Gene editing locus for stable and efficient expression of exogenous gene
Patent Information
- Application Number
- PCT/CN2026/085472
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-03-25
- Filing Date
- 2026-03-24
- Publication Date
- 2026-10-01
Smart Images

Figure CN2026085472_01102026_PF_FP_ABST
Abstract
Description
A gene editing site for stable and efficient expression of exogenous genes
[0001] Cross-reference to related applications
[0002] This application claims priority to the earlier application filed on March 25, 2025, with patent application number 202510360027.X and entitled "A Gene Editing Site for Stable and Efficient Expression of Exogenous Genes". The entire contents of the earlier application are incorporated herein by reference. Technical Field
[0003] This invention relates to the field of gene editing technology, and in particular to a gene editing site that stably and efficiently expresses exogenous genes. Background Technology
[0004] With advancements in medical science and technology, cell gene therapy is increasingly emerging as a new treatment approach, offering novel treatment options for rare diseases, genetic diseases, and tumors, thus transforming traditional treatment models. It utilizes living cells as drugs for disease treatment, modifying or replacing the genes of these cells to induce desired biological characteristics and ultimately achieve therapeutic effects. Common gene replacement methods can be implemented virally or non-virally. Viral methods can lead to random integration of exogenous genes and generate unwanted immune responses, impacting treatment outcomes. Non-viral methods allow for targeted integration of exogenous genes into the cell genome, resulting in safe and stable live cells expressing the exogenous gene. However, non-viral methods require more precise selection of the gene integration site.
[0005] Currently, those skilled in the art have identified several gene loci suitable for site-specific integration of exogenous genes, such as the AAVS1 locus, the B2M gene, the CCR5 gene, the CIITA gene, and rDNA regions (human ribosomal DNA regions). Among these, the AAVS1 gene locus is located within the PPP1R12C gene on human chromosome 19. Insertion of exogenous genes at this locus does not disrupt normal cellular function, exhibiting good stability and low oncogenicity; this locus is commonly used in existing technologies. The rDNA region contains 600-800 copies in the human genome. Addition or removal of genes from the rDNA region does not cause phenotypic abnormalities and is stably inherited, making it a suitable gene region for site-specific integration. Furthermore, its high copy number allows for increased efficiency in gene integration, facilitating more efficient site-specific homologous recombination and resulting in stable clones of exogenous genes with site-specific integration.
[0006] However, existing gene loci suitable for targeted integration of exogenous genes still have many shortcomings in practice. For example, they are significantly deficient in terms of safety, expression efficiency, and regulatory flexibility, and cannot meet the needs of actual treatment. Therefore, it is necessary to screen and identify novel loci with low risk and high expression potential to break through the bottleneck and meet the needs of precision and personalized gene therapy. Summary of the Invention
[0007] Based on the aforementioned problems, the inventors of this application previously developed a gene editing site suitable for site-specific integration of exogenous genes, namely the B2M locus. When the exogenous gene is a secretory protein, especially in mesenchymal stem cells, site-specific integration at the B2M locus achieved better integration efficiency and higher expression levels, far superior to gene editing sites such as AAVS1, CCR5, rDNA region, ROSA26, HTRP, H11, and TCR published in the prior art. Building upon this, the inventors of this application further optimized and screened gene editing sites, selecting a site in the Human Reference Genome 38 (GRCh38 / hg38) human genome with coordinates within NC_000015.10:44718549-44719549 as the site-specific integration site. Preferably, the gene locus with coordinates NC_000015.10:44719049 was selected as the site-specific integration site, achieving higher site-specific integration efficiency and higher exogenous gene expression levels compared to the B2M locus previously developed by the inventors.
[0008] In a first aspect, the present invention provides an engineered cell, wherein at least one exogenous polynucleotide is site-specifically integrated into the genome of the engineered cell; the genomic site for site-specific integration of the engineered cell is selected from gene sites in the human genome of Human Reference Genome 38 (GRCh38 / hg38) with coordinates within NC_000015.10:44718549-44719549.
[0009] In one embodiment of the present invention, the engineered cell selects the gene locus with coordinates NC_000015.10:44719049 as the site of integration.
[0010] In one embodiment of the present invention, the engineered cell is a human cell.
[0011] In one embodiment of the present invention, the engineered cells are mesenchymal stem cells, and / or iPSC cells and their derivatives.
[0012] In one embodiment of the present invention, the mesenchymal stem cells are derived from adult cells or stem cells.
[0013] In one embodiment of the present invention, the mesenchymal stem cells are derived from pluripotent stem cells, and more preferably, the pluripotent stem cells are selected from induced pluripotent stem cells.
[0014] In one embodiment of the present invention, the mesenchymal stem cells are derived from bone marrow, fat, muscle, heart, umbilical cord blood, or umbilical cord.
[0015] In one embodiment of the present invention, the derived cells are selected from CAR-iNK, dopaminergic neural progenitor cells, CAR-iMac, cardiomyocytes, endothelial progenitor cells, iNK cells, retinal cells, nerve cells, osteoblasts, hematopoietic stem cells, mesenchymal stem cells, blood cells, T cells, β cells, fibroblasts, hair cells, monocytes, macrophages, Treg cells, renal progenitor cells, lung epithelial cells, endothelial cells, megakaryocytes, smooth muscle cells, skeletal muscle cells, chondrocytes, osteocytes, adipocytes, hepatocytes, pancreatic islet cells, keratinocytes, melanocytes, or dendritic cells.
[0016] In one embodiment of the present invention, the exogenous polynucleotide encodes a secretory protein or a membrane protein.
[0017] In one embodiment of the present invention, the secretory protein includes one or more of the following: immune checkpoint inhibitors, TNF-α inhibitors, GLP-1 receptor agonists, growth hormones, coagulation factors, interleukins, insulin, interferon, tumor necrosis factor, enzymes, and growth factors.
[0018] In one embodiment of the present invention, the membrane protein includes one or more of transmembrane receptors, ion channels, transport proteins, cell adhesion molecules, membrane anchoring enzymes, major histocompatibility complex (MHC), and membrane-bound cytokine receptors.
[0019] In one embodiment of the present invention, compared to the B2M gene editing site, site-specific integration at the aforementioned gene editing site (or B3 gene editing site) results in higher integration efficiency of exogenous polynucleotides. In one embodiment of the present invention, site-specific integration at the B3 gene editing site, compared to the B2M gene editing site, increases integration efficiency by at least 7 times. In one embodiment of the present invention, the integration efficiency of exogenous polynucleotides can reach 87.5%.
[0020] In one embodiment of the present invention, site-specific integration at the B3 gene editing site, relative to the B2M gene editing site, results in engineered cells exhibiting significantly higher protein expression levels. In another embodiment of the present invention, site-specific integration at the B3 gene editing site, relative to the B2M gene editing site, increases protein expression levels by up to 2000 times.
[0021] In one embodiment of the present invention, compared with the B2M gene editing site, targeted integration is performed at the B3 gene editing site, resulting in engineered cells expressing proteins with a higher tumor apoptosis rate and a better inhibitory effect on tumor growth. In another embodiment of the present invention, compared with the B2M gene editing site, targeted integration is performed at the B3 gene editing site, resulting in engineered cells exhibiting better anti-tumor activity.
[0022] In a second aspect, the present invention provides a method for editing engineered cells, wherein at least one exogenous polynucleotide is site-specifically integrated into a genomic locus of the engineered cell; the genomic locus for site-specific integration of the engineered cell is selected from gene loci in the Human Reference Genome 38 (GRCh38 / hg38) human genome with coordinates in the range of NC_000015.10:44718549-44719549.
[0023] In one embodiment of the present invention, the engineered cell is the engineered cell described above.
[0024] In one embodiment of the present invention, the method includes cutting genome editing sites using a gene editing system and performing gene knockout, knock-in, or modification through homologous recombination or non-homologous end joining.
[0025] In one embodiment of the present invention, the gene editing system is not limited to any one of the CRISPR / Cas system, TALEN system, or ZFN system.
[0026] In a third aspect, the present invention provides a pharmaceutical composition comprising the engineered cells described above.
[0027] In a fourth aspect, the present invention provides a method for improving the site-specific integration efficiency or expression level of exogenous polynucleotides, wherein at least one exogenous polynucleotide is site-specifically integrated into a genomic site in engineered cells; wherein the genomic site for site-specific integration in the engineered cells is selected from gene sites in the human genome of Human Reference Genome 38 (GRCh38 / hg38) with coordinates within NC_000015.10:44718549-44719549.
