New multivalent recombinant MDV vector vaccine

Abstract

The present invention provides novel recombinant Marek's disease virus (MDV), which involves a novel insertion site for heterologous genes and / or expression cassettes, and / or efficiently co-expresses multiplexed heterologous antigens by optimizing the heterologous antigenic expression regulatory elements, combinations of the expression regulatory elements and their linkage to the antigens, and / or combinations of multiple insertion sites. Also provided are the use of the recombinant MDV in vaccines, and methods of constructing the same.

Description

New multivalent recombinant MDV vector vaccineTechnical field

[0001] The present invention relates to the technical field of medicine or veterinary medicine, and the technical field of live recombinant poultry vaccine vectors. Specifically, the present invention relates to novel Marek’s disease virus (MDV) vector vaccines, the choice of antigens from prevalent strains, and construction and evaluation of multiplex vector vaccines.Background

[0002] As the scale and industrialization of poultry farming develop, the concentrated outbreaks of epidemics and the presence of multiple infections are frequent, especially viral diseases, which cause huge losses to the poultry industry every year. Due to the lack of effective treatments, immunization by vaccines is still an important means for the prevention and control of poultry viral diseases, and safe and effective vaccines with controllable quality are the key factor to the establishment of a population immunity barrier. In recent years, the research direction of poultry vaccines has gradually transitioned from traditional vaccines to novel types of combined vaccines such as vector vaccines, especially viral vectors, whose properties of stable replication and inheritance in vitro are very favorable for production in a large-scale.

[0003] Turkey herpesvirus (HVT) , originally isolated from turkeys, is a naturally non-pathogenic Marek's disease virus (MDV) , which belongs to the herpesviruses. HVT itself can be applied as a vaccine to prevent Marek's disease, and it is also suitable for the use as a vector vaccine. The vector vaccines are recombinant viruses that express heterologous antigens, and are usually constructed using live non-pathogenic viruses as vectors. Gene editing techniques are frequently used in such construction. Compared with other poultry virus vectors, the advantages of the combined viral vector vaccine constructed based on HVT as a vector are significant: (1) HVT is non-pathogenic to poultry and other species, with limited horizontal transmission capacity, low risk of spreading (especially recombinant HVT) , and good biosafety; (2) herpesviruses such as HVT possess a large linear double-stranded DNA genome, wherein a number of non-essential gene loci and non-coding regions can serve as insertion sites on the genome for heterologous antigen genes, and are compatible with the stable insertion of long (10-50 kb) heterologous expression cassettes, which is suitable for the development of combined vector vaccines; (3) Compared with viral vectors such as fowlpox virus (FWPV) and Newcastle disease virus (NDV) , recombinant MDV such as recombinant HVT and the heterologous antigens expressed therefrom are less likely to be interfered by Maternal Derived Antibody (MDA) . (4) HVT infects a wide range of cell types, and its unique characteristics of lifelong latent infection and conditional activation enable the continuous expression of heterologous antigens, which can effectively stimulate the body's cellular immunity and humoral immunity, and continue to produce high levels of antibodies, providing lifelong immune protection. Due to the above advantages, the industry is very enthusiastic about the development of recombinant MDV vector vaccines, and a variety of recombinant HVT vaccine products have been approved and marketed all over the world. Mature production processes combined with automated embryo injection technology have dramatically reduced the cost of vaccination against a wide range of epidemics.

[0004] Infectious bursal disease virus (IBDV) serotype I is highly infectious and pathogenic, infecting chickens and causing chicken infectious bursal disease. The virus is genetically unstable, and classical virulent infectious bursal disease virus (cv IBDV) , and widely prevalent novel variant IBDV (nVar IBDV) and very virulent infectious bursal disease virus (vv IBDV) in recent years, have emerged through mutation and recombination. The emerging variants which are more prone to escape protection of previous vaccines, and the lack of adequate cross-protection among serotypes, have created a more urgent need for vaccine improvement.

[0005] It has been shown that when the same individual is vaccinated with two kinds of recombinant HVT vaccines, the recombinant HVTs may interfere with each other and thereby the effectiveness of the vaccine's immunoprotection against heterologous antigenic target pathogens is reduced. Therefore, in order to avoid the interference effect between different vaccine strains, multivalent recombinant MDV vector vaccines that simultaneously express multiple key antigens of multiple epidemic diseases have become a research hotspot for novel combination vaccines. However, the insertion of a heterologous gene into its viral genome is a burden on a vector virus, as that may affect its replication, expression, and / or its genetic stability, in vitro and / or in vivo. These issues are particularly prominent when more than one heterologous gene is inserted, more inserts cause more problems to a viral vector’s genetic stability in regard to replication and foreign gene expression. This even to such an extent that no predictions of what would be successful multivalent recombinant HVT constructs, could be based on observations in the prior art on what was an allowable insertion site for a heterologous gene in the HVT genome.

[0006] Therefore, the development of multivalent recombinant MDV vector vaccines (e.g., recombinant HVT vaccines) requires an improvement on efficient co-expression strategy of heterologous antigens: while conferring good in vitro and in vivo proliferation characteristics of the vaccine, multiple heterologous antigens can be expressed stably, consistently, and in appropriate quantities, and at the same time, induce the generation of a protective immune response against multiple target epidemics.Summary of the Invention

[0007] The purpose of the present invention is to develop a novel insertion site for heterologous genes and / or expression cassettes, enabling recombinant Marek's disease virus (MDV, preferably HVT) to efficiently express transgenic antigens through the development of novel heterologous genes or expression cassette insertion sites. Thus, a further purpose is to provide a novel strategy for efficient co-expression of multiplexed heterologous antigens by optimizing the heterologous antigenic expression regulatory elements, combinations of the expression regulatory elements and their linkage to the antigens, and / or combinations of multiple insertion sites, and thereby to construct recombinant MDV (preferably HVT) vector vaccines expressing more than one (e.g., two, three ......) epidemic key antigens accordingly.

[0008] The recombinant MDV vector vaccine of the present invention immunizes poultry against at least the following four epidemics: the MDV itself as the vector protects against multiple types of Marek's disease (MD) caused by various Marek's disease viruses, the Newcastle disease (ND) virus (NDV) F antigen expressed thereby protects against Newcastle disease (ND) caused by NDV, the Infectious bursal disease virus (IBDV) VP2 antigen expressed thereby prevent infectious bursal disease (IBD) caused by IBDV, and the infectious laryngotracheitis virus (ILTV) gD antigen expressed thereby prevents infectious laryngotracheitis (ILT) in chickens caused by ILTV.

[0009] The recombinant MDV vector vaccines constructed by the present invention are stably replicated and inherited in vitro, e.g., the two or more heterologous antigens are efficiently co-expressed in Chicken Embryo Fibroblast (CEF) cells even after 10 or more passages, preferentially even after 15 passages, and more preferentially even after 20 passages.

[0010] The present invention also provides the use of various IBDV VP2 proteins and their coding genes in the construction of recombinant MDV vaccines, which are multivalent vaccines and / or are capable of providing simultaneous immune protection / cross-protection against multiple IBDV serotypes / subtypes including vv IBDV, cv IBDV and nVar IBDV, inducing broad and efficient protection.

[0011] The present invention also provides codon-optimized gene sequences, and use thereof in the construction of recombinant MDVs.

[0012] The present invention also provides a variety of regulatory elements / base sequences particularly suitable for use in the construction of multiplexed recombinant MDVs. The present invention also provides the use of a variety of endogenous elements in the MDV genome in the construction of multiplex recombinant MDVs.

[0013] The present invention also provides methods of inoculating an animal or inducing an immunogenic or protective response in an animal comprising at least one administration of a recombinant MDV vaccine of the present invention.

[0014] The present invention also provides methods of constructing recombinant herpes virus, comprising the steps of constructing infectious clones carrying a vector comprising replicons and screening tags for E. coli and eliminating the vector sequence.

[0015] Brief Description of the Figures

[0016] Figure 1 shows the schematic diagram of the construction of HVT15 of the present invention on the basis of an exemplary MDV strain, HVT FC-126, depicting the inserted fragments and the insertion sites.

[0017] Figure 2 shows the schematic diagram of the construction of HVT14 of the present invention on the basis of an exemplary MDV strain, HVT FC-126, depicting the inserted fragments and the insertion sites.

[0018] Figure 3 shows the schematic diagram of the construction of HVT22 of the present invention on the basis of an exemplary MDV strain, HVT FC-126, depicting the inserted fragments and the insertion sites.

[0019] Figure 4 shows the schematic diagram of the construction of HVT35of the present invention on the basis of an exemplary MDV strain, HVT FC-126, depicting the inserted fragments and the insertion sites.

[0020] Figure 5 shows the schematic diagram of the construction of HVT38 of the present invention on the basis of an exemplary MDV strain, HVT FC-126, depicting the inserted fragments and the insertion sites.

[0021] Figure 6 shows the schematic diagram of the construction of HVT39 of the present invention on the basis of an exemplary MDV strain, HVT FC-126, depicting the inserted fragments and the insertion sites.

[0022] Figure 7 shows the schematic diagram of the construction of HVT310 of the present invention on the basis of an exemplary MDV strain, HVT FC-126, depicting the inserted fragments and the insertion sites.

[0023] Figure 8 is a detailed flow diagram of the construction process of the recombinant HVTs of the present invention: (a) the construction of HVT virus-infectious bacterial artificial chromosome; (b) the construction of a recombinant turkey herpesvirus circular genome; (c) the rescue of recombinant turkey herpesvirus.

[0024] Figure 9 shows the identification in vitro of HVT14. (a) after infection with HVT14, cultured CEF develops morphological changes and viral plaque formation, as observed under bright-field microscopy; (b) In the immunofluorescence assay, the fluorescence visualizing the IBDV VP2 antigen polypeptides co-localizes significantly with the plaque area as shown in Panel (a) ; (c) In the agarose gel electrophoresis, it is shown that the PCR using the primers HVT-site2-F / R obtains DNA fragments with expected size of the inserted cassette in HVT14 genome and positive control, and DNA fragments of a very small size in wildtype HVT genome and negative control suggesting that no insert present in the tested insertion site.

[0025] Figure 10 shows the identification in vitro of HVT15. (a) after infection with HVT15, cultured CEF develops morphological changes and viral plaque formation, as observed under bright-field microscopy; (b) In the immunofluorescence assay, the fluorescence visualizing the NDV F antigen polypeptides co-localizes significantly with the plaque area as shown in Panel (a) ; (c) In the agarose gel electrophoresis, it is shown that the PCR using the primers HVT-site1-F / R obtains DNA fragments with expected size of the inserted cassette in HVT15 genome and positive control, and DNA fragments of a very small size in wildtype HVT genome and negative control suggesting that no insert present in the tested insertion site.

[0026] Figure 11 shows the test of the titer of the anti-IBDV antibodies elicited in vivo by HVT14 in a column chart, wherein n=12. The antibodies are produced in 100%animals after 21 days post-immunization (dpi) (green inverted triangle-marked column) , and the titer even increased from about 6000 on average on 21dpi to about 12000 on average on 28dpi (orange diamond-marked column) .

[0027] Figure 12 shows the morphologic change of the bursa of Fabricius through necropsy in the HVT14 vaccination-challenge test against nVar IBDV. (a) bursae of Fabricius and spleens of the chickens in the blank control group; (b) bursae of Fabricius, all of which show atrophy, and spleens of the chickens in the challenge control group; (c) bursae of Fabricius and spleens of the chickens in the test group which get vaccinated with HVT14 in prior to the nVar IBDV challenge.

[0028] Figure 13 shows the morphologic change of the bursa of Fabricius through necropsy in the HVT14 vaccination-challenge test against vv IBDV. (a) bursae of Fabricius of the chickens in the blank control group; (b) bursae of Fabricius, all of which show obvious lesions, of the chickens in the challenge control group; (c) bursae of Fabricius of the chickens in the test group which get vaccinated with HVT14 in prior to the vv IBDV challenge. Photos were taken for part of subjects of the group for the purpose of exhibiting typical pathological change.

[0029] Figure 14 shows the morphologic change of the bursa of Fabricius through necropsy in the HVT14 vaccination-challenge test against cv IBDV. (a) bursae of Fabricius of the chickens in the blank control group; (b) bursae of Fabricius, all of which show obvious lesions, of the chickens in the challenge control group; (c) bursae of Fabricius of the chickens in the test group which get vaccinated with HVT14 in prior to the cv IBDV challenge. Photos were taken for part of subjects of the group for the purpose of exhibiting typical pathological change. The red arrow emphasizes an obvious lesion.

[0030] Figure 15 shows (a) the test of the titer of the anti-NDV antibodies elicited in vivo by HVT15 in a column chart, wherein n=12. The antibodies are produced in 11 animals of 12 (91.6%) after 21 days post-immunization (dpi) (orange diamond -marked column) , and in all 12 animals on 28 dpi (black dot-marked column) , with the titer also increasing from about 1800 on average to about 3200 on average. (b) the survival in the vaccination-challenge test against NDV.

[0031] Figure 16 shows the observations under microscopy to the cells of test groups and control groups in identification assays on HVT22. The photos of CEF cells infected with HVT22, taken 36 hours post-infection (hpi) , are listed in Column (A) , and the photos of CEF cells 36 hpi with wildtype HVT or not infected are listed in Column (B) and (C) , respectively. Photos in Row (a) are taken under bright-field microscopy showing cytopathies and plaques of the culture cells; the photos in Row (b) and (c) show the fluorescence visualizing the IBDV VP2 antigen polypeptides and the ILTV gD antigen polypeptides, respectively, in the immunofluorescence assay.

[0032] Figure 17 shows that (a) the PCR using the primers HVT-site2-F / R obtains DNA fragments with expected size of the inserted cassette in HVT22 genome and positive control (PC) , and DNA fragments of a very small size in wildtype HVT genome and negative control (NC) , as separated in an agarose gel electrophoresis suggesting that no insert present in the tested insertion site; and (b) in Western blotting of the total protein of the infected cells or control cells, anti-IBDV VP2 antibody and anti-ILTV gD antibody as the primary antibody bind to the corresponding significant bands with expected sizes on the membrane, suggesting that the IBDV VP2 antigen and the ILTV gD antigen are successfully expressed in the infected cells in a considerable amount.

[0033] Figure 18 shows (a) the test of the titer of the anti-IBDV antibodies elicited in vivo by HVT22 in a column chart, wherein n=12. The antibodies are produced in 100%animals after 21 days post-immunization (dpi) (blue inverted triangle-marked column) , and the titer even increased from about 6000 on average on 21dpi to above 12000 on average on 28dpi (black diamond-marked column) . (b) shows the morphologic change of the larynx and trachea through necropsy in the HVT22 vaccination-challenge test against ILTV. (ba) the larynx and trachea of the chickens in the blank control group; (bb) the larynx and trachea, all of which show obvious lesions, of the chickens in the challenge control group; (bc) the larynx and trachea of the chickens in the test group which get vaccinated with HVT22 in prior to the ILTV-WG strain challenge. The red arrows in (bb) and (bc) show a significant contrast between inflammatory tissue and normal tissue. Photos were taken for part of subjects of the group for the purpose of exhibiting typical pathological change.

[0034] Figure 19 shows the morphologic change of the bursa of Fabricius through necropsy in the HVT22 vaccination-challenge test against vv IBDV. (a) bursae of Fabricius of the chickens in the blank control group; (b) bursae of Fabricius, all of which show obvious lesions, of the chickens (if not dead yet) in the challenge control group; (c) bursae of Fabricius of the chickens in the test group which get vaccinated with HVT22 in prior to the vv IBDV challenge. Photos were taken for part of subjects of the group for the purpose of exhibiting typical pathological change.

[0035] Figure 20 shows the observations under microscopy to the cells of test groups and control groups in identification assays on HVT35. The photos of CEF cells infected with HVT35, taken 36 hours post-infection (hpi) , are listed in Column (A) , and the photos of CEF cells 36 hpi with wildtype HVT or not infected are listed in Column (B) and (C) , respectively. Photos in Row (a) are taken under bright-field microscopy showing cytopathies and irregular plaques of the culture cells; the photos in Row (b) (c) and (d) show the fluorescence visualizing the NDV F antigen polypeptides, IBDV VP2 antigen polypeptides and the ILTV gD antigen polypeptides, respectively, by the cognate antibodies, in the immunofluorescence assay.

[0036] Figure 21 shows that (a) in Western blotting of the total protein of the infected cells or control cells, the anti-NDV F antibody, the anti-IBDV VP2 antibody and the anti-ILTV gD antibody as the primary antibody bind to the corresponding significant bands with expected sizes on the membrane, suggesting that the anti-NDV F antigen, the IBDV VP2 antigen and the ILTV gD antigen are successfully expressed in the infected cells in a considerable amount; (b) the PCR using the primers HVT-site1-F / R obtains DNA fragments with expected size of the inserted cassette in HVT35 genome and positive control (PC) , and DNA fragments of a very small size in wildtype HVT genome and negative control (NC) , as separated in an agarose gel electrophoresis suggesting that no insert present in the tested insertion site; and (c) the PCR using the primers HVT-site2-F / R obtains DNA fragments with expected size of the inserted cassette in HVT35 genome and positive control (PC) , and DNA fragments of a very small size in wildtype HVT genome and negative control (NC) , as separated in an agarose gel electrophoresis suggesting that no insert present in the tested insertion site. Lanes of the samples from HVT35-infected cells are marked as “HVT35” .

[0037] Figure 22 shows a same Western blotting assay as in Figure 21 (a) , but the total protein of the infected cells is sampled from 5 generations: F4, F8, F12, F16 and F20. Bands of 3 antigens are evident in all the lanes for each generation of infected cells, suggesting the 3 heterologous antigens are efficiently co-expressed in infected CEF cells even after 20 passages.

[0038] Figure 23 shows same PCR reactions as in Figure 21 (b) and (c) , but the viral genomes of the infected cells is extracted from 5 generations: F4, F8, F12, F16 and F20. Amplification of the inserts at the expected insertion sites are evident in all the lanes for each generation of infected cells, suggesting the inserted expression cassettes are stably present and transcribed in the HVT genome and even after 20 passages.

[0039] Figure 24 shows that the replication of HVT35 and the parental wildtype HVT are investigated in CEF cells. HVT35 exhibits largely comparable replication to the parental strain in 24–72 hpi, although some minor gaps in the overall titer were observed. The growth curves of quantitation of the virus (Y-axis: Log PFU / mL) by time of hours (X-axis: hours post-infection) is drawn based on the determined PFU results of the virus collected at each time point, wherein the curves of hollow dots (gray color) correspond to the parental HVT and the curves of solid dots (orange color) correspond to HVT35.

[0040] Figure 25 shows (a) the test of the titer of the anti-NDV F antibodies elicited in vivo by HVT35 in a column chart, wherein n=12. The antibodies are produced in 8 animals of 12 (66.7%) after 21 days post-immunization (dpi) (orange diamond -marked column) , and in all 12 animals on 28 dpi (black dot-marked column) , with the titer also increasing from about 1500 on average to above 4000 on average; (b) the survival in the vaccination-challenge test against NDV; (c) the test of the titer of the anti-IBDV VP2 antibodies elicited in vivo by HVT35 in a column chart, wherein n=12. The antibodies are produced in 100%animals after 21 days post-immunization (dpi) (black dot-marked column) , and the titer even increased from above 4000 on average on 21dpi to above 6000 on average on 28dpi (green dot-marked column) .

[0041] Figure 26 shows the morphologic change of the bursa of Fabricius through necropsy in the HVT35 vaccination-challenge test against vv IBDV. (a) bursae of Fabricius of the chickens in the blank control group; (b) bursae of Fabricius, all of which show obvious lesions, of the chickens in the challenge control group; (c) bursae of Fabricius of the chickens in the test group which get vaccinated with HVT35 in prior to the vv IBDV challenge. Photos were taken for part of subjects of the group for the purpose of exhibiting typical pathological change.

[0042] Figure 27 shows the morphologic change of the bursa of Fabricius through necropsy in the HVT35 vaccination-challenge test against nVar IBDV. (a) bursae of Fabricius and spleens of the chickens in the blank control group; (b) bursae of Fabricius, all of which show atrophy, and spleens of the chickens in the challenge control group; (c) bursae of Fabricius and spleens of the chickens in the test group which get vaccinated with HVT35 in prior to the nVar IBDV challenge.

[0043] Figure 28 shows the morphologic change of the bursa of Fabricius through necropsy in the HVT35 vaccination-challenge test against cv IBDV. (a) bursae of Fabricius of the chickens in the blank control group; (b) bursae of Fabricius, all of which show obvious lesions, of the chickens in the challenge control group; (c) bursae of Fabricius of the chickens in the test group which get vaccinated with HVT35 in prior to the cv IBDV challenge. The red arrow emphasizes an obvious lesion. Photos were taken for part of subjects of the group for the purpose of exhibiting typical pathological change.

[0044] Figure 29 shows the morphologic change of the larynx and trachea through necropsy in the HVT35 vaccination-challenge test against ILTV. (a) the larynx and trachea of the chickens in the blank control group; (b) the larynx and trachea, all of which show obvious lesions, of the chickens in the challenge control group; (c) the larynx and trachea of the chickens in the test group which get vaccinated with HVT35 in prior to the ILTV-WG strain challenge. The red arrow emphasizes an obvious lesion. Photos were taken for part of subjects of the group for the purpose of exhibiting typical pathological change.

[0045] Figure 30 shows that HVT38 infection causes cytopathies in cultured CEF cells and produces heterologous NDV F antigen polypeptides, IBDV VP2 antigen polypeptides and the ILTV gD antigen polypeptides therein. In the photos taken under bright-field microscopy, irregular plaques are observed. In immunofluorescence assays, the fluorescence visualizes the three heterologous antigens, respectively, by the cognate antibodies, and co-localizes with the plaque areas, wherein, (a) displays NDV F antigen, (b) displays IBDV VP2 antigen, and (c) displays ILTV gD antigen.

[0046] Figure 31 shows that HVT39 infection causes cytopathies in cultured CEF cells and produces heterologous NDV F antigen polypeptides, IBDV VP2 antigen polypeptides and the ILTV gD antigen polypeptides therein. In the photos taken under bright-field microscopy, irregular plaques are observed. In immunofluorescence assays, the fluorescence visualizes the three heterologous antigens, respectively, by the cognate antibodies, and co-localizes with the plaque areas, wherein, (a) displays NDV F antigen, (b) displays IBDV VP2 antigen, and (c) displays ILTV gD antigen.

[0047] Figure 32 shows that HVT310 infection causes cytopathies in cultured CEF cells and produces heterologous NDV F antigen polypeptides, IBDV VP2 antigen polypeptides and the ILTV gD antigen polypeptides therein. In the photos taken under bright-field microscopy, irregular plaques are observed. In immunofluorescence assays, the fluorescence visualizes the three heterologous antigens, respectively, by the cognate antibodies, and co-localizes with the plaque areas, wherein, (a) displays NDV F antigen, (b) displays IBDV VP2 antigen, and (c) displays ILTV gD antigen.

[0048] Figure 33 shows the PCR using (a) the primers HVT-site1-F / R and (b) the primers HVT-site2-F / R obtains DNA fragments with expected size of the inserted cassettes in HVT35 genome and positive control (PC) , and DNA fragments of a very small size in wildtype HVT genome and negative control (NC) , as separated in an agarose gel electrophoresis suggesting that no insert present in the tested insertion site. Lanes of the samples from HVT38-infected cells, HVT39-infected cells and HVT310-infected cells are marked as “HVT38” , “HVT39” and “HVT310” , respectively.

[0049] Figure 34 shows that the replication of HVT38, HVT39, HVT310, and the parental wildtype HVT are investigated in CEF cells, wherein the curves of hollow dots (black color) correspond to the parental HVT and the curves of small dots (red color) , inverted triangle (red color) , and diamond (blue color) correspond to HVT38, HVT39 and HVT310, respectively.

[0050] Figure 35 shows (a) the test of the titer of the anti-IBDV VP2 antibodies elicited in vivo by HVT38 in a column chart, wherein n=12. The antibodies are produced in 100%animals after 28 days post-immunization (black dot-marked column) with the titer of about 9000 on average; (b) the test of the titer of the anti-NDV F antibodies elicited in vivo by HVT38 in a column chart, wherein n=12. The antibodies are produced in 11 animals of 12 (91.7%) after 28 days post-immunization (black dot -marked column) , with the titer of about 3500 on average.

[0051] Figure 36 shows the survival in the HVT38-vaccination-challenge test against NDV.

[0052] Figure 37 shows bursae of Fabricius of the chickens in the blank control group in the HVT38 vaccination-challenge test.

[0053] Figure 38 shows bursae of Fabricius, all showing obvious lesions, of the chickens in the vv IBDV-challenge control group in the HVT38 vaccination-challenge test.

[0054] Figure 39 shows bursae of Fabricius, all showing obvious lesions, of the chickens in the cv IBDV-challenge control group.

[0055] Figure 40 shows the morphologic change of the bursae of Fabricius through necropsy in the HVT38 vaccination-challenge test against vv IBDV. All photos are taken for the chickens in the test group which get vaccinated with HVT38 in prior to the vv IBDV challenge.

[0056] Figure 41 shows the morphologic change of the bursae of Fabricius through necropsy in the HVT38 vaccination-challenge test against cv IBDV. All photos are taken for the chickens in the test group which get vaccinated with HVT38 in prior to the cv IBDV challenge. The red arrow emphasizes an obvious lesion.

[0057] Figure 42 shows the morphologic change of the larynx and trachea through necropsy in the HVT38 vaccination-challenge test against ILTV. (a) the larynx and trachea of the chickens in the blank control group; (b) the larynx and trachea, all of which show obvious lesions, of the chickens in the challenge control group; (c) the larynx and trachea of the chickens in the test group which get vaccinated with HVT38 in prior to the ILTV-WG strain challenge. The red arrow emphasizes a bleeding point. Photos were taken for part of subjects of the group for the purpose of exhibiting typical pathological change.

[0058] Figure 43 is a histogram showing the relative expression level of the antigens expressed by HVT38, HVT39 and HVT310, as compared with those expressed by HVT35, acquired by quantitative RT-PCR. The ratio of a target cDNA was calculated versus the corresponding cDNA from HVT35 as the reference.Detailed Description of the Invention

[0059] While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth and as follows in the scope of the appended claims. This invention includes all modifications and equivalents of the subject matter recited in the aspects or claims presented herein to the maximum extent permitted by applicable law.

[0060] Definitions and Abbreviations

[0061] It is noted that in this disclosure and particularly in the claims, terms such as "comprises" , "comprised" , "comprising" and the like can mean, e.g., "includes" , "included" , "including" , and the like; and that terms such as "consisting essentially of" and "consists essentially of" have the meaning that, e.g., they allow for elements not explicitly recited, but exclude elements that affect a basic or novel characteristic of the invention or change to any extent the function of the invention.

[0062] The singular terms "a, " "an, " and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicate otherwise. The word "or" means any one member of a particular list and also includes any combination of members of that list.

[0063] The term "animal" is used herein to include all mammals, birds and fish. The animal as used herein may be selected from the group consisting of equine (e.g., horse) , canine (e.g., dogs, wolves, foxes, coyotes, jackals) , feline (e.g., lions, tigers, domestic cats, wild cats, other big cats, and other felines including cheetahs and lynx) , bovine (e.g., cattle) , swine (e.g., pig) , ovine (e.g., sheep, goats, lamas, bisons) , avian (e.g., chicken, duck, goose, turkey, quail, pheasant, parrot, finches, hawk, crow, ostrich, emu and cassowary) , primate (e.g., prosimian, tarsier, monkey, gibbon, ape) , humans, and fish. The term "animal" also includes an individual animal in all stages of development, including embryonic and fetal stages.

[0064] In preferred embodiments of the present invention, “animal” means avian animals. The avian species may be poultry, preferably the avian species is chicken, duck, goose, turkey, quail, guinea or pigeon, more preferably the avian species is turkey or chicken, even more preferably chicken.

[0065] The term "about" as used herein, means approximately, in the region of, roughly, or around. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term "about" is used herein to modify a numerical value above and below the stated value by a variance of 10%. In one aspect, the term "about" means plus or minus 20%of the numerical value of the number with which it is being used. Therefore, about 50%means in the range of 45%-55%. Numerical ranges recited herein by endpoints include all numbers and fractions subsumed within that range (e.g. 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.90, 4, and 5) . It is also to be understood that all numbers and fractions thereof are presumed to be modified by the term "about. "

[0066] The terms "polypeptide" and "protein" are used interchangeably herein to refer to a polymer of consecutive amino acid residues.

[0067] The term "nucleic acid" , "nucleotide" , and "polynucleotide" are used interchangeably and refer to RNA, DNA, cDNA, or cRNA and derivatives thereof, such as those containing modified backbones. It should be appreciated that the invention provides polynucleotides comprising sequences complementary to those described herein. The "polynucleotide" contemplated in the present invention includes both the forward strand (5'to 3') and reverse complementary strand. Polynucleotides according to the invention can be prepared in different ways (e.g. by chemical synthesis, by gene cloning etc. ) and can take various forms (e.g. linear or branched, single or double stranded, or a hybrid thereof, primers, probes etc. ) .

[0068] The term "genomic DNA" or "genome" is used interchangeably and refers to the heritable genetic information of a host organism. The genomic DNA comprises the DNA of the nucleus (also referred to as chromosomal DNA) but also the DNA of the plastids (e.g., chloroplasts) and other cellular organelles (e.g., mitochondria) . The genomic DNA or genome contemplated in the present invention also refers to the RNA of a virus. The RNA may be a positive strand or a negative strand RNA. The term "genomic DNA" contemplated in the present invention includes the genomic DNA containing sequences complementary to those described herein. The term "genomic DNA" also refers to messenger RNA (mRNA) , complementary DNA (cDNA) , and complementary RNA (cRNA) .

[0069] Herpesviridae family members have a linear 120 to 230 kb double-stranded DNA genome, organized in a very similar overall manner structurally. The genome comprises long and short unique regions, and each unique region is bounded by identical inverted repeats. The UL region and the US region contain 50-70 viral genes and about 10 viral genes, respectively, which share high identity among the different herpesvirus species.

[0070] Marek's disease virus (MDV) refers to any alpha herpesvirus of the genus Marekovirus of the Herpesviridae family, and MDVs share a similar size and overall organization of their genomes with other Herpesviridae families, as well as a high degree of genomic similarity among their internal members. Thus, the construction of recombinant HVT (MDV3) validated in embodiments of the present invention can be transposed to any MDV1 and MDV2 member, preferably non-pathogenic strains and / or weakly pathogenic strains. Such diversion is feasible.

[0071] The term “turkey herpesvirus (HVT) ” is defined as a non-pathogenic virus of domesticated turkeys and is categorized as serotype 3 (MDV3) in the Marek's disease virus group of antigenically and genetically related lymphocytic avian herpesviruses.

[0072] As used herein, “Marek's disease virus” or “MDV” refers to any alpha herpesvirus of the genus Marekovirus, which encompasses turkey herpesviruses (HVT) as described herein. In specific embodiments, the present invention relates to Marek's disease viruses, their genomic components, genes and proteins produced therefrom. As used herein, such viruses may comprise genomic components of the virus, i.e., the genome and transcripts thereof, infectious clones, proteins (including structural and non-structural proteins) encoded by the genome, and functional or non-functional virus particles. The genomes of such viruses, the structural genes, and the polynucleotide and polypeptide sequences encoding such viruses are well known in the art and are readily discoverable by those skilled in the art.

[0073] Exemplary members of Marek's disease viruses suitable for use in the present invention include MDV type 1 strain CVI-988, CVTR, SC9-1, and 814, MDV type 2 (avian herpesvirus type 3) strain SB-1, MDV type 3 (HVT) strain FC-126, and the like, and prevalent strains and their attenuated strains by passaging, mutagenesis, and / or genetic engineering.

[0074] The term "recombinant" in relation to an MDV refers to an MDV whose genome has been modified by insertion of at least one heterologous and / or exogenous polynucleotide. It will be understood that the recombinant MDV can be manufactured by a variety of methods, and once made, can be reproduced without use of further recombinant DNA technology. The structure of the "recombinant MDV" is therefore described in terms of DNA insertion.

[0075] The terms "recombinant" and "genetically modified" are used interchangeably and refer to any modification, alteration or engineering of a polynucleotide or protein in its native form or structure, or any modification, alteration or engineering of a polynucleotide or protein in its native environment or surrounding. The modification, alteration or engineering of a polynucleotide or protein may include, but is not limited to, deletion of one or more nucleotides or amino acids, deletion of an entire gene, codon-optimization of a gene, conservative substitution of amino acids, insertion of one or more heterologous polynucleotides.

[0076] The term "gene" is used broadly to refer to any segment of polynucleotide associated with a biological function. Thus, genes or polynucleotides include introns and exons as in genomic sequence, or just the coding sequences as in cDNAs, such as an open reading frame (ORF) , starting from the start codon (usually methionine codon) and ending with a termination signal (stop codon) . Genes and polynucleotides can also include regions that regulate their expression, such as transcription initiation, translation and transcription termination. Thus, also included are promoters and ribosome binding regions (in general these regulatory elements lie approximately between 60 and 250 nucleotides upstream of the start codon of the coding sequence or gene; Doree S M et al; Pandher K et al; Chung J Y et al) , transcription terminators (in general the terminator is located within approximately 50 nucleotides downstream of the stop codon of the coding sequence or gene; Ward C K et al) . Gene or polynucleotide also refers to a nucleic acid fragment that expresses mRNA or functional RNA, or encodes a specific protein, and which includes regulatory sequences.

[0077] The term "heterologous" as used herein refers to the characteristic that the polynucleotide (such as, DNA) or protein (such as, polypeptide) being derived from a different organism, such as a different cell type or a different species than the recipient.

[0078] The term "heterologous polynucleotide" as used herein refers to a polynucleotide derived from a different organism or a different species from the recipient, preferably coding for a heterologous protein. In the context of the recombinant MDV the skilled person would understand that it refers to a DNA or cDNA. A heterologous polynucleotide may also be referred to as transgene. Thus, it may be a gene or open reading frame (ORF) coding for a heterologous protein. In the context of the recombinant MDV "heterologous polynucleotide" refers to a polynucleotide derived from a different avian pathogen or virus (different species and / or strain) , particularly a different avian virus, including a different virus of the family Herpesviridae that causes avian infection and a different strain of MDV1, 2, or 3. The term "heterologous" when used with reference to portions of a nucleic acid indicates that the nucleic acid comprises two or more sequences that are not found in the same relationship to each other in nature. Heterologous may also refer to a viral polynucleotide sequence, such as a gene or transgene, or a portion thereof, being inserted into a (particular position of) viral genome in which it is not typically found, or a gene introduced into an organism in which it is not typically found.

[0079] The term "bacterial artificial chromosome" abbreviated as BAC as used herein refers to a DNA construct based on functional fertility plasmid, comprising an insert of about 150 to 350 kb used for transforming and cloning in bacteria such as Escherichia coli. BAC vectors can harbor large DNA sequences, such as DNA virus genomes or DNA sequences coding for RNA virus genomes. This allows for efficient modification of viral genomes using well-established techniques in E. coli.

