Composite silk fiber containing spider silk protein and preparation method therefor

Abstract

Provided are a composite silk fiber containing a spider silk protein and a preparation method therefor. The preparation method is a method for producing a composite silk fiber using a practical silkworm variety. Specifically, a gene targeting vector and a nuclease-expressing plasmid are introduced into freshly laid eggs of the practical silkworm variety, followed by hatching and rearing until moth emergence, and then the resulting moths are mated with wild-type moths of the practical silkworm variety of the opposite sex to obtain moth-circle silkworm eggs; DNA of parent moths from the moth-circle silkworm eggs is amplified, and screening is performed to obtain eggs laid by transgenic silkworm moths; the obtained eggs are then subjected to incubation until moth emergence, and moths within the same moth brood are mated to lay eggs; subsequently, DNA of the resulting moths is amplified, the amplified products are sequenced for verification, and eggs produced by the mating of gene-targeted silkworm moths in which both male and female parents are homozygous lines are selected for propagation; after hatching and rearing to the mounting stage, the composite silk fiber containing the spider silk protein is obtained. The composite silk provided is used to meet the demand for silk protein diversity in the production of various textile silk products and the preparation of various biological materials. In addition, the obtained genome-edited silkworms can be used to breed new silkworm varieties by means of conventional crossbreeding.

Description

A composite silk fiber containing spider silk protein and its preparation method Technical Field

[0001] This invention relates to the field of genome editing, specifically to a composite silk fiber containing spider silk protein and its preparation method. Background Technology

[0002] Spider silk is renowned worldwide for its superior comprehensive mechanical properties. Its filaments perfectly combine breaking strength, Young's modulus, toughness, and elongation at break, making it the fiber with the best comprehensive mechanical properties in nature. Its strength even surpasses that of steel and Kevlar fiber at the same mass. Therefore, spider silk fibers have attracted considerable attention from researchers in high-tech fields such as medicine and the military. However, spiders are territorial, carnivorous, and cannibalistic, and spider silk is extremely difficult to collect, resulting in very low yields. Although humans have made many innovative achievements using spider silk in high-strength military materials and low-toxicity, highly biocompatible, and biodegradable medical materials, the limited production of spider silk still hinders the practical application of these new discoveries.

[0003] To date, researchers have successfully expressed spider silk protein gene sequences in heterologous cells or hosts using genetic engineering techniques. Recombinant spider silk proteins expressed through this strategy cannot assemble into silk fibers autonomously. Therefore, recombinant spider silk proteins must be purified and processed into silk fibers using artificial spinning techniques. However, due to limitations in the maturity of related technologies such as heterologous expression, purification of expression products, and artificial spinning, it is currently difficult to obtain large quantities of genetically engineered spider silk fibers with excellent mechanical properties.

[0004] Spinning silk and forming cocoons is a natural instinct of silkworms. After more than 5,000 years of domestication, the silkworm's powerful ability to synthesize silk protein has reached near-maximum. Silk protein is mainly composed of sericin and fibroin. Silk fibers are mainly assembled from fibroin heavy chains (350 kDa), fibroin light chains (25.8 kDa), and P25 protein (25.7 kDa) in a molar ratio of 6:6:1. The mechanical properties of silk protein are mainly determined by the high molecular weight of the fibroin heavy chains and the highly repetitive amino acid sequence. The primary structure of spider silk protein is very similar to that of silkworm fibroin. The silkworm's silk secretion system is very similar to that of spiders; therefore, the silkworm is considered the most promising commercial vehicle for producing recombinant spider silk protein.

[0005] Existing technology discloses a method for improving silkworm silk performance by expressing the spider variegata filament protein gene. The method involves cloning a spider silk protein gene sequence, composed of repeating units from the variegata filaments of black widow spiders or orb-weaver spiders, at 1-8 times consecutive repetitions, into a piggyBac transposon-based transgenic vector to construct the recombinant plasmid pBac-ACSP. This plasmid is then mixed with an auxiliary plasmid expressing transposase and microinjected into the newly laid eggs of silkworms. Through the piggyBac transposon, the expression cassette for secreting the variegata filament protein gene is integrated into the silkworm genome, stably inherited and expressed, resulting in transgenic silkworms that secrete and express spider variegata filament protein. This method for improving silkworm silk performance by expressing the spider variegata filament protein gene is a widely disclosed approach. Most currently disclosed methods for expressing spider silk protein genes in transgenic silkworms employ similar technical solutions. However, the sites for integrating spider silk protein gene expression cassettes based on piggyBac transposons into the silkworm genome are mostly TTAA sites, resulting in significant randomness. Furthermore, since the silk fibroin gene in the silkworm itself is not replaced by the spider silk protein gene, the expression level of the spider silk protein gene is low. Overall, this technical approach is gradually being phased out.

[0006] Zinc-finger nucleases (ZFNs) and transcription activator-like (TAL) effector nucleases (TALENs) have also been explored for use in genome-edited silkworms. ZFNs have been used to successfully construct silkworm mutants with inactivated fibroin heavy chain genes, revealing that the silk fibroin heavy chain is not indispensable in silkworm cocoons. This suggests the possibility of using spider silk protein genes to replace the silk fibroin heavy chain gene, thus forming spider-silkworm chimeric silk. Using TALENs-mediated directed homologous recombination repair technology, spider silk protein gene expression cassettes were successfully used to replace either the silk fibroin heavy or light chain loci, yielding spider-silkworm chimeric fibers. However, due to the complexity of these techniques, genome editing systems based on ZFNs and TALENs have been superseded by the CRISPR / Cas system. Using the CRISPR / Cas9 system, an artificial spider silk gene (10 kb) has been inserted into the intron region of the silk fibroin heavy chain gene in silkworms, producing chimeric silk fibers with mechanics similar to natural spider silk. Through CRISPR / Cas9-mediated genome editing, the silk fibroin heavy chain gene was replaced with a naturally occurring, complete full-length spider subampullary gland silk protein gene (150 kDa), resulting in high-strength and ultra-tough chimeric silk fibers. However, the silkworm varieties used in this technology are polymorphic and impractical, with generally poor economic traits (cocoon yield, cocoon layer ratio, total cocoon weight, silk length, etc.), making it unsuitable for practical use. Technical issues

[0007] The introduction of exogenous genes into silkworms plays a crucial role in the production of transgenic silkworms. Currently, a widely used strategy involves microinjection into the first eggs laid by non-diapause silkworms (3-4 hours after laying). This method is technically mature and has a high genetic conversion rate. However, the poor economic traits of non-diapause silkworms severely impact the economic value of transgenic silkworms. Currently, commercially available, practical diapause varieties exhibit bipolarity. The laid eggs are protected at 24-25 degrees Celsius for approximately 20 hours before diapause is broken by hydrochloric acid treatment. However, microinjection into the first eggs of newly laid silkworms will cause egg death due to hydrochloric acid treatment. Therefore, the first eggs of practical varieties obtained through conventional techniques are not suitable for microinjection. Techniques such as pulsed-field electrophoresis, pressure osmosis, electroporation, gene gun injection, sperm-mediated gene transfer, recombinant virus-mediated gene transfer, and gonadal injection have been used in the exploration of transgenic silkworm varieties, but due to low efficiency and poor reproducibility, they have not been widely accepted by most professionals in the field. Treating silkworm eggs 2.5 hours after laying in practical silkworm varieties with hydrochloric acid resulted in a high egg mortality rate, poor hatching rate, and extremely low transgenic efficiency after microinjection. Low-temperature induction treatment and combined induction treatment can relieve diapause in some offspring eggs, but due to their long technical cycle and poor timeliness, this strategy has not yet been accepted by most professionals in the field. Therefore, transgenic development of practical silkworm varieties remains a challenge. Technical solutions

[0008] The purpose of this invention is to provide a composite silk fiber containing spider silk protein and its preparation method. Specifically, it is a method for producing composite silk fibers containing spider silk protein using a practical variety of silkworm, and the product thereof. Specifically, it is a method for preparing composite silk fibers of spider ampullae gland silk protein and silkworm silk protein using a practical variety of silkworm based on genome editing and homologous recombination repair.

