New multivalent recombinant MDV vector vaccine

Abstract

The present invention provides novel recombinant Marek's disease virus (MDV), which involves a novel insertion site for heterologous genes and / or expression cassettes, and / or efficiently co-expresses multiplexed heterologous antigens by optimizing the heterologous antigenic expression regulatory elements, combinations of the expression regulatory elements and their linkage to the antigens, and / or combinations of multiple insertion sites. Also provided are the use of the recombinant MDV in vaccines, and methods of constructing the same.

Description

New multivalent recombinant MDV vector vaccineTechnical field

[0001] The present invention relates to the technical field of medicine or veterinary medicine, and the technical field of live recombinant poultry vaccine vectors. Specifically, the present invention relates to novel Marek’s disease virus (MDV) vector vaccines, the choice of antigens from prevalent strains, and construction and evaluation of multiplex vector vaccines.Background

[0002] As the scale and industrialization of poultry farming develop, the concentrated outbreaks of epidemics and the presence of multiple infections are frequent, especially viral diseases, which cause huge losses to the poultry industry every year. Due to the lack of effective treatments, immunization by vaccines is still an important means for the prevention and control of poultry viral diseases, and safe and effective vaccines with controllable quality are the key factor to the establishment of a population immunity barrier. In recent years, the research direction of poultry vaccines has gradually transitioned from traditional vaccines to novel types of combined vaccines such as vector vaccines, especially viral vectors, whose properties of stable replication and inheritance in vitro are very favorable for production in a large-scale.

[0003] Turkey herpesvirus (HVT) , originally isolated from turkeys, is a naturally non-pathogenic Marek's disease virus (MDV) , which belongs to the herpesviruses. HVT itself can be applied as a vaccine to prevent Marek's disease, and it is also suitable for the use as a vector vaccine. The vector vaccines are recombinant viruses that express heterologous antigens, and are usually constructed using live non-pathogenic viruses as vectors. Gene editing techniques are frequently used in such construction. Compared with other poultry virus vectors, the advantages of the combined viral vector vaccine constructed based on HVT as a vector are significant: (1) HVT is non-pathogenic to poultry and other species, with limited horizontal transmission capacity, low risk of spreading (especially recombinant HVT) , and good biosafety; (2) herpesviruses such as HVT possess a large linear double-stranded DNA genome, wherein a number of non-essential gene loci and non-coding regions can serve as insertion sites on the genome for heterologous antigen genes, and are compatible with the stable insertion of long (10-50 kb) heterologous expression cassettes, which is suitable for the development of combined vector vaccines; (3) Compared with viral vectors such as fowlpox virus (FWPV) and Newcastle disease virus (NDV) , recombinant MDV such as recombinant HVT and the heterologous antigens expressed therefrom are less likely to be interfered by Maternal Derived Antibody (MDA) . (4) HVT infects a wide range of cell types, and its unique characteristics of lifelong latent infection and conditional activation enable the continuous expression of heterologous antigens, which can effectively stimulate the body's cellular immunity and humoral immunity, and continue to produce high levels of antibodies, providing lifelong immune protection. Due to the above advantages, the industry is very enthusiastic about the development of recombinant MDV vector vaccines, and a variety of recombinant HVT vaccine products have been approved and marketed all over the world. Mature production processes combined with automated embryo injection technology have dramatically reduced the cost of vaccination against a wide range of epidemics.

[0004] Infectious bursal disease virus (IBDV) serotype I is highly infectious and pathogenic, infecting chickens and causing chicken infectious bursal disease. The virus is genetically unstable, and classical virulent infectious bursal disease virus (cv IBDV) , and widely prevalent novel variant IBDV (nVar IBDV) and very virulent infectious bursal disease virus (vv IBDV) in recent years, have emerged through mutation and recombination. The emerging variants which are more prone to escape protection of previous vaccines, and the lack of adequate cross-protection among serotypes, have created a more urgent need for vaccine improvement.

[0005] It has been shown that when the same individual is vaccinated with two kinds of recombinant HVT vaccines, the recombinant HVTs may interfere with each other and thereby the effectiveness of the vaccine's immunoprotection against heterologous antigenic target pathogens is reduced. Therefore, in order to avoid the interference effect between different vaccine strains, multivalent recombinant MDV vector vaccines that simultaneously express multiple key antigens of multiple epidemic diseases have become a research hotspot for novel combination vaccines. However, the insertion of a heterologous gene into its viral genome is a burden on a vector virus, as that may affect its replication, expression, and / or its genetic stability, in vitro and / or in vivo. These issues are particularly prominent when more than one heterologous gene is inserted, more inserts cause more problems to a viral vector’s genetic stability in regard to replication and foreign gene expression. This even to such an extent that no predictions of what would be successful multivalent recombinant HVT constructs, could be based on observations in the prior art on what was an allowable insertion site for a heterologous gene in the HVT genome, especially when evaluating an insertion site that has not previously been tested in HVT.

[0006] Therefore, the development of multivalent recombinant MDV vector vaccines (e.g., recombinant HVT vaccines) requires an improvement on efficient co-expression strategy of heterologous antigens: while conferring good in vitro and in vivo proliferation characteristics of the vaccine, multiple heterologous antigens can be expressed stably, consistently, and in appropriate quantities, and at the same time, induce the generation of a protective immune response against multiple target epidemics.Summary of the Invention

[0007] The purpose of the present invention is to develop a novel insertion site for heterologous genes and / or expression cassettes, enabling recombinant Marek's disease virus (MDV, preferably HVT) to efficiently express transgenic antigens through the development of novel heterologous genes or expression cassette insertion sites.

[0008] Moreover, the present invention also develops a combination of the novel insertion site and the endogenous promoter, exogenous gene inserts may not comprise any promoter sequence.

[0009] Thus, a further purpose is to provide a novel strategy for efficient co-expression of multiplexed heterologous antigens by optimizing the heterologous antigenic expression regulatory elements, combinations of the expression regulatory elements and their linkage to the antigens, and / or combinations of multiple insertion sites, and thereby to construct recombinant MDV (preferably HVT) vector vaccines expressing more than one (e.g., two, three ......) epidemic key antigens accordingly.

[0010] The recombinant MDV vector vaccine of the present invention immunizes poultry against at least the following four epidemics: the MDV itself as the vector protects against multiple types of Marek's disease (MD) caused by various Marek's disease viruses, the Newcastle disease (ND) virus (NDV) F antigen expressed thereby protects against Newcastle disease (ND) caused by NDV, the Infectious bursal disease virus (IBDV) VP2 antigen expressed thereby prevent infectious bursal disease (IBD) caused by IBDV, and the infectious laryngotracheitis virus (ILTV) gD antigen expressed thereby prevents infectious laryngotracheitis (ILT) in chickens caused by ILTV.

[0011] The recombinant MDV vector vaccines constructed by the present invention are stably replicated and inherited in vitro, e.g., the two or more heterologous antigens are efficiently co-expressed in Chicken Embryo Fibroblast (CEF) cells even after 10 or more passages, preferentially even after 15 passages, and more preferentially even after 20 passages.

[0012] The present invention also provides the use of various IBDV VP2 proteins and their coding genes in the construction of recombinant MDV vaccines, which are multivalent vaccines and / or are capable of providing simultaneous immune protection / cross-protection against multiple IBDV serotypes / subtypes including vv IBDV, cv IBDV and nVar IBDV, inducing broad and efficient protection.

[0013] The present invention also provides codon-optimized gene sequences, and use thereof in the construction of recombinant MDVs.

[0014] The present invention also provides a variety of regulatory elements / base sequences particularly suitable for use in the construction of multiplexed recombinant MDVs. The present invention also provides the use of a variety of endogenous elements in the MDV genome in the construction of multiplex recombinant MDVs.

[0015] The present invention also provides methods of inoculating an animal or inducing an immunogenic or protective response in an animal comprising at least one administration of a recombinant MDV vaccine of the present invention.

[0016] The present invention also provides methods of constructing recombinant herpes virus, comprising the steps of constructing infectious clones carrying a vector comprising replicons and screening tags for E. coli and eliminating the vector sequence.

[0017] Brief Description of the Figures

[0018] Figure 1 shows the schematic diagram of the construction of HVT15 of the present invention on the basis of an exemplary MDV strain, HVT FC-126, depicting the inserted fragments and the insertion sites.

[0019] Figure 2 shows the schematic diagram of the construction of HVT14 of the present invention on the basis of an exemplary MDV strain, HVT FC-126, depicting the inserted fragments and the insertion sites.

[0020] Figure 3 shows the schematic diagram of the construction of HVT22 of the present invention on the basis of an exemplary MDV strain, HVT FC-126, depicting the inserted fragments and the insertion sites.

[0021] Figure 4 shows the schematic diagram of the construction of HVT35 of the present invention on the basis of an exemplary MDV strain, HVT FC-126, depicting the inserted fragments and the insertion sites.

[0022] Figure 5 shows the schematic diagram of the construction of HVT38 of the present invention on the basis of an exemplary MDV strain, HVT FC-126, depicting the inserted fragments and the insertion sites.

[0023] Figure 6 shows the schematic diagram of the construction of HVT39 of the present invention on the basis of an exemplary MDV strain, HVT FC-126, depicting the inserted fragments and the insertion sites.

[0024] Figure 7 shows the schematic diagram of the construction of HVT310 of the present invention on the basis of an exemplary MDV strain, HVT FC-126, depicting the inserted fragments and the insertion sites.

[0025] Figure 8 is a detailed flow diagram of the construction process of the recombinant HVTs of the present invention: (a) the construction of HVT virus-infectious bacterial artificial chromosome; (b) the construction of a recombinant turkey herpesvirus circular genome; (c) the rescue of recombinant turkey herpesvirus.

[0026] Figure 9 shows the identification in vitro of HVT14. (a) after infection with HVT14, cultured CEF develops morphological changes and viral plaque formation, as observed under bright-field microscopy; (b) In the immunofluorescence assay, the fluorescence visualizing the IBDV VP2 antigen polypeptides co-localizes significantly with the plaque area as shown in Panel (a) ; (c) In the agarose gel electrophoresis, it is shown that the PCR using the primers HVT-site2-F / R obtains DNA fragments with expected size of the inserted cassette in HVT14 genome and positive control, and DNA fragments of a very small size in wildtype HVT genome and negative control suggesting that no insert present in the tested insertion site.

[0027] Figure 10 shows the identification in vitro of HVT15. (a) after infection with HVT15, cultured CEF develops morphological changes and viral plaque formation, as observed under bright-field microscopy; (b) In the immunofluorescence assay, the fluorescence visualizing the NDV F antigen polypeptides co-localizes significantly with the plaque area as shown in Panel (a) ; (c) In the agarose gel electrophoresis, it is shown that the PCR using the primers HVT-site1-F / R obtains DNA fragments with expected size of the inserted cassette in HVT15 genome and positive control, and DNA fragments of a very small size in wildtype HVT genome and negative control suggesting that no insert present in the tested insertion site.

[0028] Figure 11 shows the test of the titer of the anti-IBDV antibodies elicited in vivo by HVT14 in a column chart, wherein n=12. The antibodies are produced in 100%animals after 21 days post-immunization (dpi) (green inverted triangle-marked column) , and the titer even increased from about 6000 on average on 21dpi to about 12000 on average on 28dpi (orange diamond-marked column) .

