Effect and use of crept in fatty liver disease and comorbidities thereof

WO2026200934A1PCT designated stage Publication Date: 2026-10-01TSINGHUA UNIVERSITY +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2026/085687
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-03-24
Filing Date
2026-03-24
Publication Date
2026-10-01

Smart Images

  • Figure CN2026085687_01102026_PF_FP_ABST
    Figure CN2026085687_01102026_PF_FP_ABST
Patent Text Reader

Abstract

Provided are the effect and use of CREPT in fatty liver disease and comorbidities thereof. Specifically, provided is the use of a CREPT gene or protein as a target or an agent targeting the CREPT gene or protein in the treatment of metabolic-associated fatty liver disease and diseases comorbid with fatty liver disease, or in the preparation of a drug for treating metabolic-associated fatty liver disease and diseases comorbid with fatty liver disease. By means of reducing the expression of the CREPT gene or attenuating or inactivating the function of the CREPT protein, metabolic-associated fatty liver disease and diseases comorbid with fatty liver disease are treated. It is discovered for the first time that CREPT is closely correlated with metabolic-associated fatty liver disease. By means of reducing the expression of CREPT, metabolic-associated fatty liver disease and diseases comorbid with fatty liver disease can be effectively treated via systemic or local administration.
Need to check novelty before this filing date? Find Prior Art

Description

The role and application of CREPT in fatty liver disease and its complications Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to the role of CREPT in metabolic-associated fatty liver disease and comorbid fatty liver disease, and the application of targeted CREPT therapy in metabolic-associated fatty liver disease and comorbid fatty liver disease. Background Technology

[0002] The pathogenesis of metabolic associated fatty liver disease (MAFLD) initially presents as simple fatty liver, characterized by fat accumulation with little or no inflammation. MAFLD can be diagnosed as long as fatty liver is present and accompanied by at least one metabolic disorder (such as obesity or type 2 diabetes). As the disease progresses, it transitions from a quantitative to a qualitative change, actively damaging the liver and developing into metabolic dysfunction-associated steatohepatitis (MASH). Hepatocytes exhibit steatosis, intralobular inflammation, and ballooning degeneration, sometimes accompanied by fibrosis. At this stage, aggressive intervention is often necessary to prevent progression to liver fibrosis, cirrhosis, liver failure, and even liver cancer.

[0003] Metabolic fatty liver disease (MAF) is a clinical syndrome characterized by abnormal accumulation of neutral fat in the liver and diffuse fatty degeneration of hepatocytes, caused by various factors such as genetic susceptibility, environmental factors, and metabolic stress. It is a common liver condition, not a standalone disease. Fatty liver seriously threatens human health, becoming the second most common liver disease after viral hepatitis.

[0004] The CREPT gene is expressed significantly higher in tissues of various cancers than in non-tumor cells and adjacent normal tissues. Its expression is associated with cancer development and also directly or indirectly promotes cell proliferation. However, the specific role of the CREPT gene in the progression of fatty liver disease remains unclear in current research. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the first aspect of this invention is the use of the CREPT gene or protein as a target or a reagent targeting the CREPT gene or protein in the treatment of fatty liver disease and fatty liver disease, or in the preparation of a medicament for the treatment of fatty liver disease and fatty liver disease, thereby treating fatty liver disease and fatty liver disease by reducing the expression of the CREPT gene or by reducing or inactivating the function of the CREPT protein.

[0006] The tumor-associated gene CREPT, also known as RPRD1B, C20ORF77, or Kub5-Hera, can promote cell cycle transition and tumorigenesis, making it a highly promising target for cancer therapy. CREPT is highly expressed in various tumor cells; therefore, knocking out CREPT significantly inhibits tumor cell growth without affecting the normal cell state.

[0007] A target, also known as a biomolecule, is a biomolecule that performs a specific function in a living organism and can bind to an effective drug. A target must not only participate in the pathological process related to the disease and play a key role, but also not participate in the normal physiological process of tissues unrelated to the disease, and can specifically bind to the drug.

[0008] Fatty liver disease, also known as fatty liver, is a disease caused by various factors such as genetic susceptibility, environmental factors, and metabolic stress. It is characterized by the transformation of hepatocytes into fatty tissue. It mainly includes alcoholic fatty liver disease (ALD), metabolic-associated fatty liver disease, and special types of fatty liver, among which metabolic-associated fatty liver disease is the most common.

[0009] In some embodiments of this application, the comorbidities of fatty liver disease are other liver diseases. In some embodiments of this application, the comorbidities of fatty liver disease include one or more of the following: focal nodular hyperplasia of the liver, chronic cholecystitis-adenomyoma, moderately to poorly differentiated adenocarcinoma of the gallbladder, chronic cholecystitis-adenomyoma-cholelithiasis, benign liver tumors, hepatocellular carcinoma, alcoholic cirrhosis, and liver rupture and hemorrhage.

[0010] As some embodiments of this application, fatty liver disease also includes fatty liver disease with complications, including one or more of the following complications: hypertension, coronary heart disease, steatohepatitis, liver fibrosis, cirrhosis, liver cancer, arteriosclerosis, liver failure, portal hypertension, metabolic syndrome, cardiovascular disease, hyperlipidemia, diabetes, type 2 diabetes, chronic kidney disease, diffuse cerebral edema, liver injury, polycystic ovary syndrome, sleep apnea syndrome, and hepatic encephalopathy.

[0011] As some embodiments of this application, the reagent targeting the CREPT gene or protein reduces CREPT gene expression or impairs or inactivates CREPT protein function.

[0012] As some embodiments of this application, the reagent targeting the CREPT gene or protein is selected from one or more of the following: agents that affect CREPT protein expression, agents that knock out CREPT protein, agents that alter CREPT protein, and agents that degrade CREPT protein.

[0013] As some embodiments of this application, the formulation affecting CREPT protein expression includes a nucleic acid reagent or a vector containing a nucleic acid fragment that inhibits CREPT protein expression.

[0014] As some embodiments of this application, the formulation for knocking out the CREPT protein includes reagents for homologous recombination and gene editing to eliminate the CREPT gene.

[0015] As some embodiments of this application, the formulation for altering the CREPT protein includes agents that alter the structure of the CREPT protein;

[0016] As some embodiments of this application, the formulation for degrading CREPT protein includes one or more of the following: PROTAC, molecular glue, LYTAC, MoDE, ATAC, Apt-LYTAC, AbTAC, PROTAB, REULR, KineTAC, IFLD, ATTEC, AUTAC, and AUTOTAC pathways.

[0017] PROTACs, also known as protein degradation chimeras, are heterobifunctional molecules composed of two ligands linked by a linker. One ligand binds to the target protein, while the other targets the E3 ligase. PROTACs can simultaneously bind to both the target protein and the E3 ligase, thus shortening the distance between them, inducing ubiquitination of the target protein, which is then recognized and degraded by the 26S proteasome. Traditional inhibitors employ a "site-driven" mechanism, requiring the drug molecule to bind tightly to the active site of the target protein to inhibit its activity and achieve a pharmacological effect. PROTACs, however, operate on an event-driven mechanism, binding to any site on the target protein without requiring high affinity to potentially induce protein degradation.

[0018] Molecular glue technology is one of the main technologies based on the ubiquitin-proteasome degradation system. In the field of targeted protein degradation, molecular glues are typically monovalent small molecules (molecular weight less than 500 Da). Their specific mechanism of action involves altering the surface of E3 ligases, thereby blocking the binding of E3 ligases to natural substrates, inducing the specific protein to be degraded to bind to the E3 ligase, further promoting the ubiquitination modification of the specific protein, and finally causing it to be degraded by the proteasome. Due to the complexity of their biological characteristics, some disease-related proteins may possess multiple domains or functional sites, making it difficult to form stable bindings with drug molecules. These proteins have not yet been effectively targeted using traditional drugs such as small molecule drugs or antibodies. The development of molecular glue technology offers a possibility for solving this problem.

[0019] Intracellular targeted protein degradation (iTPD) technologies, represented by PROTAC and molecular gels, have developed into an important new mode for small molecule drug development. While iTPD technology is rapidly developing, extracellular targeted protein degradation (eTPD) technology has also made several significant advances.

[0020] LYTAC is a bifunctional molecule with two binding domains. One end is an oligoglycopeptide group that binds to the cell surface transmembrane receptor CI-M6PR (cation-independent mannose-6-phosphate receptor), and the other end is an antibody or small molecule that binds to a target protein. These two binding domains are linked by a chemical linker. The trimer CI-M6PR–LYTAC–target protein complex formed on the plasma membrane is engulfed by the cell membrane, forming a transport vesicle. The vesicle transports the complex to the lysosome, where the target protein is degraded. LYTAC has the potential to degrade membrane proteins and soluble proteins.

[0021] The asialoglycoprotein receptor (ASGPR) is an endocytic cell surface receptor, highly expressed primarily on hepatocytes (up to 500,000 copies per cell), playing a crucial role in the natural process of endogenous protein internalization and degradation within hepatocytes. Multiple target proteins (such as EGFR) can be degraded by conjugating (multiple) targeting ligands of ASGPR, such as tri-GalNac, to target protein-binding antibodies. The bifunctional small-molecule extracellular targeted protein degradation (eTPD) technologies MoDE and ATAC (ASGPR Targeting Chimeras) utilize ASGPR. ATAC uses a high-affinity monodentate ASGPR targeting moiety that is three to four times smaller than tri-GalNAc. Because ASGPR is a liver-specific lysosomal targeted receptor, ATAC technology, compared to LYTAC (CI-M6PR, which is widely expressed in multiple cell types), can degrade extracellular proteins in a cell-type-restricted manner, offering a potential safety advantage.

[0022] Apt-LYTAC is a small aptamer (8–25 kDa) ASGPR adaptor that links tri-GalNac to the 5' end of the aptamer for the soluble growth factor PDGF and the membrane receptor PTK7, and has demonstrated that PDGF-labeled Apt-LYTAC is degraded in HepG2 cells. PDGF-bound Apt-LYTAC can be delivered to lysosomes.

[0023] Cytokine receptor-targeting chimera (KineTAC) technology is a novel degradative agent that utilizes the decoy circulating receptor CXCR7 to transport cell membrane and extracellular target proteins to lysosomes for degradation. For example, CXCL12 can be internalized after binding to the decoy receptor CXCR7. One end of KineTAC is the chemokine CXCL12, and the other end binds to the target protein. After the complex enters the lysosome, the target protein is degraded. Studies have confirmed that KineTAC technology can degrade membrane proteins such as PD-L1, HER2, and EGFR, as well as soluble proteins VEGF and TNF-α. The KineTAC platform expands the selectivity of eTPD by utilizing a series of circulating receptors with different tissue distributions and levels.

[0024] A novel integrin-facilitated lysosomal degradation (IFLD) strategy based on bifunctional compounds couples a target protein-binding ligand with an integrin-recognizing ligand. The resulting bifunctional compound induces the endocytosis and degradation of extracellular or cell membrane proteins in an integrin- and lysosome-dependent manner. Integrins are cell adhesion receptors expressed on the cell surface and play a crucial role in cell-matrix interactions. Because integrins can bind to ligands containing the Arg-Gly-Asp (RGD) motif and transport them to lysosomes, they represent an attractive degradation system.

[0025] As some embodiments of this application, the drug includes a small molecule inhibitor of the CREPT protein.

[0026] As some embodiments of this application, the nucleic acid reagent is selected from one or more of siRNA, shRNA, microRNA, and ASO.

[0027] Small interfering RNA (siRNA), sometimes called short interfering RNA or silencing RNA, is a double-stranded RNA of 20 to 25 nucleotides in length, with many different uses in biology. siRNA is primarily involved in RNA interference (RNAi) to regulate gene expression in a specific manner.

[0028] Short hairpin RNA (shRNA), cloned into an shRNA expression vector, consists of two short inverted repeat sequences separated by a stem-loop sequence, forming a hairpin structure controlled by the pol III promoter. It is then followed by 5-6 T molecules as a transcription terminator for RNA polymerase III. Cloning the siRNA sequence as a "short hairpin" into a plasmid vector allows for the delivery of "small interfering RNA" (siRNA) in vivo. When introduced into an animal, the hairpin sequence is expressed, forming a "double-stranded RNA" (dsRNA), which is then processed by RNAi channels.

[0029] MicroRNAs (miRNAs) are non-coding RNAs approximately 22 nt in length, widely found in various organisms from viruses to humans. These small RNAs can bind to mRNA and block the expression of protein-coding genes, preventing them from being translated into proteins.

[0030] Antisense oligonucleotides (ASOs) are single-stranded oligonucleotide molecules that typically contain 15-25 nucleotides. After entering the cell, they bind to their complementary target mRNA through base pairing under the action of ribonuclease H1, thereby inhibiting the expression of the target gene.

[0031] As some embodiments of this application, the vector containing the nucleic acid fragment that inhibits CREPT protein expression includes one or more of adenovirus, adeno-associated virus, lentivirus, and retrovirus.

[0032] As some embodiments of this application, the reagents for homologous recombination and gene editing to eliminate the CREPT gene include the CRISPR / Cas9 system.

[0033] As some embodiments of this application, the nucleotide sequence of the siRNA is shown in any one of SEQ ID No. 1, 3-11, 15, 17-24, 27; the nucleotide sequence of the shRNA is shown in SEQ ID No. 12.

[0034] The nucleotide sequence of siRNA can have ≥75% homology with any of the nucleotide sequences shown in SEQ ID No. 1, SEQ ID No. 3-11, SEQ ID No. 15, SEQ ID No. 17-24 and SEQ ID No. 27. The nucleotide sequence of shRNA can also have ≥75% homology with the nucleotide sequence shown in SEQ ID No. 12, for example, having 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homology with the nucleotide sequence shown in SEQ ID No. 1; the same applies to other sequences.

[0035] Homology refers to the degree of similarity between the nucleotide sequences of two nucleic acid molecules or the amino acid sequences of two protein molecules. Sequence analysis is the ultimate method for determining the degree of homology, and DNA-DNA hybridization or DNA-RNA hybridization are also useful estimation methods.

[0036] As some embodiments of this application, the application includes any one or more of the following: a. preparing a drug for weight reduction; b. preparing a drug for lowering one or more of ALT, AST, HDL-C, LDL-C, LDH, and CHOL; c. preparing a drug for improving hepatic steatosis; d. preparing a drug for lowering body fat; e. preparing a drug for lowering one or more of triglyceride, total cholesterol, and glucose levels in the liver; f. preparing a drug for regulating hepatic lipid metabolism and glucose metabolism; g. preparing a drug for controlling the progression of fatty liver disease; h. preparing a drug for reducing the infiltration of inflammatory cells in the liver; i. preparing a drug for reducing hepatic fibrosis; j. k. Preparation of drugs to reduce fatty liver cells; l. Preparation of drugs to alleviate hepatic steatosis; m. Preparation of gene-regulating drugs; n. Preparation of drugs to regulate fatty acid synthesis extension; o. Preparation of drugs to improve lipid metabolism; p. Preparation of drugs to inhibit collagen synthesis; q. Preparation of drugs to regulate immune function; r. Preparation of drugs to regulate endocrine function; s. Preparation of drugs to inhibit inflammation in fatty liver disease; t. Preparation of drugs to significantly improve hepatic lipid metabolism and amino acid metabolism pathways; and t. Preparation of drugs to downregulate lipid metabolism-related metabolites, preferably, the drugs to downregulate lipid metabolism-related metabolites include drugs to downregulate glycerol and drugs to downregulate unsaturated glycosides.