[0028] In a fifth aspect, the present invention provides a gene editing method, wherein the method uses a gene editing system to cut at a gene editing site and achieves the knockout, knock-in, or modification of a target gene through homologous recombination or non-homologous end joining.
[0029] The gene editing sites are selected from gene sites in the human genome of Human Reference Genome Version 38 (GRCh38 / hg38) with coordinates within NC_000015.10:44718549-44719549.
[0030] In one embodiment of the present invention, the gene editing system comprises:
[0031] (i) a targeting component, said targeting component being capable of specifically binding to a targeting sequence at the gene editing site; and
[0032] (ii) an effector component capable of cleaving or modifying the target sequence.
[0033] In one embodiment of the present invention, the targeting component is a sequence that is complementary to the targeting sequence, such as sgRNA, zinc finger protein, or TALE repeat module.
[0034] In one embodiment of the present invention, the effector component is a nuclease, which includes, but is not limited to, recognition sequences of zinc finger nucleases, transcription activator-like effector nucleases, homing endonucleases, Cas proteins, Cpf1 proteins, or combinations thereof.
[0035] In one embodiment of the present invention, the Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5d, Cas5t, Cas5h, Cas5a, Cas6, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2, Csy3, Csy4, Cse1, Cse2, Cse3, Cse4, Cse5e, Csc1, Csc2, Csa5, Csn1, Csn2, Csm1, Csm2, Csm3, Csm4, Csm5, and Csm6. Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx1S, Csf1, Csf2, CsO, Csf4, Csd1, Csd2, Cst1, Cst2, Csh1, Csh2, Csa1, Csa2, Csa3, Csa4, Csa5, C2c1, C2c2, C2c3, Cpf1, CARF, DinG, their homologs, or their modified forms.
[0036] In a sixth aspect, the present invention provides the use of the above-described engineered cells and pharmaceutical composition in the preparation of a drug for treating diseases.
[0037] In one embodiment of the present invention, the diseases include, but are not limited to, cell proliferative diseases such as tumors, melanoma, non-small cell lung cancer, renal cell carcinoma, colorectal cancer, breast cancer, pancreatic cancer, head and neck cancer, and other solid tumors; hematologic diseases such as leukemia, anemia, lymphoma, hemophilia, leukopenia, thrombocytopenia, angiogenesis disorders, Kaposi's sarcoma, etc.; autoimmune diseases such as Crohn's disease, ulcerative colitis, allergies, inflammatory bowel disease, arthritis, psoriasis, respiratory inflammation, asthma, and organ transplant rejection, etc.; metabolic diseases such as diabetes, growth hormone deficiency, and growth retardation in children, etc.; infections, including viral infections, bacterial infections, fungal infections, and parasitic infections, such as hepatitis B, hepatitis B and hepatitis C, etc.; digestive system diseases such as indigestion, pancreatic diseases, etc.; and skin injuries such as trauma, burns, etc.
[0038] In a seventh aspect, the present invention provides a reagent for editing exogenous polynucleotides at a gene editing site, the reagent comprising a sequence capable of recognizing the gene editing site, wherein the gene editing site is selected from the human genome of Human Reference Genome Version 38 (GRCh38 / hg38) at coordinates within NC_000015.10:44718549-44719549.
[0039] In one embodiment of the present invention, the gene editing site is selected from the gene site with coordinates NC_000015.10:44719049.
[0040] In one embodiment of the present invention, the reagent includes a construct and a gene editing system.
[0041] In one embodiment of the present invention, the construct and gene editing system are introduced into cells for gene editing.
[0042] In one embodiment of the present invention, the cell is the engineered cell described in the first aspect above, and the gene editing system is the gene editing system described in the fifth aspect above.
[0043] In an eighth aspect, the present invention provides the use of the above-described reagent in the preparation of a medicament for treating diseases.
[0044] In one embodiment of the present invention, the drug is the engineered cell described in the first aspect or the pharmaceutical composition described in the third aspect, and the disease is the disease described in the sixth aspect.
[0045] Compared with the prior art, the present invention has the following beneficial effects:
[0046] This invention is the first to discover gene editing sites that can stably and efficiently express exogenous genes. The sites are selected from the coordinates of the human genome in Human Reference Genome Version 38 (GRCh38 / hg38) within the range of NC_000015.10:44718549-44719549; preferably, the gene site with coordinates of NC_000015.10:44719049 is selected, namely the B3 site described herein.
[0047] This invention integrates various exogenous genes into the B3 site, achieving better technical results compared to the B2M site. The targeted integration of exogenous genes into the B3 site reduces the amount of cells needed for actual treatment, minimizes side effects caused by excessive cell usage, improves the safety of cell therapy, and saves on treatment costs. Attached Figure Description
[0048] Figure 1 shows the core element of the plasmid vector in Embodiment 1 of the present invention.
[0049] Figure 2 is a schematic diagram of the plasmid vector and B2M site-directed integration in Embodiment 2 of the present invention.
[0050] Figure 3 is a schematic diagram of the plasmid vector and B3 site-specific integration in Example 2 of this discovery.
[0051] Figure 4 shows the electrophoresis diagram of the PCR products of the B2M-WT-IL-2-iPSCs clones that were identified and integrated at the B2M site in Example 2 of this discovery, spanning the upstream and downstream homologous arms.
[0052] Figure 5 shows the expression and secretion of B2M-WT-IL-2-iPSCs representative clones in Example 2 of this discovery.
[0053] Figure 6 shows the electrophoresis diagram of the PCR products of the B2M-IL-2v-iPSCs clones that were identified and integrated at the B2M site in Example 2 of this discovery, spanning the upstream and downstream homologous arms.
[0054] Figure 7 shows the expression and secretion of B2M-IL-2v-iPSCs representative clones in Example 2 of the present invention.
[0055] Figure 8 is an electrophoresis diagram of the PCR products of the B3-WT-IL-2-iPSCs clone identified and integrated at the B3 site in Example 2 of this invention, spanning the upstream and downstream homologous arms.
[0056] Figure 9 shows the expression and secretion of B3-WT-IL-2-iPSCs representative clones in Example 2 of the present invention.
[0057] Figure 10 is an electrophoresis diagram of the PCR products of B3-IL-2v-iPSCs clones that were identified and integrated at the B3 site in Example 2 of this invention, spanning the upstream and downstream homologous arms.
[0058] Figure 11 shows the expression and secretion of B3-IL-2v-iPSCs representative clones in Example 2 of the present invention.
[0059] Figure 12 is an electrophoresis diagram of the PCR products of the B2M-1002-IL2abias-iPSCs clone that were identified and integrated at the B2M site in Example 2 of the present invention, spanning the upstream and downstream homologous arms.
[0060] Figure 13 shows the expression and secretion of the B2M-1002-IL2abias-iPSCs representative clone in Example 2 of the present invention.
[0061] Figure 14 is a flow cytometry diagram of the B3-1002-IL2abias-iPSCs hybrid clone identified by site-specific integration at the B3 site in Example 2 of the present invention.
[0062] Figure 15 is an electrophoresis diagram of the PCR product of the B3-1002-IL2abias-iPSCs clone identified and integrated at the B3 site in Example 2 of the present invention, spanning the upstream homologous arm.
[0063] Figure 16 is an electrophoresis diagram of the PCR product of the B3-1002-IL2abias-iPSCs clone identified and integrated at the B3 site in Example 2 of the present invention, spanning the downstream homologous arm.
[0064] Figure 17 shows the expression and secretion of the B3-1002-IL2abias-iPSCs representative clone in Example 2 of the present invention.
[0065] Figure 18 is an electrophoresis diagram of the PCR products of B2M-a-VEGF-KBXP-iPSCs clones that were identified and integrated at the B2M site in Example 2 of this invention, spanning the upstream and downstream homologous arms.
[0066] Figure 19 shows the expression and secretion of representative clones of B2M-a-VEGF-KBXP-iPSCs in Example 2 of the present invention.
[0067] Figure 20 is an electrophoresis diagram of the PCR product of B2M-a-VEGF-BXZ-iPSCs clones that were identified and integrated at the B2M site in Example 2 of this invention, spanning the upstream homologous arm.
[0068] Figure 21 is an electrophoresis diagram of the PCR product of B2M-a-VEGF-BXZ-iPSCs clones that were identified and integrated at the B2M site in Example 2 of this invention, spanning the downstream homologous arm.
[0069] Figure 22 shows the expression and secretion of representative clones of B2M-a-VEGF-BXZ-iPSCs in Example 2 of the present invention.
