated control cells (UTC) represents 0% inhibition, and an undetectable level of FDX2 mRNA represents 100% inhibition. A negative inhibition value means that the level of FDX2 mRNA detected was greater than that detected in untreated control cells.Example 2. FDX2 Screening of siRNAs (21mer / 19mer) targeting FDX2

[0306] siRNA comprising an antisense / sense sequence pairs were designed. In Table A antisense / sense sequence pairs are shown in the same row (e.g., the antisense sequence of SEQ ID NO: 9 and the sense sequence of SEQ ID NO: 76 form an antisense / sense sequence pair, etc.).

[0307] As shown in Table E, the modified antisense strand is 21 nucleotides in length, a sugar motif is (from 5’ to 3’) yfyyyfyffyyyyfyfyyyyy wherein each ‘y’ represents a 2’-OMe modified nucleotide and each ‘f represents a 2’-F modified nucleotide, and an internucleoside linkage motif is (from 5’ to 3’) ssooooooooooooooooss wherein each ‘o’ represents a phosphodiester internucleoside linkage and each ‘s’ represents a phosphorothioate internucleoside linkage. In some experiments, each cytosine residue is a non-methylated cytosine. In some experiments, each antisense strand has a terminal phosphate at the 5 ’-end. In some experiments, a modified antisense strand comprises an uracil “U” or a thymine “T” at the 5’ end (e.g., see FIG. 1). AsWSGR Docket No. 71197-703.601shown in Table E, the modified sense strand is 19 nucleotides in length, the sugar motif is (from 5’ to 3’) yyyyfyfffyyyyyyyyyy wherein each ‘y’ represents a 2’-0Me modified nucleotide and each ‘f represents a 2’-F modified nucleotide, and the intemucleoside linkage motif is (from 5’ to 3’) ssoooooooooooooooo wherein each ‘o’ represents a phosphodiester intemucleoside linkage and each ‘s’ represents a phosphorothioate intemucleoside linkage. In some experiments, each cytosine residue is a non-methylated cytosine. In some experiments, a modified sense strand comprises an adenine “A” at the 3’ end of sense strand (e.g., see FIG. 1).

[0308] The siRNAs were analyzed for their effects on target mRNA levels. The siRNAs were analyzed for their effects on target mRNA levels. Briefly, SW1783 cells are plated in 96-well plates in Leibovitz’s L15 Medium (Gibco Invitrogen Ref. 11415-049) supplemented with 10% Fetal calf serum (Sigma) and 1% Pen / Strep, and transfected with (i) a modified siRNA, (ii) no siRNA for untreated control, (iii) a non-targeting negative control siRNA, or (iv) a positive control siRNA using Lipofectamine 2000 transfection agent (Invitrogen Thermo Fisher). After approximately 24 hours, RNA is isolated from the cells, and FDX2 mRNA levels were measured by specific branched DNA (bDNA) assay (Quantigene Singleplex). Results are presented as relative remaining FDX2-mRNA expression normalized to mean mRNA value in cells transfected with negative control siRNAs. The levels of FDX2 mRNA in untreated control cells (UTC) represents 0% inhibition, and an undetectable level of FDX2 mRNA represents 100% inhibition. A negative inhibition value means that the level of FDX2 mRNA detected was greater than that detected in untreated control cells. Additional assays may be used to measure the potency and efficacy of these siRNAs.Example 3. Design of siRNAs (19mer / 19mer) targeting FDX2

[0309] siRNA were designed based on satisfying the following criteria:• 19-mer duplex fragments using the human FDX2 transcript (e.g., NCBI Accession No.NM_001397406.1),• no overlapping common SNPs (>=1% occurrence) as reported by dbSNP,• a predicted minimal self-folding (e.g., no more than about -5 kcal / mole), a predicted weak target self-folding (e.g., no more than about -10 kcal / mole, where the target included the binding site plus an additional 10 nt of flanking sequence), a predicted weak self-binding (e.g., no more than about -12 kcal / mole) and / or at least about -17 kcal / mole of net binding free energy between the antisense strand and its target, as determined by an Oligonucleotide Modeling Platform (e.g., an “OMP Developer Edition™”) under standard physiological conditions,• an intermediate GC content (e.g., at least about 20% to no more than about 80%),• zero (0) terminal runs of more three 3 G residues,WSGR Docket No. 71197-703.601• limited binding to an off-target site (e.g., 13-mer subsequences that are abundant in the human genome or transcriptome), and• cross species reactivity with human and monkey (e.g., rhesus and cynomolgus monkey) or human and mouse.

[0310] The base sequences for designed siRNA were kept as all-RNA; however, other chemical modification patterns could be used e.g., combinations of 2’-fluoro (2’-F) and 2’-O-methyl (OMe) -alternating 2’-F / 2’-OMe in each strand, with the antisense strand having 2’-F at the 2nd position and the sense strand having 2 ’-OMe at the position across from it. Designed siRNAs can also have two or more phosphorothioate linkages at each end of each strand to help protect from nucleases, a phosphate or vinylphosphonate at the 5’ end of the antisense strand to direct proper loading into RISC.

[0311] An exemplary set of siRNAs generated using this design method are further described in Examples 8 and 9.Example 4. FDX2 Screening of siRNAs (19mer / 19mer) targeting FDX2

[0312] siRNAs as described in Example 4 were synthesized and analyzed by the following methods.