[0009] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0010] A method for preparing composite silk fibers containing spider silk protein includes the following steps:

[0011] (1) The gene targeting vector pUC57-MaSp-c and the plasmid expressing nuclease were introduced into the first egg-laying of the practical variety of silkworm, and then hatched and raised until the moth emerged. The eggs were then mated with wild-type practical silkworms to obtain the moth-eggs.

[0012] (2) Amplify the DNA of the parent moths of the silkworm eggs in the moth area, and screen to obtain the eggs produced by the silkworm moths carrying the MaSp-c gene; then induce the eggs of the silkworm moths carrying the MaSp-c gene to turn into moths and mate them with the moths in the same area to lay eggs.

[0013] (3) Then amplify the DNA of the moth in step (2), sequence the amplified product for verification, and select the eggs produced by the mating of gene-targeting silkworm moths whose male and female parents are both pure lines for the next generation;

[0014] (4) The eggs or sub-eggs from step (3) are hatched and raised to the upper clump to obtain composite silk fibers containing spider silk protein.

[0015] A method for constructing a genome-edited silkworm includes the following steps:

[0016] (1) The gene targeting vector pUC57-MaSp-c and the plasmid expressing nuclease were introduced into the first egg-laying of the practical variety of silkworm, and then hatched and raised until the moth emerged. The eggs were then mated with wild-type practical silkworms to obtain the moth-eggs.

[0017] (2) Amplify the DNA of the parent moths of the silkworm eggs in the moth area, and screen to obtain the eggs produced by the silkworm moths carrying the MaSp-c gene; then induce the eggs of the silkworm moths carrying the MaSp-c gene to turn into moths and mate them with the moths in the same area to lay eggs.

[0018] (3) Then amplify the DNA of the moth in step (2), sequence the amplified product for verification, and select the eggs produced by the mating of gene-targeting silkworm moths whose male and female parents are both pure lines for the next generation;

[0019] (4) The eggs or sub-eggs from step (3) are hatched to obtain genome-edited silkworms.

[0020] A method for constructing genome-edited silkworm eggs, comprising the following steps:

[0021] (1) The gene targeting vector pUC57-MaSp-c and the plasmid expressing nuclease were introduced into the first egg-laying of the practical variety of silkworm, and then hatched and raised until the moth emerged. The eggs were then mated with wild-type practical silkworms to obtain the moth-eggs.

[0022] (2) Amplify the DNA of the parent moths of the silkworm eggs in the moth area, and screen to obtain the eggs produced by the silkworm moths carrying the MaSp-c gene; then induce the eggs of the silkworm moths carrying the MaSp-c gene to turn into moths and mate them with the moths in the same area to lay eggs.

[0023] (3) Then amplify the DNA of the moth in step (2), sequence and verify the amplification product, and select the eggs or sub-generation eggs produced by the mating of gene-targeting silkworm moths with pure lineage of male and female parents as genome-edited silkworm eggs.

[0024] In this invention, pUC57-MaSp-c uses the flanking sequence of the silk fibroin light chain gene as a homologous arm. The expression cassette encoding the silk protein sequence of the large ampullae gland in the golden web-weaving spider, controlled by the silk fibroin light chain gene promoter, and the fluorescent protein gene controlled by the 3×P3 promoter are cloned between the left and right homologous arms. Furthermore, the gRNA expression cassette targeting the silk fibroin light chain gene, controlled by the silkworm U6 promoter, is cloned downstream of the right homologous arm. As an example, the DNA sequence of pUC57-MaSp-c is SEQ ID NO: 1.

[0025] In this invention, the gene targeting vector pUC57-MaSp-c and the plasmid expressing nuclease are introduced into the first eggs of a practical silkworm variety after corona treatment, and then hatched; or the gene targeting vector pUC57-MaSp-c and the plasmid expressing nuclease are introduced into the first eggs of a practical silkworm variety, then corona treatment is performed, and then hatched.

[0026] Preferably, the corona treatment temperature is 24-25℃, the voltage is 10-12kV, and the time is 3-5 minutes; the first oviposition refers to the oviposition within 8 hours of being laid.

[0027] In this invention, the plasmid expressing the nuclease is a plasmid expressing the Cas12a nuclease.

[0028] In this invention, the method for introducing the initial egg-laying of practical silkworm varieties is a conventional technique, which can be achieved through conventional injection methods, such as microinjection.

[0029] In this invention, during step (2), the specific primers used for amplification are primer pairs for amplifying the ampullary gland silk protein gene of the web spider, primer pairs for amplifying the fluorescent protein gene, primer pairs for detecting the left insertion site of exogenous DNA, and primer pairs for detecting the right insertion site of exogenous DNA; during step (3), the specific primer pairs used for amplification are primer pairs for detecting whether the obtained silkworm is a pure genome-edited silkworm.

[0030] Specifically, the method for preparing composite silk fibers containing spider silk protein, the method for constructing genome-edited silkworms, or the method for constructing genome-edited silkworm eggs disclosed in this invention include the following steps:

[0031] (1) Construct the gene targeting vector pUC57-MaSp-c;

[0032] (2) Mix the gene targeting vector pUC57-MaSp-c with the plasmid piggyCPF1 expressing Cas12a nuclease, and then inject it into the first eggs of practical silkworm varieties. After that, the eggs are subjected to corona treatment, or they are directly introduced into the first eggs of silkworms that have been corona treated before hatching.

[0033] (3) After the silkworm eggs hatch, they are raised until they become moths, and then mated with wild-type domestic varieties to obtain moth eggs;

[0034] (4) Amplify the DNA of the parent moths of the silkworm eggs in the moth-egg-growing area using specific primers, and screen the eggs laid by the genome-edited silkworm moths;

[0035] (5) After the eggs produced by mating with the parent silkworm moth with genome editing were induced to mature, they were raised normally until they became moths and mated with the same moth area to lay eggs; then the DNA of the moth was amplified using specific primers and the amplified products were sequenced and verified. Eggs produced by mating with the gene-targeted silkworm moth with pure lineage of male and female parents were selected for subgeneration. The eggs or subgeneration eggs were genome-edited silkworm eggs.

[0036] (6) After the eggs or sub-eggs obtained in step (5) are hatched, genome-edited silkworms are obtained and conventionally raised to the upper cocoon, thereby obtaining spider silkworm composite silk fibers.

[0037] In step (2) above, the eggs of the practical silkworm breed are injected into the newly laid eggs and then subjected to corona treatment, or directly injected into the corona-treated newly laid eggs of the silkworm breed before hatching. Specifically, at 24-25℃, eggs laid by the practical silkworm moth within 4 hours are injected with the pUC57-MaSp-c plasmid and the Cas12a nuclease plasmid piggyCPF1, protected at 24-25℃ for 18-20 hours, and then subjected to corona treatment at 10-12kV with an electrode spacing of 8mm for 3-5 minutes; or at 24-25℃, eggs laid by the practical silkworm moth within 2 hours are subjected to corona treatment at 10-12kV with an electrode spacing of 8mm for 3-5 minutes. After being treated with corona for 3-5 minutes, the pUC57-MaSp-c plasmid and the Cas12a-expressing plasmid piggyCPF1 were injected into the eggs. Protection was carried out using conventional techniques, such as protecting the treated silkworm eggs at 24-25 degrees Celsius for 18 hours of light exposure per day until the eggs turned blue, and then protecting them in the dark at 24-25 degrees Celsius until the day of hatching. The eggs were then exposed to light for hatching in the early morning of the day of hatching.