[0037] As some embodiments of this application, the gene-regulating drugs include one or more of the following: Fap5 gene upregulation drugs, Pck1 gene upregulation drugs, Pnpla2 gene upregulation drugs, Apoa1 gene upregulation drugs, Acadm gene downregulation drugs, Pparg gene downregulation drugs, Pdk4 gene downregulation drugs, Lpl gene downregulation drugs, Acsl3 gene downregulation drugs, Scd1 gene downregulation drugs, Gk gene downregulation drugs, Acacb gene downregulation drugs, Plin2 gene downregulation drugs, Cd36 gene downregulation drugs, Cidec gene downregulation drugs, Plin4 gene downregulation drugs, G0s2 gene downregulation drugs, and Mogat1 gene downregulation drugs.

[0038] As some embodiments of this application, the fatty liver disease includes one or more of alcoholic fatty liver disease, metabolic-associated fatty liver disease, and special types of fatty liver.

[0039] Alcoholic fatty liver disease is chronic liver damage caused by long-term excessive drinking. It initially manifests as alcoholic fatty liver, which can then develop into alcoholic steatohepatitis (also known as alcoholic hepatitis), liver fibrosis, and cirrhosis.

[0040] Metabolic fatty liver disease (MAFLD) is chronic liver damage caused by genetic predisposition and overnutrition and its complications (insulin resistance, obesity, metabolic syndrome, type 2 diabetes), including metabolic fatty liver, metabolic fatty hepatitis (MASH), metabolic fatty liver fibrosis, and metabolic fatty liver cirrhosis.

[0041] Special types of fatty liver mainly refer to fatty liver caused by certain drugs (tamoxifen, amiodarone, sodium valproate, methotrexate, glucocorticoids, etc.) and environmental toxins (antimony, barium, organic solvents, etc.), as well as fatty liver caused by total parenteral nutrition, inflammatory bowel disease, malnutrition, genotype 3 hepatitis C virus infection, Wilson's disease, autoimmune hepatitis, β-lipoprotein deficiency, lipoatrophic diabetes, Mauriac syndrome, progressive muscular dystrophy, etc.

[0042] As some embodiments of this application, the alcoholic fatty liver disease includes one or more of alcoholic fatty liver, alcoholic steatohepatitis, liver fibrosis, and cirrhosis.

[0043] As some embodiments of this application, the metabolic-associated fatty liver disease (MAFLD) includes one or more of metabolic-associated fatty liver, metabolic-associated steatohepatitis (MASH), metabolic-associated fatty liver fibrosis, and metabolic-associated fatty liver cirrhosis.

[0044] As some embodiments of this application, the specific types of fatty liver include one or more of the following: drug-induced fatty liver, environmental toxin-induced fatty liver, disease-induced fatty liver, acute fatty liver, total parenteral nutrition-induced fatty liver, inflammatory bowel disease-induced fatty liver, and malnutrition-induced fatty liver.

[0045] Acute fatty liver disease is a special type of fatty liver disease. Its main causes include acute fatty liver of pregnancy, HELLP syndrome, Reye's syndrome, and alcoholic foamy hepatic steatosis.

[0046] As some embodiments of this application, drugs that cause fatty liver disease include one or more of tamoxifen, amiodarone, sodium valproate, methotrexate, and glucocorticoids.

[0047] As some embodiments of this application, the environmental toxins that cause fatty liver disease include one or more of antimony, barium, and organic solvents.

[0048] As some embodiments of this application, diseases leading to fatty liver disease include one or more of the following: genotype 3 hepatitis C virus infection, Wilson's disease, autoimmune hepatitis, β-lipoprotein deficiency, lipoatrophic diabetes, Mauriac syndrome, and progressive muscular dystrophy.

[0049] As some embodiments of this application, the etiology of the acute fatty liver includes one or more of the following: acute fatty liver of pregnancy, HELLP syndrome, Reye syndrome, and alcoholic foamy hepatic steatosis.

[0050] As some embodiments of this application, acute fatty liver includes one or more of acute fatty liver of pregnancy, HELLP syndrome, Reye syndrome, and alcoholic foamy hepatic steatosis.

[0051] A second aspect of this application is to provide a medicament for treating fatty liver disease, said medicament comprising an agent that reduces CREPT gene expression or impairs or inactivates CREPT protein function.

[0052] As some embodiments of this application, the drug comprises an effective amount of one or more of siRNA, ASO, and AAV containing siRNA and shRNA.

[0053] As some embodiments of this application, the nucleotide sequences of the siRNA are shown in SEQ ID No. 1, SEQ ID No. 3-11, SEQ ID No. 15, SEQ ID No. 17-24 and SEQ ID No. 27. The nucleotide sequence of the shRNA is shown in SEQ ID No. 12.

[0054] As some embodiments of this application, the drug also includes a delivery system.

[0055] As some embodiments of this application, the delivery system includes one of GalNAc and LNP.

[0056] A third aspect of this application is to provide a pharmaceutical combination product comprising the aforementioned drug and a second drug, wherein the second drug has a therapeutic effect on fatty liver disease; preferably, the second drug comprises semaglutide or rametiro.

[0057] As some embodiments of this application, the drug and the second drug are used sequentially or simultaneously.

[0058] The fourth aspect of this application is to provide the use of the said drug or the said drug combination product in the preparation of a medicament for treating fatty liver disease or its symptoms.

[0059] As some embodiments of this application, the medicament for treating fatty liver disease or its symptoms includes any one of the following: a. a medicament for weight loss; b. a medicament for reducing one or more of ALT, AST, HDL-C, LDL-C, LDH, and CHOL; c. a medicament for improving hepatic fat accumulation; d. a medicament for reducing body fat; e. a medicament for reducing one or more of triglyceride, total cholesterol, and glucose levels in the liver; f. a medicament for regulating hepatic lipid metabolism and glucose metabolism; g. a medicament for controlling the progression of fatty liver disease; h. a medicament for reducing the infiltration of inflammatory cells in the liver; i. a medicament for reducing hepatic fibrosis. The drugs include: j. drugs for reducing fatty degeneration cells; k. drugs for alleviating hepatic steatosis; l. drugs for gene regulation; m. drugs for regulating fatty acid synthesis extension; n. drugs for improving lipid metabolism; o. drugs for inhibiting collagen synthesis; p. drugs for regulating immune function; q. drugs for regulating endocrine function; r. drugs for inhibiting inflammation in fatty liver disease; s. drugs for significantly improving hepatic lipid metabolism and amino acid metabolism pathways; and t. drugs for downregulating lipid metabolism-related metabolites, preferably, the drugs for downregulating lipid metabolism-related metabolites include drugs for downregulating glycerol and drugs for downregulating unsaturated glycosides.

[0060] As some embodiments of this application, the gene-regulating drugs include one or more of the following: Fap5 gene upregulation drugs, Pck1 gene upregulation drugs, Pnpla2 gene upregulation drugs, Apoa1 gene upregulation drugs, Acadm gene downregulation drugs, Pparg gene downregulation drugs, Pdk4 gene downregulation drugs, Lpl gene downregulation drugs, Acsl3 gene downregulation drugs, Scd1 gene downregulation drugs, Gk gene downregulation drugs, Acacb gene downregulation drugs, Plin2 gene downregulation drugs, Cd36 gene downregulation drugs, Cidec gene downregulation drugs, Plin4 gene downregulation drugs, G0s2 gene downregulation drugs, and Mogat1 gene downregulation drugs.

[0061] The fifth aspect of this application is to provide a method for treating fatty liver disease, the method comprising treating fatty liver disease by administering to a patient an agent targeting the CREPT gene or protein to reduce the expression of the CREPT gene or to reduce or inactivate the function of the CREPT protein.

[0062] As some embodiments of this application, the reagents targeting the CREPT gene or protein include one or more of siRNA, ASO, and AAV containing siRNA and shRNA.

[0063] As some embodiments of this application, the nucleotide sequences of the siRNA are shown in SEQ ID No. 1, SEQ ID No. 3-11, SEQ ID No. 15, SEQ ID No. 17-24 and SEQ ID No. 27; and the nucleotide sequences of the shRNA are shown in SEQ ID No. 12.

[0064] The sixth aspect of this application is to provide a drug for controlling the progression of liver disease, the liver disease including one or more progressive stages of fatty liver, hepatitis caused by fatty liver disease, liver fibrosis, and cirrhosis; wherein the drug controls the progression of liver disease by reducing the expression of the CREPT gene or by reducing or inactivating the function of the CREPT protein.

[0065] As some embodiments of this application, the reagent targeting the CREPT gene or protein is selected from one or more of the following: agents that affect CREPT protein expression, agents that knock out CREPT protein, agents that alter CREPT protein, and agents that degrade CREPT protein.

[0066] As some embodiments of this application, the formulation affecting CREPT protein expression includes a nucleic acid reagent or a vector containing a nucleic acid fragment that inhibits CREPT protein expression.

[0067] As some embodiments of this application, the formulation for knocking out the CREPT protein includes reagents for homologous recombination and gene editing to eliminate the CREPT gene.

[0068] As some embodiments of this application, the formulation for altering the CREPT protein includes agents that alter the structure of the CREPT protein.

[0069] As some embodiments of this application, the formulation for degrading CREPT protein includes one or more of the following: PROTAC, molecular glue, LYTAC, MoDE, ATAC, Apt-LYTAC, AbTAC, PROTAB, REULR, KineTAC, IFLD, ATTEC, AUTAC, and AUTOTAC pathways.

[0070] The drug includes a small molecule inhibitor of the CREPT protein.

[0071] As some embodiments of this application, the nucleic acid reagent includes one or more of siRNA, shRNA, microRNA, and ASO.

[0072] As some embodiments of this application, the vector containing the nucleic acid fragment that inhibits CREPT protein expression includes one or more of adenovirus, adeno-associated virus, lentivirus, and retrovirus.

[0073] The reagents used for homologous recombination and gene editing to eliminate the CREPT gene include the CRISPR / Cas9 system;

[0074] As some embodiments of this application, the nucleotide sequences of the siRNA are shown in SEQ ID No. 1, SEQ ID No. 3-11, SEQ ID No. 15, SEQ ID No. 17-24 and SEQ ID No. 27; and the nucleotide sequences of the shRNA are shown in SEQ ID No. 12.

[0075] A seventh aspect of this application is to provide a method for controlling the progression of liver disease, the method comprising administering to a patient an agent targeting the CREPT gene or protein to control the progression of liver disease by reducing the expression of the CREPT gene or by reducing or inactivating the function of the CREPT protein; wherein the liver disease includes one or more stages of fatty liver, hepatitis caused by fatty liver disease, liver fibrosis, and cirrhosis.

[0076] As some embodiments of this application, the reagents targeting the CREPT gene or protein include one or more of siRNA, ASO, and AAV containing siRNA and shRNA.

[0077] As some embodiments of this application, the nucleotide sequences of the siRNA are shown in SEQ ID No. 1, SEQ ID No. 3-11, SEQ ID No. 15, SEQ ID No. 17-24 and SEQ ID No. 27; and the nucleotide sequences of the shRNA are shown in SEQ ID No. 12.

[0078] The eighth aspect of this application is to provide CREPT + Liver parenchymal cells or CREPT test + The use of reagents for liver parenchymal cells in the preparation of a kit for detecting whether a patient has fatty liver.

[0079] As some embodiments of this application, the CREPT + If liver parenchymal cells are positive for CREPT expression or the protein expressing CREPT is positive, the patient has fatty liver disease.

[0080] As some embodiments of this application, CREPT detection + The reagents used for liver parenchymal cells are those capable of detecting CREPT protein or CREPT mRNA.

[0081] As some embodiments of this application, the detection of CREPT + The reagent for liver parenchymal cells is used to determine the presence of CREPT protein or CREPT mRNA through in vitro detection.

[0082] As some embodiments of this application, the methods for detecting the presence of CREPT mRNA in vitro include one or more of qPCR, nucleic acid sequencing or hybridization, mass spectrometry, and chromatography.

[0083] As some embodiments of this application, the methods for detecting the presence of CREPT protein in vitro include one or more of immunological detection, mass spectrometry, and spectroscopy.

[0084] The ninth aspect of this application is to provide CREPT + The proportion of hepatic parenchymal cells or the detection of CREPT + The use of reagents for determining the proportion of hepatocytes in the preparation of a kit for assessing the progression of liver disease in a patient.

[0085] As some embodiments of this application, the CREPT + The proportion of hepatocytes is the percentage of hepatocytes that are positive for CREPT gene expression and / or CREPT protein expression.

[0086] As some embodiments of this application, the liver disease includes one or more stages of fatty liver disease, hepatitis caused by fatty liver disease, liver fibrosis, and cirrhosis.

[0087] As some embodiments of this application, the CREPT + The higher the proportion of hepatocytes, the higher the stage of liver disease progression.

[0088] The tenth aspect of this application is to provide the CREPT gene or protein as a target or an agent targeting the CREPT gene or protein for the treatment of obesity or in the preparation of a medicament for the treatment of obesity, wherein obesity is treated by reducing the expression of the CREPT gene or by reducing or inactivating the function of the CREPT protein.

[0089] Obesity refers to a significant degree of overweight and excessive fat accumulation, a condition caused by excessive accumulation of body fat, especially triglycerides. Excessive food intake or changes in metabolism lead to excessive fat accumulation, resulting in excessive weight gain and causing or inducing pathological and physiological changes in the body.

[0090] As some embodiments of this application, the reagent targeting the CREPT gene or protein reduces CREPT gene expression or impairs or inactivates CREPT protein function.

[0091] As some embodiments of this application, the reagent targeting the CREPT gene or protein is selected from one or more of the following: agents that affect CREPT protein expression, agents that knock out CREPT protein, agents that alter CREPT protein, and agents that degrade CREPT protein.

[0092] As some embodiments of this application, the formulation affecting CREPT protein expression includes a nucleic acid reagent or a vector containing a nucleic acid fragment that inhibits CREPT protein expression.

[0093] As some embodiments of this application, the formulation for knocking out the CREPT protein includes reagents for homologous recombination and gene editing to eliminate the CREPT gene.

[0094] As some embodiments of this application, the formulation for altering the CREPT protein includes agents that alter the structure of the CREPT protein.

[0095] As some embodiments of this application, the formulation for degrading CREPT protein includes one or more of the following: PROTAC, molecular glue, LYTAC, MoDE, ATAC, Apt-LYTAC, AbTAC, PROTAB, REULR, KineTAC, IFLD, ATTEC, AUTAC, and AUTOTAC pathways.

[0096] As some embodiments of this application, the drug includes a small molecule inhibitor of the CREPT protein.

[0097] As some embodiments of this application, the nucleic acid reagent is selected from one or more of siRNA, shRNA, microRNA, and ASO.

[0098] As some embodiments of this application, the vector containing the nucleic acid fragment that inhibits CREPT protein expression includes one or more of adenovirus, adeno-associated virus, lentivirus, and retrovirus.

[0099] As some embodiments of this application, the reagents for homologous recombination and gene editing to eliminate the CREPT gene include the CRISPR / Cas9 system.

[0100] As some embodiments of this application, the nucleotide sequences of the siRNA are shown in SEQ ID No. 1, SEQ ID No. 3-11, SEQ ID No. 15, SEQ ID No. 17-24 and SEQ ID No. 27; and the nucleotide sequences of the shRNA are shown in SEQ ID No. 12.

[0101] As some embodiments of this application, the application has one or more effects of reducing overall weight, reducing body mass index, reducing waist circumference, and reducing overall fat.

[0102] The eleventh aspect of this application is to provide a medicament for treating obesity, the medicament comprising the agent that reduces CREPT gene expression or impairs or inactivates CREPT protein function.

