Method for preparing recombinant collagen

WO2026200967A1PCT designated stage Publication Date: 2026-10-01CANTONBIO CO LTD +2
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2026/085858
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-03-25
Filing Date
2026-03-25
Publication Date
2026-10-01

Smart Images

  • Figure CN2026085858_01102026_PF_FP_ABST
    Figure CN2026085858_01102026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention belongs to the technical field of bioengineering, and specifically relates to a method for preparing recombinant collagen. Provided is a vector comprising a gene encoding collagen and a gene encoding hydroxylase, wherein the backbone of the vector comprises a first expression cassette, and the first expression cassette comprises EF1a-intronA. Cells containing the vector can increase the expression level of collagen while ensuring the stable formation of the triple-helical structure of collagen.
Need to check novelty before this filing date? Find Prior Art

Description

A method for preparing recombinant collagen Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to a method for preparing recombinant collagen. Background Technology

[0002] Collagen is the most abundant protein in the human body and a major component of tissue structure. Distributed throughout the body's tissues and organs, collagen not only maintains the shape and structure of skin and organs but also plays a crucial role in repairing damaged tissues. Collagen possesses high tensile strength, is biodegradable, has low immunogenicity, low cytotoxicity, and promotes cell adhesion, proliferation, and tissue repair as part of the organ skeleton. These properties make collagen an ideal and widely applicable biomedical material, currently used extensively in medical dressings, regenerative medicine, tissue engineering, and cosmetic medicine.

[0003] Currently, collagen production mainly relies on animal tissue extraction, which inevitably carries risks of animal virus contamination and immune rejection, limiting its widespread application in medicine, bioengineering, and aesthetic medicine. While human-derived collagen extracted from human tissue does not pose an immune rejection risk, the availability of human tissue is extremely limited, and it faces significant ethical controversies, further restricting its application.

[0004] In recent years, recombinant synthesis and expression using genetic engineering technology has become a new development direction for human collagen production. However, human collagen has characteristics such as large molecular weight and complex folding modifications, which makes its expression and purification in microbial expression systems difficult. Currently, existing technologies using microbial expression systems can achieve the expression of humanized collagen containing truncated sequences, but the expressed collagen lacks a triple helix structure, resulting in its stability, biological properties, and activity being far inferior to collagen extracted from animal tissues, greatly limiting its efficacy and industrial application. At present, there are no full-length recombinant human collagen raw materials or products with a triple helix structure available globally, indicating that related technology development and product market have high technical barriers and enormous market potential. Summary of the Invention

[0005] The first aspect of the present invention is to provide a carrier.

[0006] A second aspect of the present invention is to provide a cell.

[0007] The third aspect of this invention is to provide a method for constructing cells according to the second aspect of this invention.

[0008] The fourth aspect of this invention is to provide a method for preparing recombinant collagen.

[0009] The fifth aspect of this invention is to provide a recombinant collagen.

[0010] The sixth aspect of this invention is to provide the application of the recombinant collagen of the fifth aspect of this invention.

[0011] The seventh aspect of this invention aims to provide a product.

[0012] An eighth aspect of the present invention aims to provide a method for promoting cell proliferation and / or adhesion.

[0013] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0014] In a first aspect, the present invention provides a vector comprising: a gene encoding collagen and a gene encoding hydroxylase, the backbone of the vector comprising: a first expression cassette comprising: EF1a-intronA.

[0015] In some embodiments, the first expression cassette is used for the expression of the gene encoding collagen and / or the gene encoding hydroxylase.

[0016] In some implementations, the first expression box further includes: bGHpoly(A).

[0017] In some implementations, the first expression box further includes a CMV promoter.

[0018] In some implementations, the first expression box contains, from the 5' end to the 3' end, the following components in sequence: CMV promoter, EF1a-intronA, and bGHpoly(A).

[0019] In some embodiments, the gene encoding collagen and the gene encoding hydroxylase are located between EF1a-intronA and bGHpoly(A).

[0020] In some embodiments, the nucleotide sequence of the EF1a-intron A comprises: SEQ ID NO: 6, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with and having the same function.

[0021] In some embodiments, the nucleotide sequence of the bGH poly(A) comprises: SEQ ID NO: 7, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with and having the same function.

[0022] In some embodiments, the nucleotide sequence of the CMV promoter comprises: SEQ ID NO: 5, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with and having the same function.

[0023] In some embodiments, the skeleton of the carrier further includes a second expression cassette.

[0024] In some implementations, the second expression box is used for the expression of filter markers (preferably GS filter markers).

[0025] In some implementations, the second expression box is connected in reverse series with the first expression box.

[0026] In some embodiments, the second expression cassette comprises, from the 5' end to the 3' end, the following components in sequence: AmpR, Ori replication initiation, SV40 poly(A), a gene encoding a selection marker (preferably a GS selection gene), and an SV40 promoter.

[0027] In some embodiments, the skeleton of the carrier comprises, from the 5' end to the 3' end, a first expression box and a second expression box.

[0028] In some embodiments, the backbone of the vector is prepared by digesting the target gene expression vector (anti-HER2 monoclonal antibody (Trastuzumab) expression vector (human GS selection marker)) used in Example 4 of patent CN116445542A with HindIII and BamHI double enzyme digestion.

[0029] In some embodiments, the collagen is full-length collagen; more specifically, it is full-length animal collagen.

[0030] In some embodiments, the animal is a mammal; further selected from humans, cats, cattle, sheep, pigs, dogs, chickens, ducks, geese, rabbits, and mice; and even further selected from humans.

[0031] In some embodiments, the collagen comprises at least one of type I collagen, type II collagen, type III collagen, type V collagen, type XI collagen, type XXIV collagen, and type XXVII collagen; further comprises at least one of type I collagen and type III collagen; and even more specifically, type I collagen or type III collagen.

[0032] In some embodiments, the collagen is full-length human type I collagen or full-length human type III collagen.

[0033] In some embodiments, the full-length human type III collagen is registered under number P02461.

[0034] In some embodiments, the nucleotide sequence of the gene encoding full-length human type III collagen is shown in SEQ ID NO: 1.

[0035] In some embodiments, the full-length human type I collagen comprises full-length human type I collagen COL1A1 and full-length human type I collagen COL1A2.

[0036] In some embodiments, the full-length human collagen COL1A1 has the accession number P02452.

[0037] In some embodiments, the full-length human collagen COL1A2 is registered under the number P08123.

[0038] In some embodiments, the nucleotide sequence of the gene encoding full-length human collagen COL1A1 is shown in SEQ ID NO: 3.

[0039] In some embodiments, the nucleotide sequence of the gene encoding full-length human collagen COL1A2 is shown in SEQ ID NO: 4.

[0040] The natural full-length human collagen sequence contains numerous Gly-XY repeats, where the X or Y position is typically proline (Pro), while the codons for glycine (Gly) are GGT / GGA / GGC / GGG, and those for proline (Pro) are CCT / CCA / CCC / CCG. This leads to a significant increase in the GC content of the corresponding protein-encoding DNA sequence during recombinant expression of full-length collagen. High GC content often results in reduced transcription levels of the target gene, making efficient recombinant expression of full-length human collagen difficult to achieve to some extent. This application addresses the problem of reduced transcription levels of the target gene by optimizing codons according to the codon preferences of Chinese hamsters, selecting highly biased codons to convert the amino acid sequence into the protein-encoding DNA sequence, while controlling the GC content below 70%.

[0041] In some embodiments, the hydroxylase comprises: proline hydroxylase and / or lysine hydroxylase; further comprising proline hydroxylase.

[0042] In some embodiments, the hydroxylase is derived from an animal; further, a mammal; further selected from humans, cats, cattle, sheep, pigs, dogs, chickens, ducks, geese, rabbits, and mice (e.g., Chinese hamsters); and even further, humans.

[0043] In some embodiments, the proline hydroxylase is designated as accession number P13674.