[0038] This invention discloses a composite silk fiber containing spider silk protein prepared according to the above-described method for preparing composite silk fibers containing spider silk protein; a genome-edited silkworm constructed according to the above-described method for constructing genome-edited silkworms; and a genome-edited silkworm egg constructed according to the above-described method for constructing genome-edited silkworm eggs.

[0039] This invention discloses the application of the above-mentioned genome-edited silkworm or genome-edited silkworm eggs in the preparation of composite silk fibers containing spider silk protein, or in the preparation of composite silk fibers containing spider silk protein with improved mechanical properties.

[0040] This invention discloses the application of the above-mentioned composite silk fiber containing spider silk protein in improving the mechanical strength of silk fibers.

[0041] This invention discloses the application of the gene targeting vector pUC57-MaSp-c in preparing composite silk fibers containing spider silk proteins from practical silkworm varieties, or in constructing practical silkworm varieties for genome editing, or in constructing eggs of practical silkworm varieties for genome editing. Specifically, in the application process, the newly laid eggs of practical silkworm varieties are subjected to corona treatment.

[0042] Purebred silkworms can be used as breeding material and crossbred with existing varieties. Through conventional breeding, silk production and / or disease resistance can be further improved. Beneficial effects

[0043] Using practical silkworm varieties as transgenic subjects, the above-mentioned technical solution can yield genome-edited silkworms with the MaSp-c gene replacing the fibroin light chain gene, and composite silk fibers made from spider ampullary gland silk protein MaSp-c and silkworm fibroin heavy chain protein prepared based on genome-edited silkworms. Due to the application of the above-mentioned technical solution, this invention has the following advantages compared to existing technologies:

[0044] (1) Directly genetically modifying practical silkworm varieties to improve economic traits: Due to technological bottlenecks, traditional methods of genetically modifying silkworms mostly target non-diapause silkworms. Non-diapause silkworms have extremely poor economic traits, which seriously affects the economic value of genetically modified silkworms. Crossing non-diapause genetically modified silkworms with existing practical varieties and continuously backcrossing and selecting can improve economic traits, but in the short term, it is often difficult to completely overcome the defects brought about by the non-diapause silkworm system. The application of the technical solution of this invention can fundamentally solve the defects of non-diapause genetically modified silkworms without affecting other excellent traits of practical silkworm varieties, and greatly shorten the breeding cycle.

[0045] (2) Improving the content and mechanical properties of spider silk protein in composite silk fibers: Based on piggyBac transposon-mediated transgenesis, the insertion site of the exogenous gene tends to be at the TTAA site of the silkworm genome, which is highly random. Furthermore, since the silk fibroin gene of the silkworm itself is not replaced by the spider silk protein gene, the expression level of the spider silk protein gene is low. Therefore, the spider silk protein content in composite silk fibers obtained through this technical solution is relatively low (2-5%). In particular, unlike previous studies that replaced the silkworm fibroin heavy chain gene with the spider silk gene, this invention innovatively replaces the silk fibroin light chain gene with the spider silk gene. In the composite silk fibers produced using this invention, the silkworm's silk fibroin light chain protein is replaced by MaSp-c, thereby significantly improving the spider silk protein content and mechanical properties of the composite silk fibers.

[0046] (3) The use of novel CRISPR / Cas12a technology can reduce off-target effects and improve genome editing efficiency: Currently, there are very few research reports on improving the mechanical properties of silkworm silk fibers through genome editing and genome repair. There is one paper on homology-directed repair technology mediated by TALEN, one paper on directional insertion based on CRISPR / Cas9 genome editing, and one paper on homology-directed repair based on CRISPR / Cas9 genome editing. Genome editing technology based on TALEN technology has been phased out due to its cumbersome technology and high off-target rate; CRISPR / Cas9 technology has been gradually replaced by new-generation technologies due to its high off-target frequency. This invention uses novel CRISPR / Cas12a technology, and the designed U6-gDNA array element expresses a gRNA array that can simultaneously target different regions of a genome, effectively reducing the off-target frequency and improving editing efficiency. Attached Figure Description

[0047] Figure 1 illustrates the structure and targeting strategy of pUC-MaSp-c in Example 1. Using the flanking sequence of the silkworm fibroin light chain gene as a homologous arm, a full-length MaSp-c gene expression cassette controlled by the silkworm fibroin light chain gene promoter with codon optimization and a DsRed gene expression cassette controlled by the 3×P3 promoter were inserted. A gDNA array controlled by the U6 promoter was designed downstream of the homologous right arm, and its transcription product gRNA can target different regions of the silk fibroin light chain genome. After this plasmid was introduced into silkworm eggs, the light chain locus was cleaved using the CRISPR-Cas12a genome editing system under the action of Cas12a. Furthermore, homologous recombination was used to replace the light chain locus with the MaSp-c gene expression cassette and the DsRed gene expression cassette.

[0048] Figure 2 is a schematic diagram of the corona treatment device in Example 1. Two steel plates (thickness: 1.5mm) are fixed parallel to each other on an insulator post, with a spacing of 2cm between the steel plates. A electrode needle (length: 1.2cm, diameter: 2mm) is fixed to the lower side of the upper steel plate. During corona treatment, the upper and lower steel plates are connected to the positive and negative terminals of the power supply, respectively.

[0049] Figure 3 shows the MaSp-c electrophoresis and sequencing images of the PCR detection of five G0 generation silkworm moths in Example 1, using Light-cF and Light-cR primers. The upper image shows the PCR product electrophoresis: lane M, standard molecular weight DNA; lane NC, untransgenic wild-type Soho silkworm moths; lanes 1-5, G0 generation G0. 1 G0 2 G0 3 G0 4 G0 5Silkworm moth. The image below shows the sequencing results of the PCR product; the sequence is a partial sequence of the MaSp-c gene.

[0050] Figure 4 shows the electrophoresis diagram of PCR identification of gene-targeted silkworms in Example 1. Lane M is the DNA Marker; lane NC is the wild-type Soho silkworm moth that has not undergone transgenic treatment; lanes 1 and 2 are the products of PCR amplification of DNA from female and male silkworm moths of the G0 generation and G1 generation from the same moth zone, respectively, using LF and LR primer pairs. The molecular weight of the product is 2455 bp.

[0051] Figure 5 shows the PCR identification and sequencing verification of the gene-targeted silkworms in Example 1. Top: Electrophoresis diagram of the PCR products. Lane Marker, DNA Marker; Lane NC, control without transgenic treatment; Lanes 1 and 2, representing G0 generation female and male silkworm moth DNA from the same moth enclosure, respectively, were amplified by PCR using LF and LR primer pairs. Using the amplified products as templates, further amplification was performed using L-2-F and L-2-R primers, respectively. The molecular weight of the PCR product was 672 bp. Bottom: Sequencing diagram of the PCR products.

[0052] Figure 6 shows the Western blot detection of MaSp-c in silk fibroin in Example 1. Lane M, protein marker; lane NC, normal Soho silk fibroin; lane GMO, genome-edited silk fibroin. The primary antibody was MaSp-c and P25 antibody (rabbit anti-1:1000), and the secondary antibody was HRP-labeled goat anti-mouse IgG (1:5000).

[0053] Figure 7 shows the stress-strain curves of genome-edited silk and control group silk.