[0070] Figure 23 is an electrophoresis diagram of the PCR product of B3-a-VEGF-KBXP-iPSCs clones that were identified and integrated at the B3 site in Example 2 of this invention, spanning the upstream homologous arm.
[0071] Figure 24 is an electrophoresis diagram of the PCR product of B3-a-VEGF-KBXP-iPSCs clones identified and integrated at the B3 site in Example 2 of the present invention, spanning the downstream homologous arm.
[0072] Figure 25 shows the expression and secretion of B3-a-VEGF-KBXP-iPSCs representative clones in Example 2 of the present invention.
[0073] Figure 26 shows the expression and secretion of B3-a-VEGF-BXZ-iPSCs representative clones in Example 2 of the present invention.
[0074] Figure 27 is a statistical chart of the site-specific integration efficiency of each expression frame at the B2M and B3 sites in Embodiment 2 of the present invention.
[0075] Figure 28 is a statistical chart showing the expression and secretion of each target gene that is site-directedly integrated into the B2M and B3 sites in Example 2 of the present invention.
[0076] Figure 29 shows the flow cytometry results of the identification of surface markers of each successfully differentiated iMSC in Example 3 of the present invention.
[0077] Figure 30 is a bar chart showing the expression and secretion of target genes by each iMSC in Example 3 of the present invention.
[0078] Figure 31 is a statistical graph showing the results of in vitro tumor killing mediated by iMSCs expressing WT-IL-2 and IL-2v at B2M and B3 sites in Example 4 of the present invention.
[0079] Figure 32 shows the results of in vivo inhibition of tumor growth by iMSCs expressing WT-IL-2 at B2M and B3 sites in Example 5 of the present invention. Detailed Implementation
[0080] The technical solution of the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are merely illustrative and explanatory of the present invention, and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are covered within the scope of protection intended by the present invention.
[0081] Unless otherwise stated, the raw materials and reagents used in the following examples are commercially available products or can be prepared by known methods.
[0082] The inventors of this application have previously developed several gene editing sites suitable for site-specific integration, such as the B2M locus, as detailed in patent application PCT / CN2024 / 113685. Building upon this, the inventors further optimized the site through experiments, discovering gene editing sites capable of achieving higher site-specific integration efficiency and exogenous gene expression levels. These gene editing sites are selected from the coordinates of the human genome in Human Reference Genome Version 38 (GRCh38 / hg38) within the range of NC_000015.10:44718549-44719549. Preferably, the gene locus with coordinates NC_000015.10:44719049 is selected as the site-specific integration site; this site is also referred to herein as the B3 site.
[0083] In particular, in specific embodiments of the present invention, a variety of different exogenous genes were selected for site-specific integration. The gene locus with coordinates NC_000015.10:44719049 was used as the site-specific integration site. In induced pluripotent stem cells or their derivative cells (e.g., mesenchymal stem cells), site-specific integration efficiency and exogenous gene expression levels were achieved that were superior to those of the B2M locus.
[0084] In this invention, the gene locus with coordinates NC_000015.10:44719049 is also known as the B3 locus.
[0085] The term “antibody” is used in the broadest sense herein to refer to a protein that contains an antigen-binding site, encompassing natural and artificial antibodies of various structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), single-chain antibodies, intact antibodies, and antibody fragments.
[0086] iPSCs or ipsc (Induced pluripotent stem cells) refer to induced pluripotent stem cells. iMSCs or iMSC refer to mesenchymal stem cells differentiated from induced pluripotent stem cells.
[0087] Fusion proteins are single proteins composed of two or more different proteins or peptide chains linked together using gene recombination technology. Fusion proteins typically consist of protein fragments from different sources, designed to combine their respective properties to achieve advantages in function, stability, or purifurability. Non-fusion proteins, on the other hand, are proteins that are not fused together using gene recombination technology. This involves independently transcribing and translating multiple genes or proteins to achieve their individual functions or properties, without linking them together through fusion or other means.
[0088] The B2M locus refers to the location of the Beta-2-Microglobulin gene in the human genome. Located on chromosome 15, the B2M locus encodes Beta-2-Microglobulin, a small protein that typically binds to the major histocompatibility complex (MHC I) molecules on the surface of most human cells.
[0089] Site-specific integration refers to the insertion or integration of all or part of a desired sequence (e.g., the target sequence) into a desired site or locus within the genome. Methods for site-specific integration are various and well-known to those skilled in the art. Examples include calcium phosphate-mediated integration: integrating a foreign gene into a cell by binding it to a calcium ionophore (e.g., CaPO4) and activating it with electrical stimulation or ultraviolet light. Transposon-mediated integration: integrating a foreign gene into the cell chromosome using transposons (e.g., Tn7, Tn5). CRISPR / Cas9-mediated integration: integrating a foreign gene into the cell chromosome using the CRISPR / Cas9 system. Direct DNA ligation: directly ligating a foreign gene to a specific location on the cell chromosome using DNA ligase. In some embodiments, site-specific integration is performed using the CRISPR / Cas9 system.
[0090] In this article, B2M-X-iPSCs / iMSCs refer to iPSCs / iMSCs that integrate exogenous gene X at the B2M locus or site; B3-X-iPSCs refer to iPSCs / iMSCs that integrate exogenous gene X at the B3 site. Preferably, in some embodiments, exogenous gene X can be a secreted protein or a membrane protein, including but not limited to different types such as antibodies, interleukins, and fusion proteins.
[0091] Exogenous polynucleotides: refer to exogenous DNA or RNA sequences introduced into cells or organisms through genetic engineering techniques. In some embodiments, the exogenous polynucleotides include, but are not limited to, gene regulatory elements, coding sequences, and non-coding RNA. In some embodiments, the gene regulatory elements include, but are not limited to, promoters, enhancers, and silencers. In some embodiments, the coding sequence includes at least one of the following: a target gene (reporter gene, therapeutic gene, selection marker gene), a leader sequence, a signal peptide sequence, a membrane anchoring sequence, an exon, an intron, and an expression frame. In one embodiment of the present invention, the protein encoded by the target gene includes a secreted protein or a membrane protein.
[0092] Secretory proteins: Proteins that, after synthesis, are transported to the extracellular environment via secretory signal peptides, such as hormones and cytokines. In some embodiments, the secretory protein refers to one or more of the following: immune checkpoint inhibitors, TNF-α inhibitors, GLP-1 receptor agonists, growth hormones, coagulation factors, interleukins, insulin, interferon, tumor necrosis factor, enzymes, and growth factors. In some embodiments, the immune checkpoint is selected from one or more of PD1, PD-L1, CTLA-4, TIGIT, LAG-3, and TIM-3, preferably PD1. In some embodiments, the immune checkpoint inhibitor is an antibody or antibody fragment, preferably a full-length antibody or a single-chain antibody. In some embodiments, the immune checkpoint inhibitor is a full-length antibody or a single-chain antibody against PD1. Preferably, it is a single-chain antibody against PD1. In some embodiments, the TNF-α inhibitor is selected from TNF-α receptors or TNF-α antibodies, such as etanercept, adalimumab, secukinumab, infliximab, golimumab, and pecelizumab. In some embodiments, the interleukins are selected from members of the leukocyte family, such as IL-2, IL-7, IL-10, IL-11, IL-12, IL-15, IL-23, and IL-24. In some embodiments, the tumor necrosis factor family members are selected from, for example, TNF, LTA, LTB, FASLG, TNFSF8, TNFSF9, TNFSF10, TNFSF11, TNFSF12, TNFSF13, TNFSF14, TNFSF15, TNFSF18, and EDA and TRAIL. In some embodiments, the interferons are selected from, for example, interferons α, β, and γ. In some embodiments, the GLP-1 receptor agonist is a peptide GLP-1 receptor agonist, selected from, for example, exenatide, benaglutide, dulaglutide, abiglutide, and other peptide GLP-1 receptor agonists whose polypeptide chains are unmodified or chemically modified. In some embodiments, the growth hormone is preferably natural or recombinant human growth hormone (rhGH), which is divided into short-acting recombinant human growth hormone or long-acting recombinant human growth hormone. In some embodiments, the coagulation factor is selected from, for example, prothrombin complex, fibrinogen, antifibrinolytic, recombinant factor VIIa, recombinant factor VIII, recombinant factor IX, and recombinant factor X. In some embodiments, the growth factor is selected from, for example, epidermal growth factor (EGF), platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), GM-CSF, and G-CSF.In some embodiments, the enzyme is selected from, for example, lipase, amylase, trypsin, chymotrypsin, lysozyme, urokinase, L-asparaginase, glutaminase, neuraminidase, etc.