[0029] Figure 12 shows the morphologic change of the bursa of Fabricius through necropsy in the HVT14 vaccination-challenge test against nVar IBDV. (a) bursae of Fabricius and spleens of the chickens in the blank control group; (b) bursae of Fabricius, all of which show atrophy, and spleens of the chickens in the challenge control group; (c) bursae of Fabricius and spleens of the chickens in the test group which get vaccinated with HVT14 in prior to the nVar IBDV challenge.

[0030] Figure 13 shows the morphologic change of the bursa of Fabricius through necropsy in the HVT14 vaccination-challenge test against vv IBDV. (a) bursae of Fabricius of the chickens in the blank control group; (b) bursae of Fabricius, all of which show obvious lesions, of the chickens in the challenge control group; (c) bursae of Fabricius of the chickens in the test group which get vaccinated with HVT14 in prior to the vv IBDV challenge. Photos were taken for part of subjects of the group for the purpose of exhibiting typical pathological change.

[0031] Figure 14 shows the morphologic change of the bursa of Fabricius through necropsy in the HVT14 vaccination-challenge test against cv IBDV. (a) bursae of Fabricius of the chickens in the blank control group; (b) bursae of Fabricius, all of which show obvious lesions, of the chickens in the challenge control group; (c) bursae of Fabricius of the chickens in the test group which get vaccinated with HVT14 in prior to the cv IBDV challenge. Photos were taken for part of subjects of the group for the purpose of exhibiting typical pathological change. The red arrow emphasizes an obvious lesion.

[0032] Figure 15 shows (a) the test of the titer of the anti-NDV antibodies elicited in vivo by HVT15 in a column chart, wherein n=12. The antibodies are produced in 11 animals of 12 (91.6%) after 21 days post-immunization (dpi) (orange diamond -marked column) , and in all 12 animals on 28 dpi (black dot-marked column) , with the titer also increasing from about 1800 on average to about 3200 on average. (b) the survival in the vaccination-challenge test against NDV.

[0033] Figure 16 shows the observations under microscopy to the cells of test groups and control groups in identification assays on HVT22. The photos of CEF cells infected with HVT22, taken 36 hours post-infection (hpi) , are listed in Column (A) , and the photos of CEF cells 36 hpi with wildtype HVT or not infected are listed in Column (B) and (C) , respectively. Photos in Row (a) are taken under bright-field microscopy showing cytopathies and plaques of the culture cells; the photos in Row (b) and (c) show the fluorescence visualizing the IBDV VP2 antigen polypeptides and the ILTV gD antigen polypeptides, respectively, in the immunofluorescence assay.

[0034] Figure 17 shows that (a) the PCR using the primers HVT-site2-F / R obtains DNA fragments with expected size of the inserted cassette in HVT22 genome and positive control (PC) , and DNA fragments of a very small size in wildtype HVT genome and negative control (NC) , as separated in an agarose gel electrophoresis suggesting that no insert present in the tested insertion site; and (b) in Western blotting of the total protein of the infected cells or control cells, anti-IBDV VP2 antibody and anti-ILTV gD antibody as the primary antibody bind to the corresponding significant bands with expected sizes on the membrane, suggesting that the IBDV VP2 antigen and the ILTV gD antigen are successfully expressed in the infected cells in a considerable amount.

[0035] Figure 18 shows (a) the test of the titer of the anti-IBDV antibodies elicited in vivo by HVT22 in a column chart, wherein n=12. The antibodies are produced in 100%animals after 21 days post-immunization (dpi) (blue inverted triangle-marked column) , and the titer even increased from about 6000 on average on 21dpi to above 12000 on average on 28dpi (black diamond-marked column) . (b) shows the morphologic change of the larynx and trachea through necropsy in the HVT22 vaccination-challenge test against ILTV. (ba) the larynx and trachea of the chickens in the blank control group; (bb) the larynx and trachea, all of which show obvious lesions, of the chickens in the challenge control group; (bc) the larynx and trachea of the chickens in the test group which get vaccinated with HVT22 in prior to the ILTV-WG strain challenge. The red arrows in (bb) and (bc) show a significant contrast between inflammatory tissue and normal tissue. Photos were taken for part of subjects of the group for the purpose of exhibiting typical pathological change.

[0036] Figure 19 shows the morphologic change of the bursa of Fabricius through necropsy in the HVT22 vaccination-challenge test against vv IBDV. (a) bursae of Fabricius of the chickens in the blank control group; (b) bursae of Fabricius, all of which show obvious lesions, of the chickens (if not dead yet) in the challenge control group; (c) bursae of Fabricius of the chickens in the test group which get vaccinated with HVT22 in prior to the vv IBDV challenge. Photos were taken for part of subjects of the group for the purpose of exhibiting typical pathological change.

[0037] Figure 20 shows the observations under microscopy to the cells of test groups and control groups in identification assays on HVT35. The photos of CEF cells infected with HVT35, taken 36 hours post-infection (hpi) , are listed in Column (A) , and the photos of CEF cells 36 hpi with wildtype HVT or not infected are listed in Column (B) and (C) , respectively. Photos in Row (a) are taken under bright-field microscopy showing cytopathies and irregular plaques of the culture cells; the photos in Row (b) (c) and (d) show the fluorescence visualizing the NDV F antigen polypeptides, IBDV VP2 antigen polypeptides and the ILTV gD antigen polypeptides, respectively, by the cognate antibodies, in the immunofluorescence assay.

[0038] Figure 21 shows that (a) in Western blotting of the total protein of the infected cells or control cells, the anti-NDV F antibody, the anti-IBDV VP2 antibody and the anti-ILTV gD antibody as the primary antibody bind to the corresponding significant bands with expected sizes on the membrane, suggesting that the anti-NDV F antigen, the IBDV VP2 antigen and the ILTV gD antigen are successfully expressed in the infected cells in a considerable amount; (b) the PCR using the primers HVT-site1-F / R obtains DNA fragments with expected size of the inserted cassette in HVT35 genome and positive control (PC) , and DNA fragments of a very small size in wildtype HVT genome and negative control (NC) , as separated in an agarose gel electrophoresis suggesting that no insert present in the tested insertion site; and (c) the PCR using the primers HVT-site2-F / R obtains DNA fragments with expected size of the inserted cassette in HVT35 genome and positive control (PC) , and DNA fragments of a very small size in wildtype HVT genome and negative control (NC) , as separated in an agarose gel electrophoresis suggesting that no insert present in the tested insertion site. Lanes of the samples from HVT35-infected cells are marked as “HVT35” .

[0039] Figure 22 shows a same Western blotting assay as in Figure 21 (a) , but the total protein of the infected cells is sampled from 5 generations: F4, F8, F12, F16 and F20. Bands of 3 antigens are evident in all the lanes for each generation of infected cells, suggesting the 3 heterologous antigens are efficiently co-expressed in infected CEF cells even after 20 passages.

[0040] Figure 23 shows same PCR reactions as in Figure 21 (b) and (c) , but the viral genomes of the infected cells is extracted from 5 generations: F4, F8, F12, F16 and F20. Amplification of the inserts at the expected insertion sites are evident in all the lanes for each generation of infected cells, suggesting the inserted expression cassettes are stably present and transcribed in the HVT genome and even after 20 passages.

[0041] Figure 24 shows that the replication of HVT35 and the parental wildtype HVT are investigated in CEF cells. HVT35 exhibits largely comparable replication to the parental strain in 24–72 hpi, although some minor gaps in the overall titer were observed. The growth curves of quantitation of the virus (Y-axis: Log PFU / mL) by time of hours (X-axis: hours post-infection) is drawn based on the determined PFU results of the virus collected at each time point, wherein the curves of hollow dots (gray color) correspond to the parental HVT and the curves of solid dots (orange color) correspond to HVT35.

[0042] Figure 25 shows (a) the test of the titer of the anti-NDV F antibodies elicited in vivo by HVT35 in a column chart, wherein n=12. The antibodies are produced in 8 animals of 12 (66.7%) after 21 days post-immunization (dpi) (orange diamond -marked column) , and in all 12 animals on 28 dpi (black dot-marked column) , with the titer also increasing from about 1500 on average to above 4000 on average; (b) the survival in the vaccination-challenge test against NDV; (c) the test of the titer of the anti-IBDV VP2 antibodies elicited in vivo by HVT35 in a column chart, wherein n=12. The antibodies are produced in 100%animals after 21 days post-immunization (dpi) (black dot-marked column) , and the titer even increased from above 4000 on average on 21dpi to above 6000 on average on 28dpi (green dot-marked column) .

[0043] Figure 26 shows the morphologic change of the bursa of Fabricius through necropsy in the HVT35 vaccination-challenge test against vv IBDV. (a) bursae of Fabricius of the chickens in the blank control group; (b) bursae of Fabricius, all of which show obvious lesions, of the chickens in the challenge control group; (c) bursae of Fabricius of the chickens in the test group which get vaccinated with HVT35 in prior to the vv IBDV challenge. Photos were taken for part of subjects of the group for the purpose of exhibiting typical pathological change.

[0044] Figure 27 shows the morphologic change of the bursa of Fabricius through necropsy in the HVT35 vaccination-challenge test against nVar IBDV. (a) bursae of Fabricius and spleens of the chickens in the blank control group; (b) bursae of Fabricius, all of which show atrophy, and spleens of the chickens in the challenge control group; (c) bursae of Fabricius and spleens of the chickens in the test group which get vaccinated with HVT35 in prior to the nVar IBDV challenge.

[0045] Figure 28 shows the morphologic change of the bursa of Fabricius through necropsy in the HVT35 vaccination-challenge test against cv IBDV. (a) bursae of Fabricius of the chickens in the blank control group; (b) bursae of Fabricius, all of which show obvious lesions, of the chickens in the challenge control group; (c) bursae of Fabricius of the chickens in the test group which get vaccinated with HVT35 in prior to the cv IBDV challenge. The red arrow emphasizes an obvious lesion. Photos were taken for part of subjects of the group for the purpose of exhibiting typical pathological change.

[0046] Figure 29 shows the morphologic change of the larynx and trachea through necropsy in the HVT35 vaccination-challenge test against ILTV. (a) the larynx and trachea of the chickens in the blank control group; (b) the larynx and trachea, all of which show obvious lesions, of the chickens in the challenge control group; (c) the larynx and trachea of the chickens in the test group which get vaccinated with HVT35 in prior to the ILTV-WG strain challenge. The red arrow emphasizes an obvious lesion. Photos were taken for part of subjects of the group for the purpose of exhibiting typical pathological change.

[0047] Figure 30 shows that HVT38 infection causes cytopathies in cultured CEF cells and produces heterologous NDV F antigen polypeptides, IBDV VP2 antigen polypeptides and the ILTV gD antigen polypeptides therein. In the photos taken under bright-field microscopy, irregular plaques are observed. In immunofluorescence assays, the fluorescence visualizes the three heterologous antigens, respectively, by the cognate antibodies, and co-localizes with the plaque areas, wherein, (a) displays NDV F antigen, (b) displays IBDV VP2 antigen, and (c) displays ILTV gD antigen.