[0080] The term “expression cassette” is a segment of a nucleic acid molecule, e.g., a double-stranded DNA molecule, which comprises or consists of some or all elements required for the expression of a polynucleotide of interest in a host cell and may be used as part of a longer nucleic acid molecule or vector, typically an expression vector, such as a plasmid or a viral vector. It may also be integrated in a chromosome by random or targeted integration, such as by homologous recombination or by viral integration. To facilitate the convenient construction, manipulation, and insertion of an expression cassette into an MDV for the invention, the cassette can itself be comprised in a DNA molecule, such as a vehicle allowing cloning or transfection, e.g. such as a plasmid, a Cosmid, a Bacmid, etc.. A plasmid comprising an expression cassette is commonly referred to as a ‘transfervector’ , ‘shuttle vector’ , or ‘donor plasmid’ . In this situation the plasmid comprises an expression cassette with flanking sequence regions (e.g., homology arm) from the target insertion locus of the vector’s genome, to direct the insertion. Typically, a transfervector that is used in transfection is not itself integrated into the genome of the vector, it only facilitates the integration of the expression cassette it carries, e.g. by allowing the insertion to occur by homologous recombination.

[0081] In the context of the present invention, the expression cassette is responsible for directing cellular expression and preparation of the target RNA / protein (usually exogenous and / or heterologous) . Expression cassettes can contain one or more of the following elements: one or more promoter sequences, one or more open reading frames (of the transgene) , polyadenylation (polyA) signaling motifs, and the like. An open reading frame (ORF) is a reading frame that contains the coding sequence of the target protein from the start codon to the stop codon. The regulatory element / regulatory sequence of the expression cassette may be operably linked to the polynucleotide sequence encoding the target protein.

[0082] An expression cassette is prepared using cloning techniques and does therefore not refer to a natural occurring gene structure. Unless otherwise indicated, in the context of the present invention, the nucleic acid sequence of the “expression cassette” as a whole located at a particular insertion site was not originally present at the corresponding position in the natural MDV genome, but were artificially introduced (e.g., known as “exogenous” ) for the purposes of the present invention. The sequences of the expression cassettes of the present invention may be heterologous or partly homologous (to MDV) .

[0083] The expression cassette of the present invention may be a multicistronic expression cassette. A multicistronic construct comprising the multicistronic expression cassette is capable of simultaneously expressing two or more different proteins, which are encoded by the same multicistronic nucleic acid, driven by the same promoter, but not fused. Such coding sequences in di-, or even multicistronic nucleic acids may be separated by at least one internal ribosome entry site (IRES) sequence, e.g. as defined herein or by at least one coding sequence of self-cleavage peptides. which induce the cleavage of the resulting polypeptide which comprises several proteins or peptides. In some embodiments, such a multicistronic expression cassette may comprises one or more internal ribosome entry sites (IRES) to allow for translation of another protein starting therefrom at the internal region of the mRNA. In other embodiments, such a multicistronic expression cassette may comprises one, or more coding sequences of 2A peptides in tandem as the linker sequence.

[0084] The term “2A peptide” or “peptide 2A” is a self-cleaving peptide with a typical length of 18 to 22 amino acids, resulting in the production of two or more proteins from one same mRNA at equimolar levels usually. The “self-cleaving” mediated by 2A peptides is commonly seen in all eukaryotic cells. Examples of commonly used 2A peptides comprise Thosea asigna virus 2A (T2A) ; porcine teschovirus-1 2A (P2A) ; equine rhinitis A virus (ERAV) 2A (E2A) and FMDV 2A (F2A) .

[0085] The term “operably linked” , "operatively linked" or “functionally linked” has a same meaning, meaning that the specified components are linked or adjacent to each other and in a relationship that allows them to function in the intended manner. Such a term is usually used to describe the connection between regulatory elements and a gene or its coding region. Typically, gene expression is placed under the control of one or more regulatory elements, for example, without limitation, constitutive or inducible promoters, polyadenylation (polyA) signal motif, and the like. A gene or coding region is said to be "operably linked to" or "operatively linked to" or "operably associated with" or “functionally linked to” the regulatory elements, meaning that the gene or coding region is controlled or influenced by the regulatory element. For instance, a promoter is operably linked to a coding sequence if the promoter initiates / effects transcription or expression of the coding sequence.

[0086] In the context of the present invention, unless otherwise noted, two sequences that are “operably linked” do not necessarily imply that they are physically linked directly or even close to each other physically. However, there must be a functional connection between the two sequences that are “operably linked” , e.g., a promoter effecting the transcription or expression of the coding sequence, whereby no significant other sequences are present between them that would intervene said functional connection.

[0087] As used herein, the term "antigen" or "immunogen" means a substance that induces a specific immune response in a host animal. The antigen may comprise a whole organism, killed, attenuated or live; a subunit or portion of an organism; a recombinant vector containing an insert with immunogenic properties; a piece or fragment of DNA capable of inducing an immune response upon presentation to a host animal; a polypeptide, an epitope, a hapten, or any combination thereof. Alternately, the immunogen or antigen may comprise a toxin or antitoxin.

[0088] The term "immunogenic protein or peptide" as used herein includes polypeptides that are immunologically active in the sense that once administered to the host, it is able to evoke an immune response of the humoral and / or cellular type directed against the protein. Preferably the protein fragment is such that it has substantially the same immunological activity as the total protein. Thus, a protein fragment according to the invention comprises or consists essentially of or consists of at least one epitope or antigenic determinant. An "immunogenic" protein or polypeptide, as used herein, includes the full-length sequence of the protein, analogs thereof, or immunogenic fragments thereof.

[0089] By "immunogenic fragment" is meant a fragment of a protein which includes one or more epitopes and thus elicits the immunological response described above. Such fragments can be identified using any number of epitope mapping techniques, well known in the art. For example, linear epitopes may be determined by e.g., concurrently synthesizing large numbers of peptides on solid supports, the peptides corresponding to portions of the protein molecule, and reacting the peptides with antibodies while the peptides are still attached to the supports. Similarly, conformational epitopes are readily identified by determining spatial conformation of amino acids such as by, e.g., x-ray crystallography and 2-dimensional nuclear magnetic resonance.

[0090] The term "immunogenic protein or peptide" further contemplates deletions, additions and substitutions to the sequence, so long as the polypeptide functions to produce an immunological response as defined herein. The term "conservative variation" denotes the replacement of an amino acid residue by another biologically similar residue, or the replacement of a nucleotide in a nucleic acid sequence such that the encoded amino acid residue does not change or is another biologically similar residue. In this regard, particularly preferred substitutions will generally be conservative in nature, i.e., those substitutions that take place within a family of amino acids. For example, amino acids are generally divided into four families: (1) acidic-aspartate and glutamate; (2) basic-lysine, arginine, histidine; (3) non-polar-alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar-glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids. Examples of conservative variations include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another hydrophobic residue, or the substitution of one polar residue for another polar residue, such as the substitution of arginine for lysine, glutamic acid for aspartic acid, or glutamine for asparagine, and the like; or a similar conservative replacement of an amino acid with a structurally related amino acid that will not have a major effect on the biological activity. Proteins having substantially the same amino acid sequence as the reference molecule but possessing minor amino acid substitutions that do not substantially affect the immunogenicity of the protein are, therefore, within the definition of the reference polypeptide. All of the polypeptides produced by these modifications are included herein. The term "conservative variation" also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid provided that antibodies raised to the substituted polypeptide also immunoreact with the unsubstituted polypeptide.

[0091] The term "epitope" refers to the site on an antigen or hapten to which specific B cells and / or T cells respond. The term is also used interchangeably with "antigenic determinant" or "antigenic determinant site" . Antibodies that recognize the same epitope can be identified in a simple immunoassay showing the ability of one antibody to block the binding of another antibody to a target antigen.

[0092] An "immunological response" to a composition or vaccine is the development in the host of a cellular and / or antibody-mediated immune response to a composition or vaccine of interest. Usually, an "immunological response" includes but is not limited to one or more of the following effects: the production of antibodies, B cells, helper T cells, and / or cytotoxic T cells, directed specifically to an antigen or antigens included in the composition or vaccine of interest. Preferably, the host will display either a therapeutic or protective immunological response such that resistance to new infection will be enhanced and / or the clinical severity of the disease reduced. Such protection will be demonstrated by either a reduction or lack of symptoms normally displayed by an infected host, a quicker recovery time and / or a lowered viral titer in the infected host.

[0093] The terms "multivalent vaccine or composition" , and "multivalent vaccine or composition" are used interchangeably to refer to a composition or vaccine containing or bringing in more than one antigens / immunogens. The multivalent vaccine or composition may contain or bring in two, three, four or more antigens / immunogens components. Therefore, preferably, the multivalent vaccine or composition may induce / elicit immunological protection against more than one pathogens / diseases simultaneously.

[0094] In some embodiments of the invention, provided are recombinant Marek’s Disease Virus (MDV) comprising at least one or more heterologous polynucleotides encoding at least one (e.g., one) antigen of an avian pathogen. In some particular embodiments, said MDV is selected from the group consisting of the following serotypes: MDV-1, MDV-2 (also known as GaHV-3) , MDV-3 (also known as Herpesvirus of turkey, HVT) , and any combination thereof. In some preferable embodiments, said MDV is HVT. The HVT strains used for the recombinant virus may be any HVT strains, including, but not limited to, the HVT strain FC-126 (Igarashi T. et al., J. Gen. Virol. 70, 1789-1804, 1989) .

[0095] Successful expression of the heterologous polynucleotides by the recombinant / modified infectious virus requires two conditions. First, the heterologous polynucleotides must be inserted or introduced into a region of the genome of the virus in order that the modified virus remains viable. The second condition for expression of inserted heterologous polynucleotides is the presence of a regulatory sequences allowing expression of the gene in the viral background (for instance: promoter, donor and acceptor splicing sites, polyadenylation signal motifs, untranslated sequence elements, and the like) .

[0096] In one aspect, the present invention provides a novel insertion site very suitable for the effective expression of exogenous genes in the genome of MDV: the non-coding interval (intergenic) region between UL26 / UL26.5 gene locus and UL27 gene locus, in the Unique Long (UL) region. Such a novel insertion site confers efficient expression of the exogenous gene without affecting the expression of the viral structural gene. Moreover, in some embodiments, the exogenous gene, when inserted at such a novel insertion site, can be operably linked to and driven by the endogenous promoter, e.g., the endogenous UL26 gene promoter and the endogenous UL26.5 gene promoter, and thus the inserts may not comprise any promoter sequence. In the context of the present invention, references to the "novel insertion site" or the "first insertion site" are, unless otherwise specified, references to such an insertion site located in the intergenic region of the genome of the MDV between UL26 / UL26.5 gene locus and UL27 gene locus.

[0097] Accordingly, in some embodiments, the present invention provides recombinant Marek's disease virus (MDV) comprising at least one or more heterologous polynucleotides encoding at least one (e.g., one) antigen of an avian pathogen, and at least one of said heterologous polynucleotides is inserted at the following insertion site in the genome of said MDV: the intergenic region between UL26 and UL27 genes, e.g., preferably, between the stop codon of UL26 gene and the stop codon of UL27 gene. In a particular embodiment, provided is the use of the novel insertion site in the construction of a recombinant MDV, wherein said novel insertion site is in the intergenic region between UL26 / UL26.5 gene locus and UL27 gene locus.

[0098] In some embodiments, said MDV comprises MDV-1, MDV-2, MDV-3 (herpesvirus of turkeys, HVT) or any combinations thereof. In some particular embodiments, said MDV comprises MDV-1, e.g., strain CVI-988, strain CVTR, strain SC9-1, or strain 814, or any prevalent strain or their attenuated strain by passaging, mutagenesis, and / or genetic engineering. In some particular embodiments, said MDV comprises MDV-2, e.g., strain SB-1, or any prevalent strain or their attenuated strain by passaging, mutagenesis, and / or genetic engineering.

[0099] In some particular embodiments, said MDV is HVT, preferably HVT strain FC-126. It is known in the art that when referring to the HVT genome, UL26, UL26.5 and UL27 are also known as HVT033, HVT034 and HVT035, respectively.

[0100] In some particular embodiments, the MDV comprises HVT FC-126, and the novel insertion site is located in the region between the FC-126 genome DNA sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and ctatacaatttcatcatccgtctcagaatccgtgtcgttt (SEQ ID NO: 25) . In some particular embodiments, the MDV comprises MDV1, MDV2 or HVT strains other than FC-126, and the novel insertion site is located in the genome region which is corresponding to the region between FC-126 genome DNA sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and ctatacaatttcatcatccgtctcagaatccgtgtcgttt (SEQ ID NO: 25) .

[0101] In some particular embodiments, the MDV comprises HVT FC-126, and the flanking sequence of the insertion site is the same with or reverse complementary to a sequence that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with at least part of SEQ ID NO: 36, wherein the flanking sequence is the upstream flanking sequence or the downstream flanking sequence.

[0102] In some particular embodiments, a sequence that has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with at least part of SEQ ID NO: 36, and / or a complementary sequence thereof, could be used to form the homology arm sequence (s) , e.g., the upstream homology arm sequence or the downstream homology arm sequence, by which the transgene could be inserted at the target site via, e.g., homologous recombination. In some more particular embodiments, said part refers to the length of the homology arm, e.g., about 25-60 nucleotides, about 30-50 nucleotides, and the like.

[0103] In some even more particular embodiments, the MDV comprises HVT FC-126, and the novel insertion site is located at the site between the FC-126 genome DNA sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and aaagcggtgtgttaatgtcagagagctgta (SEQ ID NO: 24) , i.e., between the 30th nucleotide and the 31st nucleotide of the sequence as shown in SEQ ID NO: 36.In some even more particular embodiments, the MDV comprises MDV1, MDV2 or HVT strains other than FC-126, and the novel insertion site is located at the site which is corresponding to the site between FC-126 genome DNA sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and aaagcggtgtgttaatgtcagagagctgta (SEQ ID NO: 24) .

[0104] In some embodiments, the heterologous polynucleotide (s) inserted at the novel insertion site are expressed in the forward orientation, i.e., the same orientation in which UL26 / UL26.5 gene expresses.

[0105] In some embodiments, the heterologous polynucleotide (s) inserted at the novel insertion site are expressed in the reverse orientation, i.e., the same orientation in which UL27 gene expresses.

[0106] Some embodiments of the present invention involve another insertion site suitable for expressing exogenous genes. Similarly, said insertion site is required to ensure efficient expression of the exogenous genes without affecting the expression of the viral structural genes. Moreover, in some preferred embodiments, where more than one exogenous genes need to integrate into two insertion sites at the same time, this insertion site in combination with the aforementioned "first insertion site" (i.e., the novel insertion site in the intergenic region between UL26 / UL26.5 gene locus and UL27 gene locus of the MDV genome) confers that two or more transgenes are effectively expressed at both sites, with the expression better than that at any other combination of insertion sites, and even better than that at only one insertion site. In the embodiments of the recombinant MDVs of the present invention, especially in those involving two or more insertion sites, this insertion site that is different from the “first insertion site” is referred to as the “second insertion site” , unless otherwise specified.

[0107] This insertion site may be any non-essential region of the MDV (e.g., HVT) genome, including, but not limited to, the intergenic region between UL55 and MDV71 genes, the intergenic region between UL3 and UL4 genes, the intergenic region between UL22 and UL23 genes, the intergenic region between UL44 and UL45 genes, the intergenic region between UL45 and UL46 genes, the intergenic region between UL48 and UL49 genes, the intergenic region between UL54 and MDV69 genes, the IG2 region, the intergenic region between US10 and US1 genes, the intergenic region between SORF3 and US2 genes, the US2 locus, the US6 locus, the US7 locus, the US8 locus, the US10 locus, and the intergenic region between US10 and SORF3 genes. In some preferred embodiments, said “second insertion site” is located in the intergenic region between UL55 and MDV71 genes, e.g., between the stop codon of UL55 gene and the stop codon of MDV71 gene.

[0108] Therefore, in a preferred embodiment, the present invention provides a recombinant MDV comprising a first heterologous polynucleotide sequence encoding a first antigenic peptide inserted into the non-coding region located between UL26 / 26.5 and UL27, and a second heterologous polynucleotide sequence encoding a second antigenic peptide inserted into the non-coding region located between UL55 and MDV71 genes.

[0109] It is known in the art that when referring to the HVT genome, UL55 and MDV71 are also known as HVT065 and HVT066, respectively. In some particular embodiments, the MDV comprises HVT FC-126, and the insertion site in the intergenic region between UL55 and MDV71 genes is located in the region between the FC-126 genome (e.g., as shown in Genbank accession ID: NC_002641) DNA sequences atcgctatgcaaagagatgcgtgtgtacacgcgccgttga (SEQ ID NO: 26) and ttaagatgcaggagtaacaatgtgcatagtaggcgtagtt (SEQ ID NO: 29) . In some particular embodiments, the MDV comprises MDV1, MDV2 or HVT strains other than FC-126, and the insertion site in the intergenic region between UL55 and MDV71 genes is located in the genome region which is corresponding to the region between FC-126 genome DNA sequences atcgctatgcaaagagatgcgtgtgtacacgcgccgttga (SEQ ID NO: 26) and ttaagatgcaggagtaacaatgtgcatagtaggcgtagtt (SEQ ID NO: 29) .

[0110] In some particular embodiments, the MDV comprises HVT FC-126, and the flanking sequence of the insertion site is the same with or reverse complementary to a sequence that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with at least part of SEQ ID NO: 37, wherein the flanking sequence is the upstream flanking sequence or the downstream flanking sequence.

[0111] In some particular embodiments, a sequence that has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with at least part of SEQ ID NO: 37, and / or a complementary sequence thereof, could be used to form the homology arm sequence (s) , e.g., the upstream homology arm sequence or the downstream homology arm sequence, by which the transgene could be inserted at the target site via, e.g., homologous recombination. In some more particular embodiments, said part refers to the length of the homology arm, e.g., about 25-60 nucleotides, about 30-50 nucleotides, and the like.

[0112] In some even more particular embodiments, the MDV comprises HVT FC-126, and the insertion site in the intergenic region between UL55 and MDV71 genes is located at the site between the FC-126 genome DNA sequences tatatgttattaaataaaataattgaccagtgaacaattt (SEQ ID NO: 27) and gtttaatgttagtttattcaatgcattggttgcaaatatt (SEQ ID NO: 28) , i.e., between the 118th nucleotide and the 119th nucleotide of the sequence as shown in SEQ ID NO: 37. In some even more particular embodiments, the MDV comprises MDV1, MDV2 or HVT strains other than FC-126, and the insertion site in the intergenic region between UL55 and MDV71 genes is located at the site which is corresponding to the site between FC-126 genome DNA sequences tatatgttattaaataaaataattgaccagtgaacaattt (SEQ ID NO: 27) and gtttaatgttagtttattcaatgcattggttgcaaatatt (SEQ ID NO: 28) .

[0113] In some embodiments, the heterologous polynucleotide (s) inserted at the novel insertion site are expressed in the forward orientation, i.e., the same orientation in which UL55 gene expresses.

[0114] In some embodiments, the heterologous polynucleotide (s) inserted at the novel insertion site are expressed in the reverse orientation, i.e., the same orientation in which MDV71 gene expresses.

[0115] The locations of the quoted non-coding intergenic regions are well-known in the art. For example, by reference to complete virus genome sequence in the public biological database (e.g., NCBI GenBank, and the like) , the region between the stop codons of UL26 gene and UL27 gene could be easily confirmed in terms of genomic sequences. So is the region between the stop codons of UL55 gene and MDV71 gene. For example, the non-coding intergenic region between HVT033 gene and HVT035 gene in the genome of FC-126 has a sequence being from the 31st nucleotide to the 142nd nucleotide of the sequence as shown in SEQ ID NO: 36. For example, the non-coding intergenic region between HVT065 gene and HVT066 gene in the genome of FC-126 has a sequence being from the 41st nucleotide to the 238th nucleotide of the sequence as shown in SEQ ID NO: 37.

[0116] The genes coding for antigen or polypeptide may be those coding for Newcastle Disease Virus fusion protein (NDV F) , Newcastle Disease Virus hemagglutinin neuraminidase (NDV-HN) , Infectious Bursal Disease Virus (IBDV) VP2, IBDV VPX, IBDV VP3, IBDV VP4, ILTV glycoprotein B, ILTV glycoprotein I, ILTV UL32, ILTV glycoprotein D, ILTV glycoprotein E, ILTV glycoprotein C, protective genes derived from Mycoplasma gallisepticum (MG) , or Mycoplasma synoviae (MS) , or combinations thereof. The antigen or polypeptide may be any antigen from the poultry pathogen selected form the group consisting of avian encephalomyelitis virus, avian reovirus, avian paramyxovirus, avian metapneumovirus, avian adenovirus, fowl pox virus, avian coronavirus, avian rotavirus, chick anemia virus, avian astrovirus, avian parvovirus, avian retrovirus, avian picornavirus, coccidiosis (Eimeria sp. ) , Campylobacter sp., Salmonella sp., Pasteurella sp., Avibacterium sp., Mycoplasma gallisepticum, Mycoplasma synoviae, Clostridium sp., and Escherichia coli.

[0117] Moreover, homologs of aforementioned antigen or polynucleotides are intended to be within the scope of the present invention. As used herein, the term "homologs" includes orthologs, analogs and paralogs. The term "analogs" refers to two polynucleotides or polypeptides that have the same or similar function, but that have evolved separately in unrelated organisms. The term "orthologs" refers to two polynucleotides or polypeptides from different species, but that have evolved from a common ancestral gene by speciation. Normally, orthologs encode polypeptides having the same or similar functions. The term "paralogs" refers to two polynucleotides or polypeptides that are related by duplication within a genome. Paralogs usually have different functions, but these functions may be related. Analogs, orthologs, and paralogs of a wild-type polypeptide can differ from the wild-type polypeptide by post-translational modifications, by amino acid sequence differences, or by both. In particular, homologs of the invention will generally exhibit at least 80-85%, 85-90%, 90-95%, or 95%, 96%, 97%) , 98%) , 99%sequence identity, with all or part of the polynucleotide or polypeptide sequences of antigens described above, and will exhibit a similar function.

[0118] In some particular embodiments, said avian pathogen is selected from the group consisting of Newcastle Disease Virus (NDV) , Infectious Bursal Disease Virus (IBDV) , Infectious Laryngotracheitis Virus (ILTV) . In some particular embodiments, said at least one antigen of an avian pathogen is one or more polypeptides selected from the group consisting of an Infectious Bursal Disease Virus (IBDV) VP2 antigen, an Infectious Laryngotracheitis Virus (ILTV) glycoprotein D (gD) antigen and a Newcastle Disease Virus F (NDV F) antigen.

[0119] To optimize the expression of the IBDV VP2, ILTV gD and / or NDV F antigens for the invention, their encoding polynucleotide sequence can be subjected to codon optimization. This is well-known in the art and is commonly applied to improve the expression level of a DNA or RNA sequence in a context that differs from that of the natural origin of the encoded protein. It involves the adaptation of a nucleotide sequence to encode the intended amino acids, but by way of a nucleotide sequence that matches the codon preference (the tRNA repertoire) of the recombinant virus, the host cell, or the target organism in which the sequence will be expressed. Consequently, the nucleotide mutations applied are commonly silent. Such modifications are commonly planned in silico by using one of many computer software programs, after which the desired nucleotide sequence can be synthesized.

[0120] Therefore, in some embodiments of the recombinant MDVs according to the invention, the polynucleotides encoding the IBDV VP2, the ILTV gD and / or the NDV F antigen proteins are codon-optimized, e.g., towards the MDV viral codon preference.

[0121] In some particular embodiments involving an IBDV VP2 antigen, e.g., the embodiments of the recombinant MDVs of the present invention, or the embodiments of the expression cassettes of the present invention, said VP2 antigen is derived from vv IBDV, for example, said VP2 antigen comprises or consists of an amino acid sequence as shown in SEQ ID NO: 5, or an amino acid sequence which has at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 5, or a conservative variant, an allelic variant, a homolog or an immunogenic fragment comprising at least eight or at least ten consecutive amino acids of one of these polypeptides, or a combination of these polypeptides. In some more particular embodiments, said vv IBDV VP2 antigen is encoded by its wildtype gene, for example, a nucleic acid sequence as shown in SEQ ID NO: 6, or a sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 6. In some more particular embodiments, the gene coding for said vv IBDV VP2 antigen has been codon-optimized, for example, comprising or consisting of a nucleic acid sequence as shown in SEQ ID NO: 7, or a sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 7.

[0122] In some particular embodiments involving an IBDV VP2 antigen, e.g., the embodiments of the recombinant MDVs of the present invention, or the embodiments of the expression cassettes of the present invention, said VP2 antigen is derived from nVar IBDV, for example, said VP2 antigen comprises or consists of an amino acid sequence as shown in SEQ ID NO: 8, or an amino acid sequence which has at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 8, or a conservative variant, an allelic variant, a homolog or an immunogenic fragment comprising at least eight or at least ten consecutive amino acids of one of these polypeptides, or a combination of these polypeptides. In some more particular embodiments, said nVar IBDV VP2 antigen is encoded by its wildtype gene, for example, a nucleic acid sequence as shown in SEQ ID NO: 9, or a sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 9. In some more particular embodiments, the gene coding for said nVar IBDV VP2 antigen has been codon-optimized, for example, comprising or consisting of a nucleic acid sequence as shown in SEQ ID NO: 10, or a sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 10. In some preferred embodiments of the present invention, the nVar IBDV VP2 antigen, when used as an effective immunogen, is capable of inducing cross-protection against various kinds of IBDV serotypes, including but not limited to cv IBDV, nVar IBDV and vv IBDV.

[0123] In some particular embodiments involving an NDV F antigen, e.g., the embodiments of the recombinant MDVs of the present invention, or the embodiments of the expression cassettes of the present invention, said F antigen comprise a mutated amino acid sequence of the protease cleavage site, for example, said F antigen comprises or consists of an amino acid sequence as shown in SEQ ID NO: 1, or an amino acid sequence which has at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 1, or a conservative variant, an allelic variant, a homolog or an immunogenic fragment comprising at least eight or at least ten consecutive amino acids of one of these polypeptides, or a combination of these polypeptides. In some more particular embodiments, the coding sequence of said NDV F antigen is derived from its wildtype gene and not codon-optimized, for example, a nucleic acid sequence as shown in SEQ ID NO: 2, or a sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 2. In some more particular embodiments, the gene coding for said NDV F antigen has been codon-optimized, for example, comprising or consisting of a nucleic acid sequence as shown in SEQ ID NO: 3 or 4, or a sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 3 or 4.

[0124] In some particular embodiments involving an ILTV gD antigen, e.g., the embodiments of the recombinant MDVs of the present invention, or the embodiments of the expression cassettes of the present invention, said gD antigen comprise a mutated amino acid sequence of the protease cleavage site, for example, said gD antigen comprises or consists of an amino acid sequence as shown in SEQ ID NO: 11, or an amino acid sequence which has at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 11, or a conservative variant, an allelic variant, a homolog or an immunogenic fragment comprising at least eight or at least ten consecutive amino acids of one of these polypeptides, or a combination of these polypeptides. In some more particular embodiments, said ILTV gD antigen is encoded by its wildtype gene, for example, a nucleic acid sequence as shown in SEQ ID NO: 12, or a sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 12. In some more particular embodiments, the gene coding for said ILTV gD antigen has been codon-optimized, for example, comprising or consisting of a nucleic acid sequence as shown in SEQ ID NO: 13, or a sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 13.

[0125] One embodiment of the invention provides a recombinant MDV comprising one, two or more heterologous polynucleotides coding for and expressing at least one antigen or polypeptide of an avian pathogen. In one embodiment, the present invention provides a recombinant HVT comprising one, two or more heterologous polynucleotides coding for and expressing the NDV F antigen or polypeptide, the IBDV VP2 antigen or polypeptide, the ILTV gD antigen or polypeptide, or a combination thereof.

[0126] In some embodiments of the recombinant MDVs, at least one of the heterologous polynucleotides is inserted at said novel insertion site. In some embodiments of the recombinant MDVs, at least two of the heterologous polynucleotides are inserted at said novel insertion site. In some embodiments of the recombinant MDVs, each of the heterologous polynucleotides is inserted at said novel insertion site.

[0127] In some embodiments of the recombinant MDVs, the heterologous polynucleotide coding for and expressing the NDV F antigen or polypeptide is inserted at said novel insertion site. In some embodiments of the recombinant MDVs, the heterologous polynucleotide coding for and expressing the IBDV VP2 antigen or polypeptide is inserted at said novel insertion site. In some embodiments of the recombinant MDVs, the heterologous polynucleotide coding for and expressing the ILTV gD antigen or polypeptide is inserted at said novel insertion site.

[0128] In some embodiments of the recombinant MDVs, the heterologous polynucleotide coding for and expressing the NDV F antigen or polypeptide and the heterologous polynucleotide coding for and expressing the IBDV VP2 antigen or polypeptide are inserted at said novel insertion site.

[0129] In some embodiments of the recombinant MDVs, the heterologous polynucleotide coding for and expressing the NDV F antigen or polypeptide and the heterologous polynucleotide coding for and expressing the ILTV gD antigen or polypeptide are inserted at said novel insertion site.

[0130] In some embodiments of the recombinant MDVs, the heterologous polynucleotide coding for and expressing the IBDV VP2 antigen or polypeptide and the heterologous polynucleotide coding for and expressing the ILTV gD antigen or polypeptide are inserted at said novel insertion site.

[0131] In some embodiments of the recombinant MDVs, the heterologous polynucleotide coding for and expressing the NDV F antigen or polypeptide, the heterologous polynucleotide coding for and expressing the IBDV VP2 antigen or polypeptide and the heterologous polynucleotide coding for and expressing the ILTV gD antigen or polypeptide are inserted at said novel insertion site.

[0132] In some particular embodiments, the recombinant MDV comprises a heterologous polynucleotide encoding a polypeptide selected from the group consisting of an IBDV VP2 antigen, an ILTV glycoprotein D (gD) antigen and an NDV F antigen, being inserted at the novel insertion site of the present invention. In some preferred embodiments, said heterologous polynucleotide is operably linked to the endogenous UL26 promoter of MDV and / or the endogenous UL26.5 promoter of MDV, and expresses in an orientation same with the orientation of UL26. In some preferred embodiments, said heterologous polynucleotide is operably linked to the endogenous UL26 gene polyA signal motif. In some preferred embodiments, said heterologous polynucleotide is linked at its 5’ end to the flanking sequence of the insertion site via an IRES element, or via a stop codon+IRES (wherein, the stop codon, TAA, TGA or TAG, is 5’ upstream to IRES, preferably directly 5’ flanking the IRES) .

[0133] In a more preferred embodiment, the recombinant MDV comprises a heterologous polynucleotide encoding an NDV F antigen and being inserted at the novel insertion site in the form of a first expression cassette. In some particular embodiments, the MDV comprises HVT. In some particular embodiments, the MDV is HVT. In some particular embodiments, the first expression cassette is inserted in between the HVT genome sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and ctatacaatttcatcatccgtctcagaatccgtgtcgttt (SEQ ID NO: 25) , more preferably inserted in between the HVT genome sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and aaagcggtgtgttaatgtcagagagctgta (SEQ ID NO: 24) .

[0134] In one or more embodiments, said first expression cassette further comprise at least one heterologous polynucleotide coding for an antigen of an avian pathogen, which is preferably not NDV F antigen.

[0135] In one embodiment, said expression cassette further comprises a promoter sequence, which is operably linked to one or more heterologous polynucleotides. In one or more particular embodiments, said expression cassette comprises a homologous promoter. In one embodiment, the promoter is one or more promoters selected from the group consisting of the following: an immediate early (IE) human cytomegalovirus (CMV) (hCMV) promoter, mouse CMV (mCMV) IE promoter, guinea pig CMV (gpCMV) IE promoter, an SV40 promoter, Pseudorabies Virus promoters such as that of glycoprotein X promoter, Herpes Simplex Virus-1 such as the alpha 4 promoter, Marek's Disease Viruses (including MDV-1, MDV-2 and HVT) promoters such as those driving glycoproteins gC, gB, gE, or gl expression, HHV3gB promoter (Human Herpesvirus Type 3 glycoprotein B promoter) , Infectious Laryngotracheitis Virus promoters such as those of glycoprotein gB, gE, gl, gD, gC genes, or other herpesvirus promoters. In one embodiment, said expression cassette comprises a mouse CMV promoter, e.g., an mCMV IE promoter.

[0136] In one or more embodiments, said expression cassette does not comprise a heterologous promoter. In a preferred embodiment, the expression cassette does not comprise a heterologous promoter, but the insertion of the expression cassette into the target sequence of the MDV genome allows the heterologous polynucleotide in the expression cassette being operably linked to the endogenous promoter originally present in the MDV genome, e.g., via an Internal Ribosomal Entry Site (IRES) , or via a stop codon+IRES (wherein, the stop codon, TAA, TGA or TAG, is 5’ upstream to IRES, preferably directly 5’ flanking the IRES) or via a coding sequence for self-cleavage peptide or via a stop codon+ coding sequence for self-cleavage peptide (wherein, the stop codon, TAA, TGA or TAG, is 5’ upstream to coding sequence for self-cleavage peptide, preferably directly 5’ flanking the coding sequence for self-cleavage peptide) . In a particular embodiment, said endogenous promoter is the endogenous promoter of MDV UL26 gene, and / or the endogenous promoter of MDV UL26.5 gene. In a particular embodiment, the IRES could be any IRES element, e.g., the optimized IRES of the present invention as hereinafter described. In a particular embodiment, the self-cleavage peptide is 2A peptide, e.g., P2A, T2A, E2A or F2A.

[0137] In one or more embodiments, said expression cassette comprises nucleic acid sequences coding for the signal of polyadenylation (i.e., polyA signal motif) , which are operably linked to one or more heterologous polynucleotides. In one or more particular embodiments, said polyA signal motif can promote the termination of the encountered transcriptional elongation, which is preferably along either of the two genome DNA strands. Therefore, in one or more particular embodiments, said polyA signal motif promotes to the transcriptional termination of said heterologous polynucleotides. In one or more particular embodiments, said polyA signal motif blocks the transcription of any endogenous genes flanking the expression cassette. In one or more embodiments, said polyA signal motif is one or more known polyA signal motifs, e.g., SV40 polyA signal motif, BGH poly A motif, and / or polyA signal motifs of the present invention as hereinafter described, e.g., the artificial reverse tandem polyA signal motif of the present invention, the novel bidirectional artificial polyA signal motif of the present invention, the MDV CVI988 MDV89 gene polyA signal motif of the present invention, the MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention, and / or the MDV UL26 endogenous polyA signal motif.

[0138] In one or more embodiments, said expression cassette does not comprise an exogenous polyA signal motif. In a preferred embodiment, the expression cassette does not comprise an exogenous polyA signal motif, but the insertion of the expression cassette into the target sequence of the MDV genome allows the heterologous polynucleotide in the expression cassette being operably linked to the endogenous polyA signal motif originally present in the MDV genome.

[0139] In another aspect, the recombinant MDV of the present invention further comprises another heterologous polynucleotide, inserted at the “second insertion site” which is different from said novel insertion site, thereby, the recombinant MDV comprises at least two heterologous polynucleotides coding for at least two avian pathogen antigens.

[0140] In some preferred embodiments, said heterologous polynucleotides encodes at least two polypeptides selected from the group consisting of an IBDV VP2 antigen, an ILTV gD antigen and an NDV F antigen. In some particular embodiments, not all or both of said heterologous polynucleotides encoding an IBDV VP2 antigen, an ILTV gD antigen and / or an NDV F antigen are inserted at the novel insertion site of the present invention (i.e., the intergenic region between UL26 and UL27 genes) .