[0103] As some embodiments of this application, the reagents for reducing CREPT gene expression or impairing or inactivating CREPT protein function are selected from one or more of the following: agents that affect CREPT protein expression, agents that knock out CREPT protein, agents that alter CREPT protein, and agents that degrade CREPT protein.

[0104] As some embodiments of this application, the formulation affecting CREPT protein expression includes a nucleic acid reagent or a vector containing a nucleic acid fragment that inhibits CREPT protein expression.

[0105] As some embodiments of this application, the formulation for knocking out the CREPT protein includes reagents for homologous recombination and gene editing to eliminate the CREPT gene.

[0106] As some embodiments of this application, the formulation for altering the CREPT protein includes agents that alter the structure of the CREPT protein.

[0107] As some embodiments of this application, the formulation for degrading CREPT protein includes one or more of the following: PROTAC, molecular glue, LYTAC, MoDE, ATAC, Apt-LYTAC, AbTAC, PROTAB, REULR, KineTAC, IFLD, ATTEC, AUTAC, and AUTOTAC pathways.

[0108] The drug includes a small molecule inhibitor of the CREPT protein.

[0109] As some embodiments of this application, the drug comprises an effective amount of one or more of siRNA, ASO, and AAV containing siRNA and shRNA, wherein the nucleotide sequence of the siRNA is shown in SEQ ID No. 1, SEQ ID No. 3-11, SEQ ID No. 15, SEQ ID No. 17-24, and SEQ ID No. 27. The nucleotide sequence of the shRNA is shown in SEQ ID No. 12.

[0110] As some embodiments of this application, the drug also includes a delivery system.

[0111] As some embodiments of this application, the delivery system includes one of GalNAc and LNP.

[0112] The twelfth aspect of this application is to provide a pharmaceutical combination product comprising the aforementioned drug and a second drug, wherein the second drug has an effect on treating obesity; preferably, the second drug comprises smegglutide or rametiro.

[0113] As some embodiments of this application, the drug and the second drug are used sequentially or simultaneously.

[0114] The thirteenth aspect of this application is to provide the use of the said drug or the said drug combination product in the preparation of a drug for treating obesity.

[0115] The fourteenth aspect of this application is to provide a method for treating obesity, the method comprising administering to a patient an agent targeting the CREPT gene or protein to treat obesity by reducing the expression of the CREPT gene or by reducing or inactivating the function of the CREPT protein.

[0116] As some embodiments of this application, the reagent targeting the CREPT gene or protein is selected from one or more of the following: agents that affect CREPT protein expression, agents that knock out CREPT protein, agents that alter CREPT protein, and agents that degrade CREPT protein.

[0117] As some embodiments of this application, the formulation affecting CREPT protein expression includes a nucleic acid reagent or a vector containing a nucleic acid fragment that inhibits CREPT protein expression.

[0118] As some embodiments of this application, the formulation for knocking out the CREPT protein includes reagents for homologous recombination and gene editing to eliminate the CREPT gene.

[0119] As some embodiments of this application, the formulation for altering the CREPT protein includes agents that alter the structure of the CREPT protein.

[0120] As some embodiments of this application, the formulation for degrading CREPT protein includes one or more of the following: PROTAC, molecular glue, LYTAC, MoDE, ATAC, Apt-LYTAC, AbTAC, PROTAB, REULR, KineTAC, IFLD, ATTEC, AUTAC, and AUTOTAC pathways.

[0121] The drug includes a small molecule inhibitor of the CREPT protein.

[0122] As some embodiments of this application, the reagents targeting the CREPT gene or protein include one or more of siRNA, ASO, and AAV containing siRNA and shRNA.

[0123] As some embodiments of this application, the nucleotide sequences of the siRNA are shown in SEQ ID No. 1, SEQ ID No. 3-11, SEQ ID No. 15, SEQ ID No. 17-24 and SEQ ID No. 27; and the nucleotide sequences of the shRNA are shown in SEQ ID No. 12.

[0124] As some embodiments of this application, the treatment of obesity includes one or more of the following indicators: reducing total weight, reducing body mass index, reducing waist circumference, and reducing total fat.

[0125] As stated above, the role of CREPT in fatty liver disease and its comorbid fatty liver disease, and its targeted therapy, have the following beneficial effects:

[0126] 1. This application found that CREPT is highly expressed in the liver of patients with fatty liver disease associated with various liver diseases.

[0127] 2. After inhibiting CREPT expression with siRNA, the liver morphology and color of mice with fatty liver induced by high-fat diet were restored, the appearance was relatively smooth and normal, the body weight was significantly reduced, the hepatic steatosis was alleviated, and indicators such as ALT and AST were significantly reduced. The levels of triglycerides, total cholesterol and glucose in the liver were also reduced.

[0128] 3. After inhibiting CREPT expression with siRNA, the collagen synthesis family was significantly downregulated in mice with 60% HFD-induced fatty liver, and the expression of genes related to fatty liver was downregulated. In cell biology, immune function and lipid metabolism were enhanced. In signal transduction, the Wnt signaling pathway and PI3K-AKT pathway were inhibited, which regulated fatty acid synthesis extension, improved lipid metabolism, inhibited collagen synthesis, regulated immune function, regulated endocrine function, and inhibited the accumulation of fat in the liver, thereby controlling the progression of fatty liver and the generation of inflammation. Attached Figure Description

[0129] Figure 1. Expression of CREPT in human models of steatosis and mouse models of fatty liver.

[0130] Figure 1A. Expression of CREPT in healthy individuals and various liver diseases with and without hepatic steatosis, as well as in databases. Figure 1A sequentially shows two types of human specimens without steatosis: healthy control tissue (without steatosis) and focal nodular hyperplasia (FNH, without steatosis); other human specimens containing steatosis include: gallbladder adenomyomatosis (with steatosis), chronic cholecystitis (with steatosis), hepatocellular carcinoma (HCC, with steatosis), focal nodular hyperplasia (FNH, with steatosis), benign liver tumors (with steatosis), and gallbladder adenocarcinoma (with steatosis), among other clinically derived tissue samples. Figure 1B. Immunohistochemical detection of HE and CREPT in liver tissues of mice on normal diet (NCD) and high-fat diet (HFD) at 4, 8, and 12 weeks. Figure 1C. Detection of various liver function indicators in serum of mice on normal diet (NCD) and high-fat diet (HFD) at 4, 8, and 12 weeks.

[0131] Figure 2. CREPT knockout significantly reduced fat accumulation induced by a high-fat diet. Figure 2A. Schematic diagram of the overall experimental procedure for mice. Mice were fed either a normal control diet (NCD) or a high-fat diet (HFD), and their weight and food intake were recorded at predetermined time points. At the experimental endpoint, the mice were disposed of, and relevant tissue samples were collected for subsequent analysis. Figure 2B. Weight changes of mice in different experimental groups during the experimental period. The horizontal axis represents the number of experimental days, and the vertical axis represents the mouse weight. Different curves correspond to mice with normal CREPT expression or conditional knockout under normal control diet or high-fat diet conditions, respectively, reflecting the overall weight change trend of mice under different gene states and dietary conditions. Figure 2C. Statistical results of liver weight and liver weight / body weight ratio of mice in each group at the experimental endpoint. The bar chart represents the average level of each experimental group, the scatter plot represents the distribution of individual samples, and statistical differences are marked with symbols in the figure. Figure 2D. Histological analysis results of liver tissue from animals in different experimental groups. The top row shows the hematoxylin-eosin (HE) staining results of liver tissue, used to observe the overall structure of liver tissue and pathological features related to fatty degeneration; the middle row shows the Oil Red O staining results, used to show the distribution of neutral lipids in liver tissue. The bottom row shows the immunohistochemical staining (IHC) results of target proteins in the liver tissue of animals in different experimental groups. Brown signals indicate positive expression of CREPT protein, and cell nuclei appear blue after hematoxylin counterstaining. The images shown are representative fields of view, used to demonstrate the effect of conditional knockout of the CREPT gene on the expression and distribution of CREPT protein in liver tissue under normal control diet or high-fat diet conditions. Figure 2E. The bar charts quantitatively analyze the grade of fatty degeneration and the area stained with Oil Red O, used to reflect the changes in the degree of lipid deposition in the liver under different experimental conditions. Figure 2F. Statistical results of kidney weight, spleen weight, kidney weight / body weight ratio, spleen weight / body weight ratio, quadriceps weight, and inguinal white adipose tissue weight (iWAT) of animals in each experimental group at the experimental endpoint. The bar chart represents the average level of the corresponding indicators in each experimental group, and the scatter plot represents the distribution of individual samples. Statistical differences are marked with symbols in the figure. The above results were used to evaluate the changes in peripheral organ mass and adipose tissue distribution under different dietary conditions and target gene states. Figure 2G. Detection results of multiple serum biochemical indicators in mice under different dietary conditions and target gene conditional knockout states. The figure shows the detection results of alanine aminotransferase (ALT), aspartate aminotransferase (AST), lactate dehydrogenase (LDH), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), triglycerides (TG), total cholesterol (CHOL), blood glucose (Glucose), and creatine kinase (CK) in the serum of mice in each experimental group. The vertical axis represents the measured value of the corresponding biochemical indicator, and the horizontal axis represents the different experimental groups.The bar chart is used to represent the average level of each experimental group, the scatter plot represents the distribution of individual samples, and statistical differences are marked in the figure with symbols.

[0132] Figure 3. The therapeutic effect of GalNAc-delivered CREPT siRNA in a high-fat diet (HFD)-induced fatty liver model. Figure 3A. Schematic diagram of the timeline of subcutaneous (sc) administration of GalNAc-siRNA to mice during weeks 12–16 of HFD-induced fatty liver model, with sacrifice at the endpoint; inset shows a representative mouse appearance. Figure 3B. Curves of mouse body weight change over time in each group during the experiment (examples show the HFD group, HFD-GalNAc-NC negative control group, and HFD-GalNAc-siCREPT treatment group). Figure 3C. Statistical results of liver weight at the endpoint for each group (example groups include normal diet control NCD, HFD, HFD-GalNAc-NC, and HFD-GalNAc-siCREPT). Figure 3D. Immunoblotting (WB) results of CREPT protein in liver tissue, with β-Actin used as an internal control to verify the downregulation effect of GalNAc-siCREPT. Figure 3E. Serum biochemical index detection results, including changes in ALT (E), AST (F), LDH (G), and total cholesterol (CHOL) (H). Figure 3F. Representative photographs of mouse liver appearance in each group (top row), and representative images of liver tissue H&E staining (middle-top row), CREPT immunohistochemistry (IHC-CREPT) (middle-bottom row), and Oil Red O staining (bottom row); example groups include NCD, HFD, HFD-GalNAc-NC, and HFD-GalNAc-siCREPT, with magnified views provided. Figure 3G. Liver triglyceride content (Liver TG, μg / g tissue) detection results, used to compare the differences between the HFD-GalNAc-NC and HFD-GalNAc-siCREPT groups. Liver total cholesterol content (Liver TC, μg / g tissue) detection results, used to compare the differences between the HFD-GalNAc-NC and HFD-GalNAc-siCREPT groups. Liver glycogen content (mg / g tissue) was measured to compare the differences between the HFD-GalNAc-NC and HFD-GalNAc-siCREPT groups. The bar charts in the figure show the mean and the distribution of discrete points (individuals), with statistical significance indicated by ns, **, ****.

[0133] Figure 4. The role of AAV8-delivered CREPT shRNA in a high-fat diet (HFD)-induced fatty liver model. Figure 4A. High-fat diet (HFD) induction: Mice were administered AAV8-shRNA via tail vein (iv) once at week 8 and sacrificed at the endpoint. Figure 4B. Weight changes in the two groups of mice at the end of the experiment (HFD-AAV8-shNC negative control group and HFD-AAV8-shCREPT treatment group). Figure 4C. Liver weight statistics at the endpoint for each group (HFD-AAV8-shNC negative control group and HFD-AAV8-shCREPT treatment group). Figures 4D-4G. Serum biochemical indicators, including changes in ALT(D), AST(E), TG(F), and total cholesterol (CHOL(G)). Figure 4H. H&E and Oil Red staining of liver tissue from each group of mice; example groups include the HFD-AAV8-shNC negative control group and the HFD-AAV8-shCREPT treatment group. The bar chart in the figure shows the distribution of the mean and marks the statistical significance (ns, *, ***).

[0134] Figure 5. Expression of CREPT in the public database MASH. The changes in CREPT mRNA expression levels in different human liver disease states were analyzed based on public transcriptome databases.

[0135] Figure 6. Expression of CREPT in the MASH phenotype induced by a high-fat diet. Figure 6A. Immunohistochemical staining of liver tissues from mice fed a normal diet (NCD) and a high-fat diet (HFD) at 20 and 30 weeks of age for HE and CREPT. Figure 6B. HE staining of liver tissues from high-fat diet (HFD) mice at 20 and 30 weeks of age to observe the three main characteristics of MASH. Figure 6C. Detection of various liver function indicators in serum from mice fed a normal diet (NCD) and a high-fat diet (HFD) at 20 and 30 weeks of age.

[0136] Figure 7. Therapeutic effect of GalNAc-siCREPT in HFD+CCL4-induced MASH. Figure 7A. Schematic diagram of model establishment and drug administration timeline. Mice were induced by a high-fat diet (HFD) for weeks 12–16, and then administered GalNAc-siRNA subcutaneously (sc) in combination with intraperitoneal injection (ip) of CCl4. Mice were sacrificed after the last treatment for tissue collection. Figure 7B. Curves showing the change in mean body weight of mice in each group over time during the experiment (examples show NCD, HFD+CCl4, HFD+CCl4-GalNAc-NC, and HFD+CCl4-GalNAc-siCREPT). Figure 7C. Curves showing the change in food intake of mice in each group over time during the experiment. Figure 7D. Statistical results of liver weight at the endpoint (example groups include NCD, HFD+CCl4, HFD+CCl4-GalNAc-NC, and HFD+CCl4-GalNAc-siCREPT). Figure 7E. Western blot results of CREPT protein in liver tissue, with β-Actin used as an internal control to verify the downregulation effect of GalNAc-siCREPT on CREPT. Figures 7F–7H. Results of liver tissue metabolism-related indicators, including liver triglyceride content (Liver TG) (7F), liver total cholesterol content (Liver TC) (7G), and liver glycogen content (Liver glycogen) (7H), used to compare the differences between the HFD+CCl4-GalNAc-NC and HFD+CCl4-GalNAc-siCREPT groups. Figure 7I. Representative photographs of mouse liver appearance in each group (first row), and representative images of liver tissue H&E staining (second row), Sirius Red staining (third row, reflecting collagen deposition / fibrosis), Masson staining (fourth row, reflecting fibrosis / collagen fiber distribution), and Oil Red O staining (fifth row, reflecting lipid deposition); example groups include NCD, HFD+CCl4, HFD+CCl4-GalNAc-NC, and HFD+CCl4-GalNAc-siCREPT, with a rametirone (Resmetirom) treatment group as a positive control example. Below are bar charts: Quantitative results of NAS score based on histological assessment. Figure 7J: Serum biochemical index detection results, including changes in ALT, AST, LDH, and total cholesterol (CHOL).

[0137] Figure 8. Screening of human-mouse homologous sequences of CREPT siRNA. The expression level of the CREPT gene was detected by real-time quantitative PCR to verify the knockdown efficiency of siCREPT-1 to siCREPT-7 in human hepatocellular carcinoma cell lines HepG2 and Huh7, as well as siCREPT-HMF-35, with NC as a negative control.