[0313] The siRNAs were analyzed for their effects on target mRNA levels. Briefly, SW1783 cells are plated in 96-well plates in Leibovitz’s L15 Medium (Gibco Invitrogen Ref. 11415-049) supplemented with 10% Fetal calf serum (Sigma) and 1% Pen / Strep, and transfected with (i) an siRNA (e.g., a modified siRNA), (ii) no siRNA for untreated control, (iii) a non-targeting negative control siRNA, or (iv) a positive control siRNA using Lipofectamine 2000 transfection agent (Invitrogen Thermo Fisher). After approximately 24 hours, RNA is isolated from the cells, and FDX2 mRNA levels are measured by specific branched DNA (bDNA) assay (Quantigene Singleplex). Results are presented as relative remaining FDX2-mRNA expression normalized to mean mRNA value in cells transfected with negative control siRNAs. The levels of FDX2 mRNA in untreated control cells (UTC) represents 0% inhibition, and an undetectable level of FDX2 mRNA represents 100% inhibition. A negative inhibition value means that the level of FDX2 mRNA detected was greater than that detected in untreated control cells.Example 5: siRNA Library Design against Full-Length FDX2 mRNA Transcript

[0314] FIG.2 shows a flowchart of an exemplary in silico selection process of generating siRNAs against FDX2. Sequences of all siRNAs that can bind to FDX2, or a pre-determined region of FDX2, are collected to generate a starting set of siRNAs. From the starting set of FDX2 siRNAs, the first eliminating step may comprise eliminating one or more FDX2 siRNAs based on the criteria including, but not limited to, cross-reactivity with non-human primate FDX2 sequences, predicted secondary structure, predicting binding affinity, inclusion of knownWSGR Docket No. 71197-703.601toxic motifs, and predicted high off-target effects. The next selection step can be testing the siRNAs that are not eliminated in an initial dual dose in vitro screen. The top performing siRNAs from the dual dose screen are subjected to a dose-response potency assay, wherein each siRNA is evaluated for dose-responsiveness and consistency to generate its IC50 value to arrive at a set of selected siRNAs for further development and testing in clinical trials. Additional screening steps may include subjecting selected siRNAs to acute tolerability screens when the siRNAs are administered intracerebroventricularly to mice and / or in-depth off-target analysis.

[0315] Using such series of selection steps, 9 FDX2 siRNAs were selected from a starting set of over 6000 FDX2 siRNAs. The identified siRNA candidates shared common characteristics in their sequences. The identified siRNAs were 19 / 21-mer siRNAs.Table 2: siRNA SequencessiRNA Unmodified Sense Strand SEQ Unmodified Antisense Strand SEQ Identifier Sequence (5’-3’) ID Sequence (5’-3’) ID NO: NO:XD- UUGGAGCUGCAAUAAAUCA 130 UGAUUUAUUGCAGCUCCAAUA 63 96211XD- AGGAGUGGACUCAUAUUGA 129 UCAAUAUGAGUCCACUCCUAC 62 96210XD- AUGUGUAUGUGAGUGAAGA 101 UCUUCACUCACAUACACAUGG 33 96181XD- GCUGCCAGAUUGUGCUGAA 107 UUCAGCACAAUCUGGCAGCCC 40 96188XD- AUGAACACCUGGACCAUUA 114 UAAUGGUCCAGGUGUUCAUGU 47 96195XD- AAUCAGGGUUUGAGUAGGA 128 UCCUACUCAAACCCUGAUUCU 61 96209XD- AUUCCACAUUGCCAUGGCA 115 UGCCAUGGCAAUGUGGAAUGG 48 96196XD- AAGACCACCUGGAUCUCCA 101 UGGAGAUCCAGGUGGUCUUCA 34 96182XD- GAGUCGGGGACAAUGUUCA 94 UGAACAUUGUCCCCGACUCUG 2796175Example 6: Dual Dose Screen for siRNAs