[0048] Figure 31 shows that HVT39 infection causes cytopathies in cultured CEF cells and produces heterologous NDV F antigen polypeptides, IBDV VP2 antigen polypeptides and the ILTV gD antigen polypeptides therein. In the photos taken under bright-field microscopy, irregular plaques are observed. In immunofluorescence assays, the fluorescence visualizes the three heterologous antigens, respectively, by the cognate antibodies, and co-localizes with the plaque areas, wherein, (a) displays NDV F antigen, (b) displays IBDV VP2 antigen, and (c) displays ILTV gD antigen.

[0049] Figure 32 shows that HVT310 infection causes cytopathies in cultured CEF cells and produces heterologous NDV F antigen polypeptides, IBDV VP2 antigen polypeptides and the ILTV gD antigen polypeptides therein. In the photos taken under bright-field microscopy, irregular plaques are observed. In immunofluorescence assays, the fluorescence visualizes the three heterologous antigens, respectively, by the cognate antibodies, and co-localizes with the plaque areas, wherein, (a) displays NDV F antigen, (b) displays IBDV VP2 antigen, and (c) displays ILTV gD antigen.

[0050] Figure 33 shows the PCR using (a) the primers HVT-site1-F / R and (b) the primers HVT-site2-F / R obtains DNA fragments with expected size of the inserted cassettes in HVT35 genome and positive control (PC) , and DNA fragments of a very small size in wildtype HVT genome and negative control (NC) , as separated in an agarose gel electrophoresis suggesting that no insert present in the tested insertion site. Lanes of the samples from HVT38-infected cells, HVT39-infected cells and HVT310-infected cells are marked as “HVT38” , “HVT39” and “HVT310” , respectively.

[0051] Figure 34 shows that the replication of HVT38, HVT39, HVT310, and the parental wildtype HVT are investigated in CEF cells, wherein the curves of hollow dots (black color) correspond to the parental HVT and the curves of small dots (red color) , inverted triangle (red color) , and diamond (blue color) correspond to HVT38, HVT39 and HVT310, respectively.

[0052] Figure 35 shows (a) the test of the titer of the anti-IBDV VP2 antibodies elicited in vivo by HVT38 in a column chart, wherein n=12. The antibodies are produced in 100%animals after 28 days post-immunization (black dot-marked column) with the titer of about 9000 on average; (b) the test of the titer of the anti-NDV F antibodies elicited in vivo by HVT38 in a column chart, wherein n=12. The antibodies are produced in 11 animals of 12 (91.7%) after 28 days post-immunization (black dot -marked column) , with the titer of about 3500 on average.

[0053] Figure 36 shows the survival in the HVT38-vaccination-challenge test against NDV.

[0054] Figure 37 shows bursae of Fabricius of the chickens in the blank control group in the HVT38 vaccination-challenge test.

[0055] Figure 38 shows bursae of Fabricius, all showing obvious lesions, of the chickens in the vv IBDV-challenge control group in the HVT38 vaccination-challenge test.

[0056] Figure 39 shows bursae of Fabricius, all showing obvious lesions, of the chickens in the cv IBDV-challenge control group.

[0057] Figure 40 shows the morphologic change of the bursae of Fabricius through necropsy in the HVT38 vaccination-challenge test against vv IBDV. All photos are taken for the chickens in the test group which get vaccinated with HVT38 in prior to the vv IBDV challenge.

[0058] Figure 41 shows the morphologic change of the bursae of Fabricius through necropsy in the HVT38 vaccination-challenge test against cv IBDV. All photos are taken for the chickens in the test group which get vaccinated with HVT38 in prior to the cv IBDV challenge. The red arrow emphasizes an obvious lesion.

[0059] Figure 42 shows the morphologic change of the larynx and trachea through necropsy in the HVT38 vaccination-challenge test against ILTV. (a) the larynx and trachea of the chickens in the blank control group; (b) the larynx and trachea, all of which show obvious lesions, of the chickens in the challenge control group; (c) the larynx and trachea of the chickens in the test group which get vaccinated with HVT38 in prior to the ILTV-WG strain challenge. The red arrow emphasizes a bleeding point. Photos were taken for part of subjects of the group for the purpose of exhibiting typical pathological change.

[0060] Figure 43 is a histogram showing the relative expression level of the antigens expressed by HVT38, HVT39 and HVT310, as compared with those expressed by HVT35, acquired by quantitative RT-PCR. The ratio of a target cDNA was calculated versus the corresponding cDNA from HVT35 as the reference.

[0061] Figure 44 shows same PCR reactions as in Figure 33 (a) and (b) , but the HVT38 viral genomes of the infected cells is extracted from 5 generations: F4, F8, F12, F16 and F20. Amplification of the inserts at the expected insertion sites are evident in all the lanes for each generation of infected cells, suggesting the inserted expression cassettes are stably present and transcribed in the HVT genome and even after 20 passages.

[0062] Figure 45 shows same Western blotting assay as shown in Figure 21 (a) , but uses total protein extracted from infected cells of the F10 generation of HVT35WT, and the F4, F8, F12, and F18 generations of HVT38 and HVT39. Bands of 3 antigens are evident in all the lanes for each generation of infected cells, suggesting the 3 heterologous antigens are efficiently co-expressed in infected CEF cells even after 18 passages.

[0063] Figure 46 shows the schematic diagram of the construction of HVT35WT of the present invention on the basis of an exemplary MDV strain, HVT FC-126, depicting the inserted fragments and the insertion sites.

[0064] Figure 47 shows the observations under microscopy to the cells of test groups and control groups in identification assays on HVT35WT. The photos of CEF cells infected with F2 and F3 generation HVT35WT, taken 36 hours post-infection (hpi) , are listed in Column (A) and Column (B) , and the photos of CEF cells 36 hpi with wildtype HVT or not infected are listed in Column (C) and (D) , respectively. Photos in Row (a) are taken under bright-field microscopy showing cytopathies and irregular plaques of the culture cells; the photos in Row (b) show the fluorescence visualizing the NDV F antigen polypeptides, IBDV VP2 antigen polypeptides and the ILTV gD antigen polypeptides, by the cognate antibodies, in the immunofluorescence assay.

[0065] Figure 48 shows PCR analyses of the insertion sites in the viral genome extracted from HVT35WT-infected cells at five generation (F4, F6, F10, F16, and F20) . Using primers HVT-F / R, HVT-site1-F / R, and HVT-site2-F / R, DNA fragments of the expected size for the inserted cassette were amplified from the HVT35WT genome and the positive control (PC) , but not from the wild-type HVT genome or the negative control (NC) . These results indicate that the inserted expression cassettes remain stably present in the HVT genome even after 20 passages.

[0066] Figure 49 shows the immunofluorescence of the NDV F, IBDV VP2 and ILTV gD antigens and the corresponding bright-field microscopy images of cytopathies in the cells infected with the F4, F6, F10, F16 and F20 generations of HVT35WT.

[0067] Figure 50 shows the Western blot results of the NDV F, IBDV VP2, and ILTV gD antigens, as well as the internal reference GAPDH, from the total protein extracted from cells infected with the F5, F10, and F15 generations of HVT35WT.

[0068] Figure 51 shows the PCR analyses of the insertion sites using primers HVT-F / R, HVT-site1-F / R, and HVT-site2-F / R in the HVT35WT after 5 in vivo passages.

[0069] Figure 52 shows the detection of the NDV F, IBDV VP2, and ILTV gD antigens by immunofluorescence assay and the corresponding cytopathies and plaque formation observed under bright-field microscopy in cultured CEF cells infected with HVT35WT after 5 in vivo passages. The images were taken at 36 hours post-infection (hpi) .

[0070] Figure 53 shows the replication of HVT35WT, HVT35, and the parental wildtype HVT in CEF cells. The viral titer of HVT35WT was slightly lower than that of the wildtype HVT but higher than that of HVT35 within 36 to 72 hours post-infection (hpi) . The growth curves, depicting virus quantification (Y-axis: Log PFU / mL) over time (X-axis: hours post-infection) , were plotted based on the plaque-forming unit (PFU) results determined from virus collected at each time point. The curves with black triangles correspond to the parental HVT, the curves with solid blue dots correspond to HVT35, and the curves with red inverted triangles correspond to HVT35WT.

[0071] Figure 54 shows (a) Serological analysis of anti-NDV antibody titers elicited in vivo by HVT35WT and HVT35. Column chart displays the antibody titers measured at 21-and 28-days post‐immunization (dpi) , with n=13 animals per group. At a vaccination dose of 5000 PFU, the seropositivity rate in the HVT35WT‐immunized group was 9 / 13 (69.2%) at 21 dpi, compared with only 8 / 13 (61.5%) in the HVT35‐immunized group. By 28 dpi, the seropositivity rate in the HVT35WT group further increased to 11 / 13 (84.6%) , with a mean antibody titer reaching 5600, whereas the HVT35 group achieved only 9 / 13 (69.2%) seropositivity and a mean titer of 2800. At a vaccination dose of 3000 PFU, the seropositivity rate in the HVT35WT group was 8 / 13 (61.5%) at 21 dpi, while the HVT35 group showed a lower rate of 5 / 13 (38.5%) . By 28 dpi, the HVT35WT group again reached 11 / 13 (84.6%) seropositivity with a mean titer of 4600, whereas the HVT35 group attained 9 / 13 (69.2%) seropositivity and a mean titer of 3500. (b) Serological analysis of anti‐IBDV antibody titers elicited in vivo by HVT35WT and HVT35. Column chart displays the antibody titers measured at 21-and 28-days post‐immunization (dpi) , with n=13 animals per group. At a vaccination dose of 5000 PFU, both the HVT35WT and HVT35 groups achieved 100%seropositivity (13 / 13) as early as 21 dpi. By 28 dpi, the mean antibody titer in the HVT35WT group rose to 9400, while the HVT35 group reached a mean titer of 7400. At a vaccination dose of 3000 PFU, the seropositivity rate was 12 / 13 (92.3%) for both groups at 21 dpi, and reached 100% (13 / 13) in both groups by 28 dpi. However, the mean antibody titer in the HVT35WT group (7100) was slightly higher than that in the HVT35 group (6700) .

[0072] Figure 55 shows the survival in the vaccination-challenge test against NDV.

[0073] Figure 56 shows the morphologic change of the bursa of Fabricius through necropsy in the HVT35WT vaccination-challenge test against vv IBDV. (a) bursae of Fabricius of the chickens in the blank control group; (b) bursae of Fabricius, all of which show obvious lesions, of the chickens in the challenge control group; (c) bursae of Fabricius of the chickens in the test group which get vaccinated with HVT35WT in prior to the vv IBDV challenge. Photos were taken for part of subjects of the group for the purpose of exhibiting typical pathological change.

[0074] Figure 57 shows the morphologic change of the bursa of Fabricius through necropsy in the HVT35WT vaccination-challenge test against cv IBDV. (a) bursae of Fabricius of the chickens in the blank control group; (b) bursae of Fabricius, all of which show obvious lesions, of the chickens in the challenge control group; (c) bursae of Fabricius of the chickens in the test group which get vaccinated with HVT35WT in prior to the cv IBDV challenge. The red arrow emphasizes an obvious lesion. Photos were taken for part of subjects of the group for the purpose of exhibiting typical pathological change.Detailed Description of the Invention

[0075] While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth and as follows in the scope of the appended claims. This invention includes all modifications and equivalents of the subject matter recited in the aspects or claims presented herein to the maximum extent permitted by applicable law.