[0141] In some particular embodiments, the recombinant MDV comprises three heterologous polynucleotides, a polynucleotide encoding an IBDV VP2 antigen, a polynucleotide encoding an ILTV gD antigen and a polynucleotide encoding an NDV F antigen.

[0142] In some particular embodiments, one or two of the heterologous polynucleotides encoding IBDV VP2, ILTV gD and NDV F are inserted in the intergenic region between UL26 and UL27 genes. In some preferred embodiments, a first cassette comprising the heterologous polynucleotide encoding NDV F is inserted in the intergenic region between UL26 and UL27 genes, and a second cassette comprising a heterologous polynucleotide encoding IBDV VP2 and a heterologous polynucleotide encoding ILTV gD is inserted at the second insertion site.

[0143] In some preferred embodiments, one of said heterologous polynucleotides encodes an NDV F antigen and is inserted at said novel insertion site, preferably in the form of a first expression cassette. In some particular embodiments, the MDV comprises HVT. In some particular embodiments, the MDV is HVT. In some particular embodiments, the first expression cassette is inserted in between the HVT genome sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and ctatacaatttcatcatccgtctcagaatccgtgtcgttt (SEQ ID NO: 25) , more preferably inserted in between the HVT genome sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and aaagcggtgtgttaatgtcagagagctgta (SEQ ID NO: 24) . In some preferred embodiments, the first expression cassette comprising the heterologous polynucleotide is operably linked to the endogenous UL26 promoter of MDV and / or the endogenous UL26.5 promoter of MDV. In some preferred embodiments, the first expression cassette comprising the heterologous polynucleotide is linked at its 5’ end to the 3’ end of the ORF of UL26 gene via an IRES element or via a stop codon+IRES (wherein, the stop codon, TAA, TGA or TAG, is 5’ upstream to IRES, preferably directly 5’ flanking the IRES) . In some preferred embodiments, the heterologous polynucleotide is placed after the stop codon of the endogenous UL26 / UL26.5 gene, preferably via an IRES element or via a stop codon+IRES (wherein, the stop codon, TAA, TGA or TAG, is 5’ upstream to IRES, preferably directly 5’ flanking the IRES) . In some embodiments, the first expression cassette comprising the heterologous polynucleotide is operably linked to the endogenous UL26 gene polyA signal motif and / or the endogenous UL26.5 gene polyA signal motif. In some preferred embodiments, the first cassette comprises the heterologous polynucleotide encoding NDV F and optionally an IRES element or a stop codon+IRES (wherein, the stop codon, TAA, TGA or TAG, is 5’ upstream to IRES, preferably directly 5’ flanking the IRES) , wherein the heterologous polynucleotide is placed after the stop codon of the endogenous UL26 / UL26.5 gene, preferably linked via an IRES element a stop codon+IRES; and / or the heterologous polynucleotide is placed under the control of the endogenous UL26 promoter of MDV, and / or under the control of the endogenous UL26.5 promoter of MDV. In some preferred embodiments, the first cassette comprises or consists of in 5’ to 3’ direction and in this order: (a) an IRES element or a stop codon+IRES, and (b) the heterologous polynucleotide encoding NDV F, and the heterologous polynucleotide is placed after the stop codon of the endogenous UL26 / UL26.5 gene, via the IRES element or the stop codon+IRES; and the heterologous polynucleotide is placed under the control of the endogenous UL26 promoter of MDV and / or the endogenous UL26.5 promoter of MDV, thereby the promoters and polyA signal motifs are operatively linked to the heterologous polynucleotide encoding NDV F.

[0144] In some preferred embodiments, the first expression cassette comprises the heterologous polynucleotide encoding NDV F, and further comprises a non-endogenous promoter and one or more non-endogenous polyA signal motifs operably linked to the heterologous polynucleotide, and preferably the first expression cassette is expressed in the same orientation as UL27 gene. In some more preferred embodiments, the heterologous polynucleotide encoding NDV F is directly 3’ flanked by a polyadenylation signal core sequence, and / or directly 5’ flanked by a Kozak sequence. In some more preferred embodiments, the first cassette comprises or consists of in 5’ to 3’ direction and in this order: (a) a polyA signal motif, (b) a non-endogenous promoter, (c) the heterologous polynucleotide encoding NDV F, and (d) one or more polyA signal motifs; and whereby the promoters and polyA signal motifs are operatively linked to the heterologous polynucleotide encoding NDV F. In some more preferred embodiments, the first cassette comprises or consists of in 5’ to 3’ direction and in this order: (a) a polyA signal motif, (b) a non-endogenous promoter, (c) a Kozak sequence, (d) the heterologous polynucleotide encoding NDV F, (e) a polyadenylation signal core sequence, and (f) one or more polyA signal motifs; and whereby the promoters and polyA signal motifs are operatively linked to the heterologous polynucleotide encoding NDV F.

[0145] In some preferred embodiments, said heterologous polynucleotides encodes an IBDV VP2 antigen and / or an ILTV gD antigen. In some more preferred embodiments, the heterologous polynucleotides encodes an IBDV VP2 antigen and / or an ILTV gD antigen are inserted at the second insertion site, preferably in the form of a second expression cassette. In some particular embodiments, the second insertion site is located in the intergenic region between UL55 and MDV71 genes, e.g., between the stop codon of UL55 gene and the stop codon of MDV71 gene. In some particular embodiments, the MDV comprises HVT. In some particular embodiments, the MDV is HVT. In some particular embodiments, the second expression cassette is inserted in between the HVT genome sequences atcgctatgcaaagagatgcgtgtgtacacgcgccgttga (SEQ ID NO: 26) and ttaagatgcaggagtaacaatgtgcatagtaggcgtagtt (SEQ ID NO: 29) , more preferably inserted in between the HVT genome sequences tatatgttattaaataaaataattgaccagtgaacaattt (SEQ ID NO: 27) and gtttaatgttagtttattcaatgcattggttgcaaatatt (SEQ ID NO: 28) .

[0146] In some preferred embodiments, said second expression cassette comprises two heterologous polynucleotides coding for two avian pathogen antigens, which are linked to each other via an IRES element or via a stop codon+IRES (wherein, the stop codon, TAA, TGA or TAG, is 5’ upstream to IRES, preferably directly 5’ flanking the IRES) or via a coding sequence for self-cleavage peptide or via a stop codon+ coding sequence for self-cleavage peptide (wherein, the stop codon, TAA, TGA or TAG, is 5’ upstream to coding sequence for self-cleavage peptide, preferably directly 5’ flanking the coding sequence for self-cleavage peptide) . In a particular embodiment, the IRES could be any IRES element, e.g., the optimized IRES of the present invention as hereinafter described. In a particular embodiment, the self-cleavage peptide is 2A peptide, e.g., P2A, T2A, E2A or F2A.

[0147] In some preferred embodiments, said second expression cassette comprises a promoter sequence, which is operably linked to the at least two heterologous polynucleotides in the expression cassette. In one embodiment, the promoter is one or more promoters selected from the group consisting of the following: an immediate early (IE) human cytomegalovirus (CMV) (hCMV) promoter, mouse CMV (mCMV) IE promoter, guinea pig CMV (gpCMV) IE promoter, an SV40 promoter, Pseudorabies Virus promoters such as that of glycoprotein X promoter, Herpes Simplex Virus-1 such as the alpha 4 promoter, Marek's Disease Viruses (including MDV-1, MDV-2 and HVT) promoters such as those driving glycoproteins gC, gB, gE, or gl expression, HHV3gB promoter (Human Herpesvirus Type 3 glycoprotein B promoter) , Infectious Laryngotracheitis Virus promoters such as those of glycoprotein gB, gE, gl, gD, gC genes, or other herpesvirus promoters. In general, it is advantageous to employ a strong promoter functional in eukaryotic cells. In one embodiment, said expression cassette comprises a mouse CMV promoter, e.g., an mCMV IE promoter.

[0148] In one or more embodiments, the second expression cassette does not comprise a heterologous promoter, but the insertion of the expression cassette into the target sequence of the MDV genome allows the heterologous polynucleotides in the expression cassette being operably linked to the endogenous promoter originally present in the MDV genome.

[0149] In one or more embodiments, said expression cassette comprises nucleic acid sequences coding for the signal of polyadenylation (i.e., polyA signal motif) , which are operably linked to the heterologous polynucleotides. In one or more particular embodiments, said polyA signal motif can promote the termination of the encountered transcriptional elongation, which is preferably along either of the two genome DNA strands. In one or more particular embodiments, said polyA signal motif blocks the transcription of any genes (e.g., endogenous viral genes) flanking the expression cassette. In one or more embodiments, said polyA signal motif is one or more known polyA signal motifs, e.g., SV40 polyA signal motif, BGH poly A motif, and / or polyA signal motifs of the present invention as hereinafter described, e.g., the artificial reverse tandem polyA signal motif of the present invention, the novel bidirectional artificial polyA signal motif of the present invention, the MDV CVI988 MDV89 gene polyA signal motif of the present invention, and / or the MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention.

[0150] In one or more embodiments, said second expression cassette comprises at least two polyA signal motifs at both ends of the cassette, thereby promoting the transcriptional termination of the heterologous polynucleotides in the cassette and blocking the expression of the genes flanking the cassette. In a preferred embodiment, the polyA signal motifs are at least two of the novel polyA signal motifs provided by the present invention as hereinafter described.

[0151] In one or more embodiments, the second cassette comprises a heterologous polynucleotide encoding IBDV VP2 and a heterologous polynucleotide encoding ILTV gD, respectively, preferably linked to each other via an IRES element or via a stop codon+IRES or via a self-cleaving peptide-coding sequence or via a stop codon+self-cleaving peptide-coding sequence, and cassette further comprises an exogenous promoter, operably linked to the heterologous polynucleotides. In some preferred embodiments, the second cassette further comprises one or more (e.g., one, two, or three in tandem) non-endogenous polyA signal motifs in each end, e.g., one or more (e.g., one, two, or three in tandem) polyA signal motif at the 5’ end (e.g., upstream to the promoter) ; and / or one or more (e.g., one, two, or three in tandem) polyA signal motif at the 3’ end (e.g., downstream to the heterologous polynucleotide) .

[0152] In one or more particular embodiments, the second cassette further comprises a nonfunctioning FRT site.

[0153] In one or more particular embodiments, the second cassette further comprises a nonfunctioning FRT site.

[0154] In some particular embodiments, the second cassette comprises or consists of in 5’ to 3’ direction and in this order: (a) a polyA signal motif; (b) an FRT site; (c) an exogenous promoter; (d) one of the heterologous polynucleotide encoding IBDV VP2 and the heterologous polynucleotide encoding ILTV gD; (e) IRES or stop codon+IRES, (f) the other one of the heterologous polynucleotide encoding IBDV VP2 and the heterologous polynucleotide encoding ILTV gD; and (g) one or two polyA signal motifs.

[0155] In some other particular embodiments, the second cassette comprises or consists of in 5’ to 3’ direction and in this order: (a) a polyA signal motif; (b) an exogenous promoter; (c) one of the heterologous polynucleotide encoding IBDV VP2 and the (heterologous polynucleotide encoding ILTV gD; (d) IRES or stop codon+IRES; (e) one or two polyA signal motifs; (f) an FRT site; and (g) a polyA signal motif.

[0156] In one aspect, the present invention provided an artificial reverse tandem polyA signal motif, which comprises or consists of:

[0157] (i) a nucleotide sequence set forth in SEQ ID NO: 16;

[0158] (ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or

[0159] (iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,

[0160] and can promote the termination of the encountered transcriptional elongation, which is preferably along either of the two genome DNA strands.

[0161] In one aspect, the present invention provided a novel bidirectional artificial polyA signal motif, which comprises or consists of :

[0162] (i) a nucleotide sequence set forth in SEQ ID NO: 17;

[0163] (ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or

[0164] (iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,

[0165] and can promote the termination of the encountered transcriptional elongation, which is preferably along either of the two genome DNA strands.

[0166] In one aspect, the present invention provided an MDV CVI988 MDV89 gene polyA signal motif, which comprises or consists of:

[0167] (i) a nucleotide sequence set forth in SEQ ID NO: 18;

[0168] (ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or

[0169] (iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,

[0170] and can promote the termination of the encountered transcriptional elongation, which is preferably along either of the two genome DNA strands.

[0171] In one aspect, the present invention provided an MDV39 / 40-intergenic bidirectional polyA signal motif, which comprises or consists of:

[0172] (i) a nucleotide sequence set forth in SEQ ID NO: 19;

[0173] (ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or

[0174] (iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,

[0175] and can promote the can promote the termination of the encountered transcriptional elongation, which is preferably along either of the two genome DNA strands.

[0176] In one or more particular embodiments of the recombinant MDV of the present invention comprising the second expression cassette, the polyA signal motif upstream to the promoter is an artificial reverse tandem polyA signal motif upstream to the promoter.

[0177] In one or more particular embodiments of the recombinant MDV of the present invention comprising the second expression cassette, the polyA signal motifs downstream to the heterologous polynucleotides are a combination of a novel bidirectional artificial polyA signal motif and an MDV39 / 40-intergenic bidirectional polyA signal motif in tandem downstream to the heterologous polynucleotides.

[0178] In one or more particular embodiments of the recombinant MDV of the present invention comprising the second expression cassette, the polyA signal motif upstream to the promoter is an MDV CVI988 MDV89 gene polyA signal motif upstream to the promoter.

[0179] In one or more particular embodiments of the recombinant MDV of the present invention comprising the second expression cassette, the polyA signal motifs downstream to the heterologous polynucleotides are a combination of a novel bidirectional artificial polyA signal motif, an MDV39 / 40-intergenic bidirectional polyA signal motif and an artificial reverse tandem polyA signal motif in tandem downstream to the heterologous polynucleotides.

[0180] In one or more embodiments, said expression cassette does not comprise an exogenous polyA signal motif. In a preferred embodiment, the expression cassette does not comprise a polyA signal motif, but the insertion of the expression cassette into the target sequence of the MDV genome allows the heterologous polynucleotides in the expression cassette being operably linked to the endogenous polyA signal motif originally present in the MDV genome.

[0181] In one or more particular embodiments of the recombinant MDV of the present invention comprising the first and the second expression cassettes, the first cassette comprises or consists of in 5’ to 3’ direction and in this order:

[0182] (a) a stop codon, e.g., SEQ ID NO: 57;

[0183] (b) an optimized IRES of the present invention;

[0184] (c) a heterologous polynucleotide encoding cleavage site-mutated NDV F, e.g., comprising or consisting of a sequence as shown in SEQ ID NO: 4, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 4;

[0185] or

[0186] (a) a novel bidirectional artificial polyA signal motif of the present invention;

[0187] (b) an exogenous promoter which comprises or consists of a sequence of SEQ ID NO: 20, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 20 and can bind an RNA polymerase to initiate transcription;

[0188] (c) a Kozak sequence;

[0189] (d) a heterologous polynucleotide encoding cleavage site-mutated NDV F, e.g., comprising or consisting of a sequence as shown in SEQ ID NO: 4, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 4;

[0190] (e) Polyadenylation signal core sequence, e.g., SEQ ID NO: 61;

[0191] (f) an MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention;

[0192] and / or

[0193] the second cassette comprises or consists of in 5’ to 3’ direction and in this order:

[0194] (a) an artificial reverse tandem polyA signal motif of the present invention;

[0195] (b) an FRT site;

[0196] (c) an mCMV promoter, which comprises or consists of a sequence of SEQ ID NO: 14, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription;

[0197] (d) a heterologous polynucleotide encoding IBDV VP2 antigen, e.g., comprising or consisting of a sequence as shown in SEQ ID NO: 6 or 7, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 6 or 7;

[0198] (e) a stop codon, e.g., SEQ ID NO: 58;

[0199] (f) an optimized IRES, e.g., of the present invention;

[0200] (g) a heterologous polynucleotide encoding ILTV gD antigen, e.g., comprising or consisting of a sequence as shown in SEQ ID NO: 12, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 12; and

[0201] (h) a novel bidirectional artificial polyA signal motif of the present invention;

[0202] (i) an MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention;

[0203] or

[0204] (a) a MDV CVI988 MDV89 gene polyA signal motif of the present invention;

[0205] (b) an mCMV promoter, which comprises or consists of a sequence of SEQ ID NO: 14, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription;

[0206] (c) a heterologous polynucleotide encoding IBDV VP2 antigen, e.g., comprising or consisting of a sequence as shown in SEQ ID NO: 7, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 7;

[0207] (d) a stop codon, e.g., SEQ ID NO: 58;

[0208] (e) an optimized IRES of the present invention;

[0209] (f) a heterologous polynucleotide encoding ILTV gD antigen, e.g., comprising or consisting of a sequence as shown in SEQ ID NO: 12, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 12; and

[0210] (g) a novel bidirectional artificial polyA signal motif of the present invention;

[0211] (h) an MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention;

[0212] (i) an FRT site;

[0213] (j) an artificial reverse tandem polyA signal motif of the present invention.

[0214] In one or more embodiments, said expression cassette further comprises a heterologous polynucleotide coding for another avian pathogen antigen.

[0215] In some preferred embodiments of recombinant MDVs of the present invention, the mCMV promoter comprises or consists of a nucleic acid sequence as shown in SEQ ID NO: 14, or a nucleic acid sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription.

[0216] In some preferred embodiments of recombinant MDVs of the present invention, the amino acid sequence at the protease cleavage site of the NDV F antigen has been mutated. In some preferred embodiments of recombinant MDVs of the present invention, the coding sequence for the NDV F antigen is derived from the wildtype gene, or is codon-optimized, and thus the heterologous polynucleotide encoding NDV F antigen comprises or consists of a nucleic acid sequence as shown in any one of SEQ ID NOs: 2-4, or a nucleic acid sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with any one of SEQ ID NOs: 2-4.

[0217] In some preferred embodiments of recombinant MDVs of the present invention, the coding sequence for the ILTV gD antigen is wildtype or codon-optimized, and thus the heterologous polynucleotide encoding ILTV gD antigen comprises or consists of a nucleic acid sequence as shown in SEQ ID NO: 12 or 13, or a nucleic acid sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 12 or 13.

[0218] In some preferred embodiments of recombinant MDVs of the present invention, the coding sequence for the IBDV VP2 antigen is wildtype or codon-optimized, and thus the heterologous polynucleotide encoding IBDV VP2 antigen comprises or consists of a nucleic acid sequence as shown in SEQ ID NO: 6, 7, 9 or 10, or a nucleic acid sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 6, 7, 9 or 10.

[0219] Furthermore, the present invention provides a recombinant MDV comprising the heterologous polynucleotide encoding IBDV VP2 antigen. In some preferred embodiments, the IBDV VP2 antigen is an VP2 antigen from nVar IBDV, preferably said IBDV VP2 antigen

[0220] (a) is encoded by the heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 10, or 9, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 10, or 9, and / or

[0221] (b) comprises or consists of an amino acid sequence as shown in SEQ ID NO: 8, or an amino acid sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 8.

[0222] In some preferred embodiments, the heterologous polynucleotide encoding IBDV VP2 antigen is inserted into the intergenic region between UL55 and MDV71 genes, e.g., between the stop codon of UL55 gene and the stop codon of MDV71 gene, preferably between the HVT genome sequences atcgctatgcaaagagatgcgtgtgtacacgcgccgttga (SEQ ID NO: 26) and ttaagatgcaggagtaacaatgtgcatagtaggcgtagtt (SEQ ID NO: 29) , more preferably inserted in between the HVT genome sequences tatatgttattaaataaaataattgaccagtgaacaattt (SEQ ID NO: 27) and gtttaatgttagtttattcaatgcattggttgcaaatatt (SEQ ID NO: 28) . In some other embodiments, the heterologous polynucleotide is inserted atan insertion site located in the intergenic region between UL26 and UL27 genes.

[0223] In a preferred embodiment, the recombinant MDV comprises an mCMV promoter flanking the 5’ end of the heterologous polynucleotide and being operably linked thereto.

[0224] In an exemplary embodiment of the present invention, the recombinant MDV further comprises a heterologous polynucleotide encoding an ILTV gD antigen, which lies preferably 3’ to the heterologous polynucleotide encoding the IBDV VP2 antigen. In a preferred embodiment, the two heterologous polynucleotides are linked by an IRES element or a stop codon+IRES.

[0225] In another exemplary embodiment of the present invention, the recombinant MDV comprises a heterologous polynucleotide encoding IBDV VP2 antigen and a heterologous polynucleotide encoding an ILTV gD antigen, wherein the heterologous polynucleotide encoding IBDV VP2 antigen comprises or consists of a nucleic acid sequence as shown in SEQ ID NO: 6, 7, 9 or 10, or a nucleic acid sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 6, 7, 9 or 10,

[0226] and / or

[0227] the heterologous polynucleotide encoding ILTV gD antigen comprises or consists of a nucleic acid sequence as shown in SEQ ID NO: 12 or 13, or a nucleic acid sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 12 or 13.

[0228] In a preferred embodiment, the recombinant MDV comprises a heterologous polynucleotide encoding IBDV VP2 antigen and a heterologous polynucleotide encoding ILTV gD antigen, wherein, the IBDV VP2 antigen is encoded by the heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 7, or 10, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 7 or 10,

[0229] and / or

[0230] the ILTV gD antigen is encoded by the heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 13 or 12, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 13 or 12.

[0231] In a more preferred embodiment, the heterologous polynucleotide encoding IBDV VP2 antigen and the heterologous polynucleotide encoding ILTV gD antigen are operably linked to each other via an IRES element or via a stop codon+IRES or via a self-cleaving peptide-coding sequence or via a stop codon+ coding sequence for self-cleavage peptide.

[0232] In a more preferred embodiment, the heterologous polynucleotides are inserted to an insertion site located in the intergenic region between UL55 and MDV71 genes.

[0233] In another aspect, the present invention provides an optimized Internal Ribosomal Entry Site (IRES) element, which is derived from the IRES of Encephalomyocarditis Virus (EMCV) and engineered to be more potent in promoting the expression of the second gene in the bicistronic, comprising or consisting of a nucleic acid sequence as shown in SEQ ID NO: 15, or a nucleic acid sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 15 and can recruit the ribosome to initiate the translation. Therefore, in some preferred embodiments of recombinant MDVs of the present invention, the IRES element used therein is the novel optimized IRES of the present invention as described above.

[0234] As described in the background art, selecting available insertion sites in the MDV genome is restricted, and thus a further problem faced for the construction of recombinant MDV candidates of the present invention is that promoter resources are limited either in a multi-genes co-expression system. Heterologous strong promoters are conventionally used in the art, but in the previous study, the inventors found that the introduction of such heterologous promoters often interferes with the expression of endogenous genes, and the expression efficiency of heterologous genes is not so high either. In this regard, the inventors innovatively employ the MDV endogenous UL26 / 26.5 gene promoter. In a first way, the MDV endogenous UL26 / 26.5 gene promoter is copied to a different position as an exogenous element and found to be ideally compatible and potent for driving the transcription of the heterologous gene in MDV. In a second way, the heterologous gene was placed after the stop codon of the endogenous UL26 / UL26.5 gene, connected thereto via an IRES element or via a stop codon+IRES, so that when the transcription of said endogenous gene was initiated by its promoter, the heterologous gene also got transcribed and translated via said IRES.

[0235] For expression cassettes using a heterologous strong promoter (e.g., mCMV promoter) , the inventors similarly introduced an IRES element or a self-cleavage sequence to express two heterologous genes as a bicistronic mRNA by a single promoter.

[0236] Due to the strong elongation ability of the MDV UL26 / 26.5 gene promoter or the mCMV promoter in transcription, both gene sequences were able to be well transcribed.

[0237] Meanwhile, to address the problem that the known IRES sequences usually translate the second gene less efficiently than the gene before IRES, we provided an optimized IRES element, which, combined with codon-optimized coding sequences, also significantly promoted the expression of the second gene in the bicistronic.

[0238] To solve the transcriptional interference problem of exogenous gene cassettes due to read-through of endogenous promoters, the inventors cleverly introduced MDV-derived short polyA signal motifs (70-110bp) and an artificial polyA motif of only 54bp, and placed one or more of polyA signal motifs to the upstream and / or downstream of the heterologous genes. In some preferred embodiments of the present invention, the polyA signal motifs of the present invention can promote the termination of the encountered transcriptional elongation, which is preferably along either of the two genome DNA strands. Thus, the polyA signal motifs in the recombinant MDV and / or expression cassette of the present invention would then provide stronger transcription termination and block the genes in the upstream and / or the downstream from transcriptionally extending / elongating into the insert. Due to the optimized short sequence, the polyA motifs of the present invention remain shorter even in tandem than the commonly used eukaryotic polyA motifs such as SV40 polyA signal motif, BGH polyA signal motif, and the like, thus allowing more room for antigenic genes.

[0239] In a further aspect of the present invention, provided is the use of one or more of the following elements in the manufacture of a recombinant virus:

[0240] (1) the optimized IRES element of the present invention,

[0241] (2) endogenous UL26 promoter of MDV, comprising or consisting of a sequence of SEQ ID NO: 21, or a sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 21 and can bind an RNA polymerase to initiate transcription;

[0242] (3) endogenous UL26.5 promoter of MDV, comprising or consisting of a sequence of SEQ ID NO: 20, or a sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 20 and can bind an RNA polymerase to initiate transcription;

[0243] (4) endogenous UL26 polyA signal of MDV, comprising or consisting of a sequence of SEQ ID NO: 22, or a sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 22;

[0244] (5) mCMV promoter, comprising or consisting of a sequence of SEQ ID NO: 14, or a sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription;

[0245] (6) the artificial reverse tandem polyA signal motif of the present invention;

[0246] (7) the novel bidirectional artificial polyA signal motif of the present invention;

[0247] (8) the MDV CVI988 MDV89 gene polyA signal motif of the present invention;

[0248] (9) the MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention, wherein, preferably, said recombinant virus is a recombinant MDV (such as recombinant HVT) comprising at least one heterologous polynucleotide encoding at least one (e.g., one) antigen of an avian pathogen, and wherein the at least one or more heterologous polynucleotides are operably linked to the one or more elements listed above.

[0249] In another aspect of the present invention, on the basis of the various kinds of gene elements (coding sequences, regulatory sequences, and the like) as described above, expression cassettes are provided, which are suitable for integration into various kinds of expression vectors, especially recombinant MDVs, for the purpose of expressing the heterologous polynucleotides comprised in the expression cassettes under appropriate conditions, preferably suitable for expressing the heterologous polynucleotides comprised therein under appropriate conditions when inserted at the preferable novel insertion site of the present invention.

[0250] In some embodiments, the expression cassettes of the present invention comprise one or more heterologous polynucleotides encoding at least one (e.g., one) antigen of an avian pathogen. In some preferred embodiments, said at least one antigen is one or more, e.g., one or two, selected from the group consisting of the NDV F antigen, IBDV (e.g., vv IBDV or nVar IBDV) VP2 antigen and ILTV gD antigen as described above herein. In some particular embodiments, the expression cassettes comprise a heterologous polynucleotide encoding NDV F antigen. In some particular embodiments, the expression cassettes comprise heterologous polynucleotides encoding IBDV (e.g., vv IBDV or nVar IBDV) VP2 antigen and ILTV gD antigen.

[0251] In some embodiments, the expression cassette expresses in the forward orientation. In some embodiments, the expression cassette expresses in the reverse orientation.

[0252] In some particular embodiments, the expression cassette further comprises a promoter sequence, which is operably linked to one or more heterologous polynucleotides. In some more particular embodiments, the promoter is heterologous. In some other more particular embodiments, the promoter is homologous.

[0253] In some other particular embodiments, said expression cassette does not comprise a promoter. In some preferred embodiments, the expression cassette does not comprise a promoter, but the insertion of the expression cassette into the target sequence (e.g., sequence of the viral genome) allows the heterologous polynucleotide in the expression cassette being operably linked to the endogenous promoter originally present in the MDV genome.

[0254] In one or more embodiments, said expression cassette comprises one or more polyA signal motifs to promote the transcriptional termination of said heterologous polynucleotides encoding avian pathogen antigens and / or to block the transcription of the flanking genes (e.g., endogenous viral genes) in either or both flanks.

[0255] In one or more embodiments, said polyA signal motif is BGH polyA signal motif and / or SV40 polyA signal motif. In one or more embodiments, said polyA signal motif is one or more polyA signal motifs of the present invention as above described.

[0256] In one or more embodiments, the expression cassette comprises a polyA signal motif at either end of the cassette. In one or more embodiments, the expression cassette comprises at least two polyA signal motifs at both ends of the cassette, thereby promoting the transcriptional termination of the heterologous polynucleotides in the cassette and blocking the expression of the genes flanking the cassette. In some other embodiments, said expression cassette does not comprise an exogenous polyA signal motif, but the insertion of the expression cassette into the target sequence of the viral genome allows the heterologous polynucleotide in the expression cassette being operably linked to the endogenous polyA signal motif originally present in the viral genome, e.g., the MDV genome, the HVT genome.

[0257] In some more particular embodiments, the expression cassette further comprises a recognition site of site-specific recombinases, e.g., a recognition site of Flp recombinase, a recognition site of CRE / lox recombinase, a recognition site of PHIC31 recombinase, a recognition site of DRE recombinase, a recognition site of VIKA recombinase, and the like. Unless otherwise indicated, when referring to the expression cassette in the context of the present invention, the recognition site is a scar sequence of the elimination of BAC vector during preorder operations of the construction, and is functionally silent without any disturbance to the functions of other elements in the expression cassette.

[0258] In some particular embodiments, the present invention provides an expression cassette comprising one or more of the following elements: (1) the optimized IRES element of the present invention, (2) the artificial reverse tandem polyA signal motif of the present invention; (3) the novel bidirectional artificial polyA signal motif of the present invention; (4) the MDV CVI988 MDV89 gene polyA signal motif of the present invention; (5) the MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention, and one or more heterologous polynucleotides encoding an antigen of an avian pathogen, preferably an IBDV VP2 antigen, an ILTV gD antigen and / or an NDV F antigen.

[0259] In some particular embodiments, the present invention provides an expression cassette comprising or consisting of in this order: (1) an optional polyA signal motif; (2) a promoter; (3) one or more heterologous polynucleotides encoding an antigen of an avian pathogen; (4) one or more polyA signal motifs in tandem, being operably linked, wherein said heterologous polynucleotide (s) encodes one or two polypeptides selected from the group consisting of an IBDV VP2 antigen, an ILTV gD antigen and an NDV F antigen, wherein the polyA signal motif of (1) , if any, could be the same or different with the polyA signal motif of (4) , and wherein the expression cassette could be used to insert into the genome of a recombinant MDV, expressing said heterologous polynucleotides in the forward orientation or the reverse orientation.

[0260] In some more particular embodiments, said heterologous polynucleotide encodes the IBDV VP2 antigen. In some more particular embodiments, the IBDV VP2 antigen is as defined above, and / or the promoter is the mCMV promoter as defined above, and / or the polyA signal motif of (1) is the artificial reverse tandem polyA signal motif of the present invention, and / or the polyA signal motifs of (4) are the novel bidirectional artificial polyA signal motif and the MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention. In some more particular embodiments, said heterologous polynucleotide encodes the IBDV VP2 antigen is followed by a backup stop codon.

[0261] In some more particular embodiments, said heterologous polynucleotide encodes the NDV F antigen. In some more particular embodiments, the NDV F antigen is as defined above. In some more particular embodiments, the promoter is exogenous and the same with the endogenous UL26.5 promoter of MDV. In some more particular embodiments, the polyA signal motif of (1) is absent. In some more particular embodiments, the polyA signal motif of (4) is the MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention. In some preferred embodiments, the heterologous polynucleotide is expressed in the reverse orientation. In some more particular embodiments, said heterologous polynucleotide encodes the NDV F antigen is followed by a backup stop codon.

[0262] In some more particular embodiments, said heterologous polynucleotides encode the IBDV VP2 antigen and the ILTV gD antigen. In some more particular embodiments, the heterologous polynucleotide encoding IBDV VP2 antigen and the heterologous polynucleotide encoding ILTV gD antigen are operably linked to each other via an IRES element or a 2A peptide-coding sequence, preferably an IRES element. In some more particular embodiments, the IBDV VP2 antigen and / or the ILTV gD antigen are as defined above, and / or the promoter is the mCMV promoter as defined above, and / or the IRES is the optimized IRES element of the present invention. In some more particular embodiments, said heterologous polynucleotide encodes the ILTV gD antigen is followed by a backup stop codon.

[0263] In some even more particular embodiments the polyA signal motif of (1) is the artificial reverse tandem polyA signal motif of the present invention, and / or the polyA signal motifs of (4) are the novel bidirectional artificial polyA signal motif and the MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention. In some preferred embodiments, the heterologous polynucleotides are expressed in the forward orientation.

[0264] In some other even more particular embodiments, the polyA signal motif of (1) is the artificial reverse tandem polyA signal motif of the present invention, and / or the polyA signal motifs of (4) are the novel bidirectional artificial polyA signal motif, the MDV39 / 40-intergenic bidirectional polyA signal motif and the MDV CVI988 MDV89 gene polyA signal motif of the present invention. In some preferred embodiments, the expression cassette further comprises a nonfunctioning FRT site inserted among the polyA signal motifs of (4) , and the heterologous polynucleotides are expressed in the reverse orientation.

[0265] In some particular embodiments, the present invention provides an expression cassette comprising or consisting of in this order: (1) an IRES element or a stop codon+IRES or a 2A peptide-coding sequence or a stop codon+2A peptide-coding sequence; (2) one or more heterologous polynucleotides encoding an antigen of an avian pathogen, being operably linked, wherein said heterologous polynucleotide (s) encodes one polypeptide selected from the group consisting of an IBDV VP2 antigen, an ILTV gD antigen and an NDV F antigen, and wherein the expression cassette could be used to insert into the genome of a recombinant MDV to be operably linked to an endogenous gene in the reverse orientation or preferably the forward orientation, and express said heterologous polynucleotide in a same orientation.

[0266] In some more particular embodiments, said heterologous polynucleotide encodes the NDV F antigen. In some more particular embodiments, the NDV F antigen is as defined above. In some more particular embodiments, the element of (1) is an optimized IRES element of the present invention. In some more particular embodiments, the element of (1) is a stop codon + an optimized IRES element of the present invention, wherein the stop codon is directly 5’ flanking the IRES.

[0267] In a preferred particular embodiment, the present invention provides Expression Cassette 1, which comprises a heterologous polynucleotide coding for and expressing an NDV F antigen, optionally codon-optimized, of the present invention. In some more preferred embodiments, the amino acid sequence at the protease cleavage site of the NDV F antigen has been mutated. In some more preferred embodiments, Expression Cassette 1 expresses in the forward orientation when inserted into the MDV genome, i.e., same with the orientation of UL26 and UL55. In some more preferred embodiments, Expression Cassette 1 further comprises an IRES element operably linked to the heterologous polynucleotide coding the NDV F antigen, e.g., the optimized IRES of the present invention. In some more preferred embodiments, Expression Cassette 1 is operably linked to, when inserted into the MDV genome, the endogenous UL26 promoter of MDV and / or the endogenous UL26.5 promoter of MDV, and / or the endogenous UL26 / UL26.5 polyA signal motif of MDV. In some even more particular embodiments, Expression Cassette 1 comprises or consists essentially of or consists of a heterologous polynucleotide coding for and expressing an NDV F antigen, and an optimized IRES of the present invention being upstream to and operably linked to the heterologous polynucleotide.