[0316] A set of over 90 19 / 21-mer siRNAs (Table 3) were analyzed for their effects on target FDX2 mRNA levels.Table 3: siRNA sequencesSense Unmodified Sense Strand SEQ Unmodified Antisense Strand SEQ Strand Sequence (5’-3’) ID Sequence (5’-3’) ID Target NO: NO: Start SiteonNM 001397406.1382 CCACCUGGAUCUCCUGCCU 553 AGGCAGGAGAUCCAGGUGG 456520 CAAGAUCACCAGGAACUUC 585 GAAGUUCCUGGUGAUCUUG 488WSGR Docket No. 71197-703.601521 AAGAUCACCAGGAACUUCU 586 AGAAGUUCCUGGUGAUCUU 489 522 AGAUCACCAGGAACUUCUA 587 UAGAAGUUCCUGGUGAUCU 490 523 GAUCACCAGGAACUUCUAC 588 GUAGAAGUUCCUGGUGAUC 491 45 GCGUGAGUGCCAGGGUUCU 508 AGAACCCUGGCACUCACGC 411 46 CGUGAGUGCCAGGGUUCUA 509 UAGAACCCUGGCACUCACG 412 137 GGGACAACCAGAAAGUUUC 510 GAAACUUUCUGGUUGUCCC 413 138 GGACAACCAGAAAGUUUCA 511 UGAAACUUUCUGGUUGUCC 414 147 GAAAGUUUCAAGCGACAGG 513 CCUGUCGCUUGAAACUUUC 416 148 AAAGUUUCAAGCGACAGGC 514 GCCUGUCGCUUGAAACUUU 417 149 AAGUUUCAAGCGACAGGCU 515 AGCCUGUCGCUUGAAACUU 418 150 AGUUUCAAGCGACAGGCUC 516 GAGCCUGUCGCUUGAAACU 419 151 GUUUCAAGCGACAGGCUCG 517 CGAGCCUGUCGCUUGAAAC 420 152 UUUCAAGCGACAGGCUCGC 518 GCGAGCCUGUCGCUUGAAA 421 153 UUCAAGCGACAGGCUCGCG 519 CGCGAGCCUGUCGCUUGAA 422 154 UCAAGCGACAGGCUCGCGC 520 GCGCGAGCCUGUCGCUUGA 423 213 GGGACGUGGUGAACGUGGU 521 ACCACGUUCACCACGUCCC 424 214 GGACGUGGUGAACGUGGUG 522 CACCACGUUCACCACGUCC 425 215 GACGUGGUGAACGUGGUGU 523 ACACCACGUUCACCACGUC 426 219 UGGUGAACGUGGUGUUCGU 524 ACGAACACCACGUUCACCA 427 220 GGUGAACGUGGUGUUCGUA 525 UACGAACACCACGUUCACC 428 221 GUGAACGUGGUGUUCGUAG 526 CUACGAACACCACGUUCAC 429 223 GAACGUGGUGUUCGUAGAC 528 GUCUACGAACACCACGUUC 431 224 AACGUGGUGUUCGUAGACC 529 GGUCUACGAACACCACGUU 432 225 ACGUGGUGUUCGUAGACCG 530 CGGUCUACGAACACCACGU 433 226 CGUGGUGUUCGUAGACCGC 531 GCGGUCUACGAACACCACG 434 227 GUGGUGUUCGUAGACCGCU 532 AGCGGUCUACGAACACCAC 435 228 UGGUGUUCGUAGACCGCUC 533 GAGCGGUCUACGAACACCA 436 229 GGUGUUCGUAGACCGCUCA 534 UGAGCGGUCUACGAACACC 437 230 GUGUUCGUAGACCGCUCAG 535 CUGAGCGGUCUACGAACAC 438 231 UGUUCGUAGACCGCUCAGG 536 CCUGAGCGGUCUACGAACA 439 232 GUUCGUAGACCGCUCAGGC 537 GCCUGAGCGGUCUACGAAC 440 233 UUCGUAGACCGCUCAGGCC 538 GGCCUGAGCGGUCUACGAA 441 234 UCGUAGACCGCUCAGGCCA 539 UGGCCUGAGCGGUCUACGA 442 235 CGUAGACCGCUCAGGCCAG 540 CUGGCCUGAGCGGUCUACG 443 248 GGCCAGCGGAUCCCAGUGA 541 UCACUGGGAUCCGCUGGCC 444 250 CCAGCGGAUCCCAGUGAGU 542 ACUCACUGGGAUCCGCUGG 445 371 GUGAGUGAAGACCACCUGG 543 CCAGGUGGUCUUCACUCAC 446 372 UGAGUGAAGACCACCUGGA 544 UCCAGGUGGUCUUCACUCA 447 373 GAGUGAAGACCACCUGGAU 545 AUCCAGGUGGUCUUCACUC 448 374 AGUGAAGACCACCUGGAUC 546 GAUCCAGGUGGUCUUCACU 449 375 GUGAAGACCACCUGGAUCU 547 AGAUCCAGGUGGUCUUCAC 450 376 UGAAGACCACCUGGAUCUC 548 GAGAUCCAGGUGGUCUUCA 451 378 AAGACCACCUGGAUCUCCU 549 AGGAGAUCCAGGUGGUCUU 452 379 AGACCACCUGGAUCUCCUG 550 CAGGAGAUCCAGGUGGUCU 453 380 GACCACCUGGAUCUCCUGC 551 GCAGGAGAUCCAGGUGGUC 454 381 ACCACCUGGAUCUCCUGCC 552 GGCAGGAGAUCCAGGUGGU 455 409 GGAGAGGGAAGACGACAUG 554 CAUGUCGUCUUCCCUCUCC 457 410 GAGAGGGAAGACGACAUGC 555 GCAUGUCGUCUUCCCUCUC 458 411 AGAGGGAAGACGACAUGCU 556 AGCAUGUCGUCUUCCCUCU 459 412 GAGGGAAGACGACAUGCUA 557 UAGCAUGUCGUCUUCCCUC 460 413 AGGGAAGACGACAUGCUAG 558 CUAGCAUGUCGUCUUCCCU 461 414 GGGAAGACGACAUGCUAGA 559 UCUAGCAUGUCGUCUUCCC 462 415 GGAAGACGACAUGCUAGAC 560 GUCUAGCAUGUCGUCUUCC 463 416 GAAGACGACAUGCUAGACA 561 UGUCUAGCAUGUCGUCUUC 464420 ACGACAUGCUAGACAUGGC 562 GCCAUGUCUAGCAUGUCGU 465WSGR Docket No. 71197-703.601422 GACAUGCUAGACAUGGCCC 563 GGGCCAUGUCUAGCAUGUC 466 445 CCUCCAGGAGAACUCGCGG 564 CCGCGAGUUCUCCUGGAGG 467 446 CUCCAGGAGAACUCGCGGC 565 GCCGCGAGUUCUCCUGGAG 468 447 UCCAGGAGAACUCGCGGCU 566 AGCCGCGAGUUCUCCUGGA 469 448 CCAGGAGAACUCGCGGCUG 567 CAGCCGCGAGUUCUCCUGG 470 449 CAGGAGAACUCGCGGCUGG 568 CCAGCCGCGAGUUCUCCUG 471 450 AGGAGAACUCGCGGCUGGG 569 CCCAGCCGCGAGUUCUCCU 472 451 GGAGAACUCGCGGCUGGGC 570 GCCCAGCCGCGAGUUCUCC 473 452 GAGAACUCGCGGCUGGGCU 571 AGCCCAGCCGCGAGUUCUC 474 453 AGAACUCGCGGCUGGGCUG 572 CAGCCCAGCCGCGAGUUCU 475 454 GAACUCGCGGCUGGGCUGC 573 GCAGCCCAGCCGCGAGUUC 476 455 AACUCGCGGCUGGGCUGCC 574 GGCAGCCCAGCCGCGAGUU 477 456 ACUCGCGGCUGGGCUGCCA 575 UGGCAGCCCAGCCGCGAGU 478 492 AGCUGGAAGGAGCGGAAUU 576 AAUUCCGCUCCUUCCAGCU 479 493 GCUGGAAGGAGCGGAAUUC 577 GAAUUCCGCUCCUUCCAGC 480 494 CUGGAAGGAGCGGAAUUCA 578 UGAAUUCCGCUCCUUCCAG 481 495 UGGAAGGAGCGGAAUUCAC 579 GUGAAUUCCGCUCCUUCCA 482 496 GGAAGGAGCGGAAUUCACC 580 GGUGAAUUCCGCUCCUUCC 483 497 GAAGGAGCGGAAUUCACCC 581 GGGUGAAUUCCGCUCCUUC 484 498 AAGGAGCGGAAUUCACCCU 582 AGGGUGAAUUCCGCUCCUU 485 499 AGGAGCGGAAUUCACCCUG 583 CAGGGUGAAUUCCGCUCCU 486 500 GGAGCGGAAUUCACCCUGC 584 GCAGGGUGAAUUCCGCUCC 487 524 AUCACCAGGAACUUCUACG 589 CGUAGAAGUUCCUGGUGAU 492 525 UCACCAGGAACUUCUACGU 590 ACGUAGAAGUUCCUGGUGA 493 526 CACCAGGAACUUCUACGUG 591 CACGUAGAAGUUCCUGGUG 494 527 ACCAGGAACUUCUACGUGG 592 CCACGUAGAAGUUCCUGGU 495 528 CCAGGAACUUCUACGUGGA 593 UCCACGUAGAAGUUCCUGG 496 529 CAGGAACUUCUACGUGGAU 594 AUCCACGUAGAAGUUCCUG 497 661 AGGCCCGGGAGAGACGUGG 595 CCACGUCUCUCCCGGGCCU 498 662 GGCCCGGGAGAGACGUGGA 596 UCCACGUCUCUCCCGGGCC 499 663 GCCCGGGAGAGACGUGGAA 597 UUCCACGUCUCUCCCGGGC 500 664 CCCGGGAGAGACGUGGAAG 598 CUUCCACGUCUCUCCCGGG 501 665 CCGGGAGAGACGUGGAAGC 599 GCUUCCACGUCUCUCCCGG 502 666 CGGGAGAGACGUGGAAGCC 600 GGCUUCCACGUCUCUCCCG 503 667 GGGAGAGACGUGGAAGCCC 601 GGGCUUCCACGUCUCUCCC 504 793 UGAGUAGGAGUGGACUCAU 602 AUGAGUCCACUCCUACUCA 505 812 AUUGGAGCUGCAAUAAAUC 603 GAUUUAUUGCAGCUCCAAU 506 813 UUGGAGCUGCAAUAAAUCG 604 CGAUUUAUUGCAGCUCCAA 507 139 GACAACCAGAAAGUUUCAA 512 UUGAAACUUUCUGGUUGUC 415222 UGAACGUGGUGUUCGUAGA 527 UCUACGAACACCACGUUCA 430