[0138] Figure 9. Therapeutic effect of GalNAc-siCREPT-1 in HFD-induced MASH. Figure 9A. Schematic diagram of model establishment and drug administration timeline. Mice were treated with subcutaneous (sc) administration of GalNAc-siRNA during weeks 16–24 of high-fat diet (HFD) induction, and were sacrificed for tissue collection after the last treatment. Figure 9B. Curves showing the change in mean body weight of mice in each group over time during the experiment (examples show NCD, HFD, HFD-GalNAc-NC, and HFD-GalNAc-siCREPT). Figure 9C. Western blot results of CREPT protein in liver tissue, with β-Actin used as an internal control to verify the downregulation effect of GalNAc-siCREPT on CREPT. Figures 9D–9F. Comparison of body weight, liver weight, and kidney weight among different treatment groups. Figures 9G-9I. Figure 9G shows the H&E staining, CREPT staining, Sirius Red staining (third row, reflecting collagen deposition / fibrosis), and Masson staining (fourth row, reflecting fibrosis / collagen fiber distribution) of liver tissue from mice in the control and treatment groups. Example groupings include HFD+-GalNAc-NC and HFD-GalNAc-siCREPT. Figures 9H and I compare fibrosis-positive areas. Figure 9J: Quantitative results of NAS score based on histological assessment. Figures 9K-9O: Serum biochemical index detection results, including changes in ALT, AST, LDH, total cholesterol (CHOL), and HDLC.

[0139] Figure 10. Therapeutic effects of GalNAc-siCREPT and the GLP-1 receptor agonist semaglutide in HFD+CCL4-induced MASH. Figure 10A. Schematic diagram of model establishment and drug administration timeline. Mice were induced by a high-fat diet (HFD) from week 16 to week 24, and were administered GalNAc-siRNA and semaglutide subcutaneously (sc). After the last treatment, the mice were sacrificed for sampling. Figure 10B. Curves showing the change in mean body weight of mice in each group over time during the experiment (examples show NCD, HFD, HFD-semaglutide+GalNAc-NC, and HFD-semaglutide+GalNAc-siCREPT). Figures 10C-10D: Endpoint mouse and liver weight statistics (example groups include NCD, HFD, HFD-Semaglutide + GalNAc-NC, and HFD-Semaglutide + GalNAc-siCREPT). Figures 10E-10I: Serum biochemical indicators, including changes in ALT, AST, LDH, total cholesterol (CHOL), and HDLC. Figure 10J: Representative images of H&E and CREPT staining of liver tissue from each group of mice. Figure 10K: Quantitative results of NAS score based on histological assessment.

[0140] Figure 11. Therapeutic effects of GalNAc-siCREPT and resmetirom in HFD+CCL4-induced MASH. Figure 11A. Schematic diagram of model establishment and drug administration timeline. Mice were induced by a high-fat diet (HFD) for weeks 12–16, and then administered GalNAc-siRNA subcutaneously (sc) in combination with intraperitoneal injection (ip) of CCl4. Resmetirom was mixed into the mouse diet. After the last treatment, the mice were sacrificed for tissue collection. Figure 11B. Representative images of H&E staining of liver tissue from each group of mice. Figure 10C. Quantitative results of NAS score obtained based on histological assessment.

[0141] Figure 12. Effects of CREPT-siRNA on human hepatic steatosis and fibrotic organoids. (A) Oil Red staining of lipid droplet formation in human fatty liver organoids by CREPT-siRNA. (B) Detection of triglyceride levels in human fatty liver organoids after CREPT-siRNA treatment. (C) Oil Red staining of lipid droplet formation in induced adipocytes after CREPT-siRNA treatment. (D) Determination of triglycerides and total cholesterol in induced adipocytes after CREPT-siRNA treatment. (E) Determination of mitochondrial activity in induced adipocytes after CREPT-siRNA treatment. (F) Immunohistochemical staining of CREPT in fibrotic organoids after CREPT-siRNA treatment. (G) Sirius red staining in fibrotic organoids after CREPT-siRNA treatment.

[0142] Figure 13. Distribution of CREPT siRNA with different delivery methods in mice. Figure 13A-C fluorescence imaging confirms that LNP-siCREPT can be efficiently delivered to the liver, with the signal intensity in the liver region significantly higher than that in non-target organs such as the spleen, kidneys, lungs, and lymph nodes (Figure 13A-C). There is no statistically significant difference in liver fluorescence intensity between the LNP-siCREPT group and the control siRNA (LNP-siNC) group (Figure 13B-C), indicating that both lipid nanoparticles can achieve efficient targeted delivery to the liver, validating the liver tissue specificity of this delivery system. Figure 13D-F fluorescence imaging confirms that GalNAc-siCREPT can be efficiently delivered to the liver, with the signal intensity in the liver region significantly higher than that in non-target organs such as the spleen, kidneys, lungs, and lymph nodes (Figure 13D-F). There is no statistically significant difference in liver fluorescence intensity between the GalNAc-siCREPT group and the control siRNA (GalNAc-siNC) group (Figure 13E-F).

[0143] Figure 14. Mechanism of action of CREPT as a target in fatty liver: The role of CREPT in fatty liver disease is closely related to the PPARγ pathway. Figure 14A. Schematic diagram of KEGG pathway enrichment analysis results based on RNA sequencing differentially expressed genes. Bubble charts or scatter plots are used to show significantly enriched pathways and their enrichment levels, with the PPAR signaling pathway highlighted in the enrichment results. Figure 14B. Schematic diagram of expression profile heatmap of differentially expressed genes related to the PPARγ axis. The expression levels of selected genes in different samples or groups are row-normalized and displayed as a color gradient to characterize the overall expression pattern differences of PPARγ axis genes between groups. Figure 14C. Schematic diagram of bar chart of differential expression results of PPARγ axis genes. Colors are used to distinguish differential expression directions, and the display is combined with set thresholds to show the direction and magnitude of changes in key genes. Figure 14D. Schematic diagram of the results of qPCR detection of the relative mRNA expression levels of lipid metabolism-related genes in liver tissues of mice with different genotypes. The differences in expression of fatty acid synthesis-related genes FASN and SREBP1, fatty acid uptake-related gene CD36, fatty acid oxidation-related gene PPARα, mitochondrial function-related gene hm9CR, and lipolysis-related genes PPARγ, G0S2, ATGL, CGI58, and MAGL between the control group and the CREPT gene knockout group are compared, and statistical significance is marked. Figure 14E. Schematic diagram of the results of Western blotting detection of the expression levels of PI3K-AKT-mTOR pathway and lipid metabolism-related proteins in liver tissues of mice with different genotypes. The differences in expression of P-mTOR, P-AKT, FASN, S6K1, CREPT, 4EBP1, and PI3K proteins between the control group and the CREPT gene knockout group are compared, with β-actin as an internal control. Figure 14F. Schematic diagram of immunoblotting results showing changes in the expression of related proteins after oleic acid (OA) treatment for different times (0h, 24h, 48h) in HepG2 cells and CREPT knockdown HepG2 cells (HepG2 sh2). The levels of proteins such as PI3K, AKT, P-AKT, PPARγ, G0S2, and CREPT were detected, with β-actin as an internal control. Figure 14G. Schematic diagram of the results of co-immunoprecipitation (co-IP) to verify the interaction between CREPT and PPARγ in 293T cells co-transfected with Myc-CREPT and Flag-PPARγ (or the corresponding empty vector) and treated with rosiglitazone. Immunoprecipitation was performed with Flag or Myc, and the lysate and precipitation products were detected by immunoblotting (IB) to show the binding of Myc-CREPT and Flag-PPARγ under different treatment conditions, and the positions of the antibody heavy chains were marked.

[0144] Figure 15. Safety data for CREPT as a therapeutic target, showing that specific knockout of the CREPT gene in hepatocytes does not affect liver function in mice. Figure 15A. Efficiency of specific CREPT knockout in hepatocytes detected by Western blotting. Figures 15B, C, and D. Effects of CREPT gene knockout in hepatocytes on body weight in 2-10 week old male and female mice. Figures 15E and F. Effects of specific CREPT gene knockout in hepatocytes on the liver-to-body weight ratio in mice of different ages. Figure 15G. Effects of CREPT gene knockout in hepatocytes on the spleen-to-body weight ratio. Figure 15H. Effects of CREPT gene knockout in hepatocytes on liver appearance (gross view) and histological morphology (HE staining). Figure 15I. Effects of CREPT gene knockout in hepatocytes on hepatocyte apoptosis detected by TUNEL assay. Figure 15J. Changes in liver ALT, AST, LDH, and TG, as well as changes in cytokines TNF-α and IL-6, detected by blood biochemistry and ELISA experiments. Figure 15K. Effects of CREPT gene knockout in hepatocytes on the livers of 6-month-old male and female mice. Figure 15L. Effects of CREPT gene knockout in hepatocytes on immune cells in the peripheral blood of 6-month-old male and female mice. Figure 15M. Effects of CREPT gene knockout in hepatocytes on biochemical parameters in the peripheral blood of 6-month-old male and female mice. Detailed Implementation

[0145] To make the technical means, creative features, achieved objectives, and effects of this invention readily understandable, the technical solutions in the embodiments of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Obviously, the described embodiments are merely some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0146] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0147] Laboratory animals, materials and methods

[0148] All experiments involving mice in this study were conducted in accordance with the guidelines of the Tsinghua University Animal Care and Use Committee and approved by the Tsinghua University Ethics Committee.

[0149] Male C57BL / 6J mice, aged 8 and 20 weeks, were purchased from Vital River Biotechnology Co., Ltd. Upon arrival, the mice were acclimatized for one week. Mice with fatty liver induced by a high-fat diet were purchased from Zhongyan Zichuang (Beijing) Biotechnology Co., Ltd., and the high-fat diet was purchased from Beijing Yicheng Technology Co., Ltd.

[0150] In Example 9, both male and female grandparent mice were purchased from Vital River C57BL / 6J mice in Beijing, and the offspring had the genotype CREPT. flox / flox The genotype is Alb-cre + / - CREPT flox / flox The parents were born through surrogacy.

[0151] HE, immunohistochemistry (IHC), and image analysis

[0152] The paraffin-embedded liver tissue sections were stained with hematoxylin and eosin (HE) and analyzed by IHC.

[0153] Specifically, slides were dewaxed and heat-treated with citrate buffer (pH 6) (Zhongshan Jinqiao Biotechnology Co., Ltd.) for 30 min to extract antigen. Slides were then blocked with 0.3% H2O2 (Zhongshan Jinqiao Biotechnology Co., Ltd.) for 20 min at room temperature, followed by blocking with appropriate blocking serum (Zhongshan Jinqiao Biotechnology Co., Ltd.) for 30 min. Primary antibody was incubated overnight at 4°C (prepared in-house). Slides were washed with 1×PBST and incubated with the corresponding biotinylated secondary antibody. Signal amplification was achieved using ABC grade 3 reagents (Dako, Denmark). IHC was developed using 3,3'-diaminobenzidine (DAB) (Dako, Denmark). Representative images were analyzed under an Eclipse 80i (Nikon) microscope.

[0154] Serological markers in mice were determined using a fully automated blood biochemistry analyzer.

[0155] Serological parameters of mice, including ALT and AST, were analyzed using the fully automated blood biochemistry analyzer of the Laboratory of Laboratory Medicine, China Agricultural University, following the manufacturer's instructions.

[0156] Immunoblotting analysis

[0157] Tissue was lysed using RIPA lysis buffer (Beyotime). The lysis buffer was centrifuged at 12,000 rpm for 15 minutes at 4°C. Protein samples (20 μg per lane) were separated using 10% or 12% SDS-PAGE and transferred to NC membranes (Biorad). The membranes were blocked in 5% skim milk at room temperature for 1 hour. After blocking, the cell membranes were cut according to protein size markers. The membranes were then incubated overnight (12 hours) at 4°C with primary antibody, followed by incubation at 37°C for 1 hour with HRP-conjugated secondary antibody. The signals were visualized using an enhanced chemiluminescence (ECL) system, and images were captured using a gel recording system. Protein bands were analyzed using ImageJ software. The primary antibody used was lab-prepared (1:500 dilution), β-actin (Sigma, catalog number: A2228; 1:2000 dilution), and HRP-conjugated secondary antibody (Aksomics, KC-RB-035, 1:5000 dilution).

[0158] Statistical analysis

[0159] All data were statistically analyzed using GraphPad Prism 7.00 (GraphPad software). Comparisons between two groups were performed using independent samples t-tests or Mann-Whitney U tests, while comparisons among multiple groups were performed using one-way ANOVA or Kruskal-Wallis tests, depending on normality. Correlation analysis was performed using Pearson correlation tests (parametric) or Spearman correlation tests (non-parametric). Data are expressed as mean ± standard deviation (SD). All experiments were repeated at least three times. *P<0.05, **P<0.01, ***P<0.001, and ****P<0.0001 were considered statistically significant.

[0160] Construction and drug administration of 3D fatty liver and liver fibrosis organoid culture models

[0161] Human primary hepatocytes (PHH), hepatic sinusoidal endothelial cells (LSEC), hepatic stellate cells (HSC), and Kupffer cells (KC) were revived and cultured, and 3D models were constructed using NAC-Organ technology, with a model size of 3000 cells / model (of which PHH cells numbered 1500).

[0162] For the fatty liver model, after receiving the organoids, equilibrate the plates in an incubator for 2-4 hours, remove the old culture medium, add 100 μL of fatty liver induction culture medium to each well, administer the drug the day after receipt, and change the culture medium every two days (it should be replaced with fresh culture medium diluted with the drug). Collect the samples on the third day after drug administration and perform subsequent analysis.

[0163] After receiving the liver fibrosis organoids, the plates were equilibrated in an incubator for 2-4 hours. The old culture medium was removed, and 100 μL of fibrosis induction medium was added to each well for incubation. The drug was administered the day after receipt, and the culture medium was changed every two days (it should be replaced with fresh culture medium diluted with the drug). Samples were collected and subsequent analyses were performed on the fifth day after drug administration.

[0164] Drug grouping and other materials information

[0165] (1) Fatty liver grouping: Dosage 400 nM: control group (GalNAc-NC), experimental group (GalNAc-CREPTi);

[0166] (2) Grouping of liver fibrosis: Dosage 400 nM: control group (GalNAc-NC), experimental group (GalNAc-CREPTi);

[0167] (3) Triglyceride determination: The Amplex Red Triglyceride Assay Kit from Beyotime Pharmaceutical Co., Ltd. is product number S0219S.

[0168] (4) Oil Red staining: The product number of Beyotime is C0158S Modified Oil Red O Staining Kit;

[0169] (5) Sirius Red Staining Kit: Catalog No.: 1227182305, Kramar product;

[0170] (6) Antibody and drug information: Human GalNAc-siCREPT–CY5 labeling (50 μL): 20 Um; Human GalNAc-siCREPT (2#) (50 μL): 5.78 mmol / L; GalNAc-NC (10 OD): Add 10 ml EDPC and water to reach 100 uM; Mouse GalNAc-siCREPT (10 OD): Add 10 ml EDPC and water to reach 100 uM.

[0171] (7) Experimental cell lipid additive: Xi'an Quinochuang Biotechnology Co., Ltd., product number: KC006.

[0172] (8) Detection of mitochondrial activity: The Mitochondrial Deep Red Fluorescence Staining Kit with Mito-Tracker Deep Red 633, developed by Beyotime, is a kit for specific fluorescent staining of mitochondria in live cells based on the mitochondrial deep red fluorescent probe Mito-Tracker Deep Red 633. This deep red fluorescent probe can detect mitochondrial membrane potential and specifically stain mitochondria in live cells.

[0173] siRNA synthesis

[0174] siRNA was synthesized by Suzhou Ouli Biomedical Technology Co., Ltd.

