Methods and agents for assessing and promoting microvascularization

WO2026199076A1PCT designated stage Publication Date: 2026-10-01VAL CHUM
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/CA2026/050464
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-03-26
Filing Date
2026-03-25
Publication Date
2026-10-01

Smart Images

  • Figure CA2026050464_01102026_PF_FP_ABST
    Figure CA2026050464_01102026_PF_FP_ABST
Patent Text Reader

Abstract

Microvascular dysfunction has a wide array of clinical presentations, ranging from ischemic heart disease to renal failure, stroke, blindness, pulmonary arterial hypertension, and dementia. Unfortunately, the lack of clinically reliable biomarkers of microvascular injury or dysfunction is a major roadblock for assessing and preventing microvascular rarefaction in patients. Also, currently, there are no medications that can effectively treat and prevent microvascular diseases. The present application discloses methods for treating a microvascular disease and / or dysfunction in a subject based on the administration of miR-423-5p, let-7b-5p, let- 7a-5p, miR-30a-3p and / or let-7c-5p miRNA or RNA interfering agent mimicking one or more of these miRNAs. The present application discloses methods for assessing the risk of suffering from a microvascular disease or dysfunction by measuring the levels of at least one of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and / or let-7c-5p miRNA in a sample.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] METHODS AND AGENTS FOR ASSESSING AND PROMOTING MICROVASCULARIZATION CROSS REFERENCE TO RELATED APPLICATIONS

[0002] The present application claims the benefit of U.S. provisional patent application serial No. 63 / 777,825, filed on March 26, 2025, which is incorporated herein by reference in its entirety.

[0003] SEQUENCE LISTING

[0004] A sequence listing is submitted herewith as an XML file named G 12810-00919_Seq Listing. xml, created on March 23, 2026, and having a size of ~ 12073 bytes. The content of the aforementioned file is hereby incorporated by reference in its entirety.

[0005] TECHNICAL FIELD

[0006] The present disclosure generally relates to the field of microvascularization, and more specifically to methods and agents for assessing and treating microvascular diseases and microvascular dysfunction.

[0007] BACKGROUND ART

[0008] Microvascular dysfunction describes a varied set of conditions which includes vessel destruction, abnormal vasoreactivity, in situ thrombosis, and fibrosis which ultimately results in tissue damage and progressive organ failure. Microvascular dysfunction has a wide array of clinical presentations, ranging from ischemic heart disease to renal failure, stroke, blindness, pulmonary arterial hypertension, and dementia. Endothelial dysfunction, capillary rarefaction, microcirculatory obstruction due to microthrombi and microemboli, microvascular remodeling, and impaired autoregulation are fundamental pathophysiological mechanisms common to microvascular dysfunction across various organs. These mechanisms lead to diverse clinical manifestations. For instance, cerebral small vessel disease affects the microvasculature of the leptomeninges and the deep perforating branches of the anterior, middle, and posterior cerebral arteries. Clinically, this type of microvascular dysfunction presents as stroke, cognitive impairment, cerebral amyloid angiopathy, vascular dementia, depression, and anxiety. It is the primary cause of lacunar stroke and contributes to up to 45% of dementia cases. The retina is unique in that its blood vessels can be directly observed, providing significant insight into the pathophysiological changes of the microvasculature. Intimal inflammation and fibrosis, edema, neovascularization, and capillary degeneration lead to retinopathy and associated vision loss. Finally, in the lungs, pulmonary arterial hypertension, caused by vascular remodeling, vasoconstriction, and in situ thrombosis, results in increased pulmonary vascular resistance, progressive right heart failure, and ultimately, death. Chronic kidney disease (CKD) ischaracterized by capillary bed destruction, abnormal vasoreactivity, hypertension and fibrosis, resulting in progressive renal damage.

[0009] Renal ischemia-reperfusion injury (IRI) is an important cause of both acute kidney injury (AKI) and progressive chronic kidney disease (CKD) (1-7). IRI is an integral component of organ transplantation, and severe IRI in the perioperative transplantation setting can result in posttransplantation AKI which manifests as delayed graft function, i.e., partial or complete incapacity of the kidney allograft to resume function after transplantation (8). The long-term impact of IRI on kidney function has been a matter of debate in the field of transplantation, as some, but not all, episodes of delayed graft function are associated with permanent reduction in graft function. Mounting evidence from different laboratories demonstrates that the degree of microvascular injury associated with AKI is a central prognostic factor for development of long-term kidney dysfunction (9-11).

[0010] In kidney transplant recipients, loss of peritubular capillaries (PTCs) in the first months after transplantation is closely associated with fibrosis, progressive loss of renal function and reduced allograft survival (9, 10). Animal models of renal IRI have demonstrated an association between the severity of microvascular rarefaction and long-term loss of renal function (6, 11-14). Activation of caspase-3, the major effector of apoptosis, in PTCs after AKI has been implicated in microvascular rarefaction and progressive loss of renal function (13, 15). It has been shown that caspase-3-deficient mice exposed to renal IRI show increased tubular epithelial injury in the acute phase of AKI but preservation of microvascular integrity at all stages. In the long term, this translates into reduced renal fibrosis and prevention of long-term kidney dysfunction (16, 17). Collectively, these results in animal models and in cohorts of kidney transplant patients highlight the central importance of microvascular injury and rarefaction in the pathophysiology of progressive kidney dysfunction after IRI.

[0011] Unfortunately, the lack of clinically reliable biomarkers of microvascular injury is a major roadblock for assessing and preventing microvascular rarefaction in patients. Also, currently, there are no medications that can specifically target the endothelial and amongst medication that have pleiotropic effects of potential benefit to the endothelium (e.g., ACE, ARBs, statins, SGLT-2) the lack of diagnostic tools prevent the monitoring of their impact on the microvasculature in an individualised fashion.

[0012] The present description refers to a number of documents, the content of which is herein incorporated by reference in their entirety.

[0013] SUMMARY OF THE INVENTION

[0014] In various aspects and embodiments, the present disclosure provides the following items 1 to 53:

[0015] 1. A method for treating a microvascular disease and / or microvascular dysfunction in a subject comprising administering to the subject an effective amount of at least one of the followingRNA interfering agents: (i) miR-423-5p microRNA (miRNA), a precursor thereof, or another RNA interfering agent binding to the same mRNAtarget(s) as miR-423-5p miRNA; (ii) let-7b-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNAtarget(s) as let-7b-5p miRNA; (iii) let-7a-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as let-7a-5p miRNA; (iv) let-7c-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as let-7c-5p miRNA; and (v) miR-30a-3p, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as miR-30a-3p miRNA.

[0016] 2. The method of item 1 , wherein the method comprises administering an effective amount of at least two or at least three of (i) to (v).

[0017] 3. The method of item 1 , wherein the method comprises administering an effective amount of (i), (ii) and (iv).

[0018] 4. The method of any one of items 1 to 3, wherein the RNA interfering agent binding to the same mRNA target(s) as miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p or let-7c-5p miRNA is a small interfering RNA (siRNA) or an antisense oligonucleotide (ASO).

[0019] 5. The method of item 4, wherein the siRNA or ASO comprises at least 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p or let-7c-5p miRNA.

[0020] 6. The method of item 5, wherein the siRNA or ASO comprises the nucleotide sequence of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p or let-7c-5p miRNA.

[0021] 7. The method of any one of items 1 to 6, wherein the method comprises administering an effective amount of miR-423-5p miRNA or a precursor thereof, preferably miR-423-5p miRNA.

[0022] 8. The method of any one of items 1 to 7, wherein the method comprises administering an effective amount of let-7b-5p miRNA or a precursor thereof, preferably let-7b-5p miRNA.

[0023] 9. The method of any one of items 1 to 8, wherein the method comprises administering an effective amount of let-7c-5p miRNA or a precursor thereof, preferably let-7c-5p miRNA.

[0024] 10. The method of any one of items 1 to 9, wherein the RNA interfering agent(s) is / are encapsulated in vesicles.

[0025] 11. The method of item 10, wherein the vesicles are lipid nanoparticles (LNPs).

[0026] 12. The method of any one of items 1 to 11, wherein the RNA interfering agent(s) is / are formulated in a pharmaceutical composition comprising one or more pharmaceutically acceptable excipients or carriers, or a cosmetic composition comprising one or more cosmetically acceptable excipients or carriers.

[0027] 13. The method of any one of items 1 to 12, wherein the microvascular disease and / or microvascular dysfunction is subsequent to an organ transplantation and / or to ischemia.

[0028] 14. The method of item 13, wherein the wherein the organ is kidney, heart or lung15. The method of any one of items 1 to 14, wherein the microvascular disease and / or microvascular dysfunction is a kidney microvascular disease or dysfunction.

[0029] 16. The method of item 15, wherein the subject suffers from acute kidney injury (AKI) or chronic kidney disease (CKD).

[0030] 17. The method of item 14 or 15, wherein the subject is a kidney transplant recipient.

[0031] 18. A method for preserving or improving microvascular density, or preventing microvascular rarefaction, in a body part from a subject, the method comprising administering to the subject an effective amount of at least one of the RNA interfering agents defined in any one of items 1 to 12.

[0032] 19. The method of item 17, wherein the body part is an organ, for example kidney, heart, skin or lung.

[0033] 20. The method of item 19, wherein the kidney is a transplanted kidney.

[0034] 21. The method of item 18, wherein the organ is skin.

[0035] 22. The method of item 21 , wherein the method reduces or alleviates skin aging.

[0036] 23. Use of at least one of the RNA interfering agents defined in any one of items 1 to 12 for the manufacture of a medicament for treating a microvascular disease and / or microvascular dysfunction in a subject.

[0037] 24. The use of item 23, wherein the microvascular disease and / or microvascular dysfunction is subsequent to an organ transplantation and / or to ischemia.

[0038] 25. The use of item 24, wherein the organ is kidney, heart or lung.

[0039] 26. The use of item 24 or 25, wherein the microvascular disease and / or microvascular dysfunction is a kidney microvascular disease or dysfunction.

[0040] 27. The use of item 26, wherein the subject suffers from acute kidney injury (AKI) or chronic kidney disease (CKD).

[0041] 28. The use of item 26 or 27, wherein the subject is a kidney transplant recipient.

[0042] 29. Use of at least one of the RNA interfering agents defined in any one of items 1 to 12 for the manufacture of a medicament or cosmetic product for preserving or improving microvascular density, or preventing microvascular rarefaction, in a body part from a subject.

[0043] 30. The use of item 29, wherein the body part is an organ, for example kidney, heart, skin or lung.

[0044] 31. The use of item 30, wherein the organ is a kidney.

[0045] 32. The use of item 31 , wherein the kidney is a transplanted kidney.

[0046] 33. The use of item 30, wherein the organ is skin.

[0047] 34. The use of item 33, wherein the cosmetic product reduces or alleviates skin aging.

[0048] 35. A method for assessing the risk of suffering from a microvascular disease or dysfunction, and / or for detecting microvascular injury, in a subject, the method comprising (a) measuring the levels of at least one of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and let-7c-5p in a biological sample from the subject; (b) comparing the measured levels of miR-423-5p, let-7b-5p, let-7a-5p,miR-30a-3p and / or let-7c-5p to a reference level; and (c) assessing the risk of suffering from a microvascular disease or dysfunction based on the comparison, wherein a low level of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and / or let-7c-5p is indicative of an increased risk of suffering from a microvascular disease or dysfunction and / or of the presence of microvascular injury. 36. The method of item 35, wherein the method comprises measuring the levels of at least two or at least three of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and let-7c-5p in the biological sample.

[0049] 37. The method of item 36, wherein the method comprises measuring the levels of miR-423-5p, let-7b-5p, and let-7c-5p in the biological sample.

[0050] 38. The method of any one of items 35 to 37, wherein the reference level is a corresponding level or standard established based on miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and / or let-7c-5p in subjects not suffering from a microvascular disease or dysfunction, or not at risk of suffering from a microvascular disease or dysfunction, and wherein a lower miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and / or let-7c-5p levels measured in a sample from subject relative to the control level is indicative that the subject is suffering from a microvascular disease or dysfunction, or is at risk of suffering from a microvascular disease or dysfunction.

[0051] 39. The method of any one of items 35 to 38, further comprising administering a suitable therapy against the microvascular disease, dysfunction or injury if the subject is identified as having an increased risk of suffering from a microvascular disease or dysfunction and / or as having microvascular injury.

[0052] 40. The method of item 39, wherein the therapy comprises the method defined in any one of items 1 to 12.

[0053] 41. A method for monitoring the course of treatment of a subject suffering from a microvascular disease or dysfunction, the method comprising: (a) determining a first level of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and / or let-7c-5p in a biological sample from said subject; wherein an increase in the level relative to a corresponding level determined in a corresponding biological sample obtained from said subject at an earlier time is indicative that said patient is responsive to said treatment, and wherein an absence of change or a decrease in said first level relative to a corresponding level determined in a corresponding biological sample obtained from said subject at an earlier time is indicative that said patient is not responsive to said treatment.

[0054] 42. The method of item 41, wherein the method comprises measuring the levels of at least two or at least three of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and let-7c-5p in the biological sample.

[0055] 43. The method of item 42, wherein the method comprises measuring the levels of miR-423-5p, let-7b-5p, and let-7c-5p in the biological sample.

[0056] 44. The method of any one of items 35 to 43, wherein the microvascular disease and / or microvascular dysfunction is subsequent to an organ transplantation and / or to ischemia.45. The method of any one of items 35 to 44, wherein the microvascular disease and / or microvascular dysfunction is a kidney microvascular disease or dysfunction.

[0057] 46. The method of item 45, wherein the subject suffers from acute kidney injury (AKI) or chronic kidney disease (CKD).

[0058] 47. The method of item 45 or 46, wherein the subject is a kidney transplant recipient.

[0059] 48. The method of any one of items 35 to 47, wherein the biological sample is a biological fluid.

[0060] 49. The method of item 47, wherein the biological fluid is plasma or serum.

[0061] 50. The method of any one of items 35 to 49, wherein the biological sample comprises extracellular vesicles (EVs).

[0062] 51. A method to follow-up the condition of a subject suffering from a microvascular disease or dysfunction, the method comprising determining a first level of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and / or let-7c-5p in a serum or plasma sample, and / or in a large extracellular vesicle (microvesicle) sample from said subject; wherein an increase in said first level relative to a corresponding level determined in a corresponding serum, plasma and / or large extracellular vesicle sample obtained from said subject at an earlier time is indicative that said patient condition has improved, and wherein a decrease in said first level relative to a corresponding level determined in a corresponding serum, plasma and / or large extracellular vesicle sample obtained from said subject at an earlier time is indicative that said patient condition has deteriorated. 52. A kit or package comprising (a) means or reagents useful for determining the level of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and / or let-7c-5p in a biological sample (b) instructions setting forth the method of any one of items 35 to 52.

[0063] 53. A combination or composition comprising at least two of the RNA interfering agents defined in any one of items 1 to 12.

[0064] Other objects, advantages and features of the present invention will become more apparent upon reading of the following non-restrictive description of specific embodiments thereof, given by way of example only with reference to the accompanying drawings.

[0065] BRIEF DESCRIPTION OF DRAWINGS

[0066] In the appended drawings:

[0067] FIGs. 1A-1K show the specific microRNA signature of apoptotic exosome-like vesicles (ApoExos) produced by endothelial cells in vitro. FIG. 1A: Apoptosis in HUVECs exposed to normal medium (N) or serum-starved (SS) for 4 h is expressed as the percentage of apoptotic cells ± SEM, along with caspase-3 activity. Scale bar: 200 pm. P values obtained by unpaired t test (* P < 0.05, ** P < 0.01), n = 3 for each condition. Western blots show protein markers in large (50,000xg) and small (200,000 xg) extracellular vesicles (EVs) purified from media conditioned by serum-starved HUVECs. Apoptotic bodies (ApoBodies) and ApoExos are recovered from large and small vesicle fractions, respectively (n = 8). MW expressed in kDa. FIG. 1B: Principalcomponent analysis (PCA) using small RNAs in ApoBodies (50,000xg-SS) and ApoExos (200,000xg-SS) from SS HUVEC media and small RNAs from cells under normal (HUVEC_N) or pro-apoptotic serum-starved (HUVEC_SS) conditions; n = 2. FIG. 1C: Enrichment network of biological process GO terms. Visualisation of GO terms with a P value < 0.05 using Reduced + Visualized Gene Ontology (Revigo) software. P value and observed frequency of the GO term are represented by the color and size of the circles, respectively. The strongest GO term pairwise similarities are designated as edges in the network. FIG. 1D: Heatmap of small RNA in ApoExos, ApoBodies and HUVEC_N or HUVEC_SS; n = 2. FIG. 1E: MiRNA in small and large EV fractions derived from apoptotic HUVECs (small EVs. ApoExos, large EVs ApoBodies) or healthy HUVECs (small EVs normal exosomes - ExoN, large EVs normal microvesicles - MVs). MiRNA expression was measured by qRT-PCR presented as relative copy expression per ng of RNA ± SEM after normalization to cel-miR-39; n = 5-8 biological replicates from separate EV preparations. FIG. 1F: Representative immunoblots of CD82, SDCBP, LG3 and 20S proteasome in large (centrifugation at 50,000 xg) and small (centrifugation at 200,000 x g) EV fractions purified from endothelial cells under normal condition for 4 h. FIG. 1G: Evaluation by Hoescht 33342 and Propidium iodide (HO / PI) staining of apoptosis in renal tubular epithelial cells serum-starved (SS) for 48 h. P value was obtained by one sample t test (*** P < 0.001), n = 9. Representative immunoblots of SDCBP, 20S proteasome, LG3, and histone H3C1 in large (centrifugation at 50,000 x g) and small (centrifugation at 200,000 x g) EV fractions purified from apoptotic renal tubular epithelial cells serum starved for 48 h. FIG. 1H: MiR-423-5p, let-7b-5p and let-7c-5p expression in large and small EV fractions derived from apoptotic endothelial cells or apoptotic renal tubular epithelial cells. Expression of miRNAs was measured by quantitative RT-PCR and the result is presented as relative copies expression of miRNA per ng of RNA ± SEM after normalization with cel-miR-39; n = 3. P values obtained by one-way ANOVA and the Bonferroni post hoc test (* P < 0.05, ** P < 0.01). FIGs. 1 l-K: Selective enrichment of miR-30a-3p in apoptotic exosomes and induction of its overexpression in endothelial cells. FIG. 11: RNA sequencing analysis (n=2). FIG. 1J: RT-qPCR analyses (n=3-7). FIG. 1K: miR-30a-3p expression in endothelial cells treated with ApoExos for 24 h (n=3). P values were obtained using a two-tailed Student’s t-test (*, P < 0.05).

[0068] FIGs. 2A-2K show the assessment of renal injury, circulating extracellular vesicles and circulating microRNA levels after renal IRI in mice. FIG. 2A: Blood urea nitrogen (BUN) concentration in mice at baseline, 1, 2, 7, or 21 days after renal ischemia-reperfusion injury (IRI); n = 9-10. FIG. 2B: Top: Hematoxylin and eosin (H&E)-stained corticomedullary junction at 2 days post-IRI. Arrow head: Rouleaux formation. Bottom: Rouleaux formation expressed as the number of erythrocytes within peritubular capillaries (PTC) per high-power field (HPF) in corticomedullary junction; n = 4-5. FIG. 2C: Top: Cleaved caspase-3 immunohistochemistry in corticomedullary junction presurgery and at 2 days post-IRI. Bottom: Quantification of cleaved caspase-3-positivePTC in renal sections; n = 5-6. FIG.2D: Top: MECA-32 immunohistochemistry in corticomedullary junction presurgery and at 21 days post- IRI . Bottom: Quantification of MECA-32-positive PTC per tubule in corticomedullary junction; n = 3-5. FIG. 2E: Quantification of CellTrace (CT) + Annexin (AnV) + Proteasome (LWA) + extracellular vesicles (100-1000 nm) by small particle flow cytometry (n = 4-12) and proteasome caspase-like activity in exosome-like vesicles (n = 6-18) from serum. FIG. 2F: Quantification of miR-423-5p and let-7b-5p serum levels; n = 5-14. Mean ± SEM. FIG. 2G: Quantification of miR-423-5p and let-7b-5p serum levels in wild-type mice at baseline. Serum was treated or not with RNase A (0.025 mg / mL) with or without Triton X-100 (0.1 %) for 20 min at 37 °C; n = 3. Expression of miRNAs is presented as relative copies of miRNAs per pL of total serum ± SEM. FIG. 2H: Quantification of let-7c-5p serum levels pre-surgery or 2-, 7- and 21 -days post-IRI. Let-7c-5p was measured by quantitative RT-PCR, and the result is presented as relative copy expression of miRNA per pL of total serum ± SEM after normalization with cel-miR-39; n > 5. Values are the mean ± SEM. P values were obtained by one-way ANOVA and Bonferroni post hoc test. FIG. 2I: Correlation matrix of miRNAs mouse serum levels. P values were obtained by Spearman correlation. P value and rare represented in the heatmap by value and color respectively. FIG. 2J: Quantification of miR-361-5p serum levels pre-surgery or 2-, 7-and 21-days post-IRI. MiR-361-5p was measured by quantitative RT-PCR, and the results are presented as relative copy expression of miRNA per pL of total serum ± SEM after normalization with cel-miR-39; n > 4. Values are the mean ± SEM. FIG. 2K: Quantification of let-7c-5p serum levels in wild-type mice at baseline. Serum was treated or not with RNase A (0.025 mg / mL) with or without Triton™ X-100 (0.1 %) for 20 min at 37 °C. Expression of let-7c-5p was measured by quantitative RT-PCR and the result is presented as relative copies of miRNA per pL of total serum ± SEM. n = 3 for each condition. P values obtained by one-way ANOVA and the Bonferroni (FIG.