[0054] Figure 8 shows the electrophoresis diagram and sequencing diagram of the PCR products from four G0 generation silkworm moths in Example 2, using primers DsRed-F and DsRed-R. The top image shows the electrophoresis diagram of the PCR products. Lane M represents standard molecular weight DNA; lane NC represents untransgenic wild-type silkworm moths from the Zhongye generation; lanes 1-4 represent G0 generation G0 silkworm moths. 1 G0 2 G0 3 G0 4 Silkworm moth. The image below shows the sequencing results of the PCR product; the sequence is a partial sequence of the DsRed gene.

[0055] Figure 9 shows the PCR detection and sequencing results of the PCR products from two G1 silkworm moth DNA samples in Example 2. DNA from the G1 generation silkworm moths was amplified by PCR using LF and LR primer pairs. The 2455 bp PCR product was recovered and used as a template for further PCR using CF and CR primer pairs. The PCR product was electrophoresed on a 1% agarose gel, and a 1457 bp band was recovered for sequencing verification. The upper figure shows the electrophoresis diagram of the 1457 bp PCR product. Lane M: DNA Marker; Lane NC: Non-transgenic *Salvia miltiorrhiza*; Lanes 1 and 2: DNA from the G0 generation female and male silkworm moths in the same moth zone was amplified by PCR using LF and LR primer pairs. The amplified product was then used as a template for further amplification using CF and CR primer pairs, respectively. The molecular weight of the PCR product was 1457 bp. The lower figure shows the sequencing result of the PCR product, which is the 3' end of the left homologous arm and a portion of the silk fibroin light chain promoter sequence.

[0056] Figure 10 shows the PCR detection of the upstream sequence of the left homologous arm insertion site in Example 2. DNA from the G1 generation silkworm moth was amplified by PCR using LF and LR primer pairs. The recovered 2455 bp PCR product was used as a template. PCR was then performed using LF and LeftK-R primer pairs, amplifying a specific 416 bp band. Sequencing results showed that this band represented the homologous left arm targeting site and its upstream genomic sequence. The upper figure shows the electrophoretic detection of the PCR product using LF and LeftK-R primer pairs. Lane Marker: DNA Marker; Lane NC: Non-transgenic *Bombyx mori*; Lanes 1 and 2: G0 generation female and male silkworm moth DNA from the same moth zone were amplified by PCR using LF and LR primer pairs. The amplified product was then used as a template for further amplification using LF and LeftK-R primer pairs. The molecular weight of the PCR product was 416 bp. The lower figure shows the sequencing diagram of the 416 bp PCR product. Embodiments of the present invention

[0057] Transgenic silkworm varieties are the most direct and effective means of improving and innovating silkworm varieties using molecular targets. Establishing an efficient method for relieving diapause in silkworm eggs suitable for transgenic microinjection is one of the key technical problems that still needs to be solved in silkworm transgenic technology. In existing technologies, treating silkworm eggs 2.5 hours after laying with hydrochloric acid results in a high egg mortality rate, poor hatching rate, and extremely low transgenic efficiency after microinjection. Low-temperature induction treatment and repeated induction treatment can relieve diapause in some offspring eggs, but due to their long technical cycle and poor timeliness, this strategy has not yet been accepted by most professionals in the field.

[0058] This invention discloses a method for producing composite silk fibers containing spider silk protein using a practical silkworm breed. Specifically, it involves using genome editing and homology repair technology to produce composite silk fibers of spider ampullary gland silk protein MaSp-c and silkworm fibroin from a practical silkworm breed. Eggs laid within 2 hours of the practical silkworm moth are treated with a continuous 10-12 kV corona discharge for 3-5 minutes at 24-25°C, followed by injection of the pUC57-MaSp-c plasmid and the pCase12a plasmid expressing the nuclease Cas12a. Alternatively, eggs laid within 4 hours of the moth are injected with the pUC57-MaSp-c plasmid and the Cas12a plasmid, protected at 24-25°C for 18-20 hours, and then treated with a continuous 10-12 kV electric shock for 3-5 minutes. After hatching, the silkworm eggs are reared for multiple generations. Through molecular biological screening and identification, genome-edited silkworms are obtained that replace the silkworm fibroin light chain gene expression cassette with the spider ampullary gland silk protein MaSp-c gene sequence expression cassette. After being reared and spinning cocoons, the genome-edited silkworms produced this invention yielded composite silk containing the urna gland filament protein from the golden web-weaving spider, obtained through conventional silk reeling. This invention allows for the acquisition of silk containing the urna gland filament protein MaSp-c from the golden web-weaving spider, meeting the diverse needs of silk proteins in the production of various textile silk products and the preparation of various biomaterials. Furthermore, the obtained genome-edited silkworms can be used to breed new silkworm varieties through conventional hybridization breeding methods.

[0059] This invention discloses a method for producing composite silk fibers containing spider silk protein using the practical variety of silkworm, comprising the following steps:

[0060] (1) Construct the gene targeting vector pUC57-MaSp-c;

[0061] (2) The gene targeting vector pUC57-MaSp-c was mixed with the plasmid piggyCPF1 expressing Cas12a nuclease and then injected into the first eggs of practical silkworm varieties. After that, the eggs were subjected to corona treatment, or they were directly introduced into the first eggs of silkworms that had been corona treated before hatching. Preferably, the plasmid expressing Cas12a nuclease is piggyCPF1 (see CN202310944134.8); preferred silkworm varieties include Suhao, Zhong 2016, Zhongye, Ri 2016, Jingsong, and Haoyue; preferably, eggs laid by silkworm moths of the preferred varieties within 4 hours at 24-25℃ are injected with pUC57-MaSp-c plasmid and the Cas12a nuclease plasmid piggyCPF1, protected at 24-25℃ for 18-20 hours, and then subjected to continuous corona treatment at 10-12kV with an electrode spacing of 8mm for 3-5 minutes; or, egg circles laid by silkworm moths of the preferred varieties within 2 hours at 24-25℃ are subjected to continuous corona treatment at 10-12kV with an electrode spacing of 8mm for 3-5 minutes; The silkworm eggs were treated with corona for 3-5 minutes, and then the pUC57-MaSp-c plasmid and the Cas12a nuclease plasmid piggyCPF1 were injected into them. The treated silkworm eggs were protected at 24-25℃ until hatching.

[0062] (3) After the silkworm eggs hatch, they are raised until they become moths. The male and female mate to obtain the moth-eggs.

[0063] (4) Use specific primers to amplify the DNA of the parent moths of the silkworm eggs in the moth-ring and screen for eggs laid by gene-targeting silkworm moths.

[0064] (5) After the eggs produced by mating with the parent silkworm moth with gene targeting were induced to develop into moths, they were raised normally until they emerged as moths and mated with the same moth area to lay eggs. Then, the DNA of the moths was amplified using specific primers, and the amplified products were sequenced and verified. Eggs produced by mating with the parent silkworm moth with pure lineage of both male and female were selected for the next generation.

[0065] (6) After the eggs obtained in step (5) are hatched, they are fed in a conventional manner until they are on the cocoon, and then spider-silkworm composite silk fibers are obtained.

[0066] The composite silk fiber containing spider silk protein prepared by this invention is a spider-silkworm composite silk fiber, preferably a composite silk fiber containing spider macromedullary gland silk protein MaSp-c (GenBank accession number: PRD18936.1) and silkworm fibroin heavy chain protein; the spider silk protein can also be submedullary gland silk protein.