[0175] The terms "metabolic fatty liver disease" and "metabolic steatohepatitis" used in this invention have been updated in accordance with the "Guidelines for the Prevention and Treatment of Metabolic (Non-Alcoholic) Fatty Liver Disease (2024)" (see https: / / rs.yiigle.com / cmaid / 1504653).

[0176] The former "non-alcoholic fatty liver disease (NAFLD)" has now been renamed "metabolic fatty liver disease (MAFLD)".

[0177] The former "non-alcoholic steatohepatitis (NASH)" has been renamed "metabolic steatohepatitis (MASH)".

[0178] The original term "non-alcoholic steatosis" has been renamed "metabolic steatosis".

[0179] According to the latest version of the guidelines, the clinical classification of metabolic-associated fatty liver disease (MAFLD) includes the following four categories, among which metabolic-associated steatohepatitis (MASH) is one of the clinical classifications of metabolic-associated fatty liver disease (MAFLD).

[0180] The aforementioned name changes are merely adjustments to terminology and do not alter the pathological mechanisms, clinical characteristics, or scope of protection of the technical solution in this application for the relevant diseases. All descriptions involving such diseases shall be based on the updated terminology to conform to current industry consensus and academic norms.

[0181] Example 1: Expression analysis of CREPT in healthy individuals and individuals with and without hepatic steatosis in various liver diseases.

[0182] The inventors discovered that CREPT is highly expressed in the livers of patients with fatty liver disease accompanying various liver diseases. To verify the correlation between CREPT and human fatty liver disease, clinical data were analyzed. Immunohistochemical staining was performed on liver tissue samples from different clinical sources using paraffin embedding. These included two types of human specimens without steatosis: healthy control tissue (without steatosis) and focal nodular hyperplasia (FNH, without steatosis); and other human specimens containing steatosis, such as adenomyomatosis of the gallbladder (with steatosis), chronic cholecystitis (with steatosis), hepatocellular carcinoma (HCC, with steatosis), focal nodular hyperplasia (FNH, with steatosis), benign liver tumors (with steatosis), and gallbladder adenocarcinoma (with steatosis). The staining results of liver tissue sections are shown in Figure 1A. The experimental results indicate that in various liver-related diseases, whenever fatty liver lesions are present, CREPT expression is strongly expressed in hepatocytes with steatosis. In Figure 1A, the scale bar in the lower left corner is 200 μm, and the segments are marked as 0, 40, 80, 120, 160, and 200 μm, respectively.

[0183] Example 2: Expression of CREPT in the early stage of a high-fat diet-induced mouse model of simple fatty liver

[0184] To clarify the dynamic changes of CREPT during high-fat diet-induced simple fatty liver, we performed HE and CREPT immunohistochemical staining on liver tissues from normal diet (NCD) and high-fat diet (HFD) mice at 4, 8, and 12 weeks (Figure 1B). HE staining was used to display the overall structure of liver tissue and pathological morphological features related to steatosis, including hepatocyte arrangement, hepatic cord structure, and the presence of lipid droplet vacuoles; in IHC staining, brown signal indicated positive expression of CREPT, and cell nuclei were counterstained blue with hematoxylin. Each image simultaneously included a low-power field to reflect the overall tissue structure and a corresponding high-power inset to show morphological or expression characteristics at the cellular level.

[0185] HE staining showed that the liver lobule structure remained intact at all time points in the NCD group, with no obvious fat vacuoles. In contrast, the HFD group showed progressive steatosis from week 8, with a significant increase in fat vacuoles reaching a peak at week 12 (Figure 1B). Consistent with the morphological changes, IHC results showed that CREPT staining was generally weak / nearly negative at all time points in the NCD group; while in the HFD group, the positive signal of CREPT increased with the severity of steatosis, with a slight upregulation from week 4 to week 8, and the strongest intranuclear brown staining appearing at week 12 (Figure 1B, IHC: CREPT). These results suggest that CREPT is upregulated in stages during the progression of HFD-induced fatty liver, and this upregulation is consistent with the changes in the degree of steatosis.

[0186] Next, the serum liver function indicators of mice fed a normal diet (NCD) and a high-fat diet (HFD) were measured at 4, 8, and 12 weeks. The results showed that the blood biochemical indicators ALT, AST, LDH, CHOL, HDL-C, and LDL-C of the mice were significantly increased compared with the control (Figure 1C).

[0187] These results indicate that fatty degeneration can cause changes in serum liver function indicators, and CREPT expression shows a significant upregulation trend as the disease progresses.

[0188] Example 3: Phenotypic effect of whole-body CREPT gene knockout mouse model in high-fat diet (HFD) induced fatty liver model

[0189] To assess the impact of induced CREPT deficiency on high-fat diet-related phenotypes, we established CREPT... flox / flox ERT2 CRE+ / - (CREPT knockout mice) and littermate control CREPT flox / flox ERT2 CRE- / -Mice (library control group) were followed up and samples were collected under NCD or HFD conditions according to the experimental protocol. Systemic CREPT gene knockout mice were induced by HFD to observe changes in mouse phenotype and various indicators. Figure 2A is a schematic diagram of the overall experimental procedure for mice. Experimental mice were fed either a normal control diet (NCD) or a high-fat diet (HFD), and their body weight and food intake were recorded at different time points. At the experimental endpoint, the mice were disposed of and relevant tissue samples were collected for subsequent analysis.

[0190] In dynamic weight monitoring, the weight gain curves of the two genotypes were basically consistent under NCD conditions; however, under HFD conditions, the weight of the control group increased significantly over time, while the weight gain of the CREPT knockout group was significantly inhibited (Figure 2B). Endpoint histological and organ parameters showed that there were no significant differences in liver weight and liver-to-body ratio between the two groups under NCD conditions; under HFD conditions, the liver weight of the CREPT knockout group was lower than that of the control group, but the liver-to-body ratio was significantly higher (Figure 2C), indicating that CREPT knockout protected liver function. Morphological analysis further supported the above conclusions: HE staining showed that the liver tissue structure was normal and steatosis was mild in both groups under NCD conditions; under HFD conditions, the control group showed significant accumulation of fat vacuoles, while steatosis was significantly reduced in the CREPT knockout group (Figure 2D). Consistent with this, Oil Red O staining showed large areas of lipid droplet deposition in the HFD control group, while the red staining area was significantly reduced in the CREPT knockout group. Quantitative results showed that under NCD conditions, there were no significant differences in the grade of steatosis and the area of ​​Oil Red O staining; under HFD conditions, the grade of steatosis and the area of ​​positive Oil Red O staining in the CREPT knockout group were significantly reduced (Figure 2D). The right-hand bar chart in Figure 2E quantitatively analyzed the grade of steatosis and the area of ​​Oil Red O staining to reflect the changes in the degree of hepatic lipid deposition under different experimental conditions. These results indicate that CREPT knockout significantly alleviates HFD-induced hepatic lipid deposition and steatosis, accompanied by suppressed weight gain.

[0191] To assess the impact of CREPT deletion on peripheral organs and fat deposition, we further measured relevant parameters of the kidney, spleen, skeletal muscle, and white adipose tissue (Figure 2F). Under NCD conditions, there were no significant differences in kidney weight, spleen weight, and quadriceps muscle weight between the CREPT knockout group and the control group, and the kidney-to-body ratio and spleen-to-body ratio also remained unchanged. Under HFD (high-fat diet) conditions, there were still no significant differences in absolute kidney weight and spleen weight. Furthermore, under HFD conditions, the weight of inguinal white adipose tissue (iWAT) was significantly increased in the control group but significantly decreased in the CREPT deletion group, indicating that CREPT deletion can significantly inhibit HFD-induced white adipose tissue expansion.

[0192] To further evaluate the effects of CREPT deficiency on HFD-induced liver injury and systemic metabolic parameters, we measured serum biochemical parameters (Figure 2G). Under NCD conditions, most parameters did not differ significantly between the two genotypes; only the serum TG and HDL-C levels in the CREPT deficiency group were lower than those in the control group, while LDL-C also decreased, suggesting that CREPT deficiency can affect lipid profile composition even under basal conditions (Figure 2G).

[0193] Under HFD conditions, the control group exhibited a more pronounced hepatocellular injury phenotype, characterized by significantly elevated ALT levels. In contrast, the CREPT-deficient group showed a significantly lower ALT level, suggesting that CREPT deficiency can alleviate HFD-related liver injury (Figure 2G). AST and LDH levels did not differ significantly among the groups, and CK levels also showed no significant change, indicating that the effect was mainly reflected in hepatocellular injury indicators as reflected by ALT. Simultaneously, the CREPT-deficient group significantly improved dyslipidemia under HFD conditions: TG, total cholesterol (CHOL), and LDL-C were all significantly reduced; HDL-C also decreased. Furthermore, under HFD conditions, the CREPT-deficient group had lower blood glucose levels than the control group, suggesting that CREPT deficiency, in addition to improving lipid metabolism, may also have a certain protective effect on glucose metabolism (Figure 2G). Overall, CREPT deficiency can significantly alleviate liver injury and improve metabolic disorders under HFD conditions.

[0194] Example 4: Therapeutic effect of GalNAc delivery of CREPT siRNA in a high-fat diet-induced simple fatty liver model

[0195] Given that CREPT is highly expressed in hepatocytes in fatty liver disease, the applicant further investigated whether targeting CREPT expression could treat fatty liver disease. To this end, the applicant used an n-acetylgalactosamine (GalNAc) delivery system, recently approved by the FDA for a rare liver disease, to specifically deliver siRNA targeting CREPT in hepatocytes in a mouse model of fatty liver disease.

[0196] The applicant first screened for the siRNA with the strongest ability and specificity to inhibit CREPT expression. The antisense strands of the siRNA sequences are shown in SEQ ID No. 1, and the control sequence siNC is shown in SEQ ID No. 2. The GalNAc siRNA carrying CREPT (SEQ ID No. 1) is named GalNAc-siCREPT.

[0197] Table 1 siCREPT and siNC sequences

[0198] The applicant induced a fatty liver model in mice using a high-fat diet and treated them with GalNAc-siCREPT. The high-fat diet was started at week 4 and continued for 12 weeks, followed by subcutaneous injections of GalNAc-siCREPT containing siRNA (10 mg / kg) for 4 consecutive weeks. An equal amount of non-specific siRNA (GalNAc-siNC) served as a control. HFD, HFD+GalNAc-NC, and HFD+GalNAc-siCREPT groups were established, and mice were sacrificed at the endpoint after 4 weeks of treatment (Figure 3A schematic diagram). Compared with the control, the GalNAc-siCREPT group showed a sustained decrease in body weight throughout the treatment period, with an overall body weight curve significantly lower than that of the HFD and HFD+GalNAc-NC groups (Figure 3B), suggesting that CREPT inhibition can significantly improve the HFD-related body weight phenotype. Endpoint liver weight measurement showed that HFD induced a significant increase in liver weight (compared to healthy controls HC), while GalNAc-siCREPT significantly reduced liver weight in the HFD context (compared to HFD+GalNAc-NC); there was no difference between HFD and HFD+GalNAc-NC (Figure 3C). At the molecular level, immunohybridization confirmed that GalNAc-siCREPT effectively downregulated CREPT protein levels in liver tissue (Figure 3D).

[0199] Serum biochemical tests showed that CREPT inhibition significantly alleviated liver damage and improved dyslipidemia in the context of HFD: ALT was significantly reduced, LDH also decreased, and AST showed a downward trend (Figure 3E). Regarding lipid profiles, HDL-C and LDL-C were significantly reduced in the GalNAc-siCREPT group, total cholesterol (CHOL) was significantly reduced, while triglycerides (TG) showed no significant change (Figure 3E). Furthermore, there were no significant differences in urea (UREA) and creatine kinase (CK), while total protein (TP) showed a slight change (Figure 3E). In summary, targeted inhibition of CREPT in an adult HFD model can effectively reduce CREPT protein levels, accompanied by improvements in body weight, liver weight, and liver damage indicators, while partially correcting HFD-induced dyslipidemia.

[0200] In the HFD model, the liver exhibited a typical fatty liver appearance (lighter color and altered texture) upon gross observation, and this phenotype did not show significant improvement after GalNAc-si control treatment. In contrast, the liver appearance after GalNAc-siCREPT treatment significantly reverted to that of the healthy control (HC) (Figure 3F). HE staining further revealed the formation of numerous lipid droplet vacuoles in hepatocytes in the HFD and GalNAc-si control groups, while lipid vacuoles were significantly reduced in the GalNAc-siCREPT group, suggesting that fatty degeneration was alleviated (Figure 3F). Simultaneously, IHC results showed enhanced CREPT signal against the HFD background, while GalNAc-siCREPT significantly reduced CREPT staining intensity, demonstrating that CREPT was effectively downregulated in liver tissue (Figure F). Oil Red O staining showed a significant increase in lipid deposition in the HFD and GalNAc-si control groups, while GalNAc-siCREPT significantly reduced the area of ​​red-stained lipid droplets (Figure 3F). At the biochemical quantitative level, GalNAc-siCREPT treatment reduced liver triglyceride (TG) and total cholesterol (TC) levels, while also significantly decreasing liver glucose levels (Figure 3G). In summary, liver-targeted siCREPT not only alleviates HFD-induced lipid deposition at the histological level but also significantly reduces intrahepatic lipid load at the quantitative level, and IHC confirms its clear knockdown effect in the liver.

[0201] All results indicate that GalNAc-siCREPT treatment not only improved hepatic steatosis induced by a high-fat diet but also significantly reduced body fat. It also affected carbohydrate metabolism while regulating lipid changes. This suggests a therapeutic effect in inhibiting CREPT expression during fatty liver in mice.

[0202] Example 5: Therapeutic effect of AAV8 delivery of CREPT shRNA in a high-fat diet-induced simple fatty liver model

[0203] In Example 4, we used GalNAc-siCREPT to improve liver steatosis function after high-fat diet stimulation. To further verify the effects of other liver-targeting delivery vectors, we designed adeno-associated virus serotype 8 (AAV8), a highly efficient liver-targeting gene delivery vector, which loaded mouse shRNA-NC (sequence SEQ ID No. 13: 5'-AACAGAAACGAATAAAGCACA-3') and shRNA-CREPT (sequence SEQ ID No. 12: GCCAAATCAAATAGAAAGCTT) into a mouse model of simple fatty liver, and verified its effect on the fatty liver model by reducing CREPT expression.

[0204] The experiment used a high-fat diet to induce a fatty liver model in mice, and administered a single intravenous injection of adeno-associated virus (AAV) at a dose of 1×10⁻⁶. 11 Treatment was administered via VG only. A high-fat diet was started at week 4 and continued for 12 weeks, followed by a single tail vein injection of 1×10-1 adeno-associated virus containing shRNA-CREPT. 11 Vg / mouse, with an equal amount of adeno-associated virus containing nonspecific shRNA-NC as a control (Figure 4A schematic diagram). Compared with the control treatment, the group treated with adeno-associated virus containing shRNA-CREPT showed a very significant difference in body weight and liver weight after the endpoint treatment (Figures 4B-C), suggesting that CREPT inhibition can significantly improve HFD-related body weight and restore liver phenotype. Further serum biochemical tests showed that CREPT inhibition significantly alleviated liver damage and improved serum indicators in the HFD background: ALT was significantly reduced, AST also decreased, and CHOL showed a decreasing trend (Figures 4D-G). In the HFD model, HE staining further showed that a large number of lipid droplet vacuoles formed in hepatocytes in the shRNA-NC control group in the HFD background, while lipid vacuoles were significantly reduced in the shRNA-CREPT group, suggesting that steatosis was alleviated (Figure 4H). Oil Red O staining showed that lipid deposition was significantly increased in the shRNA-NC control group, while red-stained lipid droplets were significantly reduced in the shRNA-CREPT group.