[0069] 2A-F), Tukey (FIG. 2G), or ANOVA and Tukey (FIG. 2K) post hoc test (* P < 0.05, ** P < 0.01 , ***, P < 0.001, ****, P < 0.0001).

[0070] FIGs. 3A-3L show that at a distance from IRI, lower miR-423-5p serum levels correlate with more severe microvascular rarefaction and renal fibrosis. FIG. 3A: MECA-32 immunohistochemistry (Left panel) and Sirius Red staining (Right panel) in corticomedullary junction at 21 days in sham mice or 21 days after 30-min and 60-min IRI. Quantification of MECA-32-positive PTC (Left panel) and Sirius Red-positive area within PTC (Right panel) in corticomedullary junction at 21 days in sham mice or 21 days after 30-min and 60-min IRI; n = 3-5. FIG. 3B: MiR-423-5p serum levels at baseline or 1, 2, 7 and 21 days after 30-min and 60-min IRI or in 21 days sham mice. Expression of miR-423-5p measured by qRT-PCR, and presented as relative copies of miR-423-5p per pL of total serum ± SEM after normalization with cel-miR-39; n = 3-23. FIG. 3C: MiR-423-5p serum levels at 21 days after sham surgery or 30-min and 60-min IRI correlated with microvascular density (Rho = 0.7802; P = 0.0025) and inversely correlated with collagen deposition (Rho = -0.8626; P = 0.0003). FIG. 3D: Immunoblots and quantificationof different protein markers in large (50,000 x g) and small (200,000 x g) extracellular vesicles (EVs) from mouse serum at baseline and 1 and 21 days post-IRI. MECA-32 for endothelial-derived EVs, 20S proteasome and LG3 for apoptotic exosome-like vesicles, p-actin for EV marker and CD82 forexosome marker, n = 3-10. FIG. 3E: Distribution of miR-423-5p expression in large (50,000 x g) and small EVs (200,000 x g) from the serum of mice at baseline and 2 and 21 days after 30 min of IRI; n = 5 for each fraction. Values are mean ± SEM. FIG. 3F: Blood urea nitrogen (BUN) concentration in mice at baseline or 1, 2, 7, or 21 days after 30-min (IR30) and 60-min (IR60) renal ischemia-reperfusion injury (IRI); n = 5 for each condition. FIG. 3G: Quantification of miR-423-5p serum levels pre-surgery or 1-, 2-, 7- and 21-days post IRI. MiR-423-5p was measured by quantitative RT-PCR, and the result is presented as relative copy expression of miRNA per pL of total serum ± SEM after normalization with cel-miR-39; n > 6. Values are the mean ± SEM. FIG.3H: Quantification ofcleaved caspase-3-positive peritubular capillaries (PTCs) in renal sections at baseline, 1 - and 2-days post-surgery in mice that underwent 30 min or 60 min or renal artery clamping; n > 3. Representative images of cleaved caspase-3 immunohistochemistry in renal sections (corticomedullary junction) pre-surgery and at 1-day post-IRI. Scale bar: 50 pm FIG. 3I: Quantification of phosphorylated Receptor-interacting serine / threonine-protein kinase 3 (RIPK3)-positive peritubular capillaries (PTCs) in renal sections at baseline, 1- and 2-days post-surgery in mice that underwent 30 min or 60 min of renal artery clamping; n > 3. Representative images of pRIPK3 immunohistochemistry in renal sections (corticomedullary junction) at baseline and 1-day post-IRI. P values compared to baseline (time 0) [*] or between IR30 and IR60 [#]. Scale bar: 50 pm FIG. 3J: Mean tubular injury scores often randomly chosen high-power fields in renal cortical sections at baseline and 2 days post-IRI in mice that underwent 30 min and 60 min IRI or 2 days post-sham operation with contralateral nephrectomy. Representative haematoxylin and eosin (H&E) stained renal sections showing tubular injury, n = 3-6 for each condition. Scale bar: 50 pm. FIG. 3K: Quantification of miR-423-5p serum levels at baseline, 2 days after the sham operation with contralateral nephrectomy, and at 2 and 21 days following the sham operation without contralateral nephrectomy. The expression of miR-423-5p was measured by quantitative RT-PCR, and the result is presented as relative copies of miR-423-5p per pL of total serum ± SEM after normalization with cel-miR-39; n > 3. FIG.

[0071] 3L: Representative immunoblots of different protein markers in large (centrifugation at 50,000 x g) and small (centrifugation at 200,000 x g) extracellular vesicles purified from mouse serum at baseline and 2 days post-sham operation with contralateral nephrectomy. MECA-32 is a marker of endothelial-derived extracellular vesicles, 20S proteasome and LG3 are markers of apoptotic exosome-like vesicles, p-actin is a general marker of extracellular vesicles and CD82 is an exosome marker, n = 3. P values obtained by one-way ANOVA and the Bonferroni post hoc test (* P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001).FIGs. 4A-4E show that serum levels of miR-423-5p 21 days after renal ischemiareperfusion injury (IRI) are independent of caspase-3 activation. FIG. 4A: Kaplan-Meier survival curves of wild-type (WT) or caspase-3 knockout (Casp-3 - / -) mice that underwent 30 min or 60 min of renal artery clamping; n > 23. P values were obtained by log-rank test (** P < 0.01). FIG.

[0072] 4B: Quantification of miR-423-5p serum levels 21 days after 60-min renal artery clamping in WT or Casp-3 - / - mice. Expression of miR-423-5p was measured by quantitative RT-PCR and the result is presented as relative copies of miR-423-5p per pL of total serum ± SEM after normalization with cel-miR-39. FIG.4C: Quantification of MECA-32-positive peritubular capillaries (PTC) per tubule with representative images of MECA-32 immunohistochemistry in renal sections (corticomedullary junction) 21 days after 60 of renal artery clamping in WT or Casp-3 - / - mice. Scale bar: 50 pm. FIG. 4D: Quantification of Sirius Red within PTC areas in the corticomedullary junction of renal sections in WT or Casp-3 - / - mice 21 days after renal artery clamping for 60 min IRI with representative images of Sirius Red staining; n = 5. P values were obtained by unpaired t test (* P < 0.05, “ P < 0.01, *** P < 0.001, **** P < 0.0001). Scale bar: 50 pm. FIG. 4E: Left'. Evaluation by Hoescht 33342 and Propidium iodide (HO / PI) staining of apoptosis in HUVECs in normal or serum-starved condition and treated with the pan-caspase inhibitor zVAD-Fmk (ZVAD) or vehicle (Ctrl) for 4 h. P values were obtained by one-way ANOVA and the Bonferroni post hoc test (** P < 0.01, **** P < 0.0001), n = 3. Right MiR-423-5p expression in small extracellular vesicle fractions derived from apoptotic endothelial cells (ApoExo) or in large extracellular vesicle fractions derived from healthy endothelial cells (MVs) treated with ZVAD or its vehicle (Ctrl) for 4 h. The expression of miRNAs was measured by quantitative RT-PCR, and the results are presented as the relative copy expression of miRNA per mL of supernatant ± SEM after normalization to cel-miR-39; n = 3. P values were obtained by unpaired t test (* P < 0.05).

[0073] FIGs. 5A-5J show that MiR-423-5p serum levels predict microvascular rarefaction and fibrosis in human renal transplant patients. FIG. 5A: Left’. CD34 immunohistochemistry in renal allograft biopsies performed 3-9 months post-transplantation from patients with high or low peritubular capillary (PTC) densities. Middle’. MiR-423-5p serum levels in renal transplant patients with delayed graft function (DGF) at one-month post-transplantation correlate with the PTC density on the post-transplantation biopsy (Rho = 0.33; P = 0.02); n = 51. FIG.5B: Left’. Masson’s trichrome staining of renal allograft biopsy performed 3-9 months post-transplantation from two different patients with high and low interstitial fibrosis. Right. miR-423-5p serum levels in DGF patients at one month post-transplantation inversely correlate with fibrosis based on the posttransplantation biopsy (Rho = -0.28; P = 0.054); n = 51. FIG. 5C: PTC density (Rho = 0.37, P = 0.008) and fibrosis (p = -0.30, P = 0.04) on the 3-9-month post-transplantation biopsy are both associated with the estimated glomerular filtration rate (eGFR) at 3 years post-transplantation in patients with DGF. (for FIGs.5A-C, P and Rho values obtained by Pearson correlation coefficient; n = 51). FIG. 5D: Immunoblots and quantification of different protein markers in large (50,000 xg) and small (200,000 x g) extracellular vesicles (EVs) from the serum of three randomly chosen DGF patients at 8-9 days and one-month post-transplantation. PECAM1: endothelial marker; 20S proteasome and LG3: apoptotic exosome-like vesicle markers; p-actin: general EV marker; CD81 : exosome marker; n = 3. P values obtained by unpaired t tests (* P < 0.05). FIG. 5E: Distribution of miR-423-5p expression in the fractions of large (50,000 xg) and small (200,000 xg) EVs from the serum of six patients with delayed DGF at 8-10 days and one-month post-transplantation; n = 6. FIG. 5F: The correlation matrix of miRNAs serum levels, measured in total serum from transplanted patients, was analyzed. P values were obtained by Spearman correlation, and the correlation coefficient (r) is represented by a heatmap. FIG. 5G: Expression levels of miR-423-5p, let-7b-5p and let-7c-5p in total serum and extracellular vesicles purified from the same amount of patients’ serum; n = 5-6. FIG. 5H: Distribution of miR-423-5p in natural logarithm among the delayed graft function (DGF) patients; n = 51. FIG. 5I: Relative distribution of miR-423-5p expression in large EV fraction (centrifugation at 50,000 xg) and small EV fraction (centrifugation at 200,000 xg) from the serum of six randomly chosen DGF patients at 8-10 days and one-month post-transplantation; n = 6. MiR-423-5p serum level was measured by quantitative RT-PCR and normalized with cel-miR-39. FIG.5J: Summary of enrollment strategy for the cohort study in renal transplant patients.

[0074] FIGs. 6A-6E show that MiR-423-5p injection attenuates microvascular injury and fibrogenesis after acute kidney injury. Mice were treated by renal subcapsular injection with miR-423-5p or with a scrambled miR mimic control (Ctrl) following 30 min of renal artery ischemiareperfusion injury (IRI). FIG. 6A: Left’. Representative images of cleaved caspase-3 immunohistochemistry and hematoxylin and eosin (H&E)-stained renal sections 2 days post-IRI. Right. Quantification ofcleaved caspase-3-positive peritubular capillaries (PTC) and erythrocytes in PTCs in murine renal sections (corticomedullary junction) 2 days post-IRI per high-power field (HPF); n = 4-6. Arrow: Cleaved caspase-3-positive PTC, arrowhead: erythrocytes in PTC. FIG.

[0075] 6B: Left’. Representative images of MECA-32 immunohistochemistry and Sirius Red staining within peritubular capillaries (PTCs) in renal sections (corticomedullary junction) 21 days post-IRI. Right. Quantification of MECA-32-positive PTCs per tubule and Sirius Red-positive area (pm2) within PTCs in murine renal sections (corticomedullary junction) at 21 days post-IRI; n = 4-6. FIG.

[0076] 6C: Total (Left) or sectioned Right) renal expression of miR-423-5p following subcapsular injection of Ctrl ormiR-423-5p mimics 2 days post-surgery. Expression of miR-423-5p in the whole kidney (Left) or in the four kidney sections (Q1-4) Right), was measured by quantitative RT-PCR and the result is presented as expression fold change ± SEM. Each quadrant corresponds to a portion of the kidney obtained through cross-sectional cuts. P value was obtained by unpaired t test (Left) and by one-way ANOVA and the Bonferroni post hoc test (* P < 0.05, ** P < 0.01 , *** P < 0.001), n > 4. FIG. 6D: Blood urea nitrogen (BUN) concentration at baseline or 2, 7, 14 and 21 days after 30-min renal ischemia-reperfusion injury (IRI) in mice with subcapsular injection ofCtrl or miR-423-5p mimics. P value was obtained by one-way ANOVA and the Bonferroni post hoc test (* P < 0.05); n > 4 for each condition. FIG. 6E: Mean tubular injury scores often randomly chosen high-power fields in mice renal cortical sections at 2 days post-IRI from mice that underwent 30 min IRI with subcapsular injection of Ctrl or miR-423-5p mimics. P values were obtained by unpaired t test (* P < 0.05, ** P < 0.01) between the miR-423-5p and Ctrl groups.

[0077] FIGs. 7A-7E show that expression of miR-423-5p drives a distinct protein signature in endothelial cells. FIG. 7A: Heatmap representation of the differentially expressed proteins in endothelial cells transfected with scrambled miR mimic control (Ctrl) or miR-423-5p (10 nM). n = 3. FIG. 7B: Volcano plot of quantitative proteomics data from endothelial cells transfected with either Ctrl or miR-423-5p mimics. The plot displays the significantly differentially expressed proteins identified through proteomics analysis. Proteins are ranked in the volcano plot according to their statistical P value (y-axis) as -log 10 and their relative abundance ratio (Iog2) between miR-423-5p and control samples (x-axis). The cutoffs for significant changes are a fold change (FC) of ±1 and a P value of < 0.05. Red spots represent the upregulated proteins in miR-423-5p-transfected cells, green spots show the downregulated proteins in miR-423-5p-transfected cells, orange spots indicate the up- or downregulated proteins with -1 < FC < 1, P < 0.05, and gray spots show the unregulated proteins between both groups. FIG. 7C: Enrichment analyses for Biological processes and WikiPathways were conducted for proteins that were upregulated and downregulated in endothelial cells transfected with the miR-423-5p mimic compared to the control. FIG. 7D: Endothelial cells were transfected with Ctrl or miR-423-5p mimics (10 nM). Fortyeight hours post-transfection, miR-423-5p expression was measured by quantitative RT-PCR and presented as relative copies expression of miR-423-5p ± SEM after normalization with cel-miR-39; n = 3. FIG. 7E: Endothelial cells were transfected with Ctrl or miR-423-5p mimics (10 nM). The expression of HIF1A and VEGFA mRNAs was measured by quantitative RT-PCR 48 h posttransfection. The results are presented as the relative expression of mRNA compared to cells transfected with mimic Ctrl (Ctrl) ± SEM after normalization with HPRT1; n = 6 for each condition. P values were obtained by unpaired t test (* P < 0.05, ** P < 0.01).

[0078] FIGs. 8A-8E show that MiR-423-5p protects endothelial cells from apoptosis and promotes endothelial migration and angiogenesis. FIG. 8A: Immunoblot and densitometric analysis of cleaved PARP1 in endothelial cells transfected with scrambled miR mimic control (Ctrl) or miR-423-5p mimics (10 nM) and exposed to normal medium (N) or serum starvation (SS) for 4 h. a-tubulin was used as a loading control; n = 2-3. FIG. 8B: Quantification of caspase-3 activity in endothelial cells transfected with Ctrl or miR-423-5p mimics (10 nM) exposed to N or SS for 4 h. n = 3. FIG. 8C: Endothelial cells transfected with Ctrl or miR-423-5p mimics and: (top) mechanically injured and percentage of open wound areas at 0 h was measured with TScratch software. Data are shown as % of the open wound area, (bottom) Capillary-like structures were quantified after 6 h on Matrigel. Angiogenic activity is assessed by quantifying the number ofnodes, junctions and segment length per field ± SEM. n = 4 for each condition. P values obtained by unpaired t-test. Scale bar: 200 pm. FIG. 8D: Endothelial cells transfected with scrambled miR mimic control (Ctrl) or miR-423-5p mimics (10 nM) were mechanically injured, and wound closure was followed over a 6 h period. The wound healing assay results are expressed as the percentage of wound closure ± SEM. n = 4 for each condition. Representative pictures at 6 h post-injury are presented. FIG. 8E: Endothelial cells were transfected with scrambled miR mimic control (Ctrl) or miR-423-5p mimics (10 nM), and capillary-like structures were quantified after 6 h on Matrigel. Angiogenic activity was assessed by quantifying the number of segments per field ± SEM. n = 4 for each condition. Representative images of tubule formation are presented in the right panel. P values were obtained by one-way ANOVA and the Bonferroni post hoc test (* P < 0.05, ** P < 0.01, **** P < 0.0001).

[0079] FIGs. 9A-9C show that MiR-423-5p increases neovascularization after hindlimb ischemia. FIG.9A: Expression of miR-423-5p in ischemic muscle following intramuscular injection of Ctrl or miR-423-5p mimics at 3 days post-surgery. Expression of miR-423-5p was measured by quantitative RT-PCR and the result is presented as expression fold change ± SEM. P value was obtained by unpaired t test (** P < 0.01); n = 3. FIG. 9B: Representative results at 7 days post-surgery and quantification by laser Doppler imaging of blood flow in the hindlimb of mice after femoral arteriectomy in mice treated with miR-423-5p or with a scrambled miR mimic control; n = 6-17 per time point. FIG. 9C: Representative images of CD34 immunohistochemistry and quantification of the capillary-to-muscle fiber ratio in ischemic muscles of different groups at 21 days post-surgery; n = 8-9 for each group. P values were obtained by unpaired t test (* P < 0.05, **** p < 0.0001) between the miR-423-5p and Ctrl groups.

[0080] FIGs. 10A-10D show circulating levels of miR-423-5p, miR-122-5p, let-7b-5p, let-7c-5p, miR-451a, and miR-361-5p in mice following renal ischemia reperfusion. FIG. 10A: Quantification of murine serum levels of miR-423-5p, miR-122-5p, let-7b-5p, let-7c-5p, miR-451a, and miR-361-5p before surgery or 2, 7, and 21 days after renal ischemia-reperfusion by clamping of the renal artery. The miRs were measured by quantitative RT-PCR, and the results are presented as relative miRNA copy expression per pL of total serum ± SEM after normalization with cel-miR-39; n = 5. Values are mean ± SEM. FIG. 10B: Correlation matrix of serum miRNA levels in mice. P-values were obtained by Spearman correlation and r is represented by the heat map. FIG. 10C-D: Quantification of circulating serum level of let-7b-5p (C) and let-7c-5p (D) before surgery or 21 days after renal ischemia-reperfusion by clamping of the renal artery. Let-7b-5p and let-7c-5p were measured by quantitative RT-PCR, and the results are presented as relative miRNA copy expression per pL of total serum ± SEM after normalization with cel-miR-39; n = 5-10. P-values were obtained by Student's t-test (two-tailed) (*, P < 0.05, ** P < 0.01).

[0081] FIGs. 11 A-11 D show the impact of age on caspase-3 activation in peritubular capillaries, microvascular rarefaction, and serum level of miR-423-5p in young (8-12 weeks) and aged (6months and 1 year) mice. FIG. 11 A: Quantification of cleaved caspase-3 positive peritubular capillaries in renal sections; n = 15. FIG. 11B: Quantification of MECA-32 positive peritubular capillaries (murine endothelial marker) per tubule in the corticomedullary junction; n = 4-5. FIG.

[0082] 11C: Quantification ofa-SMA positive peritubular capillaries (fibrosis marker) per high-power field (HPF) in the corticomedullary junction; n = 4-5. FIG. 11D: Quantification of circulating serum level of miR-423-5p; n > 5. P-values obtained by one-way ANOVA and Bonferroni post hoc test (* P < 0.05, ** P < 0.01 , ***, P < 0.001 , ****, P < 0.0001).

[0083] FIG. 12 shows caspase-3 activation in cardiac and pulmonary capillaries in young (8-12 weeks) and aged (6 months) mice. Quantification of cleaved caspase-3 positive capillaries in heart and lung sections; n = 10. P-values obtained by Student's t-test (two-tailed) (***, P < 0.001).

[0084] FIGs. 13A-13C show circulating levels of miR-423-5p, miR-122-5p, let-7a-5p, let-7b-5p, miR-30a-3p and let-7c-5p in kidney transplant patients with significant ischemia-reperfusion at the time of transplantation (manifested by delayed graft function). The circulating levels of the different miRs one-month post-transplant are correlated with each other. FIG. 13A shows a correlation matrix of serum miRNA levels. P-values were obtained by Pearson correlation and r is represented by the heat map. FIG. 13B shows circulating serum levels of miR-423-5p and miR-30a-3p at 1-month post-transplant. P values and Rho (r) were obtained using Pearson correlation; n=16. FIG. 13C shows the serum levels of miR-423-5p and let-7a-5p in patients who underwent kidney transplantation and exhibited delayed graft function (DGF) one month after transplantation correlate with the microvascular density in renal peritubular capillaries on the post-transplant biopsy performed between 3-9 months; n = 56.

[0085] FIG. 14 shows circulating levels of miR-423-5p in kidney transplant patients with severe vascular rejection or without rejection (Tolerant) at the time of biopsy. Vascular rejection was defined according to the Banff classification, which includes both microvascular and macrovascular damage. Microvascular damage was classified as acute antibody-mediated rejection, while macrovascular damage was categorized as T-cell mediated rejection with a Banff classification score of > 2. P-value obtained by Student's t-test (two-tailed) (*, P < 0.05).