[0044] In some embodiments, the nucleotide sequence of the gene encoding proline hydroxylase is shown in SEQ ID NO: 2.

[0045] In some embodiments, the gene encoding collagen and the gene encoding hydroxylase are located on the same vector or on different vectors.

[0046] In some embodiments, when the collagen is full-length human type I collagen, the gene encoding full-length human type I collagen COL1A1 and the gene encoding full-length human type I collagen COL1A2 are located on the same vector or on different vectors.

[0047] In some embodiments, the carrier comprises:

[0048] Carrier a1 and carrier a2; or

[0049] Carrier a11, carrier a12 and carrier a2;

[0050] The vector a1 contains a gene encoding full-length human type III collagen, the vector a11 contains a gene encoding full-length human type I collagen COL1A1, the vector a12 contains a gene encoding full-length human type I collagen COL1A2, and the vector a2 contains a gene encoding hydroxylase. The backbones of the vectors a1, a11, a12, and a2 are all the backbones of the aforementioned vectors.

[0051] In some embodiments, the mass ratio of the carrier a1 to the carrier a2 is (0.5-5):1; further, (1-4.5):1; and even further, (3.8-4.2):1.

[0052] In some embodiments, the mass ratio of the mixture of carrier a11 and carrier a12 to carrier a2 is (0.5-5):1; further, (1-4.5):1; and even further, (3.8-4.2):1.

[0053] In some embodiments, the mass ratio of the carrier a11 to the carrier a12 is (1-3):1; more specifically (1.5-2.5):1.

[0054] In some embodiments, the 5' end of the gene encoding full-length human type III collagen also includes a Kozak sequence.

[0055] In some embodiments, the 3' end of the gene encoding full-length human type III collagen also includes a stop codon (TGA).

[0056] In some embodiments, the 5' end of the gene encoding full-length human collagen COL1A1 also contains a Kozak sequence.

[0057] In some embodiments, the 3' end of the gene encoding full-length human collagen COL1A1 also contains a stop codon (TGA).

[0058] In some embodiments, the 5' end of the gene encoding full-length human collagen COL1A2 also contains a Kozak sequence.

[0059] In some embodiments, the 3' end of the gene encoding full-length human collagen COL1A2 also contains a stop codon (TGA).

[0060] In some embodiments, the 5' end of the gene encoding the hydroxylase also contains a Kozak sequence.

[0061] In some embodiments, the 3' end of the gene encoding the hydroxylase also contains a stop codon (TGA).

[0062] In some embodiments, the gene encoding full-length human type III collagen and the vector backbone are combined via restriction enzyme sites HindIII and BamHI to form vector a1.

[0063] In some embodiments, the vector a1 is constructed as follows: HindIII restriction enzyme sites (AAGCTT) and BamHI restriction enzyme sites (GGATCC) are added to the 5' and 3' ends of the gene encoding full-length human type III collagen, respectively. The resulting gene encoding full-length human type III collagen with added restriction enzyme sites is inserted between the HindIII restriction enzyme site and the BamHI restriction enzyme site of the pUC57 plasmid to obtain pUC57-COL3A1. pUC57-COL3A1 and the pMGT vector (the target gene expression vector (anti-HER2 monoclonal antibody (Trastuzumab) expression vector (human GS selection marker) used in Example 4 of patent CN116445542A) are double-digested with HindIII and BamHI, respectively. The resulting COL3A1 gene restriction fragment is ligated with the pMGT vector restriction fragment (i.e., the backbone of the vector) to obtain vector a1.

[0064] In some embodiments, the gene encoding full-length human collagen COL1A1 and the vector backbone are connected via restriction enzyme sites HindIII and BamHI to form vector a11.

[0065] In some embodiments, the vector a11 is constructed as follows: HindIII restriction sites (AAGCTT) and BamHI restriction sites (GGATCC) are added to the 5' and 3' ends of the gene encoding full-length human I collagen COL1A1, respectively. The resulting gene encoding full-length human I collagen COL1A1 with added restriction sites is inserted between the HindIII restriction site and the BamHI restriction site of the pUC57 plasmid to obtain pUC57-COL1A1. pUC57-COL1A1 and the pMGT vector (the target gene expression vector (anti-HER2 monoclonal antibody (Trastuzumab) expression vector (human GS selection marker) used in Example 4 of patent CN116445542A) are double-digested with HindIII and BamHI, respectively. The resulting COL1A1 gene digest fragment is ligated with the pMGT vector digest fragment (i.e., the backbone of the vector) to obtain vector a11.

[0066] In some embodiments, the gene encoding full-length human collagen COL1A2 and the vector backbone are combined via restriction enzyme sites HindIII and BamHI to form vector a12.

[0067] In some embodiments, the vector a12 is constructed as follows: HindIII restriction sites (AAGCTT) and BamHI restriction sites (GGATCC) are added to the 5' and 3' ends of the gene encoding full-length human I collagen COL1A2, respectively. The resulting gene encoding full-length human I collagen COL1A2 with added restriction sites is inserted between the HindIII restriction site and the BamHI restriction site of the pUC57 plasmid to obtain pUC57-COL1A2. pUC57-COL1A2 and pMGT vector (the target gene expression vector (anti-HER2 monoclonal antibody (Trastuzumab) expression vector (human GS selection marker) used in Example 4 of patent CN116445542A) are double-digested with HindIII and BamHI, respectively. The resulting COL1A2 gene digest fragment is ligated with the pMGT vector digest fragment (i.e., the backbone of the vector) to obtain vector a12.

[0068] In some embodiments, the gene encoding the hydroxylase and the vector backbone constitute vector a2 via restriction enzyme sites HindIII and BamHI.

[0069] In some embodiments, the vector a2 is constructed as follows: HindIII restriction sites (AAGCTT) and BamHI restriction sites (GGATCC) are added to the 5' and 3' ends of the gene encoding hydroxylase, respectively. The resulting gene encoding hydroxylase with added restriction sites is inserted between the HindIII restriction site and the BamHI restriction site of the pUC57 plasmid to obtain pUC57-P4H. pUC57-P4H and the pMGT vector (the target gene expression vector (anti-HER2 monoclonal antibody (Trastuzumab) expression vector (human GS selection marker) used in Example 4 of patent CN116445542A) are double-digested with HindIII and BamHI, respectively. The resulting P4H gene restriction fragment is ligated to the pMGT vector restriction fragment (i.e., the backbone of the vector) to obtain vector a2.

[0070] A second aspect of the invention provides a cell comprising the carrier of the first aspect of the invention.

[0071] In some embodiments, the cells do not involve reproductive material.

[0072] In some embodiments, the cells are mammalian cells; further comprising at least one of hamster ovary cells (CHO cells), human embryonic kidney epithelial cells HEK293, mouse myeloma cells (NS0 cells), young hamster kidney cells (BHK cells), and African green monkey kidney cells (Vero cells); even further comprising CHO cells; and still further comprising CHO-K1 cells.

[0073] A third aspect of the present invention provides a method for constructing cells according to the second aspect of the present invention, wherein the vector of the first aspect of the present invention is introduced into cells.

[0074] In some embodiments, the method of introduction is transfection; more specifically, chemical transfection.

[0075] In some implementations, the transfection includes transient transfection or stable transfection.

[0076] In some embodiments, the construction method includes the following steps: mixing the vector with PEI, mixing the resulting mixture with the cells, and culturing.

[0077] This application utilizes the highly positively charged property of PEI (polyethyleneimine) to form a positively charged PEI complex with the expression plasmid, which then binds to the negatively charged cell membrane, allowing for endocytosis and transfection of the expression plasmid. Since the full-length human collagen gene sequence is longer than typical recombinant proteins, the PEI method can better induce the transfection of such long-fragment plasmids.

[0078] In some embodiments, the mass ratio of the carrier to PEI is 1:(1-3); more specifically, it is 1:(1.5-2.5).