[0268] In some even more particular embodiments, Expression Cassette 1 comprises or consists of in 5’ to 3’ direction and in this order: (a) an IRES or a stop codon+IRES (wherein the stop codon is directly 5’ flanking the IRES) , e.g., an optimized IRES, such as an optimized IRES of the present invention; (b) a heterologous polynucleotide encoding cleavage site-mutated NDV F, e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 4, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 4, and preferably, Expression Cassette 1 is or is designed to be placed after the stop codon of the endogenous UL26 / UL26.5 gene, and under the control of the endogenous UL26 promoter of MDV, and / or under the control of the endogenous UL26.5 promoter of MDV, thereby the promoters and polyA signal motifs are operatively linked to the heterologous polynucleotide encoding NDV F.

[0269] In some even more particular embodiments, Expression Cassette 1 comprises or consists of SEQ ID NO: 31.

[0270] In some particular embodiments, the present invention provides a recombinant MDV comprising Expression Cassette 1, preferably inserted at the novel insertion site of the present invention.

[0271] In some particular embodiments, the present invention provides a recombinant HVT comprising SEQ ID NO: 31, preferably inserted at the site between the HVT genome DNA sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and aaagcggtgtgttaatgtcagagagctgta (SEQ ID NO: 24) , i.e., between the 30th nucleotide and the 31st nucleotide of the sequence as shown in SEQ ID NO: 36.

[0272] In a preferred particular embodiment, the present invention provides Expression Cassette 2, which comprises a heterologous polynucleotide coding for and expressing an IBDV VP2 antigen, optionally codon-optimized, of the present invention, and a heterologous polynucleotide coding for and expressing an ILTV gD antigen, optionally codon-optimized, of the present invention. In some more preferred embodiments, the heterologous polynucleotide encodes the IBDV VP2 antigen is followed by a backup stop codon. In some more preferred embodiments, the heterologous polynucleotide encodes the ILTV gD antigen is followed by a backup stop codon. In some more preferred embodiments, Expression Cassette 2 expresses in the forward orientation when inserted into the MDV genome, i.e., same with the orientation of UL26 and UL55. In some more preferred embodiments, Expression Cassette 2 further comprises an IRES element connecting the two heterologous polynucleotides, e.g., the optimized IRES of the present invention. In some more preferred embodiments, Expression Cassette 2 further comprises a polyA signal motif and a promoter operably linked to the heterologous polynucleotides. In some more preferred embodiments, Expression Cassette 2 comprises polyA signal motifs at both ends of the cassette, thereby promoting the transcriptional termination of the heterologous polynucleotides in the cassette and blocking the expression of the genes flanking the cassette. In some more preferred embodiments, Expression Cassette 2 further comprises a recognition site of site-specific recombinases, e.g., a recognition site of Flp recombinase, a recognition site of CRE / lox recombinase, a recognition site of PHIC31 recombinase, a recognition site of DRE recombinase, a recognition site of VIKA recombinase, and the like. In some more preferred embodiments, said promoter is a murine cytomegalovirus IE1 gene promoter (mCMV promoter) , e.g., as defined above. In some even more particular embodiments, Expression Cassette 2 comprises or consists essentially of or consists of from the 5’ end an artificial reverse tandem polyA signal motif of the present invention, an FRT site which is a scar sequence, an mCMV promoter as defined above, a codon-optimized vv IBDV VP2 gene, a stop codon, an optimized IRES of the present invention, a wildtype ILTV gD gene, and a novel bidirectional artificial polyA signal motif of the present invention and the MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention in tandem.

[0273] In some even more particular embodiments, Expression Cassette 2 comprises or consists of in 5’ to 3’ direction and in this order: (a) an artificial reverse tandem polyA signal motif, e.g., an artificial reverse tandem polyA signal motif of the present invention; (b) an FRT site; (c) an mCMV promoter, e.g., an mCMV promoter comprising or consisting of a sequence of SEQ ID NO: 14, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription; (d) a heterologous polynucleotide encoding IBDV VP2 antigen, e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 6 or 7, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 6 or 7; (e) a stop codon, e.g., SEQ ID NO: 58; (f) an optimized IRES, e.g., an IRES of the present invention; (g) a heterologous polynucleotide encoding ILTV gD antigen, e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 12, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 12; and (h) a combination of a novel bidirectional artificial polyA signal motif and an MDV39 / 40-intergenic bidirectional polyA signal motif in tandem, e.g., a combination of a novel bidirectional artificial polyA signal motif of the present invention and an MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention in tandem.

[0274] In some even more particular embodiments, Expression Cassette 2 comprises or consists of SEQ ID NO: 32.

[0275] In some particular embodiments, the present invention provides a recombinant MDV comprising Expression Cassette 2, preferably inserted at the insertion site between UL55 and MDV71 genes of the MDV genome as described above.

[0276] In some particular embodiments, the present invention provides a recombinant HVT comprising SEQ ID NO: 32, preferably inserted at the site between the HVT genome DNA sequences tatatgttattaaataaaataattgaccagtgaacaattt (SEQ ID NO: 27) and gtttaatgttagtttattcaatgcattggttgcaaatatt (SEQ ID NO: 28) , i.e., between the 118th nucleotide and the 119th nucleotide of the sequence as shown in SEQ ID NO: 37.

[0277] In a preferred particular embodiment, the present invention provides Expression Cassette 3, which comprises a heterologous polynucleotide coding for and expressing an IBDV VP2 antigen, which is wildtype or codon-optimized, preferably wildtype, of the present invention, and a heterologous polynucleotide coding for and expressing an ILTV gD antigen, which is wildtype or codon-optimized, preferably wildtype, of the present invention. In some more preferred embodiments, the heterologous polynucleotide encodes the IBDV VP2 antigen is followed by a backup stop codon. In some more preferred embodiments, the heterologous polynucleotide encodes the ILTV gD antigen is followed by a backup stop codon. In some more preferred embodiments, Expression Cassette 3 expresses in the reverse orientation when inserted into the MDV genome, i.e., same with the orientation of UL27 and MDV71. In some more preferred embodiments, Expression Cassette 3 further comprises an IRES element connecting the two heterologous polynucleotides, e.g., the optimized IRES of the present invention. In some more preferred embodiments, Expression Cassette 3 further comprises a polyA signal motif and a promoter operably linked to the heterologous polynucleotides. In some more preferred embodiments, Expression Cassette 3 comprises polyA signal motifs at both ends of the cassette, thereby promoting the transcriptional termination of the heterologous polynucleotides in the cassette and blocking the expression of the genes flanking the cassette. In some more preferred embodiments, Expression Cassette 3 further comprises a recognition site of site-specific recombinases, e.g., a recognition site of Flp recombinase, a recognition site of CRE / lox recombinase, a recognition site of PHIC31 recombinase, a recognition site of DRE recombinase, a recognition site of VIKA recombinase, and the like. In some more preferred embodiments, said promoter is a murine cytomegalovirus IE1 gene promoter (mCMV promoter) , e.g., as defined above. In some even more particular embodiments, Expression Cassette 3 comprises or consists essentially of or consists of from the 5’ end a MDV CVI988 MDV89 gene polyA signal motif of the present invention, an mCMV promoter as defined above, a wildtype vv IBDV VP2 gene, a stop codon, an optimized IRES of the present invention, a wildtype ILTV gD gene, a novel bidirectional artificial polyA signal motif of the present invention and the MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention in tandem, an FRT site which is a scar sequence, and an artificial reverse tandem polyA signal motif of the present invention.

[0278] In some even more particular embodiments, Expression Cassette 3 comprises or consists of in 5’ to 3’ direction and in this order: (a) a MDV CVI988 MDV89 gene polyA signal motif, e.g., a MDV CVI988 MDV89 gene polyA signal motif of the present invention; (b) an mCMV promoter, e.g., an mCMV promoter comprising or consisting of a sequence of SEQ ID NO: 14, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription; (c) a heterologous polynucleotide encoding IBDV VP2 antigen, e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 6, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 6; (d) a stop codon, e.g., SEQ ID NO: 58; (e) an optimized IRES, e.g., an IRES of the present invention; (f) a heterologous polynucleotide encoding ILTV gD antigen, e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 12, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 12; and (g) a combination of a novel bidirectional artificial polyA signal motif and an MDV39 / 40-intergenic bidirectional polyA signal motif in tandem, e.g., a combination of a novel bidirectional artificial polyA signal motif of the present invention and an MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention in tandem; (h) an FRT site; and (i) an artificial reverse tandem polyA signal motif, e.g., an artificial reverse tandem polyA signal motif of the present invention.

[0279] In some even more particular embodiments, Expression Cassette 3 comprises or consists of SEQ ID NO: 33.

[0280] In some particular embodiments, the present invention provides a recombinant MDV comprising Expression Cassette 3, preferably inserted at the insertion site between UL55 and MDV71 genes of the MDV genome as described above.

[0281] In a preferred particular embodiment, the present invention provides Expression Cassette 4, which comprises a heterologous polynucleotide coding for and expressing an nVar IBDV VP2 antigen, optionally codon-optimized, of the present invention. In some more preferred embodiments, the heterologous polynucleotide encodes the IBDV VP2 antigen is followed by a backup stop codon. In some more preferred embodiments, Expression Cassette r expresses in the forward orientation when inserted into the MDV genome, i.e., same with the orientation of UL26 and UL55. In some more preferred embodiments, Expression Cassette 4 further comprises a polyA signal motif and a promoter operably linked to the heterologous polynucleotide. In some more preferred embodiments, Expression Cassette 4 comprises polyA signal motifs at both ends of the cassette, thereby promoting the transcriptional termination of the nVar IBDV VP2 gene in the cassette and blocking the expression of the genes flanking the cassette. In some more preferred embodiments, Expression Cassette 4 further comprises a recognition site of site-specific recombinases, e.g., a recognition site of Flp recombinase, a recognition site of CRE / lox recombinase, a recognition site of PHIC31 recombinase, a recognition site of DRE recombinase, a recognition site of VIKA recombinase, and the like. In some more preferred embodiments, said promoter is a murine cytomegalovirus IE1 gene promoter (mCMV promoter) , e.g., as defined above. In some even more particular embodiments, Expression Cassette 4 comprises or consists essentially of or consists of from the 5’ end an artificial reverse tandem polyA signal motif of the present invention, an FRT site which is a scar sequence, an mCMV promoter as defined above, a codon-optimized nVar IBDV VP2 gene, an optimized IRES of the present invention, a wildtype ILTV gD gene, and a novel bidirectional artificial polyA signal motif of the present invention and the MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention in tandem.

[0282] In some even more particular embodiments, Expression Cassette 4 comprises or consists of in 5’ to 3’ direction and in this order: (a) an artificial reverse tandem polyA signal motif, e.g., an artificial reverse tandem polyA signal motif of the present invention; (b) an FRT site; (c) an mCMV promoter, e.g., an mCMV promoter comprising or consisting of a sequence of SEQ ID NO: 14, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription; (d) a heterologous polynucleotide encoding IBDV VP2 antigen, e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 9 or 10, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 9 or 10; and (e) a combination of a novel bidirectional artificial polyA signal motif and an MDV39 / 40-intergenic bidirectional polyA signal motif in tandem, e.g., a combination of a novel bidirectional artificial polyA signal motif of the present invention and an MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention in tandem.

[0283] In some even more particular embodiments, Expression Cassette 4 comprises or consists of SEQ ID NO: 34.

[0284] In some particular embodiments, the present invention provides a recombinant MDV comprising Expression Cassette 4, preferably inserted at the insertion site between UL55 and MDV71 genes of the MDV genome as described above.

[0285] In a preferred particular embodiment, the present invention provides Expression Cassette 5, which comprises a heterologous polynucleotide coding for and expressing an NDV F antigen, optionally codon-optimized, of the present invention. In some more preferred embodiments, the amino acid sequence at the protease cleavage site of the NDV F antigen has been mutated. In some more preferred embodiments, the heterologous polynucleotide encodes the NDV F antigen is followed by a backup stop codon. In some more preferred embodiments, Expression Cassette 5 expresses in the reverse orientation when inserted into the MDV genome, i.e., same with the orientation of UL27. In some more preferred embodiments, Expression Cassette 5 further comprises an UL26.5 gene promoter, which is thus homologous but exogenously introduced, operably linked to the heterologous polynucleotide coding the NDV F antigen. In some more preferred embodiments, Expression Cassette 5 further comprises a Kozak sequence. In some more preferred embodiments, Expression Cassette 5 comprises a polyadenylation signal core sequence. In some more preferred embodiments, Expression Cassette 5 comprises polyA signal motifs at 3; or both ends of the cassette, thereby promoting the transcriptional termination of the NDV F gene in the cassette and blocking the expression of the genes flanking the cassette. In some even more particular embodiments, Expression Cassette 5 comprises or consists essentially of or consists of a novel bidirectional artificial polyA signal motif of the present invention, an UL26.5 gene promoter as defined above, a Kozak sequence, a heterologous polynucleotide coding for and expressing an NDV F antigen, a polyadenylation signal core sequence, and MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention.

[0286] In some even more particular embodiments, Expression Cassette 5 comprises or consists of in 5’ to 3’ direction and in this order: (a) a novel bidirectional artificial polyA signal motif, e.g., a novel bidirectional artificial polyA signal motif of the present invention; (b) an exogenous promoter same with an MDV endogenous UL26.5 promoter, e.g., a promoter comprises or consists of a sequence of SEQ ID NO: 20, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 20 and can bind an RNA polymerase to initiate transcription; (c) a Kozak sequence; (d) a heterologous polynucleotide encoding cleavage site-mutated NDV F, e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 4, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 4; (e) a polyadenylation signal core sequence, e.g., SEQ ID NO: 61; and (f) an MDV39 / 40-intergenic bidirectional polyA signal motif, e.g., an MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention.

[0287] In some even more particular embodiments, Expression Cassette 5 comprises or consists of SEQ ID NO: 35.

[0288] In some particular embodiments, the present invention provides a recombinant MDV comprising Expression Cassette 5, preferably inserted at the novel insertion site of the present invention.

[0289] In one or more embodiments, the present invention provides recombinant MDV comprising one or more of the above-described expression cassettes of the present invention.

[0290] In one or more embodiments, the present invention provides recombinant MDV comprising one of the above-described expression cassettes of the present invention inserted at the novel insertion site of the present invention.

[0291] In one or more embodiments, the present invention provides recombinant MDV comprising one of the above-described expression cassettes of the present invention inserted at a different insertion site than the novel insertion site of the present invention. In a preferred embodiment, the insertion site is the intergenic region between UL55 and MDV71 genes.

[0292] In one or more embodiments, the present invention provides recombinant MDV comprising two or more of the above-described expression cassettes of the present invention, preferably inserted at two different insertion sites. In some preferred embodiments, a first expression cassette is inserted at the novel insertion site of the present invention, and a second expression cassette is inserted at the following insertion site of the MDV genome: the intergenic region between UL55 and MDV71 genes, the intergenic region between UL3 and UL4 genes, the intergenic region between UL22 and UL23 genes, the intergenic region between UL44 and UL45 genes, the intergenic region between UL45 and UL46 genes, the intergenic region between UL48 and UL49 genes, the intergenic region between UL54 and MDV69 genes, the IG2 region, the intergenic region between US10 and US1 genes, the intergenic region between SORF3 and US2 genes, the US2 locus, the US6 locus, the US7 locus, the US8 locus, the US10 locus, and the intergenic region between US10 and SORF3 genes, preferably the intergenic region between UL55 and MDV71 genes.

[0293] In one particular embodiment, the present invention provides a recombinant HVT rHVT-nVarIBD (clone codename of the strain: HVT14) .

[0294] As shown in Table 1 and Figure 2, Exemplary Expression Cassette 4 is inserted into the intergenic sequence between HVT065 (UL55) and HVT066 (MDV71) in the UL region of the HVT genome, thereby constructing strain HVT14.

[0295] In HVT14, the insertion site is between the sequence 112048bp-tatatgttattaaataaaataattgaccagtgaacaattt -112087bp (SEQ ID NO: 27) and 112088bp-gtttaatgttagtttattcaatgcattggttgcaaatatt-112127bp (SEQ ID NO: 28) of the HVT genome (Genbank accession ID: NC_002641) .

[0296] Exemplary Expression Cassette 4 (SEQ ID NO: 34) consists essentially of an artificial reverse tandem polyA signal motif (SEQ ID NO: 34, 1-50bp, i.e., SEQ ID NO: 16) , an FRT site sequence which is a sequence scar left by the elimination of BAC vector (SEQ ID NO: 34, 51-84bp, i.e., SEQ ID NO: 30) , an mCMV promoter (SEQ ID NO: 34, 85-1505bp, i.e., SEQ ID NO: 14) , a codon-optimized nVar IBDV VP2 gene (SEQ ID NO: 34, 1506-2867bp, i.e., SEQ ID NO: 10) , and a novel bidirectional artificial polyA signal motif (SEQ ID NO: 34, 2868-2916bp, i.e., SEQ ID NO: 17) and the MDV39 / 40-intergenic bidirectional polyA signal motif (SEQ ID NO: 34, 2917-2986bp, i.e., SEQ ID NO: 19) in tandem.

[0297] According to experimental data not shown herein, the codon-optimized nVar IBDV VP2 gene could be replaced by wildtype / codon-optimized nVar IBDV VP2 gene or vv IBDV VP2 gene, e.g., SEQ ID NO: 6, 7 or 10.

[0298] Table 1. Elements of Exemplary Expression Cassette 4

[0299] In one particular embodiment, the present invention provides a recombinant HVT rHVT-ND (clone codename of the strain: HVT15) .

[0300] As shown in Table 2 and Figure 1, Exemplary Expression Cassette 1 is inserted into the intergenic sequence between HVT033 (UL26) and HVT035 (UL27) genes in the UL region of the HVT genome, thereby constructing strain HVT15.

[0301] In HVT15, the insertion site is between the sequence 52408bp-tttattagccacatgatgacccatcgctga-52437bp (SEQ ID NO: 23) and 52438bp-aaagcggtgtgttaatgtcagagagctgta-52467bp (SEQ ID NO: 24) of the HVT genome (Genbank accession ID: NC_002641) .

[0302] Exemplary Expression Cassette 1 (SEQ ID NO: 31) does not comprise any promoter sequence. Upon insertion into the genome, Exemplary Expression Cassette 1 would be operably linked to and driven by endogenous HVT033 promoter (SEQ ID NO: 21) and endogenous HVT034 promoter (SEQ ID NO: 20) together, and the transcription would be terminated by endogenous HVT033 / HVT034 polyA signal motif (SEQ ID NO: 22) which is also operably linked to Exemplary Expression Cassette 1. The heterologous NDV F gene would be co-transcribed with HVT033 and HVT034 to obtain one multicistronic messenger RNA.

[0303] Exemplary Expression Cassette 1 consists essentially of a codon-optimized NDV F gene (SEQ ID NO: 31, 632-2293bp, i.e., SEQ ID NO: 4) and a stop codon (SEQ ID NO: 31, 1-3 bp, i.e., SEQ ID NO: 57) + an Encephalomyocarditis Virus (EMCV) -derived optimized IRES (SEQ ID NO: 31, 4-631bp, i.e., SEQ ID NO: 15) upstream to the NDV F gene, wherein the NDV F antigen comprise a mutated amino acid sequence of the protease cleavage site. The IRES element would initiate the translation and obtain the expected NDV F antigen protein (SEQ ID NO: 1) .

[0304] According to experimental data not shown herein, the codon-optimized gene of cleavage site-mutated NDV F could be replaced by other NDV F gene derived from the wildtype, or codon-optimized, e.g., SEQ ID NO: 2 or 3.

[0305] Table 2. Elements of Exemplary Expression Cassette 1

[0306] In one particular embodiment, the present invention provides a recombinant HVT rHVT-IBD-ILT (clone codename of the strain: HVT22) .

[0307] As shown in Table 3 and Figure 3, Exemplary Expression Cassette 2 is inserted at the preferable second insertion site, i.e., the intergenic sequence between HVT065 (UL55) and HVT066 (MDV71) in the UL region of the HVT genome, thereby constructing strain HVT22. The insertion site is between the sequence 112048bp-tatatgttattaaataaaataattgaccagtgaacaattt -112087bp (SEQ ID NO: 27) and 112088bp-gtttaatgttagtttattcaatgcattggttgcaaatatt-112127bp (SEQ ID NO: 28) of the HVT genome (Genbank accession ID: NC_002641) .

[0308] Exemplary Expression Cassette 2 (SEQ ID NO: 32) consists essentially of an artificial reverse tandem polyA signal motif (SEQ ID NO: 32, 1-50bp, i.e., SEQ ID NO: 16) , an FRT site sequence which is a scar sequence left by the elimination of BAC vector (SEQ ID NO: 32, 51-84bp, i.e., SEQ ID NO: 30) , an mCMV promoter (SEQ ID NO: 32, 85-1505bp, i.e., SEQ ID NO: 14) , a codon-optimized vv IBDV VP2 gene (SEQ ID NO: 32, 1506-2867bp, i.e., SEQ ID NO: 7) , a (backup) stop codon (SEQ ID NO: 32, 2868-2870bp, i.e., SEQ ID NO: 58) , an EMCV-derived optimized IRES (SEQ ID NO: 32, 2871-3498bp, i.e., SEQ ID NO: 14) , a wildtype ILTV gD gene (SEQ ID NO: 32, 3499-4803bp, i.e., SEQ ID NO: 12) and a novel bidirectional artificial polyA signal motif (SEQ ID NO: 32, 4804-4852bp, i.e., SEQ ID NO: 17) and the MDV39 / 40-intergenic bidirectional polyA signal motif (SEQ ID NO: 32, 4853-4922bp, i.e., SEQ ID NO: 19) in tandem.

[0309] According to experimental data not shown herein, the codon-optimized vv IBDV VP2 gene could be replaced by wildtype / codon-optimized nVar IBDV VP2 gene or vv IBDV VP2 gene, e.g., SEQ ID NO: 6, 9 or 10; the wildtype ILTV gD gene could be replaced by codon-optimized ILTV gD gene, e.g., SEQ ID NO: 13.

[0310] Table 3. Elements of Exemplary Expression Cassette 2

[0311] In one particular embodiment, the present invention provides a multivalent recombinant HVT rHVT-ND-IBD-ILT (clone codename of the strain: HVT35) .

[0312] Exemplary Expression Cassette 1, identical with that in HVT15, and Exemplary Expression Cassette 2, identical with that in HVT22, are inserted at two different sites in the UL region of the HVT genome, respectively, thereby constructing strain HVT35, which expresses three heterologous antigens (see Figure 4) .

[0313] Exemplary Expression Cassette 1 consists of the same elements and nucleic acid sequences as Exemplary Expression Cassette 1 in HVT15, and is also inserted at the same site.

[0314] Exemplary Expression Cassette 2 consists of the same elements and nucleic acid sequences as Exemplary Expression Cassette 2 in HVT22, and is also inserted at the same site.

[0315] In one particular embodiment, the present invention provides a multivalent recombinant HVT rHVT-ND-IBD-ILT (clone codename of the strain: HVT38) .

[0316] Exemplary Expression Cassette 1 and Exemplary Expression Cassette 3 are inserted at two different sites in the UL region of the HVT genome, respectively, thereby constructing strain HVT38, which expresses three heterologous antigens (see Figure 5) .

[0317] Exemplary Expression Cassette 1 consists of the same elements and nucleic acid sequences as Exemplary Expression Cassette 1 in HVT15 and HVT35, and is also inserted at the same site.

[0318] As shown in Table 4, Exemplary Expression Cassette 3 is also inserted at the same site where Exemplary Expression Cassette 2 is inserted in HVT22 and HVT35. However, Exemplary Expression Cassette 3 expressed in an opposite orientation, that is, Exemplary Expression Cassette 3 lies in the complementary strand of Exemplary Expression Cassette 2.

[0319] Exemplary Expression Cassette 3 (SEQ ID NO: 33) consists essentially of an MDV CVI988 MDV89 gene polyA signal motif (SEQ ID NO: 33, 1-110bp, i.e., SEQ ID NO: 14) , an mCMV promoter (SEQ ID NO: 33, 111-1531bp, i.e., SEQ ID NO: 14) , a wildtype vv IBDV VP2 gene (SEQ ID NO: 33, 1532-2893bp, i.e., SEQ ID NO: 6) , a (backup) stop codon (SEQ ID NO: 33, 2894-2896bp, i.e., SEQ ID NO: 58) , an EMCV-derived optimized IRES (SEQ ID NO: 33, 2897-3524bp, i.e., SEQ ID NO: 15) , a wildtype ILTV gD gene (SEQ ID NO: 33, 3525-4829bp, i.e., SEQ ID NO: 12) , a novel bidirectional artificial polyA signal motif (SEQ ID NO: 33, 4830-4878bp, i.e., SEQ ID NO: 17) and the MDV39 / 40-intergenic bidirectional polyA signal motif (SEQ ID NO: 33, 4879-4948bp, i.e., SEQ ID NO: 19) in tandem, an FRT site sequence which is a scar sequence left by the elimination of BAC vector (SEQ ID NO: 33, 4949-4982bp, i.e., complementary to SEQ ID NO: 30) and an artificial reverse tandem polyA signal motif (SEQ ID NO: 33, 4983-5032bp, i.e., complementary to SEQ ID NO: 16) .

[0320] According to experimental data not shown herein, the wildtype vv IBDV VP2 gene could be replaced by wildtype / codon-optimized nVar IBDV VP2 gene or vv IBDV VP2 gene, e.g., SEQ ID NO: 7, 9 or 10; the wildtype ILTV gD gene could be replaced by codon-optimized ILTV gD gene, e.g., SEQ ID NO: 13.

[0321] Table 4. Elements of Exemplary Expression Cassette 3

[0322] In one particular embodiment, the present invention provides a multivalent recombinant HVT rHVT-ND-IBD-ILT (clone codename of the strain: HVT39) .

[0323] Exemplary Expression Cassette 5 and Exemplary Expression Cassette 3 are inserted at two different sites in the UL region of the HVT genome, respectively, thereby constructing strain HVT39, which expresses three heterologous antigens (see Figure 6) .

[0324] Exemplary Expression Cassette 3 consists of the same elements and nucleic acid sequences as Exemplary Expression Cassette 3 in HVT38, and is also inserted at the same site and expresses in the same orientation.

[0325] As shown in Table 5, Exemplary Expression Cassette 5 is also inserted at the same site where Exemplary Expression Cassette 1 is inserted in HVT15, and expresses the same antigen with Exemplary Expression Cassette 1. However, Exemplary Expression Cassette 5 expressed in an opposite orientation that is, Exemplary Expression Cassette 5 lies in the complementary strand of Exemplary Expression Cassette 1. Moreover, rather than getting co-transcribed with UL27gene, the NDV F gene in Exemplary Expression Cassette 5 is expressed separately instead, by the regulation of an exogenous promoter, which has a same sequence with endogenous UL26.5 promoter, preferably.

[0326] Exemplary Expression Cassette 5 (SEQ ID NO: 35) consists essentially of a novel bidirectional artificial polyA signal motif (SEQ ID NO: 35, 1-49bp, i.e., complementary to SEQ ID NO: 17) , an UL26.5 gene promoter (SEQ ID NO: 35, 50-636bp, i.e., SEQ ID NO: 20) , a Kozak sequence (SEQ ID NO: 35, 637-642bp, i.e., SEQ ID NO: 60) , a codon-optimized gene of cleavage site-mutated NDV F (SEQ ID NO: 35, 643-2304bp, i.e., SEQ ID NO: 4) , a polyadenylation signals core sequence (SEQ ID NO: 35, 2305-2309bp, i.e., SEQ ID NO: 61) , and an MDV39 / 40-intergenic bidirectional polyA signal motif (SEQ ID NO: 35, 2310-2379bp, i.e., complementary to SEQ ID NO: 19) .

[0327] According to experimental data not shown herein, the codon-optimized gene of cleavage site-mutated NDV F could be replaced by other NDV F gene derived from the wildtype, or codon-optimized, e.g., SEQ ID NO: 2 or 3. However, as compared to other promoters, the exogenous UL26.5 promoter confers a better expression efficiency.

[0328] Table 5. Elements of Exemplary Expression Cassette 5

[0329] In one particular embodiment, the present invention provides a multivalent recombinant HVT rHVT-ND-IBD-ILT (clone codename of the strain: HVT310) .

[0330] Exemplary Expression Cassette 5 and Exemplary Expression Cassette 2’ are inserted at two different sites in the UL region of the HVT genome, respectively, thereby constructing strain HVT310, which expresses three heterologous antigens (see Figure 7) .

[0331] Exemplary Expression Cassette 5 consists of the same elements and nucleic acid sequences as Exemplary Expression Cassette 5 in HVT39, and is also inserted at the same site.

[0332] Exemplary Expression Cassette 2’ consists of almost the same elements as Exemplary Expression Cassette 2 in HVT22, and is also inserted at the same site. The only difference between Exemplary Expression Cassette 2’ and 2 is that the former comprises SEQ ID NO: 6 as the vv IBDV VP2 gene instead of SEQ ID NO: 7 in the latter.

[0333] In some preferred embodiments of the recombinant MDVs and expression cassettes of the present invention, a stop codon is introduced therein. It follows and be downstream to a gene ORF, and sometimes it is 5’ upstream to, preferably 5’ flanking an IRES element ( “stop codon+IRES” ) , or a self-cleavage peptide-coding sequence (such as 2A-coding sequence) . Such an extra stop codon, in relative to the real stop codon in the gene ORF, is expected to be present downstream of genes to act as a backup in case of read-through of the real stop codon. A term “backup stop codon” may be used to name such a stop codon in view of its potential function. Not intended to be limited theoretically, translation read-through of the real stop codon, although rare, would be more disadvantageous for a multicistronic mRNA once happens. Therefore, a backup stop codon may be introduced and is hypothesized to be useful.

[0334] The recombinant MDV according to the invention can be amplified by common techniques, preferably by replication in vitro, e.g. in cultures of avian cells, typically primary chicken embryo fibroblast cells (CEF) . These can be prepared by trypsin isolation of chicken embryos, all well-known in the art. The CEF are plated in monolayers and infected with the recombinant MDV. This process can be scaled up to industrial size production.

[0335] In one aspect, the present invention provides virus particles, which comprises any one of recombinant MDVs of the present invention as described above, encapsulated by the protein coat.

[0336] Therefore, in a further aspect, the invention relates to a host cell comprising the recombinant MDV according to the invention. A “host cell” for the invention, is a cell that is susceptible to infection and replication by an HVT. Examples of such cells are avian cells, and in particular lymphocytes or fibroblasts.

[0337] Preferably the host cell according to the invention is a host cell kept under in vitro conditions.

[0338] In an embodiment, the host cell according to the invention is a primary avian cell.

[0339] In an embodiment the primary avian host cell for the invention is a primary chicken embryo fibroblast (CEF) .

[0340] As described, the main advantageous use of the recombinant MDV according to the invention is in a vaccine for poultry, providing a safe, stable and effective vaccination against MD, IBD, ND and / or ILT or associated signs of disease, and can be administered to poultry at a very young age.

[0341] Therefore, a further aspect of the invention relates to the recombinant MDV according to the invention, and / or to the host cell according to the invention, for use in a vaccine for poultry.

[0342] Different ways of a ‘use in a vaccine’ of the recombinant MDV or of the host cell, both according to the invention, have been outlined above, and comprise the use as cell-free virus or as cell-associated virus in a host cell, in a vaccine composition for inoculation of poultry.

[0343] Also, in a further aspect the invention relates to a vaccine for poultry comprising the recombinant MDV according to the invention and / or the host cell according to the invention, and a pharmaceutically acceptable carrier.

[0344] In one aspect, the present invention provides a composition or vaccine comprising any one of recombinant MDVs of the present invention as described above, optionally further comprising a pharmaceutically or veterinarily acceptable carrier, excipient, vehicle or adjuvant.

[0345] In an embodiment the vaccine for poultry according to the invention is a cell-associated vaccine. “Cell-associated” means that the recombinant MDV according to the invention is comprised in host cells in vitro, according to the invention. Consequently a vaccine of this type comprises both the host cells as well as the recombinant MDV, both according to the invention.

[0346] In some embodiments for the present invention, the vaccine is in the form of cell-associated MDV, and the pharmaceutically acceptable carrier is preferably a mixture of culture medium, serum, and DMSO. This carrier also provides for the stabilization of the recombinant MDV-infected host cells during freezing and frozen storage. The serum can be any serum routinely used for cell culturing such as foetal-or new-born calf serum. The vaccine according to the invention is prepared from an recombinant MDV according to the invention by methods as described herein, which are readily applicable by a person skilled in the art. For example, the recombinant MDV according to the invention is constructed by insertion of the expression cassettes as described for the invention by transfection and recombination. Next the desired recombinant MDV is selected, and is amplified industrially in smaller or larger volumes, preferably in in vitro cell cultures, e.g. in CEF. From such cultures a suspension of host cells infected with the recombinant MDV is harvested, either as whole infected cells or as a cell-free preparation obtained by cell-disruption. This suspension is formulated into a vaccine with a suitable pharmaceutical carrier, and the final product is packaged. Cell-associated vaccine is then stored in liquid nitrogen, and freeze-dried vaccine at -20 or at +4 ℃.

[0347] The present invention also provides a combination comprising the recombinant MDV, the virus particles, the host cells, and / or the composition or vaccine of the present invention, wherein the combination further comprises other agents. It can be advantageous to make further combinations with additional immunoactive components. This can serve to enhance the immune protection already provided, or to expand it to other pathogens.

[0348] In one aspect, the present invention provides use of any one of recombinant MDVs of the present invention as described above in the manufacture of vaccines vaccinating, or inducing an immune or protective response in an animal against one or more avian pathogens.

[0349] In one aspect, the present invention provides the vaccine of the present invention for use in vaccinating an avian species against one or more diseases caused by one or more avian pathogens, preferably against Marek's disease and one or more diseases caused by one or more avian pathogens. In one embodiment the one or more diseases are caused by one or more of infectious bursal disease virus (IBDV) , infectious laryngotracheitis virus (ILTV) , and / or Newcastle disease virus (NDV) . The vaccine is further provided for use in protecting an avian species against clinical symptoms caused by one or more avian pathogens, preferably against clinical symptoms caused by Marek's disease virus and clinical symptoms caused by one or more avian pathogens. In one embodiment the one or more avian pathogen causing the diseases or clinical symptoms is selected from the group consisting of Newcastle disease virus, infectious bursal disease virus and avian infectious laryngotracheitis virus.

[0350] The avian species may be poultry, preferably the avian species is chicken, duck, goose, turkey, quail, guinea or pigeon, more preferably the avian species is turkey or chicken, even more preferably chicken. The vaccine according to the invention may be administered by spray administration, in ovo, subcutaneously, intramuscularly, orally or nasally. In a particular embodiment the vaccine is administered in ovo preferably in ovo in 18 day old embryonated eggs. In an alternative embodiment the vaccine is administered in subcutaneously or intramuscularly in chicks, preferably in 1 day old chicks.

[0351] In one aspect, the present invention provides a method of vaccinating, or inducing an immune or protective response in an animal against one or more avian pathogens, at least one administration of recombinant MDVs, the virus particles, compositions, or vaccines of the present invention. In some particular embodiments, the the avian pathogen is selected from the group consisting of Newcastle Disease Virus (NDV) , Infectious Bursal Disease Virus (IBDV) , Infectious Laryngotracheitis Virus (ILTV) , avian encephalomyelitis virus, avian reovirus, avian paramyxovirus, avian metapneumovirus, avian adenovirus, fowl pox virus, avian coronavirus, avian rotavirus, avian parvovirus, avian astrovirus and chick anemia virus coccidiosis (Eimeria sp. ) , Campylobacter sp., Salmonella sp., Mycoplasma gallisepticum, Mycoplasma synoviae, Pasteurella sp., Avibacterium sp., E. coli and Clostridium sp.