[0086] FIGs. 15A-15B show an inverse correlation between the age of normal individuals (living kidney donors) and circulating plasma level of miR-423-5p. FIG. 15A: Quantification of circulating plasma level of miR-423-5p in living donors before donation according to the donor's age; n = 46.

[0087] FIG. 15B: Quantification of circulating plasma level of miR-423-5p in male living donors before donation according to the donor's age; n = 21. P-values and Rho were obtained by Pearson correlation.

[0088] FIG. 16 shows the quantification by laser Doppler imaging of blood flow in the hind limb of mice after femoral arteriectomy in mice treated with a plasmid expressing PCSK5 mRNA or with a control plasmid; n = 6-16. P-values obtained by Student's t-test (two-tailed) (*, P < 0.05; **, P < 0.01).FIGs. 17A-17C show the impact of the combination of microRNAs with miR-423-5p on migration, angiogenesis, and apoptotic cell death of endothelial cells. Endothelial cells were transfected with a combination of miR-423-5p (10 nM), let-7b-5p (10 nM), let-7c-5p (10 nM), and control miR (10 nM) to achieve a total concentration of 30 nM. FIG.17A: wound was mechanically-generated and wound closure was monitored over a period of 6 hours; n = 6. The wound healing results are expressed as a percentage of wound closure ± SEM. FIG. 17B: Capillary-like structures were quantified after 6 hours on extracellular matrix (Matrigel™). Angiogenic activity was assessed by quantifying the number of segments per field ± SEM; n = 7. FIG. 17C: Caspase-3 activity in endothelial cells exposed to normal or pro-apoptotic conditions (serum deprivation) for 4 hours; n = 7.

[0089] FIG. 17D shows the impact of combining miR-30a-3p with miR-423-5p on endothelial cell angiogenesis. Endothelial cells were transfected with a combination of miR-423-5p (10 nM), miR-30a-3p (10 nM), and control miR (10 nM) to achieve a total concentration of 30 nM. Capillarylike structures were quantified after 6 hours on extracellular matrix (Matrigel™). Angiogenic activity was assessed by quantifying the number of segments per field ± SEM; n = 10. P-values were obtained using one-way ANOVA and Bonferroni post hoc test (*P < 0.05, ****P < 0.0001).

[0090] FIGs. 18A-B depict graphs showing the association between serum levels of miR-423-5p in total serum, small extracellular vesicles and large extracellular vesicles present in the serum one month post-transplant in a cohort of kidney transplant patients (n=54), and microvascular density in renal peritubular capillaries (FIG. 18A) and fibrosis (FIG. 18B, top panels) on the posttransplant biopsy performed between 3-9 months, as well as with renal function 1-year (FIG. 18B, middle panels) and 3-year (FIG. 18B, lower panels) post-transplant. P-values and Rho were obtained by Pearson correlation.

[0091] FIGs. 19A-C are graphs showing caspase-3 activation in alveolar capillaries, microvascular rarefaction, and plasma level of miR-423-5p in a mouse model of acute lung injury by bleomycin instillation. FIG. 19A: Quantification of alveolar capillaries positive for cleaved caspase-3 in lung sections; n = 5. FIG. 19B: Quantification of alveolar capillaries positive for MECA-32 (murine endothelial marker) per analyzed region; n = 4-5. FIG. 19C: Quantification of circulating plasma levels of miR-423-5p; n = 13. P-values were obtained by Student's t-test (two-tailed) (*P < 0.05, ***P < 0.001).

[0092] FIG. 20 is a graph showing circulating plasma levels of miR-423-5p in a myocardial ischemia-reperfusion model. Wild-type mice (C57BL / 6, n = 3-5) underwent a transient 30-minute ischemia of the left anterior descending coronary artery followed by reperfusion up to 21 days. The P-value was obtained using Student's t-test (two-tailed) (**P < 0.01).

[0093] DISCLOSURE OF INVENTION

[0094] The use of the terms "a" and "an" and "the" and similar referents in the context of describing the technology (especially in the context of the following claims) are to be construedto cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.

[0095] The terms "comprising", "having", "including", and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to") unless otherwise noted.

[0096] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context.

[0097] The use of any and all examples, or exemplary language (“e.g.”, "such as") provided herein, is intended merely to better illustrate embodiments of the claimed technology and does not pose a limitation on the scope unless otherwise claimed.

[0098] No language in the specification should be construed as indicating any non-claimed element as essential to the practice of embodiments of the claimed technology.

[0099] Herein, the term "about" has its ordinary meaning. The term “about” is used to indicate that a value includes an inherent variation of error for the device or the method being employed to determine the value, or encompass values close to the recited values, for example within 10% of the recited values (or range of values).

[0100] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All subsets of values within the ranges are also incorporated into the specification as if they were individually recited herein.

[0101] Where features or aspects of the disclosure are described in terms of Markush groups or list of alternatives, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member, or subgroup of members, of the Markush group or list of alternatives.

[0102] Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in stem cell biology, cell culture, molecular genetics, immunology, immunohistochemistry, protein chemistry, and biochemistry).

[0103] Unless otherwise indicated, the molecular biology, cell culture, and immunological techniques utilized in the present disclosure are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), T. A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D. M. Glover and B. D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F. M. Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-lnterscience (1988, including all updates untilpresent), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, (1988), and J. E. Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates until present).

[0104] In the studies described herein, the present inventors have demonstrated that a specific set of microRNAs including miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and let-7c-5p are highly expressed in endothelial apoptotic exosome-like vesicles released in circulation during the early phase of acute kidney injury (AKI) after renal IRI as a model of microvascularization disease / dysfunction. In the long term, caspase-3-independent large EVs produced at least in part by endothelial cells contribute to circulating miR-423-5p levels, which are positively correlated with renal microvascular density and negatively correlated with renal fibrosis. It is also shown that administration of miR-423-5p permits to prevent long-term microvascular rarefaction and fibrosis after renal IRI, and increases doppler flow rate recovery and the number of CD34+ capillaries in a model of femoral arteriectomy, thus providing compelling evidence that these miRNAs may be useful for the prevention and / or treatment of microvascular diseases and microvascular dysfunction.

[0105] Prevention and / or treatment of microvascular diseases or dysfunction

[0106] Accordingly, in a first aspect, the present disclosure provides a method for treating a microvascular disease and / or dysfunction in a subject, the method comprising administering to the subject an effective amount of (i) miR-423-5p microRNA (miRNA), a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as miR-423-5p miRNA; (ii) let-7b-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as let-7b-5p miRNA; (iii) let-7c-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as let-7c-5p miRNA; (iv) let-7a-5p, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as let-7a-5p; (v) miR-30a-3p, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as miR-30a-3p miRNA; or (vi) any combination of (i) to (v). The present disclosure also provides the use of (i) miR-423-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as miR-423-5p miRNA; (ii) let-7b-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as let-7b-5p miRNA; (iii) let-7c-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as let-7c-5p miRNA; (iv) let-7a-5p, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as let-7a-5p; (v) miR-30a-3p, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as miR-30a-3p miRNA; or (vi) any combination of (i) to (v), for treating a microvascular disease and / or dysfunction, or for the manufacture of a medicament for treating a microvascular disease and / or dysfunction, in a subject. The present disclosure also provides an agent for use in the treatmentof a microvascular disease and / or dysfunction in a subject, the agent comprising: (i) miR-423-5p microRNA (miRNA), a precursor thereof, or another RNA interfering agent binding to the same mRNAtarget(s) as miR-423-5p miRNA; (ii) let-7b-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNAtarget(s) as let-7b-5p miRNA; (iii) let-7c-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNAtarget(s) as let-7c-5p miRNA; (iv) let-7a-5p, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as let-7a-5p; (v) miR-30a-3p, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as miR-30a-3p miRNA; or (vi) any combination of (i) to (v).

[0107] In another aspect, the present disclosure provides a method for preserving or improving microvascular density, or preventing microvascular rarefaction, in a body part (e.g., tissue or organ) from a subject, the method comprising administering to the subject an effective amount of (i) miR-423-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNAtarget(s) as miR-423-5p miRNA; (ii) let-7b-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNAtarget(s) as let-7b-5p miRNA; (iii) let-7c-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNAtarget(s) as let-7c-5p miRNA; (iv) let-7a-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as let-7a-5p miRNA; (v) miR-30a-3p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNAtarget(s) as miR-30a-3p miRNA; or (vi) any combination of (i) to (v). The present disclosure also provides the use of (i) miR-423-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNAtarget(s) as miR-423-5p miRNA; (ii) let-7b-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as let-7b-5p miRNA; (iii) let-7c-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as let-7c-5p miRNA; (iv) let-7a-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as let-7a-5p; (v) miR-30a-3p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as miR-30a-3p miRNA; or (vi) any combination of (i) to (v), for preserving or improving microvascular density in a body part (e.g., tissue or organ), or for the manufacture of a medicament for preserving or improving microvascular density in a body part (e.g., tissue or organ), from a subject. The present disclosure also provides an agent for use in preserving or improving microvascular density in a body part (e.g., tissue or organ) from in a subject, the agent comprising: (i) miR-423-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as miR-423-5p miRNA; (ii) let-7b-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNAtarget(s) as let-7b-5p miRNA; (iii) let-7c-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as let-7c-5p miRNA; (iv) let-7a-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNAtarget(s)as let-7a-5p miRNA; (v) miR-30a-3p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as miR-30a-3p miRNA; or (vi) any combination of (i) to (v).

[0108] In an embodiment, the method / use described herein comprises the administration or use of a combination comprising at least two of (i) to (v), i.e., (i) an (ii), (i) and (iii), (i) and (iv), (i) and (v), (ii) and (iii), (ii) and (iv), (ii) and (v), (iii) and (iv), (iii) and (v), or (iv) and (v). In another embodiment, the method / use comprises the administration or use of a combination comprising at least three of (i) to (iv), i.e., (i), (ii), and (iii), (i), (ii) and (iv), (i), (ii) and (v), (ii), (iii) and (iv), (ii), (iii) and (v), (ii), (iv) and (v), or (iii), (iv) and (v). In another embodiment, the method / use comprises the administration or use of a combination comprising (i), (ii), (iii), and (iv), (i), (ii), (iii), and (v), (i), (ii), (iv), and (v), (ii), (iii), (iv) and (v), or (i), (ii), (iii), (iv) and (v).

[0109] In another aspect, the present disclosure provides a combination, mixture or composition comprising at least two of (i) miR-423-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as miR-423-5p miRNA; (ii) let-7b-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as let-7b-5p miRNA; (iii) let-7c-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as let-7c-5p miRNA; (iv) let-7a-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as let-7a-5p miRNA; and (v) miR-30a-3p, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as miR-30a-3p miRNA, i.e., (i) an (ii), (i) and (iii), (i) and (iv), (i) and (v), (ii) and (iii), (ii) and (iv), (ii) and (v), (iii) and (iv), (iii) and (v), or (iv) and (v). In another aspect, the present disclosure provides a combination, mixture or composition comprising at least three of (i) miR-423-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as miR-423-5p miRNA; (ii) let-7b-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNAtarget(s) as let-7b-5p miRNA; (iii) let-7c-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNAtarget(s) as let-7c-5p miRNA; (iv) let-7a-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as let-7a-5p, and (v) miR-30a-3p, a precursor thereof, or another RNA interfering agent binding to the same mRNAtarget(s) as miR-30a-3p miRNA / .e., (i), (ii), and (iii), (i), (ii) and (iv), (i), (ii) and (v), (ii), (iii) and (iv), (ii), (iii) and (v), (ii), (iv) and (v), or (iii), (iv) and (v). In another aspect, the present disclosure provides a combination comprising (i), (ii), (iii), and (iv), (i), (ii), (iii), and (v), (i), (ii), (iv), and (v), (ii), (iii), (iv) and (v), or (i), (ii), (iii), (iv) and (v). In an embodiment, the combination is for treating a microvascular disease and / or dysfunction, preserving or improving microvascular density, and / or preventing microvascular rarefaction in a subject.

[0110] The term microRNAs (miRNAs) as used herein refers to small, regulatory RNAs that are expressed in animals and plants and affect the translation or stability of target mRNAs. The IT-24 nt, single-stranded (ss) miRNAs are derived from longer, primary or precursor transcriptstermed "pri-miRNAs". The pri-miRNAs contain an RNA hairpin in which one of the two strands includes the mature miRNA. The hairpin is cleaved from the pri-miRNA in the nucleus by the double-strand-specific ribonuclease, Drosha. The resulting precursor miRNA, or "pre-miRNA," is transported to the cytoplasm and is further cleaved by Dicer to generate a short, partially doublestranded (ds) RNA in which one strand is the mature miRNA. The mature miRNA is taken up by the RNA Induced Silencing Complex (RISC), and miRNA-bound complex functions to regulate translation. The term “a precursor thereof’ (when referring to an miRNA) as used herein encompasses both a pri-miRNA or pre-miRNA.

[0111] The mature miR-423-5p miRNA (miRbase accession No. MIMAT0004748; RNAcentral accession No. URS00001C8A86_9606) comprises the sequence UGAGGGGCAGAGAGCGAGACUUU (SEQ ID NO:1). The precursor RNA for miR-423-5p miRNA comprises the sequence ataaaggaag ttaqqctqaq qqqcaqaqaq cqaqactttt ctattttcca aaagctcggt ctgaggcccc tcagtcttgc ttcctaaccc gcgc (NCBI Reference Sequence: NC_000017.11, SEQ ID NO:2).

[0112] The mature let-7b-5p miRNA (miRbase accession No. MIMAT0000063; RNAcentral accession No. URS00001C8A86_9606) comprises the sequence UGAGGUAGUAGGUUGUGUGGUU (SEQ ID NO:3). The precursor RNA for let-7b-5p miRNA comprises the sequence cqqqqtqaqq taqtaqqttq tqtqqtttca gggcagtgat gttgcccctc ggaagataac tatacaacct actgccttcc ctg (NCBI Reference Sequence: NR_029479.1, SEQ ID NO:4). According to the RNAcentral database, let-7b-5p miRNA interacts with the mRNA encoding IGF1R, HMGA2, IGF2BP2, CCND2, IL-6, TGFBR1, CASP3 and LIN28A.

[0113] The mature let-7c-5p miRNA (miRbase accession No. MIMAT0000064; RNAcentral accession No. URS000050DE77_9606) comprises the sequence UGAGGUAGUAGGUUGUAUGGUU (SEQ ID NO:5). The precursor RNA for let-7c-5p miRNA comprises the sequence gcatccgggt tqaqqtaqta qqttqtatqq tttaqaqtta caccctggga gttaactgta caaccttcta gctttccttg gage (NCBI Reference Sequence: NR_029480.1, SEQ ID NO:6). According to the RNAcentral database, let-7b-5p miRNA interacts with the mRNA encoding IL-6, IL-6R, IL-10, and NR4A2.

[0114] The mature let-7a-5p (miRbase accession No. MIMAT0000062; RNAcentral accession No. URS0000416056_9606) comprises the sequence UGAGGUAGUAGGUUGUAUAGUU (SEQ ID NO:7). The precursor RNAs for let-7a-5p miRNA comprise the sequence tgggatgagg tagtaggttg tatagtttta gggtcacacc caccactggg agataactat acaatctact gtctttccta (NCBI Reference Sequence: NRJ329476.1, SEQ ID NO:8), aggttgaggt agtaggttgt atagtttaga attacatcaa gggagataac tgtacagcct cctagctttc ct (NCBI Reference Sequence: NRJ329477.1, SEQ ID NO:9) or gggtgaggta gtaggttgta tagtttgggg ctctgccctg ctatgggata actatacaat etaetgtett tcct (NCBI Reference Sequence: NRJ329478.1, SEQ ID NO: 10). According to the RNAcentral database, let-7a-5p miRNA interacts with the mRNA encoding HMGA2 and IL6.The mature miR-30a-3p (miRbase accession No. MIMAT0000088; RNAcentral accession No. URS0000065D58_9606) comprises the sequence CUUUCAGUCGGAUGUUUGCAGC (SEQ ID NO: 11). The precursor RNA for miR-30a-3p miRNA comprises the sequence gcgactgtaa acatcctcga ctggaagctg tgaagccaca gatgggcttt cagtcggatg tttgcagctgc (NCBI Reference Sequence: NR_029504.1, SEQ ID NO:12). According to the RNAcentral database, miR-30a-3p miRNA interacts with the mRNA encoding GJA1 , MECP2, and CREBBP.

[0115] The term “RNA interfering agent” as used herein refers to a molecule that permits the enzyme-dependent degradation of targeted mRNA to regulate gene expression. RNA interference is a biological process in which nucleic acid (e.g., RNA, RNA-like, DNA) molecules inhibit gene expression or translation by neutralizing targeted messenger RNA (mRNA) molecules. Examples of RNAi agent include single-stranded antisense oligonucleotides (ASOs), microRNAs (miRNAs) (non-coding RNA), siRNAs, and shRNAs. While the present disclosure is not limited by any particular mechanism of action, in some embodiments, the RNA interfering agent according to the present disclosure enters a cell and causes the degradation, blocks the translation, blocks the interaction with another factor or affects the splicing of a target transcript.

[0116] In an embodiment, the RNA interfering agent is a siRNA that comprises an antisense strand and a sense strand, where the antisense strand comprises the nucleotide sequence of miR-423-5p miRNA, let-7b-5p miRNA, let-7a-5p, miR-30a-3p or let-7c-5p, or at least 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of miR-423-5p miRNA, let-7b-5p miRNA, let-7a-5p, miR-30a-3p or let-7c-5p.

[0117] In an embodiment, the method / use comprises the administration or use of miR-423-5p miRNA or of an RNA interfering agent (e.g., ASO, siRNA, shRNA) that binds to the same sequence of the mRNAtarget(s) as miR-423-5p miRNA. In a further embodiment, the method / use comprises the administration or use of miR-423-5p miRNA.

[0118] In an embodiment, the method / use comprises the administration or use of let-7b-5p miRNA or of an RNA interfering agent (e.g., ASO, siRNA, shRNA) that binds to the same sequence of the mRNA target(s) as let-7b-5p miRNA. In a further embodiment, the method / use comprises the administration or use of let-7b-5p miRNA.

[0119] In an embodiment, the method / use comprises the administration or use of let-7a-5p miRNA or of an RNA interfering agent (e.g., ASO, siRNA, shRNA) that binds to the same sequence of the mRNA target(s) as let-7a-5p miRNA. In a further embodiment, the method / use comprises the administration or use of let-7a-5p miRNA.

[0120] In an embodiment, the method / use comprises the administration or use of let-7c-5p miRNA or of an RNA interfering agent (e.g., ASO, siRNA, shRNA) that binds to the same sequence of the mRNA target(s) as let-7c-5p miRNA. In a further embodiment, the method / use comprises the administration or use of let-7c-5p miRNA.In an embodiment, the method / use comprises the administration or use of let-7c-5p miRNA or of an RNA interfering agent (e.g., ASO, siRNA, shRNA) that binds to the same sequence of the mRNAtarget(s) as miR-30a-3p miRNA. In a further embodiment, the method / use comprises the administration or use of miR-30a-3p miRNA.

[0121] In certain embodiments, the above-mentioned RNA interfering agents (e.g., ASOs, siRNAs, or miRNA) are chemically modified to improve at least one property such as solubility, permeability, loading capacity, stability, plasma half-life or for targeting the RNA interfering agent of a specific site. In embodiments, the RNA interfering agent is modified to increase their stability and / or help them evade immune response (i.e., reduce immunogenicity). Such modifications include backbone (inter-nucleotide linkage) modifications as well as 2' ribose modifications. Examples of 2' ribose modifications include 2’-fluoro, 2’-O-methyl (i.e., 2’-methoxy), 2'-O-alkyl, or 2’-0-methoxyethyl (2-O-MOE).

[0122] The first nucleotide from the 5’ end of the RNA interfering agent may be a modified nucleotide that has a phosphate analog, i.e., a chemical moiety that mimics the electrostatic and / or steric properties of a phosphate group. A 5’ phosphate analog can include a phosphatase-resistant linkage. Examples of phosphate analogs include 5’ methylene phosphonate (5’-MP) and 5’-(E)-vinylphosphonate (5’-VP). In some embodiments, the phosphate analog is 5 ’-VP.

[0123] In an embodiment, the RNA interfering agent includes one or more of the following modifications: phosphorothioate (PS) (e.g., increases stability), 2’0-Methyl (2’OMe) (e.g., increases stability and reduces immune response), 2’0-Methoxy (2’MOE) e.g. , (increases stability and reduces immune response), phosphoramidite (NP) (e.g., increases stability), locked nucleic acid (LNA) or phosphoramidate morpholino (PMO), and / or peptide nucleic acid (PNA) groups. Such modifications may also assist in loading in the RISC complex and in excluding the passenger strand, and / or facilitate cleavage by RNase H. In an embodiment, the RNA interfering agent (e.g., ASO) comprises one or more phosphorothioate (PS) modifications, in a further embodiment all inter-nucleotide linkages of the RNAi agent (e.g., ASO) are PS linkages. In an embodiment, the RNA interfering agent (e.g., ASO) comprises one or more 2’MOE modifications.