[0079] In some embodiments, the ratio of the mixture to the cells is (1-5) μg: 10 μg by weight of cells. 6 10 cells; further for (2-4) μg: 10 6 10 cells; further to (2.5-3.5) μg: 10 6 Each cell.

[0080] In some embodiments, the culture time is 26-74 hours; further, 38-62 hours; and even further, 48-52 hours.

[0081] In some embodiments, culture medium is added after 1-3 hours (preferably 1.5-2.5 hours) of culture (preferably). CD CHO Fusion medium).

[0082] In some embodiments, the culture process is followed by pressure screening and recovery culture.

[0083] In some embodiments, the pressure screening method is as follows: in a culture medium containing MSX (preferably a final concentration of 20-30 μM) The cells were cultured in CD CHO Fusion medium until the cell viability recovered to over 90%.

[0084] CHO cells have low endogenous glutamine synthetase (GS) activity, making it impossible to synthesize enough glutamine to maintain normal cell growth. Therefore, additional glutamine is usually added to the culture medium. Using exogenous GS screening genes in expression vectors can achieve efficient screening of collagen-expressing cell pools.

[0085] In some implementations, the pressure screening process involves passage every 2-4 days (preferably 3 days).

[0086] In some embodiments, the method of restorative culture is as follows: in a medium that does not contain MSX (preferably...) Incubate in CD CHO Fusion medium for 2-4 days (preferably 3 days).

[0087] In some embodiments, the cells are mammalian cells; further comprising at least one of hamster ovary cells (CHO cells), human embryonic kidney epithelial cells HEK293, mouse myeloma cells (NS0 cells), young hamster kidney cells (BHK cells), and African green monkey kidney cells (Vero cells); even further comprising CHO cells; and still further comprising CHO-K1 cells.

[0088] A fourth aspect of the present invention provides a method for preparing recombinant collagen by culturing cells according to the second aspect of the present invention.

[0089] In some embodiments, the preparation method includes the following steps: seeding cells into a culture medium, culturing them, and obtaining a culture solution.

[0090] In some implementations, the culture is a fed-batch culture.

[0091] Fed-batch culture is a cell culture process that extends the high-density growth and production phase of cells by supplementing nutrients in stages. Its core process involves initially using a basal medium to support cell growth, followed by the gradual addition of concentrated feed medium during the culture process to replenish consumed nutrients (such as amino acids, glucose, and vitamins), thereby maintaining cell density and extending production time. Fed-batch culture is now widely used in the large-scale production of CHO cells, offering advantages such as process robustness, good scalability, and controllable costs.

[0092] In some embodiments, the culture medium is a fed-batch culture medium (preferably). Advanced CHO Fed-batch medium).

[0093] In some embodiments, the culture time is 10-18 days; further, 12-16 days; and even further, 13-15 days.

[0094] In some implementations, starting on the third day of cultivation, the culture is fed daily at a ratio of 2-4% (preferably 3%) v / v cell boost 7a + 0.2-0.4% (preferably 0.3%) v / v cell boost 7b until the end of the cultivation.

[0095] In some implementations, when the glucose concentration is below 4 g / L during the culture process, the glucose is increased to 8 g / L.

[0096] In some embodiments, the culture process may further include a step of removing cells and cell debris.

[0097] In some embodiments, the step of removing cells and cell debris is a solid-liquid separation.

[0098] In some embodiments, the solid-liquid separation includes centrifugation and filtration (i.e., filtering the supernatant obtained from centrifugation).

[0099] In some embodiments, the centrifugation conditions are (1200-1600)×g centrifugation for (8-12) min; further, (1300-1500)×g centrifugation for (9-11) min.

[0100] In some embodiments, the filtration uses a 0.22 μm filter membrane.

[0101] In some embodiments, the preparation method further includes the step of purifying the culture medium.

[0102] In some embodiments, the purification method is: salting-out chromatography (i.e., the culture medium is separated and purified by sequentially using salting-out and chromatography).

[0103] Because full-length collagen has a large molecular weight and easily assembles into collagen fibers, purification using common chromatographic processes for recombinant proteins presents challenges such as low loading capacity, high column pressure, easy precipitation within the column, and difficulty in elution, resulting in low recovery efficiency. Furthermore, obtaining high-purity collagen typically requires 2-3 chromatographic steps, leading to significant collagen loss and hindering large-scale production and cost control. Traditional salting-out processes can rapidly precipitate collagen from solution, but their low separation precision prevents further impurity removal and purification. Therefore, this application combines the advantages and disadvantages of both methods, employing a combined salting-out and chromatography approach. First, salting-out rapidly enriches the target protein and removes most impurities, followed by high-precision purification using chromatography. This approach achieves easy-to-operate, low-cost purification of high-purity full-length recombinant human collagen while minimizing chromatographic steps and losses.

[0104] In some embodiments, the purification method is as follows: the collagen is enriched by salting out, and the enriched collagen is purified by chromatography.

[0105] In some embodiments, the collagen is enriched using saturated salts.

[0106] In some embodiments, the salt comprises at least one selected from ammonium sulfate, sodium chloride, sodium sulfate, and magnesium sulfate; more particularly, it is ammonium sulfate.

[0107] In some embodiments, the method of enriching the collagen using salting-out technology involves mixing the culture medium with saturated salt, reacting, separating the solid and liquid phases, and re-dissolving the resulting salting-out precipitate.

[0108] In some embodiments, the method for enriching collagen using salting-out technology further includes the following steps: mixing the obtained salting-out precipitate reconstituted solution with a saturated salt, reacting, separating the solid and liquid phases, and redissolving the obtained salting-out precipitate.

[0109] In some embodiments, the resolvation is performed using water; more specifically, it is performed using water of the same volume as the culture medium.

[0110] In some embodiments, the reaction time is 25-35 minutes.

[0111] In some embodiments, the reaction is carried out at room temperature.

[0112] In some embodiments, the solid-liquid separation method is centrifugation.

[0113] In some embodiments, the centrifugation conditions are (2000-4000)×g, centrifugation for (20-40) min; further, it is (2500-3500)×g, centrifugation for (25-35) min.

[0114] In some embodiments, the volume of the saturated salt is 10%-40% of the culture medium or salting-out precipitation reconstituted solution; more particularly, it is 25%-30%.

[0115] In some embodiments, the chromatography is preceded by the following steps: adjusting the pH of the salting-out precipitation reconstituted solution (i.e., the enriched collagen) to 7-12; further to 7-9; and even further to 8.

[0116] In some embodiments, the method for adjusting the pH of the salting-out precipitate reconstituted solution is to perform ultrafiltration with a buffer solution of the pH value. Preferably, the method is as follows: ultrafiltration is performed using a hollow fiber tube (preferably a hollow fiber tube with a pore size of 100 kD) to replace the solution with an equal volume of buffer solution of the pH value (preferably 20 mM PB (pH: 8.0)).

[0117] In some embodiments, the chromatography is selected from at least one of ion exchange chromatography, hydrophobic chromatography, hydrophilic chromatography, affinity chromatography, and complex chromatography; further, it is ion exchange chromatography; and even further, it is anion exchange chromatography.

[0118] In some embodiments, the packing material for the anion exchange chromatography is Cpto Q.

[0119] In some embodiments, the step of purifying and enriching the collagen using chromatography is as follows: adding the pH-adjusted salting-out precipitation reconstituted solution (i.e., the enriched collagen) to a chromatography system containing packing material, followed by washing and elution to obtain the eluent.

[0120] In some embodiments, 4-6 (preferably 5) column volumes are equilibrated with 10-30 mM PB (pH: 7-12) (preferably 20 mM PB (pH: 8.0)) before adding the pH-adjusted salting-out precipitation reconstituted solution (i.e., the enriched collagen).