[0352] Therefore, the present invention provides vaccines based on the recombinant MDVs of the present invention. Not intended to be limited theoretically, the vaccines provide a multivalent immunity: against IBD, ND, and ILT by the expression of the heterologous inserts, and in addition against MD by the HVT vector itself, therefore, the vaccines could prevent four epidemics, when used to immunizing poultry: the HVT itself protects against Marek's disease (MD) caused by Marek's disease virus (MDV) , the expressed NDV F protects against Newcastle disease (ND) caused by Newcastle disease virus (NDV) , the expressed IBDV VP2 protects against Infectious bursal disease (IBD) caused by Infectious Bursal Disease Virus (IBDV) , and the expressed ILTV gD protects against chicken infectious laryngotracheitis (ILT) caused by chicken Infectious Laryngotracheitis Virus (ILTV) .

[0353] Variants include allelic variants. The term "allelic variant" refers to a polynucleotide or a polypeptide containing polymorphisms that lead to changes in the amino acid sequences of a protein and that exist within a natural population (e.g., a virus species or variety) . Such natural allelic variations can typically result in 1-5%variance in a polynucleotide or a polypeptide. Allelic variants can be identified by sequencing the nucleic acid sequence of interest in a number of different species, which can be readily carried out by using hybridization probes to identify the same gene genetic locus in those species. Any and all such nucleic acid variations and resulting amino acid polymorphisms or variations that are the result of natural allelic variation and that do not alter the functional activity of gene of interest, are intended to be within the scope of the invention.

[0354] The term "identity" with respect to sequences can refer to, for example, the number of positions with identical nucleotides or amino acids divided by the number of nucleotides or amino acids in the shorter of the two sequences wherein alignment of the two sequences can be determined in accordance with the Wilbur and Lipman algorithm (Wilbur and Lipman) . The sequence identity or sequence similarity of two amino acid sequences, or the sequence identity between two nucleotide sequences can be determined using Vector NTI software package (Invitrogen, 1600 Faraday Ave., Carlsbad, CA) . When RNA sequences are said to be similar, or have a degree of sequence identity or homology with DNA sequences, thymidine (T) in the DNA sequence is considered equal to uracil (U) in the RNA sequence. Thus, RNA sequences are within the scope of the invention and can be derived from DNA sequences, by thymidine (T) in the DNA sequence being considered equal to uracil (U) in RNA sequences.

[0355] The terms "identical" or "percent identity, " in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60%identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., the NCBI web site found at https:  / / blast. ncbi. nlm. nih. gov / Blast. cqi or the like) . Such sequences are then referred to as "substantially identical. " This definition also refers to, or applies to, the compliment of a particular sequence. The definition may also include sequences that have deletions, additions, and / or substitutions.

[0356] For sequence comparison, one sequence typically serves as a reference sequence, to which other sequences are compared. When using a sequence comparison algorithm, reference and comparison sequences may be entered into a computer, and sequence algorithm program parameters are selected as desired. Percent sequence identities are then generated for the comparison sequences relative to the reference sequence, based on the parameters selected. An example of an algorithm that may be suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., (Nuc Acids Res 25: 3389-3402, 1977) and Altschul et al., (J Mol Biol 215: 403-410, 1990) , respectively. BLAST and BLAST 2.0 are well known in the art and may be used to determine percent sequence identity for any nucleic acids or proteins, such as those described herein. When RNA sequences are said to be similar, or have a degree of sequence identity or homology with DNA sequences, thymidine (T) in the DNA sequence is considered equal to uracil (U) in the RNA sequence. Thus, RNA sequences are within the scope of the invention and can be derived from DNA sequences, by thymidine (T) in the DNA sequence being considered equal to uracil (U) in RNA sequences.

[0357] The polynucleotides of the disclosure include sequences that are degenerate as a result of the genetic code, e.g., optimized codon usage for a specific host. As used herein, "optimized" refers to a polynucleotide that is genetically engineered to increase its expression in a given species. To provide optimized polynucleotides coding for NDV F, IBDV VP2 or ILTV gD polypeptides, the DNA sequence of these genes can be modified to 1) comprise codons preferred by highly expressed genes in a particular species; 2) comprise an A+T or G+C content in nucleotide base composition to that substantially found in said species; 3) form an initiation sequence of said species; or 4) eliminate sequences that cause destabilization, inappropriate polyadenylation, degradation and termination of RNA, or that form secondary structure hairpins or RNA splice sites. Increased expression of NDV F, IBDV VP2 or ILTV gD protein in said species can be achieved by utilizing the distribution frequency of codon usage in eukaryotes and prokaryotes, or in a particular species. The term "frequency of preferred codon usage" refers to the preference exhibited by a specific host cell in usage of nucleotide codons to specify a given amino acid. There are 20 natural amino acids, most of which are specified by more than one codon. Therefore, all degenerate nucleotide sequences are included in the disclosure as long as the amino acid sequence of the NDV F, IBDV VP2 or ILTV gD polypeptide encoded by the nucleotide sequence is functionally unchanged.

[0358] Methods for producing a recombinant MDV

[0359] The recombinant MDVs of the present invention could be constructed by any molecular cloning methods and / or recombination methods that are commonly known in the art, only if constructs with a same or similar structures are produced, wherein each element is operably linked in a predetermined order and functions as expected.

[0360] In some particular embodiments, the present invention provides a method of construction of recombinant herpes virus, comprising:

[0361] (1) constructing infectious clones of said recombinant herpes virus in E. coli by recombineering, wherein the genome of said recombinant herpes virus carries a vector comprising replicons and screening tags in E. coli, and wherein the vector is linked to FRT sites at its both ends,

[0362] (2) eliminating the vector sequence by the recombination between the two FRT sites mediated by FLP recombinase in E. coli expressing FLP recombinase, to obtain the circular genome of the recombinant herpes virus,

[0363] (3) infecting susceptible cells using the circular genome of the recombinant herpes virus, and then rescuing the recombinant herpes virus to obtain a pure culture.

[0364] In some more particular embodiments, the present invention provides a method of construction of recombinant herpes virus, comprising:

[0365] (1) constructing infectious clones of said recombinant herpes virus in E. coli by recombineering, wherein the genome of said recombinant herpes virus carries a BAC vector with FRT sites linked to its both ends,

[0366] (2) eliminating the BAC vector sequence by the recombination between the two FRT sites mediated by FLP recombinase in E. coli expressing FLP recombinase, to obtain the circular genome of the recombinant herpes virus,

[0367] (3) infecting susceptible cells using the circular genome of the recombinant herpes virus, and then rescuing the recombinant herpes virus to obtain a pure culture.

[0368] In some more particular embodiments, the BAC vector has a structure as follows:

[0369] (1) Site-specific recombinase recognition sites in the same direction, such as the FRT site recognized by Flp recombinase, are introduced into both flanks for deletion of the BAC vector at the completion of subsequent cloning. For example, one FRT site is integrated at one end or flank of the BAC vector, and the other FRT site in the same direction is provided by the expression cassette which would be inserted in to the same region, preferably quite or immediately close to the BAC vector sequence. Alternatively, two FRT sites in the same direction are integrated into both ends or flanks of the BAC vector, respectively.

[0370] Thereby the BAC vector sequence is or is designed to be sandwiched by the two FRT sites.

[0371] (2) an expression cassette of a resistance gene -gpt gene, for screening and purification of recombinant virus, is inserted;

[0372] (3) Optional structural reduction: for example, on the basis of any known or conventionally used BAC vector, deleting the cos sequence, the wild-type loxP sequence and the lacZ gene expression cassette, that are not needed.

[0373] Also provided is a method of producing a recombinant MDV comprising (a) providing an MDV, (b) inserting one or more heterologous polynucleotide (s) coding for and expressing at least one antigen of an avian pathogen into the intergenic loci between UL26 and UL27 genes and / or between UL55 and MDV71 genes of the MDV genome, and optionally (c) amplifying the MDV comprising one or more heterologous polynucleotide (s) coding for at least one antigen of an avian pathogen of step (b) .

[0374] The present invention further provides a method for producing a recombinant MDV comprising the introduction of one, two or more polynucleotides into the intergenic loci between UL26 and UL27 genes and / or between UL55 and MDV71 genes of the MDV genome, wherein the MDV is preferably an HVT.

[0375] The pharmaceutically or veterinarily acceptable carriers or adjuvant or vehicles or excipients are well known to the one skilled in the art. For example, a pharmaceutically or veterinarily acceptable carrier or adjuvant or vehicle or excipient can be Marek's disease vaccine diluent used for MD vaccines. Other pharmaceutically or veterinarily acceptable carrier or adjuvant or vehicle or excipients that can be used for methods of this invention include, but are not limited to, 0.9%NaCl (e.g., saline) solution or a phosphate buffer, poly- (L-glutamate) , the Lactated Ringer's Injection diluent (sodium chloride, sodium lactate, potassium chloride and calcium chloride) , or polyvinylpyrrolidone. The pharmaceutically or veterinarily acceptable carrier or vehicle or adjuvant or excipients may be any compound or combination of compounds facilitating the administration of the vector (or protein expressed from an inventive vector in vitro) , or facilitating transfection or infection and / or improve preservation of the vector (or protein) . Doses and dose volumes are herein discussed in the general description and can also be determined by the skilled artisan from this disclosure read in conjunction with the knowledge in the art, without any undue experimentation.

[0376] Optionally other compounds may be added as pharmaceutically or veterinarily acceptable carriers or adjuvants or vehicles or excipients, including, but not limited to, alum; CpG oligonucleotides (ODN) , in particular ODN 2006, 2007, 2059, or 2135 (Pontarollo R. A. et al, Vet. Immunol. Immunopath, 2002, 84: 43-59; Wernette CM. et al., Vet. Immunol. Immunopath, 2002, 84: 223-236; Mutwiri G. et al., Vet. Immunol. Immunopath, 2003, 91 : 89-103) ; polyA-polyU, dimethyldioctadecylammonium bromide (DDA) ( "Vaccine Design The Subunit and Adjuvant Approach" , edited by Michael F. Powell and Mark J. Newman, Pharmaceutical Biotechnology, 6: p. 03, p. 157) ; N, N-dioctadecyl-N', N'-bis (2-hydroxyethyl) propanediamine (such as  ) (Ibid, p. 148) ; carbomer, chitosan (see US Patent Serial No. 5,980.912) .

[0377] The pharmaceutical compositions and vaccines according to the invention may comprise or consist essentially of one or more adjuvants. Suitable adjuvants for use in the practice of the present invention are (1) polymers of acrylic or methacrylic acid, maleic anhydride and alkenyl derivative polymers, (2) immunostimulating sequences (ISS) , such as oligodeoxyribonucleotide sequences having one or more non-methylated CpG units (Klinman et al., 1996; W098 / 16247) , (3) an oil in water emulsion, such as the SPT emulsion described on p 147 of "Vaccine Design, The Subunit and Adjuvant Approach" published by M. Powell, M. Newman, Plenum Press 1995, and the emulsion MF59 described on p 183 of the same work, (4) cation lipids containing a quaternary ammonium salt, e.g., DDA (5) cytokines, (6) aluminum hydroxide or aluminum phosphate, (7) saponin or (8) other adjuvants discussed in any document cited and incorporated by reference into the instant application, or (9) any combinations or mixtures thereof.

[0378] In one embodiment, the adjuvant may include TS6 TS7, TS8 and TS9 (US7, 371, 395) , LR2, LR3 and LR4 (US7, 691, 368) , TSAP (US20110129494) , TRIGENTM (Newport Labs) , synthetic dsRNAs (e.g. poly-IC, poly-ICLC ) , and MONTANIDETM adjuvants (W / O, W / OAV, OAV, IMS and Gel; all produced by SEPPIC) .

[0379] In another embodiment, the invention provides for the administration of a therapeutically effective amount of a vaccine or composition for the delivery of recombinant MDVs in a target cell. Determination of the therapeutically effective amount is routine experimentation for one of ordinary skill in the art.

[0380] Another aspect of the invention relates to a method for inducing an immunological response in an animal against one or more antigens or a protective response in an animal against one or more avian pathogens, which method comprises inoculating the animal at least once with the vaccine or pharmaceutical composition of the present invention. Yet another aspect of the invention relates to a method for inducing an immunological response in an animal to one or more antigens or a protective response in an animal against one or more avian pathogens in a prime-boost administration regimen, which is comprised of at least one primary administration and at least one booster administration using at least one common polypeptide, antigen, epitope or immunogen. The immunological composition or vaccine used in primary administration may be same, may be different in nature from those used as a booster.

[0381] A vaccine may generally be used for prophylactic and / or therapeutic purposes. For example, in accordance with the invention, the vaccine may be provided to a subject, such as an avian species, to vaccinate against one or more diseases caused by one or more avian pathogens. Typically, the vaccine is administered prior to infection with or exposure to an avian pathogen in order to provide protection against infection with one or more avian pathogen or development of clinical symptoms caused by one or more avian pathogen. Preferably the avian pathogen is an avian virus.

[0382] The avian pathogens may be Newcastle Disease Virus (NDV) , Infectious Bursal Disease Virus (i.e., IBDV or Gumboro Disease virus) , Infectious Laryngotracheitis Virus (ILTV) , avian encephalomyelitis virus, avian reovirus, avian paramyxovirus, avian metapneumovirus, avian adenovirus, fowl pox virus, avian coronavirus, avian rotavirus, avian parvovirus, avian astrovirus and chick anemia virus coccidiosis (Eimeria sp. ) , Campylobacter sp., Salmonella sp., Mycoplasma gallisepticum, Mycoplasma synoviae, Pasteurella sp., Avibacterium sp., E. coli or Clostridium sp.

[0383] Usually, one administration of the vaccine in avian is performed either at one day-of-age by the subcutaneous or intramuscular route or in ovo in 17-19 day-old embryo. A second administration can be done within 0-30 days after the first administration.

[0384] A variety of administration routes in day-old chicks may be used such as subcutaneously or intramuscularly, intradermally, transdermally. The in ovo vaccination can be performed in the amniotic sac and / or the embryo. Commercially available in ovo and SC administration devices can be used for vaccination.

[0385] The composition or vaccine may contain a dose from about 102 to about 1020 , about 103 to about 1020 , about 103 to about 1018 , about 104 to about 1016 recombinant virus produced in vitro or in vivo. The recombinant virus may be titrated based on any virus titration methods including, but not limited to, FFA (Focus Forming Assay) or FFU (Focus Forming Unit) , TCID50 (50%Tissue Culture Infective Dose) , PFU (Plaque Forming Units) , and FAID50 (50%Fluorescent Antibody Infectious Dose) , and the VLPs produced in vitro can be titrated by hemagglutination assay, ELISA, and electron microscopy. Other methods may also be applicable.

[0386] The composition or vaccine may contain, for example, from about 102.0 to about 107.0 PFU / dose, from about 102.0 to about 107.0 PFU / dose, from about 102.5 to about 106.5 PFU / dose, from about 103.0 to about 106.0 PFU / dose, or from about 103.5 to about 105.5 PFU / dose. The dose volumes can be between about 0.01 and about 10 ml, between about 0.01 and about 5 ml.

[0387] The present invention also provides the following exemplary embodiments:

[0388] 1. A recombinant MDV or expression cassette, comprising at least one or more heterologous polynucleotides encoding an antigen of an avian pathogen, wherein one of the heterologous polynucleotides encodes NDV F antigen and comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 3 or 4, and optionally being 3’ flanked by a backup stop codon.

[0389] 2. A recombinant MDV or expression cassette, comprising at least one or more heterologous polynucleotides encoding an antigen of an avian pathogen, wherein one of the heterologous polynucleotides encodes IBDV VP2 antigen and comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 7, 9 or 10, and optionally being 3’ flanked by a backup stop codon.

[0390] 3. A recombinant MDV or expression cassette, comprising at least one or more heterologous polynucleotides encoding an antigen of an avian pathogen, wherein one of the heterologous polynucleotides encodes ILTV gD antigen and comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 13, and optionally being 3’ flanked by a backup stop codon.

[0391] 4. A recombinant MDV or expression cassette, comprising at least one or more heterologous polynucleotides encoding an antigen of an avian pathogen, wherein a first heterologous polynucleotide encodes IBDV VP2 antigen and comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 7, 9 or 10, and optionally being 3’ flanked by a backup stop codon, and a second heterologous polynucleotide encodes ILTV gD antigen and comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 13, and optionally being 3’ flanked by a backup stop codon.

[0392] 5. A recombinant MDV or expression cassette, comprising at least one or more heterologous polynucleotides encoding an antigen of an avian pathogen, wherein the recombinant MDV vector or expression cassette further comprises one or more elements selected from the following:

[0393] (1) the optimized IRES element of the present invention,

[0394] (2) endogenous UL26 promoter of MDV, comprising or consisting of a sequence of SEQ ID NO: 21, or a sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 21 and can bind an RNA polymerase to initiate transcription;

[0395] (3) endogenous UL26.5 promoter of MDV, comprising or consisting of a sequence of SEQ ID NO: 20, or a sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 20 and can bind an RNA polymerase to initiate transcription;

[0396] (4) endogenous UL26 polyA signal of MDV, comprising or consisting of a sequence of SEQ ID NO: 22, or a sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 22;

[0397] (5) mCMV promoter, comprising or consisting of a sequence of SEQ ID NO: 14, or a sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription;

[0398] (6) the artificial reverse tandem polyA signal motif of the present invention;

[0399] (7) the novel bidirectional artificial polyA signal motif of the present invention;

[0400] (8) the MDV CVI988 MDV89 gene polyA signal motif of the present invention;

[0401] (9) the MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention.

[0402] 6. An expression cassette, comprising or consisting of in this order:

[0403] (1) a polyA signal motif or not exist;

[0404] (2) a promoter;

[0405] (3) one or more heterologous polynucleotides encoding at least one antigen of an avian pathogen;

[0406] (4) one or more polyA signal motifs in tandem,

[0407] being operably linked,

[0408] wherein, said heterologous polynucleotide (s) encodes one or two polypeptides selected from the group consisting of an IBDV VP2 antigen, an ILTV gD antigen and an NDV F antigen,

[0409] wherein the polyA signal motif of (1) , if any, could be the same or different with the polyA signal motif of (4) ,

[0410] wherein, said heterologous polynucleotide (s) are 3’ flanked by a backup stop codon,

[0411] wherein, the expression cassette could be used to insert into the genome of a recombinant MDV vector, expressing said heterologous polynucleotides in the forward orientation or the reverse orientation.

[0412] 7. The expression cassette of embodiment 5 or 6, wherein said heterologous polynucleotide encodes the IBDV VP2 antigen.

[0413] 8. The expression cassette of embodiment 6, wherein, the IBDV VP2 antigen is as defined herein, and / or the promoter is the mCMV promoter of the present invention, and / or the polyA signal motif of (1) is the artificial reverse tandem polyA signal motif of the present invention , and / or the polyA signal motifs of (4) are the novel bidirectional artificial polyA signal motif the present invention and the MDV39 / 40-intergenic bidirectional polyA signal motif the present invention, preferably in tandem.

[0414] 9. The expression cassette of embodiment 6, wherein said heterologous polynucleotide encodes the NDV F antigen, preferably, said heterologous polynucleotide is 3’ flanked by a polyadenylation signal core sequence, and / or 5’ flanked by a Kozak sequence.

[0415] 10. The expression cassette of embodiment 9, wherein, the NDV F antigen is as defined herein, and / or the promoter is exogenous and the same with the endogenous UL26.5 promoter of MDV, and / or the polyA signal motif of (1) is absent (does not exist) or the novel bidirectional artificial polyA signal motif the present invention, and / or the polyA signal motif of (4) is the MDV39 / 40-intergenic bidirectional polyA signal motif or a polyA signal motif same with the endogenous UL26 polyA signal of MDV.

[0416] 11. The expression cassette of embodiment 9 or 10, wherein the heterologous polynucleotide is expressed in the reverse orientation.

[0417] 12. The expression cassette of embodiment 6, wherein said heterologous polynucleotides encode the IBDV VP2 antigen and the ILTV gD antigen.

[0418] 13. The expression cassette of embodiment 12, wherein, the heterologous polynucleotide encoding IBDV VP2 antigen and the heterologous polynucleotide encoding ILTV gD antigen are operably linked to each other via:

[0419] an IRES element, or

[0420] a stop codon+IRES (wherein, the stop codon, TAA, TGA or TAG, is 5’ upstream to IRES, preferably directly 5’ flanking the IRES) , or

[0421] a 2A peptide-coding sequence, preferably an IRES element, or

[0422] a stop codon+ coding sequence for 2A peptide (wherein, the stop codon, TAA, TGA or TAG, is 5’ upstream to coding sequence for 2A peptide, preferably directly 5’ flanking the coding sequence for 2A peptide) .

[0423] 14. The expression cassette of embodiment 13, wherein, the IBDV VP2 antigen is as defined herein, and / or the ILTV gD antigen is as defined herein, and / or the promoter is the mCMV promoter, and / or the IRES is the optimized IRES element, and / or the polyA signal motif of (1) is the artificial reverse tandem polyA signal motif, and / or the polyA signal motifs of (4) are the novel bidirectional artificial polyA signal motif and the MDV39 / 40-intergenic bidirectional polyA signal motif.

[0424] 15. The expression cassette of embodiment 14, wherein the heterologous polynucleotide is expressed in the forward orientation.

[0425] 16. The expression cassette of embodiment 13, wherein, the IBDV VP2 antigen is as defined herein, and / or the ILTV gD antigen is as defined herein, and / or the promoter is the mCMV promoter, and / or the IRES is the optimized IRES element, and / or the polyA signal motif of (1) is the artificial reverse tandem polyA signal motif, and / or the polyA signal motifs of (4) are the novel bidirectional artificial polyA signal motif, the MDV39 / 40-intergenic bidirectional polyA signal motif and the MDV CVI988 MDV89 gene polyA signal motif,

[0426] and wherein the expression cassette comprises a nonfunctioning FRT site inserted among the polyA signal motifs of (4) .

[0427] 17. The expression cassette of embodiment 16, wherein the heterologous polynucleotide is expressed in the reverse orientation.

[0428] 18. An expression cassette, comprising or consisting of from 5’ to 3’ direction and in this order:

[0429] (1) an IRES element or a stop codon+IRES or a 2A peptide-coding sequence or a stop codon+2A peptide-coding sequence;

[0430] (2) a heterologous polynucleotide encoding an antigen of an avian pathogen;

[0431] being operably linked,

[0432] wherein, said heterologous polynucleotide encodes one polypeptide selected from the group consisting of an IBDV VP2 antigen, an ILTV gD antigen and an NDV F antigen,

[0433] wherein, the expression cassette could be used to insert into the genome of a recombinant MDV to be operably linked to an endogenous gene in the forward orientation or the reverse orientation, and express said heterologous polynucleotides in a same orientation,

[0434] wherein said expression cassette:

[0435] (a) is designed to be inserted into the non-coding intergenic region between UL26 and UL27 genes; and / or

[0436] (b) is designed to be operably linked to the endogenous UL26 promoter of MDV, and / or the endogenous UL26.5 promoter of MDV via the element of (1) ; and / or operably linked to the endogenous UL26 / UL26.5 gene via the element of (1) ; and / or

[0437] (c) is designed to be flanked by sequences which the same with or reverse complementary to a sequence that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with at least part of SEQ ID NO: 36,

[0438] preferably flanked by SEQ ID NOs: 23 and 25,

[0439] more preferably flanked by SEQ ID NOs: 23 and 24; and / or; and / or

[0440] (d) further comprises, or is designed to be flanked by 5’ homology arm sequence at 5’ end and 3’ homology arm sequence at 3’ end, wherein either of the homology arm sequences is the same with or reverse complementary to a sequence that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with at least part of SEQ ID NO: 36,

[0441] preferably, said 5’ homology arm sequence comprises or consists of a portion of at least 15 contiguous nucleotides that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with an equal length portion of SEQ ID NO: 23, and said 3’ homology arm sequence comprises or consists of a portion of at least 15 contiguous nucleotides that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with an equal length portion of SEQ ID NO: 25,

[0442] more preferably, said 5’ homology arm sequence comprises or consists of a portion of at least 15 contiguous nucleotides that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with an equal length portion of SEQ ID NO: 23, and said 3’ homology arm sequence comprises or consists of a portion of at least 15 contiguous nucleotides that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with an equal length portion of SEQ ID NO: 24.

[0443] 19. The expression cassette of embodiment 18, wherein said heterologous polynucleotide encodes the NDV F antigen.

[0444] 20. The expression cassette of embodiment 19, wherein, the NDV F antigen is as defined herein.

[0445] 21. The expression cassette of any of embodiments 18-20, wherein said element (1) is selected from a coding sequence coding for P2A, T2A, E2A or F2A.

[0446] 22. The expression cassette of any of embodiments 18-20, wherein, said element (1) is an optimized IRES element.

[0447] 23 The expression cassette of any of embodiments 18-20, comprising or consisting of in 5’ to 3’ direction and in this order:

[0448] (a) an IRES element, and

[0449] (b) the heterologous polynucleotide encoding NDV F,

[0450] and the expression cassette is designed to place the heterologous polynucleotide after the stop codon of the endogenous UL26 / UL26.5 gene via the IRES element and to place the heterologous polynucleotide under the control of the endogenous UL26 promoter of MDV and / or the endogenous UL26.5 promoter of MDV, thereby the promoters and polyA signal motifs are operatively linked to the heterologous polynucleotide encoding NDV F.

[0451] 24. The expression cassette of any of embodiments 18-23, expresses in the forward orientation as UL26 gene.

[0452] 25. An expression cassette, comprising or consisting of from 5’ to 3’ direction and in this order:

[0453] (1) a polyA signal motif;

[0454] (2) an exogenous promoter;

[0455] (3) one or more heterologous polynucleotides encoding an antigen of an avian pathogen;

[0456] (4) one polyA signal motif or more polyA signal motifs in tandem,

[0457] being operably linked,

[0458] wherein, said heterologous polynucleotide (s) encodes one or two polypeptides selected from the group consisting of an IBDV VP2 antigen, an ILTV gD antigen and an NDV F antigen,

[0459] wherein the polyA signal motif of (1) could be the same or different with the polyA signal motif of (4) ,

[0460] wherein, said heterologous polynucleotide (s) is 3’ flanked by a polyadenylation signal core sequence, and / or 5’ flanked by a Kozak sequence,

[0461] wherein, the expression cassette could be used to insert into the genome of a recombinant MDV, expressing said heterologous polynucleotides in the forward orientation or the reverse orientation, wherein, said expression cassette:

[0462] (a) is designed to be inserted into the non-coding intergenic region between UL26 and UL27 genes; and / or

[0463] (b) is designed to be operably linked to the endogenous UL26 promoter of MDV, and / or the endogenous UL26.5 promoter of MDV via the element of (1) ; and / or operably linked to the endogenous UL26 / UL26.5 gene via the element of (1) ; and / or

[0464] (c) is designed to be flanked by sequences which the same with or reverse complementary to a sequence that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with at least part of the reverse complementary sequence of SEQ ID NO: 36, preferably flanked by the reverse complementary sequences of SEQ ID NOs: 23 and 25,

[0465] more preferably flanked by the reverse complementary sequences of SEQ ID NOs: 23 and 24; and / or

[0466] (d) further comprising or is designed to be flanked by 5’ homology arm sequence at 5’ end and 3’ homology arm sequence at 3’ end, wherein either of the homology arm sequences is the same with or reverse complementary to a sequence that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with at least part of the reverse complementary sequence of SEQ ID NO: 36,

[0467] preferably, said 5’ homology arm sequence comprises or consists of a portion of at least 15 contiguous nucleotides that is at least 80%complementary to, at least 85%complementary to, at least 90%complementary to, at least 95%complementary to, at least 96%complementary to, at least 97%complementary to, at least 98%complementary to, at least 99%complementary to or 100%complementary to an equal length portion of SEQ ID NO: 23, and said 3’ homology arm sequence comprises or consists of a portion of at least 15 contiguous nucleotides that is at least 80%complementary to, at least 85%complementary to, at least 90%complementary to, at least 95%complementary to, at least 96%complementary to, at least 97%complementary to, at least 98%complementary to, at least 99%complementary to or 100%complementary to with an equal length portion of SEQ ID NO: 25,

[0468] more preferably, said 5’ homology arm sequence comprises or consists of a portion of at least 15 contiguous nucleotides that is at least 80%complementary to, at least 85%complementary to, at least 90%complementary to, at least 95%complementary to, at least 96%complementary to, at least 97%complementary to, at least 98%complementary to, at least 99%complementary to or 100%complementary to an equal length portion of SEQ ID NO: 23, and said 3’ homology arm sequence comprises or consists of a portion of at least 15 contiguous nucleotides that is at least 80%complementary to, at least 85%complementary to, at least 90%complementary to, at least 95%complementary to, at least 96%complementary to, at least 97%complementary to, at least 98%complementary to, at least 99%complementary to or 100%complementary to an equal length portion of SEQ ID NO: 24.

[0469] 26. The expression cassette of embodiment 25, wherein said heterologous polynucleotide encodes the NDV F antigen, and is preferably 3’ flanked by a polyadenylation signal core sequence, and / or 5’ flanked by a Kozak sequence.

[0470] 27. The expression cassette of embodiment 26, wherein, the NDV F antigen is as defined herein.

[0471] 28. The expression cassette of any one of embodiments 24-26, the cassette comprises or consists of in 5’ to 3’ direction and in this order:

[0472] (1) a polyA signal motif or not exist;

[0473] (2) a non-endogenous promoter;

[0474] (3) the heterologous polynucleotide encoding NDV F; and

[0475] (4) one polyA signal motif or more polyA signal motifs in tandem,

[0476] and whereby the promoters and polyA signal motifs are operatively linked to the heterologous polynucleotide encoding NDV F.

[0477] 29. The expression cassette of any one of embodiments 24-28, wherein, the promoter is exogenous and the same with the endogenous UL26.5 promoter of MDV, and / or the polyA signal motif of (1) is the novel bidirectional artificial polyA signal motif, and / or the polyA signal motif of (4) is the MDV39 / 40-intergenic bidirectional polyA signal motif.

[0478] 30. The expression cassette of any one of embodiments 24-29, wherein the heterologous polynucleotide is expressed in the reverse orientation.

[0479] 31. An expression cassette, comprising one or more heterologous polynucleotides encoding an antigen of an avian pathogen, wherein the antigen is selected from the group consisting of an IBDV VP2 antigen, an ILTV gD antigen and an NDV F antigen, and wherein

[0480] said heterologous polynucleotide encoding NDV F antigen comprises or consists of a sequence as shown in SEQ ID NO: 3 or 4, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 3 or 4, and / or

[0481] said heterologous polynucleotide encoding IBDV VP2 antigen comprises or consists of a sequence as shown in SEQ ID NO: 7 or 10, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 7 or 10, and / or

[0482] said heterologous polynucleotide encoding ILTV gD antigen comprises or consists of a sequence as shown in SEQ ID NO: 13, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 13.

[0483] 32. The expression cassette of embodiment 31, wherein said expression cassette comprises or consists of two heterologous polynucleotides that are linked via an IRES element or a stop codon+IRES,

[0484] wherein the IRES comprises or consists of a sequence of SEQ ID NO: 15, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 15 and can recruit the ribosome to initiate the translation.

[0485] 33. The expression cassette of embodiments 25-32, wherein said expression cassette comprises or consists of in 5’ to 3’ direction and in this order

[0486] (1) a polyA signal motif;

[0487] (2) a promoter;

[0488] (3) one or more heterologous polynucleotides encoding an antigen of an avian pathogen;

[0489] (4) one or more polyA signal motifs in tandem,

[0490] being operably linked,

[0491] wherein, said heterologous polynucleotide (s) encodes one or two polypeptides selected from the group consisting of an IBDV VP2 antigen, an ILTV gD antigen and an NDV F antigen,

[0492] wherein the polyA signal motif of (1) could be the same or different with the polyA signal motif of (4) ,

[0493] wherein, the expression cassette could be used to insert into the genome of a recombinant MDV, expressing said heterologous polynucleotides in the forward orientation or the reverse orientation.

[0494] 34. The expression cassette of embodiment 33, wherein said heterologous polynucleotide encodes the IBDV VP2 antigen.

[0495] 35. The expression cassette of embodiment 34, wherein, the IBDV VP2 antigen is as defined herein, and / or the promoter is the mCMV promoter of the present invention, and / or the polyA signal motif of (1) is the artificial reverse tandem polyA signal motif, and / or the polyA signal motifs of (4) are the novel bidirectional artificial polyA signal motif and the MDV39 / 40-intergenic bidirectional polyA signal motif.

[0496] 36. the expression cassettes of any of the embodiments 1-35, further comprising an FRT site among the elements, preferably upstream or downstream immediately to a polyA signal motif, preferably, the FRT site is non-functioning.

[0497] 37. A recombinant MDV, which comprises any one of the expression cassettes of embodiments 1-35, or any combination thereof.

[0498] 38. A recombinant MDV comprising a heterologous polynucleotide encoding IBDV VP2 antigen, wherein, the IBDV VP2 antigen is an VP2 antigen from nVar IBDV, which:

[0499] (a) is encoded by the heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 10, or 9, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 10, or 9, and / or

[0500] (b) comprises or consists of an amino acid sequence as shown in SEQ ID NO: 8, or an amino acid sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 8,

[0501] optionally, the heterologous polynucleotide is 3’ flanked by a backup stop codon,

[0502] optionally, the heterologous polynucleotide is inserted at an insertion site located in the intergenic region between UL26 and UL27 genes, or an insertion site located in the intergenic region between UL55 and MDV71 genes, preferably an insertion site located in the intergenic region between UL55 and MDV71 genes,

[0503] preferably, the MDV further comprises an exogenous promoter optionally linked to the heterologous polynucleotide.

[0504] 39. The recombinant MDV of embodiment 38, wherein the exogenous promoter is an mCMV promoter.

[0505] 40. The recombinant MDV of embodiment 38 or 39, wherein the heterologous polynucleotide is operably linked to one or more (e.g., one, two, or three in tandem) non-endogenous polyA signal motifs upstream and / or downstream to the heterologous polynucleotide or heterologous polynucleotides.

[0506] 41. The recombinant MDV of embodiment 40, wherein the heterologous polynucleotide is operably linked to an artificial reverse tandem polyA signal motif located upstream to the promoter,

[0507] wherein the reverse tandem polyA signal motif is the reverse tandem polyA signal motif of the present invention.

[0508] 42. The recombinant MDV of embodiment 41 or 40, wherein the heterologous polynucleotide are operably linked to a novel bidirectional artificial polyA signal motif, e.g., the novel bidirectional artificial polyA signal motif of the present invention, and an MDV39 / 40-intergenic bidirectional polyA signal motif, e.g., the MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention, in tandem located downstream to the heterologous polynucleotide or the heterologous polynucleotides,

[0509] 43. The recombinant MDV of any one of embodiments 38-42, wherein the heterologous polynucleotide is expressed in the same orientation as UL55 gene.