[0067] In this invention, the constructed gene targeting vector pUC57-MaSp-c has the following characteristics: using the flanking sequence of the silk fibroin light chain gene as homologous arms, the gene expression cassette encoding the large ampullae gland silk protein (MaSp-c) of the golden web-weaving spider (preferably using the tailing signal of the silkworm sericin ser3 gene (GenBank accession number: AB299446.1)) controlled by the silk fibroin light chain gene promoter and the fluorescent protein gene (preferably the red fluorescent protein (DsRed) gene) controlled by the 3×P3 promoter are cloned between the left and right homologous arms, and the gRNA expression cassette targeting the silk fibroin light chain gene controlled by the silkworm U6 promoter is cloned downstream of the right homologous arm. Preferably, the DNA sequence of the constructed gene targeting vector pUC57-MaSp-c is SEQ ID NO: 1.

[0068] In SEQ ID NO: 1, in the pUC57-MaSp-c plasmid, 1-431 nt is the pUC vector backbone sequence; 432-2015 nt is the left arm (containing the silk fibroin light chain gene promoter); 2016-2066 nt is the signal peptide sequence of the silk fibroin light chain gene, which is preferably the sequence optimized according to the silkworm codon; 2067-4730 nt is the codon-optimized MaSp-c gene (removing the 81 nt from the 5' end of the MaSp-c gene (encoding the signal peptide of MaSp-c) and containing a 337 nt ser3 tailing signal). 3731-4981 nt is the 3×P3 promoter; 5017-5697 nt is the DsRed gene coding sequence; 5706-5938 nt is the SV40 tailing signal (GenBank accession number: MH541846.1); 5939-7740 nt is the homologous right arm sequence; 7741-8202 nt is the U6 promoter sequence; 8203-8529 nt is the gDNA array targeting the silk fibroin light chain genome sequence; TCACTGTATTGATTGATGGTC and AGAAACTGTAATCGAATTGAA are the target site sequences on the template strand; TGCAAGTCAAGCATCAGCGGT, TCAATCAACTCGTCATCAACC, and GCCAGCAGTGACTCTAGGTAA are the target site sequences on the positive strand; and 8530-10808 nt is the pUC vector backbone sequence.

[0069] The sequence SEQ ID NO: 1 can be synthesized entirely by artificial chemical means, or it can be synthesized by combining artificial chemical means with PCR amplification, specifically using conventional techniques. Preferably, the lengths of the homologous left and right arms are greater than 1 kb, and the lengths of the homologous left and right arms can be those specified in SEQ ID NO: 1. The 3×P3 promoter sequence can also be replaced by other promoters active in silkworms, such as the actin A3 promoter or the immediate early promoter of baculoviruses. The red fluorescent protein (DsRed) gene can also be replaced by other fluorescent protein genes, such as the green fluorescent protein (GFP) gene. The tailing signal can also be a tailing signal of other genes. As the backbone sequence of the vector pUC57-MaSp-c, vectors other than pUC can also be used, such as the pBlueScript SK vector.

[0070] In this invention, the gene targeting vector pUC57-MaSp-c is mixed with the plasmid piggyCPF1 expressing the Cas12a nuclease and injected into the eggs of a practical silkworm variety. The DNA sequence of plasmid piggyCPF1 is the sequence shown in the applicant's previous invention patent (application number 202310944134.8). The silkworm actin A3 promoter controlling Cas12a expression in this sequence can be replaced by other active promoters in silkworms, such as the immediate early promoter of baculovirus. In the above scheme, the plasmid piggyCPF1 expressing the Cas12a nuclease can be directly replaced by commercially available recombinant Cas12a protein, or by in vitro transcribed Cas12a mRNA.

[0071] In this invention, the selected silkworm eggs are those of practical varieties. The gene targeting vector pUC57-MaSp-c in this invention can also be used to inject the first eggs of multi-diapause silkworms (eggs laid within 2-8 hours of being kept at room temperature).

[0072] In this invention, in step (4), the specific primers are primer pairs for amplifying the MaSp-c gene of the large ampullae gland silk protein from the web-web spider, primer pairs for amplifying the fluorescent protein gene, and primer pairs for detecting the left insertion site of exogenous DNA. Preferably, the specific primers are the primer pairs Light-cF and Light-cR for amplifying a partial sequence (406 bp) of the MaSp-c gene of the large ampullae gland silk protein from the web-web spider, whose sequences correspond to SEQ ID NO: 2 and SEQ ID NO: 3; the primer pairs DsRed-F and dsRed-R for amplifying a partial sequence (360 bp) of the fluorescent protein gene, whose sequences correspond to SEQ ID NO: 4 and SEQ ID NO: 5. The primer pairs CF and CR for amplifying a portion of the left arm and a portion of the MaSp-c sequence (1457 bp), whose sequences correspond to SEQ ID NO: 6 and SEQ ID NO: 7. The primer pairs for amplifying the 5' end sequence (2455 bp) of the homologous left arm upstream (upstream of the left integration site) to MaSp-c are LF and LR, corresponding to SEQ ID NO: 8 and SEQ ID NO: 9; the primer pairs for amplifying the light chain promoter and a partial sequence (672 bp) of the MaSp-c gene are L-2-F and L-2-R, corresponding to SEQ ID NO: 10 and SEQ ID NO: 11; the primer pairs for amplifying the partial sequence (416 bp) of the homologous left arm upstream (upstream of the left integration site) to the homologous left arm are LF and LeftK-R, corresponding to SEQ ID NO: 8 and SEQ ID NO: 12.

[0073] For example, the Light-cF and Light-cR primer pairs specifically amplified a 406bp sequence, indicating the detection of a specific band representing the MaSp-c fragment in the genomic DNA. The DsRed-F and dsRed-R primer pairs specifically amplified a 306bp sequence, indicating the detection of a specific band representing the DsRed gene fragment in the genomic DNA. When using the PCR product of the LF and LR primer pairs as a template (2455bp), amplification with the CF and CR primer pairs, or with the L-2-F and L-2-R primer pairs, yielded specific bands of 1457bp and 672bp, respectively, indicating that the left side of the expression cassette of the spider silk protein MaSp-c gene had been integrated into the silkworm genome as designed. The offspring of parent silkworm moths whose PCR amplification results matched the above characteristics were the silkworm eggs required for this invention. To further confirm the correctness of the PCR products, the PCR products were cloned into a vector and verified using Sanger sequencing.

[0074] In addition to the identification methods mentioned above, other specific primers can be designed based on the theoretical sequence of the exogenous DNA fragment integrated into the silkworm genome, according to the theoretical target region. This can be followed by PCR amplification and Sanger sequencing of the product. If the DsRed gene in pUC-MaSp-c is replaced with the GFP gene, a specific band representing the GFP gene fragment will be screened out. Similarly, if the 3×P3 promoter in pUC-MaSp-c is replaced with the immediate early promoter of a baculovirus, a specific band representing the immediate early promoter will be screened out.

[0075] In this invention, in step (5), the specific primer pair is used to detect whether the obtained silkworm is a pure-line genome-edited silkworm. Specifically, the specific primer is used to detect the silkworm moth DNA by PCR, and the PCR product is verified by Sanger sequencing. Eggs produced by mating of the parent silkworm with genome-edited silkworms are retained. After hatching, they are raised normally. After the moths emerge, they are mated in the same moth area. Then, PCR detection is performed, and the PCR product is identified by Sanger sequencing. Eggs produced by mating of pure-line genome-edited silkworms with both male and female parents are selected for succession. Specific primers FIBL-F and FIBL-R are designed, with sequences of SEQ ID NO: 13 and SEQ ID NO: 14, respectively. PCR detection and Sanger sequencing are performed on the offspring of mating in the same moth area. If a specific band of 567bp can be amplified, the target is a non-purebred target silkworm; if a specific band of 567bp cannot be amplified, the target is a pure-line target silkworm. Since the fibroin light chain gene locus of pure-line gene editing silkworms is replaced by exogenous gene expression or the fibroin light chain gene is no longer expressed, other primers can be designed based on the fibroin light chain gene sequence for PCR and RT-qPCR verification; Western blot can be used to detect whether fibroin light chain protein is expressed; or whole genome sequencing can be used for verification.