[0076] Definitions and Abbreviations

[0077] It is noted that in this disclosure and particularly in the claims, terms such as "comprises" , "comprised" , "comprising" and the like can mean, e.g., "includes" , "included" , "including" , and the like; and that terms such as "consisting essentially of" and "consists essentially of" have the meaning that, e.g., they allow for elements not explicitly recited, but exclude elements that affect a basic or novel characteristic of the invention or change to any extent the function of the invention.

[0078] The singular terms "a, " "an, " and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicate otherwise. The word "or" means any one member of a particular list and also includes any combination of members of that list.

[0079] The term "animal" is used herein to include all mammals, birds and fish. The animal as used herein may be selected from the group consisting of equine (e.g., horse) , canine (e.g., dogs, wolves, foxes, coyotes, jackals) , feline (e.g., lions, tigers, domestic cats, wild cats, other big cats, and other felines including cheetahs and lynx) , bovine (e.g., cattle) , swine (e.g., pig) , ovine (e.g., sheep, goats, lamas, bisons) , avian (e.g., chicken, duck, goose, turkey, quail, pheasant, parrot, finches, hawk, crow, ostrich, emu and cassowary) , primate (e.g., prosimian, tarsier, monkey, gibbon, ape) , humans, and fish. The term "animal" also includes an individual animal in all stages of development, including embryonic and fetal stages.

[0080] In preferred embodiments of the present invention, “animal” means avian animals. The avian species may be poultry, preferably the avian species is chicken, duck, goose, turkey, quail, guinea or pigeon, more preferably the avian species is turkey or chicken, even more preferably chicken.

[0081] The term "about" as used herein, means approximately, in the region of, roughly, or around. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term "about" is used herein to modify a numerical value above and below the stated value by a variance of 10%. In one aspect, the term "about" means plus or minus 20%of the numerical value of the number with which it is being used. Therefore, about 50%means in the range of 45%-55%. Numerical ranges recited herein by endpoints include all numbers and fractions subsumed within that range (e.g. 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.90, 4, and 5) . It is also to be understood that all numbers and fractions thereof are presumed to be modified by the term "about. "

[0082] The terms "polypeptide" and "protein" are used interchangeably herein to refer to a polymer of consecutive amino acid residues.

[0083] The term "nucleic acid" , "nucleotide" , and "polynucleotide" are used interchangeably and refer to RNA, DNA, cDNA, or cRNA and derivatives thereof, such as those containing modified backbones. It should be appreciated that the invention provides polynucleotides comprising sequences complementary to those described herein. The "polynucleotide" contemplated in the present invention includes both the forward strand (5' to 3') and reverse complementary strand. Polynucleotides according to the invention can be prepared in different ways (e.g. by chemical synthesis, by gene cloning etc. ) and can take various forms (e.g. linear or branched, single or double stranded, or a hybrid thereof, primers, probes etc. ) .

[0084] The term "genomic DNA" or "genome" is used interchangeably and refers to the heritable genetic information of a host organism. The genomic DNA comprises the DNA of the nucleus (also referred to as chromosomal DNA) but also the DNA of the plastids (e.g., chloroplasts) and other cellular organelles (e.g., mitochondria) . The genomic DNA or genome contemplated in the present invention also refers to the RNA of a virus. The RNA may be a positive strand or a negative strand RNA. The term "genomic DNA" contemplated in the present invention includes the genomic DNA containing sequences complementary to those described herein. The term "genomic DNA" also refers to messenger RNA (mRNA) , complementary DNA (cDNA) , and complementary RNA (cRNA) .

[0085] Herpesviridae family members have a linear 120 to 230 kb double-stranded DNA genome, organized in a very similar overall manner structurally. The genome comprises long and short unique regions, and each unique region is bounded by identical inverted repeats. The UL region and the US region contain 50-70 viral genes and about 10 viral genes, respectively, which share high identity among the different herpesvirus species.

[0086] Marek's disease virus (MDV) refers to any alpha herpesvirus of the genus Marekovirus of the Herpesviridae family, and MDVs share a similar size and overall organization of their genomes with other Herpesviridae families, as well as a high degree of genomic similarity among their internal members. Thus, the construction of recombinant HVT (MDV3) validated in embodiments of the present invention can be transposed to any MDV1 and MDV2 member, preferably non-pathogenic strains and / or weakly pathogenic strains. Such diversion is feasible.

[0087] The term “turkey herpesvirus (HVT) ” is defined as a non-pathogenic virus of domesticated turkeys and is categorized as serotype 3 (MDV3) in the Marek's disease virus group of antigenically and genetically related lymphocytic avian herpesviruses.

[0088] As used herein, “Marek's disease virus” or “MDV” refers to any alpha herpesvirus of the genus Marekovirus, which encompasses turkey herpesviruses (HVT) as described herein. In specific embodiments, the present invention relates to Marek's disease viruses, their genomic components, genes and proteins produced therefrom. As used herein, such viruses may comprise genomic components of the virus, i.e., the genome and transcripts thereof, infectious clones, proteins (including structural and non-structural proteins) encoded by the genome, and functional or non-functional virus particles. The genomes of such viruses, the structural genes, and the polynucleotide and polypeptide sequences encoding such viruses are well known in the art and are readily discoverable by those skilled in the art.

[0089] Exemplary members of Marek's disease viruses suitable for use in the present invention include MDV type 1 strain CVI-988, CVTR, SC9-1, and 814, MDV type 2 (avian herpesvirus type 3) strain SB-1, MDV type 3 (HVT) strain FC-126, and the like, and prevalent strains and their attenuated strains by passaging, mutagenesis, and / or genetic engineering.

[0090] The term "recombinant" in relation to an MDV refers to an MDV whose genome has been modified by insertion of at least one heterologous and / or exogenous polynucleotide. It will be understood that the recombinant MDV can be manufactured by a variety of methods, and once made, can be reproduced without use of further recombinant DNA technology. The structure of the "recombinant MDV" is therefore described in terms of DNA insertion.

[0091] The terms "recombinant" and "genetically modified" are used interchangeably and refer to any modification, alteration or engineering of a polynucleotide or protein in its native form or structure, or any modification, alteration or engineering of a polynucleotide or protein in its native environment or surrounding. The modification, alteration or engineering of a polynucleotide or protein may include, but is not limited to, deletion of one or more nucleotides or amino acids, deletion of an entire gene, codon-optimization of a gene, conservative substitution of amino acids, insertion of one or more heterologous polynucleotides.

[0092] The term "gene" is used broadly to refer to any segment of polynucleotide associated with a biological function. Thus, genes or polynucleotides include introns and exons as in genomic sequence, or just the coding sequences as in cDNAs, such as an open reading frame (ORF) , starting from the start codon (usually methionine codon) and ending with a termination signal (stop codon) . Genes and polynucleotides can also include regions that regulate their expression, such as transcription initiation, translation and transcription termination. Thus, also included are promoters and ribosome binding regions (in general these regulatory elements lie approximately between 60 and 250 nucleotides upstream of the start codon of the coding sequence or gene; Doree S M et al; Pandher K et al; Chung J Y et al) , transcription terminators (in general the terminator is located within approximately 50 nucleotides downstream of the stop codon of the coding sequence or gene; Ward C K et al) . Gene or polynucleotide also refers to a nucleic acid fragment that expresses mRNA or functional RNA, or encodes a specific protein, and which includes regulatory sequences.

[0093] The term "heterologous" as used herein refers to the characteristic that the polynucleotide (such as, DNA) or protein (such as, polypeptide) being derived from a different organism, such as a different cell type or a different species than the recipient.

[0094] The term "heterologous polynucleotide" as used herein refers to a polynucleotide derived from a different organism or a different species from the recipient, preferably coding for a heterologous protein. In the context of the recombinant MDV the skilled person would understand that it refers to a DNA or cDNA. A heterologous polynucleotide may also be referred to as transgene. Thus, it may be a gene or open reading frame (ORF) coding for a heterologous protein. In the context of the recombinant MDV "heterologous polynucleotide" refers to a polynucleotide derived from a different avian pathogen or virus (different species and / or strain) , particularly a different avian virus, including a different virus of the family Herpesviridae that causes avian infection and a different strain of MDV1, 2, or 3. The term "heterologous" when used with reference to portions of a nucleic acid indicates that the nucleic acid comprises two or more sequences that are not found in the same relationship to each other in nature. Heterologous may also refer to a viral polynucleotide sequence, such as a gene or transgene, or a portion thereof, being inserted into a (particular position of) viral genome in which it is not typically found, or a gene introduced into an organism in which it is not typically found.

[0095] The term "bacterial artificial chromosome" abbreviated as BAC as used herein refers to a DNA construct based on functional fertility plasmid, comprising an insert of about 150 to 350 kb used for transforming and cloning in bacteria such as Escherichia coli. BAC vectors can harbor large DNA sequences, such as DNA virus genomes or DNA sequences coding for RNA virus genomes. This allows for efficient modification of viral genomes using well-established techniques in E. coli.

[0096] The term “expression cassette” is a segment of a nucleic acid molecule, e.g., a double-stranded DNA molecule, which comprises or consists of some or all elements required for the expression of a polynucleotide of interest in a host cell and may be used as part of a longer nucleic acid molecule or vector, typically an expression vector, such as a plasmid or a viral vector. It may also be integrated in a chromosome by random or targeted integration, such as by homologous recombination or by viral integration. To facilitate the convenient construction, manipulation, and insertion of an expression cassette into an MDV for the invention, the cassette can itself be comprised in a DNA molecule, such as a vehicle allowing cloning or transfection, e.g. such as a plasmid, a Cosmid, a Bacmid, etc.. A plasmid comprising an expression cassette is commonly referred to as a ‘transfervector’ , ‘shuttle vector’ , or ‘donor plasmid’ . In this situation the plasmid comprises an expression cassette with flanking sequence regions (e.g., homology arm) from the target insertion locus of the vector’s genome, to direct the insertion. Typically, a transfervector that is used in transfection is not itself integrated into the genome of the vector, it only facilitates the integration of the expression cassette it carries, e.g. by allowing the insertion to occur by homologous recombination.

[0097] In the context of the present invention, the expression cassette is responsible for directing cellular expression and preparation of the target RNA / protein (usually exogenous and / or heterologous) . Expression cassettes can contain one or more of the following elements: one or more promoter sequences, one or more open reading frames (of the transgene) , polyadenylation (polyA) signaling motifs, and the like. An open reading frame (ORF) is a reading frame that contains the coding sequence of the target protein from the start codon to the stop codon. The regulatory element / regulatory sequence of the expression cassette may be operably linked to the polynucleotide sequence encoding the target protein.

[0098] An expression cassette is prepared using cloning techniques and does therefore not refer to a natural occurring gene structure. Unless otherwise indicated, in the context of the present invention, the nucleic acid sequence of the “expression cassette” as a whole located at a particular insertion site was not originally present at the corresponding position in the natural MDV genome, but were artificially introduced (e.g., known as “exogenous” ) for the purposes of the present invention. The sequences of the expression cassettes of the present invention may be heterologous or partly homologous (to MDV) .