[0510] 44. The recombinant MDV of any one of embodiments 38-43, wherein the recombinant MDV is a recombinant HVT, and comprises or consists essentially of or consists of the following gene and elements in 5’ to 3’ direction and in this order: (a) an artificial reverse tandem polyA signal motif, e.g., an artificial reverse tandem polyA signal motif of the present invention; (b) an FRT site; (c) an mCMV promoter, e.g., an mCMV promoter comprising or consisting of a sequence of SEQ ID NO: 14, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription; (d) a heterologous polynucleotide encoding IBDV VP2 antigen, e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 9 or 10, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 9 or 10; and (e) a combination of a novel bidirectional artificial polyA signal motif and an MDV39 / 40-intergenic bidirectional polyA signal motif in tandem, e.g., a combination of a novel bidirectional artificial polyA signal motif of the present invention and an MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention in tandem,

[0511] preferably, inserted at the site in the intergenic region between UL55 and MDV71 genes, preferably in the region between the HVT genome DNA sequences atcgctatgcaaagagatgcgtgtgtacacgcgccgttga (SEQ ID NO: 26) and ttaagatgcaggagtaacaatgtgcatagtaggcgtagtt (SEQ ID NO: 29) , more preferably at the site between the FC-126 genome DNA sequences tatatgttattaaataaaataattgaccagtgaacaattt (SEQ ID NO: 27) and gtttaatgttagtttattcaatgcattggttgcaaatatt (SEQ ID NO: 28) , i.e., between the 118th nucleotide and the 119th nucleotide of the sequence as shown in SEQ ID NO: 37.

[0512] The following abbreviations are used herein:

[0513] Herpesvirus of turkey: HVT for short;

[0514] Newcastle disease virus: NDV for short;

[0515] Infectious laryngotracheitis virus: ILTV for short;

[0516] Chicken anemia virus: CAV for short;

[0517] Fowlpox virus: FPV for short;

[0518] Marek's disease virus: MDV for short;

[0519] Adenovirus type 4: FAdV-4 for short;

[0520] Mycoplasma gallisepticum: MG for short;

[0521] Mycoplasma synoviae: MS for short;

[0522] Reovirus: REOV for short;

[0523] Reticuloendotheliosis Virus: REV for short;

[0524] Avian leukaemia virus subtype J: ALV-J for short;

[0525] Avian leukaemia virus subtype A: ALV-Afor short;

[0526] Avian leukaemia virus subtype E: ALV-E for short;

[0527] Avian encephalomyelitis virus: AEV for short;

[0528] Infectious bursal disease virus: IBDV for short;

[0529] Plaque forming unit: PFU for short;

[0530] Specific pathogen free: SPF for short;

[0531] Chicken embryo fibroblast cell: CEF cell for short;

[0532] Dulbecco's minimum essential medium: DMEM for short;

[0533] Fetal bovine serum: FBS for short;

[0534] Phosphate-buffered saline: PBS for short;

[0535] Deoxyribonucleic acid: DNA for short;

[0536] Ribonucleic acid: RNA for short;

[0537] Polymerase chain reaction: PCR for short;

[0538] Reverse transcription polymerase chain reaction: RT-PCR for short;

[0539] Monoclonal antibody: mAb for short;

[0540] Polyclonal antibody: pAb for short;

[0541] Indirect immunoinfluscent assay: IFA for short;

[0542] Sodium dodecylsulphate polyacrylamide gel electrophoresis: SDS-PAGE for short;

[0543] Western blotting: WB for short;

[0544] Tris buffered saline Tween: TBST for short;

[0545] Mutiplicity of infection: MOI for short;

[0546] Milliliter: ml for short;

[0547] Microliter: μl for short;

[0548] Gram: g for short;

[0549] Microgram: μg for short;

[0550] day: d for short;

[0551] Hour: h for short;

[0552] Minute: min for short;

[0553] Second: s for short;

[0554] Micromole: μM for short;

[0555] Base-pairs: bp for short;

[0556] Tris-Acetate-EDTA buffer: TAE for short;

[0557] Distillation-distillation H2O: ddH2O for short;

[0558] Positive control: PC for short;

[0559] Negative control: NC for short;

[0560] hours post inoculation: hpi for short;

[0561] Kilo-dalton: KDa for short;

[0562] Fluid Thioglycollate Medium: T. G for short;

[0563] Trypticase Soy Broth: TSB for short.

[0564] The invention will now be further described by way of the following non-limiting examples.

[0565] Examples

[0566] Reagents, materials and equipment

[0567] Parental virus strain HVT FC-126

[0568] SPF chicken embryos were purchased from the SPF experimental animal center of Xinxing Dahuanong Poultry Egg Co., Ltd. with the experimental animal use license number: SYXX (Guangdong) 2019-0136, and the batch numbers were 5th Production House 20200817, 5th Production House 20200831, 3rd Production House 20200907, and 3rd Production House 20201005. The SPF chicken embryos were incubated until the age of use by the Guangzhou KingMiao Animal Health Co., Ltd..

[0569] Primary chicken embryo fibroblasts (CEF) were isolated from 9 to 10 day-old chicken embryos using conventional methods, and preferably were passaged at least to the second generation (i.e., the next generation) .

[0570] Calcium phosphate cell transfection kit was purchased from Beyotime Biotechnology Inc. with Art. No. C0508 and Lot. No. 032720200813;

[0571] DMEM medium was purchased from Gibco with Lot. No. 8120304;

[0572] Australian fetal bovine serum (FBS) was purchased from Gibco with Lot. No. 21520500;

[0573] PBS (pH 7.4) was purchased from Gibco with Lot. No. 8120292;

[0574] Antibiotic-Antimycotic solution (100X) was purchased from Gibco with Lot. No. 2240823;

[0575] Trypsin-EDTA (0.25%) was purchased from Gibco with Lot. No. 2164673;

[0576] Serum-free cell freezing medium CELLSAVING was purchased from New Cell &Molecular Biotech Co., Ltd., with Lot. No. 20200910;

[0577] Axyprep body fluid viral DNA / RNA small-scale extraction kit was purchased from Axygen Company with Lot. No. 07220KC5;

[0578] 2×Es Taq MasterMix (Dye) was purchased from Jiangsu Cowin Biotech Co., Ltd., with Lot. No. 01032 / 60428;

[0579] Nucleic acid dye Godview was purchased from WestGene Company, with Lot. No. 271625A;

[0580] DL 2000 DNA Marker was purchased from Takara Bio company, with Lot. No. AJ91890A;

[0581] DL 5000 DNA Marker was purchased from T Takara Bio company with Lot. No. AJ31720A;

[0582] One-step RT-PCR kit, HiScript II One Step RT-PCR Kit was purchased from Vazyme Biotech, with Lot. No. 7E302C9;

[0583] Agarose was purchased from Biowest Agarose, with Lot. No. 111860;

[0584] TAE instant granules were purchased from Monad Biotech Co., Ltd., with Lot. No. 00006989-110428;

[0585] 4%paraformaldehyde fixative was purchased from Sangon Biotech (Shanghai) Co., Ltd., with Lot. No. G803FA0002;

[0586] Anti-Newcastle disease virus antibody, Chicken pAb was purchased from abcam, with Lot. No. GR3297224-1;

[0587] Goat anti-chicken IgY H&L (Alexa FluorTM 488) was purchased from abcam, Lot. No. GR3239948-5;

[0588] NDV F Mouse McAb 8.2.1.1 was purchased with Lot. No. M2G20K18-010;

[0589] Serum test reactive for anti-ILTV was prepared and preserved by the Guangzhou KingMiao Animal Health Co., Ltd. with a batch number of 20210820;

[0590] Serum test reactive for anti-NDV was prepared and preserved by the Guangzhou KingMiao Animal Health Co., Ltd. with a batch number of 20210820;

[0591] GAPDH Mouse McAb was purchased from ZEN-BIOSCIENCE, with Lot. No. HI1228;

[0592] Goat anti-mouse IgG H&L (HRP) was purchased from proteintech, Lot. No. 20000216;

[0593] SDS-PAGE precast gel SurePAGE, Bis-Tris, 10x8, 10%was purchased from Genscript Biotech Corporation, Lot. No. C35602008;

[0594] Protease inhibitors were purchased from Jiangsu Cowin Biotech Co., Ltd., Lot. No. 01392 / 60536;

[0595] RIPA Lysis Buffer was purchased from Jiangsu Cowin Biotech Co., Ltd., Lot. No. 0148 / 60527;

[0596] 5× SDS loading buffer was purchased from Jiangsu Cowin Biotech Co., Ltd., Lot. No. 01411 / 50449;

[0597] 10×TBST WB rinse buffer was purchased from Sangon Biotech (Shanghai) Co., Ltd., Lot. No. G890TBST0003;

[0598] ECL chemiluminescent solution was purchased from Shanghai Epizyme Biomedical Technology Co., Ltd, Lot. No. 02381030;

[0599] T.G medium was purchased from Beijing Zhonghai Biotechnology Co., Ltd., Lot. No. 200629;

[0600] TSB medium was purchased from Beijing Zhonghai Biotechnology Co., Ltd., Lot. No. 190529;

[0601] NDV virus solution was purchased from National Center for Veterinary Culture Collection of China, Lot. No. AV16111507 / F48E9;

[0602] vv IBDV virus solution was prepared and preserved by the Guangzhou KingMiao Animal Health Co., Ltd. with a batch number of 20211224;

[0603] cv IBDV virus solution was purchased from National Center for Veterinary Culture Collection of China, Lot. No. 20240813F4;

[0604] nVar IBDV virus solution was prepared and preserved by the Guangzhou KingMiao Animal Health Co., Ltd. with a batch number of 20200920;

[0605] ILTV-WG (virulent ILTV WG strain) virus solution was purchased from National Center for Veterinary Culture Collection of China, Lot. No. 20201222P3;

[0606] FreeZol Reagent was purchased from Nanjing Vazyme Biotech Co with Catalog No. R711-01;

[0607] HiScript IV All-in-One Ultra RT SuperMix for qPCR was purchased from Nanjing Vazyme Biotech Co with Catalog No. R433-01;

[0608] SupRealQ Ultra Hunter SYBR qPCR Master Mix (U+) was purchased from Nanjing Vazyme Biotech Co with Catalog No. Q713-02;

[0609] Autoclave was purchased from HIRAYAMA Manufacturing Corp, HV-110;

[0610] Biological safety cabinet was purchased from NuAire, Inc., NU-425-400S;

[0611] Clean bench was purchased from Suzhou Antai Airtech Co., Ltd., SW-CJ-2FD;

[0612] Cell culture incubator was purchased from Esco Micro Pte Ltd., CLM-170B-8-NF;

[0613] Low-speed centrifuge was purchased from Hunan Xiangyi Laboratory Instrument Development Co., Ltd., L500;

[0614] Cell counter was purchased from Thermo Scientific, AMQAX1000;

[0615] Inverted microscope was purchased from Nikon Precision (Shanghai) Co., Ltd., NIKON TS100;

[0616] Inverted fluorescence microscope was purchased from Nikon Precision (Shanghai) Co., Ltd., NIKON DS-Qi2;

[0617] Liquid nitrogen tank was purchased from Chart Biomedical (chengdu) Co., Ltd., 20005470;

[0618] Refrigerated centrifuge was purchased from Eppendorf China Ltd., Eppendorf 5424R;

[0619] Low temperature refrigerator (-25℃) was purchased from Qingdao Haier Biomedical Co., Ltd., DW-252262;

[0620] Ultra-low temperature refrigerator (-86℃) was purchased from Qingdao Haier Biomedical Co., Ltd., DW-86L626;

[0621] 4℃ medical refrigerator was purchased from Qingdao Haier Biomedical Co., Ltd., BCD-215KS;

[0622] PCR instrument was purchased from Hangzhou Bio-Gener Technology Co., Ltd., GE4852T;

[0623] Biochemical incubator was purchased from Shanghai Yiheng Technology Instrument Co., Ltd., DHP-9082;

[0624] Water purifier was purchased from Millipore Elix5;

[0625] Micro-volume spectrophotometer was purchased from Hangzhou Allsheng Instruments Co., Ltd., Nano-100;

[0626] Nucleic acid electrophoresis tank was purchased from Beijing Liuyi Biotechnology Co., Ltd, DYCP-31DN;

[0627] Gel imager was purchased from Shanghai Tanon Life Science Co., Ltd., 3500;

[0628] Electrophoresis power source was purchased from Beijing Liuyi Biotechnology Co., Ltd. DYY-8C;

[0629] QuantStudioTM 3 Real-Time PCR System was purchased from Thermo Fisher Scientific Inc.;

[0630] Protein transfer apparatus was purchased from Bio-Rad Trans-Blot Turbo; and

[0631] Chemiluminescence imaging system was purchased from Azure Biosystems, C600.

[0632] Example 1: Construction of a recombinant turkey herpesvirus circular genome

[0633] In this example, an HVT infectious clone was first constructed by gene targeting (see Examples 1.1-1.2 for details) , and then exogenous gene expression cassettes were inserted into the HVT genome of the infectious clones according to the method described in Examples 1.2.1-1.2.4, thereby constructing the following recombinant multiple HVT with introduced exogenous antigen encoding genes: HVT14 (rHVT-nVarIBD) , HVT15 (rHVT-ND) , HVT22 (rHVT-IBD-ILT) , HVT35 (rHVT-ND-IBD-ILT) , HVT38 (rHVT-ND-IBD-ILT) , HVT39 (rHVT-ND-IBD-ILT) , and HVT310 (rHVT-ND-IBD-ILT) .

[0634] 1.1 Construction of HVT virus-infectious bacterial artificial chromosome

[0635] 1.1.1 Construction of recombinant virus with the insertion of a BAC vector:

[0636] As showed in Figure 8 (a) , gene targeting was performed inside the cells to insert the linear BAC vector into the non-coding interval region between HVT065 (UL55) gene and HVT066 (MDV071) gene of the strain FC-126 of turkey herpesvirus (HVT) genome, and then selection and plaque purification were performed to obtain recombinant viruses.

[0637] The inserted BAC vector has the following structural characteristics:

[0638] (1) . Structural modification: based on the commercially available pBeloBAC11 vector, the cos sequence, the wild-type loxP sequence and the lacZ gene expression cassette are streamlined.

[0639] (2) An expression cassette of gpt gene, which is a marker gene for screening and purification of recombinant virus, is inserted;

[0640] (3) One FRT site is integrated into one flank of the BAC vector, and the second FRT site in the same direction would be provided by the transgene expression cassette which would be inserted quite or immediately close to the BAC vector sequence and flank the BAC vector. Alternatively, two FRT sites, which are specifically recognized by site-specific recombinase Flp, are integrated into both ends or flanks of the vector in the same direction, for the purpose of the deletion of the BAC vector sequence at the completion of subsequent cloning.

[0641] 1.1.2 Construction of infectious clones:

[0642] As showed in Figure 8 (b) , the total DNA of the cells that are infected by the recombinant virus was prepared and transformed into the competent E. coli cells by electrotransformation. The recombinant viral genome in the circularized status can replicate in E. coli and provide chloramphenicol resistance, due to the presence of the BAC vector inside, thereby the surviving E. coli carrying the HVT infectious clones were selected for the next step.

[0643] 1.2 Construction of recombinant HVT

[0644] 1.2.1 Insertion of exogenous gene expression cassette into infectious clone

[0645] As showed in FIG4b, inside E. coli, the infectious clones of HVT was modified by recombineering and the antigen gene expression cassettes were inserted to obtain recombinant infectious clones.

[0646] The specific steps of the recombineering were as follows: the gene expression cassette was linked with the kanamycin resistance gene, the ccdB reverse selection marker gene and the homologous recombination homologous arms (HA) of both flanks into a linear DNA fragment through PCR, and it was then inserted at the predetermined target insertion site in the viral genome of the infectious clone, which is between the corresponding homologous recombination homologous arms (which are contained in the flanking sequences of the insertion site) , through linear plus circular homologous recombination (LCHR) mediated by the Redαβ recombination system in E. coli. Subsequently, the kanamycin resistance gene and ccdB reverse selection marker were eliminated through LCHR combined with ccdB reverse screening technique, thereby achieving the scarless insertion of the gene expression cassettes at the predetermined site in the viral genome of the infectious clone.

[0647] 1.2.2 Elimination of BAC vector

[0648] As mentioned above, the vector inserted into the viral genome contained a site-specific recombinase recognition site, which was the Flp recognition site FRT. Therefore, E. coli inducibly expressing FLP recombinase was selected. FLP recombinase mediated the recombination between the FRT sites on both sides of the BAC vector in the recombinant infectious clone, thereby resulting in the deletion of the BAC vector. And then the recombinant viral circular genome was obtained by a method for plasmids extraction. The whole process was showed in Figure 8 (b) .

[0649] In total, the following recombinant HVTs are constructed for the present invention, and the expression cassettes and insertion sites corresponding to each recombinant HVT clone were shown in Table 6 below.

[0650] Table 6.

[0651] Wherein,

[0652] Expression cassette 1 (SEQ ID NO: 31) : refer to Table 2 above

[0653] Expression cassette 2 (SEQ ID NO: 32) : refer to Table 3 above

[0654] Expression cassette 3 (SEQ ID NO: 33) : refer to Table 4 above

[0655] Expression cassette 4 (SEQ ID NO: 34) : refer to Table 1 above

[0656] Expression cassette 5 (SEQ ID NO: 35) : refer to Table 5 above

[0657] Expression cassette 2 ' (SEQ ID NO: 56) : vv IBDV VP2 gene sequence being the wild-type sequence SEQ ID NO: 115, and other elements being the same as expression cassette 2

[0658] Among them, the main transcriptional orientation of Expression Cassette 1 was consistent with UL 26  / 26.5, and the main transcriptional orientation of Expression Cassette 5 was consistent with UL27, i.e., opposite to the transcriptional orientation of UL 26  / 26.5. The main transcriptional orientations of Expression Cassettes 4 and 2 were consistent with UL55, and the main transcriptional orientation of Expression Cassette 3 was consistent with MDV71 (HVT66) , i.e., opposite to the transcriptional orientation of UL55.

[0659] Example 2: Rescue, identification, biological characteristics in vitro and protection in vaccination-challenge test of recombinant turkey herpesvirus

[0660] In this example, firstly, recombinant turkey herpesvirus HVT35 (rHVT-ND-IBD-ILT) , HVT38 (rHVT-ND-IBD-ILT) , HVT14 (rHVT-nVarIBD) , HVT15 (rHVT-ND) , HVT22 (rHVT-IBD-ILT) , HVT39 (rHVT-ND-IBD-ILT) , HVT310 (rHVT-ND-IBD-ILT) were obtained by virus rescue, and then, the recombinant viruses were identified by cytopathy test, immunofluorescence and PCR sequencing. The in vitro biological characteristics of the recombinant virus were evaluated by detecting the genetic stability in vitro, the expression stability in vitro, the replication kinetics, and establishment of the master seed bank and an experimental production therefrom. The antibody production level and the anti-virus protection effect were evaluated by in vivo experiments.

[0661] 2.1 Methods

[0662] 2.1.1 Rescue, amplification and titration of recombinant HVT

[0663] As showed in Figure 8, panel c, the recombinant viral circular genome was transfected into chicken embryo fibroblast (CEF) cells for virus rescue, and then the recombinant viruses were obtained and each strain was amplified and deposited.

[0664] 2.1.1.1 Rescue of recombinant turkey herpesvirus

[0665] The recombinant turkey herpesvirus circular genome was transfected into CEF cells according to the literature reports and the manufacturer’s instructions of the Calcium Phosphate Transfection Kit. The exemplary steps were as follows:

[0666] (1) One day before transfection, the secondary CEF cells were plated at 5×105 cells / well in a 24-well cell culture plate and cultured in a 5%CO2, 37℃ cell culture incubator for 24 h. Transfection was performed after the cell density reached 80%.

[0667] (2) 60 minutes before transfection, the cell culture medium was removed, and 500μl of fresh DMEM medium containing 10%FBS and without antibiotics was added.

[0668] (3) 2μg of the recombinant HVT circular genome to be transfected was get and added into 50μl of calcium chloride solution, and then mixed well.

[0669] (4) The DNA-calcium chloride solution was added into 50μl of BBS solution, mixed well, and incubated at room temperature for 30 min.

[0670] (5) The DNA-calcium chloride-BBS mixture was added equally to the 24-well plate, incubated in a 5%CO2, 37℃ cell culture incubator. After 4 hours, the culture plate was gently shaken for several times to fully suspend the few calcium phosphate precipitates, and the culture medium containing these calcium phosphate precipitates was removed. Then 500 μl of 10%FBS DMEM culture medium was added and then continuously cultured for 72 hours.

[0671] 2.1.1.2 Passaging and deposition of recombinant turkey herpesvirus

[0672] (1) After 5-6 days of culturation of transfected cells, cytopathy and plaque formation were observed; (2) The infected cells were harvested by digestion with 0.25%Trypsin-EDTA, resuspended in cell freezing solution, adjusted the cell density to 5×10 6 cells / ml, and frozen at -80℃ to obtain the F0 generation strain.

[0673] (3) When needed, the frozen F0 generation strain was taken and centrifuged at 1000 rpm and then the supernatant was discarded. The cell pellets were resuspended in DMEM, and inoculated onto a monolayer of CEF cells in a 10 cm cell culture dish at an amplification ratio of 1: 30 for subculture, followed by culturing for 24-36 hours. The virus was harvested when the cytopathy area reaches 80%.

[0674] (4) Subculture was continuously performed at an amplification ratio of 1: 30 until the generation of F20 (20th generation) , and wherein two 10-cm dishes of virus were harvested for cryopreservation for each generation.

[0675] 2.1.1.3 Determination of the titer of recombinant turkey herpesvirus

[0676] (1) After the strain was taken out of liquid nitrogen, it was quickly thawed in a 37℃ water bath. After centrifugation at 1000 rpm for 3 min, the freezing medium was discarded and 1 ml of DMEM medium containing 1%antibiotics and 2%FBS was added to resuspend the revived cells.

[0677] (2) The revived cells were serially diluted with DMEM supplemented with1%antibiotics and 2%FBS. 1 ml of the solutions at three steps of 5000X, 10000X and 50000X, respectively, was inoculated onto the secondary CEF cells in a 60-mm dish, respectively, wherein two replicates were set for each degrees of dilution. After the cells were cultured in a 5%CO2, 37℃ cell culture incubator for 5 days, they were observed under an inverted microscope and the plaques were counted. The dilution related to an average number of plaques being between 5 and 50 was used as the final PFU calculation dilution. The specific formula for calculation was the following: virus titer (PFU / ml) = number of plaques×dilution factor.

[0678] 2.1.1.4 Establishment of the master seed bank of recombinant HVT and experimental production

[0679] The recombinant turkey herpesvirus was amplified in a larger scale from the F9 generation to the F10 generation, and the latter was used to establish the master seed bank. Professional institutions were commissioned to conduct sterility testing, exogenous virus and mycoplasma detection to the strain of the master seed bank.

[0680] The strain of the master seed bank was taken out from liquid nitrogen and quickly thawed in a 37℃ water bath. Then it was added into a 15ml centrifuge tube containing 10ml of DMEM supplemented with 2%fetal bovine serum and 1%dual-antibiotics and the cells were resuspended therein. After centrifugation at 800×g for 10 minutes, the supernatant was discarded, the virus-containing cells were resuspended in DMEM supplemented with 2%fetal bovine serum and 1%dual-antibiotics, and the virus titer was adjusted to 5×104 PFU / ml. Then the virus was inoculated into a T175 culture flask at 1ml / flask, with the MOI approximately equivalent to 0.001. After inoculation, the culture was continued in an incubator at 37℃ at 5%CO2.

[0681] The cell status was observed every 12 hours. It would be expected to see the cells showing pathological changes gradually: they became round, the refractive index increased, and they strung together like grape bunches. Sometimes multiple pathological cells were seen to fuse together to form fused cells and then plaques. When the pathological cells reach 80%, the virus was harvested. After the culture medium was carefully poured out, the cells were washed with PBS once, and then 7ml Trypsin-EDTA (0.25%) was added into each flask, respectively. After the cells were dispersed and detached, 7ml DMEM culture medium containing 5%fetal bovine serum and 1%dual-antibiotics was added into each flask to neutralize the trypsin, respectively. Then the cell suspension was collected, well mixed, and divided with 50ml centrifuge tubes. After a centrifugation at 800×g for 10 minutes, the supernatant was discarded, and cell freezing medium was added (according to the numbers of previous flasks, in such a volume of 2mL for cells from one single flask, and a total volume of about 100ml) to resuspend the cells, which were then aliquoted into cryopreservation tubes at 1ml / tube and put in a cryopreservation box, followed by a transfer to a liquid nitrogen tank for freezing. After freezing for one week, two tubes were taken for virus titer detection. Finally, the F11 generation of recombinant virus with determined titer was obtained for subsequent experiments in vitro and challenge tests in vivo.

[0682] 2.1.2 Identification of recombinant turkey herpesvirus

[0683] 2.1.2.1 Identification of cytopathy

[0684] The solution of recombinant HVT of F11 generation obtained in Example 2.1.1.4 was inoculated onto the secondary monolayer CEF cells in a 24-well cell culture plate at an inoculation amount of MOI = 0.001 (150 PFU / well) , and cultured in a 5%CO2, 37℃ cell culture incubator for 12-36 hours. The cytopathy and plaque formation were observed under an inverted microscope.

[0685] 2.1.2.2 antibody identification by immunofluorescence

[0686] Immunofluorescence Assay (IFA) was a detection method that combines the specificity of immunological reactions with the accuracy of microscopy. It was widely used in the field of virology, including the identification of cell culture viruses, the detection of viral antigens in clinical specimens, the diagnosis of viral diseases, and the localization of viruses and viral antigens in tissue cells. The test steps were as follows:

[0687] (1) The solutions of recombinant HVT of F11 generation and parental HVT as the control strain were inoculated onto the secondary monolayer CEF cells in a 24-well cell culture plate at an inoculation amount of MOI = 0.001 (150 PFU / well) , and a blank control was also used. After the cells were cultured in a 5%CO2, 37℃ cell culture incubator for 36-48 hours, the culture medium was discarded, and 500μl PBS was added to wash the cells and the washing was repeated 3 times. Then, 300μl of pre-cooled 4%paraformaldehyde fixative was added to each well and allowed to stand at room temperature for 10 minutes.

[0688] (2) The fixative solution was discarded, followed by washing with 500μl PBS for 3 times.

[0689] (3) 300 μl of primary antibody solution (1: 500 dilution) was added to each well and then placed in a 37.0±1.0℃ biochemical incubator for incubation for 1 h.

[0690] (4) The primary antibody solution was discarded, followed by washing with 500μl PBS for 3 times.

[0691] (5) 300 μl of secondary antibody solution (1: 500 dilution) was added, and then placed in a 37.0±1.0℃biochemical incubator, and incubated for 1 h.

[0692] (6) The secondary antibody solution was discarded, followed by washing with 500μl PBS for 3 times.

[0693] (7) The results were observed under an inverted fluorescence microscope.

[0694] The primary antibody solutions were anti-NDV serum, mAb IBDV VP2 and anti-ILTV serum, and the secondary antibodies were goat anti-chicken IgY H&L Alexa FluorTM 488 or goat anti-mouse IgG H&L Alexa FluorTM 488, respectively.

[0695] 2.1.2.3 Protein immunoblotting identification

[0696] (1) Recombinant turkey herpesvirus of F11 generation and parental HVT as the control strain were inoculated onto the secondary monolayer CEF cells in a 24-well cell culture plate at an inoculation amount of MOI = 0.001 (150 PFU / well) , and a blank control was also used. After the cells were cultured in a 5%CO2, 37℃ cell culture incubator for 36-48 hours, the culture medium was discarded, followed by washing with 500μl PBS for 3 times. RIPA Lysis Buffer containing 1%protease inhibitor was added to lyse the cells and lysates were collected into 1.5-ml centrifuge tubes, boiled for 5 min, and the supernatant was collected by high-speed centrifugation to harvest the total protein of the infected cells.

[0697] (2) 35μg of protein solution was taken from each sample and 5×SDS loading buffer was added thereto at 1 / 4 volume of the sample solution. After loading the sample to the precast gel, it was placed in a vertical electrophoresis tank and connected to the electrophoresis instrument. The voltage was set to 80 V. When the bromophenol blue dye entered the separation gel, the voltage was increased to 160 V until the electrophoresis completed.

[0698] (3) Wet transfer was performed, and the transfer buffer was pre-cooled in a 4℃ refrigerator. The SDS-PAGE gel was removed from the electrophoresis apparatus and soaked into the transfer buffer. The PVDF membrane was cut according to the size of HVT gB protein (98.9 KDa) , NDV F protein (58.9 KDa) , IBDV VP2 protein (48.5 KDa) , ILTV gD protein (48.5 KDa) and GAPDH protein as the internal control (37 KDa) . The condition for the transfer was 200mA constant current for 1h. After the transfer was completed, the PVDF membrane was removed and placed in a 5%skim milk powder solution diluted with TBST for blocking at room temperature for 1h.

[0699] (4) The blocked membrane was put into a clean container, then anti-NDV positive serum diluted at a ratio of 1: 200 with TBST, anti-IBDV VP2 mouse mAb solution diluted at a ratio of 1: 500 with TBST, ILTV gD Rabbit pAb antibody solution diluted at a ratio of 1: 300 with TBST, HVT gB Rabbit pAb antibody solution diluted at a ratio of 1: 300 with TBST and GAPDH Mouse mAb solution diluted at a ratio of 1: 1000 with TBST were added, and incubated at room temperature for 1 hour; after discarding the primary antibody solution, the membrane was washed 3 times with TBST on a shaker at room temperature for 10 minutes each time.

[0700] (5) Secondary antibody solution (goat anti-mouse IgG H&L pAb (HRP) , goat anti-rabbit IgG H&L (HRP) and goat anti-chicken IgY H&L (HRP) ) diluted in TBST at a ratio of 1: 5000 were added according to the primary antibody, and incubated at room temperature for 1 h. The secondary antibody solution was discarded and the membrane was washed three times with TBST, each time for 5 min.

[0701] (6) The membrane was placed on the workbench of the chemiluminescent imaging system, ECL chemiluminescent aqueous solution was added on the membrane, and the parameters of the instrument for exposure was adjusted in order to expose.

[0702] 2.1.2.4 PCR Identification by agarose gel electrophoresis and sequencing of products

[0703] By extracting the genome of infected cells, PCR specific primers were used to amplify the characteristic fragments of the HVT genome and each expression cassette to identify the integrity of the cassette. The experimental steps were as follows:

[0704] (1) Recombinant turkey herpesvirus and parental HVT control strain were inoculated onto the secondary monolayer CEF cells in a 24-well cell culture plate at an inoculation amount of MOI =0.001 (150 PFU / well) , and a blank control was also used. After the cells were cultured in a 5%CO2, 37℃ cell culture incubator for 36-48 hours, the cells were digested and resuspended in 500μl PBS, and the total genome of the infected cells was extracted using a viral genomic DNA / RNA rapid extraction kit (Tiangen DP315-F) .

[0705] (2) Using the total genome of cells infected with each strain as a template, the PCR assays were performed with primers HVT-BF / R (SEQ ID NO: 38 and 39) for amplifying the characteristic fragment of the HVT genome, primers HVT-site1-F / R (SEQ ID NO: 40 and 41) for amplifying the first insertion site, and primers HVT-site2-F / R (SEQ ID NO: 42 and 43) for amplifying the second insertion site, respectively. The experimental conditions were based on the manufacturer’s instructions of Max DNA Polymerase (Takara R045Q) .

[0706] (3) The PCR amplification products were electrophoresed using 1%agarose gel. The electrophoresis buffer was 1×TAE, the voltage was set to 120 V, and the time was 30 min. After the electrophoresis, the gel imaging system was used to observe and record the results.

[0707] (4) The PCR amplification products were commissioned to Sangon Biotech (Shanghai) Co., Ltd. for DNA sequencing.

[0708] 2.1.2.5 quantitative RT-PCR (qRT-PCR) Identification

[0709] A quantitative RT-PCR is performed to compare the expression levels of the heterologous antigens of HVT38, HVT39 and HVT310 to those from HVT35.

[0710] (1) The solutions of recombinant HVTs of F11 generation and parental HVT control strain were inoculated onto the secondary monolayer CEF cells in a 24-well cell culture plate at an inoculation amount of MOI = 0.001 (150 PFU / well) , and a blank control was also used. After the cells were cultured in a 5%CO2, 37℃ cell culture incubator for 36 hours.

[0711] (2) The total RNA of infected cells was extracted using FreeZol Reagent according to the manufacturer's instructions;

[0712] (3) Reverse transcription was carried out to create cDNAs using HiScript IV All-in-One Ultra RT SuperMix for qPCR according to the manufacturer's instructions;

[0713] (4) qRT-PCR was performed using SupRealQ Ultra Hunter SYBR qPCR Master Mix (U+) and primers for each target gene as listed in Table 7 below;

[0714] (5) Data were analyzed using the 2-ΔΔCT method.

[0715] Table 7

[0716] 2.1.3 Detection of in vitro biological characteristics of recombinant turkey herpesvirus

[0717] 2.1.3.1 Detection of in vitro genetic stability of recombinant turkey herpesvirus

[0718] The solutions of recombinant HVT of F4, F8, F12, F16, and F20 generations obtained in 2.1.1.2 were selected for PCR detection and sequence alignment analysis of the first and second insertion sites to determine their genetic stability:

[0719] The genomes of the cells infected by F4, F8, F12, F16, and F20 generations of recombinant HVT were extracted, respectively, and subjected to PCR assay. The reaction system and procedure of the PCR refer to 2.1.2.4. The amplification products were identified by 1%agarose gel electrophoresis, and then sequenced by Sangon Biotech (Shanghai) Co., Ltd.. The files of the sequencing results were assembled with the SeqMan tool in DNASTAR software package (version 17.2) to obtain the full-length sequence of the inserted exogenous polynucleotides of each strain which were then aligned with the reference sequences with ClustalW using the MegAlign tool, and subjected to gene homology analysis.

[0720] 2.1.3.2 Detection of in vitro expression stability of recombinant turkey herpesvirus

[0721] (1) IFA identification

[0722] The IFA test was used to detect the expression of the inserted heterologous genes of NDV F, IBDV VP2 and ILTV gD of each recombinant strains of F4, F8, F12, F16, and F20. Specific methods refer to 2.1.2.2.

[0723] (2) Western Blotting identification

[0724] The WB test was used to detect the expression of the inserted heterologous genes of NDV F, IBDV VP2 and ILTV gD of each recombinant strains F4, F8, F12, F16, and F20. Specific methods refer to 2.1.2.3.

[0725] 2.1.3.3 Detection of in vitro replication kinetics of recombinant turkey herpesvirus

[0726] One day before virus inoculation, the secondary CEF cells were plated at 1.2×106 cells / dish in a 6-cm cell culture dish, and cultured in a 5%CO2, 37 ℃ cell culture incubator. On the second day, the virus was inoculated when the cell density reached more than 80%. The solutions of recombinant HVT of F11 generation obtained in Example 2.1.1.4 and the parent HVT as the control were inoculated to CEF cells at MOI=0.001 (1.2×103.0 PFU / dish) and cultured in a 5%CO2, 37 ℃ cell culture incubator. At each of the time points of 24 h, 36 h, 48 h, 60 h and 72 h after inoculation, the infected cells in three 60-mm cell culture dishes were collected, well mixed and then resuspended in 1.5 mL culture medium, from which 500 μl was taken for PFU determination.