[0076] In this invention, in step (6), after the silkworm eggs obtained in step (5) are hatched, they are conventionally raised until they reach maturity. The mature silkworms are then transferred to a cocooning machine to spin cocoons. After cocooning, composite silk containing spider ampulla gland silk protein MaSp-c is obtained through reeling. Measurements show that the average breaking elongation, average breaking strength, Young's modulus, and breaking potential energy of the obtained composite silk are significantly improved. The mechanical properties are significantly improved.

[0077] The specific operational methods involved in this invention are conventional methods, such as cloning, PCR, Western blot injection of silkworm eggs, induction of hatching, the entire process from rearing to moth emergence, and silk reeling. The testing methods involved are also conventional techniques. Except for the designed sequences and vectors, the raw materials and reagents involved are all conventional products. The practical varieties of silkworm moths (varieties: Suhao and Zhongye) are conventional varieties used in existing silkworm production and have the general characteristics of silkworms. The invention will be further described below with reference to the accompanying drawings and embodiments.

[0078] Example 1 uses the practical variety *Bombyx mori* as the transgenic object to prepare gene-edited silkworms with the MaSp-c gene replacing the silk fibroin light chain gene, as well as spider-silkworm composite silk fibers containing MaSp-c.

[0079] (1) Construction of pUC-MaSp-c plasmid: The sequence of SEQ ID NO: 1 was synthesized by conventional methods and the synthesis process was conventional technique;

[0080] The structure of the pUC-MaSp-c plasmid and the technical principle of this invention are shown in Figure 1. Specifically, using the flanking sequence of the silkworm fibroin light chain gene as a homologous arm, a full-length codon-optimized expression cassette of the golden web-weaving spider *Gymnocypris fasciatus* fibroin gene controlled by the fibroin gene promoter and a DsRed gene expression cassette controlled by the 3×P3 promoter are inserted in the middle. A gDNA array controlled by the U6 promoter is inserted downstream of the homologous right arm, and its transcription product gRNA can target different regions of the fibroin light chain gene.

[0081] After the plasmid was mixed with the cas12a expression plasmid and introduced into silkworm eggs, the expressed Cas12a was used to cut the silk fibroin light chain locus through the CRISPR-Cas12a genome editing system. Furthermore, the MaSp-c expression cassette and DsRed gene expression cassette were used to replace the silk fibroin light chain locus through homologous recombination.

[0082] (2) Construction of plasmid piggyCPF1 expressing Cas12a nuclease: constructed according to the applicant's previously disclosed technical solution (Example of application number CN202310944134.8), which is a conventional technique;

[0083] (3) Corona treatment of silkworm eggs: At 24-25℃, silkworm eggs laid within 2 hours by the practical variety of silkworm moth (variety: Soho, wild type) are corona treated. The corona treatment device and related parameters are shown in Figure 2, namely: two steel plates (thickness: 1.5mm) are fixed parallel to each other on the insulating column, with a spacing of 2cm between the steel plates, and the electrode needle (length: 1.2cm, diameter: 2mm) is fixed on the lower side of the upper steel plate. During the corona treatment, the upper and lower steel plates are connected to the positive and negative poles of the power supply, respectively. During the corona treatment, a 1.5cm diameter egg ring is placed directly below the electrode needle and corona treated with 11kV for 4 minutes;

[0084] (4) Microinjection: A mixture of pUC-MaSp-c and piggyCPF1 was microinjected, with 10 nL injected into each egg (pUC-MaSp-c: 30 ng; piggyCPF1: 10 ng), for a total of 883 silkworm eggs; the solvent was sterile deionized water;

[0085] (5) Hatching, rearing, and seed production: Silkworm eggs were hatched at 24-25℃, with a hatching rate of 9.27%. The silkworms were reared according to conventional methods until they reached the cocoon stage, formed cocoons, became pupae, and emerged as moths, yielding a total of 11 moths. These were then mated with wild-type Soho moths, resulting in 5 G1 generation moth eggs (named as G1). 1 G1 2 G1 3 G1 4 G1 5 Its parent was the G0 generation silkworm moth (named G0). 1 G0 2 G0 3 G0 4 G0 5 );

[0086] (6) Extraction of silkworm moth genomic DNA: GO was extracted with phenol and chloroform. 1 G0 2 G0 3 G0 4 G0 5 DNA from parent moths in 5 moth cycles was used, and the DNA concentration was adjusted to 1 μg / μL;

[0087] (7) PCR detection of MaSp-c: Using the DNA from step (6) as a template, PCR amplification was performed using Light-cF and Light-cR primers. The amplification conditions were: pre-denaturation at 95℃ for 5 minutes, followed by denaturation at 95℃ for 50 seconds, annealing at 55℃ for 50 seconds, extension at 72℃ for 30 seconds, for 35 cycles, and then incubation at 72℃ for 10 minutes. The PCR products were electrophoresed on a 1% agarose gel, and the results are shown in Figure 3. A specific band (406 bp) representing MaSp-c was detected in the DNA of the three silkworm moths. The sequencing results of the PCR products confirmed that this fragment was a partial sequence of MaSp-c.

[0088] (8) G1 generation preparation and PCR detection: Moths in the same area that tested positive for MaSp-c by PCR were hatched and then raised normally until they formed cocoons, pupated, and emerged as moths. Mating and egg-laying were carried out between male and female moths in the same area to obtain G2 generation silkworm eggs. The parent male and female moths were preserved, i.e., G1 generation silkworm moths. DNA was extracted from the G1 generation silkworm moths and amplified by PCR using LF and LR primer pairs. The amplification conditions were: 95℃ pre-denaturation for 5 minutes, followed by 95℃ denaturation for 50 seconds, 55℃ annealing for 50 seconds, and 72℃ extension for 2.5 minutes, for 35 cycles. Afterward, the cells were incubated at 72℃ for 10 minutes. The PCR products were electrophoresed on a 1% agarose gel, and the results are shown in Figure 4. After the PCR product (2455bp) was recovered, it was used as a template for PCR using L-2-F and L-2-R primer pairs. The amplification conditions were as follows: pre-denaturation at 95℃ for 5 minutes, followed by denaturation at 95℃ for 50 seconds, annealing at 55℃ for 50 seconds, extension at 72℃ for 40 seconds, for 35 cycles. After that, the amplification was carried out at 72℃ for 10 minutes. The PCR product was electrophoresed on a 1% agarose gel, and the 672bp band was recovered and sequenced for verification. This confirmed that the sequence was a partial sequence of the MaSp-c gene controlled by the silk fibroin light chain promoter (Figure 5).

[0089] (9) Preparation and PCR detection of pure lines of genome-edited silkworms: After the DNA tests of the two parent silkworm moths in the G1 generation were both positive, the corresponding G2 generation silkworm eggs were hatched and normally reared until they spun cocoons, pupated, and emerged as moths. The male and female moths in the same moth-producing area mated and laid eggs to obtain G3 generation silkworm eggs, and their parent male and female moths were preserved, i.e., G2 generation silkworm moths. Similarly, G4 and G5 generation silkworm eggs and the corresponding G3 and G4 generation silkworm moths were obtained in sequence. The DNA of the parent male and female moths preserved in each generation was tested. If the DNA of the male and female parents could be amplified with both Light-cF and Light-cR primers to produce a specific band (406 bp), and the 567 bp representative silk fibroin light chain gene sequence fragment could not be amplified with FIBL-F and FIBL-R primers, it indicates that the offspring corresponding to the two parent moths are pure lines of genome-edited silkworms.