[0121] In some embodiments, the washing is performed using a buffer solution, further using 10-30 mM PB (pH: 7-12) (preferably 20 mM PB (pH: 8.0)), and even further using 4-6 (preferably 5) column volumes of 20 mM PB (pH: 8.0).

[0122] In some embodiments, the elution is performed using a buffer solution containing NaCl; further elution is performed using PB (10-30 mM, pH: 7-12) containing 0.4-0.6 M NaCl (preferably PB (20 mM, pH: 8.0) containing 0.5 M NaCl); and even further elution is performed using PB (10-30 mM, pH: 7-12) containing 0.4-0.6 M NaCl (preferably PB (20 mM, pH: 8.0) containing 0.5 M NaCl) for 14-16 (preferably 15) column volumes.

[0123] In some implementations, after elution, the eluent is selected based on the purity of the SDS-PAGE.

[0124] In some embodiments, the preparation method further includes the step of ultrafiltration to replace the eluent.

[0125] In some embodiments, the method for ultrafiltration replacement of the eluent is as follows: the eluent is ultrafiltration replacement is performed using a hollow fiber tube (preferably a hollow fiber tube with a pore size of 100 kD) until NaCl (preferably 0.8-1% NaCl) is reached.

[0126] A fifth aspect of the present invention provides a recombinant collagen obtained by the preparation method of the fourth aspect of the present invention.

[0127] In some embodiments, the recombinant collagen comprises triple-helix collagen.

[0128] In some embodiments, the purity of the recombinant collagen is greater than 90% (e.g., it can be 91%, 92%, 93%, 94%, 95%, or any range between the two, such as 91%-95%).

[0129] In some embodiments, the triple-helix collagen constitutes a mass fraction greater than 90% in the recombinant collagen (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any range between the two, such as 91%-99%).

[0130] In some embodiments, the biological activity of the collagen (e.g., promoting cell proliferation and / or promoting cell adhesion, i.e., the detection of the biological activity of collagen by the cell adhesion method and / or cell proliferation method provided by the National Pharmaceutical Industry Standard for Recombinant Collagen (YY / T 1849-2022)) is superior to that of the national standard substance bovine type I collagen.

[0131] A sixth aspect of the present invention provides the use of the recombinant collagen from the fifth aspect of the present invention in the preparation of products.

[0132] In some embodiments, the product is food, medicine, or cosmetic.

[0133] In some embodiments, the product is a drug carrier, a medical product, or a cosmetic product.

[0134] In some embodiments, the product has the effect of promoting cell proliferation and / or promoting cell adhesion.

[0135] In some embodiments, the cells are fibroblasts; more specifically, skin fibroblasts.

[0136] A seventh aspect of the present invention provides a product comprising: the recombinant collagen of the fifth aspect of the present invention.

[0137] In some embodiments, the product is food, medicine, or cosmetic.

[0138] In some embodiments, the product is a drug carrier, a medical product, or a cosmetic product.

[0139] In some embodiments, the product has the effect of promoting cell proliferation and / or promoting cell adhesion.

[0140] In some embodiments, the cells are fibroblasts; more specifically, skin fibroblasts.

[0141] An eighth aspect of the present invention provides a method for promoting cell proliferation and / or adhesion, comprising the step of employing recombinant collagen from a fifth aspect of the present invention.

[0142] In some embodiments, the cells are fibroblasts; more specifically, skin fibroblasts.

[0143] In some embodiments, the method for promoting cell proliferation and / or adhesion is an in vivo or in vitro method for promoting cell proliferation and / or adhesion.

[0144] The beneficial effects of this invention are:

[0145] This invention provides a vector comprising a gene encoding collagen and a gene encoding hydroxylase. The vector's backbone comprises a first expression cassette containing EF1a-intronA. Cells containing this vector can increase collagen expression while ensuring the stable formation of the collagen triple helix structure.

[0146] Furthermore, the recombinant collagen prepared using cells containing the aforementioned carrier is purified using salting-out chromatography, which improves the purification efficiency and recovery rate of collagen. This addresses the key technical bottlenecks in the current research and production of full-length recombinant human collagen, and is conducive to promoting the commercialization of this product and enabling its widespread application in the medical, cosmetic and other fields.

[0147] Furthermore, the recombinant collagen prepared using cells containing the aforementioned carrier contains triple-helix collagen, and compared with animal-extracted full-length collagen (such as bovine type I collagen, a national standard substance), it has a higher content of triple-helix collagen and biological activities (such as cell proliferation activity and / or cell adhesion activity). Attached Figure Description

[0148] Figure 1 shows the electrophoresis diagram of the culture supernatant of full-length recombinant human type III collagen expressed by different vectors: lane 1 is for expression of the empty vector using the pcDNA3.4 vector; lane 2 is for expression of the empty vector using the pMGT vector; lane 3 is for expression of full-length recombinant human type III collagen using the pcDNA3.4 vector; lane 4 is for expression of full-length recombinant human type III collagen using the pMGT vector; lane M is the protein marker. Solid arrows indicate triple-helix collagen bands (~400kD); dashed arrows indicate monomeric collagen bands (~135kD).

[0149] Figure 2 shows the electrophoresis diagrams of the culture supernatant of full-length recombinant human type III collagen under different P4H co-expression strategies; lane M is the protein marker; lane 1 expresses only full-length recombinant human type III collagen (pcDNA3.4); lane 2 expresses pcDNA3.4-COL3A1 expression vector and pcDNA3.4-P4H expression vector at a mass ratio of 4:1; lane 3 expresses pcDNA3.4-COL3A1 expression vector and pcDNA3.4-P4H expression vector at a mass ratio of 2:1; lane 4 expresses pcDNA3.4-COL3A1 expression vector and pcDNA3.4-P4H expression vector. The vectors were co-expressed at a mass ratio of 1:1; lane 5 was for expressing only full-length recombinant human type III collagen (pMGT); lane 6 was for co-expressing pMGT-COL3A1 and pMGT-P4H expression vectors at a mass ratio of 4:1; lane 7 was for co-expressing pMGT-COL3A1 and pMGT-P4H expression vectors at a mass ratio of 2:1; lane 8 was for co-expressing pMGT-COL3A1 and pMGT-P4H expression vectors at a mass ratio of 1:1; solid arrows indicate triple-helix collagen bands (~400kD); dashed arrows indicate monomeric collagen bands (~135kD).

[0150] Figure 3 shows the electrophoresis diagram of the culture supernatant of full-length recombinant human type I collagen under different P4H co-expression strategies: Lane M is the protein marker; Lane 1 expresses only full-length recombinant human type I collagen; Lane 2 is co-expressed with the pMGT-P4H expression vector at a mass ratio of 4:1 for a mixture of pMGT-COL1A1 and pMGT-COL1A2; Lane 3 is co-expressed with the pMGT-P4H expression vector at a mass ratio of 2:1 for a mixture of pMGT-COL1A1 and pMGT-COL1A2; Lane 4 is co-expressed with the pMGT-P4H expression vector at a mass ratio of 1:1 for a mixture of pMGT-COL1A1 and pMGT-COL1A2; Solid arrows indicate triple-helix collagen bands (~400kD); Dashed arrows indicate monomeric type I collagen bands (A1 chain ~135kD, A2 chain ~127kD).

[0151] Figure 4 shows the electrophoresis diagram of collagen anion purification: lane 1 is elution peak 1; lane 2 is elution peak 2; lane 3 is elution peak 3; lane 4 is elution peak 4; lane 5 is elution peak 5; lane M is protein marker.

[0152] Figure 5 shows the SEC-HPLC purity determination of elution peak 3 protein: the main peak proportion is 95.42%.

[0153] Figure 6 shows the comparison of collagen purity results of bovine type I collagen (national standard) and recombinant human type III collagen prepared by this method using SDS-PAGE.

[0154] Figure 7 shows the results of circular dichroism (CD) analysis for identifying the triple helix structure of collagen: a positive peak appears at 212.7 nm.