[0124] In an embodiment, the methods / uses described herein comprises the use or administration of one or more of the miRNA or miRNA precursor described herein. The skilled person would understand that an miRNA or miRNA precursor is employed for therapeutic applications in two possible ways: antisense therapy, i.e., to reduce the overexpression of one or more target genes, and replacement therapy, i.e., to restore expression levels of the one or more miRNAs similar to those observed in healthy cells and mimic the function of target miRNA. Antisense therapy is utilized when the target genes of the miRNA are overexpressed. In contrast, when miRNA is downregulated or deficient, miRNA (called miRNA mimics) can be introduced into the diseased cells to restore expression levels similar to those observed in healthy cells and mimic the function of target miRNAIn some embodiments, the RNA interfering agent comprises a delivery moiety conjugated thereto, e.g., at the 3’ end. The delivery moiety can facilitate the entry of RNA interfering agent into the cells. Examples of delivery moiety include lipids, cholesterol, vitamin E, carbohydrates, amino sugars, or polypeptides. In an embodiment, the delivery moiety is a hydrophobic moiety, for example a sterol, a ganglioside, a lipid, a vitamin, or a fatty acid, such as a-tocopherol, cholesterol or palmitic acid. The delivery moiety may be conjugated to a nucleotide of the RNA interfering agent. In that case, the delivery moiety is a modified nucleotide located in the RNA interfering agent. Examples of such modified nucleotides include 2’-O-hexadecyl uridine, 2’-O-hexadecyl cytidine, 2’-O-hexadecyl guanine, or 2’-O-hexadecyl adenosine. The delivery moiety may be conjugated to the RNA interfering agent through a linker, such as a tetraethylene glycol (Teg) linker or piperidinol-PEG linker. In some embodiments, the delivery moiety is a known delivery moiety for delivering RNA interfering agent into a cell. Placement of a delivery moiety on the RNA interfering agent needs to overcome potential inefficient loading of AG02 (Argonaute-2) or other hindrance of the RNA-induced silencing complex (RISC) complex activity, or interference with RNAse H activity. The delivery moiety may also allow or enhance the loading of the RNA interfering agent into a carrier entity such as extracellular vesicles (EVs), lipid nanoparticles, or liposomes.

[0125] In an embodiment, the RNA interfering agent or combination thereof disclosed herein is present in a pharmaceutical composition comprising a pharmaceutically acceptable excipient or carrier. As used herein, "pharmaceutically acceptable excipient or carrier" includes any and all solvents, diluents, dispersion media, coatings, thickeners, lubricants, antibacterial and antifungal agents, isotonic and absorption delaying agents, pH modifiers, surfactants, emulsifiers, adjuvants, surfactants, preservatives, chelating agents and the like that are physiologically compatible. The excipient should be suitable for the desired route of administration, e.g., intravenous, intramuscular, subcutaneous, parenteral, intrathecal, spinal or epidermal administration (e.g., by injection or infusion). In another aspect, the present disclosure provides a combination or composition comprising at least two of the RNA interfering agents described herein.

[0126] Pharmaceutical compositions provided herein, in some embodiments, include a pharmaceutically acceptable antioxidant. Examples of pharmaceutically acceptable antioxidants include: water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.

[0127] Examples of suitable aqueous and non-aqueous carriers that are employed in the pharmaceutical compositions of provided herein include, but are not limited to, water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), DMSO, and suitablemixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Proper fluidity is maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.

[0128] In some embodiments, compositions herein contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents. Prevention of presence of microorganisms is ensured, in some embodiments, both by sterilization procedures, supra, and by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. In some embodiments, it is desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form, in some embodiments, is brought about by the inclusion of agents which delay absorption such as, aluminum monostearate and gelatin.

[0129] Pharmaceutically acceptable excipients include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. The use of such media and agents for pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the pharmaceutical compositions provided herein is contemplated. In some embodiments, supplementary active compounds are incorporated into the compositions.

[0130] The RNA interfering agents described herein may also be formulated in polymer- or lipid-based nanoparticles (e.g., lipid nanoparticles, LNPs) or liposomes.

[0131] In other embodiment, the RNA interfering agent or combination thereof disclosed herein is present in a cosmetic composition or product. In an embodiment, the cosmetic composition or product comprises at least one cosmetically acceptable excipient or carrier. Examples of cosmetically acceptable excipients and carriers include solvents, glycerin, emulsifiers; emollients; humectants / moisturizers; skin conditioners; exfoliants; cleansing agents; pigment balancers; antioxidants; preservatives; thickeners; stabilizers; pH balancers; film-forming agents; and bulking agents. Cosmetic composition or product may also include additional agents such as retinoids; sebum regulators: phytoestrogens; amino acids; matrikine peptides, vitamins, carotenoids, polyphenols, coenzyme Q10, etc. In an embodiment, the cosmetic composition is a topical composition. Topical compositions can be structured or formulated into a variety of different forms. Non-limiting examples include emulsions (e.g., water-in-oil, water-in-oil-in-water, oil-in-water, silicone-in-water, water-in-silicone, oil-in-water-in-oil, oil-in-water-in-silicone emulsions), creams, lotions, solutions (both aqueous and hydroalcoholic), anhydrous bases (such as lipsticks and powders), gels, masks, peelings, and ointments.

[0132] As used herein, “treatment” or “treating” refers to an approach for obtaining beneficial or desired results with respect to a disease, disorder, or medical condition including, but not limitedto, a therapeutic benefit and / or a prophylactic benefit. In certain embodiments, treatment or treating involves administering a compound or composition disclosed herein to a subject. A therapeutic benefit may include the eradication or amelioration of the underlying disorder being treated. Also, a therapeutic benefit may be achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying disorder, such as observing an improvement in the subject, notwithstanding that the subject may still be afflicted with the underlying disorder. In certain embodiments, for prophylactic benefit, the compositions are administered to a subject at risk of developing a particular disease, or to a subject reporting one or more of the physiological symptoms of a disease, even though a diagnosis of this disease may not have been made. Treating can include, for example, reducing, delaying or alleviating the severity of one or more symptoms of the disease or condition, or it can include reducing the frequency with which symptoms of a disease, defect, disorder, or adverse condition, and the like, are experienced by a patient. Treating can be used herein to refer to a method that results in some level of treatment or amelioration of the disease or condition, and can contemplate a range of results directed to that end, including but not restricted to prevention of the condition entirely.

[0133] In an embodiment, the above-mentioned treatment comprises the use / administration of more than one ( / .e. a combination of) active / therapeutic agent, one of which being the above-mentioned RNA interfering agent or composition. The combination of agents and / or compositions of the present disclosure may be administered or co-administered (e.g., consecutively, simultaneously, at different times) in any conventional dosage form. Co-administration in the context of the present disclosure refers to the administration of more than one therapeutic in the course of a coordinated treatment to achieve an improved clinical outcome. Such coadministration may also be coextensive, that is, occurring during overlapping periods of time. For example, a first agent may be administered to a patient before, concomitantly, before and after, or after a second active agent is administered. The agents may in an embodiment be combined / formulated in a single composition and thus administered at the same time. In an embodiment, the one or more active agent(s) is used / administered in combination with one or more agent(s) currently used to prevent or treat the disorder in question. In an embodiment, the one or more agents comprise an angiotensin-converting enzyme (ACE) inhibitor, a sodiumglucose cotransporter 2 (SGLT-2) inhibitor, an angiotensin receptor blocker (ARB), and / or a statin.

[0134] Assessment of the risk of sufferinq from a microvascular disease or dysfunction

[0135] In another aspect, the present disclosure provides a method for assessing the risk of suffering from a microvascular disease or dysfunction in a subject, the method comprising (a) measuring the levels of at least one of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and let-7c-5p in a biological sample from the subject; (b) comparing the measured levels of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and / or let-7c-5p to a reference level; and (c) assessing the risk ofsuffering from a microvascular disease or dysfunction based on the comparison, wherein a low level of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and / or let-7c-5p is indicative of an increased risk of suffering from a microvascular disease or dysfunction.

[0136] In an embodiment, the method comprises measuring the levels of at least two of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and let-7c-5p in the biological sample, i.e., miR-423-5p and let-7b-5p, miR-423-5p and let-7c-5p, miR-423-5p and let-7a-5p, miR-423-5p and miR-30a-3p, let-7b-5p and let-7a-5p, let-7b-5p and let-7c-5p, let-7b-5p and miR-30a-3p, let-7a-5p and let-7c-5p, let-7a-5p and miR-30a-3p, or miR-30a-3p and let-7c-5p. In a further embodiment, the method comprises measuring the levels of at least three of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p, and let-7c-5p, i.e., miR-423-5p, let-7b-5p, and let-7a-5p, miR-423-5p, let-7b-5p, and let-7c-5p, miR-423-5p, let-7b-5p, and miR-30a-3p, let-7b-5p, let-7a-5p and let-7c-5p, let-7b-5p, let-7a-5p and miR-423-5p, or let-7c-5p, miR-423-5p and let-7a-5p, in the biological sample. In an embodiment, the method comprises measuring the levels of miR-423-5p, let-7b-5p, let-7a-5p, and let-7c-5p, miR-423-5p, let-7b-5p, let-7a-5p, and miR-30a-3p, or let-7b-5p, let-7a-5p, let-7c-5p and miR-30a-3p in the biological sample. In an embodiment, the method comprises measuring the levels of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and let-7c-5p in the biological sample "Control level" or "reference level" or “standard level” are used interchangeably herein and broadly refers to a separate baseline level measured in a comparable control sample, which is generally from a subject not suffering from a microvascular disease or dysfunction or not at risk of suffering from a microvascular disease or dysfunction. The corresponding control level may be a level corresponding to an average or median level calculated based of the levels measured in several reference or control subjects (e.g., a pre-determined or established standard level). The control level may be a pre-determined “cut-off’ value recognized in the art or established based on levels measured in one or a group of control subjects. The corresponding reference / control level may be adjusted or normalized for age, sex, race, or other parameters. The "control level" can thus be a single number / value, equally applicable to every patient individually, or the control level can vary, according to specific subpopulations of patients. Thus, for example, older men might have a different control level than younger men, and women might have a different control level than men. The predetermined standard level can be arranged, for example, where a tested population is divided equally (or unequally) into groups, such as a low-risk group, a medium-risk group and a high-risk group or into quadrants or quintiles, the lowest quadrant or quintile being individuals with the lowest risk (i.e., highest levels of miR-423-5p, let-7b-5p, let-7a-5p, and / or let-7c-5p) and the highest quadrant or quintile being individuals with the highest risk (i.e., lowest levels of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p, and / or let-7c-5p).

[0137] It will also be understood that the control levels according to the disclosure may be, in addition to predetermined levels or standards, miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p,and / or let-7c-5p levels measured in other samples (e.g. from healthy / normal subjects) tested in parallel with the experimental sample.

[0138] In an embodiment, the control / reference level is a corresponding level or standard established based on miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p, and / or let-7c-5p in subjects not suffering from a microvascular disease or dysfunction, or not at risk of suffering from a microvascular disease or dysfunction. In such a case, lower miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p, and / or let-7c-5p levels measured in a sample from subject relative to the control level is indicative that the subject is suffering from a microvascular disease or dysfunction, or is at risk (or is at high risk) of suffering from a microvascular disease or dysfunction, whereas similar or higher miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p, and / or let-7c-5p levels measured in a sample from subject relative to the control level is indicative that the subject is not suffering from a microvascular disease or dysfunction, or is not at risk (or is at low risk) of suffering from a microvascular disease or dysfunction.

[0139] In another embodiment, the control level is a corresponding level or standard established based on miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p, and / or let-7c-5p levels in subjects known to suffer from a microvascular disease or dysfunction, or known to be at risk of suffering from a microvascular disease or dysfunction. In such a case, similar or lower miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p, and / or let-7c-5p levels measured in a sample from the subject relative to the control level is indicative that the subject is suffering from a microvascular disease or dysfunction, or is at risk (or at high risk) of suffering from a microvascular disease or dysfunction, whereas higher miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p, and / or let-7c-5p levels measured in a sample from subject relative to the control level is indicative that the subject is not suffering from a microvascular disease or dysfunction, or is not at risk (or is at low risk) of suffering from a microvascular disease or dysfunction.

[0140] In another aspect, the present disclosure provides a method for monitoring the course of treatment of a subject suffering from a microvascular disease or dysfunction, the method comprising: (a) determining a first level of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p, and / or let-7c-5p in a biological sample from said subject; wherein an increase in the level relative to a corresponding level determined in a corresponding biological sample obtained from said subject at an earlier time is indicative that said patient is responsive to said treatment, and wherein an absence of change or a decrease in said first level relative to a corresponding level determined in a corresponding biological sample obtained from said subject at an earlier time is indicative that said patient is not responsive to said treatment.

[0141] In another aspect, the present disclosure provides a method to follow-up the condition of a subject suffering from a microvascular disease or dysfunction, the method comprising:

[0142] (a) determining a first level of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p, and / or let-7c-5p in a serum, plasma and / or large extracellular vesicle (microvesicle) sample from saidsubject; wherein an increase in said first level relative to a corresponding level determined in a corresponding serum, plasma and / or large extracellular vesicle sample obtained from said subject at an earlier time is indicative that said patient condition has improved (e.g., that the patient is less likely to suffer from a microvascular disease or dysfunction than before, or that the microvascular disease or dysfunction is less severe relative to the earlier time point), and wherein a decrease in said first level relative to a corresponding level determined in a corresponding serum, plasma and / or large extracellular vesicle sample obtained from said subject at an earlier time is indicative that said patient condition has deteriorated (e.g., that the patient is more likely to develop a microvascular disease or dysfunction than before, or that the microvascular disease or dysfunction is more severe relative to the earlier time point). Such method permits to determine for example whether the extent or severity of the microvascular disease or dysfunction is worsening or improving.

[0143] In another aspect, the present disclosure provides a method to follow-up the condition of a subject suffering from a microvascular disease or dysfunction, the method comprising:

[0144] (a) determining a first level of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p, and / or let-7c-5p in an apoptotic exosome-like vesicle (ApoExo) sample from said subject; wherein a decrease in said first level relative to a corresponding level determined in a corresponding large extracellular vesicle sample obtained from said subject at an earlier time is indicative that said patient condition has improved (e.g., that the patient is less likely to suffer from a microvascular disease or dysfunction than before, or that the microvascular disease or dysfunction is less severe relative to the earlier time point), and wherein an increase in said first level relative to a corresponding level determined in a corresponding large extracellular vesicle sample obtained from said subject at an earlier time is indicative that said patient condition has deteriorated (e.g., that the patient is more likely to develop a microvascular disease or dysfunction than before, or that the microvascular disease or dysfunction is more severe relative to the earlier time point). Such method permits to determine for example whether the extent or severity of the microvascular disease or dysfunction is worsening or improving.

[0145] In an embodiment, the above-mentioned biological sample is a biological fluid, e.g., urine, saliva, lymph, or a blood-derived sample. The term “blood-derived sample” as used herein refers to blood (e.g., fresh blood, stored blood) or to a fraction thereof, such as serum, plasma and the like. It also refers to any sample that may be obtained following one or more purification, enrichment, and / or treatment steps using blood (obtained by venous puncture, for example) as starting material. In an embodiment, the above-mentioned blood-derived sample is serum. In another embodiment, the biological sample comprises extracellular vesicles (EVs). Extracellular vesicles refer to small vesicles (usually 30-200 nm) containing RNA, lipids, metabolites and proteins that are secreted by various types of cells, and found in body fluids including blood (serum, plasma), saliva, urine, and breast milk. In another embodiment, the method describedherein further comprises obtaining or collecting a biological sample comprising EVs from a subject. In various embodiments, the sample can be from any source that contains EVs, for example a blood or blood-derived sample such as plasma or serum. Thus, in an embodiment, the method described herein further comprises a step of isolating EVs (or enrichment of EVs) from the biological sample obtained from the subject (e.g., blood, plasma or serum). Thus, the sample may be subjected to purification / enrichment techniques to obtain a sample enriched in EVs. Accordingly, in an embodiment, the method may be performed on an isolated EV sample. Methods and kits for purification of EVs (exosomes) are well known in the art (Tang et al., Int J Mol Med. 2017, 40(3): 834-844), and include ultracentrifugation (UC)-based purification methods, as well as commercially available systems such as the T otal Exosome Isolation Kit / Reagents from Invitrogen / ThermoFisher Scientific, the qEV EV / exosome isolation system from Izon Science Ltd., and the ExoQuick™ Exosome Isolation kit series from System Biosciences. Apoptotic exosome-like vesicles (ApoExos) are a type of extracellular vesicles that are released by cells undergoing apoptosis. ApoExos contains markers such as 20S proteasome and LG3, and may be isolated or enriched using methods known in the art, for example sequential centrifugation as described in references 18 and 19. Large extracellular vesicles (also called microvesicles) are a type of extracellular vesicles that are released from the plasma membrane of cells into the extracellular environment. These vesicles typically range in size from approximately 100-200 nm to 1 micron in diameter. Unlike exosomes, which originate from the endosomal compartment, microvesicles are formed by the outward budding and fission of the plasma membrane. Large extracellular vesicles may be isolated using methods known in the art, for example by centrifugation of a sample (plasma, serum) at 50000 x g for about 15 minutes. Small extracellular vesicles may be isolated using methods known in the art, for example by centrifugation of a sample (plasma, serum) depleted in large extracellular vesicles at 200 000 x g for several hours (e.g., about 18 hours).

[0146] The biological sample may be collected using any methods for collection of biological fluid, tissue or cell sample, such as venous puncture for collection of blood samples.

[0147] Methods for detecting nucleic acids such as miRNAs in a sample are well known in the art and include, for example, polymerase chain reaction (PCR) (e.g., qPCR, RT-PCR), nextgeneration sequencing (NGS), Southern blotting, Northern blotting, in situ hybridization (ISH), and microarray analysis.

[0148] The present disclosure further provides methods for developing personalized treatment plans. Information gained by way of the methods described above can be used to develop a personalized treatment plan for subjects suffering from a microvascular disease or dysfunction, or deemed at risk of suffering from microvascular disease or dysfunction. Accordingly, the present disclosure further provides methods for developing personalized treatment plans for subjects suffering from microvascular disease or dysfunction. The methods can be carried out by, forexample, using the methods described above and, in consideration of the results obtained, designing a treatment plan for the subject. If the levels of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p, and / or let-7c-5p indicate that the subject is suffering from, or at risk of suffering from, microvascular disease or dysfunction, the subject is a candidate for treatment with an effective amount of a drug for treating the condition, e.g., the treatment described above. Depending on the levels of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p, and / or let-7c-5p detected, the subject may require a treatment regime that is more aggressive (e.g., if the miR-423-5p, let-7b-5p, and / or let-7c-5p levels are very low relative to a normal control level) than a standard regime, or it may be determined that the subject is best suited for a standard regime. When so treated, one can treat or prevent complications associated with the condition. Conversely, a different result ( / .e., normal miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p, and / or let-7c-5p levels) may indicate that the subject is not experiencing (or is not likely to experience) an undesirable clinical outcome. In that event, the patient may avoid a treatment regime (or require a less aggressive regime) and their associated side effects.

[0149] Thus, in another aspect, the present disclosure provides a method for treating a microvascular disease and / or dysfunction in a subject, the method comprising:

[0150] (a) identifying a subject suffering from a microvascular disease and / or dysfunction or at risk of suffering from a microvascular disease and / or dysfunction using the above-noted method; and

[0151] (b) administering to the subject identified in (a) an effective amount of (i) miR-423-5p microRNA (miRNA) or another RNA interfering agent binding to the same mRNAtarget(s) as miR-423-5p miRNA; (ii) let-7b-5p miRNA or another RNA interfering agent binding to the same mRNA target(s) as let-7b-5p miRNA; (iii) let-7a-5p miRNA or another RNA interfering agent binding to the same mRNA target(s) as let-7a-5p miRNA; (iv) let-7c-5p miRNA or another RNA interfering agent binding to the same mRNA target(s) as let-7c-5p miRNA; and / or (v) miR-30a-3p or another RNA interfering agent binding to the same mRNA target(s) as miR-30a-3p miRNA.

[0152] In another aspect, the present disclosure provides a method for treating a microvascular disease and / or dysfunction in a subject, the method comprising:

[0153] (a) identifying a subject suffering from a microvascular disease and / or dysfunction or at risk of suffering from a microvascular disease and / or dysfunction using the above-noted method; and

[0154] (b) administering to the subject identified in (a) an effective amount of an angiotensinconverting enzyme (ACE) inhibitor, a sodium-glucose cotransporter 2 (SGLT-2) inhibitor, an angiotensin receptor blocker (ARB), and / or a statin.

[0155] The present disclosure also provides a kit or package comprising means / reagents useful for determining the amount / level of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and / or let-7c-5p, for example one or more primers and / or probes to amplify and / or detect miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and / or let-7c-5p in a sample. Such kit may further comprise, for example, instructions setting forth the above-mentioned methods (i.e., instructions for predicting the risk and / or diagnosing microvascular disease or dysfunction, for following-up the course of treatment or condition of a subject), control samples (e.g., samples to which the test sample may be compared to establish the diagnostic / prediction), containers, reagents useful for performing the methods (e.g., buffers, enzymes, containers, etc.). The kit may further include where necessary agents for reducing background interference in a test, agents for increasing signal, software and algorithms for combining and interpolating values to produce a prediction of clinical outcome of interest, apparatus for conducting a test, calibration curves and charts, standardization curves and charts, and the like.