[0090] The scheme for identifying and screening transgenic silkworms in this invention is as follows: first, identify whether the silkworm genome contains the MaSp-c gene; then, identify whether the MaSp-c gene has replaced the silk fibroin light chain gene locus as designed; and finally, identify whether the obtained genome-edited silkworm is a pure line: that is, the silk fibroin light chain gene on both homologous chromosomes has been replaced by the MaSp-c gene.

[0091] (10) Detection of MaSp-c in genome-edited silkworm cocoons: Gene-edited silkworm cocoons (obtained by conventional feeding after hatching of G5 generation silkworm eggs) were degummed with 0.5% sodium bicarbonate as usual, dissolved in a ternary solution (calcium chloride: ethanol: water = 1:2:8) at 65℃ for 30 minutes, centrifuged at 8000 rpm for 10 minutes, and the supernatant was dialyzed with deionized water for 72 hours. The dialyzed solution was centrifuged at 8000 rpm for 10 minutes, and the supernatant (silk fibroin solution) was collected. After separation by SDS-PAGE, Western blotting was performed using MaSp-c antibody and P25 antibody. Specific signal bands of P25 (25 kDa) and MaSp-C (56 kDa) consistent with the theoretical molecular weight could be detected simultaneously. However, no specific signal of MaSp-c was detected in the control silkworm (wild Soho variety silkworm) (Figure 6), proving that the expressed MaSp-g entered the cocoon to form composite silk.

[0092] (11) Preparation of spider silk protein MaSp-c silkworm protein composite silk fiber: Genome-edited silkworm pure line was fed to maturity according to conventional methods. The mature silkworms were transferred to the cocooning machine and spun cocoons at 25℃. The cocoons were harvested 7 days later. The cocoons were dried and stored. Before reeling, the stored dry cocoons were degummed and then reeled to obtain spider silk protein MaSp-c-silkworm protein composite silk fiber.

[0093] (12) Mechanical property testing of composite silk fibers made from spider silk protein MaSp-c and silkworm silk protein: Ten G5 generation silkworm cocoons were randomly selected, degummed, and their single fiber mechanical properties were tested. The results showed that the average maximum stress of the silkworm-spider chimeric silk fiber was 692.18 MPa, which was 71.33% higher than that of the non-transgenic control group, and the average maximum elastic strain was 28.71%, which was 16.71% higher than that of the control group (Figure 7). The diameter of the composite silk fiber monofilament was 10.06 μm, the Young's modulus was 9.10 GPa, and the fracture potential energy was 134.63 MJ / m. 3 Compared with the non-GMO control group, the levels decreased by 20.72%, increased by 49.18%, and rose by 105.01%, respectively.

[0094] Brief description of the preparation of non-GMO control group silk: Wild-type Soho silkworm moths mate and lay eggs, and after routine incubation, they are fed normally until they spin cocoons, pupate, and emerge as moths. The cocoons are selected for single-fiber mechanical property testing as a parallel control group.

[0095] Compared with the applicant's previous gene-targeting silkworm preparation of spider silkworm composite silk fiber, the present invention significantly improves the average maximum stress. In particular, the previous method used spider silk MaSp-g to replace the silk fibroin heavy chain gene of silkworm, and the variety was not practical. The present invention adopts a new technical approach, using spider silk Masp-c gene to replace the silk fibroin light chain gene, and the variety is practical. The present invention solves the problem that the existing technology cannot be produced or is difficult to apply.

[0096] Example 2 uses the practical variety of silkworm, *Bombyx mori* var. *zhongye*, as the transgenic object to prepare gene-edited silkworms with the *MaSp-c* gene replacing the silk fibroin light chain gene.

[0097] (1) Construction of pUC-MaSp-c plasmid: Same as step (1) in Example 1;

[0098] (2) Construction of plasmid piggyCPF1 expressing Cas12a nuclease: Same as step (2) in Example 1;

[0099] (3) Microinjection and corona treatment of silkworm eggs: At 24-25℃, eggs laid within 4 hours by the practical variety Zhongye silkworm were injected with pUC57-MaSp-c plasmid and piggyCPF1 plasmid expressing Cas12a nuclease via microinjection. The eggs were protected at 24-25℃ for 18-20 hours, and then corona treated with 12kV and an electrode spacing of 8mm for 4 minutes. The treated silkworm eggs were protected at 24-25℃ until hatching. Corona treatment was performed according to step (3) of Example 1, and microinjection was performed according to step (4) of Example 1.

[0100] (4) Inducing growth, feeding, and seed production: Refer to step (5) of Example 1. When mating, select wild-type Zhongye silkworm moths and obtain a total of 4 G1 generation moth eggs;

[0101] (5) Extraction of silkworm moth genomic DNA: Refer to step (6) in Example 1;

[0102] (6) PCR detection of DsRed: Using the DNA from step (5) as a template, PCR amplification was performed using DsRed-F and DsRed-R primer pairs. The amplification conditions were: pre-denaturation at 95℃ for 5 minutes, followed by denaturation at 95℃ for 50 seconds, annealing at 55℃ for 50 seconds, extension at 72℃ for 30 seconds, for 35 cycles, and then incubation at 72℃ for 10 minutes. The PCR products were electrophoresed on a 1% agarose gel, and the results are shown in Figure 8. A specific band (306 bp) representing DsRed was detected in the DNA of the three silkworm moths. The sequencing results of the PCR products confirmed that this fragment was a partial sequence of DsRed.

[0103] (7) G1 generation preparation and PCR detection: Moths in the same area that showed positive DsRed results in PCR detection were hatched and then reared normally until they formed cocoons, pupated, and emerged as moths. The male and female moths in the same area mated and laid eggs to obtain G2 generation silkworm eggs, and their parent male and female moths were preserved, i.e., G1 generation silkworm moths. DNA of the G1 generation silkworm moths was extracted and PCR amplified using LF and LR primer pairs. PCR amplification and electrophoresis detection were performed according to the conditions in step (8) of Example 1. After recovery, the PCR product (2455 bp) was used as a template for PCR using CF and CR primers. The amplification conditions were: 95℃ pre-denaturation for 5 minutes, followed by 95℃ denaturation for 50 seconds, 55℃ annealing for 50 seconds, and 72℃ extension for 1.5 minutes, for 35 cycles. Afterward, the product was incubated at 72℃ for 10 minutes. The PCR product was electrophoresed on a 1% agarose gel, and a 1457 bp band was recovered and sequenced for verification. This sequence was confirmed to be the 3' end of the left homologous arm and a portion of the silk fibroin light chain promoter sequence (Figure 9). Using the recovered 2455 bp PCR product as a template, PCR was performed using LF and LeftK-R primers, which amplified a specific 416 bp band. Sequencing results showed that this band was the target site of the homologous left arm and its upstream genomic sequence (Figure 10).

[0104] (8) Preparation of pure lines of genome-edited silkworms and PCR detection: Refer to step (9) in Example 1;

[0105] (9) Detection of MaSp-c in silkworm cocoons after genome editing: Refer to step (10) in Example 1;

[0106] (10) Preparation of spider silk protein MaSp-c silkworm protein composite silk fiber: Refer to step (11) of Example 1.

[0107] The specific sequence used in this invention is as follows.