[0155] Figure 8 shows the results of detecting collagen biological activity using the cell adhesion assay: A shows cell imaging under a microscope, with a scale bar of 200 μm; B is a statistical graph of CCK8 staining.

[0156] Figure 9 shows the cell proliferation assay for detecting collagen biological activity: homogenization was performed with the PBS control group at each concentration as 100%.

[0157] Figure 10 shows a schematic diagram of the pcDNA3.4 vector.

[0158] Figure 11 shows a schematic diagram of the pMGT carrier. Detailed Implementation

[0159] definition

[0160] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly used in the field to which this invention pertains. For the purposes of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural forms, and vice versa.

[0161] As used herein, the term "about" indicates a range of ±20% of the following value. In some embodiments, the term "about" indicates a range of ±10% of the following value. In some embodiments, the term "about" indicates a range of ±5% of the following value.

[0162] The present invention will be further described in detail below through specific embodiments.

[0163] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0164] Unless otherwise specified, experimental methods in the following examples are generally performed under standard conditions or as recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in these examples are commercially available. For reagents whose manufacturers are listed, similar products from other manufacturers are substituted.

[0165] Unless otherwise specified, all quantitative experiments in the following examples are performed in triplicate.

[0166] Example 1: Construction and Cell Pool Screening of Full-Length Recombinant Human Type III Collagen Carrier

[0167]

[0168] 2) Optimized human COL3A1 and human P4H gene sequences were modified by sequentially adding a Kozak sequence (GCCACC) and a HindIII restriction site (AAGCTT) to the 5' end (i.e., 5'→3', HindIII--Kozak--human COL3A1 / human P4H gene sequence). Stop codons TGA and BamHI restriction sites (GGATCC) were also sequentially added to the 3' end (i.e., 5'→3', human COL3A1 / human P4H gene sequence--TGA--BamHI). The gene sequences were sent to GenScript for sequence synthesis and constructed into the pUC57 plasmid (GenScript, SD1176) (i.e., inserting the synthesized gene between the HindIII restriction site and the BamHI restriction site in the pUC57 plasmid), resulting in the vectors pUC57-COL3A1 and pUC57-P4H.

[0169] 3) The pUC57 plasmid containing the human COL3A1 and human P4H gene sequences was digested with HindIII and BamHI at 37℃ for 1 hour. After agarose gel electrophoresis, the bands of the correct molecular weight were excised and recovered to obtain the human COL3A1 and human P4H gene fragments.

[0170] 4) The pMGT expression vector (the target gene expression vector (anti-HER2 monoclonal antibody (Trastuzumab) expression vector (human GS selection marker) used in Example 4 of patent CN116445542A) and pcDNA3.4 were digested with HindIII and BamHI at 37°C for 1 hour. After agarose gel electrophoresis, the bands of the correct molecular weight were excised and recovered to obtain the pMGT and pcDNA3.4 vector digested fragments. The schematic diagrams of the pcDNA3.4 vector and the pMGT vector are shown in Figures 10 and 11, respectively. The pcDNA3.4 vector contains, from the 5' end to the 3' end, the first expression cassette and the second expression cassette. The first expression cassette contains, from the 5' end to the 3' end, the CMV promoter, the target gene, the WPRE element, and the HSV TK poly(A). The second expression cassette contains, from the 5' end to the 3' end, the SV40 promoter, the selection marker, and the SV40 expression cassette. poly(A), Ori replication initiation, AmpR; the pMGT vector contains, from the 5' end to the 3' end, the first expression cassette and the second expression cassette; among which...The first expression cassette, from 5' to 3', contains: CMV promoter, EF1a-intron A, target gene, and bGH poly(A); the second expression cassette, from 5' to 3', contains: AmpR, Ori replication initiation, SV40 poly(A), gene encoding selection marker, and SV40 promoter; that is, the difference between the pMGT vector and the pcDNA3.4 vector is: 1) in the CMV promoter (,SEQ ID NO: 5), EF1a-intronA (ctgaaatggaagaaaaaaactttgaaccactgtctgaggcttgagaatgaaccaagatccaaactcaaaaagggcaaattccaaggagaattacatcaagtgccaagctggcctaacttcagtctccacccactcagtgtggggaaactccatcgcataaaacccctccccccaacctaaagacgacgtactccaaaagctcgagaactaatcgaggtgcctggacggcgcccggtactccgtggagtcacatgaagcgacggctgaggacggaaaggcccttttcctttgtgtgggtgactcacccgcccgctctcccgagcgccgcgtcctccattttgagctccctgcagcagggccgggaagcggccatctttccgctcacgcaactggtgccgaccgggccagccttgccgcccagggcggggcgatacacggcggcgcgaggccaggcaccagagcaggccggccagcttgagactacccccgtccgattctcggtggccgcgctcgcaggccccgcctcgccgaacatgtgcgctgggacgcacgggccccgtcgccgcccgcggccccaaaaaccgaaataccagtgtgcagatcttggcccgcatttacaagactatcttgccagaaaaaaagcgtcgcagcaggtcatcaaaaattttaaatggctagagacttatcgaaagcagcgagacaggcgcgaaggtgccaccagattcgcacgcggcggccccagcgcccaggccaggcctcaactcaagcacgaggcgaaggggctccttaagcgcaaggcctcgaactctcccacccacttccaacccgaagctcgggatcaagaatcacgtactgcagccaggggcgtggaagtaattcaaggcacgcaagggccataacccgtaaagaggccaggcccgcgggaaccacacacggcacttac, SEQ ID NO: 6),This further induced mRNA transcription and ribosome recognition and transport; 2) replacing HSV TK poly(A) with bGH poly(A) (ccatagagcccaccgcatccccagcatgcctgctattgtcttcccaatcctcccccttgctgtcctgccccaccccaccccccagaatagaatgacacctactcagacaatgcgatgcaatttcctcattttattaggaaaggacagtgggagtggcaccttccagggtcaaggaaggcacgggggaggggcaaacaacagatggctggcaactagaaggcacag, SEQ ID NO: 7) further enhanced mRNA stability; 3) the pMGT vector adopted a dual-promoter reverse tandem design, further strengthening the expression of the target gene and selection markers, and enhancing genome integration and screening efficiency.

[0171] 5) Take the human COL3A1 and human P4H gene restriction fragments obtained in step 3), mix them with the pMGT vector restriction fragment obtained in step 4) at a mass ratio of 1:1, and ligate them using T4 ligase at 16°C overnight to obtain vectors pMGT-COL3A1 and pMGT-P4H; at the same time, take the human COL3A1 and human P4H gene restriction fragments obtained in step 3), mix them with the pcDNA3.4 vector fragment obtained in step 4) at a mass ratio of 1:1, and ligate them using T4 ligase at 16°C overnight to obtain vectors pcDNA3.4-COL3A1 and pcDNA3.4-P4H.

[0172] 6) The four ligated expression vectors were transformed into DH5α competent cells and plated onto LB plates containing kanamycin for selection. After a period of culture, positive single clones were selected and colony PCR was performed using collagen-specific primers and P4H gene-specific primers.

[0173] 7) Select colonies that have been identified as positive by PCR and inoculate them into liquid LB medium containing kanamycin for amplification culture. Extract expression plasmids. Break the bacteria and extract plasmids, send them to a sequencing company for gene sequencing, and select expression plasmids that conform to the theoretical sequence (pMGT-COL3A1, pcDNA3.4-COL3A1, pMGT-P4H, pcDNA3.4-P4H).

[0174] 8) Resuscitate ECACC CHO-K1 host cells into a shaker and use... The culture was passaged in CD CHO Fusion medium at a density of 0.5 × 10⁻⁶. 6 Cells / mL, 10mL per tube, incubated at 37℃, 5% CO2, 180rpm on a shaker, passaged every 3 days, for 3 passages for recovery culture.