[0317] Briefly, the siRNAs were analyzed for their effects on target mRNA levels. SW1783 cells were plated in 96-well plates in Leibovitz’s L15 Medium (Invitrogen, REF: 11415 - 049) supplemented with 10% fetal calf serum (Sigma) and 1% Pen / Strep, and were transfected with an siRNA, no siRNA (untreated control), non-targeting negative control siRNAs, and two positive control siRNAs using Lipofectamine™ 2000 transfection agent (Invitrogen, Thermo Fisher). After approximately 24 hours, RNA was isolated from the cells, and FDX2 mRNA levels were measured by specific branched DNA (bRNA) assay (Quantigene Singleplex) with GADPH used as the housekeeping gene for normalization. The results were presented as relative remaining FDX2-mRNA expression normalized to mean mRNA value in cells transfected withWSGR Docket No. 71197-703.601the negative control siRNA. The levels of FDX2 mRNA in untreated control cells (UTC) represents 0% inhibition, and an undetectable level of FDX2 mRNA represents 100% inhibition. A negative inhibition value means that the level of FDX2 mRNA detected was greater than that detected in untreated control cells.

[0318] First, to test whether transfection was successful, samples taken from the non-target negative control siRNA, which targets AHSA1, were analyzed for knockdown of AHSA1 mRNA levels. As shown in FIG. 3A, samples taken from cells treated with either 10 nM or 0.1 nM of the siRNA successfully reduced expression of AHSA1, indicating that transfection was successful.

[0319] To ensure that the non-targeting ASHA1 negative control siRNA specifically reduced AHSA1 expression, cells transfected with AHSA1 siRNA were analyzed for relative FDX2 mRNA expression. The AHSA1 siRNA did not exhibit major reductions in FDX1 mRNA levels, indicating that the non-targeting siRNA control did not affect FDX2 expression (FIG. 3B). Further, the mock control did not result in reduction in the FDX2 expression, suggesting that the transfection process itself did not reduce expression of the target gene (FIG. 3B).