[0727] GraphPad Prism 7 software was used to draw a one-step growth curve based on the determined PFU results of the virus collected at each time point.

[0728] 2.1.4 In vivo test of recombinant turkey herpesvirus

[0729] 2.1.4.1 identification and amplification of the virus strains used in the challenge

[0730] The NDV, cv IBDV and ILTV-WG strains for the challenge were purchased from the National Center for Veterinary Culture Collection of China, with available strain information, determined titer information and detection reports. All the three viruses were diluted to the working titer for challenge test according to the virus titer provided by the manufacturer, and subjected to back-titration assay to determine the dose of virus for inoculation.

[0731] Back-titration method for NDV: the virus solution is diluted to 10-2-fold, 10-3-fold, 10-4-fold, 10-5-fold and 10-6-fold concentrations, and each dilution of the virus was inoculated into five 10-day-old SPF chicken embryos by injection into the chorioallantoic sac (CAS) , with 0.2 ml virus dilution for one embryo, and then the inoculated embryos were incubated in the incubator at 37℃. The embryo died within 24h was discarded. The fatalities of embryos were observed 6 days after inoculation, and Reed-Muench method was used to calculate the median embryo lethal dose (ELD50) .

[0732] Back-titration method for cv IBDV: the virus solution is diluted to 10-1-fold and 10-2-fold concentrations, and each dilution of the virus was inoculated into five 28-day-old SPF chickens by eyedrop inoculation, with 0.05 ml virus dilution for one chicken. The chickens were killed and necropsied 4 days after inoculation to observe the pathological changes of the bursa of Fabricius. and Reed-Muench method was used to calculate the mean bird infective dose (BID) .

[0733] Back-titration method for ILTV-WG: the virus solution is diluted to 10-3-fold, 10-4-fold, 10-5-fold and 10-6-fold concentrations, and each dilution of the virus was inoculated into five 10-day-old SPF chicken embryos by injection into the embryo’s chorioallantoic membrane, with 0.2 ml virus dilution for one embryo, and then the inoculated embryos were incubated in the incubator at 37℃. The embryo died within 24h was discarded. The infection status of embryos were observed 6 days after inoculation, and Reed-Muench method was used to calculate the median embryo infective dose (EID50) .

[0734] The strains of vv IBDV and nVar IBDV that were used for the challenge were prepared and preserved by Guangzhou KingMiao Animal Health Co., Ltd.. RT-PCR detection and titration should be performed before use, and back-titration was also necessary if the virus working solution was diluted.

[0735] RT-PCR detection method: RT-PCR was performed using IBD VP2 gene-specific primers IBD-VP2-F / R (SEQ ID NO: 44 and 45) . The experimental conditions followed the instruction manual of PrimeScript One Step RT-PCR Kit Ver. 2 (Takara RR055A) . The amplification products were analyzed by 1%agarose gel electrophoresis using 1×TAE as the buffer under 120 V for 30 min, and the results were observed and recorded on a gel imaging system after the electrophoresis ended.

[0736] Back-titration method for vv IBDV and nVar IBDV: the virus solution is diluted to 10-2-fold, 10-3-fold, 10-4-fold, 10-5-fold and 10-6-fold concentrations, and each dilution of the virus was inoculated into five 10-day-old SPF chicken embryos by injection into the chorioallantoic membrane, with 0.2 ml virus dilution for one embryo, and then the inoculated embryos were incubated in the incubator at 37℃. The embryo died within 24h was discarded. The fatalities or infection status of chick embryos were observed 6 days after inoculation, and Reed-Muench method was used to calculate the median embryo lethal dose (ELD50) or the median embryo infective dose (EID50) .

[0737] 2.1.4.2 determination of protection against challenge with NDV induced by recombinant HVT

[0738] In the study, 1-day-old SPF chickens were numbered and assigned randomly to groups of 8-12 chickens per group. For the blank control group and the challenge control group, each chicken was inoculated with 0.2 ml DMEM solution by subcutaneously injection in the neck area. For test groups corresponding to the strains of recombinant HVT of the present invention, each chicken was inoculated with 3000PFU in 0.2 ml of virus solution, which were the F11 generation obtained in Example 2.1.1.4 and diluted to 15000 PFU / mL before use, by subcutaneously injection in the neck area. Moreover, at least 0.8 ml of diluted virus solution was retained for back titration to confirm the actual inoculation amount of the test recombinant HVTs.

[0739] After the inoculation, each group was raised in negative pressure isolators, with free access to water and food. On Day 21 and Day 28 after the vaccination, venous blood samples were collected in the volume of 0.5mL per animal, and then the serum was separated to test for anti-Newcastle disease virus antibodies therein by enzyme-linked immunosorbent assay (ELISA) . The specific operations and calculations followed the instructions of ID. Vet kit (ID Screen Newcastle Disease Indirect, ID vet, NDVS-5P) . The ELISA results were analyzed as follows: if S / P≤0.3, antibody titer in ELISA ≤993, the serum anti-NDV antibody was determined to be negative; if S / P＞0.3, antibody titer in ELISA＞993, the serum anti-NDV antibody was determined to be positive.

[0740] On the 28th day (Day 28) after the inoculation, for the blank control group, each chicken was injected with 0.2 ml of PBS intramuscularly, and for the challenge control group and challenge test groups, each chicken was injected with 0.2 ml of NDV virus solution containing 104.0 ELD50 of virus intramuscularly.

[0741] The chickens were observed continuously for 14 days after the NDV challenge, and clinical observation was carried out on each experimental chicken every day, mainly to find whether the chickens had neurological symptoms, lameness, unstable standing, paralysis and other symptoms; those chickens that died during the observation period, if any, were necropsied to determine whether there were characteristic lesions after NDV infection, whether there was intestinal and glandular stomach papilla haemorrhage, and the morbidity and number of deaths of chickens in each group were recorded. On the day of challenge (before challenge) , the 3rd day (Day 31) , the 5th day (Day 33) , and the 7th day (Day 35) after the challenge, the laryngeal and cloacal cotton swabs of the chickens in each group were collected and placed in 5ml centrifuge tubes that are pre-added with PBS containing dual-antibiotics, wherein the swab samples on the 5th day after challenge (Day 33) were collected for virus isolation and viral shedding evaluation, and on the swab samples the 3rd day (Day 31) and the 7th day (Day 35) after challenge were collected and stored in a -80℃ ultra-low temperature refrigerator ready for use. On the 14th day after challenge (Day 42) , all surviving chickens were euthanized and necropsied to observe visceral lesions.

[0742] 2.1.4.3 determination of protection induced by recombinant HVT against challenge with very virulent strain of infectious bursal disease virus (vv IBDV)

[0743] In the study, 1-day-old SPF chickens were numbered and assigned randomly to groups of 8-20 chickens per group. For the blank control group and the challenge control group, each chicken was inoculated with 0.2 ml DMEM solution by subcutaneously injection in the neck area. For test groups corresponding to the strains of recombinant HVT of the present invention, each chicken was inoculated with 3000PFU in 0.2 ml of virus solution, which were the F11 generation obtained in Example 2.1.1.4 and diluted to 15000 PFU / mL before use, by subcutaneously injection in the neck area. Moreover, at least 0.8 ml of diluted virus solution was retained for back titration to confirm the actual inoculation amount of the test recombinant HVTs.

[0744] After the inoculation, each group was raised in negative pressure isolators, with free access to water and food. On Day 21 and Day 28 after the vaccination, venous blood samples were collected in the volume of 0.5mL per animal, and then the serum was separated to test for anti-IBDV antibodies therein by enzyme-linked immunosorbent assay (ELISA) . The specific operations and calculations followed the instructions of ID. Vet kit (ID Screen IBD VP2, ID vet, IBDVP2-10P) . The ELISA results were analyzed as follows: if S / P≤0.3, antibody titer in ELISA ≤993, the serum anti-IBDVantibody was determined to be negative; if S / P＞0.3, antibody titer in ELISA＞993, the serum anti-IBDV antibody was determined to be positive.

[0745] On the 28th day (Day 28) after the inoculation, for the challenge control group and challenge test groups, each chicken was challenged with 0.05 ml of vv IBDV containing 20ELD50 by the eyedrop route, while for the blank control group, each chicken was subjected to PBS eyedrop.

[0746] After the virus challenge, the clinical observation was carried out on each experimental chicken every day until the end of the study, to find whether the chickens had symptoms caused by vv IBDV infection, which comprise, but not limited to, death, vent self-pecking, white watery or cream-like diarrhea, depression, anorexia, ragged feathers, trembling, prostration and lying in prone position, and the like. On the 4th day after the challenge (D32) , all surviving chickens were euthanized and necropsied to check the lesions of bursa of Fabricius, which included but not limited to edema or congestion (the purple grape-like appearance under severe haemorrhage) of the bursa and adjacent tissues, and caseous exudate inside the bursa, etc., and corresponding subjects were judged morbid.

[0747] 2.1.4.4 determination of protection induced by recombinant HVT against challenge with new variant strain of chicken infectious bursal disease virus (nVar IBDV)

[0748] In the study, 1-day-old SPF chickens were numbered and assigned randomly to groups of 8-18 chickens per group. For the blank control group and the challenge control group, each chicken was inoculated with 0.2 ml DMEM solution by subcutaneously injection in the neck area. For test groups corresponding to the strains of recombinant HVT of the present invention, each chicken was inoculated with 3000PFU in 0.2 ml of virus solution, which were the F11 generation obtained in Example 2.1.1.4 and diluted to 15000 PFU / mL before use, by subcutaneously injection in the neck area. Moreover, at least 0.8 ml of diluted virus solution was retained for back titration to confirm the actual inoculation amount of the test recombinant HVTs.

[0749] After the inoculation, each group was raised in negative pressure isolators, with free access to water and food. On Day 21 and Day 28 after the vaccination, venous blood samples were collected in the volume of 0.5mL per animal, and then the serum was separated to test for anti-IBDV antibodies therein by enzyme-linked immunosorbent assay (ELISA) . The specific operations and calculations followed the instructions of ID. Vet kit (ID Screen IBD VP2, ID vet, IBDVP2-10P) . The ELISA results were analyzed as follows: if S / P≤0.3, antibody titer in ELISA ≤993, the serum anti-IBDVantibody was determined to be negative; if S / P＞0.3, antibody titer in ELISA＞993, the serum anti-IBDV antibody was determined to be positive.

[0750] On the 28th day (Day 28) after the inoculation, firstly, for each group, 6 subjects with large weight deviation were excluded, and the rest 12 subjects with more similar weight were retained, so that the difference between the average weight of the retained subjects in each group and the average weight of the blank group was no more than 20g. Subsequently, for the challenge control group and challenge test groups, each chicken was challenged with 0.05 ml of vv IBDV containing 50 EID50 by the eyedrop route, while for the blank control group, each chicken was subjected to PBS eyedrop.

[0751] After the virus challenge, the clinical observation was carried out on each experimental chicken every day until the end of the study, to find whether the chickens had symptoms caused by IBDV infection, which comprise, but not limited to, depression, curling, anorexia, ruffled feathers and abnormal feces, and the like. On the fifth day after the challenge (Day 33) , all surviving chickens were euthanized and necropsied to check the lesions of bursa of Fabricius and calculate the bursa: body weight index (BBIX) , whose value of less than 0.7 meant bursal atrophy. Lesions of bursa of Fabricius included but were not limited to bursal atrophy, edema or congestion of the bursa and adjacent tissues, and caseous exudate inside the bursa, etc..

[0752] 2.1.4.5 determination of protection induced by recombinant HVT against challenge with classical virulent infectious bursal disease virus (cv IBDV)

[0753] In the study, 1-day-old SPF chickens were numbered and assigned randomly to groups of 8-20 chickens per group. For the blank control group and the challenge control group, each chicken was inoculated with 0.2 ml DMEM solution by subcutaneously injection in the neck area. For test groups corresponding to the strains of recombinant HVT of the present invention, each chicken was inoculated with 3000PFU in 0.2 ml of virus solution, which were the F11 generation obtained in Example 2.1.1.4 and diluted to 15000 PFU / mL before use, by subcutaneously injection in the neck area. Moreover, at least 0.8 ml of diluted virus solution was retained for back titration to confirm the actual inoculation amount of the test recombinant HVTs.

[0754] After the inoculation, each group was raised in negative pressure isolators, with free access to water and food. On Day 21 and Day 28 after the vaccination, venous blood samples were collected in the volume of 0.5mL per animal, and then the serum was separated to test for anti-IBDV antibodies therein by enzyme-linked immunosorbent assay (ELISA) . The specific operations and calculations followed the instructions of ID. Vet kit (ID Screen IBD VP2, ID vet, IBDVP2-10P) . The ELISA results were analyzed as follows: if S / P≤0.3, antibody titer in ELISA ≤993, the serum anti-IBDVantibody was determined to be negative; if S / P＞0.3, antibody titer in ELISA＞993, the serum anti-IBDV antibody was determined to be positive.

[0755] On the 28th day (Day 28) after the inoculation, for the challenge control group and challenge test groups, each chicken was challenged with 0.05 ml of cv IBDV containing 10 BID by the eyedrop route, while for the blank control group, each chicken was subjected to PBS eyedrop.

[0756] After the virus challenge, the clinical observation was carried out on each experimental chicken every day until the end of the study, to find whether the chickens had symptoms caused by cv IBDV infection, which comprise, but not limited to, death, vent self-pecking, white watery or cream-like diarrhea, depression, anorexia, ragged feathers, trembling, prostration and lying in prone position, and the like. On the 4th day after the challenge (D32) , all surviving chickens were euthanized and necropsied to check the lesions of bursa of Fabricius, which included but not limited to edema or congestion (the purple grape-like appearance under severe haemorrhage) of the bursa and adjacent tissues, and caseous exudate inside the bursa, etc., and corresponding subjects were judged morbid.

[0757] 2.1.4.6 Test on the anti-virus protection of recombinant turkey herpesvirus against chicken infectious laryngotracheitis virus (ILTV)

[0758] In the study, 1-day-old SPF chickens were numbered and assigned randomly to groups of 8-18 chickens per group. For the blank control group and the challenge control group, each chicken was inoculated with 0.2 ml DMEM solution by subcutaneously injection in the neck area. For test groups corresponding to the strains of recombinant HVT of the present invention, each chicken was inoculated with 3000PFU in 0.2 ml of virus solution, which were the F11 generation obtained in Example 2.1.1.4 and diluted to 15000 PFU / mL before use, by subcutaneously injection in the neck area. Moreover, at least 0.8 ml of diluted virus solution was retained for back titration to confirm the actual inoculation amount of the test recombinant HVTs.

[0759] After the inoculation, each group was raised in negative pressure isolators, with free access to water and food. On the 28th day (Day 28) after the inoculation, for the challenge control group and challenge test groups, each chicken was challenged with ILTV-WG strains in a dose of 103.5 EID50 by the intratracheal route, while for the blank control group, each chicken was subjected to PBS in a same volume.

[0760] The chickens were observed continuously for 10 days after the ILTV challenge, and clinical observation for at least 10 minutes for each group was carried out twice a day from the 2nd day to the 6th day, and once a day on other days. Whether there were symptoms of dyspnea, conjunctivitis and / or depression was checked. For those chickens showing clinical symptoms, they were scored according to the criteria in Table 8 below. At the end of the study, all surviving chickens were euthanized and necropsied to observe tracheal lesions.

[0761] Table 8 Scoring of clinical sign severity in ILTV infection

[0762] After the challenge, the experimental chicken was judged morbid if any of the following symptoms were met: (1) death; (2) score for "dyspnea" was 3, or 2 for no less than 2 observation days; (3) score for "conjunctivitis" was 1; and (4) score for "depression" was 2.

[0763] After the challenge, the experimental chicken was judged to be protected if all of the following signs were met at the same time: (1) the experimental chicken was survived; (2) the score for “dyspnea” was ≤2 while being 2 for less than 2 observation days; (3) score for "conjunctivitis" was 0; and (4) the score for "depression" was <2.

[0764] 2.2 Results

[0765] 2.2.1 Rescue and evaluation of recombinant turkey herpesvirus expressing one heterologous antigen

[0766] In order to verify the feasibility of inserting a heterologous antigen expression cassette into the first insertion site of the present invention located in the non-coding intergenic region between HVT033 (UL26) and HVT035 (UL27) and inserting a heterologous antigen expression cassette into another insertion site located in the non-coding intergenic region between HVT065 (UL55) and HVT066 (MDV71) to construct a recombinant HVT vaccine, rHVT-ND (HVT15) and rHVT-nVarIBD (HVT14) were constructed by inserting Expression Cassette 1 (SEQ ID NO: 31) into the first insertion site and inserting Expression Cassette 4 (SEQ ID NO: 34) into the second insertion site, respectively, based on the parental strain HVT FC-126.

[0767] The recombinant viral circular genomes of HVT14 and HVT15 were transfected into CEF cells to rescue the viruses, respectively. Through tests such as passaging, sterility detection, exogenous viruses and mycoplasma detection etc., it is demonstrated that the expected recombinant HVTs have been successfully constructed, with verified genomic stability even after multiple passages (data not shown) .

[0768] Thereby, the F11 generation viruses of HVT14 and HVT15 were established, with titers of 3.4×106 PFU / ml and 2.8×106 PFU / ml, respectively, to be used for the identification, detection of in vitro biological characteristics and in vivo experiments of recombinant HVT.

[0769] As shown in Figure 10, CEF cells inoculated with HVT15 developed obvious cytopathies, and irregular viral plaques were formed, with significant immunofluorescence in the plaque area, indicating that the recombinant virus can express NDV F protein. The PCR amplification product of the genome of the infected cells was consistent with the expected HVT characteristic sequence and the expression cassette in terms of the size, and the sequencing results of the PCR product were also identical with the reference sequence.

[0770] In the in vivo controlled vaccination-challenge study, as showed in Figure 15 (a) , the test group vaccinated with HVT15 showed an 91.6%percent (11 / 12) positive rate of anti-NDV antibody on Day 21 after vaccination, which further reaches 100% (12 / 12) on Day 28. As showed in Figure 15 (b) , in the NDV challenge test, (1) the validity of the study was ensured: the back-titration result of the NDV virus solution used to challenge was 104.20 ELD50 / 0.2ml, and the morbidity of the blank control group was 0 while the morbidity of the challenge control group was 100%, in which all the subjects began to develop clinical symptoms of NDV infection, including dyspnea, diarrhea, paralysis, etc., on the 3rd day after challenge (Day 31) , and even died on 5th day after challenge (Day 33) . The morbidity rate and fatality rate were both 100%. Therefore, the validity of the study was established. (2) the anti-virus protection of the vaccine against the challenge was determined: in the group inoculated with 3000PFU of HVT15 in prior, no clinical symptoms or deaths were seen. On 14th day after the challenge (Day 42) , all surviving chickens were euthanized for the necropsy, in which no lesions were found either. The pharyngeal swabs and cloacal swabs for each animal collected on the 5th day after the challenge were tested for virus isolation, in which the positive rates of the blank control group and the test group (vaccination-challenge group) were both 0, while the positive rate of the challenge control group was 100%. It is indicated that HVT15 provided effective protection against the challenge with NDV, with a protection rate of 100% (12 / 12) .

[0771] The above results had well proved the full (100%) protection of HVT15 vaccination against NDV had been. On one hand, this result verified the feasibility of constructing a recombinant virus-based vaccine by inserting a gene cassette at the first insertion site of the present invention. On the other hand, it is also verified that the expression level of a heterologous antigen driven by the endogenous UL26 / UL26.5 gene promoter is so considerable that a high level of immune response could be elicited to produce excellent protection against the target pathogen.

[0772] As shown in Figure 9, CEF cells inoculated with HVT14 developed obvious cytopathies, and irregular viral plaques were formed, with significant immunofluorescence in the plaque area, indicating that the recombinant virus can express nVar IBDV VP2 protein. The PCR amplification product of the genome of the infected cells was consistent with the expected HVT characteristic sequence and the expression cassette in terms of the size, and the sequencing results of the PCR product were also identical with the reference sequence.

[0773] In the in vivo controlled vaccination-challenge study, as showed in Figure 11, the test group vaccinated with HVT14 showed a 100%percent (12 / 12) positive rate of anti-IBDV antibody on Day 21 after vaccination. As showed in Figure 12, in the nVar IBDV challenge test, (1) the validity of the study was ensured: the nVar IBDV virus solution used to challenge was identified by PCR (data not shown) , the back-titration result was 60 EID50 / 0.05mL, and the morbidity of the blank control group was 0 while the morbidity of the challenge control group was 100%, in which no obvious clinical symptoms of IBD were found, but in all subjects the bursa of Fabricius shrank significantly as seen in the necropsy on the 5th day after the challenge (Day 33) . Therefore, the validity of the study was established. (2) the anti-virus protection of the vaccine against the challenge was determined: in the group inoculated with 3000PFU of HVT14 in prior, no clinical symptoms were found and, all chicken showed the bursa of Fabricius of normal size (BBIX ≥ 0.7) , and no lesions, indicating that HVT14 provided effective protection against the challenge with nVar IBDV, with a protection rate of 100%(12 / 12) .

[0774] In the in vivo study against another serotype of IBDV, i.e., vv IBDV, as depicted in Figure 13, HVT14 also showed protective potency: (1) the validity of the study was ensured: the vv IBDV virus solution used to challenge was identified by PCR (data not shown) , the back-titration result was 30 ELD50 / 0.05mL, and the morbidity of the blank control group was 0 while the morbidity of the challenge control group was 100%, in which severe clinical symptoms of IBD were found in all subjects on the 3rd day after challenge (Day 31) and the clinical necropsy results of the surviving subjects all showed obvious lesions of bursa of Fabricius. Therefore, the validity of the study was established. (2) the anti-virus protection of the vaccine against the challenge was determined: in the group inoculated with 3000PFU of HVT14 in prior, no clinical symptoms were found and only one chicken showed edema of the bursa of Fabricius, indicating that HVT14 provided effective protection against the challenge with vv IBDV, with a protection rate of 91.6% (11 / 12) .

[0775] In the in vivo study against classical IBDV (cv IBDV) , as depicted in Figure 14, HVT14 also showed protective potency: (1) the validity of the study was ensured: the back-titration result of the cv IBDV virus solution used to challenge was 15BID, and the morbidity of the blank control group was 0 while the morbidity of the challenge control group was 100%and the clinical necropsy results of the surviving subjects in this group all showed obvious lesions of bursa of Fabricius. Therefore, the validity of the study was established. (2) the anti-virus protection of the vaccine against the challenge was determined: in the group inoculated with 3000PFU of HVT14 in prior, no clinical symptoms were found and only one chicken showed edema of the bursa of Fabricius, indicating that HVT14 provided effective protection against the challenge with cv IBDV, with a protection rate of 91.6% (11 / 12) .

[0776] The above results demonstrated that HVT14 can provide excellent immune protection against all the three of cv IBDV, nVar IBDV and vv IBDV serotypes. On one hand, this result verified the feasibility of utilizing the insertion site between UL55 and MDV71 genes for a heterologous expression cassette insert in the construction of a recombinant virus vaccine. Moreover, as described in Example 1.1, the BAC vector is also inserted at this insertion site between UL55 and MDV71 genes in a previous step. Thus these results also suggested that the insertion and subsequent elimination of the BAC vector, as designed and realized by the present invention, did not interfere or influence the function of the heterologous expression cassette in the final construct. It could be concluded as advantageous to employ the method of the present invention to construct the recombinant MDVs of the present invention.

[0777] On the other hand, this result also verified the potent immune response elicited by the nVar IBDV VP2 antigen expressed by Expression Cassette 4 can provide excellent cross-protection against various IBDV serotypes, indicating that such an antigen is a preferable candidate for constructing vaccines against IBD in avian.

[0778] 2.2.2 Rescue and evaluation of recombinant turkey herpesvirus expressing two heterologous antigens

[0779] In order to verify the feasibility of inserting an expression cassette for simultaneously expressing two heterologous antigens at the second insertion site located in the intergenic region between HVT065 and HVT066 to construct a recombinant HVT vaccine, rHVT-IBD-ILT (HVT22) was constructed by inserting Expression Cassette 2 (SEQ ID NO: 32) for co-expressing IBDV VP2 antigen polypeptide and ILTV gD antigen polypeptide at the second insertion site.

[0780] The recombinant viral circular genome of HVT22 was transfected into CEF cells to rescue the virus. Through tests such as passaging, sterility detection, exogenous viruses and mycoplasma detection etc., it is proved that the expected recombinant HVT have been successfully constructed, with verified genomic stability even after multiple passages (data not shown) .

[0781] Thereby, the F11 generation virus was established, with a titer of 2.2×106 PFU / ml, to be used for the identification, detection of in vitro biological characteristics and in vivo experiments of recombinant HVT.

[0782] CEF cells inoculated with HVT22 developed obvious cytopathies (Figure 16) , and irregular viral plaques were formed, with significant immunofluorescence in the plaque area (Figure 16) , indicating that the recombinant virus can express vv IBDV VP2 protein and ILTV gD protein, which is even further verified by a Western Blotting (Figure 17 (b) ) . The PCR amplification product of the genome of the infected cells was consistent with the expected HVT characteristic sequence and the expression cassette in terms of the size (Figure 17 (a) ) , and the sequencing results of the PCR product were also identical with the reference sequence.

[0783] In the in vivo controlled vaccination-challenge study, as showed in Figure 18 (a) , the test group vaccinated with HVT22 showed a 100%percent (12 / 12) positive rate of anti-IBDV antibody on Day 21 after vaccination. As showed in Figure 19, in the vv IBDV challenge test, (1) the validity of the study was ensured: the back-titration result of the vv IBDV virus solution used to challenge was 25 ELD50 / 0.05mL, and the morbidity of the blank control group was 0 while the morbidity of the challenge control group was 100%, in which deaths began to occur on the 3rd day after the challenge (Day 31) . On the 4th day, 100%subjects are morbid, wherein one third died and other surviving subjects showed significant lesions of bursa of Fabricius, such as edema of the bursa of Fabricius, gelatinous exudates on the serosal layer, and severe haemorrhage of bursa of Fabricius with a purple grape-like appearance, in the necropsy after the euthanasia. Therefore, the validity of the study was established. (2) the anti-virus protection of the vaccine against the challenge was determined: in the group inoculated with 3000PFU of HVT22 in prior, no clinical symptoms were found and no lesions of the bursa of Fabricius was seen in the necropsy, indicating that HVT22 provided effective protection against the challenge with vv IBDV, with a protection rate of 100% (12 / 12) .

[0784] In the in vivo study against ILTV, as depicted in Figure 18b, HVT22 also showed protective potency: (1) the validity of the study was ensured: the back-titration result of the ILTV-WG virus strain solution used to challenge was104.20 EID50 / 0.2ml, and the morbidity of the blank control group was 0 while all subjects of the challenge control group were found morbid 5 days after challenge, with the clinical symptoms of slight open mouth breathing, head shaking, and lesions on the larynx and trachea in the necropsy. Therefore, the validity of the study was established. (2) the anti-virus protection of the vaccine against the challenge was determined: in the group inoculated with 3000PFU of HVT22 in prior, only one chicken showed slight symptoms and tiny lesions in the necropsy, indicating that HVT22 provided effective protection against the challenge with ILTV-WG strain with a protection rate of 91.6% (11 / 12) .

[0785] The above results demonstrated that HVT22, constructed by inserting Expression Cassette 2 carrying dual heterologous genes into the insertion site between UL55 and MDV71 genes, achieves significant co-expression of both antigens upon inoculation in vitro and in vivo, and thereby provides excellent immune protection against IBDV and ILTV at the same time.

[0786] 2.2.3 Rescue and evaluation of recombinant turkey herpesvirus expressing three heterologous antigens

[0787] Based on the excellent immune protective effects of rHVT-ND (HVT15) and rHVT-IBD-ILT (HVT22) as verified in the above examples, the Inventors seek to combine the two and construct an rHVT that expresses all the three antigens NDV F, IBDV VP2 and ILTV gD. As a result, HVT35, a multivalent rHVT, was generated by inserting Expression Cassette 1 (SEQ ID NO: 31) of HVT15 into the same first insertion site and inserting Expression Cassette 2 (SEQ ID NO: 32) of HVT22 into the same second insertion site.

[0788] The recombinant viral circular genome of HVT35 was transfected into CEF cells to rescue the virus. Through tests such as sterility detection, exogenous viruses and mycoplasma detection etc., it is proved that the expected recombinant HVT have been successfully constructed (data not shown) .

[0789] Thereby, the F11 generation virus of HVT35 was established, with titers of 1.9×106 PFU / ml, to be used for the identification, detection of in vitro biological characteristics and in vivo experiments of recombinant HVT.

[0790] CEF cells inoculated with HVT35 developed obvious cytopathies (Figure 20, Row (a) ) , and irregular viral plaques were formed, with significant immunofluorescence in the plaque area (Figure 20, Row (b) – (d) ) , indicating that the recombinant virus can express NDV F protein, vv IBDV VP2 protein and ILTV gD protein, which is even further verified by a Western Blotting (Figure 21 (a) ) . The PCR amplification product of the genome of the infected cells was consistent with the expected HVT characteristic sequence and the expression cassette in terms of the size (Figure 21 (b) ) , and the sequencing results of the PCR product were also identical with the reference sequence.

[0791] HVT35 had high genetic stability in vitro (Figure 22) , and The PCR amplification product of the genome of the F20 generation-infected cells was consistent with the expected HVT characteristic sequence and the expression cassette in terms of the size. HVT35 was also highly stable in the expression of heterologous genes, and the IFA and WB results for F20 generation-infected cells were consistent with the results acquired from earlier generations (Figure 23) . HVT35 had similar growth characteristics to the parental HVT strain (Figure 24) , but the overall titer was slightly lower than that of the parental HVT.

[0792] In the in vivo controlled vaccination-challenge study against NDV, as showed in Figure 25 (a) , the test group vaccinated with HVT35 showed an 66.7%percent (8 / 12) positive rate of anti-NDV antibody on Day 21 after vaccination, which further reaches 100% (12 / 12) on Day 28. As showed in Figure25 (c) , in the NDV challenge test, (1) the validity of the study was ensured: the back-titration result of the NDV virus solution used to challenge was 104.32 ELD50 / 0.2ml, and the morbidity of the blank control group was 0 while the morbidity of the challenge control group was 100%, in which all the subjects began to develop clinical symptoms of NDV infection, including dyspnea, diarrhea, paralysis, etc., on the 3rd day after challenge (Day 31) , and even died on 6th day after challenge (Day 34) . The morbidity rate and fatality rate were both 100%. Therefore, the validity of the study was established. (2) the anti-virus protection of the vaccine against the challenge was determined: in the group inoculated with 3000PFU of HVT35 in prior, no clinical symptoms or deaths were seen. On 14th day after the challenge (Day 42) , all surviving chickens were euthanized for the necropsy, in which no obvious lesions were found either. The pharyngeal swabs and cloacal swabs for each animal collected on the 5th day after the challenge were tested for virus isolation, in which the positive rates of the blank control group and the test group (vaccination-challenge group) were both 0, while the positive rate of the challenge control group was 100%. It is indicated that HVT35 provided effective protection against the challenge with NDV, with a protection rate of 100% (12 / 12) .

[0793] In the in vivo study against vv IBDV, as depicted in Figure 25 (b) , the test group vaccinated with HVT35 showed an 100%percent (12 / 12) positive rate of anti-IBDV antibody on Day 21 after vaccination, which was still 100% (12 / 12) on Day 28. As showed in Figure 26, in the challenge test: (1) the validity of the study was ensured: the back-titration result of the vv IBDV virus solution used to challenge was 32 ELD50 / 0.05mL, and the morbidity of the blank control group was 0 while deaths began to occur in the challenge control group on the 3rd day after challenge (Day 31) , and the morbidity reached 100%on the 4th day after challenge (Day 32) . The clinical necropsy results of the surviving subjects all showed obvious lesions of bursa of Fabricius. Therefore, the validity of the study was established. (2) the anti-virus protection of the vaccine against the challenge was determined: in the group inoculated with 3000PFU of HVT35 in prior, no clinical symptoms were found and no obvious lesions of the bursa of Fabricius was seen either in the necropsy, indicating that HVT35 provided effective protection against the challenge with vv IBDV, with a protection rate of 100%(12 / 12) .

[0794] In the in vivo controlled vaccination-challenge study against nVar IBDV, as showed in Figure 27, the validity of the study was ensured: the back-titration result of the nVar IBDV virus solution used to challenge was 60 EID50 / 0.05mL, and the morbidity of the blank control group was 0 while the morbidity of the challenge control group was 100%, in which no obvious clinical symptoms of IBD were found, but in all subjects the bursa of Fabricius shrank significantly as seen in the necropsy on the 5th day after the challenge (Day 33) . Therefore, the validity of the study was established. In the group inoculated with 3000PFU of HVT35 in prior, atrophy of the bursa of Fabricius were seen in the necropsy of 8 animals, which were then judged to be morbid, indicating that HVT35 only achieved a protection rate of 33.3% (3 / 9) .

[0795] In the in vivo study against classical IBDV (cv IBDV) , as depicted in Figure 28, HVT35 also showed protection: (1) the validity of the study was ensured: the back-titration result of the cv IBDV virus solution used to challenge was 15BID, and the morbidity of the blank control group was 0 while the morbidity of the challenge control group was 100%, in which the clinical necropsy results of all subjects showed obvious atrophy of bursa of Fabricius. Therefore, the validity of the study was established. (2) the anti-virus protection of the vaccine against the challenge was determined: in the group inoculated with 3000PFU of HVT35 in prior, no clinical symptoms were found, but there were two chickens showing edema of the bursa of Fabricius when necropsied, indicating that HVT35 provided a protection rate of 83.3% (10 / 12) .

[0796] In the in vivo study against ILTV, as depicted in Figure 29, (1) the validity of the study was ensured: the back-titration result of the ILTV-WG virus strain solution used to challenge was104.38 EID50 / 0.2ml, and the morbidity of the blank control group was 0 while all subjects of the challenge control group were found morbid 5 days after challenge, with the clinical symptoms of slight open mouth breathing, head shaking, and lesions on the larynx and trachea in the necropsy. Therefore, the validity of the study was established. (2) the anti-virus protection of the vaccine against the challenge was determined: in the group inoculated with 3000PFU of HVT35 in prior, only one chicken showed slight symptom of gasping with extended neck and was thus judged morbid, indicating that HVT35 provided effective protection against the challenge with ILTV-WG strain with a protection rate of 91.6%(11 / 12) .

[0797] The above results indicated that HVT35 (rHVT-ND-IBD-ILT) had excellent proliferation characteristics and genomic stability in vitro, and can stably and efficiently express the heterologous antigens of the pathogens of three target diseases, thereby conferring anti-virus protections against the three serious diseases at the same time in the animals immunized with HVT35. In addition, the HVT per se can serve as antigens to elicit immunological response in vivo against various kinds of Marek's disease viruses. Therefore, this strain was an excellent multivalent recombinant HVT vaccine.

[0798] 2.2.4 Improvement of recombinant turkey herpesvirus multivalent vaccine and evaluation

[0799] The in vitro proliferation characteristics of HVT35 (rHVT-ND-IBD-ILT) were a little weaker than its parental strain, manifesting as a lower highest titer, and the positive rate of anti-NDV antibody in the animals vaccinated by HVT35 did not reach 100%. Therefore, a room for further promotion may exist.