[0175] 9) Centrifuge the recovered CHO-K1 cells, discard the supernatant, resuspend in preheated HyCell Transfx-C medium, and adjust to 1×10⁻⁶. 7 Cells / ml, dispensed into 1.5mL per tube.

[0176] 10) Take 15 μg of pMGT-COL3A1 and pcDNA3.4-COL3A1 expression vectors respectively, and mix them with 2 times the mass of 30 μg of PEI. Then add one part of the premixed PEI-plasmid to each tube of CHO-K1 host cell suspension obtained in step 9), mix quickly, and incubate in a shaker for 2 hours. Then add 3.5 mL of the premixed PEI-plasmid. Cells were cultured in CD CHO Fusion medium for 2 days on a shaker. Two days after transfection, cells were centrifuged, the supernatant was discarded, and 10 mL of a solution containing 25 μM MSX (Methionine sulfoximine) was added. Cells were selected under pressure using CD CHO fusion medium. Subculture was performed every 3 days, maintaining a MSX concentration of 25 μM in the medium until cell viability recovered to over 90%. Cells were then passaged into MSX-free CD CHO fusion medium for one passage of recovery culture and cryopreserved.

[0177] 11) Take the pMGT-COL3A1 expression vector and the pMGT-P4H expression vector, and mix them at ratios of 4:1 (12 μg pMGT-COL3A1 + 3 μg pMGT-P4H), 2:1 (10 μg + 5 μg), and 1:1 (7.5 μg + 7.5 μg), respectively. Then mix each mixture with twice the mass of 30 μg PEI. Add one portion of the premixed PEI-plasmid to each tube of CHO-K1 host cell suspension obtained in step 9), mix quickly, and incubate in a shaker for 2 hours. Then add 3.5 mL of the premixed PEI-plasmid. Cells were cultured in CD CHO Fusion medium for 2 days on a shaker. Two days after transfection, cells were centrifuged, the supernatant was discarded, and 10 mL of a solution containing 25 μM MSX (Methionine sulfoximine) was added. Cells were selected under pressure using CD CHO fusion medium. Subculture was performed every 3 days, maintaining a MSX concentration of 25 μM in the medium until cell viability recovered to over 90%. Cells were then passaged into MSX-free CD CHO fusion medium for one passage of recovery culture and cryopreserved.

[0178] 12) Take the pcDNA3.4-COL3A1 expression vector and the pcDNA3.4-P4H expression vector, and mix them at ratios of 4:1 (12 μg pcDNA3.4-COL3A1 + 3 μg pcDNA3.4-P4H), 2:1 (10 μg + 5 μg), and 1:1 (7.5 μg + 7.5 μg), respectively. Then mix each mixture with twice the mass of 30 μg PEI. Add one portion of the premixed PEI-plasmid to each tube of CHO-K1 host cell suspension obtained in step 9), mix quickly, and incubate in a shaker for 2 hours. Then add 3.5 mL of the premixed PEI-plasmid. Cells were cultured in CD CHO Fusion medium for 2 days on a shaker. Two days after transfection, cells were centrifuged, the supernatant was discarded, and 10 mL of a solution containing 25 μM MSX (Methionine sulfoximine) was added. Cells were selected under pressure using CD CHO fusion medium. Subculture was performed every 3 days, maintaining a MSX concentration of 25 μM in the medium until cell viability recovered to over 90%. Cells were then passaged into MSX-free CD CHO fusion medium for one passage of recovery culture and cryopreserved.

[0179] Example 2: Construction and Cell Pool Screening of Full-Length Recombinant Human Type I Collagen Vector

[0180]

[0181] 2) The optimized human COL1A1 and COL1A2 gene sequences were modified by adding a Kozak sequence (GCCACC) and a HindIII restriction site (AAGCTT) sequentially to the 5' end (i.e., 5'→3', HindIII--Kozak--human COL1A1 / COL1A2 gene sequence), and a stop codon TGA and a BamHI restriction site (GGATCC) were added to the 3' end (i.e., 5'→3', human COL1A1 / COL1A2 gene sequence--TGA--BamHI). The gene sequences were sent to GenScript for sequence synthesis and constructed into the pUC57 plasmid (GenScript, SD1176) (i.e., the synthesized gene was inserted between the HindIII restriction site and the BamHI restriction site in the pUC57 plasmid), resulting in the vectors pUC57-COL1A1 and pUC57-COL1A2.

[0182] 3) The pUC57 plasmid containing the human COL1A1 and COL1A2 gene sequences was digested with HindIII and BamHI at 37°C for 1 hour. After agarose gel electrophoresis, the bands of the correct molecular weight were excised and recovered to obtain the human COL1A1 and COL1A2 gene fragments.

[0183] 4) The pMGT expression vector (the target gene expression vector (anti-HER2 monoclonal antibody (Trastuzumab) expression vector (human GS selection marker)) used in Example 4 of patent CN116445542A) was double-digested with HindIII and BamHI at 37°C for 1 hour. After agarose gel electrophoresis, the bands of the correct molecular weight were excised and recovered to obtain the pMGT vector digested fragments.

[0184] 5) Take the human COL1A1 and COL1A2 gene enzyme digestion fragments obtained in step 3), mix them with the pMGT vector fragment obtained in step 4) at a mass ratio of 1:1, use T4 ligase, incubate overnight at 16℃, and ligate to obtain vectors pMGT-COL1A1 and pMGT-COL1A2.

[0185] 6) The two ligated expression vectors were transformed into DH5α competent cells and plated onto LB plates containing kanamycin for selection. After a period of culture, positive single clones were selected and colony PCR was performed using collagen-specific primers and P4H gene-specific primers.

[0186] 7) Select colonies that have been identified as positive by colony PCR and inoculate them into liquid LB medium containing kanamycin for amplification culture. Extract expression plasmids. Break the bacteria and extract plasmids, send them to a sequencing company for gene sequencing, and select expression plasmids (pMGT-COL1A1, pMGT-COL1A2) that conform to the theoretical sequence.

[0187] 8) Resuscitate ECACC CHO-K1 host cells into a shaker and use... The culture was passaged in CD CHO Fusion medium at a density of 0.5 × 10⁻⁶. 6 Cells / mL, 10mL per tube, incubated at 37℃, 5% CO2, 180rpm on a shaker, passaged every 3 days, for 3 passages for recovery culture.

[0188] 9) Centrifuge the recovered CHO-K1 cells, discard the supernatant, resuspend in preheated HyCell Transfx-C medium, and adjust to 1×10⁻⁶. 7 Cells / ml, 1.5 mL per tube. Prepare a mixture of pMGT-COL1A1 and pMGT-COL1A2 at a mass ratio of 2:1. Then, mix this mixture with pMGT-P4H from Example 1 at ratios of 4:1 (12 μg mixture + 3 μg pMGT-P4H), 2:1 (10 μg + 5 μg), and 1:1 (7.5 μg + 7.5 μg), respectively. Mix each mixture with twice the mass of 30 μg PEI. Add one portion of the premixed PEI-plasmid to each tube of CHO-K1 host cell suspension, mix quickly, and incubate on a shaker for 2 hours. Then, add 3.5 mL of the premixed PEI-plasmid. The cells were cultured in CD CHO Fusion medium for 2 days in a shaker.

[0189] 10) Take cells 2 days after transfection, centrifuge, discard the supernatant, and add 10 mL of solution containing 25 μM MSX (Methionine sulfoximine). CD CHO Fusion medium was used for pressure screening.

[0190] 11) Pass the cells every 3 days, maintaining a concentration of 25 μM MSX in the medium until cell viability recovers to over 90%. Pass the cells to MSX-free CD CHO fusion medium for one passage of recovery culture and then cryopreserve them.