[0205] In conclusion, AAV8-delivered shRNA-CREPT treatment can effectively improve hepatic steatosis induced by a high-fat diet.

[0206] Example 6: Analysis of CREPT expression in metabolic dysfunction-associated steatotic liver disease (MASH) using public databases

[0207] Figure 5 shows the changes in CREPT mRNA expression levels in different human liver disease states, based on analysis of public transcriptome databases. Figure 5A, based on the GSE63037 dataset, compares the relative mRNA expression levels of CREPT in liver tissue samples from the healthy control group (Control, n=7), the metabolic-associated fatty liver group (n=2), and the metabolic-associated steatohepatitis group (MASH group) (n=9). Figure 5B, based on the GSE167523 dataset, compares the relative mRNA expression levels of the target gene in liver tissue samples from the metabolic-associated fatty liver group (n=51) and the metabolic-associated steatohepatitis group (n=47). The results indicate that in the GSE63037 cohort, the CREPT mRNA levels in both the metabolic-associated fatty liver group and the metabolic-associated steatohepatitis group showed an increasing trend compared to the control group; in the larger GSE167523 cohort, the CREPT mRNA level in the metabolic-associated steatohepatitis group was significantly higher than that in the metabolic-associated fatty liver group.

[0208] In different independent public datasets, CREPT showed a consistent trend of expression changes under pathological conditions related to metabolic fatty liver disease, further supporting the correlation between this gene and the progression of fatty liver disease.

[0209] Example 7: Expression of CREPT in a high-fat diet-induced mouse MASH model of metabolic dysfunction-related steatohepatitis.

[0210] To clarify the dynamic changes of CREPT during diet-induced steatohepatitis, we performed HE and CREPT immunohistochemical staining on liver tissues from mice fed a normal diet (NCD) and a high-fat diet (HFD) at 20 and 30 weeks of age (Figure 6A). HE staining was used to display the overall structure of the liver tissue and the pathological morphological features related to steatosis, including hepatocyte arrangement, hepatic cord structure, and the presence of lipid droplet vacuoles; in IHC staining, the brown signal indicated positive expression of CREPT, and the cell nuclei were counterstained blue with hematoxylin. Each image includes both a low-power field to reflect the overall tissue structure and a corresponding high-power inset to show the morphological or expression characteristics at the cellular level.

[0211] HE analysis showed that the liver lobule structure was intact at all time points in the NCD group, with no obvious fat vacuoles. In contrast, the HFD group showed persistent fat deposition, inflammatory cell infiltration within the liver lobules, and ballooning degeneration of hepatocytes from weeks 20 to 30 (Figures 6A and 6B). Consistent with the morphological changes, IHC results showed that CREPT staining was generally weak / nearly negative at all time points in the NCD group, while the CREPT positive signal was very strong in the HFD group from weeks 20 to 30 (Figure 6A, IHC: CREPT). These results suggest that CREPT is upregulated in stages during HFD-induced steatohepatitis. Next, the serum liver function indicators of mice fed a normal diet (NCD) and a high-fat diet (HFD) were measured at weeks 20 and 30. The results showed that the blood biochemical indicators ALT, AST, LDH, CHOL, HDL-C, and LDL-C were significantly increased compared with the control (Figure 6C).

[0212] The data above indicate that CREPT levels tend to increase as simple fatty liver progresses to steatohepatitis.

[0213] Example 8: GalNAc-siCREPT (SEQ ID No. 1) significantly alleviated a high-fat diet (HFD) and carbon tetrachloride (CCL4)-induced metabolic dysfunction-associated steatohepatitis (MASH) model.

[0214] To evaluate the role of CREPT inhibition in metabolic-associated steatohepatitis (MASH), we established a MASH model by combining continuous HFD induction with carbon tetrachloride (CCl4) to exacerbate liver injury, and simultaneously administered GalNAc-siRNA for liver-targeted intervention (Figure 7A). During MASH modeling, the weight change trends in each HFD+CCl4 group were similar, and there was no significant difference in weight between the GalNAc-siCREPT and GalNAc-NC groups (Figure 7B). The endpoints of kidney and liver weight also showed no significant difference between the two groups (Figures 7C-D). Western blot immunoblotting confirmed that GalNAc-siCREPT effectively downregulated CREPT protein levels in liver tissue (Figure 7E). Without affecting body weight or organ weight, the siCREPT group showed significantly reduced TG and TC content in liver tissue (Figures 7F-G), and a decrease in liver glucose levels (Figure 7H), suggesting that targeted inhibition of CREPT can improve intrahepatic lipids and metabolic load in the context of MASH.

[0215] To further confirm the MASH model at the histological level and assess the pathological benefit of liver-targeted inhibition of CREPT, we performed gross observation and various staining analyses on the NCD, HFD+CCl4, HFD+CCl4+GalNAc-NC, HFD+CCl4+GalNAc-siCREPT, and the positive control drug rametirone (Resmetirom) groups (Figure 7I). Compared with NCD, the liver in the HFD+CCl4 group appeared lighter and had altered texture; HE staining showed significant steatosis accompanied by inflammatory cell infiltration and hepatocellular damage. Sirius Red and Masson staining further indicated increased collagen deposition, consistent with the MASH-related fibrosis phenotype. After GalNAc-siCREPT treatment, the overall steatosis and inflammation / damage manifestations in HE staining were reduced, while the fibrosis-related staining signal decreased; quantitative NAS scoring showed that the total NAS score of the siCREPT group was significantly lower than that of the GalNAc-NC group (Figure 7I). Furthermore, resmetirom, as a positive control, also reduced the NAS score (compared to HFD+CCl4), indicating that the model responded well to the intervention (Figure 7I). Regarding serum indicators, under the HFD+CCl4 background, GalNAc-siCREPT reduced total cholesterol (CHOL) compared to GalNAc-NC, ensuring consistency with the direction of "decreased intrahepatic lipid load"; triglycerides (TG) and LDL-C showed no significant changes (ns), while HDL-C showed a slight but significant difference (Figure 7J). Meanwhile, no significant differences were observed between siCREPT and NC in liver injury-related enzyme indicators ALT and AST (Figure 7J), suggesting that during this timeframe, CREPT inhibition was more sensitive to histological improvement, while its effect on serum transaminases was relatively limited or delayed.

[0216] Example 9: Screening for novel human-mouse homologous sequences of CREPT siRNA in human hepatocellular carcinoma cell lines

[0217] This embodiment validates the knockdown efficiency of the eight CREPT human-mouse homologous siRNA sequences designed in Table 2 (see Table 2). Specifically, human hepatocellular carcinoma cell lines HepG2 and Huh7 were selected for validation. Both cell lines were transfected with the same concentration of siRNA containing the same sequence. Cells were harvested 72 hours after transfection, and RNA was extracted for validation. The results, shown in Figure 8, indicate that the sequences with common inhibitory effects in both HepG2 and Huh7 cells are: siCREPT-1 (SEQ ID No. 3) and siCREPT-HMF-35 (SEQ ID No. 10). Both of these siRNAs can reduce CREPT mRNA expression, achieving a knockdown effect with a transfection of 4 μL. In summary, the sequences screened above exhibit high knockdown efficiency in human cells.

[0218] Table 2 siCREPT and siNC sequences

[0219] Example 10: Therapeutic effect of GalNAc delivery of CREPT siRNA-1 (SEQ ID No. 3) in a high-fat diet-induced MASH model.

[0220] To evaluate the role of the newly screened siCREPT-1 in metabolic-associated steatohepatitis (MASH) induced by a high-fat diet, we established a MASH model after 16 weeks of continuous high-fat diet induction and simultaneously administered GalNAc-siCREPT-1 for liver-targeted intervention (Figure 9A). During the MASH modeling process, the weight change trends in each HFD group were similar, with only a slight decrease in weight between the GalNAc-siCREPT-1 and GalNAc-NC groups, which was not statistically significant (Figure 9B). Immunohistochemistry analysis showed that CREPT expression levels were significantly lower in the treatment group compared to the control group (Figure 9C). The endpoint of liver weight showed a significant difference between the treatment and control groups, while kidney weight did not differ significantly between the two groups (Figures 9E-F).

[0221] To further confirm the MASH model at the histological level and assess the pathological benefit of liver-targeted inhibition of CREPT, we performed various staining analyses on the HFD+GalNAc-NC and HFD+GalNAc-siCREPT-1 groups (Figure 9G). HE staining showed significant steatosis accompanied by inflammatory cell infiltration and hepatocellular damage. Sirius Red and Masson staining further indicated increased collagen deposition, consistent with the MASH-related fibrosis phenotype. After GalNAc-siCREPT treatment, the overall steatosis and inflammation / damage manifestations in HE staining were reduced, while the fibrosis-related staining signal decreased, and the difference between the two groups was highly significant (Figures 9H and 9I); quantitative NAS scoring showed that the total NAS score of the siCREPT-1 group was significantly lower than that of the GalNAc-NC group (Figure 9J). Regarding serum indicators, GalNAc-siCREPT-1 reduced several serum indicators compared to GalNAc-NC, but the differences were not statistically significant (Figure 9K-9O). This suggests that during this time period, CREPT inhibition was more sensitive to histological improvement, while its effect on serum biochemical indicators was relatively limited.

[0222] The above results indicate that the newly screened sequence siCREPT-1 has a significant therapeutic effect on the MASH model.

[0223] Example 11: The therapeutic effect of combined GalNAc delivery of CREPT siRNA (SEQ ID No. 1) and GLP-1 receptor agonist (Semaglutide) in a high-fat diet-induced MASH model.

[0224] To evaluate the combined effect of CREPT siRNA and the GLP-1 receptor agonist (Semaglutide) in high-fat diet-induced metabolic-associated steatohepatitis (MASH), we established a MASH model after 16 weeks of continuous HFD induction and treated patients with GLP-1 receptor agonist (Semaglutide) alone; patients received GLP-1 receptor agonist (Semaglutide) treatment combined with GalNAc-siRNA for liver-targeted intervention (Figure 10A). During the MASH modeling process, the body weight of the HFD group remained high. The body weight of the patients treated with GLP-1 receptor agonist (Semaglutide) alone and the group treated with semaglutide + GalNAc-siCREPT showed significant decreases, although there was no significant difference, the body weight of the combination group was lower (Figure 10B), while liver weight was similar (Figure 10C). Regarding serum markers, semaglutide alone, compared with semaglutide combined with GalNAc-siCREPT, reduced liver injury-related enzyme markers ALT and AST, showing significant differences compared with the HFD group, while there were no differences between the two groups (Figures 10D and E). Other indicators, including CHOL, LDH, and HDL-C (Figures 10G, H, and I), showed significant differences between the semaglutide monotherapy group and the HFD group. The differences were even more significant in the semaglutide combined with GalNAc-siCREPT group compared to the HFD group, such as LDH (3 stars difference in the semaglutide monotherapy group compared to the HFD group, and 4 stars difference in the combined therapy group) (Figure 10G), CHOL (2 stars difference in the semaglutide monotherapy group compared to the HFD group, and 3 stars difference in the combined therapy group) (Figure 10H), and HDL-C (no difference in the semaglutide monotherapy group compared to the HDF group, and 1 star difference in the combined therapy group) (Figure 10I). These blood biochemistry data indicate that the combined therapy group was more effective than the semaglutide monotherapy group.

[0225] To further confirm the MASH model at the histological level and evaluate the pathological benefits of semaglutide monotherapy versus semaglutide combined with GalNAc-siCREPT, we performed HE staining analysis on the HC, HFD + semaglutide, and HFD + semaglutide + GalNAc-siCREPT groups (Figure 10). HE showed significant steatosis in the HFD group accompanied by inflammatory cell infiltration and hepatocellular damage. After semaglutide monotherapy, steatosis was significantly improved, but the reduction in inflammatory infiltration was limited. After the combined use of semaglutide and GalNAc-siCREPT, the overall steatosis and inflammation / damage manifestations in HE were significantly reduced. At the same time, immunohistochemistry was used to detect CREPT expression, and CREPT expression was significantly reduced in the group treated with the combination of semaglutide and GalNAc-siCREPT (Figure 10). Quantitative analysis using the NAS score showed highly significant differences among the three groups. Compared to the HFD group, the group treated with semaglutide alone showed a difference (1 star), and the group treated with semaglutide in combination with GalNAc-siCREPT showed a significant difference (2 stars). Importantly, the group treated with semaglutide in combination with GalNAc-siCREPT showed a difference compared to the group treated with semaglutide alone (1 star).

[0226] The above results indicate that the combination of semaglutide and GalNAc-siCREPT is superior to semaglutide alone in the MASH disease model.

[0227] Example 12: Effect of GalNAc delivery of CREPT siRNA (SEQ ID No. 1) in combination with resmetirom in a high-fat diet (HFD) and carbon tetrachloride (CCL4) induced MASH model.

[0228] To evaluate the combined effect of CREPT inhibition and resmetirom in metabolic-associated steatohepatitis (MASH), we established a MASH model by combining continuous HFD induction with carbon tetrachloride (CCL4) to exacerbate liver injury, and simultaneously administered GalNAc-siRNA for liver-targeted intervention (Figure 11A). Resmetirom was premixed into the diet at a dose of 5 mg per 100 g, based on a resmetirom dosage of 3 mg / kg / day and a daily intake of 3 g per 50 g mouse. Following MASH modeling and treatment, the MASH model was confirmed histologically, and the pathological benefits of combining liver-targeted inhibitor CREPT and rametirox (Resmetirom) were evaluated. HE analysis showed (Figure 11B): the control group exhibited significant steatosis accompanied by inflammatory cell infiltration and hepatocellular damage; while in the rametirox (Resmetirom) and control GalNAc-NC groups, the overall steatosis and inflammation / damage in HE were reduced, and fibrosis-related staining signals decreased; after co-treatment with GalNAc-siCREPT, the overall steatosis and inflammation / damage in HE were significantly reduced or approached normal; NAS scores showed that compared with the control group, rametirox (Resmetirom) significantly reduced all MASH indicators, and the total NAS score of the rametirox (Resmetirom) and GalNAc-siCREPT group was significantly lower than that of the rametirox (Resmetirom) and GalNAc-NC group (Figure 11C). The above results indicate that Resmetirom combined with GalNAc-siCREPT is significantly superior to Resmetirom alone.

[0229] Example 13. Effects of CREPT-siRNA on human hepatic steatosis and fibrotic organoids

[0230] Firstly, Oil Red staining of frozen sections of human fatty liver organoids showed that lipid droplets were very prominent in the GalNAC-si-NC group (its anti-sense sequence SEQ ID No. 14 is 5'-ACGCUGACUUCGGAGAATT-3'; sense sequence SEQ ID No. 26 is 5'-UUCUCCGAAGUCACGUTT-3'), while sections treated with GalNAC-si-CREPT (its anti-sense sequence SEQ ID No. 11 is 5'-UUCUCUUCUGUUGCUUUGG-3'; sense sequence SEQ ID No. 27 is 5'-CCAAAGCAACAGAAGAGAA-3') showed only a few small lipid droplets or none at all (Figure 12A). This indicates that GalNAC-si-CREPT has a significant inhibitory and therapeutic effect on human fatty liver. The experiment further measured triglyceride levels in fatty liver organoids. Statistical analysis results are shown in Figure 12B. A significant difference in triglyceride concentration was observed between the GalNAC-si-NC and GalNAC-si-CREPT groups (T-test, P = 0.0078). The experiment demonstrates that GalNAC-si-CREPT can significantly inhibit triglyceride levels in human fatty liver organoids.