[0093] Membrane proteins: Proteins embedded in the cell membrane or organelle membranes, possessing transmembrane domains, including transmembrane proteins, membrane-associated proteins, and lipid-anchored proteins. In some embodiments, membrane proteins include one or more of the following: transmembrane receptors, ion channels, transport proteins, cell adhesion molecules, membrane-anchored enzymes, major histocompatibility complex (MHC) molecules, and membrane-bound cytokine receptors. Examples include transmembrane receptors such as G protein-coupled receptors (GPCRs), tyrosine kinase receptors (e.g., EGFR), and Toll-like receptors (TLRs); ion channels such as voltage-gated sodium channels (Nav) and ligand-gated channels (e.g., nAChR); transport proteins such as glucose transporters (GLUT) and ABC transporters (e.g., P-glycoproteins); cell adhesion molecules such as integrins and cadherins; membrane-anchored enzymes such as membrane-bound cyclooxygenase (COX-2) and alkaline phosphatase (ALP); and major histocompatibility complex molecules such as MHC class I and MHC class II molecules. Membrane-bound cytokine receptors such as IL-2 receptor (CD25) and TNF receptor (TNFR).
[0094] In this article, αPD1, α-PD1 and anti-PD1 have the same meaning, all referring to antibodies that target the PD1 immune checkpoint.
[0095] Single-chain antibodies (scFv): These are formed by connecting the variable regions of the light chain and the variable regions of the heavy chain of an antibody through a hinge region, thus retaining the ability to bind antigens.
[0096] "Construct" refers to the nucleic acid into which a foreign gene or polynucleotide sequence is inserted. In specific embodiments of the present invention, "targeting vector," also known as "plasmid" or "vector," refers to a genetic engineering vector used to introduce a foreign gene or polynucleotide sequence into target cells or host cells. It includes at least the following optional functional elements: homology arm: a DNA fragment homologous to sequences flanking the target site in the genome, used to guide homologous recombination; selection marker: selected from neomycin resistance gene (Neo), puromycin resistance gene (Puro), or fluorescent reporter gene (e.g., EGFP), used for positive clone selection; origin of replication: ensures autonomous replication of the vector in host cells (e.g., E. coli); multiple cloning site (MCS): a cluster of restriction enzyme sites for the insertion of foreign genes; reporter gene: a fluorescent protein gene (e.g., GFP or RFP) or enzyme gene (e.g., LacZ), used for screening and quantitative analysis. In some embodiments, the targeting vector includes a target gene expression cassette, a selection marker gene, and a homology recombination arm, and is introduced into host cells via electroporation, virus-mediated, or non-viral methods to achieve stable integration of the target gene. Examples of vectors include plasmids, phage particles, granules, and artificial chromosomes (such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC)), bacteriophages (such as λ phage or M13 phage), and animal viruses. Categories of animal viruses that can be used as vectors include retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses (AAV), herpesviruses (e.g., herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and multivacuolar papillomaviruses (e.g., SV40).
[0097] The term "effective component" refers to an enzyme that can alter or modify the gene sequence in a cell. This includes, but is not limited to, nucleases (e.g., Cas9, ZFN, TALEN, and a wide range of nucleases) and recombinases (e.g., Cre, FLP, λ integrase, phiC31 integrase, Bxb1 integrase, γ-δ dissociation enzyme, Tn3 dissociation enzyme, and Gin convertase).
[0098] The term "modification" or "genetic modification" refers to disruption at the genome level that can lead to a decrease or increase in gene expression or activity in cells. Exemplary modifications may include insertions, deletions, substitutions, frameshift mutations, point mutations, exon removal, removal of one or more DNAse 1-high-sensitivity sites (DHS), etc.
[0099] The term "editing" refers to one or more modifications introduced into a target nucleic acid, such as within a target sequence. Editing can be one or more substitutions, one or more insertions, one or more deletions, or a combination thereof. As used herein, the term "substitution" refers to replacing one or more nucleotides with a different nucleotide relative to a reference sequence. As used herein, the term "insertion" refers to the addition of one or more nucleotides to a nucleic acid sequence relative to a reference sequence. As used herein, the term "deletion" refers to the removal of one or more nucleotides from a nucleic acid sequence relative to a reference sequence.
[0100] Example 1: Construction of a vector for expressing therapeutic factors
[0101] In a specific embodiment of the present invention, the structure of the therapeutic factor expression cassette is designed as promoter-signal peptide-target gene-polyA (as shown in Figure 1), wherein each part uses a known sequence disclosed in the prior art, and the corresponding targeting vector is constructed using B2M and B3 sites as site-specific integration targets. The CRISPR / Cas9 gene editing tool (purchased from Genscript Biotech Co., Ltd., Z03702) is used to site-specifically integrate the polynucleotide sequence expressing the therapeutic factor into the B2M and B3 sites, respectively. The site-specific integration process is shown in Figures 2 and 3. The sgRNA sequence used for the B2M site is: GGCCGAGATGTCTCGCTCCG (SEQ ID NO:34), and the sgRNA sequence used for the B3 site is: ATAGGTACGCGCGAAGAACT (SEQ ID NO:35).
[0102] Specifically, in this embodiment, the homologous arm sequences of the B2M and B3 sites are as shown in SEQ ID NO:1-4, and the nucleotide sequences of the therapeutic factor expression cassette in this embodiment are as shown in SEQ ID NO:5-9. More specifically, the EF1a promoter nucleotide sequence is as shown in SEQ ID NO:10. The signal peptide amino acid sequence is as shown in SEQ ID NO:11 and SEQ ID NO:36, and the nucleotide sequence is as shown in SEQ ID NO:12 and SEQ ID NO:37. The wild-type IL-2 (WT-IL-2) amino acid sequence is as shown in SEQ ID NO:13, and the nucleotide sequence is as shown in SEQ ID NO:14. The IL-2 variant (IL-2v) amino acid sequence is as shown in SEQ ID NO:15, and the nucleotide sequence is as shown in SEQ ID NO:16. In 1002-IL2abias, 1002 refers to α-PD1-scFv, which is a single-chain antibody against PD1, and IL-2abias is an IL-2 variant. The two are linked by G4S to form a fusion protein, with the amino acid sequence as shown in SEQ ID NO:17 and the nucleotide sequence as shown in SEQ ID NO:18. The a-VEGF-KBXP sequence is derived from conbercept, with the amino acid sequence shown in SEQ ID NO: 19 and the nucleotide sequence shown in SEQ ID NO: 20. The a-VEGF-BXZ sequence is derived from buxicam, with the amino acid sequence shown in SEQ ID NO: 21 and the nucleotide sequence shown in SEQ ID NO: 22. a-VEGF-KBXP and a-VEGF-BXZ are coupled with a His tag, with the His tag amino acid sequence shown in SEQ ID NO: 23 and the nucleotide sequence shown in SEQ ID NO: 24. All the above expression cassette sequences were synthesized by Beijing Qingke Biotechnology Co., Ltd. The therapeutic factor expression cassette sequences were ligated to the pre-synthesized B2M or B3 site homologous arm backbone (the B2M site homologous arm was synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the B3 site homologous arm was synthesized by Genscript Biotech Co., Ltd.) through homologous recombination via enzyme digestion to obtain the desired targeting vector. The vector was transformed into E. coli, and positive clones were obtained through ampicillin screening.
[0103] Example 2: Targeting vector nuclear transfer to human iPSCs single cells
[0104] 1. Nuclear transfer targeting B2M and B3 sites
[0105] Using Thermo Neon TM The experimental procedure for single-cell nuclear transfection of iPSCs using the Transfection Kit is as follows:
[0106] ① Preparation before nuclear transfer: 2 hours before nuclear transfer, replace the culture medium in the iPSCs culture wells with fresh mTeSR-Plus (STEMCELL, catalog number 100-0276) and add Y27632 (STEMCELL, catalog number #72304) to a final concentration of 10 μM.
[0107] ② Cell digestion: After aspirating the culture medium, wash the cells once with DPBS, add an appropriate amount of TrypLE Express enzyme (Thermo Fisher, catalog number 12604021), and digest the cells at 37°C for 5 minutes. When the cells become round and gradually detach, aspirate the enzyme solution and add 3-5 mL of mTeSR-Plus culture medium to terminate the digestion.
[0108] ③ Preparation of single-cell suspension: Use a large tip to blow off the detached cells and resuspend them to prepare a single-cell suspension. After counting the cells, centrifuge at 90g for 5 minutes at room temperature.