[0156] The term “microvascular diseases” as used herein refers to a group of conditions that affect the small blood vessels, known as microvessels, in the body. These microvessels include capillaries, arterioles, and venules, which are responsible for the exchange of oxygen, nutrients, and waste products between the bloodstream and tissues / organs. Microvascular diseases can lead to impaired blood flow and tissue perfusion, resulting in a variety of health issues.

[0157] The term “microvascular dysfunction” as used herein refers to the impaired function of these small blood vessels, which can occur without overt structural disease, often contributing to various chronic conditions.

[0158] A number of conditions are closely associated with microvascular dysfunction, including aging (e.g., skin aging), amyloidosis, chronic thromboembolic pulmonary hypertension, dementia, diabetes mellitus, heart failure with preserved ejection fraction (HFpEF), heart failure with reduced ejection fraction (HFrEF), systemic hypertension, hypertrophic obstructive cardiomyopathy, idiopathic cardiomyopathy, inflammatory disease, ischemic cardiomyopathy, no-reflow phenomenon, obesity, obstructive sleep apnea, peripheral neuropathy, stress-related cardiomyopathy, systemic lupus erythematosus, systemic sclerosis, and vasospasm. Additional conditions associated with abnormal / enhanced vasoconstriction include angina, congestive heart failure, transplanted heart, erectile dysfunction, preeclampsia, migraine, stroke, and Raynaud phenomenon.

[0159] The term microvascular rarefaction as used herein refers to the reduction in the density or number of small blood vessels, or microvessels, within a given body part (e.g., arm, leg, tissue or organ). This phenomenon can lead to decreased blood flow and impaired delivery of oxygen and nutrients to the affected area. Microvascular rarefaction is often associated with various pathological conditions, such as hypertension, diabetes, and chronic kidney disease, and can contribute to the progression of these diseases by exacerbating tissue hypoxia and dysfunction.

[0160] The expression "preserving or improving microvascular density" as used herein refers to the maintenance or enhancement of the number and distribution of microvessels within a given tissue or organ, including maintaining the existing network of microvessels, preventing anyreduction in their number or functionality, and / or increasing the number of microvessels. This may be beneficial in conditions where there is a risk of or existing microvascular rarefaction, including conditions that affect blood flow and tissue perfusion, certain diseases or aging.

[0161] In an embodiment, the microvascular disease, dysfunction or rarefaction is subsequent to an organ transplantation. In an embodiment, the microvascular disease, dysfunction or rarefaction is subsequent to ischemia. In another embodiment, the microvascular disease, dysfunction or rarefaction is subsequent to an alloimmune response, such as antibody-mediated allograft rejection.

[0162] In an embodiment, the microvascular disease, dysfunction or rarefaction is heart microvascular disease, dysfunction or rarefaction. In a further embodiment, the heart microvascular disease, dysfunction or rarefaction is angina or heart failure.

[0163] In an embodiment, the microvascular disease, dysfunction or rarefaction is lung or pulmonary microvascular disease, dysfunction or rarefaction. In a further embodiment, the lung or pulmonary microvascular disease, dysfunction or rarefaction is pulmonary hypertension (PH) such as chronic thromboembolic pulmonary hypertension (CTEPH).

[0164] In an embodiment, the microvascular disease, dysfunction or rarefaction is brain microvascular disease, dysfunction or rarefaction. In a further embodiment, the brain microvascular disease, dysfunction or rarefaction is microvascular ischemic brain disease or cerebral small vessel disease (CSVD).

[0165] In an embodiment, the microvascular disease, dysfunction or rarefaction is kidney microvascular disease, dysfunction or rarefaction. In a further embodiment, the kidney microvascular disease, dysfunction or rarefaction is acute kidney injury (AKI) or chronic kidney disease (CKD). In an embodiment, the AKI or CKD is subsequent to kidney transplantation.

[0166] In an embodiment, the microvascular disease, dysfunction or rarefaction is ocular microvascular disease, dysfunction or rarefaction. In a further embodiment, the ocular microvascular disease, dysfunction or rarefaction is dry eye disease or diabetic retinopathy.

[0167] In an embodiment, the microvascular disease, dysfunction or rarefaction is skin microvascular disease, dysfunction or rarefaction. In an embodiment, the microvascular dysfunction or rarefaction is associated with aging, i.e., skin aging. The term "skin aging" refers to the measurable signs of aging of skin which can be both visible by clinical evaluation and / or measurable. The typical signs of skin aging include wrinkles, sagging, pigmentation or enlarged pore size, the skin appears less radiant, rougher, and becomes dry.

[0168] As used herein the term “subject” or “patient” is meant to refer to any animal, such as a mammal including human, mice, rat, dog, cat, pig, cow, monkey, horse, etc. In an embodiment, the above-mentioned subject is a mammal, in a further embodiment a human. In an embodiment, the above-mentioned subject is a transplant recipient (or a transplant candidate). In a further embodiment, the above-mentioned subject is a solid organ transplant recipient, such as akidney / renal transplant recipient, a heart transplant recipient, a lung transplant recipient, or a pancreas transplant recipient. In an embodiment, the subject suffers from acute vascular rejection or is at risk of ( / .e., has a predisposition for) suffering from acute / active vascular rejection.

[0169] MODE(S) FOR CARRYING OUT THE INVENTION

[0170] The present invention is illustrated in further details by the following non-limiting examples.

[0171] Example 1: Materials and Methods

[0172] Cell culture and reagents. HUVECs were purchased from Cell Applications, cultured in Medium 200 + LSGS (Gibco) on gelatin-coated surfaces and used at passage 4. Apoptotic exosome-like vesicles were produced as described previously (18, 19).

[0173] Vesicle isolation. Apoptotic exosome-like vesicles were isolated from conditioned media by sequential centrifugation as previously described (18, 19). Briefly, conditioned serum-free media was centrifuged at 1200 x g for 15 min at 4°C to remove dead cells and debris. The supernatant was exposed to centrifugation at 50,000 x g for 15 min at 4°C to collect apoptotic bodies, followed by final centrifugation at 200,000 xg for 18 h at 4°C to collect apoptotic exosome-like vesicles. Extracellular vesicles were resuspended in TRIzol™ Reagent (Life Technologies) to extract total RNA or D-PBS to assess proteasome activity.

[0174] Small transcriptome sequencing (small RNA-Seq). Total RNA was extracted using TRIzol™ Reagent (Life Technologies) according to the manufacturer’s protocol. RNA was then purified using the miRNeasy™ micro kit (QIAGEN) and submitted to on-column DNAse I digestion using the RNAse-free DNAse set (QIAGEN) as recommended. Sample quality and quantity were determined on an Agilent 2100 Bioanalyzer using n RNA 6000 Pico kit (Agilent Technologies). Eight RNA-seq libraries (2 biological replicates of HUVECs under normal conditions (N-HUVECs), serum-starved HUVECs (SS-HUVECs), apoptotic bodies and ApoExos) were generated from 20 ng RNA using the CleanTag™ kit for small RNAs (TriLink BioTechnologies). Single-read (1 * 75 base pairs) sequencing was performed on an Illumina NextSeq™ 550 (50 M reads per sample). Sequences were trimmed for sequencing adapters and mapped to the reference genome GRCh38 using bowtie 1.2.1, part of the miRDeep2 package, version 0.0.8. Following mapping, reads were then postprocessed to quantify known miRNAs from the miRBase database (version 21) as well as to discover novel recurrent miRNAs in the sample data. An miRNA was defined as enriched in ApoExos when it exhibited a FPKM > 6000 and an expression fold change > 2 for both biological replicates, when compared to apoptotic bodies as well as to serum-starved and normal ECs. An overrepresentation analysis of biological processes was performed using GO enrichment analysis coupled with Reduced + Visualized Gene Ontology (Revigo) software.

[0175] Quantitative RT-PCR. The expression levels of mRNA and miRNA in vesicles, serum and cells were determined using qRT-PCR. Total RNA was isolated from cells or EVs using the miRNeasy™ mini kit and 100 pL of patient serum or 20 pL of mouse serum using the miRNeasy™serum / plasma kit according to the manufacturer’s protocol (QIAGEN). MiRNAs were quantified using the Qubit™ microRNA Assay Kit (Invitrogen). Total RNA was quantified using a DS-11 Series Spectrophotometer / Fluorometer (DeNovix). Then, 0.5 ng of miRNA was reverse-transcribed to cDNA and preamplified with a TaqMan™ Advanced miRNA cDNA Synthesis Kit (Applied Biosystems) according to the manufacturer’s protocols. One microgram of total RNA was treated with RNAse free-DNAse I (Invitrogen) and reverse-transcribed to cDNA with iScript Reverse Transcription Supermix™ (Bio-Rad) according to the manufacturer’s instructions. QPCR amplification of miRNAs was performed using the TaqMan™ Advanced miRNA Assay (Applied Biosystems) on the Quantstudio™ 6 Real-Time PCR System (Thermo Fisher Scientific). TaqMan Advanced miRNA assays (miR-423-5p: 478090_mir, let-7b-5p: 478576_mir, let-7c-5p: 478577_mir, miR-361-5p: mmu481127_mir and cel-miR-39-3p: 478293_mir) were used to determine the expression of selected miRNAs following the manufacturer’s instructions. Each target was measured in triplicate and normalized to the exogenous level of cel-miR-39-5p. The TATAA Interplate Calibrator (TATAA Biocenter AA) was used to compensate for the variation between qPCR runs. For qPCR amplification of mRNA, 5 ng of cDNA was amplified with HIF1A (Hs00153153_m1), VEG FA (Hs00900055_m1) or HPRT1 (Hs03929098_m1) TaqMan probes (Thermo Fisher, Waltham) using TaqMan™ Fast Advanced Master Mix (Thermo Fisher). The reaction was performed in a total volume of 15 pL, and the reaction conditions were as follows: denaturation at 95°C for 20 s, followed by 40 cycles of denaturation at 95°C for 1 s and annealing and extension at 60°C for 20 s. The fold change in HIF1A and VEGFA mRNA levels was calculated with the comparative Ct method and normalized to HPRT1.

[0176] Mimic miR-423 transfection. Cells were plated onto 6-well plates at 2500 cells per cm2. After 72 h, cells were transfected with miRIDIAN microRNA Mimic Transfection Control or miRIDIAN microRNA Human hsa-miR-423-5p mimic (Dharmacon) using magnet-assisted transfection (MATra) (I BA Lifesciences) according to the manufacturer’s instructions. MATra-si Reagent was added to mimic miRNA to a concentration of 100 nM in Opti-MEM medium (Gibco) and incubated for 25 min at room temperature. The miRNA-bead mixture was added to the supernatant (Opti-MEM) of each well for a final concentration of 10 nM mimic miRNA. Then, the plate was placed on a magnet plate for 15 min and medium was changed after 30 min. After 48 h, the cells were processed according to the respective assays.

[0177] Proteomic analysis. Samples were reconstituted in 50 mM ammonium bicarbonate urea 8 M, vortexed and further diluted to 50 mM ammonium bicarbonate urea 1 M with 10 mM TCEP [Tris(2-carboxyethyl)phosphine hydrochloride; Thermo Fisher Scientific], and vortexed for 1 h at 37 °C. Chloroacetamide (Sigma-Aldrich) was added for alkylation to a final concentration of 55 mM. Samples were vortexed for another hour at 37°C. One microgram of trypsin was added, and digestion was performed for 8 h at 37°C. Samples were dried down and solubilized in 5% ACN-4% formic acid (FA). The samples were loaded on a 1.5 ul pre-column (Optimize Technologies).Peptides were separated on a home-made reversed-phase column (150-pm i.d. by 200 mm) with a 56-min gradient from 10 to 30% ACN-0.2% FA and a 600-nl / min flow rate on an Easy nLC-1200 connected to an Exploris 480 (Thermo Fisher Scientific). Each full MS spectrum acquired at a resolution of 120,000 was followed by tandem-MS (MS-MS) spectra acquisition on the most abundant multiply charged precursor ions for 3s. Tandem-MS experiments were performed using higher energy collision dissociation (HCD) at a collision energy of 34%. The data were processed using PEAKS X Pro (Bioinformatics Solutions) and a human Uniprot database. Mass tolerances on precursor and fragment ions were 10 ppm and 0.01 Da, respectively. Fixed modification was carbamidomethyl (C). Variable selected posttranslational modifications were acetylation (N-ter), oxidation (M), deamidation (NQ), phosphorylation (STY). The data were visualized with Scaffold 5.0 (protein threshold, 99%, with at least 2 peptides identified and a FDR of 1% for peptides).

[0178] Wound healing assay, Endothelial cell tube formation assay and Apoptosis level assessment. These assays were performed as described previously (19, 43, 44). HUVECs were cultured on 12-well plates until confluence. The cells were mechanically injured using a P20 / P200 pipette tip (three wounds per condition) as previously described (50). Wound closure was quantified with TScratch software (51) from the wound area measured after 6 h compared with the initial wound area for each wound.

[0179] Endothelial cell tube formation assay. Confluent HUVECs seeded onto 6-W plates were detached and reseeded at a cell density of 130000 cells / well onto 24-well plates that had been precoated with growth factor-reduced Matrigel™ Matrix (Corning) and cultured at 37°C for 6 h undertheir respective treatments. Each experiment was performed in duplicate for each condition. Capillary-like structures were captured (four fields per well) and quantified using the Angiogenesis analyzer for Imaged (52).

[0180] Caspase-3 activity assay. Caspase-3 activity was evaluated using a colorimetric assay kit (ab39401, Abeam) according to the manufacturer’s instructions. The samples were read on a microplate reader reading absorbance at 405 nm.

[0181] Apoptosis level assessment. HUVECs were cultured in 6-well plates until they reached 90-95% confluence. Cells were rinsed twice with RPMI medium and then incubated for 4 h in either RPMI or complete M200 medium. After incubation, the cells were stained with Hoechst 33342 at a dilution of 1 : 10000 (Molecular Probes) for 10 minutes. Just before analysis, propidium iodide was added to the culture medium to a final concentration of 5 pg / mL, with excitation set between A = 360-425 nm. An investigator, who was blinded to the experimental conditions, assessed the proportions of normal, apoptotic, and necrotic adherent cells across eight random fields for each condition. Apoptotic cells were identified by their condensed nuclei (appearing bright blue) without any cell membrane permeability (indicated by red staining). The count of apoptotic cells was then divided by the total number of cells in each micrograph to calculate the percentage of apoptotic cells.Proteasome activity assay. Proteasome activity was assessed as described before (18, 21). The proteasome activity assay was performed in white 96-well plates with clear bottoms using exosome-like vesicles purified from mouse serum (50 pg) and Proteasome-Glo Caspase-Like Cell-Based Assays (Promega) according to the manufacturer’s instructions. The protein concentration was assessed using a BCA microdosage kit (Thermo Fisher). Briefly, exosome-like vesicles were isolated as described above and diluted in PBS to equal total protein concentration and volume and brought up to room temperature. Luminescent reagent was then added to the sample in equal volume, protected from light, and agitated at 450 rpm on an orbital shaker. Samples were incubated at room temperature for 10 min before reading on a Victors luminescence plate reader (PerkinElmer). Luminescence levels were normalized to protein levels and reported as activity per pL of serum.

[0182] Flow cytometric analyses of extracellular vesicles. Analyses were performed on a BD Canto II Special Order Research Product (BD Biosciences) equipped with a small particle option, as described previously (45, 46). Samples were labeled in a total reaction volume of 100 pL at 37°C for 60 min with the LWA300 probe (125 nM) (Prof. Hermen Overkleeft, Department of Bioorganic Synthesis, Leiden University, Leiden, The Netherlands). Three microliters of Annexin V APC was added for 15 minutes at room temperature. Then, the sample was diluted by adding 100 pL of labeling buffer prior to analysis by hs-FCM. All samples were processed and analyzed by an investigator blinded to experimental conditions. Analyses were performed on a BD Canto II Special Order Research Product (BD Biosciences) equipped with a small particle option, as described previously (4, 5). The forward scatter (FSC) on this dedicated equipment is coupled to a photomultiplier tube (PMT) with a 488 nm solid-state, 100 mW output blue laser and includes a 633 nm HeNe, 20 mW output red laser, a 405 nm solid-state diode, and a 50 mW output violet laser. The hs-FCM includes an FSC-PMT and a Fourier optical transformation unit, which reduces the background / noise and increases the angle of diffusion, thereby enhancing the detection of small-diameter particles. FCM performance tracking was performed daily before all analyses using the BD cytometer setup and tracking beads (BD Biosciences). Acquisition was performed at low speed (~10 pL / min), and to remain quantitative, a known quantity of (fluorescent) polystyrene microspheres (15 pm diameter: Polysciences) was added to each tube, and a constant number of beads detected on the basis of (auto)fluorescence was acquired for each sample throughout the study. Silica particles (Kisker Biotech GmbH & Co.) of known dimensions (100 nm, 500 nm and 1 pm in diameter) were used for instrument setup standardization. Samples were labeled in a total reaction volume of 100 pL at 37°C for 60 min with the LWA 300 probe (125 nM) (Prof. Hermen Overkleeft, Department of Bioorganic Synthesis, Leiden University, Leiden, The Netherlands). Three microliters of Annexin V APC was added for 15 minutes at room temperature. Then, the sample was diluted by adding 100 pL of labeling buffer prior to analysisby hs-FCM. All samples were processed and analyzed by an investigator blinded to experimental conditions.

[0183] Cell lysis, protein isolation, and immunoblotting. Cell lysis, protein isolation and immunoblotting were performed as described previously (18-21). To obtain the total extracted protein, cells were washed twice in ice-cold PBS before being lysed in lysis buffer at 4°C for 15 minutes. The lysis buffer contained 1% Triton™ X-100, 150 mM NaCI, 5 mM EDTA, and 50 mM Tris (pH 7.5) and was supplemented with protease inhibitor (Calbiochem), phosphatase inhibitor cocktails and 1 mM phenylmethylsulfonyl fluoride (PMSF) (Sigma). The lysate was collected by scraping the cells with a rubber policeman and centrifuged at 12000 x g for 10 min at 4°C. The protein concentration was evaluated with a BCA protein assay kit (Thermo Fisher) according to the manufacturer’s instructions. The proteins were solubilized in sample buffer (25 mM Tris HCI, pH 6.8, 1% SDS, 0.1% bromophenol blue, 10% glycerol, and 2% p-mercaptoethanol) and incubated at 95°C for 10 minutes before being subjected to SDS-polyacrylamide gel electrophoresis and transferred electrophoretically onto nitrocellulose membranes. The membranes were then blocked with 5% dried fat-free milk in Tris-buffered saline at pH 7.4 with 0.05% Tween™ 20 (TBST) for 1 h at room temperature and incubated overnight at 4°C with specific primary antibodies in TBST plus 5% milk. The antibodies used for blotting were antibodies against PARP1 (9542; Cell Signaling Technology), a-tubulin (11224-1-AP; Proteintech), MECA-32 (NB100-77668; Novus Biological), p-actin (a5441; Sigma-Aldrich), PECAM1 (AF3628-SP; R&D Systems), CD82 (ab66400; Abeam), CD81 (66866-1-IG; Thermo Fisher), SDCBP (SC-515538; Santa Cruz Biotechnology), 20S proteasome (SC-67340, Santa Cruz Biotechnology and 11887-1-AP, Proteintech), HSPG2 / LG3 (AF2364; R&D Systems or Polyclonal antibody against recombinant LG3; MediMabs), histone H3C1 (9715S; Cell Signaling). Following incubation, the membranes were washed with TBST and incubated with a goat anti-rabbit IgG linked to horseradish peroxidase (GE Healthcare) for 1 h, followed by Clarity Western ECL Substrate. The luminescence signal was recorded with a ChemiDoc XRS+ system (Bio-Rad Laboratories Inc.) and analyzed with Image Lab software (Bio-Rad Laboratories Inc.) to determine the intensity of each specific band. Antibodies against: PARP1 (9542; Cell Signaling Technology), a-tubulin (11224-1-AP; Proteintech), MECA-32 (NB100-77668; Novus Biological), p-actin (a5441 ; Sigma-Aldrich), PECAM1 (AF3628-SP; R&D Systems), CD82 (ab66400; Abeam), CD81 (66866-1-IG; Thermo Fisher), SDCBP (SC-515538; Santa Cruz Biotechnology), 20S proteasome (SC-67340, Santa Cruz Biotechnology and 11887-1-AP, Proteintech), HSPG2 / LG3 (AF2364; R&D Systems or Polyclonal antibody against recombinant LG3; MediMabs), histone H3C1 (9715S; Cell Signaling).

[0184] Animal studies. Adult female C57BL / 6N (20-22 g; Charles River) mice were housed in sterilized, ventilated cages in a specific pathogen-free animal facility under a standard 12-hour light / 12-hour dark cycle and fed a normal diet ad libitum. Caspase-3-deficient mice (Casp-3 - / -)were bred from heterozygous Casp-3 / _(B6.129S1-C3tm1Flv / J) mice obtained from Jackson Laboratory (stock #006233; Bar Harbor, ME) and were 6-8 weeks old. These mice were viable and reached adulthood, but exhibited various abnormal cell arrangements and hyperplasias in the brain. The mice were housed in a 12-hour light / dark cycle and had access to food ad libitum. Ischemia-reperfusion injury (IRI) by unilateral renal artery clamping plus contralateral nephrectomy was performed as described.