[0108] SEQ ID NO:1

[0109] pUC57-MaSp-c

[0110]

[0111]

[0112]

[0113]

[0114]

[0115] SEQ ID NO: 2(Light-cF)

[0116] TCAATCGAAGCTCCAGGCT

[0117] SEQ ID NO: 3(Light-c-R)

[0118] TCTTCCAGCACCCTGGTTTC

[0119] SEQ ID NO: 4(DsRed-F)

[0120] CTCGCCCGGGGATCTAATTC

[0121] SEQ ID NO: 5(DsRed-R)

[0122] CTCGATCTCGAACTCGTGGC

[0123] SEQ ID NO: 6(C-F)

[0124] CTCAACTTTCCCGAGACGCT

[0125] SEQ ID NO: 7(C-R)

[0126] CGGCAGCGATTTCAGCCATT

[0127] SEQ ID NO: 8(L-F)

[0128] AAACTAGCTGTACCCGTCCG

[0129] SEQ ID NO: 9(L-R)

[0130] GGCTTCATTGAGGAAAGCGT

[0131] SEQ ID NO: 10(L-2-F)

[0132] AGTGGGCAACTTCATTCTGT

[0133] SEQ ID NO: 11(L-2-R)

[0134] GGCTTCATTGAGGAAAGCGT

[0135] SEQ ID NO:12 (LeftK-R)

[0136] CTTCAACTCATACCCCAGCC

[0137] SEQ ID NO: 13(FIBL-F)

[0138] AGGAAGGCCGTGATCCAATG

[0139] SEQ ID NO: 14(FIBL-R)

[0140] AGTTAAGGACGGGGAGACGA

[0141] This invention discloses a method for producing composite silk fibers of spider ampullary gland silk protein MaSp-c and silkworm fibroin using a practical silkworm variety based on genome editing and homology repair technology. Eggs laid within 2 hours of the silkworm moth's birth at 24-25 degrees Celsius are treated with a continuous 10-12 kV corona discharge for 3-5 minutes, followed by injection of the pUC57-MaSp-c plasmid and the pCase12a plasmid expressing the nuclease Cas12a; or eggs laid within 4 hours of birth are injected with the pUC57-MaSp-c plasmid and the Cas12a plasmid, protected at 24-25 degrees Celsius for 18-20 hours, and then treated with a continuous 10-12 kV electric shock for 3-5 minutes. After hatching, the silkworm eggs are reared for multiple generations, and through molecular biological screening and identification, genome-edited silkworms are obtained that replace the silkworm fibroin light chain gene expression cassette with the spider ampullary gland silk protein MaSp-c gene sequence expression cassette. After being reared and spinning cocoons, the genome-edited silkworms produced this invention yielded composite silk containing the urna gland filament protein from the golden web-weaving spider, obtained through conventional silk reeling. This invention allows for the acquisition of silk containing the urna gland filament protein MaSp-c from the golden web-weaving spider, meeting the diverse needs of silk proteins in the production of various textile silk products and the preparation of various biomaterials. Furthermore, the obtained genome-edited silkworms can be used to breed new silkworm varieties through conventional hybridization breeding methods.

Claims

1. A method for preparing composite silk fibers containing spider silk protein, characterized in that, Includes the following steps: (1) The gene targeting vector pUC57-MaSp-c and the plasmid expressing nuclease were introduced into the first egg-laying of the practical variety of silkworm, and then hatched and raised until the moth emerged. The eggs were then mated with wild-type practical silkworms to obtain the moth-eggs. (2) Amplify the DNA of the parent moths of the silkworm eggs in the moth area, and screen to obtain the eggs produced by the silkworm moths carrying the MaSp-c gene; then induce the eggs of the silkworm moths carrying the MaSp-c gene to turn into moths and mate them with the moths in the same area to lay eggs. (3) Then amplify the DNA of the moth in step (2), sequence the amplified product for verification, and select the eggs produced by the mating of gene-targeting silkworm moths whose male and female parents are both pure lines for the next generation; (4) The eggs or sub-eggs from step (3) are hatched and raised to the upper clump to obtain composite silk fibers containing spider silk protein.

2. A method for constructing a genome-edited silkworm, characterized in that, Includes the following steps: (1) The gene targeting vector pUC57-MaSp-c and the plasmid expressing nuclease were introduced into the first egg-laying of the practical variety of silkworm, and then hatched and raised until the moth emerged. The eggs were then mated with wild-type practical silkworms to obtain the moth-eggs. (2) Amplify the DNA of the parent moths of the silkworm eggs in the moth area, and screen to obtain the eggs produced by the silkworm moths carrying the MaSp-c gene; then induce the eggs of the silkworm moths carrying the MaSp-c gene to turn into moths and mate them with the moths in the same area to lay eggs. (3) Then amplify the DNA of the moth in step (2), sequence the amplified product for verification, and select the eggs produced by the mating of gene-targeting silkworm moths whose male and female parents are both pure lines for the next generation; (4) The eggs or sub-eggs from step (3) are hatched to obtain genome-edited silkworms.

3. A method for constructing genome-edited silkworm eggs, characterized in that, Includes the following steps: (1) The gene targeting vector pUC57-MaSp-c and the plasmid expressing nuclease were introduced into the first egg-laying of the practical variety of silkworm, and then hatched and raised until the moth emerged. The eggs were then mated with wild-type practical silkworms to obtain the moth-eggs. (2) Amplify the DNA of the parent moths of the silkworm eggs in the moth area, and screen to obtain the eggs produced by the silkworm moths carrying the MaSp-c gene; then induce the eggs of the silkworm moths carrying the MaSp-c gene to turn into moths and mate them with the moths in the same area to lay eggs. (3) Then amplify the DNA of the moth in step (2), sequence and verify the amplification product, and select the eggs or sub-generation eggs produced by the mating of gene-targeting silkworm moths with pure lineage of male and female parents as genome-edited silkworm eggs.

4. The method according to claim 1, claim 2, or claim 3, characterized in that, Using the flanking sequence of the silk fibroin light chain gene as a homologous arm, pUC57-MaSp-c cloned the gene expression cassette encoding the filamentous gland silk protein of the golden web-weaving spider, controlled by the silk fibroin light chain gene promoter, and the fluorescent protein gene controlled by the 3×P3 promoter into the space between the left and right homologous arms. The gRNA expression cassette targeting the silk fibroin light chain gene, controlled by the silkworm U6 promoter, was cloned downstream of the right homologous arm.

5. The method according to claim 1, claim 2, or claim 3, characterized in that, The gene targeting vector pUC57-MaSp-c and the plasmid expressing nuclease were introduced into the first egg-laying of a practical silkworm variety after corona treatment, and then hatched; or the gene targeting vector pUC57-MaSp-c and the plasmid expressing nuclease were introduced into the first egg-laying of a practical silkworm variety, followed by corona treatment, and then hatched.

6. The method according to claim 1, claim 2, or claim 3, characterized in that, In step (2), during amplification, the specific primers are primer pairs for amplifying the ampullary gland silk protein gene of the web spider, primer pairs for amplifying the fluorescent protein gene, primer pairs for detecting the left insertion site of exogenous DNA, and primer pairs for detecting the right insertion site of exogenous DNA; in step (3), during amplification, the specific primer pairs are primer pairs for detecting whether the obtained silkworm is a pure-line genome-edited silkworm.

7. The composite silk fiber containing spider silk protein prepared by the method for preparing composite silk fiber containing spider silk protein according to claim 1; the genome-edited silkworm constructed by the method for constructing genome-edited silkworm according to claim 2; and the genome-edited silkworm egg constructed by the method for constructing genome-edited silkworm egg according to claim 3.

8. The use of the genome-edited silkworm or genome-edited silkworm egg as described in claim 7 in the preparation of composite silk fibers containing spider silk protein.

9. Application of the gene targeting vector pUC57-MaSp-c in the preparation of composite silk fibers containing spider silk protein from practical silkworm varieties, or in the construction of practical silkworm varieties for genome editing, or in the construction of silkworm eggs for practical silkworm varieties for genome editing.

10. The application according to claim 9, characterized in that, During application, the newly laid eggs of practical silkworm varieties are treated with electrocoagulation.

Images