[0320] After confirming successful transfection and expected performance of the controls, 67 exemplary siRNAs (Tables 4 A and 4B) selected based on criteria including, but not limited to, predicted off-target effects, were evaluated for FDX2 mRNA knockdown by measuring the expression level of FDX2 mRNA normalized to GADPH housekeeping gene expression (Table 5 and FIG. 4). It was found that 10 of the siRNAs exhibited greater than 80% reduction in FDX2 mRNA expression and 25 of the siRNAs exhibited greater than 50% reduction in FDX2 mRNA expression when administered at a dose of 10 nM (FIGs. 4-5). Further, it was observed that 6 siRNAs exhibited greater than 30% reduction of FDX2 mRNA when administered at a dose of 0.1 nM (FIG. 4).Table 4A: Unmodified siRNAs Tested in Dual Dose ScreensiRNA Sense Unmodified Sense Strand SEQ Unmodified Antisense Strand SEQ Identifier Strand Sequence (5’-3’) ID Sequence (5’-3’) ID Target NO: NO: StartSite onNM_001397406.1XD-96211 811 UUGGAGCUGCAAUAAAU 130 UGAUUUAUUGCAGCUCCAA 63CA UA XD-96210 796 AGGAGUGGACUCAUAUU 129 UCAAUAUGAGUCCACUCCUA 62GA C XD-96181 361 AUGUGUAUGUGAGUGAA 100 UCUUCACUCACAUACACAUG 33GA G XD-96188 466 GCUGCCAGAUUGUGCUG 108 UUCAGCACAAUCUGGCAGCC 40AA C XD-96195 571 AUGAACACCUGGACCAU 114 UAAUGGUCCAGGUGUUCAU 47UA GUWSGR Docket No. 71197-703.601781 AAUCAGGGUUUGAGUAG 128 UCCUACUCAAACCCUGAUUC 61 XD-96209 GA U526 CCAGGAACUUCUACGUG 111 UCCACGUAGAAGUUCCUGGU 44 XD-96192 GA G586XD-96196 AUUCCACAUUGCCAUGG 115 UGCCAUGGCAAUGUGGAAU 48CA GG376XD-96182 AAGACCACCUGGAUCUC 101 UGGAGAUCCAGGUGGUCUU 34CA CA271XD-96175 GAGUCGGGGACAAUGUU 94 UGAACAUUGUCCCCGACUCU 27CA G556 CCAAGCCCCACUGACAU 113 UCAUGUCAGUGGGGCUUGG 46 XD-96194 GA GG451 AGAACUCGCGGCUGGGC 106 UAGCCCAGCCGCGAGUUCUC 39 XD-96187 UA C676 121XD-96202 GGAAGCCCCUGUGAAGG UUCCUUCACAGGGGCUUCCA 54AA C691XD-96203 GGACAACACCCCUGCUU 122 UCAAGCAGGGGUGUUGUCC 55GA uu226XD-9617 UGGUGUUCGUAGACCGC 91 UAGCGGUCUACGAACACCAC 24 2 UA G661 GCCCGGGAGAGACGU 120 53 XD-96201 GG UUCCACGUCUCUCCCGGGCC AA u481XD-96189 UGACACCGGAGCUGGAA 108 UCUUCCAGCUCCGGUGUCAG 41GA c616XD-96 AUUGAGGGAAUAGCCAG 117 UCCUGGCUAUUCCCUCAAUC 50 198 GA U406XD- AGGAGAGGGAAGACGAC 103 UUGUCGUCUUCCCUCUCCUC 36 96184 AA G511XD CCCUGCCCAAGAUCACC 110 UUGGUGAUCUUGGGCAGGG 43 -96191 AA UG541 UGGAUGGCCAUGUCCCC 112 UUGGGGACAUGGCCAUCCAC 45 XD-96193 AA G496 AAGGAGCGGAAUUCACC 109 UGGGUGAAUUCCGCUCCUUC 42 XD-96190 CA C256XD-96174 UCCCAGUGAGUGGCAGA 93 UCUCUGCCACUCACUGGGAU 26GA C286 95XD-96176 UUCUUCACCUGGCCCAG UGCUGGGCCAGGUGAAGAA 28CA CA136XD-96166 GGACAACCAGAAAGUUU 85 UGAAACUUUCUGGUUGUCCC 18CA C346XD-96180 CCUGCUCCACCUGCCAU 99 UCAUGGCAGGUGGAGCAGG 32GA CC601 116XD-96197 GGCCCCAGGGCCCAGAU UAAUCUGGGCCCUGGGGCCA 49UA U721XD-96205 AUGUCCAGGCUCUGGUG 124 UCCACCAGAGCCUGGACAUG 57GA G766XD-96208 CCCCAGGCCCCUGAGAA 127 UAUUCUCAGGGGCCUGGGG 60UA AA421XD-96185 ACAUGCUAGACAUGGCC 104 UGGGCCAUGUCUAGCAUGUC 37CA G646XD-96200 CCAGAGUGCGGACAGGC 119 UGGCCUGUCCGCACUCUGGG 52CA C436XD-96186 CCCCCCUCCUCCAGGAG 105 UUCUCCUGGAGGAGGGGGG 38AA CC46XD-96160 UGAGUGCCAGGGUUCUA 79 UGUAGAACCCUGGCACUCAC 12CA G166 87XD-96168 CGCGCCCGGCUGGAGAG UCCUCUCCAGCCGGGCGCGA 20GA G241XD-96173 GCUCAGGCCAGCGGAUC 92 UGGAUCCGCUGGCCUGAGCG 25CA GWSGR Docket No. 71197-703.601XD-96167 151 UUCAAGCGACAGGCUCG 86 UGCGAGCCUGUCGCUUGAAA 19CA C XD-96178 316 ACCUGGAAGGGGCCUGU 97 UCACAGGCCCCUUCCAGGUC 30GA C XD-96179 331 GUGAAGCCUCCCUGGCC 98 UAGGCCAGGGAGGCUUCACA 31UA G XD-96222 976 GCGAGACCUCGUCUCUA 141 UAUAGAGACGAGGUCUCGCC 74UA A XD-96177 301 AGCGCCACGGGGUGGAC 96 UGGUCCACCCCGUGGCGCUG 29CA G XD-96223 992 