[0800] In this example, the following modification to HVT35 were attempted:

[0801] By changing the transcriptional orientation, Expression Cassette 1 (SEQ ID NO: 31) was engineered to Expression Cassette 5 (SEQ ID NO: 35) , and Expression Cassette 2 (SEQ ID NO: 32) was engineered to Expression Cassette 3 (SEQ ID NO: 33) ;

[0802] By replacing the coding sequence for IBDV VP2, Expression Cassette 2 (SEQ ID NO: 32) was engineered to Expression Cassette 2’ (SEQ ID NO: 56) , in which the coding sequence for IBDV VP2 SEQ ID NO: 7 was substituted with the wild-type gene sequence SEQ ID NO: 6,

[0803] and then, on the basis of HVT35,

[0804] HVT38 (rHVT-ND-IBD-ILT) was designed by replacing Expression Cassette 2 with Expression Cassette 3;

[0805] HVT39 (rHVT-ND-IBD-ILT) was designed by replacing Expression Cassette 1 with Expression Cassette 5 and replacing Expression Cassette 2 with Expression Cassette 3;

[0806] HVT310 (rHVT-ND-IBD-ILT) was designed by replacing Expression Cassette 1 with Expression Cassette 5 and replacing Expression Cassette 2 (SEQ ID NO: 32) with expression cassette 2’ (SEQ ID NO: 56) .

[0807] Obtaining the recombinant viral circular genomes of HVT38, HVT39 and HVT310, which were then transfected into CEF cells to rescue the viruses, respectively. Through tests such as passaging, sterility detection, exogenous viruses and mycoplasma detection, etc., it is demonstrated that the expected recombinant HVTs have been successfully constructed, with verified genomic stability even after multiple passages (data not shown) .

[0808] Thereby, the F11 generation viruses of HVT38, HVT39 and HVT310 were established, with titers of 1.8×106 PFU / ml, 1.7×106 PFU / ml and 1.9×106 PFU / ml, respectively, to be used for the identification, detection of in vitro biological characteristics and in vivo experiments of recombinant HVT.

[0809] CEF cells inoculated with HVT38, HVT39 or HVT310 developed obvious cytopathies (see Figure 30, 31, or 32) , and irregular viral plaques were formed, with significant immunofluorescence in the plaque area (see Figure 30, 31, or 32, indicating that the recombinant virus can express NDV F protein, vv IBDV protein and ILTV gD protein. The PCR amplification product of the genome of the infected cells was consistent with the expected HVT characteristic sequence and the expression cassette in terms of the size (see Figure 33) , and the sequencing results of the PCR product were also identical with the reference sequence.

[0810] As compared to HVT35, HVT39 and HVT310 achieve a lower expression level of NDV F with a decrease of 60%-70%, suggesting that the change of the transcriptional orientation at the novel insertion site may result in an adverse effect on the expression of the heterologous antigen. However, the immunological response in vivo still remains to evaluate in further studies. As compared to HVT35, HVT38 and HVT39 achieve higher expression levels of ILTV gD antigen and IBDV VP2 antigen, with a increase of about 1 fold, suggesting that the change of the transcriptional orientation and the improvement of coding sequences at the insertion site 2 may be advantageous.

[0811] HVT38, HVT39 and HVT310 all have similar proliferation characteristics with the parental HVT (Figure 34) , having a titer substantially close to, but lower than, that of HVT35.

[0812] In the in vivo controlled vaccination-challenge study against NDV, as showed in Figure 35 (b) , the test group vaccinated with HVT38 showed a 91.6%percent (11 / 12) positive rate of anti-NDV antibody on Day 28 after vaccination. In the NDV challenge test, (1) the validity of the study was ensured: the back-titration result of the NDV virus solution used to challenge was 104.32 ELD50 / 0.2ml, and the morbidity ...

Claims

1.A recombinant Marek’s Disease Virus (MDV) comprising at least one or more heterologous polynucleotides encoding an antigen of an avian pathogen, wherein at least one of said heterologous polynucleotides is inserted at an insertion site in the non-coding intergenic region of the genome of said MDV, between UL26 and UL27 genes, e.g., between the stop codon of UL26 gene and the stop codon of UL27 gene.2.The recombinant MDV of claim 1, wherein the avian pathogen is selected from the group consisting of Newcastle Disease Virus (NDV) , Infectious Bursal Disease Virus (IBDV) , Infectious Laryngotracheitis Virus (ILTV) , avian encephalomyelitis virus, avian reovirus, avian paramyxovirus, avian metapneumovirus, avian adenovirus, fowl pox virus, avian coronavirus, avian rotavirus, avian parvovirus, avian astrovirus, avian retrovirus, avian picornavirus, and chick anemia virus, coccidiosis (Eimeria sp. ) , Campylobacter sp., Salmonella sp., Mycoplasma gallisepticum, Mycoplasma synoviae, Pasteurella sp., Avibacterium sp., Escherichia coli and Clostridium sp.,optionally, the antigen is selected from the group consisting of Newcastle Disease Virus fusion protein (NDV F) , Newcastle Disease Virus hemagglutinin neuraminidase (NDV-HN) , Infectious Bursal Disease Virus (IBDV) VP2, IBDV VPX, IBDV VP3, IBDV VP4, ILTV glycoprotein B, ILTV glycoprotein I, ILTV UL32, ILTV glycoprotein D, ILTV glycoprotein E, ILTV glycoprotein C, protective genes derived from Mycoplasma gallisepticum (MG) , or Mycoplasma synoviae (MS) , or combinations thereof.3.The recombinant MDV of claim 1 or 2, wherein the MDV comprises three heterologous polynucleotides, a polynucleotide encoding an IBDV VP2 antigen, a polynucleotide encoding an ILTV gD antigen and a polynucleotide encoding an NDV F antigen.4.The recombinant MDV of claim 3, wherein, one or two of the heterologous polynucleotides encoding IBDV VP2, ILTV gD and NDV F are inserted in the intergenic region between UL26 and UL27 genes;preferably, a first cassette comprising the heterologous polynucleotide encoding NDV F is inserted in the intergenic region between UL26 and UL27 genes, and a second cassette comprising a heterologous polynucleotide encoding IBDV VP2 and a heterologous polynucleotide encoding ILTV gD is inserted at the second insertion site.5.The recombinant MDV of claim 4, wherein at least another heterologous polynucleotide is inserted at a second insertion site which is different from the insertion site between UL26 and UL27 genes, optionally, the second insertion site is located in a region selected from the group consisting of the following: the intergenic region between UL55 and MDV71 genes, the intergenic region between UL3 and UL4 genes, the intergenic region between UL22 and UL23 genes, the intergenic region between UL44 and UL45 genes, the intergenic region between UL45 and UL46 genes, the intergenic region between UL48 and UL49 genes, the intergenic region between UL54 and MDV69 genes, the IG2 region, the intergenic region between US10 and US1 genes, the intergenic region between SORF3 and US2 genes, the US2 locus, the US6 locus, the US7 locus, the US8 locus, the US10 locus, and the intergenic region between US10 and SORF3 genes,preferably, the second insertion site is located in the intergenic region between UL55 and MDV71 genes, e.g., between the stop codon of UL55 gene and the stop codon of MDV71 gene.6.The recombinant MDV of claim 4 or 5, wherein the first cassette comprises the heterologous polynucleotide encoding NDV F and optionally an IRES element or a stop codon+IRES (a stop codon 5’ upstream to, preferably directly 5’ flanking the IRES) , whereinthe heterologous polynucleotide is placed after the stop codon of the endogenous UL26 / UL26.5 gene, preferably via an IRES element or a stop codon+IRES; andthe heterologous polynucleotide is placed under the control of the endogenous UL26 promoter of MDV, and / or under the control of the endogenous UL26.5 promoter of MDV,and the first expression cassette is expressed in the same orientation as UL26 gene;preferably, the first cassette comprises or consists of in 5’ to 3’ direction and in this order:(a) an IRES element or a stop codon+IRES, and(b) the heterologous polynucleotide encoding NDV F,and the heterologous polynucleotide is placed after the stop codon of the endogenous UL26 / UL26.5 gene, preferably via an IRES element; and the heterologous polynucleotide is placed under the control of the endogenous UL26 promoter of MDV and / or the endogenous UL26.5 promoter of MDV, thereby the promoters and polyA signal motifs are operatively linked to the heterologous polynucleotide encoding NDV F.7.The recombinant MDV of anyone of claims 4 to 6, wherein the first cassette comprises the heterologous polynucleotide encoding NDV F, and further comprises a non-endogenous promoter and one or more non-endogenous polyA signal motifs operably linked to the heterologous polynucleotide, and the first expression cassette is expressed in the same orientation as UL27 gene;preferably the first cassette comprises or consists of in 5’ to 3’ direction and in this order:(a) a non-endogenous promoter,(b) the heterologous polynucleotide encoding NDV F, optionally 3’ flanked by a polyadenylation signal core sequence, and / or 5’ flanked by a Kozak sequence, and(c) one or more non-endogenous polyA signal motifs;and whereby the promoters and polyA signal motifs are operatively linked to the heterologous polynucleotide encoding NDV F.8.The recombinant MDV of any one of claims 4-7, wherein the second cassette comprises a heterologous polynucleotide encoding IBDV VP2 and a heterologous polynucleotide encoding ILTV gD, respectively, preferably linked to each other via an IRES element or via a stop codon+IRES (a stop codon 5’ upstream to, preferably directly 5’ flanking the IRES) or via a coding sequence for self-cleavage peptide or via a stop codon+ coding sequence for self-cleavage peptide (a stop codon 5’ upstream to, preferably directly 5’ flanking the coding sequence for self-cleavage peptide) , and further comprises an exogenous promoter, operably linked to the heterologous polynucleotides;optionally, the second cassette further comprises one or more (e.g., one, two, or three in tandem) non-endogenous polyA signal motifs in each end, e.g., one or more (e.g., one, two, or three in tandem) polyA signal motif at the 5’ end (e.g., upstream to the promoter) ; and / or one or more (e.g., one, two, or three in tandem) polyA signal motif at the 3’ end (e.g., downstream to the heterologous polynucleotide) ; andoptionally the second cassette further comprises a nonfunctioning FRT site.9.The recombinant MDV of claim 8, wherein the second cassette comprises or consists of in 5’ to 3’ direction and in this order:(a) a polyA signal motif;(b) an FRT site;(c) an exogenous promoter;(d) one of the heterologous polynucleotide encoding IBDV VP2 and the heterologous polynucleotide encoding ILTV gD;(e) a stop codon,(f) an IRES,(g) the other one of the heterologous polynucleotide encoding IBDV VP2 and the heterologous polynucleotide encoding ILTV gD; and(h) polyA signal motif;or(a) a polyA signal motif;(b) an exogenous promoter;(c) one of the heterologous polynucleotide encoding IBDV VP2 and the heterologous polynucleotide encoding ILTV gD;(d) a stop codon,(e) an IRES,(f) the other one of the heterologous polynucleotide encoding IBDV VP2 and the heterologous polynucleotide encoding ILTV gD;(g) a polyA signal motif or polyA signal motifs;(h) an FRT site; and(i) a polyA signal motif.10.The recombinant MDV of claim 8 or 9, wherein the exogenous promoter is an mCMV promoter.11.The recombinant MDV of anyone of claims 8 to 10, wherein the polyA signal motif upstream to the promoter is an artificial reverse tandem polyA signal motif,e.g., the reverse tandem polyA signal motif comprises or consists of a sequence of :(i) a nucleotide sequence set forth in SEQ ID NO: 16;(ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or(iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,and can promote the termination of the encountered transcriptional elongation.12.The recombinant MDV of anyone of claims 8 to 11, wherein the polyA signal motifs downstream to the heterologous polynucleotides are a combination of a novel bidirectional artificial polyA signal motif and an MDV39 / 40-intergenic bidirectional polyA signal motif in tandem;e.g., the novel bidirectional artificial polyA signal motif comprises or consists of :(i) a nucleotide sequence set forth in SEQ ID NO: 17;(ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or(iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,and can promote the termination of the encountered transcriptional elongation,and / orthe MDV39 / 40-intergenic bidirectional polyA signal motif comprises or consists of :(i) a nucleotide sequence set forth in SEQ ID NO: 19;(ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or(iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,and can promote the termination of the encountered transcriptional elongation.13.The recombinant MDV of any one of claims 4-12, wherein the second cassette is expressed in the same orientation as UL55 gene.14.The recombinant MDV of anyone of claims 8 to 13, wherein the polyA signal motif upstream to the promoter is an MDV CVI988 MDV89 gene polyA signal motif upstream to the promoter,e.g., the MDV CVI988 MDV89 gene polyA signal motif comprises or consists of :(i) a nucleotide sequence set forth in SEQ ID NO: 18;(ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or(iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,and can promote the termination of the encountered transcriptional elongation.15.The recombinant MDV of claim 10 or 14, wherein the polyA signal motifs downstream to the heterologous polynucleotides are a combination of a novel bidirectional artificial polyA signal motif, an MDV39 / 40-intergenic bidirectional polyA signal motif and an artificial reverse tandem polyA signal motif in tandem downstream to the heterologous polynucleotides,e.g., the novel bidirectional artificial polyA signal motif comprises or consists of :(i) a nucleotide sequence set forth in SEQ ID NO: 17;(ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or(iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,and can promote the termination of the encountered transcriptional elongation,the MDV39 / 40-intergenic bidirectional polyA signal motif comprises or consists of :(i) a nucleotide sequence set forth in SEQ ID NO: 19;(ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or(iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,and can promote the termination of the encountered transcriptional elongation, and / orthe reverse tandem polyA signal motif comprises or consists of :(i) a nucleotide sequence set forth in SEQ ID NO: 16;(ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or(iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,and can promote the termination of the encountered transcriptional elongation.16.The recombinant MDV of any one of claims 4-10 and 14-15, wherein the second cassette is expressed in the same orientation as MDV71 gene.MDV17.The recombinant MDV of any one of claims 7-16, wherein the promoter comprises or consists of a sequence of SEQ ID NO: 14 or 20,or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 or 20 and can bind an RNA polymerase to initiate transcription.18.The recombinant MDV of any one of claims 6-17, wherein the IRES element comprises or consists of a sequence of SEQ ID NO: 15,or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 15 and can recruit the ribosome to initiate the translation.19.The recombinant MDV of any one of claims 6-18, wherein the amino acid sequence at the protease cleavage site of the NDV F antigen has been mutated,preferably, said NDV F antigen(a) is encoded by the heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 4, 2, or 3, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 4, 2, or 3, and / or(b) comprises or consists of an amino acid sequence as shown in SEQ ID NO: 1, or an amino acid sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 1.20.The recombinant MDV of any one of claims 3-19, wherein the IBDV VP2 antigen is an VP2 antigen from vvIBDV or nVar IBDV, preferably said IBDV VP2 antigen(a) is encoded by the heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 7, 6, 9 or 10, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 7, 6, 9 or 10, and / or(b) comprises or consists of an amino acid sequence as shown in SEQ ID NO: 5 or 8, or an amino acid sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 5 or 8.21.The recombinant MDV of any one of claims 3-20, wherein the ILTV gD antigen(a) is encoded by the heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 12 or 13, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 12 or 13, and / or(b) comprises or consists of an amino acid sequence as shown in SEQ ID NO: 11, or an amino acid sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 11.22.The recombinant MDV of any one of claims 4-21, wherein:the first cassette comprises or consists of in 5’ to 3’ direction and in this order:(a) a stop codon, e.g., SEQ ID NO: 57;(b) an optimized IRES, e.g., an IRES as defined in claim 18;(c) a heterologous polynucleotide encoding cleavage site-mutated NDV F, e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 4, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity,preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 4;or(a) a novel bidirectional artificial polyA signal motif, e.g., a novel bidirectional artificial polyA signal motif as defined in claim 12;(b) an exogenous promoter same with an MDV endogenous UL26.5 promoter, e.g., a promoter comprises or consists of a sequence of SEQ ID NO: 20, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 20 and can bind an RNA polymerase to initiate transcription;(c) a Kozak sequence, e.g., SEQ ID NO: 60;(d) a heterologous polynucleotide encoding cleavage site-mutated NDV F, e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 4, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 4;(e) a polyadenylation signal core sequence, e.g., SEQ ID NO: 61;(f) an MDV39 / 40-intergenic bidirectional polyA signal motif, e.g., an MDV39 / 40-intergenic bidirectional polyA signal motif as defined in claim 12;and / orthe second cassette comprises or consists of in 5’ to 3’ direction and in this order:(a) an artificial reverse tandem polyA signal motif, e.g., an artificial reverse tandem polyA signal motif as defined in claim 11;(b) an FRT site;(c) an mCMV promoter, e.g., an mCMV promoter comprising or consisting of a sequence of SEQ ID NO: 14, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription;(d) a heterologous polynucleotide encoding IBDV VP2 antigen, e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 7, 6, 9 or 10, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 7, 6, 9 or 10;(e) a stop codon, e.g., SEQ ID NO: 58;(f) an optimized IRES, e.g., an IRES as defined in claim 18;(g) a heterologous polynucleotide encoding ILTV gD antigen, e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 12, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 12; and(h) a combination of a novel bidirectional artificial polyA signal motif and an MDV39 / 40-intergenic bidirectional polyA signal motif in tandem, e.g., a combination of a novel bidirectional artificial polyA signal motif as defined in claim 12 and an MDV39 / 40-intergenic bidirectional polyA signal motif as defined in claim 12 in tandem;or(a) a MDV CVI988 MDV89 gene polyA signal motif, e.g., a MDV CVI988 MDV89 gene polyA signal motif as defined in claim 14;(b) an mCMV promoter, e.g., an mCMV promoter comprising or consisting of a sequence of SEQ ID NO: 14, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription;(c) a heterologous polynucleotide encoding IBDV VP2 antigen, e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 6, 7, 9 or 10, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 6, 7, 9 or 10;(d) a stop codon, e.g., SEQ ID NO: 58;(e) an optimized IRES, e.g., an IRES as defined in claim 18;(f) a heterologous polynucleotide encoding ILTV gD antigen, e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 12 or 13, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 12 or 13; and(g) a combination of a novel bidirectional artificial polyA signal motif and an MDV39 / 40-intergenic bidirectional polyA signal motif in tandem, e.g., a combination of a novel bidirectional artificial polyA signal motif as defined in claim 12 and an MDV39 / 40-intergenic bidirectional polyA signal motif as defined in claim 12 in tandem;(h) an FRT site;(i) an artificial reverse tandem polyA signal motif, e.g., an artificial reverse tandem polyA signal motif as defined in claim 11.23.The recombinant MDV of any one of claims 4-22, wherein:the first cassette comprises or consists of SEQ ID NO: 31 or 35, and / or the second cassette comprises or consists of SEQ ID NO: 32, 33 or 56.24.The recombinant MDV of claim 1, wherein the MDV comprises a heterologous polynucleotide encoding a polypeptide selected from the group consisting of an Infectious Bursal Disease Virus (IBDV) VP2 antigen, an Infectious Laryngotracheitis Virus (ILTV) glycoprotein D (gD) antigen and a Newcastle Disease Virus F (NDV F) antigen.25.The recombinant MDV of claim 1, wherein the heterologous polynucleotide encodes NDV F antigen.26.The recombinant MDV of claim 25, wherein NDV F antigen is as defined in claim 19.27.The recombinant MDV of any of claims 1-26, wherein said heterologous polynucleotide is operably linked to the endogenous UL26 promoter of MDV and / or the endogenous UL26.5 promoter of MDV, and expresses in an orientation same with the orientation of UL26,optionally, said heterologous polynucleotide is linked at its 5’ end to the flanking sequence of the insertion site via an IRES element or a self-cleaving peptide-coding sequence.28.The recombinant MDV of claim 27, wherein said IRES element is as defined in claim 18.29.The recombinant MDV of any of claims 1-26, wherein said heterologous polynucleotide is operably linked to a non-endogenous promoter.30.The recombinant MDV of claim 1, wherein the MDV comprises two heterologous polynucleotides, and whereinthe first polynucleotide comprises or consists of a polynucleotide encoding a polypeptide selected from the group consisting of an IBDV VP2 antigen, an ILTV gD antigen and an NDV F antigen, and whereinthe second polynucleotide comprises or consists of a polynucleotide encoding a polypeptide selected from the group consisting of an IBDV VP2 antigen, an ILTV gD antigen and an NDV F antigen.31.A recombinant MDV comprising a heterologous polynucleotide encoding IBDV VP2 antigen, wherein, the IBDV VP2 antigen is an VP2 antigen from nVar IBDV, which:(a) is encoded by the heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 10 or 9, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 10 or 9, and / or(b) comprises or consists of an amino acid sequence as shown in SEQ ID NO: 8, or an amino acid sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 8,optionally, the heterologous polynucleotide inserted at an insertion site located in the intergenic region between UL26 and UL27 genes, or an insertion site located in the intergenic region between UL55 and MDV71 genes, preferably an insertion site located in the intergenic region between UL55 and MDV71 genes,preferably, the MDV further comprises an exogenous promoter optionally linked to the heterologous polynucleotide.32.A recombinant MDV comprising a heterologous polynucleotide encoding IBDV VP2 antigen and a heterologous polynucleotide encoding ILTV gD antigen,wherein, the IBDV VP2 antigen is encoded by the heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 7, 10, 6 or 9, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 7, 10, 6 or 9, and / orwherein, the ILTV gD antigen is encoded by the heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 13 or 12, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 13 or 12;optionally, the heterologous polynucleotides are inserted at an insertion site located in the intergenic region between UL55 and MDV71 genes;preferably, wherein, the heterologous polynucleotide encoding IBDV VP2 antigen and the heterologous polynucleotide encoding ILTV gD antigen are operably linked to each other via:an IRES element, ora stop codon+IRES (a stop codon 5’ upstream to, preferably directly 5’ flanking the IRES) , ora self-cleaving peptide-coding sequence, preferably an IRES element, ora stop codon+ self-cleaving peptide-coding sequence (a stop codon 5’ upstream to, preferably directly 5’ flanking the self-cleaving peptide-coding sequence) .33.The recombinant MDV of claim 31 or 32, wherein the exogenous promoter is an mCMV promoter.34.The recombinant MDV of any one of claims 31-33, wherein the heterologous polynucleotide or heterologous polynucleotides are operably linked to one or more (e.g., one, two, or three in tandem) non-endogenous polyA signal motifs upstream and / or downstream to the heterologous polynucleotide or heterologous polynucleotides.35.The recombinant MDV of claim 32, wherein the heterologous polynucleotide is operably linked to an artificial reverse tandem polyA signal motif located upstream to the promoter,wherein the reverse tandem polyA signal motif is as defined in claim 11.36.The recombinant MDV of claim 32 or 33, wherein the heterologous polynucleotide or heterologous polynucleotides are operably linked to a novel bidirectional artificial polyA signal motif and an MDV39 / 40-intergenic bidirectional polyA signal motif in tandem located downstream to the heterologous polynucleotide or the heterologous polynucleotides,wherein the novel bidirectional artificial polyA signal motif is as defined in claim 12, and the MDV39 / 40-intergenic bidirectional polyA signal motif is as defined in claim 12.37.The recombinant MDV of any one of claims 29-34, wherein the heterologous polynucleotide is expressed in the same orientation as UL55 gene.38.An optimized IRES element, which comprises or consists of a sequence of SEQ ID NO: 15, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 15 and can recruit the ribosome to initiate the translation.39.An artificial reverse tandem polyA signal motif, which comprises or consists of :(i) a nucleotide sequence set forth in SEQ ID NO: 16;(ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or(iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,and can promote the termination of the encountered transcriptional elongation.40.A novel bidirectional artificial polyA signal motif, which comprises or consists of :(i) a nucleotide sequence set forth in SEQ ID NO: 17;(ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or(iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,and can promote the termination of the encountered transcriptional elongation.41.An MDV CVI988 MDV89 gene polyA signal motif, which comprises or consists of :(i) a nucleotide sequence set forth in SEQ ID NO: 18;(ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or(iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,and can promote the termination of the encountered transcriptional elongation.42.An MDV39 / 40-intergenic bidirectional polyA signal motif, which comprises or consists of :(i) a nucleotide sequence set forth in SEQ ID NO: 19;(ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or(iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,and can promote the termination of the encountered transcriptional elongation.43.Use of one or more of the following elements in the manufacture of recombinant MDVs comprising at least one or more heterologous polynucleotide encoding an antigen of an avian pathogen:(1) the IRES element of claim 38,(2) endogenous UL26 promoter of MDV, comprising or consisting of a sequence of SEQ ID NO: 21, or a sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 21 and can bind an RNA polymerase to initiate transcription;(3) endogenous UL26.5 promoter of MDV, comprising or consisting of a sequence of SEQ ID NO: 20, or a sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 20 and can bind an RNA polymerase to initiate transcription;(4) endogenous UL26 polyA signal of MDV, comprising or consisting of a sequence of SEQ ID NO: 22, or a sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 22;(5) mCMV promoter, comprising or consisting of a sequence of SEQ ID NO: 14, or a sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription;(6) the polyA signal motif of claim 39;(7) the polyA signal motif of claim 40;(8) the polyA signal motif of claim 41;(9) the polyA signal motif of claim 42,wherein, said at least one or more heterologous polynucleotides are operably linked to said one or more elements and / or are regulated thereby.44.The use of claim 43, wherein the at least one or more heterologous polynucleotides encode NDV F antigen, and / or the IBDV VP2 antigen, and / or the ILTV gD antigen.45.The use of claim 43 or 44, wherein the recombinant MDV is the recombinant MDV of any one of claims 1-35.46.An expression cassette, comprising one or more of the following elements:(1) the IRES element of claim 38,(2) the polyA signal motif of claim 39;(3) the polyA signal motif of claim 40;(4) the polyA signal motif of claim 41;(5) the polyA signal motif of claim 42,and one or more heterologous polynucleotides encoding an antigen of an avian pathogen,preferably, the one or more heterologous polynucleotides encodes one or more polypeptides selected from the group consisting of an IBDV VP2 antigen, an ILTV gD antigen and an NDV F antigen, e.g., one or two.47.The expression cassette of claim 46, which further comprises one or more of the following elements:(1) mCMV promoter as defined in claim 41;(2) a promoter having a same sequence with the sequence of endogenous UL26 promoter of MDV, e.g., the endogenous UL26 promoter of MDV as defined in claim 41;(3) a promoter having a same sequence with the sequence of endogenous UL26.5 promoter of MDV, e.g., the endogenous UL26.5 promoter of MDV as defined in claim 41;(4) a polyA signal motif having a same sequence with the sequence of endogenous UL26 polyA signal motif of MDV, e.g., the endogenous UL26 polyA signal motif of MDV as defined in claim 41;(5) FRT site, e.g., comprising or consisting of a sequence of SEQ ID NO: 30, preferably a nonfunctioning FRT site.48.The expression cassette of claim 46 or 47, wherein, the NDV F antigen is as defined in claim 19, and / or the IBDV VP2 antigen is as defined in claim 21, 29 or 30, and / or the ILTV gD antigen is as defined in claim 22 or 30.49.A recombinant MDV comprising the expression cassette of any one of claims 46-48.50.The recombinant MDV of any one of claims 1-37 and 49, wherein the MDV comprises MDV-1, MDV-2, MDV-3 (herpesvirus of turkeys, HVT) or any combinations thereof.51.The recombinant MDV of any one of claims 1-37 and 49, wherein the MDV comprises HVT, e.g., strain FC-126, or any prevalent strain or their attenuated strain by passaging, mutagenesis, and / or genetic engineering.52.The recombinant MDV of any one of claims 1-37 and 49, wherein the MDV comprises MDV-1, e.g., strain CVI-988, strain CVTR, strain SC9-1, or strain 814, or any prevalent strain or their attenuated strain by passaging, mutagenesis, and / or genetic engineering.53.The recombinant MDV of any one of claims 1-37 and 49, wherein the MDV comprises MDV-2, e.g., strain SB-1, or any prevalent strain or their attenuated strain by passaging, mutagenesis, and / or genetic engineering.54.The recombinant MDV of any one of claims 1-37 and 49-53, wherein(i) when the MDV comprises HVT FC-126, said insertion site in the intergenic region between UL26 and UL27 genes is located in the region between the FC-126 genome DNA sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and ctatacaatttcatcatccgtctcagaatccgtgtcgttt (SEQ ID NO: 25) ;(ii) when the MDV comprises MDV1, MDV2 or HVT strains other than FC-126, said insertion site in the intergenic region between UL26 and UL27 genes is located in the genome region which is corresponding to the region between FC-126 genome DNA sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and ctatacaatttcatcatccgtctcagaatccgtgtcgttt (SEQ ID NO: 25) .55.The recombinant MDV of claim 54, wherein the MDV is HVT FC-126, and the flanking sequence of the insertion site is the same with or reverse complementary to a sequence that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with at least part of SEQ ID NO: 36, wherein the flanking sequence is the upstream flanking sequence or the downstream flanking sequence.56.The recombinant MDV of claim 54, wherein(i) when the MDV comprises HVT FC-126, said insertion site in the intergenic region between UL26 and UL27 genes is located at the site between the FC-126 genome DNA sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and aaagcggtgtgttaatgtcagagagctgta (SEQ ID NO: 24) , i.e., between the 30th nucleotide and the 31st nucleotide of the sequence as shown in SEQ ID NO: 36;(ii) when the MDV comprises MDV1, MDV2 or HVT strains other than FC-126, said insertion site in the intergenic region between UL26 and UL27 genes is located at the site which is corresponding to the site between FC-126 genome DNA sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and aaagcggtgtgttaatgtcagagagctgta (SEQ ID NO: 24) .57.The recombinant MDV of any one of claims 1-37 and 49-56, wherein(i) when the MDV comprises HVT FC-126, said insertion site in the intergenic region between UL55 and MDV71 genes is located in the region between the FC-126 genome DNA sequences atcgctatgcaaagagatgcgtgtgtacacgcgccgttga (SEQ ID NO: 26) and ttaagatgcaggagtaacaatgtgcatagtaggcgtagtt (SEQ ID NO: 29) ;(ii) when the MDV comprisesMDV1, MDV2 or HVT strains other than FC-126, said insertion site in the intergenic region between UL55 and MDV71 genes is located in the genome region which is corresponding to the region between FC-126 genome DNA sequences atcgctatgcaaagagatgcgtgtgtacacgcgccgttga (SEQ ID NO: 26) and ttaagatgcaggagtaacaatgtgcatagtaggcgtagtt (SEQ ID NO: 29) .58.The recombinant MDV of claim 57, wherein the MDV is HVT FC-126, and the flanking sequence of the insertion site is the same with or reverse complementary to a sequence that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with at least part of SEQ ID NO: 37, wherein the flanking sequence is the upstream flanking sequence or the downstream flanking sequence.59.The recombinant MDV of claim 58, wherein(i) when the MDV comprises HVT FC-126, said insertion site in the intergenic region between UL55 and MDV71 genes is located at the site between the FC-126 genome DNA sequences tatatgttattaaataaaataattgaccagtgaacaattt (SEQ ID NO: 27) and gtttaatgttagtttattcaatgcattggttgcaaatatt (SEQ ID NO: 28) , i.e., between the 118th nucleotide and the 119th nucleotide of the sequence as shown in SEQ ID NO: 37;(ii) when the MDV comprises MDV1, MDV2 or HVT strains other than FC-126, said insertion site in the intergenic region between UL55 and MDV71 genes is located at the site which is corresponding to the site between FC-126 genome DNA sequences tatatgttattaaataaaataattgaccagtgaacaattt (SEQ ID NO: 27) and gtttaatgttagtttattcaatgcattggttgcaaatatt (SEQ ID NO: 28) .60.virus particles comprising the recombinant MDV of any one of claims 1-37 and 49-59 encapsulated by the protein coat.61.A host cell comprising the recombinant MDV of any one of claims 1-37 and 49-59, or the virus particles of claim 60.62.A composition or vaccine comprising the recombinant MDV of any one of claims 1-37 and 49-59, the virus particles of claim 60, and / or the host cell of claim 61, optionally further comprising a pharmaceutically or veterinarily acceptable carrier, excipient, vehicle or adjuvant.63.A combination comprising the recombinant MDV of any one of claims 1-37 and 49-59, the virus particles of claim 60, the host cell of claim 61, and / or the composition or vaccine of claim 62, wherein the combination further comprises other agents.64.The recombinant MDV of any one of claims 1-37 and 49-59, the virus particles of claim 60, the host cell of claim 61, the composition or vaccine of claim 62, and / or the combination of claim 63 for use in the prophylaxis and / or treatment of against one or more avian pathogens in an animal, preferably, the avian pathogen is selected from the group consisting of Newcastle Disease Virus (NDV) , Infectious Bursal Disease Virus (IBDV) , Infectious Laryngotracheitis Virus (ILTV) , avian encephalomyelitis virus, avian reovirus, avian paramyxovirus, avian metapneumovirus, avian adenovirus, fowl pox virus, avian coronavirus, avian rotavirus, avian parvovirus, avian astrovirus and chick anemia virus coccidiosis (Eimeria sp. ) , Campylobacter sp., Salmonella sp., Mycoplasma gallisepticum, Mycoplasma synoviae, Pasteurella sp., Avibacterium sp., E. coli and Clostridium sp.65.Use of the recombinant MDV of any one of claims 1-37 and 49-59, the virus particles of claim 60, the host cell of claim 61, the composition or vaccine of claim 62, and / or the combination of claim 63 for the prophylaxis and / or treatment of against one or more avian pathogens in an animal.66.Use of the recombinant MDV of any one of claims 1-37 and 49-59, the virus particles of claim 60, the host cell of claim 61, the composition or vaccine of claim 62, and / or the combination of claim 63 in the manufacture of vaccines or immunological preparations vaccinating, or inducing an immune or protective response in an animal against one or more avian pathogens.67.A method of vaccinating, or inducing an immune or protective response in an animal against one or more avian pathogens, comprising at least one administration of the recombinant MDV of any one of claims 1-37 and 49-59, the virus particles of claim 60, the host cell of claim 61, the composition or vaccine of claim 62, and / or the combination of claim 63.68.The use of claim 65 or 66 or the method of claim 67, wherein the avian pathogen is selected from the group consisting of Newcastle Disease Virus (NDV) , Infectious Bursal Disease Virus (IBDV) , Infectious Laryngotracheitis Virus (ILTV) , avian encephalomyelitis virus, avian reovirus, avian paramyxovirus, avian metapneumovirus, avian adenovirus, fowl pox virus, avian coronavirus, avian rotavirus, avian parvovirus, avian astrovirus and chick anemia virus coccidiosis (Eimeria sp. ) , Campylobacter sp., Salmonella sp., Mycoplasma gallisepticum, Mycoplasma synoviae, Pasteurella sp., Avibacterium sp., E. coli and Clostridium sp.69.A method of construction of recombinant herpes virus, comprising:(1) constructing infectious clones of said recombinant herpes virus in E. coli by recombineering, wherein the genome of said recombinant herpes virus carries a vector comprising replicons and screening tags for E. coli, and wherein the vector is linked to FRT sites at its both ends,(2) eliminating the vector sequence by the recombination between the two FRT sites mediated by FLP recombinase in E. coli expressing FLP recombinase, to obtain the circular genome of the recombinant herpes virus,(3) infecting susceptible cells using the circular genome of the recombinant herpes virus, and then rescuing the recombinant herpes virus to obtain a pure culture.70.The method of claim 69, wherein the recombinant herpes virus is the recombinant MDV of any one of claims 1-37 and 49-59.71.The use of the method of claim 69 or 70 in the preparation of the recombinant MDV of any one of claims 1-37 and 49-59.

Images