[0185] Murine hindlimb ischemia model. Unilateral hindlimb ischemia, a model of persistent vascular injury (47), was surgically induced after anesthesia with 2% isoflurane by femoral arteriectomy as described previously (18). Mice were injected intramuscularly with 5mg / kg of miRIDIAN microRNA mmu-miR-423-5p mimic or miRIDIAN microRNA Mimic negative control #1 (Dharmacon) (48). Resuspended miRNAs were administered in a solution of Max suppressor RNA-LANCEr II (Bioo Scientific) according to the manufacturer's instructions. Resuspended miRNAs (25 pL) were injected at five-points (5 pL each) using a 33-gauge, small hub RN 1 -inch needle with a Hamilton syringe. Hindlimb blood flow recovery was monitored with a laser Doppler perfusion imager (LDPI) system (Moor Instrument Ltd.) after anesthesia with a ketaminedexmedetomidine solution (50 mg / kg and 0.5 mg / kg, IP). LDPI measurements were performed on days 3, 7, 14 and 21 after surgery, and then dexmedetomidine was antagonized with a solution of atipamezole (1 mg / kg, SC). Blood flow is expressed as the ratio of perfusion in the ischemic vs. nonischemic hindlimb to account for variables.

[0186] Renal ischemia-reperfusion injury model. Renal ischemia-reperfusion injury by unilateral renal artery clamping plus contralateral nephrectomy was performed as described previously (17, 27). Preparation before surgery: Sterile surgical instruments are prepared before the surgery. The body weight of each mouse is taken and recorded on the surgical sheet. Then, the mouse is anesthetized with 2-3% isoflurane and 1 L / min oxygen. Ophthalmic lubricant is administered to protect both eyes. Carprofen at a dosage of 10 mg / kg is administered subcutaneously to control pain. The fur on the abdomen region is removed using an electric shaver and cleaned with moisturized gauze. Depilatory cream is applied to the same region to clean the abdominal skin, and the cream is removed with cotton swabs. Surgery: Immediately after skin preparation, the mouse is placed on a homeothermic blanket. Surgery will not begin until the mouse is in deep anesthesia and does not respond to pain induced by a toe pinch. The surgical area is disinfected, and sterile surgical gloves are used to perform the surgery. A sterile surgical rodent drape is placed over the surgical area. Bupivacaine 0.25% (Marcaine, 2 mg / kg) is administered subcutaneously in the surgical wound area. A mid-abdominal incision is made with surgical scissors, and the abdominal cavity is exposed. The intestine is gently moved aside to expose the left kidney. The left renal pedicle is exposed using sterile cotton swabs. Dissection of the pedicle tissue is performed with ultra-fine-point tweezers to remove the tissue around the renal pedicle, exposing the blood vessels for renal pedicle clamping. A micro-aneurysm clamp isused to block blood flow to the kidney, inducing renal ischemia. Complete ischemia is indicated by a color change of the kidney from red to dark purple. After the pedicle clamping, the intestine is returned to its original position in the abdominal cavity. The surgical wound is covered with moist sterile gauze during the 30 or 60 minutes of ischemia. The mouse remains under anesthesia throughout renal artery clamping and the color of the left kidney is monitored during this period. After 30 or 60 minutes of ischemia, the micro-aneurysm clip is released from the left kidney to initiate reperfusion, indicated by the change in kidney color back to red. The nephrectomy of the right kidney is then performed. Immediately after wound closure, 0.5 mL of sterile saline and 0.3 mL of 2.5% dextrose are administered subcutaneously to each mouse. The body weight of the mouse is recorded on the surgical sheet. The animal is then kept in an incubator for recovery. The mouse is returned to its housing cage with an isopad at the bottom after it regains full consciousness. Chocolate Ensure® mixed soft food is provided. Monitoring the success of renal ischemia-reperfusion: After clamping, the kidney color should change from red to dark purple, indicative of successful renal ischemia. The immediate color change at the very beginning requires careful observation. However, the kidney will transition to a deep dark purple color several minutes later. After removing the clips, the kidney color should change back to red to indicate reperfusion. Post-op care: Each mouse is examined twice daily for the first two days after surgery to assess its general condition, body weight, surgical wound, and food intake. Carprofen at a dosage of 10 mg / kg is administered subcutaneously once daily. Additionally, 0.3 mL of 2.5% dextrose and 0.5 mL of saline are given subcutaneously twice daily, depending on the hydration status of the mouse. Chocolate Ensure® mixed soft food is provided for the mouse each day. All data are recorded on the surgical sheet. The endpoint is a loss of 20% body weight.

[0187] Subcapsular injection of miRIDIAN microRNA mmu-miR-423-5p mimic or miRIDIAN microRNA Mimic negative control #1 (Dharmacon) was performed directly after reperfusion. Resuspended miRNAs (25 pg) were administered using in v / vo-jetPEI reagent (N / P ratio: 8) according to the manufacturer's instructions (Polyplus transfection). The right kidney was then exposed, and ligation of the ureter and renal blood vessels with a 4-0 suture was performed before right kidney nephrectomy. Mice that underwent a sham operation, defined as the same procedures described above but without performing a 30 or60-minute ischemia-reperfusion injury or contralateral nephrectomy, were included in the study; Some mice underwent the same procedure as sham but with contralateral nephrectomy and are identified as sham + nephrectomy. Mice were euthanized at baseline or on days 1, 2, 7, or 21 post-surgery, and the left kidney, serum, and urine were collected. The expression levels of miR-423-5p were measured by quantitative PCR in each quadrant to validate the diffusion of the miRNA throughout the kidney.

[0188] Biochemical analysis of renal function. Blood urea nitrogen (BUN) levels were measured using the Quantichrom urea assay kit (BioAssay Systems) according to the manufacturer's instructions.Kidney processing, histological stains and immunohistochemistry. Mice were sacrificed at different time points (baseline, days 1, 2, 7 and 21). Kidneys were collected and fixed in 10% formalin, embedded in paraffin, and subsequently cut into 4-pm slices. Immunohistochemistry (IHC) staining was performed on paraffin-embedded tissue as described previously (17) using MECA-32 (120501; Biolegend), cleaved caspase-3 (CASP3) (9661; Cell Signaling Technology) or phospho-RIPK3 (ab195117; Abeam) antibodies. Stained slides were scanned using an Olympus VS110 slide scanner, and randomly chosen fields were evaluated. Quantification of MECA-32 and cleaved caspase-3 staining in peritubular capillaries (PTCs) was assessed by evaluating the ratio of positive PTCs / tubule in five high-power fields (200X) in the cortico-medullary junction. Caspase-3 activation in endothelial cells of PTCs was evaluated using sections stained for cleaved caspase-3. To ensure accurate identification, the total number of endothelial cells displaying a strong cleaved caspase-3 signal was counted based on specific localization criteria (present within a vascular structure lined by a cellular monolayer). This assessment was conducted on two consecutive sections to confirm that the observed cells were integral to the peritubular vessel wall rather than circulating cells. Rouleaux formation and Sirius Red positive areas were assessed as described previously (17, 27). Five randomly chosen high-power fields at the cortical-medullary junction (magnification 200X) were assessed. All assessments were conducted by an independent investigator who was blinded to the experimental conditions, and the results were subsequently validated by a pathologist.

[0189] Renal tubular damage. Mice were euthanized at baseline, and at 2 or 21 days following renal ischemia-reperfusion injury (IRI) via cardiac puncture. The kidneys were collected, fixed in neutral buffered formalin (ChapTec), and embedded in paraffin. Samples were sectioned into 4 pm slices and automatically stained with hematoxylin-eosin (H&E). Renal tubular damage was assessed on the H&E stained sections using the following criteria: tubular dilatation, loss of brush border, formation of luminal casts, tubular necrosis, and infiltration by polynuclear neutrophils. The extent of damaged tubules was quantified as a tubular injury score (TIS), with the following scale: 0 (no damaged tubules; normal kidney), 1 (< 10% damaged tubules; mild injury), 2 (11-25% damaged tubules; moderate injury), 3 (26-49% damaged tubules; severe injury), 4 (50-75% damaged tubules; high severe injury), and 5 (> 75% damaged tubules; extensive injury).

[0190] Renal tubular epithelial cell culture. PT-2 tubular epithelial cells (TECs) (kind gift of A. Jevnikar, Western University, London, Ontario, Canada) is a human renal tubular cell line isolated and cloned from centrifuged urine, which was obtained from a transplant recipient undergoing acute rejection (56). PT-2 cells were cultured in K1 medium constituted with following products: Dulbecco's modified Eagle's medium (DMEM): Hams F12 (50:50) (Invitrogen-Gibco), 5% fetal bovine serum (Invitrogen), hormone mix (5 pg / mL insulin, 1.25 ng / mL prostaglandin E1 , 34 pg / mL triiodothyronine, 5 pg / mL transferrin, 1.73 ng / mL sodium selenite and 18 ng / mL of hydrocortisone)and 25 ng / mL epidermal growth factor. PT-2 cells were grown in normal medium until confluence, then exposed to serum-free medium for 24 hours to generate apoptotic exosome-like vesicles.

[0191] Skeletal muscle capillary immunohistochemistry. Ischemic hindlimbs were harvested 21 days after surgery and fixed in 10% formalin. Transverse 3 mm thick tissue sections of the hindlimbs were cut at the level of the gastrocnemius muscle and paraffin embedded. IHC staining of capillaries was performed using CD34 antibody (ab81289; Abeam). Slides were scanned using an Olympus VS110 slide scanner microscope. Nine randomly chosen high-power fields (magnification 200x) were assessed. Capillaries and muscle fibers were counted at 200x magnification. The results are expressed as the ratio of capillaries to fibers per field. All assessments were done by two independent investigators blinded to experimental conditions.

[0192] Statistical analysis. All data are presented as the mean ± SEM of at least three independent experiments unless otherwise indicated. Data were compared using two-tailed Student’s t test, one-way ANOVA or stated otherwise in the legend with GraphPad Prism 5 software (GraphPad Software Inc.). A P value less than 0.05 was considered significant. (P values are reported for each experiment.).

[0193] Human studies: Participants, setting and study design. A single-center, observational, retrospective cohort study of kidney transplant recipients who participated in the University of Montreal Kidney Transplant Biobank (Centre Hospitalier de I’Universite de Montreal site) was performed. All patients who received a transplant between June 2008 and 2017 and experienced delayed graft function were eligible for inclusion if they had leftover material from a graft biopsy preimplantation and 3 to 9 months post-transplantation as well as serum banked one-month posttransplantation. Delayed graft function was defined as the need for dialysis in the first week posttransplant, failure of serum creatinine to decrease by more than 10% on 3 consecutive days posttransplant, or serum creatinine >250 pmol / L on day 5 post-transplantation in the presence of scintigraphic evidence of acute tubular necrosis, a definition previously found to be associated with lower 1-year kidney graft function (16). Post-transplantation biopsy was performed for surveillance purposes or to investigate graft dysfunction. All preimplantation biopsies were wedge biopsies, and all post-transplantation samples originated from core biopsies. Recipients of non kidney solid organ transplants were excluded. Patients were followed for 3 years after transplantation. A subset of the cohort with early biological material available (n=6) was also used to compare the contribution of different EV fractions to miR-423-5p serum levels early (8-10 days) and late (1 month) post-transplant.

[0194] Measurements. The PTC density on the post-transplantation biopsy was the primary outcome. PTC density was defined as the percentage of efficient cortical area occupied by PTC and was measured by quantifying CD34 mAb staining on immunohistochemistry using VIS, an image analysis software, as described previously (10). The secondary outcomes were the presence of fibrosis on the post-transplantation biopsy and estimated glomerular filtration rate(eGFR) 1- and 3-years post-transplantation. The percentage of fibrosis was assessed by two independent evaluators on Masson trichrome-stained slides. Any difference greater than 5% between the values reported by the 2 operators was resolved by consensus. All operators involved in scoring biopsies were blinded to miR-423-5p expression values. The operator measuring miR-423-5p expression was blinded to PTC density and fibrosis scores. The eGFR was calculated 1- and 3-years post-transplantation with the 4-variable Modification of Diet in Renal Disease (MDRD) equation (49). To identify other variables associated with PTC density and fibrosis, data on recipient age, sex, height, weight, renal disease, number of previous transplantations, pre-transplantation panel reactive antibodies, medication before and after transplantation, comorbidities, smoking habits, total ischemic time, induction and maintenance immunosuppressive protocols, allograft acute rejection occurring before or based on the posttransplantation biopsy defined per the Banff 2019 classification (55), and donor type, sex, age, height, weight, hypertension, diabetes, and cardiovascular disease, were collected. Donor comorbidities such as hypertension and diabetes were defined as the clinical diagnoses provided by the organ donation organization transplant coordinators to the transplant team. After cardiocirculatory arrest (DCD), all donors were maintained under controlled conditions (Maastricht category 3), awaiting death in the operating room. Information on the length of the agonal phase was not accessible.

[0195] Statistical analyses. Continuous variables are reported as the means and SD when normally distributed or as the medians and interquartile ranges otherwise. Categorical variables are summarized as proportions. The chi-square test (or Fisher’s exact test when the expected number of events was less than 5 in a cell) was used to compare categorical variables and Student’s t test (or the Kruskal-Wallis test when not normally distributed) to compare continuous variables between various groups. The Pearson correlation coefficient (p) was used to assess correlations between continuous variables.

[0196] Multivariable linear regression models were fit to determine whether miR-423-5p measured 1-month post-transplantation was associated with i) PTC density and ii) fibrosis on the 3-9-month post-transplantation biopsy. In the multivariable models, all variables associated with miR-423-5p or i) PTC density (Tables 1A-1B) or ii) fibrosis (Tables 2A-2B) on the 3-9-month biopsy with a p value of <0.15 were included to control for potential confounders in the initial multivariable models. MiR-423-5p levels were transformed in the natural log to improve the model fit given miR-423-5p’s skewed distribution. Given the limited sample size, the initial multivariable models were simplified by removing independent variables that were not associated with the dependent ones (p-value>0.05), if their removal did not modify the multivariable p coefficient for miR-423-5p and PTC density or fibrosis by >10%. Biopsy size was adjusted for in the multivariable model for PTC density to account for technical measurement considerations. The normalityassumption was verified by plotting the model residuals. All analyses were executed with SAS version 9.4 (Cary, NC).

[0197] Table 1A. Associations between recipient, donor and procedure characteristics on peritubular capillary density on the post-transplant biopsy in univariable analyses.

[0198]

[0199] Table 1B. Associations between recipient, donor and procedure characteristics on peritubular capillary density on the post-transplant biopsy in the initial multivariable model

[0200]

[0201] Table 2A. Associations between recipient, donor and procedure characteristics on interstitial fibrosis on the post-transplant biopsy in univariable analyses.

[0202]

[0203]

[0204] RAS: renin-angiotensin system; PRA: panel reactive antibodies

[0205] Table 2B. Associations between recipient, donor and procedure characteristics on interstitial fibrosis on the post-transplant biopsy in the initial multivariable model

[0206]

[0207] Example 2: Small extracellular vesicles produced by apoptotic endothelial cells are enriched in small RNAs.

[0208] HUVECs were first exposed to serum starvation for 4 h to induce an apoptotic response, as assessed by evidence of activation of caspase-3 and fluorescence microscopy findings showing chromatin condensation in the absence of necrotic features (FIG. 1A). Then, the miRNA profile of small EVs released by apoptotic endothelial cells was characterized. To this end, small and large EVs released by serum-starved apoptotic endothelial cells (ECs) in vitro were purified using sequential centrifugation. It was confirmed that markers of ApoExos, such as proteasome and LG3, are enriched in fractions containing small EVs whereas histone (H3), a marker of apoptotic bodies is expressed in fractions containing large endothelial vesicles. ApoExos also express certain exosome markers, such as syntenin (SDCBP), but lack others, such astetraspanins CD82. (FIG. 1Aand 1F). RNA sequencing was then used to characterize the miRNA profile of small and large extracellular vesicle fractions as well as the miRNA profile of ECs either serum-starved or maintained in normal conditions in vitro. Principal component analysis (PCA) of miRNA expression showed that microRNA profiles recovered in ApoExos were strikingly different from those found in apoptotic bodies. They were also distinct from those found in ECs (either serum starved or normal) (FIG. 1B). These results confirm that ApoExos represent a category of EVs distinct from classic apoptotic bodies. A Gene Ontology (GO) enrichment analysis coupled to Reduced + Visualized Gene Ontology (Revigo) software was then performed to gain further insights into the biological processes potentially modulated by miRNAs enriched in ApoExos. Strong signals for pathways regulating circulatory system development, endothelial proliferation, migration and angiogenesis as well as regulation of biosynthetic and metabolic processes were found (FIG. 1C).

[0209] The focus was then put on microRNAs overexpressed in ApoExos (with FPKM > 6000 and the expression fold change > 2 for both biological replicates, when compared to apoptotic bodies as well as to serum-starved and normal ECs). Three miRNAs (miR-423-5p, let-7b-5p and let-7c-5p) met these selection criteria and among them, miR-423-5p was the most highly enriched as represented in the hierarchical clustering (FIG. 1D). Although let-7a-5p, a member of the let-7 family, was not meeting the established criteria for the other three miRNAs, its potential enrichment was investigated since it was highly expressed in ApoExo. Sequential centrifugation and RT-qPCR were then used to compare miR-423-5p, let-7a-5p, let-7b-5p and let-7c-5p levels in small (ApoExo) and large (Apoptotic bodies) EVs produced by apoptotic endothelial cells as well as levels in small (exosome) and large (microvesicles) EVs produced by healthy endothelial cells. RT-qPCR confirmed that the expression levels of miR-423-5p, let-7b-5p and let-7c-5p were highest in fractions containing ApoExo, followed by fractions containing large EVs produced by either ECs maintained in normal culture conditions or serum starved (FIGs. 1D-F). Let-7a-5p exhibited high expression in both types of vesicles secreted by serum-starved cells, as well as in large EVs from cells maintained in normal culture conditions. In contrast, small EVs from cells in normal culture conditions showed minimal expression of let-7a-5p. miR-423-5p levels within purified ApoExos originating from renal tubular epithelial cells under serum starvation was also assessed. Although renal tubular epithelial cells undergoing apoptosis can release small EVs bearing exosome marker (SDCBP) and ApoExo markers, such as the 20S proteasome (18), it was found that ApoExos released by renal epithelial cells did not overexpress miR-423-5p, let-7b-5p and let-7c-5p (FIGs. 1G-H). The results presented in FIGs. 11-K show the selective enrichment of miR-30a-3p in apoptotic exosomes and induction of its overexpression in endothelial cells. miR-30a-3p expression was shown to be enriched in ApoExos relative to apoptotic bodies and HUVECs (FIG. 11). RT-qPCR analyses confirm that this enrichment is also significant relative to conventional exosomes produced by endothelial cells, following a profilesimilar to that of miR-423-5p and let-7b-5p (FIG. 1J). Finally, as shown in FIG. 1K, endothelial cells treated with ApoExos for 24 h show overexpression of miR-30a-3p.

[0210] Collectively, these results identify miR-423-5p, let-7b-5p, let-7-c-5p and miR-30a-3p as markers of endothelial EVs.

[0211] Example 3: miR-423-5p serum levels predict microvascular rarefaction after acute kidney injury.

[0212] It was next evaluated whether circulating miR-423-5p, let-7b-5p and let-7c-5p levels in vivo after renal IRI behave as other ApoExo markers, such as LG3 and 20S proteasome. Renal artery clamping for 30 min followed by reperfusion induced significant renal dysfunction with an early increase in blood urea nitrogen levels returning to baseline after 21 days (FIG. 2A).

[0213] Rouleaux formation, a marker of microvascular congestion, increased progressively after renal IRI for up to 21 days (FIG. 2B). Caspase-3 activation in PTCs increased on the first day post- IRI , plateaued on days 2 and 7, and decreased but remained elevated on day 21 post-IRI when compared to baseline (FIG. 2C). This was associated, at 7 and 21 days post-IRI, with a decline in mouse endothelial cell antigen 32 (MECA-32) staining, a marker of microvascular endothelial cells (FIG. 2D), indicating progressive microvascular rarefaction.

[0214] Circulating ApoExo levels after renal IRI were monitored with two different methods assessing 20S proteasome activity: measurement of caspase-like proteasome activity in serum fractions of small EVs purified by sequential centrifugation and small particle flow cytometry using a fluorescent probe for active 20S proteasome. Both methods showed increased levels of proteasome activity in the first 2 days after renal IRI followed by a progressive decline at 7 and 21 days (FIG. 2E). Small particle flow cytometry confirmed that increased proteasome activity was recovered within annexin+ and proteasome+ small EVs (FIG.2E). MiR-423-5p, let-7b-5p and let-7c-5p assessed in total non-fractionated serum followed a similar pattern (FIGs. 2F-H), and their levels were highly correlated with one another (FIG. 2I). MiR-361-5p, a negative control which was not identified within ApoExo by RNA sequencing, was not modulated in the early phase of acute kidney injury (FIG. 2J).