[0231] Secondly, a non-alcoholic fatty liver cell model induced by sodium oleate and sodium palmitate was established through in vitro adipogenesis induction experiments. HepG2 cells were induced using a special culture medium, fixed, and stained with Oil Red stained cells according to the kit provided by the company. The results showed that the GalNAC-si-NC group exhibited very obvious lipid droplet formation in the Oil Red stained group, while cells treated with GalNAC-siRNA-CREPT showed only a few small lipid droplets or none at all (Figure 12C). Simultaneously, intracellular triglyceride and total cholesterol levels were measured, showing significant differences in triglyceride and total cholesterol concentrations between the GalNAC-siRNA-NC and GalNAC-siRNA-CREPT treatment groups (Figure 12D). Furthermore, mitochondrial activity was detected using the induced adipogenesis cells. The experiment employed Beyotime's deep red fluorescent staining kit for mitochondria, detecting the degree of mitochondrial activity by measuring changes in mitochondrial membrane potential. The results showed that mitochondrial activity significantly decreased after adipogenesis induction, while mitochondrial activity was more active in cells treated with GalNAC-si-CREPT (Figure 12E).

[0232] The above experiments show that GalNAC-si-CREPT can treat fatty liver disease in humans.

[0233] Finally, immunohistochemical staining and Sirius red staining were performed on human liver fibrosis organoids. Immunohistochemical results showed that CREPT was significantly expressed in the GalNAC-si-NC group, while CREPT expression was significantly reduced or absent in sections treated with GalNAC-si-CREPT (Figure 12F). Sirius red staining results showed that the GalNAC-si-NC group had obvious red markings indicating the presence of fibrosis, while the red markings were significantly reduced or absent in sections treated with GalNAC-si-CREPT (Figure 12G). These results indicate that GalNAC-si-CREPT treatment has a significant inhibitory effect on human liver fibrosis.

[0234] Example 14: Distribution of siRNA CREPT (SEQ ID No. 1) delivered by different delivery methods on the liver

[0235] To clarify the distribution of siRNA CREPT in the liver using different delivery methods, the experiment utilized both LNP and GalNAc delivery methods, employing fluorescence as a marker for tracking. Figures 13A-C show fluorescence imaging confirming efficient delivery of LNP-siCREPT to the liver, with significantly higher signal intensity in the liver region compared to non-target organs such as the spleen, kidneys, lungs, and lymph nodes (Figures 13A-C). There was no statistically significant difference in liver fluorescence intensity between the LNP-siCREPT group and the control siRNA (LNP-siNC) group (Figures 13B-C), indicating that both lipid nanoparticles can achieve efficient targeted delivery to the liver, validating the liver tissue specificity of this delivery system. Figures 13D-F show fluorescence imaging confirming efficient delivery of GalNAc-siCREPT to the liver, with significantly higher signal intensity in the liver region compared to non-target organs such as the spleen, kidneys, lungs, and lymph nodes (Figures 13D-F). There was no statistically significant difference in liver fluorescence intensity between the GalNAc-siCREPT group and the control siRNA (GalNAc-siNC) group (Figures 13E-F). These findings demonstrate that both siRNA delivery methods can target the liver.

[0236] Example 15: Mechanism of action of CREPT as a target for fatty liver

[0237] To elucidate the molecular mechanisms by which CREPT deficiency alleviates simple fatty liver and MASH, we performed RNA-seq on liver tissue and compared the transcriptomic differences between ERT2-KO and ERT2-WT. KEGG enrichment analysis showed that differentially expressed genes significantly clustered in lipid metabolism-related pathways, with the PPAR signaling pathway consistently appearing at the core of enrichment across different enrichment display methods. This was accompanied by enrichment in pathways related to cholesterol metabolism, peroxisomes, and fatty acid metabolism / unsaturated fatty acid biosynthesis (Figure 14A), suggesting that CREPT may influence hepatic lipid homeostasis by regulating PPAR-related transcriptional networks. Based on these results, we further focused on differentially expressed genes related to the PPARγ axis. The heatmap shows that, compared to ERT2WT, the ERT2KO sample exhibited a consistent downregulation of multiple downstream PPARγ genes related to lipid uptake, droplet formation, and lipid synthesis, including Mogat1, G0s2, Plin4, Cidec, Cd36, Plin2, Acacb, Gk, Scd1, Acsl3, Lpl, Pparg, and Acadm (Figure 14B), while some genes showed the opposite trend (e.g., Apoa1, Pnpla2, Pck1, and Fapp5) (Figure 14B). Further gene-level quantification (log2(KO / WT)) revealed that the genes with the largest downregulation along the PPARγ axis were Mogat1, G0s2, Plin4, Cidec, and Cd36; while the genes with significant upregulation were Fapp5, Pck1, Pnpla2, and Apoa1 (genes meeting the significance threshold are marked in red / blue) (Figure 14C). In summary, RNA-seq results consistently point to the fact that CREPT deficiency systematically inhibits the transcriptional activation of hepatic PPARγ-related lipid storage / lipid droplet programs, thus providing transcriptomic evidence for its ability to reduce hepatic lipid deposition.

[0238] To validate transcriptomic-suggested PPAR axis alterations and to analyze the impact of CREPT deficiency on key genes in hepatic lipid metabolism, we compared the control group (CREPT) under HFD conditions. flox / flox ERT2 CRE- / - ) and liver-inducible Crept loss group (CREPT) flox / flox ERT2 CRE+ / -Gene expression in liver tissue (Fig. 14D). Results showed that Fasn, a gene related to fatty acid anabolism, was significantly downregulated in the CREPT-deficient group, while the expression of the upstream transcription factor Srebp1 remained unchanged (Fig. 14D). Cd36, a gene related to lipid uptake, showed no significant difference between the two groups, suggesting that the decrease in liver lipid load was not primarily driven by Cd36 transcriptional repression. Regarding nuclear receptors related to lipid metabolism transcriptional regulation, CREPT deficiency significantly reduced PPARγ mRNA levels, and PPARγ itself also decreased (Fig. 14D). Along the lipid droplet mobilization / lipolysis axis, CREPT deficiency led to a significant downregulation of G0s2, while the key lipolysis enzyme Atgl showed an upregulation trend (p = 0.05); its co-activator Cgi58 was upregulated, while the downstream lipolytic enzyme Magl was downregulated (*) (Fig. 14D). Furthermore, Hmgcr, a gene related to cholesterol synthesis, showed no significant difference between the two groups (ns) (Fig. 14D). Overall, these results suggest that, in the context of HFD, the loss of CREPT is consistent with the remodeling of the PPARγ axis and G0S2-ATGL-related lipid droplet metabolic programs, and may jointly promote the relief of intrahepatic lipid deposition by reducing lipid synthesis (FASN) and relieving lipolysis inhibition (G0S2↓, ATGL / CGI58↑ trend).

[0239] To further elucidate the signaling pathway underlying CREPT-mediated lipid deposition, we examined changes in key metabolic signals in liver tissue under HFD conditions. Compared to the control group (CREPT... flox / flox ERT2 CRE- / - Compared to the liver-inducible CREPT deficiency group (CREPT) flox / flox ERT2 CRE+ / -In HepG2 cells, p-mTOR and p-AKT levels were significantly reduced, along with decreased expression of downstream FASN proteins; while the levels of total proteins PI3K, S6K1, and 4EBP1 remained largely unchanged (Figure 14E). These results suggest that CREPT deficiency can inhibit the activation of the PI3K–AKT–mTOR axis, accompanied by downregulation of the key lipid synthesis enzyme FASN. In cell models, we further validated the regulatory role of CREPT in lipotoxicity-induced signaling. Adding oleic acid (OA) to HepG2 cells resulted in increased p-AKT expression over time, accompanied by upregulation of PPARγ and GOS2 expression; however, in CREPT knockdown cells (HepG2), the OA-induced effect was significantly weakened, with decreased induction amplitudes of p-AKT, PPARγ, and GOS2 (Figure 14F), suggesting that CREPT is involved in fatty acid-stimulated AKT activation and the PPARγ axis transcriptional program response. Given that the PPARγ axis was pointed to in both transcriptomic and in vitro / in vivo validation, we further examined the interaction between CREPT and PPARγ. Co-immunoprecipitation (co-IP) was performed on 293T cells co-transfected with Myc-CREPT and Flag-PPARγ. The results showed that Myc-CREPT signaling was detected in Flag-PPARγ immunoprecipitation, and Flag-PPARγ was also pulled down in Myc-PPARγ immunoprecipitation, demonstrating a protein-protein interaction (Fig. 14G). Furthermore, the co-precipitation signal of CREPT and PPARγ was still detectable even with the addition of Rosiglitazone, suggesting that this interaction can be maintained under PPARγ agonist stimulation (Fig. 14G). Overall, these results support the conclusion that CREPT promotes lipid synthesis / lipid droplet-related transcriptional programs (such as G0S2) and drives hepatic lipid deposition by regulating PI3K–AKT–mTOR signaling and interacting with PPARγ.

[0240] Example 16: Safety evaluation of CREPT as a target therapy for fatty liver

[0241] To investigate the effects of CREPT on liver development in mice, the applicant observed CREPT gene-specific knockout mice under standard feeding conditions and found that these mice developed normally compared to control mice, without any defects. Subsequently, the applicant performed a characterization analysis on the adult mice. Histological analysis using H&E (hematoxylin and eosin) staining showed that the liver structure of both the CREPT liver-specific knockout group and control mice was normal, including intact hepatic lobules and regularly arranged hepatic cords (Figure 15A).

[0242] To further assess mouse development by measuring body weight and organ weight, the applicant included both male and female mice. Results showed no statistically significant differences in body weight between male and female CREPT liver-specific knockout mice and control mice at 2 weeks (Fig. 15B), 8 weeks (Fig. 15C), and 10 weeks (Fig. 15D). Furthermore, the applicant observed no statistically significant difference in the liver weight-to-body weight ratio between the CREPT liver-specific knockout mice and control mice at 2 weeks (Fig. 15E) and 10 weeks (Fig. 15F). Simultaneously, the spleen weight-to-body weight ratio remained unchanged between the CREPT liver-specific knockout mice and control mice at 10 weeks (Fig. 15G). Notably, the conditional gene knockout mice also reproduced normally.

[0243] Further analysis of gross liver specimens, along with HE staining and apoptosis staining, revealed no differences in liver tissue structure between the CREPT liver-specific knockout group and the control group (Figures 15H-1). Next, liver-related biochemical indicators were measured in both groups, revealing no differences in liver function between the CREPT liver-specific knockout group and the control group (Figure 15J). To further investigate the impact of CREPT knockout on the liver after 6 months, the applicant conducted a gross liver analysis of male and female mice under normal feeding conditions, which showed no changes (Figure 15K). Subsequently, the applicant analyzed different types of immune cells in the peripheral blood of both groups of mice using flow cytometry, and the results showed no statistically significant differences in indicators between the male and female groups (Figure 15L). Finally, multiple biochemical indicators in the peripheral blood of the two groups of mice were measured. The results showed that compared with the control group (Figure 15M), male mice had slightly decreased serum ALT, AST, CK, LDH, and UA, and slightly increased ALP. However, albumin, globulin, creatinine, and blood glucose were normal, and no related clinical symptoms were observed. Considering the baseline characteristics of the C57BL / 6 strain, the above changes were considered to have no clear toxicological / biological significance.

[0244] All these results indicate that conditional knockout of CREPT does not affect liver development or overall body development from birth to adulthood.

[0245] In conclusion, targeted CREPT therapy can effectively alleviate the lesions of simple fatty liver and metabolic steatohepatitis, and is safe and effective. It is expected that strategies to reduce CREPT expression can be used to treat human metabolic liver diseases.

[0246] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the methods and techniques disclosed above without departing from the scope of the present invention to create equivalent embodiments. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. The use of the CREPT gene or protein as a target or an agent targeting the CREPT gene or protein in the treatment of fatty liver disease and fatty liver disease, or in the preparation of drugs for the treatment of fatty liver disease and fatty liver disease, characterized in that, Fatty liver disease and coexisting fatty liver disease can be treated by reducing the expression of the CREPT gene or by reducing or inactivating the function of the CREPT protein.

2. The application according to claim 1, characterized in that, The reagents targeting the CREPT gene or protein reduce CREPT gene expression or impair or inactivate CREPT protein function; The reagent targeting the CREPT gene or protein is selected from one or more of the following: agents that affect CREPT protein expression, agents that knock out CREPT protein, agents that alter CREPT protein, and agents that degrade CREPT protein. Preferably, the formulation affecting CREPT protein expression includes a nucleic acid reagent or a carrier containing a nucleic acid fragment that inhibits CREPT protein expression; Preferably, the formulation for knocking out the CREPT protein includes reagents for homologous recombination and gene editing to eliminate the CREPT gene; Preferably, the formulation for altering the CREPT protein includes reagents that alter the structure of the CREPT protein; Preferably, the formulation for degrading CREPT protein includes one or more of the following: PROTAC, molecular glue, LYTAC, MoDE, ATAC, Apt-LYTAC, AbTAC, PROTAB, REULR, KineTAC, IFLD, ATTEC, AUTAC, and AUTOTAC pathways. The drug includes a small molecule inhibitor of the CREPT protein.

3. The application according to claim 2, characterized in that, The nucleic acid reagent includes one or more of siRNA, shRNA, microRNA, and ASO; The vector containing the nucleic acid fragment that inhibits CREPT protein expression includes one or more of adenovirus, adeno-associated virus, lentivirus, and retrovirus; The reagents used for homologous recombination and gene editing to eliminate the CREPT gene include the CRISPR / Cas9 system; Preferably, the nucleotide sequence of the siRNA is shown in SEQ ID No. 1, SEQ ID No. 3-11, SEQ ID No. 15, SEQ ID No. 17-24 and SEQ ID No. 27; Preferably, the nucleotide sequence of the shRNA is shown in SEQ ID No.

12.

4. The application according to claim 1, characterized in that, The application includes one or more of the following: a. To prepare drugs for weight reduction; b. Prepare drugs that lower one or more of ALT, AST, HDL-C, LDL-C, LDH, and CHOL; c. Prepare drugs to improve liver fat accumulation; d. Preparation of drugs to reduce body fat; e. To prepare drugs that lower one or more of the levels of triglycerides, total cholesterol, and glucose in the liver; f. Preparation of drugs that regulate hepatic lipid and glucose metabolism; g. Preparation of drugs to control the progression of fatty liver disease; h. Preparation of drugs to reduce the infiltration of inflammatory cells in the liver; i. Preparation of drugs to reduce liver fibrosis; j. Preparation of drugs to reduce fatty degeneration cells; k. To prepare drugs that reduce hepatic steatosis; 1. Preparation of gene-regulated drugs, preferably, the gene-regulated drugs include one or more of the following: Fap5 gene upregulation drugs, Pck1 gene upregulation drugs, Pnpla2 gene upregulation drugs, Apoa1 gene upregulation drugs, Acadm gene downregulation drugs, Pparg gene downregulation drugs, Pdk4 gene downregulation drugs, Lpl gene downregulation drugs, Acsl3 gene downregulation drugs, Scd1 gene downregulation drugs, Gk gene downregulation drugs, Acacb gene downregulation drugs, Plin2 gene downregulation drugs, Cd36 gene downregulation drugs, Cidec gene downregulation drugs, Plin4 gene downregulation drugs, G0s2 gene downregulation drugs, and Mogat1 gene downregulation drugs. m. Preparation of drugs that regulate the elongation of fatty acid synthesis; n. Preparation of drugs that improve lipid metabolism; o. Preparation of drugs that inhibit collagen synthesis; p. Preparation of drugs for regulating immune function; q. To prepare drugs for regulating endocrine function; r. To prepare drugs that inhibit the production of inflammation in fatty liver disease; s. To prepare drugs that significantly improve hepatic lipid metabolism and amino acid metabolism pathways; t. To prepare a drug that downregulates lipid metabolism-related metabolites, preferably, the drug that downregulates lipid metabolism-related metabolites includes a drug that downregulates glycerol and a drug that downregulates unsaturated glycosides.