[0099] The expression cassette of the present invention may be a multicistronic expression cassette. A multicistronic construct comprising the multicistronic expression cassette is capable of simultaneously expressing two or more different proteins, which are encoded by the same multicistronic nucleic acid, driven by the same promoter, but not fused. Such coding sequences in di-, or even multicistronic nucleic acids may be separated by at least one internal ribosome entry site (IRES) sequence, e.g. as defined herein or by at least one coding sequence of self-cleavage peptides. which induce the cleavage of the resulting polypeptide which comprises several proteins or peptides. In some embodiments, such a multicistronic expression cassette may comprises one or more internal ribosome entry sites (IRES) to allow for translation of another protein starting therefrom at the internal region of the mRNA. In other embodiments, such a multicistronic expression cassette may comprises one, or more coding sequences of 2A peptides in tandem as the linker sequence.

[0100] The term “2A peptide” or “peptide 2A” is a self-cleaving peptide with a typical length of 18 to 22 amino acids, resulting in the production of two or more proteins from one same mRNA at equimolar levels usually. The “self-cleaving” mediated by 2A peptides is commonly seen in all eukaryotic cells. Examples of commonly used 2A peptides comprise Thosea asigna virus 2A (T2A) ; porcine teschovirus-1 2A (P2A) ; equine rhinitis A virus (ERAV) 2A (E2A) and FMDV 2A (F2A) .

[0101] The term “operably linked” , "operatively linked" or “functionally linked” has a same meaning, meaning that the specified components are linked or adjacent to each other and in a relationship that allows them to function in the intended manner. Such a term is usually used to describe the connection between regulatory elements and a gene or its coding region. Typically, gene expression is placed under the control of one or more regulatory elements, for example, without limitation, constitutive or inducible promoters, polyadenylation (polyA) signal motif, and the like. A gene or coding region is said to be "operably linked to" or "operatively linked to" or "operably associated with" or “functionally linked to” the regulatory elements, meaning that the gene or coding region is controlled or influenced by the regulatory element. For instance, a promoter is operably linked to a coding sequence if the promoter initiates / effects transcription or expression of the coding sequence.

[0102] In the context of the present invention, unless otherwise noted, two sequences that are “operably linked” do not necessarily imply that they are physically linked directly or even close to each other physically. However, there must be a functional connection between the two sequences that are “operably linked” , e.g., a promoter effecting the transcription or expression of the coding sequence, whereby no significant other sequences are present between them that would intervene said functional connection.

[0103] As used herein, the term "antigen" or "immunogen" means a substance that induces a specific immune response in a host animal. The antigen may comprise a whole organism, killed, attenuated or live; a subunit or portion of an organism; a recombinant vector containing an insert with immunogenic properties; a piece or fragment of DNA capable of inducing an immune response upon presentation to a host animal; a polypeptide, an epitope, a hapten, or any combination thereof. Alternately, the immunogen or antigen may comprise a toxin or antitoxin.

[0104] The term "immunogenic protein or peptide" as used herein includes polypeptides that are immunologically active in the sense that once administered to the host, it is able to evoke an immune response of the humoral and / or cellular type directed against the protein. Preferably the protein fragment is such that it has substantially the same immunological activity as the total protein. Thus, a protein fragment according to the invention comprises or consists essentially of or consists of at least one epitope or antigenic determinant. An "immunogenic" protein or polypeptide, as used herein, includes the full-length sequence of the protein, analogs thereof, or immunogenic fragments thereof.

[0105] By "immunogenic fragment" is meant a fragment of a protein which includes one or more epitopes and thus elicits the immunological response described above. Such fragments can be identified using any number of epitope mapping techniques, well known in the art. For example, linear epitopes may be determined by e.g., concurrently synthesizing large numbers of peptides on solid supports, the peptides corresponding to portions of the protein molecule, and reacting the peptides with antibodies while the peptides are still attached to the supports. Similarly, conformational epitopes are readily identified by determining spatial conformation of amino acids such as by, e.g., x-ray crystallography and 2-dimensional nuclear magnetic resonance.

[0106] The term "immunogenic protein or peptide" further contemplates deletions, additions and substitutions to the sequence, so long as the polypeptide functions to produce an immunological response as defined herein. The term "conservative variation" denotes the replacement of an amino acid residue by another biologically similar residue, or the replacement of a nucleotide in a nucleic acid sequence such that the encoded amino acid residue does not change or is another biologically similar residue. In this regard, particularly preferred substitutions will generally be conservative in nature, i.e., those substitutions that take place within a family of amino acids. For example, amino acids are generally divided into four families: (1) acidic-aspartate and glutamate; (2) basic-lysine, arginine, histidine; (3) non-polar-alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar-glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids. Examples of conservative variations include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another hydrophobic residue, or the substitution of one polar residue for another polar residue, such as the substitution of arginine for lysine, glutamic acid for aspartic acid, or glutamine for asparagine, and the like; or a similar conservative replacement of an amino acid with a structurally related amino acid that will not have a major effect on the biological activity. Proteins having substantially the same amino acid sequence as the reference molecule but possessing minor amino acid substitutions that do not substantially affect the immunogenicity of the protein are, therefore, within the definition of the reference polypeptide. All of the polypeptides produced by these modifications are included herein. The term "conservative variation" also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid provided that antibodies raised to the substituted polypeptide also immunoreact with the unsubstituted polypeptide.

[0107] The term "epitope" refers to the site on an antigen or hapten to which specific B cells and / or T cells respond. The term is also used interchangeably with "antigenic determinant" or "antigenic determinant site" . Antibodies that recognize the same epitope can be identified in a simple immunoassay showing the ability of one antibody to block the binding of another antibody to a target antigen.

[0108] An "immunological response" to a composition or vaccine is the development in the host of a cellular and / or antibody-mediated immune response to a composition or vaccine of interest. Usually, an "immunological response" includes but is not limited to one or more of the following effects: the production of antibodies, B cells, helper T cells, and / or cytotoxic T cells, directed specifically to an antigen or antigens included in the composition or vaccine of interest. Preferably, the host will display either a therapeutic or protective immunological response such that resistance to new infection will be enhanced and / or the clinical severity of the disease reduced. Such protection will be demonstrated by either a reduction or lack of symptoms normally displayed by an infected host, a quicker recovery time and / or a lowered viral titer in the infected host.

[0109] The terms "multivalent vaccine or composition" , and "multivalent vaccine or composition" are used interchangeably to refer to a composition or vaccine containing or bringing in more than one antigens / immunogens. The multivalent vaccine or composition may contain or bring in two, three, four or more antigens / immunogens components. Therefore, preferably, the multivalent vaccine or composition may induce / elicit immunological protection against more than one pathogens / diseases simultaneously.

[0110] In some embodiments of the invention, provided are recombinant Marek’s Disease Virus (MDV) comprising at least one or more heterologous polynucleotides encoding at least one (e.g., one) antigen of an avian pathogen. In some particular embodiments, said MDV is any alpha herpesvirus of the genus Marekovirus. In some particular embodiments, said MDV is selected from the group consisting of the following serotypes: MDV-1, MDV-2 (also known as GaHV-3) , MDV-3 (also known as Herpesvirus of turkey, HVT) , and any combination thereof. In some preferable embodiments, said MDV is HVT. The HVT strains used for the recombinant virus may be any HVT strains, including, but not limited to, the HVT strain FC-126 (Igarashi T. et al., J. Gen. Virol. 70, 1789-1804, 1989) .

[0111] Successful expression of the heterologous polynucleotides by the recombinant / modified infectious virus requires two conditions. First, the heterologous polynucleotides must be inserted or introduced into a region of the genome of the virus in order that the modified virus remains viable. The second condition for expression of inserted heterologous polynucleotides is the presence of a regulatory sequences allowing expression of the gene in the viral background (for instance: promoter, donor and acceptor splicing sites, polyadenylation signal motifs, untranslated sequence elements, and the like) .

[0112] In one aspect, the present invention provides a novel insertion site very suitable for the effective expression of exogenous genes in the genome of MDV: the non-coding interval (intergenic) region between UL26 / UL26.5 gene locus and UL27 gene locus, in the Unique Long (UL) region. Such a novel insertion site confers efficient expression of the exogenous gene without affecting the expression of the viral structural gene. Moreover, in some embodiments, the exogenous gene, when inserted at such a novel insertion site, can be operably linked to and driven by the endogenous promoter, e.g., the endogenous UL26 gene promoter and the endogenous UL26.5 gene promoter, and thus the inserts may not comprise any promoter sequence. In the context of the present invention, references to the "novel insertion site" or the "first insertion site" are, unless otherwise specified, references to such an insertion site located in the intergenic region of the genome of the MDV between UL26 / UL26.5 gene locus and UL27 gene locus.

[0113] Accordingly, in some embodiments, the present invention provides recombinant Marek's disease virus (MDV) comprising at least one or more heterologous polynucleotides encoding at least one (e.g., one) antigen of an avian pathogen, and at least one of said heterologous polynucleotides is inserted at the following insertion site in the genome of said MDV: the intergenic region between UL26 and UL27 genes, e.g., preferably, between the stop codon of UL26 gene and the stop codon of UL27 gene. In a particular embodiment, provided is the use of the novel insertion site in the construction of a recombinant MDV, wherein said novel insertion site is in the intergenic region between UL26 / UL26.5 gene locus and UL27 gene locus. In some more specific embodiments, the insertion site is in the intergenic region associated with the UL26 / UL26.5 gene. In some more specific embodiments, the insertion site is in the 3’ untranslated sequence associated with the UL26 / UL26.5 gene.

[0114] In some embodiments, the present invention provides recombinant Marek's disease virus (MDV) comprising at least one or more heterologous polynucleotides encoding at least one (e.g., one) antigen of an avian pathogen, and at least one of said heterologous polynucleotides is inserted at the following insertion site in the genome of said MDV: the intergenic region between UL26 and UL27 genes, e.g., preferably, between the stop codon of UL26 gene and the stop codon of UL27 gene, and the heterologous polynucleotide inserted thereinto is placed under the control of an endogenous promoter. Generally in embodiments herein, reference to an “endogenous” promoter in the context of a recombinant virus refers to a promoter that is naturally present in the virus genome, e.g. the MDV genome, e.g. the HVT genome, e.g. the FC-126 HVT genome. In some embodiments, the endogenous promoter is at its endogenous or naturally occurring position in the virus genome. In some embodiments, the “endogenous” promoter is not inserted into the recombinant virus with the inserted heterologous polynucleotide (s) and expression cassette (s) . In some embodiments, the endogenous promoter is copied or moved to a position that is different from, preferably however, close to (e.g., very close to) , neighboring, and / or adjacent to, its endogenous or naturally occurring position in the virus genome. In some embodiments, the “endogenous” promoter is copied or moved to a position that is different from, preferably however, close to (e.g., very close to) , neighboring, and / or adjacent to, its endogenous or naturally occurring position in the virus genome via being inserted into an expression cassette, which preferably comprise inserted heterologous polynucleotide (s) . In some embodiments, the heterologous polynucleotide inserted thereinto is placed under the control of the endogenous UL26 promoter of MDV, and / or under the control of the endogenous UL26.5 promoter of MDV, and / or under the control of the endogenous UL27 promoter of MDV. In some embodiments, the heterologous polynucleotide inserted thereinto is placed under the control of the endogenous UL26 promoter of MDV. In some embodiments, the heterologous polynucleotide inserted thereinto is placed under the control of the endogenous UL26.5 promoter of MDV In some embodiments, the heterologous polynucleotide inserted thereinto is placed under the control of the endogenous UL27 promoter of MDV. In some further embodiments, the inserts do not comprise any heterologous promoter sequence. In some further embodiments, the inserts do not comprise any promoter sequence.