[0215] The proportion of total serum miR-423-5p, let-7b and let-7c that are accounted for by EVs. was then evaluated. To this end, serum was treated with RNAse with or without Triton™ X-100 and miR-423-5p, let-7b and let-7c levels were assessed by RT-qPCR. MicroRNAs cargoed by EVs are not degraded by RNAse treatment in the absence of Triton™ X-100 whereas free RNA is degraded. RNAse treatment without Triton™ X-100 did not significantly reduce miR-423-5p, but reduced significantly let-7b-5p and let-7c-5p levels. This suggests that the majority of circulating miR-423-5p is cargoed by EVs while let-7b-5p and let-7c-5p are found both in EVs and in vesicle-free form (FIGs. 2G and 2K). Since miR-423-5p was the most enriched in endothelialApoExo in vitro and showed circulating levels in vivo that closely parallel those of circulating small EVs, it was decided to focus on miR-423-5p for subsequent studies.

[0216] Both mild and severe forms of renal IRI with 30 and 60 min of renal artery clamping, respectively, were used to evaluate the levels of miR-423-5p at 21 days post-renal IRI, as compared to those of sham-treated mice. Mice exposed to severe ischemia showed higher blood urea nitrogen levels than mice exposed to mild ischemia at 1-2 days post-IRI, with levels higher, although non-significantly at 7-21 days post-IRI (FIG. 3F). Microvascular rarefaction and fibrosis, as evaluated by immunostaining for MECA-32 and Sirius Red staining, respectively, were increased in mice with IRI compared to sham-treated mice and were higher in mice with 60 min of renal artery clamping (FIG. 3A). Whole-serum levels of miR-423-5p were then assessed in mice exposed to mild or severe IRI. In both groups, increased levels of miR-423-5p were observed in the first 2 days after renal IRI, followed by a progressive decline until 21 days. While the peak level of miR-423-5p occurred earlier in the severe form of IRI, it was lower compared to the mild group (FIGs. 3B and 3G). This suggested the possibility that non-apoptotic forms of cell death could be activated in the severe group. Analysis of apoptosis and necroptosis levels in PTCs on days 1 and 2 post-IRI revealed stronger activation of caspase-3 in the severe group on day 1 and increased activation of phosphorylated receptor interacting serine / threonine kinase 3 (RIPK3), a marker of necroptosis, at both time points (FIGs.3H-I). This reorientation of PTC cell death toward necroptosis, a form of cell death not associated with ApoExo release (20), could explain the earlier but lower peak of miR-423-5p expression in mice with severe IRI. In both IRI groups, miR-423-5p levels at 21 days were significantly lower than sham-treated mice at 21 days and mice at baseline (Pre) (FIG. 3B). They were also significantly lower in mice with severe IRI than in mice with mild IRI. MiR-423-5p serum levels at 21 days post-IRI strongly correlated with renal microvascular density and inversely correlated with collagen deposition (FIG.3C). It was also evaluated whether contralateral nephrectomy was contributing to miR423-5p levels in the model. To this end, contralateral nephrectomy was performed in absence of renal IRI. Nephrectomy alone did not induce tubular damage at 2 days, did not increase miR-423-5p levels, nor levels of ApoExos markers LG3 and 20S proteasome suggesting that the peak in circulating miR-423-5p is a consequence of ischemia-reperfusion (FIGs. 3J-L). Collectively, and as opposed to findings in the early phase of acute kidney injury, these results show that at a distance from IRI, higher miR-423-5p levels are associated with better microvascular density, reduced fibrosis and better-preserved renal function.

[0217] These results prompted to test the hypothesis that, at later time points after renal IRI, miR-423-5p serum levels are accounted for by caspase-3-independent EVs, such as microvesicles. To evaluate this possibility, small EVs (containing ApoExos and exosomes) and large EVs (containing apoptotic bodies and microvesicles) were isolated from the serum of mice exposed to IRI for 30 min and the expression of endothelial (MECA-32), ApoExo (LG3 and 20Sproteasome) and general markers of EVs (CD82 and p-actin) as well as miR-423-5p levels were measured. In the early phase of acute kidney injury, 20S proteasome and LG3 levels significantly increased in fractions containing small-size EVs. The endothelial marker MECA-32 was also significantly increased in the same fractions. In contrast, at 21 days post-IRI, MECA-32 expression was present both in small and large EVs fractions (FIG. 3D). The distribution of miR-423-5p expression in the various extracellular vesicle fractions overtime paralleled that of MECA-32 (FIG. 3E). To further confirm that serum levels of miR-423-5p at later time points are independent of caspase-3 activation, miR-423-5p serum levels were assessed in caspase-3 - / -mice exposed to IRI, which were previously shown to exhibit better preservation of microvascular integrity and better long-term kidney function (17, 27), as well as a higher survival rate following severe IRI (FIG. 4A). At 21 days post-IRI, caspase-3- / - mice exposed to renal IRI showed significantly higher miR-423-5p serum levels than wild-type controls as well as better preservation of PTC integrity, as evaluated with MECA-32 staining, and reduced fibrosis (FIGs. 4B-D). To further test the possibility that miR-423-5p is released within small EVs through caspasedependent pathways and in large EVs through caspase-independent pathways, HUVEC, either in normal culture conditions or serum-starved, were exposed to the pan-caspase inhibitor zVAD-Fmk. MiR-423-5p levels were significantly lower in small-extracellular vesicle fractions originating from zVAD-Fmk-treated serum-starved HUVEC whereas miR-423-5p levels were unaltered by zVAD-FMK in large extracellular vesicle fractions (FIG.4E). Collectively, these results show that, in the early phase of acute kidney injury, miR-423-5p is cargoed in circulation by small EVs bearing endothelial markers while in the long term after renal IRI, circulating miR-423-5p is cargoed by non-caspase-3-dependent EVs, with an increased contribution of large size EVs.

[0218] Example 4: Lower miR-423-5p serum levels are associated with microvascular rarefaction in kidney transplant recipients with delayed graft function.

[0219] To assess whether these observations hold true in humans, it was first confirmed that miR-423-5p, let-7b-5p and let-7c-5p were all detectable in sera from renal transplant recipients one month post-transplantation. In humans, as in mice, total serum levels of miR-423-5p, let-7b-5p and let-7c-5p were highly correlated with one another (FIG.5F). The three miRNA levels were then compared in total serum and pooled fractions of EVs purified from human serum. Similar levels of miR-423-5p were found in whole serum and pooled extracellular vesicle fractions whereas levels of let-7b-5p and let-7c-5p in pooled vesicle fractions were significantly lower than those measured in total serum (FIG. 5G). These results suggest that the vast majority miR423-5p found in circulation stems from circulating EVs whereas circulating let-7b-5p and let-7c-5p levels are found both in EVs and in vesicle-free form. Based on these results, it was decided to focus on miR-423-5p for subsequent studies, as its association with circulating vesicles would increase its stability and its potential use as a biomarker of microvascular injury. In patients withdelayed graft function, it was then evaluated whether miR-423-5p serum levels measured 1-month post-transplantation were predictive of microvascular rarefaction on the protocol biopsy performed between 3 and 9 months post-transplantation. These time points were chosen based on availability of serum samples and to parallel those measured at 21 days post-IRI in mice, reflecting a transition toward the chronic phase of acute kidney injury. After applying the exclusion criteria, 51 patients with delayed graft function were included in the analytical cohort (FIG. 5J).

[0220] The main patient characteristics are presented in Table 3. The distribution of serum miR-423-5p was skewed to the right with a median of 590 copies / pL (interquartile range (IQR 328-1321)) (FIG.

[0221] 5H) and miR-423-5p levels were lower when thymoglobulin was used as induction immunosuppression (p value = 0.03), and there was a trend for lower levels in female recipients (p value = 0.07). A correlation between miR-423-5p serum levels measured 1 -month posttransplantation and PTC density on the post-transplantation biopsy was observed (p = 0.33, p value = 0.02) (FIG. 5A). A trend for a negative correlation between miR-423-5p 1 -month serum levels and fibrosis on the post-transplantation biopsy (p = -0.28, p value = 0.054) was also observed (FIG. 5B). Both the PTC density (p = 0.37, p value = 0.008) and fibrosis (p = -0.30, p value = 0.04) on the 3-9-month post-transplantation biopsy were associated with the eGFR at 3 years post-transplantation (FIG. 5C).

[0222] Table 3: Characteristics of patients who underwent a kidney transplant at CHUM between 2008 and 2017 who experienced delayed graft function and for whom graft biopsies and sera were available pre- and post-transplantation (n=51).

[0223]

[0224]

[0225] SD: standard deviation; RAS: Renin-angiotensin-system; IQR: interquartile range * Association between miR-423-5p values and use of thymoglobulin (p = 0.03) and recipient sex (p = 0.07). MiR-423-5p levels were not associated with other

[0226] baseline donor and recipient characteristics. P values were obtained by Kruskal- Wallis.

[0227] In multivariable analyses (Table 4), it was found that higher levels of miR-423-5p 1-month post-transplantation were associated with a higher PTC density on the post-transplantation biopsy (adjusted difference (AD): +0.9% per 1 natural log higher in miR-423-5p levels, 95% confidence interval (Cl) 0.4, 1.4, p = 0.002) in a model that was adjusted for recipient sex, use of hypothermic pump during organ transportation, use of statins at transplant and PTC density on the pre-transplantation biopsy. The univariable analysis results are presented in Table 1A, while the initial multivariable model is presented in Table 1B. It was also found that higher miR-423-5p levels 1 -month post-transplantation were associated with less fibrosis on the post-transplantation biopsy (AD: -4.6% for a 1 natural log higher in miR-423-5p levels, 95% Cl -8.2, -0.9, p = 0.02)) (Table 5). Fibrosis on the post-transplantation biopsy was also associated with donor age (AD:+3.0% per 10 years higher, 95% Cl 0.9, 5.0) and with the occurrence of rejection before or on the 3-9 post-transplant biopsy (AD: +7.3, 95% Cl 0.5, 14.1). The univariable analysis results are presented in Table 2A while the initial multivariable model is presented in Table 2B. Altogether, these results suggest that in humans, as in mice, lower circulating miR-423-5p levels at a distance from IRI-induced acute kidney injury are associated with low PTC density and high renal fibrosis, both of which are associated with lower renal function in the long term.

[0228] Table 4: Associations of miR-423-5p and other clinical characteristics with peritubular capillary density based on the post-transplantation biopsy (n=51).

[0229]

[0230] considerations in peritubular capillary density measurement

[0231] Table 5: Associations of miR-423-5p and other clinical characteristics with fibrosis based on the post-transplantation biopsy (n=51).

[0232]

[0233] In a subset of patients for whom serial serum samples were available posttransplantation, it was then evaluated, whether different types of EVs contribute to miR-423-5p serum levels over time after transplantation. In the early postoperative period (8-10 days posttransplantation), the majority of the miR-423-5p signal was recovered in fractions of small EVs positive for the endothelial marker PECAM1 and for ApoExo markers (20S proteasome a3 and LG3). At one-month post-transplantation, there was an increasing contribution from fractions containing large EVs and showing increased positivity for PECAM1, in absence of 20Sproteasome and LG3 reactivity (FIGs. 5D-E and I). Collectively, these findings demonstrate that in humans, as in mice, the early increase in miR-423-5p levels after renal IRI is associated with the release of ApoExos bearing endothelial markers, while in the long term, circulating miR-423-5p levels are increasingly accounted for by endothelial-derived large EVs and reflect PTC density.

[0234] Example 5: MIR-423-5p attenuates microvascular injury and prevents renal fibrogenesis after acute kidney injury.

[0235] The positive correlation observed between miR-423-5p serum levels assessed at a distance from renal IRI and the preservation of microvascular integrity led to test the hypothesis that miR-423-5p actively contributes to microvascular homeostasis and repair, as suggested by the GO term enrichment analysis (FIG. 1C). Using renal subcapsular injections of miR-423-5p or control mimic miRNA at the time renal IRI, it was investigated whether enhancing miR-423-5p expression prevents long-term microvascular rarefaction and renal fibrosis. It was confirmed that miR-423-5p injection leads to significant renal overexpression throughout the entire kidney 2 days post-IRI. A significant increase in miR-423-5p levels was also observed in three kidney segments (Q2-4), with an upward trend noted in one of the quarters furthest from the injection site. (FIG.

[0236] 6C). Thus, subcapsular injection facilitates the delivery of miR-423-5p beneath the renal capsule, promoting the diffusion of the miRNA throughout the kidney, in contrast to a localized injection. While BUN levels or IRI-induced tubular damage in the short term were not modulated (FIGs. 6D-E), caspase-3 activation and rouleaux formation in PTC were significantly attenuated by subcapsular injection of miR-423-5p (FIG. 6A). MiR-423-5p-injected mice showed reduced PTC rarefaction and decreased fibrosis 21 days post-IRI compared to mimic miRNA-injected controls (FIG. 6B).

[0237] Example 6: miR-423-5p increases VEGFA levels and promotes endothelial migration and angiogenesis.

[0238] The potential molecular mechanisms supporting the renoprotective effect of miR-423-5p was then explored. To this end, miR-423-5p was overexpressed in endothelial cells in vitro (FIG.

[0239] 7D) and a proteomic analysis was conducted. Cells transfected with miR-423-5p exhibited a distinct protein signature compared to those transfected with control miRNA. Proteomic analysis revealed that the overexpression of miR-423-5p led to an increase in the expression of 84 proteins and a decrease in 56 proteins (FIGs. 7A-B). Enrichment analyses for biological processes, WikiPathways, and Reactome pathways indicated several pathways associated with cell survival and pro-angiogenic mechanisms contributing to vascular integrity (FIG. 7C). Overexpression of miR-423-5p in endothelial cells in vitro also led to significant increases in HIF1A and VEGFA mRNA expression levels (FIG. 7E). Subsequently, transfected endothelial cells were exposed to serum-free medium, a well-known pro-apoptotic stimulus. Reduced apoptosis levels were found,as evaluated by the cleavage of poly(ADP-ribose) polymerase 1 (PARP1) and caspase-3 / 7 activity, in endothelial cells overexpressing miR-423-5p compared to cells overexpressing scrambled miRNA (FIGs. 8A-B). Given that endothelial migration and angiogenesis are key to microvascular repair after IRI, it was also investigated whether inducing transient overexpression of miR-423-5p in endothelial cells modulates migration and angiogenesis. Endothelial cells overexpressing miR-423-5p exhibited significantly increased wound closure compared to control cells, along with enhanced angiogenesis (FIGs. 8C-E). The impact of miR-423-5p injections on angiogenesis in vivo was then tested in a model of femoral arteriectomy in mice where hindlimb reperfusion depends entirely on the development of new blood vessels (28). It was validated that intramuscular injection of miR-423-5p induced significant overexpression of the miRNA throughout the entire muscle 3 days post-surgery (FIG. 9A). Mice receiving intramuscular miR-423-5p injections at the time of femoral arteriectomy showed increased Doppler flow rate recovery at days 7 and 14 as compared to controls injected with microRNA mimic negative control (FIG.

[0240] 9B). The number of CD34+ capillaries was also significantly increased 3 weeks post-femoral artery ligation in mice injected with miR-423-5p when compared to control miRs (FIG. 9C).

[0241] Altogether, these findings identify a key role for miR-423-5p in controlling renal microvascular homeostasis and repair. The enhanced release of miR-423-5p cargoed by endothelial ApoExos early after renal IRI is likely aimed at protecting the microvasculature during periods of acute stress. In the long term, however, major loss of PTC, such as the one observed after severe renal IRI, would limit the capacity to release large endothelial EVs expressing miR-423-5p, therefore hampering completion of microvascular repair. Increasing miR-423-5p levels through exogenous injections highlights new avenues for preventing renal microvascular loss as well as fibrosis and progressive renal dysfunction.

[0242] Example 7: Additional studies on the association between certain miRNAs, microvascular rarefaction, endothelial cell apoptosis and kidney transplant outcome.

[0243] FIGs. 10A-10B show that circulating levels of miR-423-5p, miR-122-5p, let-7b-5p, and let-7c-5p are correlated in mice following renal ischemia reperfusion. The levels of these miRNAs sharply increase at day 2 following renal ischemia reperfusion, and gradually decrease thereafter. This was not observed with two irrelevant miRNAs, miR-451a, and miR-361-5p. Also, as shown in FIGs. 10C-10D, circulating levels of let-7b-5p and let-7c-5p are significantly lower at 21 days relative to the baseline levels, as observed with circulating levels of miR-423-5p.

[0244] FIG. 11A-D show that age is associated with increased activation of caspase-3 within the peritubular capillaries alongside an increase in microvascular rarefaction and fibrosis. This reduction in peritubular capillaries correlates with lower levels of miR-423-5p. FIG. 12 shows that age is also associated with increased activation of caspase-3 within the cardiac and pulmonary capillaries, similar to what is observed in the kidney. These results suggest that the decrease incirculating serum levels of miR-423-5p observed with age might represent the microvascular state in multiple organs and not just in the kidney. As older individuals are at increased risk of diseases associated with microvascular dysfunction and rarefaction (hypertension, dementia, heat failure), these results suggest that low levels of miR-423-5p, let-7b-5p and let-7b-5c could predict the risk of developing these other complications of microvascular dysfunction.

[0245] FIG. 13A shows that the circulating levels of miR-423-5p, miR-122-5p, let-7a-5p, let-7b-5p, and let-7c-5p are correlated with each other one-month post-transplant in kidney transplant patients with significant ischemia-reperfusion at the time of transplantation (manifested by delayed graft function). FIG. 13B shows that circulating serum levels of miR-423-5p and miR-30a-3p at 1 -month post-transplant are correlated with each other. Also, as shown in FIG. 13C, the serum levels of miR-423-5p and let-7a-5p in patients who underwent kidney transplantation and exhibited delayed graft function (DGF) one month after transplantation correlate with the microvascular density in renal peritubular capillaries on the post-transplant biopsy performed between 3-9 months. FIG. 14 shows that the circulating serum levels of miR-423-5p are lower in patients with severe rejection affecting renal vascularization relative to kidney transplant patients without rejection. Renal rejection affecting vascularization is associated with a high risk of progressive renal graft failure and also an increased risk of renal graft loss. Circulating levels of miR-423-5p and miR-30a-3p in kidney transplant patients with significant ischemia-reperfusion injury at the time of transplantation (as evidenced by delayed graft function).

[0246] FIGs 15A-15B show that there is an inverse correlation between the age of living kidney donors and the circulating plasma level of miR-423-5p measured before kidney donation. This correlation becomes significant in male living donors but is not significant in female living donors. As aging progresses, microvascular rarefaction increases, which could lead to a decrease in circulating miR-423-5p levels. It is also known that men are more sensitive to age-associated microvascular rarefaction relative to women (57).

[0247] FIG. 16 shows that the expression of PCSK5 increases neovascularization following femoral arteriectomy in mice. PSCK5 mRNA, an RNA that is transported in the same extracellular structures as microRNAs, promotes enhanced repair in a femoral arteriectomy model.

[0248] FIGs. 17A-17C show that the combination of miR-423-5p, let-7b-5p, and let-7c-5p, at individual concentrations insufficient to exhibit a significant effect, leads to increased migratory activity, angiogenesis, and resistance to apoptosis, providing evidence that they act synergistically.

[0249] FIG. 17D shows that the combination of miR-423-5p and miR-30a-3p, at individual concentrations insufficient to produce a significant effect, leads to increased angiogenesis, providing evidence that they act synergistically.Example 8: Assessment of miR-423-5p levels in total serum, small extracellular vesicles and large extracellular vesicles.

[0250] The serum levels of miR-423-5p were evaluated in both the total serum and in small and large extracellular vesicles present in the serum 1 -month post-transplant in a cohort of kidney transplant patients who had received a graft from a deceased donor, either brain-dead (DDN) or following cardiac arrest (DCD), n = 54. Compared to the serum levels of miR-423-5p measured in the total serum or in small extracellular vesicles, a better association with microvascular density of renal peritubular capillaries (FIG. 18A) and fibrosis (FIG. 18B, top panels) on the posttransplant biopsy performed between 3-9 months, as well as with renal function 1-year (FIG. 18B, middle panels) and 3-year (FIG. 18B, lower panels) post-transplant, is shown by the serum levels of miR-423-5p measured in large extracellular vesicles.

[0251] Example 9: Caspase-3 Activation in Alveolar Capillaries, Microvascular Rarefaction, and Plasma Level of miR-423-5p in a Mouse Model of Acute Lung Injury. Caspase-3 activation, microvascular rarefaction and miR-423-5p levels were assessed in the bleomycin-induced mouse model of acute lung injury. Bleomycin instillation is associated with increased caspase-3 activation at 7 days within the alveolar capillaries (FIG. 19A), alongside increased microvascular rarefaction 7 days post-instillation (FIG. 19B). This reduction in alveolar capillaries is linked to lower plasma levels of miR-423-5p (FIG. 19C). These results demonstrate that low levels of miR-423-5p following acute lung damage are associated with capillary loss in lungs, which is consistent with the observations made in kidneys (Examples 3 and 4), thus providing evidence that lower plasma levels of miR-423-5p are associated with microvascular rarefaction / capillary loss following injury in various organs / tissues.

[0252] Example 10: Plasma level of miR-423-5p in a mouse model of cardiac ischemiareperfusion

[0253] It was next assessed whether circulating levels of miR-423-5p are decreased following cardiac injury. As shown in FIG. 20, lower circulating plasma levels of miR-423-5p were detected at day 21 in mice previously subjected to myocardial ischemia-reperfusion. These results showing that lowered circulating levels of miR-423-5p are observed after a cardiac ischemia-reperfusion episode are consistent with results obtained in kidneys (Examples 3 and 4) and lungs (Example 9), and provide further evidence that low circulating plasma levels of miR-423-5p are indicative of a microvascular rarefaction / capillary loss following injury in various organs / tissues.