[0109] ④ Cell aliquoting: Discard the supernatant and resuspend the cells in 1×DPBS. Dispense 1.5×10⁶ cells per tube. 6 The amount of iPSCs was aliquoted into 15mL centrifuge tubes and centrifuged again.
[0110] ⑤ Preparation of Cas9-RNP: Add 16.7 μL buffer R, 1 μL Cas9 protein (25 pmol, Genscript Biotech Co., Ltd., catalog number Z03702) and 2.3 μL sgRNA (50 pmol, sequence identical to B2M sgRNA and B3 sgRNA in Example 1, synthesized by Genscript Biotech Co., Ltd.) to a 1.5 mL EP tube. Incubate the mixture at 37 °C for 15 minutes to form the RNP complex.
[0111] ⑥ Mixing cells with RNP: Discard the 1×DPBS supernatant from the centrifuge tube, resuspend the iPSCs in 100 μL buffer R, and then mix with RNP. Next, add 4 μg of nuclear transfection plasmid (the targeting vector synthesized in Example 1) and mix thoroughly.
[0112] ⑦ Transfer procedure: Transfer the application according to procedure 14.
[0113] ⑧ Cell seeding and culture: The nuclear-transformed iPSCs were seeded into well plates pre-coated with Matrigel (Corning, catalog number 354277), 10 μM Y27632 was added, and the plates were gently shaken in a cross-shaped manner. The plates were then placed in a constant temperature incubator at 37°C, 5% CO2, and saturated humidity and cultured in mTeSR-Plus medium.
[0114] ⑨ Subsequent culture and observation: 12 hours after nuclear transformation, replace the culture medium with fresh medium and add 10 μM Y27632. Observe cell adhesion under a microscope. Thereafter, replace the culture medium with fresh medium daily.
[0115] 2. Single-cell inoculation and monoclonal picking
[0116] ① Seed the cells as single cells and pick positive clones. Specifically, first digest the cells with 1-2 mL of TrypLE Express enzyme at room temperature for 5 minutes. When the cells become round and gradually detach under a microscope, discard the TrypLE Express.
[0117] ② Add 3-5 mL of mTesR-Plus medium, use a large tip to blow off the detached cells and resuspend them into a single-cell suspension. After counting the cells, centrifuge at 90 g for 5 min at room temperature.
[0118] ③ Take 1000 cells and seed them in a 6cm dish pre-coated with Matrigel. Incubate with 3mL of mTesR-Plus containing 10% CloneR additive (purchased from STEMCELL, catalog number: #05888). Follow the CloneR instructions for subsequent medium changes.
[0119] ④ Use a small tip to mechanically pick up single-cell clones from the 6cm dish and inoculate them into a 48-well Matrigel plate pre-coated with mTesR-Plus medium. After shaking well, place the plate in a 37℃, 5% CO2 saturated humidity incubator.
[0120] ⑤ Culture single-cell clones for 4-5 days, then transfer them from one 48-well plate to two other 48-well plates. One line is used for cell expansion culture, and the other line is used for crude cell lysis for subsequent identification.
[0121] 3. Cloning identification
[0122] ①Crude cell lysis
[0123] Prepare a 20 mL crude cell lysis buffer by adding 2 mL of 1 M Tris-HCl (pH = 8.2), 0.2 mL of Triton-x100, and 18.8 mL of H2O, and add proteinase K at a 1:100 ratio. After collecting the cells, wash once with DPBS and discard the supernatant. Resuspend the cells in 50 μL of the lysis buffer and lyse overnight at 56 °C. Then heat at 95 °C for 10 min to inactivate proteinase K.
[0124] ②PCR identification of single-cell clones
[0125] Design primers across the upstream homologous arm region and primers across the downstream homologous arm region for PCR amplification, and analyze them with agarose gel electrophoresis. If it is a positive clone, a band of about 1K will appear upstream or downstream.
[0126] The primer sequences used are shown in Table 1:
[0127] Table 1 Primer sequences
[0128] 4. Detection of positive cells and expression of therapeutic factors
[0129] (1) Flow cytometry detection of the positive rate of B3-1002-IL2abias-iPSC mixed cells
[0130] ① After 48 hours of site-specific integration, the cells were digested and collected into 1.5 mL centrifuge tubes.
[0131] ② Centrifuge at 500g for 5 minutes, discard the supernatant, resuspend the cells in 1mL of 1×DPBS, and wash once.
[0132] ③ Centrifuge again at 500g for 5 minutes, discard DPBS, then add 250μL Fixation / Permeabilization solution and fix the cells at 4℃ for 20 minutes.
[0133] ④ After fixation, add 1 mL of 1×BD Perm / Wash TM Buffer, mix well and wash once.
[0134] ⑤ Centrifuge at 500g for 5 minutes, discard the supernatant, and then add 250μL of 1×BD Perm / Wash TM Resuspend cells in buffer and rupture membrane at room temperature for 15 minutes.
[0135] ⑥ Centrifuge at 500g for 5 minutes, discard the supernatant, and then add 100μL of 1×BD Perm / Wash TM Resuspend cells in buffer, add 1 μL of flow cytometry antibody, prepare staining solution, and incubate at 4°C in the dark for 30 minutes.
[0136] ⑦ After staining, add 1 mL of 1×BD Perm / Wash TM The buffer is washed once.
[0137] ⑧ Finally, use 200μL of 1×BD Perm / Wash TM Cells were resuspended in buffer and analyzed on the instrument.
[0138] ⑨ After exporting the data, use FlowJo software for analysis.
[0139] (2) ELISA detection of protein expression in the culture supernatant of therapeutic factors
[0140] The protein level of IL-2 in the culture supernatant was detected using an ELISA kit (Human IL-2 ELISA Kit, KIT11848, Sino Biological). The specific procedures were performed according to the ELISA kit instructions. All reagents were allowed to equilibrate at room temperature for at least 30 minutes before use.
[0141] The amount of His-tagged protein (α-VEGF-coupled His-tagged protein) in the culture supernatant was detected using an ELISA kit (His Tag ELISA Detection Kit, L00436, Genscript Biotech). The specific operating procedure was performed according to the ELISA kit instructions.
[0142] (3) The experimental results are as follows
[0143] ① As shown in Figure 4, based on upstream and downstream PCR identification results, 6 positive clones of B2M-WT-IL-2-iPSCs were selected from 96 clones, with a positive rate of 6.25%. Clones in good condition were selected for ELISA detection. As shown in Figure 5, 100w cells can secrete 0.3-0.5ng of IL-2 in 24 hours. The results for B2M-IL-2v-iPSCs were similar. As shown in Figure 6, electrophoresis results showed that 5 clones had specific bands upstream and downstream, but the sizes of clones 2, 3, and 4 were not as expected, and sequencing revealed the insertion of non-target bands, which were excluded. Finally, 2 positive clones were obtained from the 96 clones, with a positive rate of 2.08%. According to the ELISA identification results in Figure 7, 100w cells can secrete approximately 0.2-0.32ng of IL-2 in 24 hours. Based on the above results, it can be concluded that both the WT-IL-2 and IL-2v variants have low site-specific integration efficiency at the B2M site, and their expression levels are also very low.
[0144] ② WT-IL-2 and IL-2v were site-specifically integrated at the B3 site, with 24 positive clones selected from each. As shown in Figure 8, the identification results of B3-WT-IL-2-iPSCs showed that 11 out of the 24 clones had specific and bright electrophoretic bands upstream and downstream, with a comprehensive positive rate of 45.8%, far exceeding the positive rate of site-specific integration at the B2M site. Subsequently, the inventors used ELISA technology to detect the amount of IL-2 secreted by B3-WT-IL-2-iPSCs. The results, as shown in Figure 9, showed a significant and substantial increase in secretion, reaching a maximum of 944 ng, nearly 2000 times the expression level at the B2M site. To confirm that this result was not accidental and had generalizability, the inventors then site-specifically integrated IL-2v at the B3 site, with similar results to WT-IL-2. As shown in Figure 10, 9 positive clones were identified out of the 24 selected clones, with a positive rate of 37.5%. ELISA results showed that IL-2v expression was also significantly increased, with a maximum secretion of 946 ng per 100w cells over 24 hours (Figure 11), which is 2900 times that of the B2M site. These results indicate that the B3 site is a site-specific integration site with high integration and secretion efficiency, far superior to the B2M site.