[0115] In a particular embodiment, provided is the use of the novel insertion site in combination with available endogenous promoter upstream thereto in the construction of a recombinant MDV, wherein said novel insertion site is in the intergenic region between UL26 / UL26.5 gene locus and UL27 gene locus, and / or wherein said endogenous promoter is one or more promoters selected from the endogenous UL26 promoter of MDV, the endogenous UL26.5 promoter of MDV, and the endogenous UL27 promoter of MDV. In some embodiments, said endogenous promoter is the endogenous UL26 promoter. In some embodiments, said endogenous promoter is the endogenous UL26.5 promoter. In some embodiments, said endogenous promoter is the endogenous UL27 promoter. Preferably the MDV is HVT and in such embodiments any reference to an “endogenous” promoter is the respective endogenous HVT promoter.

[0116] In some embodiments, said MDV comprises MDV-1, MDV-2, MDV-3 (herpesvirus of turkeys, HVT) or any combinations thereof. In some particular embodiments, said MDV comprises MDV-1, e.g., strain CVI-988, strain CVTR, strain SC9-1, or strain 814, or any prevalent strain or their attenuated strain by passaging, mutagenesis, and / or genetic engineering. In some particular embodiments, said MDV comprises MDV-2, e.g., strain SB-1, or any prevalent strain or their attenuated strain by passaging, mutagenesis, and / or genetic engineering.

[0117] In some particular embodiments, said MDV is HVT, preferably HVT strain FC-126. It is known in the art that when referring to the HVT genome, UL26, UL26.5 and UL27 are also known as HVT033, HVT034 and HVT035, respectively.

[0118] In some particular embodiments, the MDV comprises HVT FC-126, and the novel insertion site is located in the region between the FC-126 genome DNA sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and ctatacaatttcatcatccgtctcagaatccgtgtcgttt (SEQ ID NO: 25) . In some particular embodiments, the MDV comprises MDV1, MDV2 or HVT strains other than FC-126, and the novel insertion site is located in the genome region which is corresponding to the region between FC-126 genome DNA sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and ctatacaatttcatcatccgtctcagaatccgtgtcgttt (SEQ ID NO: 25) .

[0119] In some particular embodiments, the MDV comprises HVT FC-126, and the flanking sequence of the insertion site is the same with or reverse complementary to a sequence that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with at least part of SEQ ID NO: 36, wherein the flanking sequence is the upstream flanking sequence or the downstream flanking sequence.

[0120] In some particular embodiments, a sequence that has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with at least part of SEQ ID NO: 36, and / or a complementary sequence thereof, could be used to form the homology arm sequence (s) , e.g., the upstream homology arm sequence or the downstream homology arm sequence, by which the transgene could be inserted at the target site via, e.g., homologous recombination. In some more particular embodiments, said part refers to the length of the homology arm, e.g., about 25-60 nucleotides, about 30-50 nucleotides, and the like.

[0121] In some even more particular embodiments, the MDV comprises HVT FC-126, and the novel insertion site is located at the site between the FC-126 genome DNA sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and aaagcggtgtgttaatgtcagagagctgta (SEQ ID NO: 24) , i.e., between the 30th nucleotide and the 31st nucleotide of the sequence as shown in SEQ ID NO: 36.In some even more particular embodiments, the MDV comprises MDV1, MDV2 or HVT strains other than FC-126, and the novel insertion site is located at the site which is corresponding to the site between FC-126 genome DNA sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and aaagcggtgtgttaatgtcagagagctgta (SEQ ID NO: 24) .

[0122] In some embodiments, the heterologous polynucleotide (s) inserted at the novel insertion site are expressed in the forward orientation, i.e., the same orientation in which UL26 / UL26.5 gene expresses. In some embodiments of this type, the heterologous polynucleotide (s) are also placed under the control of an endogenous promoter as outlined above.

[0123] In some embodiments, the heterologous polynucleotide (s) inserted at the novel insertion site are expressed in the reverse orientation, i.e., the same orientation in which UL27 gene expresses.

[0124] Some embodiments of the present invention involve another insertion site suitable for expressing exogenous genes. Similarly, said insertion site is required to ensure efficient expression of the exogenous genes without affecting the expression of the viral structural genes. Moreover, in some preferred embodiments, where more than one exogenous genes need to integrate into two insertion sites at the same time, this insertion site in combination with the aforementioned "first insertion site" (i.e., the novel insertion site in the intergenic region between UL26 / UL26.5 gene locus and UL27 gene locus of the MDV genome) confers that two or more transgenes are effectively expressed at both sites, with the expression better than that at any other combination of insertion sites, and even better than that at only one insertion site. In the embodiments of the recombinant MDVs of the present invention, especially in those involving two or more insertion sites, this insertion site that is different from the “first insertion site” is referred to as the “second insertion site” , unless otherwise specified.

[0125] This insertion site may be any non-essential region of the MDV (e.g., HVT) genome, including, but not limited to, the intergenic region between UL55 and MDV71 genes, the intergenic region between UL3 and UL4 genes, the intergenic region between UL22 and UL23 genes, the intergenic region between UL44 and UL45 genes, the intergenic region between UL45 and UL46 genes, the intergenic region between UL48 and UL49 genes, the intergenic region between UL54 and MDV69 genes, the IG2 region, the intergenic region between US10 and US1 genes, the intergenic region between SORF3 and US2 genes, the US2 locus, the US6 locus, the US7 locus, the US8 locus, the US10 locus, and the intergenic region between US10 and SORF3 genes. In some preferred embodiments, said “second insertion site” is located in the intergenic region between UL55 and MDV71 genes, e.g., between the stop codon of UL55 gene and the stop codon of MDV71 gene.

[0126] Therefore, in some embodiment, the present invention provides a recombinant MDV comprising a first heterologous polynucleotide sequence encoding a first antigenic peptide inserted into the non-coding region located between UL26 / 26.5 and UL27, and a second heterologous polynucleotide sequence encoding a second antigenic peptide inserted into a non-essential region of the MDV (e.g., HVT) genome selected from the intergenic region between UL55 and MDV71 genes, the intergenic region between UL3 and UL4 genes, the intergenic region between UL22 and UL23 genes, the intergenic region between UL44 and UL45 genes, the intergenic region between UL45 and UL46 genes, the intergenic region between UL48 and UL49 genes, the intergenic region between UL54 and MDV69 genes, the IG2 region, the intergenic region between US10 and US1 genes, the intergenic region between SORF3 and US2 genes, the US2 locus, the US6 locus, the US7 locus, the US8 locus, the US10 locus, and the intergenic region between US10 and SORF3 genes, wherein optionally, the first heterologous polynucleotide is placed under the control of the endogenous UL26 promoter of MDV, and / or under the control of the endogenous UL26.5 promoter of MDV, and / or under the control of the endogenous UL27 promoter of MDV.

[0127] Therefore, in a preferred embodiment, the present invention provides a recombinant MDV comprising a first heterologous polynucleotide sequence encoding a first antigenic peptide inserted into the non-coding region located between UL26 / 26.5 and UL27, and a second heterologous polynucleotide sequence encoding a second antigenic peptide inserted into the non-coding region located between UL55 and MDV71 genes.

[0128] Therefore, in some preferred embodiment, the present invention provides a recombinant MDV comprising (i) a first heterologous polynucleotide sequence encoding a first antigenic peptide inserted into the non-coding region located between UL26 / 26.5 and UL27, and under the control of the endogenous UL26 promoter of MDV, and / or under the control of the endogenous UL26.5 promoter of MDV, and / or under the control of the endogenous UL27 promoter of MDV; and (ii) a second heterologous polynucleotide sequence encoding a second antigenic peptide inserted into the non-coding region located between UL55 and MDV71 genes.

[0129] It is known in the art that when referring to the HVT genome, UL55 and MDV71 are also known as HVT065 and HVT066, respectively. In some particular embodiments, the MDV comprises HVT FC-126, and the insertion site in the intergenic region between UL55 and MDV71 genes is located in the region between the FC-126 genome (e.g., as shown in Genbank accession ID: NC_002641) DNA sequences atcgctatgcaaagagatgcgtgtgtacacgcgccgttga (SEQ ID NO: 26) and ttaagatgcaggagtaacaatgtgcatagtaggcgtagtt (SEQ ID NO: 29) . In some particular embodiments, the MDV comprises MDV1, MDV2 or HVT strains other than FC-126, and the insertion site in the intergenic region between UL55 and MDV71 genes is located in the genome region which is corresponding to the region between FC-126 genome DNA sequences atcgctatgcaaagagatgcgtgtgtacacgcgccgttga (SEQ ID NO: 26) and ttaagatgcaggagtaacaatgtgcatagtaggcgtagtt (SEQ ID NO: 29) .

[0130] In some particular embodiments, the MDV comprises HVT FC-126, and the flanking sequence of the insertion site is the same with or reverse complementary to a sequence that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with at least part of SEQ ID NO: 37, wherein the flanking sequence is the upstream flanking sequence or the downstream flanking sequence.

[0131] In some particular embodiments, a sequence that has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with at least part of SEQ ID NO: 37, and / or a complementary sequence thereof, could be used to form the homology arm sequence (s) , e.g., the upstream homology arm sequence or the downstream homology arm sequence, by which the transgene could be inserted at the target site via, e.g., homologous recombination. In some more particular embodiments, said part refers to the length of the homology arm, e.g., about 25-60 nucleotides, about 30-50 nucleotides, and the like.

[0132] In some even more particular embodiments, the MDV comprises HVT FC-126, and the insertion site in the intergenic region between UL55 and MDV71 genes is located at the site between the FC-126 genome DNA sequences tatatgttattaaataaaataattgaccagtgaacaattt (SEQ ID NO: 27) and gtttaatgttagtttattcaatgcattggttgcaaatatt (SEQ ID NO: 28) , i.e., between the 118th nucleotide and the 119th nucleotide of the sequence as shown in SEQ ID NO: 37. In some even more particular embodiments, the MDV comprises MDV1, MDV2 or HVT strains other than FC-126, and the insertion site in the intergenic region between UL55 and MDV71 genes is located at the site which is corresponding to the site between FC-126 genome DNA sequences tatatgttattaaataaaataattgaccagtgaacaattt (SEQ ID NO: 27) and gtttaatgttagtttattcaatgcattggttgcaaatatt (SEQ ID NO: 28) .

[0133] In some embodiments, the heterologous polynucleotide (s) inserted at the insertion site are expressed in the forward orientation, i.e., the same orientation in which UL55 gene expresses.

[0134] In some embodiments, the heterologous polynucleotide (s) inserted at the insertion site are expressed in the reverse orientation, i.e., the same orientation in which MDV71 gene expresses.

[0135] In some embodiments, the heterologous polynucleotide (s) inserted at the novel insertion site are expressed in the forward orientation, i.e., the same orientation in which UL55 gene expresses.

[0136] In some embodiments, the heterologous polynucleotide (s) inserted at the novel insertion site are expressed in the reverse orientation, i.e., the same orientation in which MDV71 gene expresses.

[0137] In some further embodiments, the first heterologous polynucleotide is expressed in the same orientation as UL26 gene, and the second heterologous polynucleotide is expressed in the same orientation as UL55 gene.

[0138] In some further embodiments, the first heterologous polynucleotide is expressed in the same orientation as UL27 gene, and the second heterologous polynucleotide is expressed in the same orientation as UL55 gene.