[0191] Example 3: Fermentation culture of CHO cell pools expressing full-length recombinant human type III and type I collagen

[0192] 1) Take the CHO cell pools expressing full-length recombinant human type III and type I collagen obtained from steps 10), 11), and 12) of Example 1 and step 11) of Example 2, respectively, and thaw them in a 37°C water bath. The thawed cells are then seeded into… The cells were passaged three times in CD CHO fusion medium.

[0193] 2) Adjust the cell density to 0.5 × 10⁻⁶ 6 / mL, inoculated into a 5L shake flask, culture volume 2L, using Advanced CHOFed-batch medium was used to feed cells into batches in a shaker.

[0194] 3) Starting from day 3 after inoculation, feed the culture medium daily at a ratio of 3% v / v CellBoost 7a + 0.3% v / v CellBoost 7b until the end of the culture. Simultaneously monitor the glucose concentration in the culture medium and supplement accordingly. When the glucose concentration falls below 4 g / L, increase the glucose to 8 g / L.

[0195] 4) Monitor cell viability and number changes daily. When the number of days of fed-batch culture reaches 14, terminate the culture and harvest the cell suspension. Centrifuge at 1400×g for 10 min to harvest the supernatant. Filter through a 0.22μm filter membrane and store at -20℃.

[0196] Example 4: Evaluation of the expression of recombinant full-length human type III collagen using different expression vectors

[0197] 1) Take the cell pool obtained in Example 3, which uses different expression vectors pcDNA3.4 and pMGT to express full-length recombinant human type III collagen (i.e., the cell supernatant obtained in steps 10), 11), and 12 of Example 1), add non-reducing 4×LDS Loading Buffer, and heat at 65°C for 10 minutes.

[0198] 2) Add 2 μg of protein per well to a 12% polyacrylamide gel and electrophoresis at 140V for 50 minutes.

[0199] 3) After electrophoresis, the gel was stained with Coomassie Brilliant Blue. The staining results are shown in Figures 1 and 2. The results of detecting the effect of different vectors on the expression of full-length recombinant human type III collagen show that, compared with the commonly used expression vector pcDNA3.4, the pMGT high-efficiency expression vector can significantly improve the expression of full-length recombinant human type III collagen.

[0200] Example 5: Evaluation of the effects of different P4H co-expression strategies on the expression of recombinant full-length human type III and I collagen

[0201] 1) Take the cell supernatant obtained from each cell pool expressing full-length recombinant human type III and type I collagen using different P4H co-expression strategies (step 11 of Examples 1 and 2) obtained in Example 3, add non-reducing 4×LDS Loading Buffer, and heat at 65°C for 10 minutes.

[0202] 2) Add 2 μg of protein per well to a 12% polyacrylamide gel and electrophoresis at 140V for 50 minutes.

[0203] 3) After electrophoresis, the gel was stained with Coomassie Brilliant Blue. The expression of full-length recombinant human type III collagen is shown in Figure 2, and the expression of full-length recombinant human type I collagen is shown in Figure 3. The results of detecting the effect of different P4H co-expression strategies on the expression of full-length recombinant human type III and type I collagen show that adding PH4 for co-expression significantly increases the expression ratio of triple-helix collagen, and this ratio increases synchronously with the increase of the PH4 ratio, but the overall expression level decreases. Considering both the triple-helix ratio and the expression level, a mass ratio of 4:1 between the full-length collagen expression vector and the P4H expression vector is selected as the optimal ratio.

[0204] Example 6: Purification of recombinant full-length human type III collagen

[0205] 1) The frozen culture supernatant obtained in Example 3 (the culture supernatant of cells obtained when the mass ratio of pMGT-COL3A1 expression vector to pMGT-P4H expression vector was 4:1 in step 11 of Example 1) was thawed at room temperature. 30% saturated ammonium sulfate was added to the thawed supernatant by volume, and the mixture was precipitated at room temperature for 30 minutes.

[0206] 2) Centrifuge at 3000×g for 30min to collect the salting-out precipitate. Redissolve the precipitate with an equal volume of pure water as the supernatant. Then add 25% saturated ammonium sulfate by volume and precipitate at room temperature for 30min.

[0207] 3) Centrifuge at 3000×g for 30min to collect the salting-out precipitate, redissolve the precipitate with an equal volume of pure water as the supernatant, and filter through a 0.45μm filter membrane.

[0208] 4) Take a hollow fiber tube with a pore size of 100kD and replace the collagen solution with an equal volume of solution. The target solution is 20mM PB (pH: 8.0). After passing through 7 times the volume of the target solution, the solution replacement is completed.

[0209] 5) Take a 4.7 mL Capto Q anion exchange pre-packed column and equilibrate it with 20 mM PB for 5 column volumes.

[0210] 6) Load the protein solution that has been replaced into the chromatography column, and then load 5 column volumes of 20 mM PB (pH: 8.0) for washing.

[0211] 7) Perform linear elution for 15 column volumes using a buffer containing 0.5M NaCl and 20mM PB (pH: 8.0). Collect the eluted fractions and perform SDS-PAGE analysis. Figure 4 shows the SDS-PAGE results of collagen purification.

[0212] 8) Based on the SDS-PAGE purity, elution peak 3 was selected as the purified collagen. The eluted collagen was then replaced with a 100kD hollow fiber tube in 0.9% NaCl. The sample was then subjected to SEC-HPLC purity identification. The HPLC purity of the full-length recombinant human type III collagen prepared by this method can reach over 95%. Figure 5 shows the SEC-HPLC purity identification results.

[0213] Example 7: Purity Identification of Recombinant Full-Length Human Type III Collagen

[0214] 1) Take the national standard bovine type I collagen reference standard (China National Institutes for Food and Drug Control, 380008) and the recombinant human type III collagen prepared by this method (i.e., the collagen obtained in step 8 of Example 6), add 4×LDS loading buffer, and denature at 65°C for 10 minutes.

[0215] 2) Add 2 μg of protein per well to a 12% polyacrylamide gel and electrophoresis at 140V for 50 minutes.

[0216] 3) After electrophoresis, the gel was stained with Coomassie Brilliant Blue. The staining results are shown in Figure 6. The full-length recombinant human type III collagen prepared by this method has a higher proportion of high molecular weight high-grade structure collagen than the national standard bovine type I collagen control, with the proportion approaching 100%.

[0217] Example 8: Identification of the triple helix structure of recombinant full-length human type III collagen by circular dichroism (CD) chromatography

[0218] 1) According to the identification method of the triple helix structure of recombinant collagen provided in the national pharmaceutical industry standard for recombinant collagen (YY / T 1849-2022), the triple helix structure of the full-length recombinant human type III collagen (i.e., the collagen obtained in step 8 of Example 6) prepared by this method can be identified by circular dichroism (CD) method.

[0219] 2) Dilute the collagen solution to 0.2 mg / ml with 20 mM PB, using a 1 mm cuvette. The blank control was 20 mM PB. The test results are shown in Figure 7: The full-length recombinant human type III collagen prepared by this method has a significant positive absorption peak at 221 nm and a negative absorption peak at 198 nm, confirming that it has a triple helix structure.

[0220] Example 9: Detection of Collagen Biological Activity by Cell Adhesion Assay

[0221] 1) The biological activity of the full-length recombinant human type III collagen prepared by this method can be detected by the cell adhesion method according to the method provided in the national pharmaceutical industry standard for recombinant collagen (YY / T 1849-2022).

[0222] 2) Take the recombinant human type III collagen (i.e., the collagen obtained by step 8 of Example 6) and bovine type I collagen as national standard substances as controls, and add PBS to dilute the collagen solution to 0.25 mg / mL. Add 100 μL to each well of a 96-well plate. Use PBS as a negative control and incubate overnight at 37°C.

[0223] 3) Digest human skin fibroblasts (HSF) cells, resuspend them in serum-free DMEM medium, and adjust the cell density to 3 × 10⁻⁶. 6 / mL, add 100μL to each well, so that each well contains 100,000 HSF cells, and incubate at 37°C for 2 hours.