AUAAAAACAGUAAAAAU 142 UAAUUUUUACUGUUUUUAU 75UA AG XD-96218 916 GGAAGCCAAGAUGGGAG 137 UCCUCCCAUCUUGGCUUCCC 70GA A XD-96199 631 AGGUGCCAGCCCUGCCC 118 UUGGGCAGGGCUGGCACCUG 51AA G XD-96165 121 AGGGGGUGGCGCUGGGG 84 UUCCCCAGCGCCACCCCCUC 17AA C XD-96212 826 AUCGAUAACACAGGCCC 131 UGGGGCCUGUGUUAUCGAU 64CA UU XD-96206 736 UGGGGACAGGGCCCCUA 125 UCUAGGGGCCCUGUCCCCAC 58GA C XD-96171 211 GGGACGUGGUGAACGUG 90 UCCACGUUCACCACGUCCCC 23GA G XD-96207 751 UAGUGGGGUGGCCUUCC 126 UGGGAAGGCCACCCCACUAG 59CA G XD-96204 706 UUGGGAGAGAGUCCCAU 124 UCAUGGGACUCUCUCCCAAG 56GA C XD-96157 1 GUCACGUGAUGCAUGUC 76 UUGACAUGCAUCACGUGACU 9AA C XD-96219 931 AGGAUCACUUGAGGCCA 138 UCUGGCCUCAAGUGAUCCUC 71GA C XD-96213 841 CCCAGCAUGUUGAGUGU 132 UGACACUCAACAUGCUGGGG 65CA C XD-96217 901 AAUCCUAGCACUUUGGG 136 UUCCCAAAGUGCUAGGAUU 69AA AC XD-96221 961 AUCCUGGGCAACAUGGC 140 UCGCCAUGUUGCCCAGGAUG 73GA G XD-96215 871 AUCUGGGGUCUACAGGU 134 UCACCUGUAGACCCCAGAUC 67GA U XD-96162 76 GGGGCACCUGGUGGAAC 81 UUGUUCCACCAGGUGCCCCU 14AA G XD-96214 856 GUCCUUGGGGGACAGAU 133 UGAUCUGUCCCCCAAGGACA 66CA C XD-96158 16 UCAUGGCCGCCUCCAUG 77 UCCAUGGAGGCGGCCAUGAC 10GA A XD-96161 61 UACUGCAGGCUGCCAGG 80 UCCCUGGCAGCCUGCAGUAG 13GA A XD-96216 886 GUGGCUCACACCUGUAA 135 UAUUACAGGUGUGAGCCACC 68UA U XD-96169 181 AGGAGGACGCGGGCGGC 88 UGGCCGCCCGCGUCCUCCUC 21CA uXD-96183 391 UCCUGCCUCCUCCCGAG 102 UCCUCGGGAGGAGGCAGGA 35GA GA XD-96170 196 GCCCGGAGCGGCCCGGG 89 UCCCCGGGCCGCUCCGGGCC 22GA G XD-96159 31 UGGCCCGGGGAGGCGUG 78 UUCACGCCUCCCCGGGCCAU 11AA G XD-96163 91 ACAGACCUGGGGGCACU 82 UAAGUGCCCCCAGGUCUGUU 15UA CWSGR Docket No. 71197-703.601106 CUUCCGGGUCGGGGGAG 83 UCCUCCCCCGACCCGGAAGU 16 XD-96164GA G946XD-96 CAGGAGCUUAAGACCAU 139 UGAUGGUCUUAAGCUCCUG 72 220CA GCTable 4B: Modified siRNAs Tested in Dual Dose ScreensiRNA Unmodified Sense Strand SEQ Unmodified Antisense Strand SEQ Identifier Sequence (5’-3’) ID Sequence (5’-3’) ID NO: NO:XD- ususggAfgCfUfGfcaauaaauca 659 usGfsauuUfaUfUfgcagCfuCfcaasusa 726 96211XD- asgsgaGfuGfGfAfcucauauuga 658 usCfsaauAfuGfAfguccAfcUfccusasc 725 96210XD- asusguGfuAfUfGfugagugaaga 629 usCfsuucAfcUfCfacauAfcAfcausgsg 696 96181XD- gscsugCfcAfGfAfuugugcugaa 636 usUfscagCfaCfAfaucuGfgCfagcscsc 703 96188XD- asusgaAfcAfCfCfuggaccauua 643 usAfsaugGfuCfCfagguGfuUfcausgsu 710 96195XD- asasucAfgGfGfUfuugaguagga 657 usCfscuaCfuCfAfaaccCfuGfauuscsu 724 96209XD- cscsagGfaAfCfUfucuacgugga 640 usCfscacGfuAfGfaaguUfcCfuggsusg 707 96192XD- asusucCfaCfAfUfugccauggca 644 usGfsccaUfgGfCfaaugUfgGfaausgsg 711 96196XD- asasgaCfcAfCfCfuggaucucca 630 usGfsgagAfuCfCfagguGfgUfcuuscsa 697 96182XD- gsasguCfgGfGfGfacaauguuca 623 usGfsaacAfuUfGfucccCfgAfcucsusg 690 96175XD- cscsaaGfcCfCfCfacugacauga 642 usCfsaugUfcAfGfugggGfcUfuggsgsg 709 96194XD- asgsaaCfuCfGfCfggcugggcua 635 usAfsgccCfaGfCfcgcgAfgUfucuscsc 702 96187XD- gsgsaaGfcCfCfCfugugaaggaa 650 usUfsccuUfcAfCfagggGfcUfuccsasc 717 96202XD- gsgsacAfaCfAfCfcccugcuuga 651 usCfsaagCfaGfGfggugUfuGfuccsusu 718 96203XD- usgsguGfuUfCfGfuagaccgcua 620 usAfsgcgGfuCfUfacgaAfcAfccascsg 687 96172XD- gscsccGfgGfAfGfagacguggaa 649 usUfsccaCfgUfCfucucCfcGfggcscsu 716 96201XD- usgsacAfcCfGfGfagcuggaaga 637 usCfsuucCfaGfCfuccgGfuGfucasgsc 704 96189XD- asusugAfgGfGfAfauagccagga 646 usCfscugGfcUfAfuuccCfuCfaauscsu 713 96198XD- asgsgaGfaGfGfGfaagacgacaa 632 usUfsgucGfuCfUfucccUfcUfccuscsg 699 96184XD- cscscuGfcCfCfAfagaucaccaa 639 usUfsgguGfaUfCfuuggGfcAfgggsusg 706 96191XD- usgsgaUfgGfCfCfauguccccaa 641 usUfsgggGfaCfAfuggcCfaUfccascsg 708 96193XD- asasggAfgCfGfGfaauucaccca 638 usGfsgguGfaAfUfuc...