[0139] In some further embodiments, the first heterologous polynucleotide is expressed in the same orientation as UL26 gene, and the second heterologous polynucleotide is expressed in the same orientation as MDV71 gene.

[0140] In some further embodiments, the first heterologous polynucleotide is expressed in the same orientation as UL27 gene, and the second heterologous polynucleotide is expressed in the same orientation as MDV71 gene.

[0141] The locations of the quoted non-coding intergenic regions are well-known in the art. For example, by reference to complete virus genome sequence in the public biological database (e.g., NCBI GenBank, and the like) , the region between the stop codons of UL26 gene and UL27 gene could be easily confirmed in terms of genomic sequences. So is the region between the stop codons of UL55 gene and MDV71 gene. For example, the non-coding intergenic region between HVT033 gene and HVT035 gene in the genome of FC-126 has a sequence being from the 31st nucleotide to the 142nd nucleotide of the sequence as shown in SEQ ID NO: 36. For example, the non-coding intergenic region between HVT065 gene and HVT066 gene in the genome of FC-126 has a sequence being from the 41st nucleotide to the 238th nucleotide of the sequence as shown in SEQ ID NO: 37.

[0142] In some embodiment of a further aspect, the present invention provides a recombinant MDV comprising a first heterologous polynucleotide sequence encoding a first antigenic peptide and a third antigenic peptide inserted into the non-coding region located between UL26 / 26.5 and UL27, and a second heterologous polynucleotide sequence encoding a second antigenic peptide inserted into a non-essential region of the MDV (e.g., HVT) genome selected from the intergenic region between UL55 and MDV71 genes, the intergenic region between UL3 and UL4 genes, the intergenic region between UL22 and UL23 genes, the intergenic region between UL44 and UL45 genes, the intergenic region between UL45 and UL46 genes, the intergenic region between UL48 and UL49 genes, the intergenic region between UL54 and MDV69 genes, the IG2 region, the intergenic region between US10 and US1 genes, the intergenic region between SORF3 and US2 genes, the US2 locus, the US6 locus, the US7 locus, the US8 locus, the US10 locus, and the intergenic region between US10 and SORF3 genes, preferably the intergenic region between UL55 and MDV71 genes, wherein optionally, the first heterologous polynucleotide is placed under the control of the endogenous UL26 promoter of MDV, and / or under the control of the endogenous UL26.5 promoter of MDV, and / or under the control of the endogenous UL27 promoter of MDV.

[0143] In some preferable embodiments, said first heterologous polynucleotide sequence encoding a first antigenic peptide and a third antigenic peptide is placed under the control of the endogenous UL26 promoter of MDV, and / or under the control of the endogenous UL26.5 promoter of MDV, and / or under the control of the endogenous UL27 promoter of MDV.

[0144] In some embodiment of a further aspect, the present invention provides a recombinant MDV comprising a first heterologous polynucleotide sequence encoding a first antigenic peptide inserted into the non-coding region located between UL26 / 26.5 and UL27, and a second heterologous polynucleotide sequence encoding a second antigenic peptide and a third antigenic peptide inserted into a non-essential region of the MDV (e.g., HVT) genome selected from the intergenic region between UL55 and MDV71 genes, the intergenic region between UL3 and UL4 genes, the intergenic region between UL22 and UL23 genes, the intergenic region between UL44 and UL45 genes, the intergenic region between UL45 and UL46 genes, the intergenic region between UL48 and UL49 genes, the intergenic region between UL54 and MDV69 genes, the IG2 region, the intergenic region between US10 and US1 genes, the intergenic region between SORF3 and US2 genes, the US2 locus, the US6 locus, the US7 locus, the US8 locus, the US10 locus, and the intergenic region between US10 and SORF3 genes, preferably the intergenic region between UL55 and MDV71 genes, wherein optionally, the first heterologous polynucleotide is placed under the control of the endogenous UL26 promoter of MDV, and / or under the control of the endogenous UL26.5 promoter of MDV, and / or under the control of the endogenous UL27 promoter of MDV.

[0145] In some preferable embodiments, said first heterologous polynucleotide sequence is placed under the control of the endogenous UL26 promoter of MDV, and / or under the control of the endogenous UL26.5 promoter of MDV, and / or under the control of the endogenous UL27 promoter of MDV.

[0146] In some embodiment of a further aspect, the present invention provides a recombinant MDV comprising a first heterologous polynucleotide sequence encoding two or more antigenic peptides inserted into the non-coding region located between UL26 / 26.5 and UL27, and a second heterologous polynucleotide sequence encoding two or more antigenic peptides inserted into a non-essential region of the MDV (e.g., HVT) genome selected from the intergenic region between UL55 and MDV71 genes, the intergenic region between UL3 and UL4 genes, the intergenic region between UL22 and UL23 genes, the intergenic region between UL44 and UL45 genes, the intergenic region between UL45 and UL46 genes, the intergenic region between UL48 and UL49 genes, the intergenic region between UL54 and MDV69 genes, the IG2 region, the intergenic region between US10 and US1 genes, the intergenic region between SORF3 and US2 genes, the US2 locus, the US6 locus, the US7 locus, the US8 locus, the US10 locus, and the intergenic region between US10 and SORF3 genes, preferably the intergenic region between UL55 and MDV71 genes, wherein optionally, the first heterologous polynucleotide is placed under the control of the endogenous UL26 promoter of MDV, and / or under the control of the endogenous UL26.5 promoter of MDV, and / or under the control of the endogenous UL27 promoter of MDV.

[0147] In some preferable embodiments, said first heterologous polynucleotide sequence is placed under the control of the endogenous UL26 promoter of MDV, and / or under the control of the endogenous UL26.5 promoter of MDV, and / or under the control of the endogenous UL27 promoter of MDV.

[0148] The genes coding for antigen or polypeptide may be those coding for Newcastle Disease Virus fusion protein (NDV F) , Newcastle Disease Virus hemagglutinin neuraminidase (NDV-HN) , Infectious Bursal Disease Virus (IBDV) VP2, IBDV VPX, IBDV VP3, IBDV VP4, ILTV glycoprotein B, ILTV glycoprotein I, ILTV UL32, ILTV glycoprotein D, ILTV glycoprotein E, ILTV glycoprotein C, protective genes derived from Mycoplasma gallisepticum (MG) , or Mycoplasma synoviae (MS) , or combinations thereof. The antigen or polypeptide may be any antigen from the poultry pathogen selected form the group consisting of avian encephalomyelitis virus, avian reovirus, avian paramyxovirus, avian metapneumovirus, avian adenovirus, fowl pox virus, avian coronavirus, avian rotavirus, chick anemia virus, avian astrovirus, avian parvovirus, avian retrovirus, avian picornavirus, coccidiosis (Eimeria sp. ) , Campylobacter sp., Salmonella sp., Pasteurella sp., Avibacterium sp., Mycoplasma gallisepticum, Mycoplasma synoviae, Clostridium sp., and Escherichia coli.

[0149] Moreover, homologs of aforementioned antigen or polynucleotides are intended to be within the scope of the present invention. As used herein, the term "homologs" includes orthologs, analogs and paralogs. The term "analogs" refers to two polynucleotides or polypeptides that have the same or similar function, but that have evolved separately in unrelated organisms. The term "orthologs" refers to two polynucleotides or polypeptides from different species, but that have evolved from a common ancestral gene by speciation. Normally, orthologs encode polypeptides having the same or similar functions. The term "paralogs" refers to two polynucleotides or polypeptides that are related by duplication within a genome. Paralogs usually have different functions, but these functions may be related. Analogs, orthologs, and paralogs of a wild-type polypeptide can differ from the wild-type polypeptide by post-translational modifications, by amino acid sequence differences, or by both. In particular, homologs of the invention will generally exhibit at least 80-85%, 85-90%, 90-95%, or 95%, 96%, 97%) , 98%) , 99%sequence identity, with all or part of the polynucleotide or polypeptide sequences of antigens described above, and will exhibit a similar function.

[0150] In some particular embodiments, said avian pathogen is selected from the group consisting of Newcastle Disease Virus (NDV) , Infectious Bursal Disease Virus (IBDV) , Infectious Laryngotracheitis Virus (ILTV) . In some particular embodiments, said at least one antigen of an avian pathogen is one or more polypeptides selected from the group consisting of an Infectious Bursal Disease Virus (IBDV) VP2 antigen, an Infectious Laryngotracheitis Virus (ILTV) glycoprotein D (gD) antigen and a Newcastle Disease Virus F (NDV F) antigen.

[0151] To optimize the expression of the IBDV VP2, ILTV gD and / or NDV F antigens for the invention, their encoding polynucleotide sequence can be subjected to codon optimization. This is well-known in the art and is commonly applied to improve the expression level of a DNA or RNA sequence in a context that differs from that of the natural origin of the encoded protein. It involves the adaptation of a nucleotide sequence to encode the intended amino acids, but by way of a nucleotide sequence that matches the codon preference (the tRNA repertoire) of the recombinant virus, the host cell, or the target organism in which the sequence will be expressed. Consequently, the nucleotide mutations applied are commonly silent. Such modifications are commonly planned in silico by using one of many computer software programs, after which the desired nucleotide sequence can be synthesized.

[0152] Therefore, in some embodiments of the recombinant MDVs according to the invention, the polynucleotides encoding the IBDV VP2, the ILTV gD and / or the NDV F antigen proteins are codon-optimized, e.g., towards the MDV viral codon preference. Codon-optimised and not codon-optimised polynucleotides have the normal meaning attributed to them by the person skilled in the art in the context of the present invention.

[0153] In some particular embodiments involving an IBDV VP2 antigen, e.g., the embodiments of the recombinant MDVs of the present invention, or the embodiments of the expression cassettes of the present invention, said VP2 antigen is derived from vv IBDV, for example, said VP2 antigen comprises or consists of an amino acid sequence as shown in SEQ ID NO: 5, or an amino acid sequence which has at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 5, or a conservative variant, an allelic variant, a homolog or an immunogenic fragment comprising at least eight or at least ten consecutive amino acids of one of these polypeptides, or a combination of these polypeptides. In some more particular embodiments, said vv IBDV VP2 antigen is encoded by its wildtype gene, for example, a nucleic acid sequence as shown in SEQ ID NO: 6, or a sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 6. In some more particular embodiments, the gene coding for said vv IBDV VP2 antigen has been codon-optimized, for example, comprising or consisting of a nucleic acid sequence as shown in SEQ ID NO: 7, or a sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 7.

[0154] In some particular embodiments involving an IBDV VP2 antigen, e.g., the embodiments of the recombinant MDVs of the present invention, or the embodiments of the expression cassettes of the present invention, said VP2 antigen is derived from nVar IBDV, for example, said VP2 antigen comprises or consists of an amino acid sequence as shown in SEQ ID NO: 8, or an amino acid sequence which has at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 8, or a conservative variant, an allelic variant, a homolog or an immunogenic fragment comprising at least eight or at least ten consecutive amino acids of one of these polypeptides, or a combination of these polypeptides. In some more particular embodiments, said nVar IBDV VP2 antigen is encoded by its wildtype gene, for example, a nucleic acid sequence as shown in SEQ ID NO: 9, or a sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 9. In some more particular embodiments, the gene coding for said nVar IBDV VP2 antigen has been codon-optimized, for example, comprising or consisting of a nucleic acid sequence as shown in SEQ ID NO: 10, or a sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 10. In some preferred embodiments of the present invention, the nVar IBDV VP2 antigen, when used as an effective immunogen, is capable of inducing cross-protection against various kinds of IBDV serotypes, including but not limited to cv IBDV, nVar IBDV and vv IBDV.