5. The application according to claim 1, characterized in that, The fatty liver disease includes one or more of alcoholic fatty liver disease, metabolic-associated fatty liver disease, and special types of fatty liver. The alcoholic fatty liver disease includes one or more of the following: alcoholic fatty liver, alcoholic steatohepatitis, liver fibrosis, and cirrhosis. The metabolic-associated fatty liver disease includes one or more of the following: metabolic-associated fatty liver, metabolic-associated steatohepatitis, metabolic-associated fatty liver fibrosis, and metabolic-associated fatty liver cirrhosis. The specific types of fatty liver include one or more of the following: drug-induced fatty liver, environmental toxin-induced fatty liver, disease-induced fatty liver, acute fatty liver, total parenteral nutrition-induced fatty liver, inflammatory bowel disease-induced fatty liver, and malnutrition-induced fatty liver. Preferably, the drugs that cause fatty liver disease include one or more of tamoxifen, amiodarone, sodium valproate, methotrexate, and glucocorticoids; Preferably, the environmental toxins that cause fatty liver disease include one or more of antimony, barium, and organic solvents; Preferably, the diseases that cause fatty liver disease include one or more of the following: genotype 3 hepatitis C virus infection, Wilson's disease, autoimmune hepatitis, β-lipoprotein deficiency, lipoatrophic diabetes, Mauriac syndrome, and progressive muscular dystrophy. Preferably, the etiology of the acute fatty liver includes one or more of the following: acute fatty liver of pregnancy, HELLP syndrome, Reye syndrome, and alcoholic foamy steatosis. Preferably, acute fatty liver includes one or more of the following: acute fatty liver of pregnancy, HELLP syndrome, Reye's syndrome, and alcoholic foamy steatosis. Alternatively, complications of fatty liver disease include one or more of the following: focal nodular hyperplasia of the liver, chronic cholecystitis-adenomyoma, moderately to poorly differentiated adenocarcinoma of the gallbladder, chronic cholecystitis-adenomyoma-cholelithiasis, benign liver tumors, hepatocellular carcinoma, alcoholic cirrhosis, and liver rupture and hemorrhage. Alternatively, fatty liver disease can also include fatty liver disease with complications, including one or more of the following: hypertension, coronary heart disease, steatohepatitis, liver fibrosis, cirrhosis, liver cancer, arteriosclerosis, liver failure, portal hypertension, metabolic syndrome, cardiovascular disease, hyperlipidemia, diabetes, type 2 diabetes, chronic kidney disease, diffuse cerebral edema, liver damage, polycystic ovary syndrome, sleep apnea syndrome, and hepatic encephalopathy.

6. A drug for treating fatty liver disease, characterized in that, The drug includes agents that reduce CREPT gene expression or impair or inactivate CREPT protein function; Preferably, the drug comprises an effective amount of one or more of siRNA, ASO, and AAV containing siRNA and shRNA, wherein the nucleotide sequence of the siRNA is shown in SEQ ID No. 1, SEQ ID No. 3-11, SEQ ID No. 15, SEQ ID No. 17-24 and SEQ ID No. 27; and the nucleotide sequence of the shRNA is shown in SEQ ID No.

12.

7. The drug according to claim 6, characterized in that, The drug also includes a delivery system; Preferably, the delivery system includes one of GalNAc and LNP.

8. A drug combination product, characterized in that, The drug combination product includes the drug and the second drug as described in claim 6 or 7, wherein the second drug has the effect of treating fatty liver disease, and the drug and the second drug are used sequentially or simultaneously; preferably, the second drug includes smegglutide or rametiro.

9. The use of the medicament according to any one of claims 6 to 7 or the medicament combination product according to claim 8 in the preparation of a medicament for treating fatty liver disease or its symptoms.

10. The application according to claim 9, characterized in that, The medication for treating fatty liver disease or its symptoms includes any of the following: a. To prepare drugs for weight reduction; b. Prepare drugs that lower one or more of ALT, AST, HDL-C, LDL-C, LDH, and CHOL; c. Prepare drugs to improve liver fat accumulation; d. Preparation of drugs to reduce body fat; e. To prepare drugs that lower one or more of the levels of triglycerides, total cholesterol, and glucose in the liver; f. Preparation of drugs that regulate hepatic lipid and glucose metabolism; g. Preparation of drugs to control the progression of fatty liver disease; h. Preparation of drugs to reduce the infiltration of inflammatory cells in the liver; i. Preparation of drugs to reduce liver fibrosis; j. Preparation of drugs to reduce fatty degeneration cells; k. To prepare drugs that reduce hepatic steatosis; 1. Preparation of gene-regulated drugs, preferably, the gene-regulated drugs include one or more of the following: Fap5 gene upregulation drugs, Pck1 gene upregulation drugs, Pnpla2 gene upregulation drugs, Apoa1 gene upregulation drugs, Acadm gene downregulation drugs, Pparg gene downregulation drugs, Pdk4 gene downregulation drugs, Lpl gene downregulation drugs, Acsl3 gene downregulation drugs, Scd1 gene downregulation drugs, Gk gene downregulation drugs, Acacb gene downregulation drugs, Plin2 gene downregulation drugs, Cd36 gene downregulation drugs, Cidec gene downregulation drugs, Plin4 gene downregulation drugs, G0s2 gene downregulation drugs, and Mogat1 gene downregulation drugs. m. Preparation of drugs that regulate the elongation of fatty acid synthesis; n. Preparation of drugs that improve lipid metabolism; o. Preparation of drugs that inhibit collagen synthesis; p. Preparation of drugs for regulating immune function; q. To prepare drugs for regulating endocrine function; r. To prepare drugs that inhibit the production of inflammation in fatty liver disease; s. To prepare drugs that significantly improve hepatic lipid metabolism and amino acid metabolism pathways; t. To prepare a drug that downregulates lipid metabolism-related metabolites, preferably, the drug that downregulates lipid metabolism-related metabolites includes a drug that downregulates glycerol and a drug that downregulates unsaturated glycosides.

11. A method for treating fatty liver disease, characterized in that, The method includes treating fatty liver disease by administering a reagent targeting the CREPT gene or protein to the patient to reduce the expression of the CREPT gene or to reduce or inactivate the function of the CREPT protein.

12. The method according to claim 11, characterized in that, The reagents targeting the CREPT gene or protein include one or more of siRNA, ASO, and AAV containing siRNA and shRNA; Preferably, the nucleotide sequence of the siRNA is shown in SEQ ID No. 1, SEQ ID No. 3-11, SEQ ID No. 15, SEQ ID No. 17-24 and SEQ ID No. 27; Preferably, the nucleotide sequence of the shRNA is shown in SEQ ID No.

12.

13. A drug for controlling the progression of liver disease, characterized in that, Liver disease includes one or more progressive stages of fatty liver, hepatitis caused by fatty liver disease, liver fibrosis, and cirrhosis; wherein the drug controls the progression of liver disease by reducing the expression of the CREPT gene or by reducing or inactivating the function of the CREPT protein.

14. The medicament according to claim 13, characterized in that, The reagent targeting the CREPT gene or protein is selected from one or more of the following: agents that affect CREPT protein expression, agents that knock out CREPT protein, agents that alter CREPT protein, and agents that degrade CREPT protein. Preferably, the formulation affecting CREPT protein expression includes a nucleic acid reagent or a carrier containing a nucleic acid fragment that inhibits CREPT protein expression; Preferably, the formulation for knocking out the CREPT protein includes reagents for homologous recombination and gene editing to eliminate the CREPT gene; Preferably, the formulation for altering the CREPT protein includes reagents that alter the structure of the CREPT protein; Preferably, the formulation for degrading CREPT protein includes one or more of the following: PROTAC, molecular glue, LYTAC, MoDE, ATAC, Apt-LYTAC, AbTAC, PROTAB, REULR, KineTAC, IFLD, ATTEC, AUTAC, and AUTOTAC pathways. The drug includes a small molecule inhibitor of the CREPT protein.

15. The medicament according to claim 14, characterized in that, The nucleic acid reagent includes one or more of siRNA, shRNA, microRNA, and ASO; The vector containing the nucleic acid fragment that inhibits CREPT protein expression includes one or more of adenovirus, adeno-associated virus, lentivirus, and retrovirus; The reagents used for homologous recombination and gene editing to eliminate the CREPT gene include the CRISPR / Cas9 system; Preferably, the nucleotide sequence of the siRNA is shown in SEQ ID No. 1, SEQ ID No. 3-11, SEQ ID No. 15, SEQ ID No. 17-24 and SEQ ID No. 27; Preferably, the nucleotide sequence of the shRNA is shown in SEQ ID No.

12.

16. A method for controlling the progression of liver disease, characterized in that, The method includes administering a reagent targeting the CREPT gene or protein to a patient to control the progression of liver disease by reducing the expression of the CREPT gene or by impairing or inactivating the function of the CREPT protein; wherein the liver disease includes one or more stages of fatty liver, hepatitis caused by fatty liver disease, liver fibrosis, or cirrhosis.

17. The method according to claim 16, characterized in that, The reagents targeting the CREPT gene or protein include one or more of siRNA, ASO, and AAV containing siRNA and shRNA; Preferably, the nucleotide sequence of the siRNA is shown in SEQ ID No. 1, SEQ ID No. 3-11, SEQ ID No. 15, SEQ ID No. 17-24 and SEQ ID No. 27; Preferably, the nucleotide sequence of the shRNA is shown in SEQ ID No.

12. 18.CREPT + Liver parenchymal cells or CREPT test + The use of hepatocyte reagents in the preparation of the kit, characterized in that, The kit is used to detect whether a patient has fatty liver disease.

19. The application according to claim 18, characterized in that, The CREPT + If liver parenchymal cells are positive for CREPT expression or the protein expressing CREPT is positive, the patient has fatty liver disease.

20. The application according to claim 18, characterized in that, Detecting CREPT + The reagents for hepatocytes are those capable of detecting CREPT protein or CREPT mRNA; Preferably, the detection of CREPT + The reagent for liver parenchymal cells is used to determine the presence of CREPT protein or CREPT mRNA through in vitro detection.

21. The application according to claim 20, characterized in that, Methods for detecting the presence of CREPT mRNA in vitro include one or more of the following: qPCR, nucleic acid sequencing or hybridization, mass spectrometry, and chromatography. Methods for detecting the presence of CREPT protein in vitro include one or more of the following: immunological detection, mass spectrometry, and spectroscopy. 22.CREPT + The proportion of hepatic parenchymal cells or the detection of CREPT + The use of a reagent for determining the proportion of hepatic parenchymal cells in the preparation of a kit, characterized in that the kit is used to determine the progression stage of a patient's liver disease.

23. The application according to claim 22, characterized in that, The CREPT + The proportion of hepatocytes is the proportion of hepatocytes that are positive for CREPT gene expression and / or positive for CREPT protein out of all hepatocytes; Alternatively, the liver disease may include one or more stages of fatty liver disease, hepatitis caused by fatty liver disease, liver fibrosis, or cirrhosis.

24. The application according to claim 22, characterized in that, The CREPT + The higher the proportion of hepatocytes, the higher the stage of liver disease progression.

25. The use of the CREPT gene or protein as a target or an agent targeting the CREPT gene or protein in the treatment of obesity or in the preparation of a medicament for the treatment of obesity, characterized in that, in, Obesity can be treated by reducing the expression of the CREPT gene or by reducing or inactivating the function of the CREPT protein.

26. The application according to claim 25, characterized in that, The reagents targeting the CREPT gene or protein reduce CREPT gene expression or impair or inactivate CREPT protein function; The reagent targeting the CREPT gene or protein is selected from one or more of the following: agents that affect CREPT protein expression, agents that knock out CREPT protein, agents that alter CREPT protein, and agents that degrade CREPT protein. Preferably, the formulation affecting CREPT protein expression includes a nucleic acid reagent or a carrier containing a nucleic acid fragment that inhibits CREPT protein expression; Preferably, the formulation for knocking out the CREPT protein includes reagents for homologous recombination and gene editing to eliminate the CREPT gene; Preferably, the formulation for altering the CREPT protein includes reagents that alter the structure of the CREPT protein; Preferably, the formulation for degrading CREPT protein includes one or more of the following: PROTAC, molecular glue, LYTAC, MoDE, ATAC, Apt-LYTAC, AbTAC, PROTAB, REULR, KineTAC, IFLD, ATTEC, AUTAC, and AUTOTAC pathways. The drug includes a small molecule inhibitor of the CREPT protein.

27. The application according to claim 26, characterized in that, The nucleic acid reagent is selected from one or more of siRNA, shRNA, microRNA, and ASO; The vector containing the nucleic acid fragment that inhibits CREPT protein expression includes one or more of adenovirus, adeno-associated virus, lentivirus, and retrovirus; The reagents used for homologous recombination and gene editing to eliminate the CREPT gene include the CRISPR / Cas9 system; Preferably, the nucleotide sequence of the siRNA is shown in SEQ ID No. 1, SEQ ID No. 3-11, SEQ ID No. 15, SEQ ID No. 17-24 and SEQ ID No. 27; Preferably, the nucleotide sequence of the shRNA is shown in SEQ ID No.

12.

28. The application according to claim 25, characterized in that, The application has one or more effects, including reducing overall weight, reducing body mass index, reducing waist circumference, and reducing overall fat.

29. A drug for treating obesity, characterized in that, The drug includes the reagents that reduce CREPT gene expression or impair or inactivate CREPT protein function; Preferably, the drug comprises an effective amount of one or more of siRNA, ASO, and AAV containing siRNA and shRNA, wherein the nucleotide sequence of the siRNA is shown in SEQ ID No. 1, 3-11, SEQ ID No. 15, and SEQ ID No. 17-24, and the nucleotide sequence of the shRNA is shown in SEQ ID No.

12.

30. The medicament according to claim 29, characterized in that, The drug also includes a delivery system; Preferably, the delivery system includes one of GalNAc and LNP.

31. A drug combination product, characterized in that, The pharmaceutical combination product includes the drug and the second drug as described in any one of claims 29 to 30, wherein the second drug has the effect of treating obesity; preferably, the second drug includes smegglutide or rametiro.

32. The use of the medicament according to any one of claims 29 to 30 or the medicament combination product according to claim 19 in the preparation of a medicament for treating obesity.

33. A method for treating obesity, characterized in that, The method includes administering a reagent to a patient that targets the CREPT gene or protein to treat obesity by reducing the expression of the CREPT gene or by reducing or inactivating the function of the CREPT protein.

34. The method according to claim 33, characterized in that, The reagents targeting the CREPT gene or protein include one or more of siRNA, ASO, and AAV containing siRNA and shRNA; Preferably, the nucleotide sequence of the siRNA is shown in SEQ ID No. 1, 3-11, SEQ ID No. 15, and SEQ ID No. 17-24; Preferably, the nucleotide sequence of the shRNA is shown in SEQ ID No.

12.

35. The method according to claim 33, characterized in that, The treatment of obesity includes one or more of the following indicators: reducing total weight, reducing body mass index, reducing waist circumference, and reducing total fat.