Claims

WSGR Docket No. 71197-703.601CLAIMSWhat is claimed is:

1. A modified double-stranded inhibitory oligonucleotide comprising an antisense strand and a sense strand, wherein the antisense strand has at least or about 80%, at least or about 85%, at least or about 90%, at least or about 95%, at least or about 98%, or about 100% identical to a reverse complementary sequence of nucleobases of positions 45-64, 136-184, 214-304, 331-400, 406-634, 646-709, 721-739, 766-831, 916-934, or 961- 994from the 5’ end of SEQ ID NO: 1.

2. A modified double-stranded inhibitory oligonucleotide comprising an antisense strand and a sense strand, wherein the antisense strand comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of a reverse complementary sequence of nucleobases of positions 45-64, 136-184, 214-304, 331-400, 406-634, 646-709, 721-739, 766-831, 916- 934, or 961-994from the 5’ end of SEQ ID NO: 1.

3. The modified double-stranded inhibitory oligonucleotide of claim 1 or 2, wherein:the antisense strand comprises about 12 to about 30 linked nucleosides and having a nucleobase sequence comprising about 8 to about 19 consecutive nucleobases of any one of the nucleobase sequences of SEQ ID NOs: 9-75, 143-209, 277-343, 411-507, or 1007-1103; andthe sense strand comprises about 12 to about 30 linked nucleosides and having a nucleobase sequence comprising about 8 to about 19 consecutive nucleobases of any one of the nucleobase sequences of SEQ ID NOs: 76-142, 210-276, 344-410, 508-604, or 1104-1200.

4. A modified double-stranded inhibitory oligonucleotide comprising an antisense strand and a sense strand, wherein:the antisense strand comprises about 12 to about 30 linked nucleosides and having a nucleobase sequence comprising about 8 to about 19 consecutive nucleobases of any one of the nucleobase sequences of SEQ ID NOs: 9-75, 143-209, 277-343, 411-507, or 1007-1103; andthe sense strand comprises about 12 to about 30 linked nucleosides and having a nucleobase sequence comprising about 8 to about 19 consecutive nucleobases of any one of the nucleobase sequences of SEQ ID NOs: 76-142, 210-276, 344-410, 508-604, or 1104-1200.WSGR Docket No. 71197-703.6015. The modified double-stranded inhibitory oligonucleotide of claim 3 or 4, wherein the antisense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleobases of any one of the nucleobase sequences of SEQ ID NOs: 9-75, 143-209, 277-343, 411- 507, or 1007-1103, with no more than 1, 2, or 3 mismatches.

6. The modified double-stranded inhibitory oligonucleotide of any one of claims 1-5, wherein the antisense strand comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identity to any one of SEQ ID NOs: 9-75, 143-209, 277-343, 411-507, or 1007- 1103.

7. The modified double-stranded inhibitory oligonucleotide of claim 6, wherein the antisense strand consists of any one of the nucleobase sequences of SEQ ID NOs: 9-75, 143-209, 277-343, 411-507, or 1007-1103.

8. The modified double-stranded inhibitory oligonucleotide of claim 3 or 4, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleobases of any one of the nucleobase sequences of SEQ ID NOs: 76-142, 210-276, 344-410, 508- 604, or 1104-1200, with no more than 1, 2, or 3 mismatches9. The modified double-stranded inhibitory oligonucleotide of any one of claims 1-8, wherein the sense strand comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identity any one of SEQ ID NOs: 76-142, 210-276, 344-410, 508-604, or 1104- 1200.

10. The modified double-stranded inhibitory oligonucleotide of claim 9, wherein the sense strand consists of any one of the nucleobase sequences of SEQ ID NOs: 76-142, 210- 276, 344-410, 508-604, or 1104-1200.

11. The modified double-strand inhibitory oligonucleotide of any one of claims 1-10, wherein the antisense sense strand consists of 19 to 23 nucleosides.

12. The modified double-stranded inhibitory oligonucleotide of any one of claim 1-11, wherein the sense strand consists of 19 to 21 nucleosides.