[0145] ③ The inventors further investigated the site-specific integration of various other types of proteins at the B2M and B3 sites, thereby providing a more comprehensive evaluation of the performance of the B3 site. Examples include the 1002-IL2abias fusion protein, a-VEGF-KBXP, and a-VEGF-BXZ. 1002-IL2abias is a fusion protein that links a-PD1-scFv to the IL-2CD25-biased variant IL2abias via G4S. This fusion protein can bind to both PD1 and IL-2 receptors simultaneously, making it a multi-site binding protein. The a-VEGF-KBXP sequence is derived from conbercept, representing a version of conbercept without the Fc group. It consists of core fragments of multiple VEGF receptors and can competitively bind to VEGF. The a-VEGF-BXZ sequence is derived from buxiclosporine monoclonal antibody and is in scFv form. These three proteins belong to different types of secreted proteins, allowing for the estimation of differences among various secreted proteins at the B2M and B3 sites.
[0146] As shown in Figure 12, the upstream and downstream identification results of B2M-1002-IL2abias-iPSCs monoclonal assays showed that among 60 clones, 3 clones had specific bands upstream and 2 clones had specific bands downstream. Subsequent ELISA results showed that clone 2 expressed the target protein and was confirmed as a positive clone, resulting in an overall positive rate of 5%. ELISA results (Figure 13) showed that the secretion level of 100w cells was approximately 6-7 ng after 24 hours.
[0147] The inventors then performed site-directed integration of 1002-IL2abias at the B3 site. After integration, flow cytometry was used to identify the proportion of IL-2-positive cells in the mixed cell line. Unexpectedly, the flow cytometry results showed a positive rate of up to 90% for site-directed integration (Figure 14). Subsequent PCR identification further supported this result. Among the 48 selected clones, 42 were positive clones, with a PCR positive rate of 87.5% (Figures 15-16). Due to the large number of positive clones, the inventors randomly selected 3 positive clones and used ELISA to detect the expression level of the target protein. The results showed (Figure 17) that the secretion of 100w cells over 24 hours was between 30-46 ng, representing a maximum 7-fold increase in expression compared to the B2M site.
[0148] As shown in Figure 18, the upstream and downstream identification results of B2M-a-VEGF-KBXP-iPSCs monoclonal assays showed that among 58 clones, 9 clones had specific bands in both upstream and downstream regions, confirming them as positive clones, with an overall positive rate of 15%. ELISA results (Figure 19) showed that the secretion volume of 100w cells could reach up to 5000ng in 24 hours. The upstream and downstream identification results of B2M-a-VEGF-BXZ-iPSCs monoclonal assays (Figures 20-21) showed that among 72 clones, 8 clones had specific bands in both upstream and downstream regions, confirming them as positive clones, with an overall positive rate of 11%. ELISA results (Figure 22) showed that the secretion volume of 100w cells could reach up to 8000ng in 24 hours. It can be seen that the B2M site itself has good expression efficiency for α-VEGF.
[0149] The inventors further performed site-specific integration of α-VEGF-KBXP at the B3 site. Based on the combined results of upstream and downstream PCR, at least 16 of the 32 selected clones were positive, resulting in a PCR positive rate of 50% (Figures 23-24). Due to the large number of positive clones, the inventors randomly selected four positive clones and used ELISA to detect the expression level of the target protein. The results showed (Figure 17) that the secretion level of 100w cells over 24 hours ranged from 2800 to 11000 ng, with a maximum of 11000 ng. The average expression level was 2.5 times that of the B2M site. ELISA results for the B3-α-VEGF-BXZ-iPSC monoclonal also showed a significant increase compared to the B2M site, with the secretion level of 100w cells over 24 hours ranging from 9800 to 15000 ng, and the average expression level being 3.1 times that of the B2M site.
[0150] Based on the results of site-specific integration and secretion of the above five proteins, the inventors compared the differences in integration efficiency and expression levels between the B2M and B3 sites. As shown in Figure 27, the B3 site significantly improved the integration efficiency of various target protein expression cassettes, with an average integration efficiency of 54%, which is 7.7 times that of the B2M site. The highest integration efficiency reached 87.5%, which can significantly reduce the workload of those skilled in the art in selecting positive clones, shorten the cell processing cycle, and greatly save on cell preparation costs.
[0151] In terms of expression levels, the B3 site also showed superior performance. Because different proteins have different expression characteristics, the extent to which the B3 site increases their expression levels varies considerably. However, for all the proteins mentioned above, the expression levels at the B3 site were significantly increased compared to when they were integrated into the B2M site (Figure 28), with the highest increases observed in WT-IL-2 and IL-2v proteins, where the B3 site increased their expression levels by 2000-fold. Therefore, those skilled in the art will understand that proteins whose expression is limited or almost non-existent when integrated into the B2M site will show a more significant increase at the B3 site. These results are difficult for those skilled in the art to infer and expect.
[0152] Example 3: Site-directed integration clone induction into iMSCs and performance characterization
[0153] To confirm whether the advantage of the B3 site can be sustained in iPSC-derived cells, the inventors used iMSC cells as an example and selected one clone of B2M-WT-IL-2-iPSCs, B3-WT-IL-2-iPSCs, B2M-IL-2v-iPSCs, and B3-IL-2v-iPSCs to differentiate into iMSC cells and tested the performance of the cells.
[0154] 1. Site-directed integration of clones to induce differentiation into iMSCs
[0155] According to STEMDiff of STEMCELL Technology TM Using the Mesenchymal Progenitor Kit (Catalog #05240), site-integrated iPSC clones were directed to differentiate into iMSCs according to the methods described in the instruction manual. The differentiation method was performed in accordance with the instructions.
[0156] The obtained iMSCs were identified by surface markers. All differentiated clones exhibited typical characteristics of MSCs, including cell growth morphology and surface markers. All iMSCs showed a fibroblast-like morphology, exhibiting a distinct fingerprint-like spiral distribution when they merged. Flow cytometry analysis of the surface markers in all iMSCs revealed that their cell surface markers were CD44+, CD73+, CD90+, CD105+, and CD34- / CD45- / HLA-DR-, consistent with the characteristics of tissue-derived MSCs and meeting the ISCT identification criteria (as shown in Figure 29).
[0157] 2. Identification of exogenous integration factor secretion levels in iMSCs
[0158] To identify the expression levels of exogenous factors for site-directed integration in differentiated iMSCs, the inventors digested them with Tryple, counted 100 cells, and then seeded them into 6cm dishes pre-coated with gelatin. After culturing for 24 hours, the supernatant was collected and centrifuged at 13000g at 4°C for 20 minutes to remove dead cells and cell debris, thus avoiding false positive interference signals.
[0159] ELISA analysis showed that, after 24 hours, the expression levels of B2M-WT-IL-2-iMSCs in 100W cells were 8.54 ng and B3-WT-IL-2-iPSCs were 130 ng, representing a 14-fold increase compared to the B2M site. B2M-IL-2v-iPSCs showed 2.39 ng and B3-IL-2v-iPSCs showed 187 ng, representing a 77-fold increase compared to the B2M site (Figure 30). This indicates that in iPSC-derived cells, the B3 site still exhibits significantly higher expression levels than the B2M site.
[0160] Example 4: A comparative study on the promoting effect and in vitro comparative effect of iMSCs with B2M and B3 site-specific integration of WT-IL-2 and IL-2v on the antitumor activity of PBMCs.
[0161] IL-2 is an immune cell stimulating factor, so the inventors evaluated the ability of each IL-2-iMSC to promote the killing of tumor cells by PBMCs (peripheral blood mononuclear cells) in vitro.
[0162] 1. PBMC separation
[0163] ① Add freshly collected peripheral blood to a 50mL centrifuge tube, then add an equal volume of 1×DPBS to dilute and mix well.
[0164] ② Take another 50mL centrifuge tube, first add 20mL of separation solution (product number: 10771, Sigma), and then slowly add 20mL of diluted peripheral blood along the tube wall.
[0165] ③ After centrifugation, remove the upper plasma layer, carefully collect the second milky white lymphocyte layer, and transfer it to a new 15mL centrifuge tube.
[0166] ④ Add 1×DPBS to the lymphocytes to a total volume of 12mL, mix well, and centrifuge at 300g for 10 minutes at room temperature (25℃). Repeat the washing process twice.
[0167] ⑤ Remove the supernatant, add 3 mL of erythrocyte lysis buffer (product number: C3702, Shanghai Beyotime Biotechnology Co., Ltd.) to the tube, gently disperse the cells and mix well, and place at room temperature.
[0168] ⑥ After standing for 10 minutes, add 10 mL of 1×DPBS and centrifuge again at 300 g for 10 minutes at room temperature (25℃).