[0224] 4) Discard the supernatant from each well, wash twice with PBS, and finally add 200 μL of serum-free DMEM medium to each well.

[0225] 5) Perform microscopic cell imaging on each experimental well, then add 50 μL of CCK8 staining solution to each well, incubate at 37°C for 2 hours, and read the absorbance value at OD450 using a microplate reader. The resulting activity results are shown in Figure 8. The recombinant human type III collagen prepared by this method has better biological activity than the national standard bovine type I collagen control.

[0226] Example 10: Detection of Collagen Biological Activity by Cell Proliferation Assay

[0227] 1) The biological activity of the full-length recombinant human type III collagen prepared by this method can be detected by the cell proliferation method according to the method provided in the national pharmaceutical industry standard for recombinant collagen (YY / T 1849-2022).

[0228] 2) Take the recombinant human type III collagen (i.e., the collagen obtained by step 8 of Example 6) and bovine type I collagen as the national standard substance as the control. Dilute the drug to 0.1 mg / mL with serum-free DMEM medium, add 100 μL / well to a 96-well plate, and set up a PBS blank control group. Incubate overnight at 37°C.

[0229] 3) Digest human skin fibroblasts (HSF) cells, resuspend them in serum-free DMEM medium, and adjust the cell density to 5 × 10⁶ cells / year. 4 / mL, add 100μL to each well, and incubate at 37℃ for 48 hours.

[0230] 4) After the culture is completed, add 20 μL of CCK8 staining solution to each well and incubate at 37°C for 2 hours. Read the absorbance value at OD450 using a microplate reader. The activity results are shown in Figure 9. The recombinant human type III collagen prepared by this method has better biological activity than the national standard bovine type I collagen control.

[0231] The technical solutions of the present invention are not limited to the specific embodiments described above. Any technical modifications made in accordance with the technical solutions of the present invention fall within the protection scope of the present invention.

Claims

1. A vector comprising: a gene encoding collagen and a gene encoding hydroxylase, the backbone of the vector comprising: a first expression cassette, the first expression cassette comprising: EF1a-intronA; Preferably, the nucleotide sequence of the EF1a-intron A comprises: SEQ ID NO: 6, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with and having the same function.

2. The carrier according to claim 1, characterized in that, The first expression cassette is used for the expression of the gene encoding collagen and the gene encoding hydroxylase; Preferably, the first expression box further includes: bGHpoly(A); Preferably, the nucleotide sequence of the bGH poly(A) comprises: SEQ ID NO: 7, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with and having the same function; Preferably, the first expression box further includes: a CMV promoter; Preferably, the nucleotide sequence of the CMV promoter comprises: SEQ ID NO: 5, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with and having the same function as SEQ ID NO: 5; Preferably, the skeleton of the carrier further includes: a second expression cassette; Preferably, the second expression box is used to filter the expression of the marker; Preferably, the second expression box is connected in series with the first expression box in reverse order; Preferably, the collagen is full-length collagen; more preferably, it is full-length animal collagen. Preferably, the collagen comprises at least one of type I collagen, type II collagen, type III collagen, type V collagen, type XI collagen, type XXIV collagen, and type XXVII collagen; and more preferably, at least one of type I collagen and type III collagen. Preferably, the collagen is full-length human type I collagen or full-length human type III collagen; Preferably, the full-length human type I collagen comprises full-length human type I collagen COL1A1 and full-length human type I collagen COL1A2; Preferably, the hydroxylase comprises: proline hydroxylase and / or lysine hydroxylase; more preferably, proline hydroxylase.

3. The carrier according to any one of claims 1-2, characterized in that, The gene encoding collagen and the gene encoding hydroxylase are located on the same vector or on different vectors. Preferably, when the collagen is full-length human type I collagen, the gene encoding full-length human type I collagen COL1A1 and the gene encoding full-length human type I collagen COL1A2 are located on the same vector or on different vectors. Preferably, the carrier comprises: Carrier a1 and carrier a2; or Carrier a11, carrier a12 and carrier a2; The vector a1 contains a gene encoding full-length human type III collagen, the vector a11 contains a gene encoding full-length human type I collagen COL1A1, the vector a12 contains a gene encoding full-length human type I collagen COL1A2, and the vector a2 contains a gene encoding hydroxylase. The backbones of the vectors a1, a11, a12, and a2 are all the backbones of the vectors described in any one of claims 1-2. Preferably, the mass ratio of carrier a1 to carrier a2 is (0.5-5):1; Preferably, the mass ratio of the mixture of carrier a11 and carrier a12 to carrier a2 is (0.5-5):1; Preferably, the nucleotide sequence of the gene encoding full-length human type III collagen is shown in SEQ ID NO: 1; Preferably, the nucleotide sequence of the gene encoding full-length human collagen COL1A1 is shown in SEQ ID NO: 3; Preferably, the nucleotide sequence of the gene encoding full-length human collagen COL1A2 is shown in SEQ ID NO: 4; Preferably, the nucleotide sequence of the gene encoding the hydroxylase is shown in SEQ ID NO:

2.

4. A cell comprising the vector according to any one of claims 1-3.

5. The cell according to claim 4, characterized in that, The cells are mammalian cells; further comprising at least one of hamster ovary cells (CHO cells), human embryonic kidney epithelial cells HEK293, mouse myeloma cells (NS0 cells), young hamster kidney cells (BHK cells), and African green monkey kidney cells (Vero cells); and even more specifically, CHO cells.

6. The method for constructing cells according to any one of claims 4-5, wherein the vector according to any one of claims 1-3 is introduced into the cells.

7. The construction method according to claim 6, characterized in that, The method of introduction is transfection; more specifically, chemical transfection. Preferably, the transfection includes transient transfection or stable transfection; Preferably, the construction method includes the following steps: mixing the vector with PEI, mixing the resulting mixture with the cells, and culturing.

8. A method for preparing recombinant collagen, obtained by culturing the cells described in any one of claims 4-5.

9. The preparation method according to claim 8, characterized in that, The preparation method includes the following steps: seeding cells into a culture medium, culturing them, and obtaining a culture solution; Preferably, the culture is a fed-batch culture.

10. The preparation method according to claim 9, characterized in that, The preparation method further includes the following steps: purifying the culture medium; Preferably, the purification method is as follows: the culture medium is separated and purified sequentially using salting-out and chromatography techniques; Preferably, the purification method is as follows: the collagen is enriched by salting out, and the enriched collagen is purified by chromatography. Preferably, the collagen is enriched using saturated salts; Preferably, the salt comprises at least one of ammonium sulfate, sodium chloride, sodium sulfate, and magnesium sulfate; Preferably, the chromatography is selected from at least one of ion exchange chromatography, hydrophobic chromatography, hydrophilic chromatography, affinity chromatography, and complex chromatography; further, it is ion exchange chromatography; and even further, it is anion exchange chromatography. Preferably, the packing material for the anion exchange chromatography is Cpto Q.

11. A recombinant collagen protein, obtained by the preparation method according to any one of claims 8-10.

12. The recombinant collagen according to claim 11, characterized in that, The recombinant collagen includes triple-helix collagen; Preferably, the triple-helix collagen has a mass fraction greater than 90% in the recombinant collagen.

13. The use of the recombinant collagen according to any one of claims 11-12 in the preparation of products.

14. A product comprising: the recombinant collagen according to any one of claims 11-12.

15. The application according to claim 13 or the product according to claim 14, characterized in that, The product is food, medicine, or cosmetics; or The product is a drug carrier, medical device, or cosmetic product; or The product has the effect of promoting cell proliferation and / or promoting cell adhesion.

16. A method for promoting cell proliferation and / or adhesion, comprising the step of using the recombinant collagen according to any one of claims 11-12; Preferably, the cells are fibroblasts; more preferably, they are skin fibroblasts.