13. The modified double-stranded inhibitory oligonucleotide of any one of claims 1-12, wherein the modified double-stranded inhibitory oligonucleotide is a small interfering RNA (siRNA).WSGR Docket No. 71197-703.60114. The modified double-stranded inhibitory oligonucleotide of any one of claims 1-13, wherein the double-stranded oligonucleotide comprises at least one modified sugar moiety, at least one modified internucleoside linkage, or at least one modified nucleobase.

15. The modified double-stranded inhibitory oligonucleotide of claim 14, wherein the antisense strand and the sense strand each independently comprise one or more modified sugar moieties selected from a 2’-F sugar moiety, a 2’-0Me sugar moiety, and a 2’-M0E sugar moiety, or a sugar surrogate selected from 2’ -deoxy, UNA, and GNA.

16. The modified double-stranded inhibitory oligonucleotide of claim 15, wherein the antisense strand comprises 21 nucleosides, and wherein the antisense strand is modified with a modification pattern (5’ to 3’) of yfyyyfyffyyyyfyfyyyyy, wherein each ‘y’ represents a 2’-0Me modified nucleotide and each ‘f represents a 2’-F modified nucleotide.

17. The modified double-stranded inhibitory oligonucleotide of claim 15 or 16, wherein the sense strand comprises 19 nucleosides, and wherein the sense strand is modified with a modification pattern (5’ to 3’) of yyyyfyfffyyyyyyyyyy, wherein each ‘y’ represents a 2’- OMe modified nucleotide and each ‘f represents a 2’-F modified nucleotide.

18. The modified double-stranded inhibitory oligonucleotide of any one of claims 14-17, wherein the antisense strand or the sense strand comprise at least one modified internucleoside linkage.

19. The modified double-stranded inhibitory oligonucleotide of claim 18, wherein the at least one modified internucleoside linkage is a phosphorothioate intemucleoside linkage, a phosphorodi thioate internucleoside linkage, a mesyl phosphoramidate intemucleoside linkage, a phosphotriester intemucleoside linkage, or a methoxypropyl phosphonate intemucleoside linkage.

20. The modified double-stranded inhibitory oligonucleotide of claim 19, wherein the antisense strand comprises 21 nucleosides, and wherein the antisense strand has an internuclsoside linkage motif (5’ to 3’) of ssooooooooooooooooss, wherein each ‘o’ represents a phosphodiester intemucleoside linkage and each ‘s’ represents a phosphorothioate intemucleoside linkage.WSGR Docket No. 71197-703.60121. The modified double-stranded inhibitory oligonucleotide of claim 19 or 20, wherein the sense strand comprises 19 nucleosides, and wherein the sense strand has an internucleoside linkage motif (5’ to 3’) of ssoooooooooooooooo, wherein each ‘o’ represents a phosphodiester internucleoside linkage and each ‘s’ represents a phosphorothioate intemucleoside linkage.

22. The modified double-stranded inhibitory oligonucleotide of any one of claims 14-21, wherein the antisense strand comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleobases selected from SEQ ID NOs: 672-738, 873-1006, or 1298- 1394.

23. The modified double-stranded inhibitory oligonucleotide of any one of claims 14-22, wherein the sense strand comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleobases selected from SEQ ID NOs: 605-671, 739-872, or 1201- 1297.

24. The modified double-stranded inhibitory oligonucleotide of any one of claims 14-23, wherein the antisense strand comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identity to any one of SEQ ID NOs: 672-738, 873-1006, or 1298-1394.

25. The modified double-stranded inhibitory oligonucleotide of claim 24, wherein the antisense strand consists of any one of SEQ ID NOs: 672-738, 873-1006, or 1298-1394.

26. The modified double-stranded inhibitory oligonucleotide of any one of claims 14-25, wherein the sense strand comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identity to any one of SEQ ID NOs: 605-671, 739-872, or 1201-1297.

27. The modified double-stranded inhibitory oligonucleotide of claim 26, wherein the sense strand consists of any one of SEQ ID NOs: 605-671, 739-872, or 1201-1297.

28. A pharmaceutical composition comprising the modified double-stranded inhibitory oligonucleotide of any one of claims 1-27 and a pharmaceutically acceptable excipient.

29. The pharmaceutical composition of claim 28, wherein the pharmaceutical composition is formulated for intravenous administration, subcutaneous administration, intramuscular administration, intrathecal administration, intracerebroventricular administration, parenteral administration, oral administration, nasal administration, or rectaladministration.WSGR Docket No. 71197-703.60130. A method for inhibiting FDX2 expression in a subject, the method comprising:providing the modified double-stranded inhibitory oligonucleotide of any one of claims 1-27 or the pharmaceutical composition of claim 28 or 29; and administering the modified double-stranded inhibitory oligonucleotide to the subject, wherein the modified double-stranded inhibitory oligonucleotide reduced a quantity of an mRNA transcript of human FDX2.

31. The method of claim 30, wherein the modified double-stranded inhibitory oligonucleotide mediates RNA interference against the mRNA transcript of human FDX2.

32. A method of treating, preventing, alleviating a symptom of, or ameliorating a disorder associated with a mutation in an FXN gene in a subject in need thereof, the method comprising:providing the modified double-stranded inhibitory oligonucleotide of any one of claims 1-27 or the pharmaceutical composition of claim 28 or 29; and administering the modified double-stranded inhibitory oligonucleotide to the subject, wherein the modified double-stranded inhibitory oligonucleotide mediates RNA interference against an mRNA transcript of human FXN and thereby treats the disorder.

33. The method of claim 32, wherein the disorder associated with the mutation in the FXN gene is Friedreich’s Ataxia.