[0169] ⑦ Discard the supernatant, add 3-4 mL of RPMI 1640 medium, and disperse and mix the cells (at this time, 10 μL of cell suspension can be taken for counting).
[0170] ⑧ Seed the cells into a 10cm culture dish, add RPMI 1640 medium to a total volume of 10mL, mix gently, and then place in an incubator for culture.
[0171] ⑨ After 24 hours, cell counting was performed. CD3 / CD28 magnetic beads (catalog number: 11131D, Thermo Fisher Scientific (China) Co., Ltd.) were added at a cell to magnetic bead ratio of 10:1. At the same time, IL-2 (catalog number: H7041, Sigma Aldrich) was added to a final concentration of 100 IU / mL. After 72 hours of activation, the cells were used for subsequent co-culture experiments.
[0172] 2. Tumor cell markers
[0173] Using CellTrace TM Violet (catalog number: C34557, Thermo Fisher Scientific) is used to fluorescently label tumor cells to distinguish them in a co-culture system. This dye can be retained intracellularly for a long time. Procedure: Digest tumor cells with 0.25% trypsin for 3 minutes, add culture medium to stop digestion, resuspend cells and count them. Centrifuge at room temperature (25°C) (175g, 5 minutes), discard the supernatant. Distribute the dye at 1×10⁻⁶ cells per cell. 6 Resuspend cells in 1 mL of 1×DPBS, then add CellTrace to a final concentration of 5 μM. TMStain with Violet dye at room temperature in the dark for 20 minutes. Wash once with complete culture medium and resuspend the cells for later use.
[0174] 3. Co-cultured cell seeding
[0175] Labeled tumor cells and iMSC cells were seeded in 6-well plates at an effector-target ratio of 1:5 (iMSC 3×10⁶ cells / well). 5 / well, tumor cells 6×10 4 / well). After 12 hours, the cells adhered, and 6×10⁶ cells were added. 5 PBMC cells (magnetic beads and IL-2 removed 24 hours prior). After co-culturing for 48 hours, the tumor cell apoptosis rate was detected. In this specific embodiment of the invention, the tumor cells were selected from the human clear cell renal carcinoma cell line, namely 786-O cells, purchased from procell, catalog number: CL-0010.
[0176] 4. Flow cytometry detection of tumor cell apoptosis
[0177] ① Using BD Pharmingen TM PE Annexin V Apoptosis Detection Kit I (Catalog No.: 559763) is used to detect cell apoptosis. Procedure:
[0178] ② Digest and collect the co-cultured cells, and centrifuge at room temperature (25℃) (175g, 5 minutes).
[0179] ③ Discard the supernatant, wash with 1×DPBS, and centrifuge again (175g, 5 minutes).
[0180] ④ Resuspend the cells in 100 μL Binding Buffer, add 5 μL PE-Annexin V and 5 μL 7-ADD dye, and mix well. Prepare single-stain and blank control tubes at the same time.
[0181] ⑤ Incubate at room temperature in the dark for 15 minutes.
[0182] ⑥ Add 300 μL Binding Buffer to resuspend the cells and place on ice in the dark.
[0183] ⑦ Test on the machine within 1 hour.
[0184] As shown in Figure 31, this embodiment included six experimental groups: 786-O, 786-O+PBMC, 786-O+PBMC+Blank-iMSC, 786-O+PBMC+B2M-WT-IL-2-iMSC, 786-O+PBMC+B3-WT-IL-2-iMSC, 786-O+PBMC+B2M-IL-2v-iMSC, and 786-O+PBMC+B3-IL-2v-iMSC. The experimental results are shown in Figure 32. After 48 hours of co-culture, the proportions of apoptotic tumor cells in each group were 3.6%, 7.3%, 7.9%, 20.1%, 29.65%, 9.4%, and 24.7%, respectively. The B3 site-specific integration group showed a significantly higher tumor apoptosis rate. Compared to the B2M site-specific integration group, the WT-IL-2-iMSC rate increased by 50%, and the IL-2v-iMSC rate increased by 1.6 times.
[0185] Example 5: Comparative Study of In vivo Tumor Growth Inhibition by B2M and B3 Site-Specific Integration of WT-IL-2iMSCs
[0186] Based on the superior performance of WT-IL-2-iMSC compared to IL-2v-iMSC in in vitro co-culture, the inventors further selected B2M-WT-IL-2-iMSC and B3-WT-IL-2-iMSC for in vivo experiments to evaluate the difference in their ability to inhibit tumor growth.
[0187] 1. Establishment of subcutaneous xenograft tumors in mice
[0188] A. Cell preparation
[0189] ① Select the CT-26 tumor cell line in the logarithmic growth phase and expand it to the required number through continuous passage.
[0190] ② Digest the cells with 0.25% trypsin, resuspend them, and then count the cells.
[0191] ③ Wash the cells twice with 1×DPBS and discard the supernatant.
[0192] ④ Resuspend cells in 1×DPBS, at a rate of 2×10⁻⁶ cells per 1000 ml. 7 Adjust the cell concentration by adding cells to 1 mL of culture medium.
[0193] ⑤ Take 100 μL (approximately 1 × 10⁻⁶) 6 The cells were aliquoted into 1.5 mL centrifuge tubes for later use.
[0194] B. Mouse preparation
[0195] Six-week-old female BALB / c mice were selected (purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.).
[0196] Each cage contains 5-8 mice, and mice in the same cage are treated in the same way to avoid confusion in numbering.
[0197] C. Subcutaneous injection of tumor cells
[0198] ① The dispensed cells were transported on ice and, after surface sterilization, transferred to the SPF-grade breeding room.
[0199] ② Gently resuspend the cells in the 1.5mL centrifuge tube with a pipette, and use an insulin syringe to draw up the cell suspension and expel all air.
[0200] ③ Grasp the mouse, hold it in place with your left hand, expose the armpit area, and disinfect the injection site with an alcohol swab.
[0201] ④ Hold the syringe in your right hand and insert it into the skin under the mouse's armpit at a 45° angle. Gently lift the needle to confirm the location, and then slowly inject the cell suspension.
[0202] ⑤ After the injection is completed, slowly withdraw the needle and gently press the injection site with a cotton swab for 5-7 seconds to prevent bleeding or leakage of cell suspension.
[0203] 2. Therapeutic iMSC cell injection
[0204] Five to seven days after subcutaneous tumor formation in mice, when the tumor volume reached 60-100 mm... 3 (60-80mm preferred) 3 At that time, therapeutic cell injections were initiated. The injections were administered intraperitoneally, once every two days, for a total of five injections, each consisting of 2 × 10⁻⁶ cells. 6 iMSC cells.
[0205] 3. Mouse feeding and observation
[0206] Mice were observed every other day after tumor cell injection, and their activity level, movement status, food and water intake, and weight changes were recorded. The long and short diameters of the subcutaneous tumor were measured, and the tumor volume was calculated (formula: volume = long diameter × short diameter). 2 / 2).
[0207] The experimental results are shown in Figure 32. The tumor growth curves show that B3-WT-IL-2-iMSCs are more effective at inhibiting tumor growth than B2M-WT-IL-2-iMSCs. At the experimental endpoint, the average tumor volume in the B2M-WT-IL-2-iMSC group was 1187 mm3, while that in the B3-WT-IL-2-iMSC group was 706 mm3, representing a 40% reduction in tumor volume compared to the B2M group (P=0.058).
[0208] In summary, whether in vivo or in vitro, targeted integration of exogenous genes at the B3 site achieves better technical results than at the B2M site. This helps reduce the amount of cells used in actual treatment, minimizes side effects caused by excessive cell usage, improves the safety of cell therapy, and saves on treatment costs.
[0209] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.