[0254] Although the present invention has been described hereinabove by way of specific embodiments thereof, it can be modified, without departing from the spirit and nature of the subject invention as defined in the appended claims. In the claims, the word "comprising" is used as an open-ended term, substantially equivalent to the phrase "including, but not limited to". Thesingular forms "a", "an" and "the" include corresponding plural references unless the context clearly dictates otherwise.

[0255] REFERENCES

[0256] 1. Bedford M, et al. Acute kidney injury and CKD: chicken or egg? Am J Kidney Dis.

[0257] 2012;59(4):485-491.

[0258] 2. Lo LJ, et al. Dialysis-requiring acute renal failure increases the risk of progressive chronic kidney disease. Kidney Int. 2009;76(8):893-899.

[0259] 3. Cavaille-Coll M, et al. Summary of FDA workshop on ischemia reperfusion injury in kidney transplantation. Am J Transplant. 2013; 13(5): 1134-1148.

[0260] 4. Lechevallier E, et al. Posttransplantation acute tubular necrosis: risk factors and implications for graft survival. Am J Kidney Dis. 1998;32(6):984-991.

[0261] 5. Irish WD, et al. Nomogram for predicting the likelihood of delayed graft function in adult cadaveric renal transplant recipients. J Am Soc Nephrol. 2003;14(11):2967-2974.

[0262] 6. Basile DP. The endothelial cell in ischemic acute kidney injury: implications for acute and chronic function. Kidney Int. 2007;72(2):151-156.

[0263] 7. Hannan M, et al. Risk Factors for CKD Progression: Overview of Findings from the CRIC Study. Clin J Am Soc Nephrol. 2021 ;16(4):648-659.

[0264] 8. Mannon RB. Delayed Graft Function: The AKI of Kidney Transplantation. Nephron.

[0265] 2018;140(2):94-98.

[0266] 9. Steegh FM, et al. Early loss of peritubular capillaries after kidney transplantation. J Am Soc Nephrol. 2011 ;22(6): 1024- 1029.

[0267] 10. Doreille A, et al. Acute Kidney Injury, Microvascular Rarefaction, and Estimated Glomerular Filtration Rate in Kidney Transplant Recipients. Clin J Am Soc Nephrol.

[0268] 2021 ;16(3):415-426.

[0269] 11. Molitoris BA. Therapeutic translation in acute kidney injury: the epithelial / endothelial axis. J Clin Invest. 2014;124(6):2355-2363.

[0270] 12. Basile DP, et al. Renal ischemia reperfusion inhibits VEGF expression and induces ADAMTS-1, a novel VEGF inhibitor. Am J Physiol Renal Physiol. 2008;294(4):F928-936.

[0271] 13. Hbrbelt M, et al. Acute and chronic microvascular alterations in a mouse model of ischemic acute kidney injury. Am J Physiol Renal Physiol. 2007;293(3):F688-695.

[0272] 14. Leonard EC, et al. VEGF-121 preserves renal microvessel structure and ameliorates secondary renal disease following acute kidney injury. Am J Physiol Renal Physiol.

[0273] 2008;295(6):F1648-1657.

[0274] 15. Zhang X, et al. Prevention of renal ischemic injury by silencing the expression of renal caspase 3 and caspase 8. Transplantation. 2006;82(12):1728-1732.16. Yang B, et al. Anti-LG3 Antibodies Aggravate Renal Ischemia-Reperfusion Injury and Long-Term Renal Allograft Dysfunction. Am J Transplant. 2016; 16(12):3416-3429.

[0275] 17. Lan S, et al. Caspase-3-dependent peritubular capillary dysfunction is pivotal for the transition from acute to chronic kidney disease after acute ischemia-reperfusion injury. Am J Physiol Renal Physiol. 2021;321(3):F335-f351.

[0276] 18. Dieude M, et al. The 20S proteasome core, active within apoptotic exosome-like vesicles, induces autoantibody production and accelerates rejection. Sci Transl Med.

[0277] 2015;7(318):318ra200.

[0278] 19. Migneault F, et al. Apoptotic exosome-like vesicles regulate endothelial gene expression, inflammatory signaling, and function through the NF-KB signaling pathway. Sci Rep.

[0279] 2020;10(1):12562.

[0280] 20. Beillevaire D, et al. Autolysosomes and caspase-3 control the biogenesis and release of immunogenic apoptotic exosomes. Cell Death Dis. 2022; 13(2): 145.

[0281] 21. Brodeur A, et al. Apoptotic exosome-like vesicles transfer specific and functional mRNAs to endothelial cells by phosphatidylserine-dependent macropinocytosis. Cell Death Dis.

[0282] 2023; 14(7) :449.

[0283] 22. Dieude M, et al. Extracellular vesicles derived from injured vascular tissue promote the formation of tertiary lymphoid structures in vascular allografts. Am J Transplant. 2020;20(3):726-738.

[0284] 23. Dieude M, et al. The Impact of Programmed Cell Death on the Formation of Tertiary Lymphoid Structures. Front Immunol. 2021; 12:696311.

[0285] 24. Thery C, et al. Minimal information for studies of extracellular vesicles 2018 (MISEV2018): a position statement of the International Society for Extracellular Vesicles and update of the MISEV2014 guidelines. J Extracell Vesicles. 2018;7(1):1535750.

[0286] 25. Hardy MP, et al. Apoptotic endothelial cells release small extracellular vesicles loaded with immunostimulatory viral-like RNAs. Sci Rep. 2019;9(1):7203.

[0287] 26. Backes C, et al. Specific miRNA Disease Biomarkers in Blood, Serum and Plasma: Challenges and Prospects. Mol Diagn Ther. 2016;20(6):509-518.

[0288] 27. Yang B, et al. Caspase-3 Is a Pivotal Regulator of Microvascular Rarefaction and Renal Fibrosis after Ischemia-Reperfusion Injury. J Am Soc Nephrol. 2018;29(7):1900-1916.

[0289] 28. Aref Z, et al. Variations in Surgical Procedures for Inducing Hind Limb Ischemia in Mice and the Impact of These Variations on Neovascularization Assessment. Int J Mol Sci.

[0290] 2019;20(15).

[0291] 29. Xu Y, et al. miR-423-5p suppresses high-glucose-induced podocyte injury by targeting Nox4. Biochem Biophys Res Commun. 2018;505(2):339-345.30. Barbagallo C, et al. Upregulated microRNAs in membranous glomerulonephropathy are associated with significant downregulation of IL6 and MYC mRNAs. J Cell Physiol.

[0292] 2019;234(8):12625-12636.

[0293] 31. Yuan XP, et al. MicroRNA-423-5p facilitates hypoxia / reoxygenation-induced apoptosis in renal proximal tubular epithelial cells by targeting GSTM1 via endoplasmic reticulum stress. Oncotarget. 2017;8(47):82064-82077.

[0294] 32. Muralidharan J, et al. Extracellular microRNA signature in chronic kidney disease. Am J Physiol Renal Physiol. 2017;312(6):F982-f991.

[0295] 33. Wu X, et al. LncRNA NEAT 1 Accelerates the Proliferation, Oxidative Stress, Inflammation, and Fibrosis and Suppresses the Apoptosis Through the miR-423-5p / GLIPR2 Axis in Diabetic Nephropathy. J Cardiovasc Pharmacol. 2022;79(3):342-354.

[0296] 34. Zhang H, et al. MicroRNA-423-5p as a biomarker for early diagnosis and outcome prediction of acute kidney injury in patients with acute decompensated heart failure. Int J Urol.

[0297] 2021 ;28(1):25-32.

[0298] 35. Tolonen AM, et al. Inhibition of Let-7 microRNA attenuates myocardial remodeling and improves cardiac function postinfarction in mice. Pharmacol Res Perspect. 2014;2(4):e00056.

[0299] 36. Zhu Y, et al. Extracellular vesicles derived from human adipose-derived stem cells promote the exogenous angiogenesis of fat grafts via the let-7 / AGO1A / EGF signalling pathway. Sci Rep. 2020;10(1):5313.

[0300] 37. Aday S, et al. Bioinspired artificial exosomes based on lipid nanoparticles carrying let-7b-5p promote angiogenesis in vitro and in vivo. Mol Ther. 2021;29(7):2239-2252.

[0301] 38. Carter N, et al. Endothelial cell-derived extracellular vesicles impair the angiogenic response of coronary artery endothelial cells. Front Cardiovasc Med. 2022;9:923081.

[0302] 39. Zhou Q, et al. let-7 Contributes to Diabetic Retinopathy but Represses Pathological Ocular Angiogenesis. Mol Cell Biol. 2017;37(16).

[0303] 40. Chen Z, et al. Hypoxia-responsive miRNAs target argonaute 1 to promote angiogenesis. J Clin Invest. 2013;123(3):1057-1067.

[0304] 41. Zhao C, and Popel AS. Computational Model of MicroRNA Control of HIF-VEGF Pathway: Insights into the Pathophysiology of Ischemic Vascular Disease and Cancer. PLoS Comput Biol.

[0305] 2015;11 (11):e1004612.

[0306] 42. Lv W, et al. Therapeutic potential of microRNAs for the treatment of renal fibrosis and CKD. Physiol Genomics. 2018;50(1):20-34.

[0307] 43. Geback T, et al. TScratch: a novel and simple software tool for automated analysis of monolayer wound healing assays. Biotechniques. 2009;46(4):265-274.

[0308] 44. Carpentier G. Angiogenesis Analyzer for Imaged - Gilles Carpentier Research Web Site: Computer Image Analysis. Available at: http: / / image.bio.methods.free.fr / lmageJ / 7Angiogenesis-Analyzerfor-lmageJ&artpage=2-6. Accessed November 02, 2016.45. Marcoux G, et al. Revealing the diversity of extracellular vesicles using high-dimensional flow cytometry analyses. Sci Rep. 2016;6:35928.

[0309] 46. Rousseau M, et al. Detection and quantification of microparticles from different cellular lineages using flow cytometry. Evaluation of the impact of secreted phospholipase A2 on microparticle assessment. PLoS One. 2015;10(1):e0116812.

[0310] 47. Lee SH, et al. Hypoxia accelerates vascular repair of endothelial colony-forming cells on ischemic injury via STAT3-BCL3 axis. Stem Cell Res Ther. 2015;6:139.

[0311] 48. Desjarlais M, et al. Forced expression of microRNA-146b reduces TRAF6-dependent inflammation and improves ischemia-induced neovascularization in hypercholesterolemic conditions. Atherosclerosis. 2019;289:73-84.

[0312] 49. Levey AS, et al. Expressing the Modification of Diet in Renal Disease Study equation for estimating glomerular filtration rate with standardized serum creatinine values. Clin Chem.

[0313] 2007;53(4):766-772.

[0314] 50. Migneault F, et al. Apoptotic exosome-like vesicles regulate endothelial gene expression, inflammatory signaling, and function through the NF-KB signaling pathway. Sci Rep.

[0315] 2020;10(1):12562.

[0316] 51. Geback T, et al. TScratch: a novel and simple software tool for automated analysis of monolayer wound healing assays. Biotechniques. 2009;46(4):265-274.

[0317] 52. Carpentier G. Angiogenesis Analyzer for Imaged - Gilles Carpentier Research Web Site: Computer Image Analysis. Available at: http: / / image.bio.methods.free.fr / lmageJ / 7Angiogenesis-Analyzerfor-lmageJ&artpage=2-6. Accessed November 02, 2016.

[0318] 53. Marcoux G, et al. Revealing the diversity of extracellular vesicles using high-dimensional flow cytometry analyses. Sci Rep. 2016;6:35928.

[0319] 54. Rousseau M, et al. Detection and quantification of microparticles from different cellular lineages using flow cytometry. Evaluation of the impact of secreted phospholipase A2 on microparticle assessment. PLoS One. 2015;10(1):e0116812.

[0320] 55. Loupy A, et al. The Banff 2019 Kidney Meeting Report (I): Updates on and clarification of criteria forT cell- and antibody-mediated rejection. Am J Transplant. 2020;20(9):2318-2331. 56. Wang S, et al. Anti-IL-2 receptor antibody decreases cytokine-induced apoptosis of human renal tubular epithelial cells (TEC). Nephrol Dial Transplant. 2011 Jul;26(7):2144-53. 57. Huxley VH, Kemp SS. Sex-Specific Characteristics of the Microcirculation. Adv Exp Med Biol. 2018;1065:307-328. doi: 10.1007 / 978-3-319-77932-4_20. PM ID: 30051393; PMCID: PMC6209095.

Claims

WHAT IS CLAIMED IS:

1. A method for treating a microvascular disease and / or microvascular dysfunction in a subject comprising administering to the subject an effective amount of at least one of the following RNA interfering agents: (i) miR-423-5p microRNA (miRNA), a precursor thereof, or another RNA interfering agent binding to the same mRNAtarget(s) as miR-423-5p miRNA; (ii) let-7b-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNAtarget(s) as let-7b-5p miRNA; (iii) let-7a-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as let-7a-5p miRNA; (iv) let-7c-5p miRNA, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as let-7c-5p miRNA; and (v) miR-30a-3p, a precursor thereof, or another RNA interfering agent binding to the same mRNA target(s) as miR-30a-3p miRNA.

2. The method of claim 1 , wherein the method comprises administering an effective amount of at least two or at least three of (i) to (v).

3. The method of claim 1, wherein the method comprises administering an effective amount of (i), (ii) and (iv).

4. The method of any one of claims 1 to 3, wherein the RNA interfering agent binding to the same mRNA target(s) as miR-423-5p, let-7b-5p, let-7a-5p, let-7c-5p or miR-30a-3p miRNA is a small interfering RNA (siRNA) or an antisense oligonucleotide (ASO).

5. The method of claim 4, wherein the siRNA or ASO comprises at least 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of miR-423-5p, let-7b-5p, let-7a-5p, let-7c-5p or miR-30a-3p miRNA.

6. The method of claim 5, wherein the siRNA or ASO comprises the nucleotide sequence of miR-423-5p, let-7b-5p, let-7a-5p, or let-7c-5p miRNA.

7. The method of any one of claims 1 to 6, wherein the method comprises administering an effective amount of miR-423-5p miRNA or a precursor thereof.

8. The method of any one of claims 1 to 7, wherein the method comprises administering an effective amount of let-7b-5p miRNA or a precursor thereof.

9. The method of any one of claims 1 to 8, wherein the method comprises administering an effective amount of let-7c-5p miRNA or a precursor thereof.

10. The method of any one of claims 1 to 9, wherein the RNA interfering agent(s) is / are encapsulated in vesicles.

11. The method of claim 10, wherein the vesicles are lipid nanoparticles (LNPs).

12. The method of any one of claims 1 to 11, wherein the RNA interfering agent(s) is / are formulated in a pharmaceutical composition comprising one or more pharmaceutically acceptable excipients or carriers, or a cosmetic composition comprising one or more cosmetically acceptable excipients or carriers.

13. The method of any one of claims 1 to 12, wherein the microvascular disease and / or microvascular dysfunction is subsequent to an organ transplantation and / or to organ ischemia.

14. The method of claim 13, wherein the organ is kidney, heart or lung.

15. The method of any one of claims 1 to 14, wherein the microvascular disease and / or microvascular dysfunction is a kidney microvascular disease or dysfunction.

16. The method of claim 15, wherein the subject suffers from acute kidney injury (AKI) or chronic kidney disease (CKD).

17. The method of claim 15 or 16, wherein the subject is a kidney transplant recipient.

18. A method for preserving or improving microvascular density, or preventing microvascular rarefaction, in a body part from a subject, the method comprising administering to the subject an effective amount of at least one of the RNA interfering agents defined in any one of claims 1 to 12.

19. The method of claim 18, wherein the body part is an organ, for example kidney, heart, skin or lung.

20. The method of claim 19, wherein the kidney is a transplanted kidney.

21. The method of claim 18, wherein the organ is skin.

22. The method of claim 21 , wherein the method reduces or alleviates skin aging.

23. Use of at least one of the RNA interfering agents defined in any one of claims 1 to 12 for the manufacture of a medicament for treating a microvascular disease and / or microvascular dysfunction in a subject.

24. The use of claim 23, wherein the microvascular disease and / or microvascular dysfunction is subsequent to an organ transplantation and / or to organ ischemia.

25. The use of claim 24, wherein the organ is kidney, heart or lung.

26. The use of claim 24 or 25, wherein the microvascular disease and / or microvascular dysfunction is a kidney microvascular disease or dysfunction.

27. The use of claim 26, wherein the subject suffers from acute kidney injury (AKI) or chronic kidney disease (CKD).

28. The use of claim 26 or 27, wherein the subject is a kidney transplant recipient.

29. Use of at least one of the RNA interfering agents defined in any one of claims 1 to 12 for the manufacture of a medicament or cosmetic product for preserving or improving microvascular density, or preventing microvascular rarefaction, in a body part from a subject.

30. The use of claim 29, wherein the body part is an organ, for example kidney, heart, skin or lung.

31. The use of claim 30, wherein the organ is a kidney.

32. The use of claim 31 , wherein the kidney is a transplanted kidney.

33. The use of claim 30, wherein the organ is skin.

34. The use of claim 33, wherein the cosmetic product reduces or alleviates skin aging.

35. A method for assessing the risk of suffering from a microvascular disease or dysfunction, and / or for detecting microvascular injury, in a subject, the method comprising (a) measuring the levels of at least one of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and let-7c-5p in a biological sample from the subject; (b) comparing the measured levels of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and / or let-7c-5p to a reference level; and (c) assessing the risk of suffering from a microvascular disease or dysfunction based on the comparison, wherein a low level of miR-423-5p, let-7b-5p, let-7a-5p, and / or let-7c-5p is indicative of an increased risk of suffering from a microvascular disease or dysfunction and / or of the presence of microvascular injury.

36. The method of claim 35, wherein the method comprises measuring the levels of at least two or at least three of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and let-7c-5p in the biological sample.

37. The method of claim 36, wherein the method comprises measuring the levels of miR-423-5p, let-7b-5p, and let-7c-5p in the biological sample.

38. The method of any one of claims 35 to 37, wherein the reference level is a corresponding level or standard established based on miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and / or let-7c-5p in subjects not suffering from a microvascular disease or dysfunction, or not at risk of suffering from a microvascular disease or dysfunction, and wherein a lower miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and / or let-7c-5p levels measured in a sample from subject relative to the control level is indicative that the subject is suffering from a microvascular disease or dysfunction, or is at risk of suffering from a microvascular disease or dysfunction.

39. The method of any one of claims 35 to 38, further comprising administering a suitable therapy against the microvascular disease, dysfunction or injury if the subject is identified as having an increased risk of suffering from a microvascular disease or dysfunction and / or as having microvascular injury.

40. The method of claim 39, wherein the therapy comprises the method defined in any one of claims 1 to 12.

41. A method for monitoring the course of treatment of a subject suffering from a microvascular disease or dysfunction, the method comprising: (a) determining a first level of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and / or let-7c-5p in a biological sample from said subject; wherein an increase in the level relative to a corresponding level determined in a corresponding biological sample obtained from said subject at an earlier time is indicative that said patient is responsive to said treatment, and wherein an absence of change or a decrease in said first level relative to a corresponding level determined in a corresponding biological sample obtained from said subject at an earlier time is indicative that said patient is not responsive to said treatment.

42. The method of claim 41 , wherein the method comprises measuring the levels of at least two or at least three of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and let-7c-5p in the biological sample.

43. The method of claim 42, wherein the method comprises measuring the levels of miR-423-5p, let-7b-5p, and let-7c-5p in the biological sample.

44. The method of any one of claims 35 to 43, wherein the microvascular disease and / or microvascular dysfunction is subsequent to an organ transplantation and / or to ischemia.

45. The method of any one of claims 35 to 44, wherein the microvascular disease and / or microvascular dysfunction is a kidney microvascular disease or dysfunction.

46. The method of claim 45, wherein the subject suffers from acute kidney injury (AKI) or chronic kidney disease (CKD).

47. The method of claim 45 or 46, wherein the subject is a kidney transplant recipient.

48. The method of any one of claims 35 to 47, wherein the biological sample is a biological fluid.

49. The method of claim 48, wherein the biological fluid is plasma or serum.

50. The method of any one of claims 35 to 49, wherein the biological sample is enriched in extracellular vesicles (EVs).

51. The method of claim 50, wherein the extracellular vesicles are large extracellular vesicles.

52. A method to follow-up the condition of a subject suffering from a microvascular disease or dysfunction, the method comprising determining a first level of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and / or let-7c-5p in serum or plasma sample, and / or a large extracellular vesicle (microvesicle) sample, from said subject; wherein an increase in said first level relative to a corresponding level determined in a corresponding serum, plasma and / or large extracellular vesicle sample obtained from said subject at an earlier time is indicative that said patient conditionhas improved, and wherein a decrease in said first level relative to a corresponding level determined in a corresponding serum, plasma and / or large extracellular vesicle sample obtained from said subject at an earlier time is indicative that said patient condition has deteriorated.

53. A kit or package comprising (a) means or reagents useful for determining the level of miR-423-5p, let-7b-5p, let-7a-5p, miR-30a-3p and / or let-7c-5p in a biological sample (b) instructions setting forth the method of any one of claims 35 to 52.

54. A combination or composition comprising at least two of the RNA interfering agents defined in any one of claims 1 to 12.