[0210] SEQ ID NO:1B2M site upstream homologous arm nucleotide sequence B2M LHA:
[0211] SEQ ID NO:2B2M downstream homologous arm nucleotide sequence B2M RHA:
[0212] SEQ ID NO:3B3 upstream homologous arm nucleotide sequence B3 LHA:
[0213] SEQ ID NO:4B3 downstream homologous arm nucleotide sequence B3 RHA:
[0214] SEQ ID NO:5WT-IL-2 expression cassette nucleotide sequence
[0215] SEQ ID NO:6IL-2v expression cassette nucleotide sequence
[0216] SEQ ID NO:71002-IL2abias expression cassette nucleotide sequence
[0217] SEQ ID NO:8a-VEGF-KBXP expression cassette nucleotide sequence
[0218] SEQ ID NO:9a-VEGF-BXZ expression cassette nucleotide sequence
[0219] SEQ ID NO:10EF1a promoter nucleotide sequence
[0220] SEQ ID NO:11 and SEQ ID NO:36 signal peptide amino acid sequences
[0221] SP1:MGVKVLFALICIAVAEA
[0222] SP3: MDWTWRFLFVVAAATGVQS
[0223] SEQ ID NO:12 and SEQ ID NO:37 signal peptide nucleotide sequences
[0224] SP1:ATGGGCGTGAAGGTGCTGTTTGCCCTGATTTGCATCGCCGTGGCCGAGGCC
[0225] SP3: ATGGACTGGACCTGGCGGTTCCTGTTTGTGGTGGCCGCCGCCACCGGCGTGCAGAGC
[0226] SEQ ID NO:13WT-IL-2 amino acid sequence
[0227] SEQ ID NO:14WT-IL-2 nucleotide sequence
[0228] SEQ ID NO:15IL-2v amino acid sequence
[0229] SEQ ID NO:16IL-2v nucleotide sequence
[0230] SEQ ID NO:171002-IL2abias amino acid sequence
[0231] SEQ ID NO:181002-IL2abias nucleotide sequence
[0232] SEQ ID NO:19a-VEGF-KBXP amino acid sequence
[0233] SEQ ID NO:20a-VEGF-KBXP nucleotide sequence
[0234] SEQ ID NO:21a-VEGF-BXZ amino acid sequence
[0235] SEQ ID NO:22a-VEGF-BXZ nucleotide sequence
[0236] SEQ ID NO:23 His-tagged amino acid sequence: HHHHHH
[0237] SEQ ID NO:24 His tag nucleotide sequence: CACATCACCATCACCATTGA
[0238] SEQ ID NO:25:TYB-GSH-2-UP-F:5'-TAGAGGGCGCTGGAAGCTCTAA-3'
[0239] SEQ ID NO:26:TYB-GSH-UP-R:5'-GGGAACCACACACGGCACTTAC-3'
[0240] SEQ ID NO:27:TYB-GSH-2-DOWN-IL-2-F:5'-GAACTCAAACCTCTGGAGGAAGTGC-3'
[0241] SEQ ID NO:28:TYB-GSH-2-DOWN-R:5'-GCAAAGCACATAAAGTCCTTGGCAC-3'
[0242] SEQ ID NO:29:B3-TYB-UP-F:5'-GACACAGCTGTCTAGTGGGAGG-3'
[0243] SEQ ID NO:30:B3-TYB-DOWN-R:5'-CACAGAGTCTCAGCCAATCACAGG-3'
[0244] SEQ ID NO:31:TYB-down-KBXP-F1:5'-CGGGGCATGTACTGACGATT-3'
[0245] SEQ ID NO:32:TYB-down-BXZ-F1:5'-GGGACACAGCAAGAACACACTG-3'
[0246] SEQ ID NO:33:NC_000015.10:44718549-44719549
Claims
1. An engineered cell, characterized in that: The engineered cell integrates at least one exogenous polynucleotide into its genome at a specific site; the genomic site for the engineered cell to perform the specific integration is selected from the human genome coordinates in NC_000015.10:44718549-44719549 of the Human Reference Genome 38 (GRCh38 / hg38).
2. The engineered cell of claim 1, wherein: The engineered cells selected the gene locus with coordinates NC_000015.10:44719049 as the site of integration.
3. The engineered cell as described in claim 1, characterized in that: The engineered cells are human cells.
4. The engineered cell as described in claim 1, characterized in that: The engineered cells are mesenchymal stem cells, and / or iPSC cells and their derivatives.
5. An engineered cell as described in claim 4, characterized in that: The mesenchymal stem cells are derived from adult cells or stem cells; Preferably, the mesenchymal stem cells are derived from pluripotent stem cells; more preferably, the pluripotent stem cells are selected from induced pluripotent stem cells. Preferably, the mesenchymal stem cells are derived from bone marrow, fat, muscle, heart, umbilical cord blood, or umbilical cord.
6. An engineered cell as described in claim 4, characterized in that: The derived cells are selected from CAR-iNK, dopaminergic neural progenitor cells, CAR-iMac, cardiomyocytes, endothelial progenitor cells, iNK cells, retinal cells, nerve cells, osteoblasts, hematopoietic stem cells, mesenchymal stem cells, blood cells, T cells, β cells, fibroblasts, hair cells, monocytes, macrophages, Treg cells, kidney progenitor cells, lung epithelial cells, endothelial cells, megakaryocytes, smooth muscle cells, skeletal muscle cells, chondrocytes, osteocytes, adipocytes, hepatocytes, pancreatic islet cells, keratinocytes, melanocytes, or dendritic cells.
7. An engineered cell as described in claim 1, characterized in that: The exogenous polynucleotide encodes secretory proteins or membrane proteins.
8. An engineered cell as described in claim 7, characterized in that: The secreted proteins include one or more of the following: immune checkpoint inhibitors, TNF-α inhibitors, GLP-1 receptor agonists, growth hormones, coagulation factors, interleukins, insulin, interferons, tumor necrosis factors, enzymes, and growth factors. Alternatively, the membrane proteins may include one or more of the following: transmembrane receptors, ion channels, transport proteins, cell adhesion molecules, membrane anchoring enzymes, major histocompatibility complex (MHC), and membrane-bound cytokine receptors.
9. A method for editing engineered cells, characterized in that: At least one exogenous polynucleotide is site-directedly integrated into the genomic locus of the engineered cell; the genomic locus for site-directed integration of the engineered cell is selected from the human genome coordinates in NC_000015.10:44718549-44719549 of the Human Reference Genome Version 38 (GRCh38 / hg38). Preferably, the engineered cell is the engineered cell according to any one of claims 1-8; Preferably, the method includes cutting the genome editing site using a gene editing system, and performing gene knockout, knock-in or modification through homologous recombination or non-homologous end joining.
10. A pharmaceutical composition, characterized in that: The pharmaceutical composition comprises engineered cells according to any one of claims 1-8.
11. A method for improving the site-directed integration efficiency or expression level of exogenous polynucleotides, characterized in that: At least one exogenous polynucleotide is site-directedly integrated into the genomic locus of the engineered cell; the genomic locus for site-directed integration of the engineered cell is selected from the human genome coordinates in NC_000015.10:44718549-44719549 of the Human Reference Genome 38 (GRCh38 / hg38).
12. A gene editing method, characterized in that: The method uses a gene editing system to cut at the gene editing site, and achieves the knockout, knock-in, or modification of the target gene through homologous recombination or non-homologous end joining. The gene editing sites are selected from gene sites in the human genome of Human Reference Genome Version 38 (GRCh38 / hg38) with coordinates within NC_000015.10:44718549-44719549.
13. The use of the engineered cells according to any one of claims 1-8 and the pharmaceutical composition according to claim 10 in the preparation of a medicament for treating diseases; Preferably, the diseases include, but are not limited to, proliferative diseases such as tumors, melanoma, non-small cell lung cancer, renal cell carcinoma, colorectal cancer, breast cancer, pancreatic cancer, head and neck cancer, and other solid tumors; hematologic diseases such as leukemia, anemia, lymphoma, hemophilia, leukopenia, thrombocytopenia, angiogenesis disorders, Kaposi's sarcoma, etc.; autoimmune diseases such as Crohn's disease, ulcerative colitis, allergies, inflammatory bowel disease, arthritis, psoriasis, respiratory inflammation, asthma, and organ transplant rejection, etc.; metabolic diseases such as diabetes, growth hormone deficiency, and growth retardation in children, etc.; infections, including viral infections, bacterial infections, fungal infections, and parasitic infections, such as hepatitis B, hepatitis B and hepatitis C, etc.; digestive system diseases such as indigestion and pancreatic diseases; and skin injuries such as trauma and burns.
14. A reagent for editing exogenous polynucleotides at gene editing sites, characterized in that: The reagent contains a sequence capable of recognizing the gene editing site, wherein the gene editing site is selected from the human genome in Human Reference Genome Version 38 (GRCh38 / hg38) with coordinates within NC_000015.10:44718549-44719549; Preferably, the gene editing site is selected from the gene site with coordinates NC_000015.10:44719049; Preferably, the reagents include constructs and gene editing systems.
15. The use of the reagent of claim 14 in the preparation of a medicament for treating diseases; Preferably, the drug is an engineered cell according to any one of claims 1-8 or a pharmaceutical composition according to claim 12.