[0155] In some particular embodiments involving an NDV F antigen, e.g., the embodiments of the recombinant MDVs of the present invention, or the embodiments of the expression cassettes of the present invention, said F antigen comprise a mutated amino acid sequence of the protease cleavage site, for example, said F antigen comprises or consists of an amino acid sequence as shown in SEQ ID NO: 1, or an amino acid sequence which has at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 1, or a conservative variant, an allelic variant, a homolog or an immunogenic fragment comprising at least eight or at least ten consecutive amino acids of one of these polypeptides, or a combination of these polypeptides. In some more particular embodiments, the coding sequence of said NDV F antigen is derived from its wildtype gene and not codon-optimized, for example, a nucleic acid sequence as shown in SEQ ID NO: 2, or a sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 2. In some more particular embodiments, the gene coding for said NDV F antigen has been codon-optimized, for example, comprising or consisting of a nucleic acid sequence as shown in SEQ ID NO: 3 or 4 or 63, or a sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 3 or 4 or 63.

[0156] In some particular embodiments involving an ILTV gD antigen, e.g., the embodiments of the recombinant MDVs of the present invention, or the embodiments of the expression cassettes of the present invention, said gD antigen comprise a mutated amino acid sequence of the protease cleavage site, for example, said gD antigen comprises or consists of an amino acid sequence as shown in SEQ ID NO: 11, or an amino acid sequence which has at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 11, or a conservative variant, an allelic variant, a homolog or an immunogenic fragment comprising at least eight or at least ten consecutive amino acids of one of these polypeptides, or a combination of these polypeptides. In some more particular embodiments, said ILTV gD antigen is encoded by its wildtype gene, for example, a nucleic acid sequence as shown in SEQ ID NO: 12, or a sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 12. In some more particular embodiments, the gene coding for said ILTV gD antigen has been codon-optimized, for example, comprising or consisting of a nucleic acid sequence as shown in SEQ ID NO: 13, or a sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 13.

[0157] One embodiment of the invention provides a recombinant MDV comprising one, two or more heterologous polynucleotides coding for and expressing at least one antigen or polypeptide of an avian pathogen. In one embodiment, the present invention provides a recombinant HVT comprising one, two or more heterologous polynucleotides coding for and expressing the NDV F antigen or polypeptide, the IBDV VP2 antigen or polypeptide, the ILTV gD antigen or polypeptide, or a combination thereof.

[0158] In some embodiments of the recombinant MDVs, at least one of the heterologous polynucleotides is inserted at said novel insertion site. In some embodiments of the recombinant MDVs, at least two of the heterologous polynucleotides are inserted at said novel insertion site. In some embodiments of the recombinant MDVs, each of the heterologous polynucleotides is inserted at said novel insertion site.

[0159] In some embodiments of the recombinant MDVs, at least one of the heterologous polynucleotides is inserted at said novel insertion site and placed under the control of an endogenous promoter. In some embodiments of the recombinant MDVs, at least two of the heterologous polynucleotides are inserted at said novel insertion site and placed under the control of an endogenous promoter. In some embodiments of the recombinant MDVs, each of the heterologous polynucleotides is inserted at said novel insertion site and placed under the control of an endogenous promoter.

[0160] In some embodiments of the recombinant MDVs, the heterologous polynucleotide coding for and expressing the NDV F antigen or polypeptide is inserted at said novel insertion site. In some embodiments of the recombinant MDVs, the heterologous polynucleotide coding for and expressing the IBDV VP2 antigen or polypeptide is inserted at said novel insertion site. In some embodiments of the recombinant MDVs, the heterologous polynucleotide coding for and expressing the ILTV gD antigen or polypeptide is inserted at said novel insertion site.

[0161] In some embodiments of the recombinant MDVs, the heterologous polynucleotide coding for and expressing the NDV F antigen or polypeptide is inserted at said novel insertion site and placed under the control of an endogenous promoter. In some embodiments of the recombinant MDVs, the heterologous polynucleotide coding for and expressing the IBDV VP2 antigen or polypeptide is inserted at said novel insertion site and placed under the control of an endogenous promoter. In some embodiments of the recombinant MDVs, the heterologous polynucleotide coding for and expressing the ILTV gD antigen or polypeptide is inserted at said novel insertion site and placed under the control of an endogenous promoter.

[0162] In some embodiments of the recombinant MDVs, the heterologous polynucleotide coding for and expressing the NDV F antigen or polypeptide is inserted at said novel insertion site and the recombinant MDVs, the heterologous polynucleotides coding for and expressing the IBDV VP2 antigen or polypeptide and the ILTV gD antigen or polypeptide are inserted at a second insertion site. In some embodiments of the recombinant MDVs, the heterologous polynucleotide coding for and expressing the IBDV VP2 antigen or polypeptide is inserted at said novel insertion site and the recombinant MDVs, the heterologous polynucleotides coding for and expressing the NDV F antigen or polypeptide and the ILTV gD antigen or polypeptide are inserted at a second insertion site. In some embodiments of the recombinant MDVs, the heterologous polynucleotide coding for and expressing the ILTV gD antigen or polypeptide is inserted at said novel insertion site and the recombinant MDVs, the heterologous polynucleotides coding for and expressing the IBDV VP2 antigen or polypeptide and the NDV F antigen or polypeptide are inserted at a second insertion site.

[0163] In some embodiments of the recombinant MDVs, the heterologous polynucleotide coding for and expressing the NDV F antigen or polypeptide and the heterologous polynucleotide coding for and expressing the IBDV VP2 antigen or polypeptide are inserted at said novel insertion site.

[0164] In some embodiments of the recombinant MDVs, the heterologous polynucleotide coding for and expressing the NDV F antigen or polypeptide and the heterologous polynucleotide coding for and expressing the IBDV VP2 antigen or polypeptide are inserted at said novel insertion site and placed under the control of an endogenous promoter.

[0165] In some embodiments of the recombinant MDVs, the heterologous polynucleotide coding for and expressing the NDV F antigen or polypeptide and the heterologous polynucleotide coding for and expressing the ILTV gD antigen or polypeptide are inserted at said novel insertion site.

[0166] In some embodiments of the recombinant MDVs, the heterologous polynucleotide coding for and expressing the NDV F antigen or polypeptide and the heterologous polynucleotide coding for and expressing the ILTV gD antigen or polypeptide are inserted at said novel insertion site and placed under the control of an endogenous promoter.

[0167] In some embodiments of the recombinant MDVs, the heterologous polynucleotide coding for and expressing the IBDV VP2 antigen or polypeptide and the heterologous polynucleotide coding for and expressing the ILTV gD antigen or polypeptide are inserted at said novel insertion site.

[0168] In some embodiments of the recombinant MDVs, the heterologous polynucleotide coding for and expressing the IBDV VP2 antigen or polypeptide and the heterologous polynucleotide coding for and expressing the ILTV gD antigen or polypeptide are inserted at said novel insertion site and placed under the control of an endogenous promoter.

[0169] In some embodiments of the recombinant MDVs, the heterologous polynucleotide coding for and expressing the NDV F antigen or polypeptide, the heterologous polynucleotide coding for and expressing the IBDV VP2 antigen or polypeptide and the heterologous polynucleotide coding for and expressing the ILTV gD antigen or polypeptide are inserted at said novel insertion site.

[0170] In some embodiments of the recombinant MDVs, the heterologous polynucleotide coding for and expressing the NDV F antigen or polypeptide, the heterologous polynucleotide coding for and expressing the IBDV VP2 antigen or polypeptide and the heterologous polynucleotide coding for and expressing the ILTV gD antigen or polypeptide are inserted at said novel insertion site and placed under the control of an endogenous promoter.

[0171] In some particular embodiments, the recombinant MDV comprises a heterologous polynucleotide encoding a polypeptide selected from the group consisting of an IBDV VP2 antigen, an ILTV glycoprotein D (gD) antigen and an NDV F antigen, being inserted at the novel insertion site of the present invention. In some preferred embodiments, said heterologous polynucleotide is operably linked to the endogenous UL26 promoter of MDV and / or the endogenous UL26.5 promoter of MDV, and expresses in an orientation same with the orientation of UL26. In some preferred embodiments, said heterologous polynucleotide is operably linked to the endogenous UL26 gene polyA signal motif. In some preferred embodiments, said heterologous polynucleotide is expressed via an IRES element. In some preferred embodiments, said heterologous polynucleotide is linked at its 5’ end to the flanking sequence of the insertion site via an IRES element, or via a stop codon+IRES (wherein, the stop codon, TAA, TGA or TAG, is 5’ upstream to IRES, preferably directly 5’ flanking the IRES) .

[0172] In a more preferred embodiment, the recombinant MDV comprises a heterologous polynucleotide encoding an NDV F antigen and being inserted at the novel insertion site in the form of a first expression cassette. In some particular embodiments, the MDV comprises HVT. In some particular embodiments, the MDV is HVT. In some particular embodiments, the first expression cassette is inserted in between the HVT genome sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and ctatacaatttcatcatccgtctcagaatccgtgtcgttt (SEQ ID NO: 25) , more preferably inserted in between the HVT genome sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and aaagcggtgtgttaatgtcagagagctgta (SEQ ID NO: 24) . When referring to the insertion / inserting of any expression cassette into a specific site or region (e.g., in the MDV genome) , those skilled in the art will understand that the original genomic sequence at the insertion site / region may not be strictly distinct from the sequence of the expression cassette; rather, there may be overlap between the sequences upstream / downstream of the insertion site / region and the sequences at either or both ends of the expression cassette. Usually, such a situation may be intended and / or designed to facilitate molecular cloning operations (e.g., via homologous recombination) . After the insertion is completed, typically, only one copy of the sequence in the overlapping region will be retained. This does not imply that the insertion site / region has shifted; rather, the critical portion of the expression cassette (namely, the heterologous polynucleotide to be expressed) is inserted at said site or within the said region as expected. This is not inconsistent with the fact that the non-coding regions / regulatory elements of the expression cassette may be located within the overlapping region (and thus may appear to locate outside the said site / region wholly or partly) .

[0173] In some embodiments of the expression cassettes of the present invention, elements contained at either end of the expression cassette may be located wholly or partially within the overlapping sequence region. In some embodiments of the expression cassettes of the present invention, elements contained at either end of the expression cassette may be partially located within the overlapping sequence region, e.g., wherein such an element is the artificial reverse tandem polyA signal motifs of the present invention. In some embodiments of the expression cassettes of the present invention, an element contained at either end (e.g., the 5'end) of the expression cassette may be partially located within the overlapping sequence region, wherein said element is the artificial reverse tandem polyA signaling motif of the present invention, having a 32-bp nucleic acid portion located within the overlapping region. These embodiments also fall within the protection scope of the present invention, particularly those defined by the insertion site / region.

[0174] In one or more embodiments, said first expression cassette further comprise at least one heterologous polynucleotide coding for an antigen of an avian pathogen, which is preferably not NDV F antigen.

[0175] In one embodiment, said expression cassette further comprises a promoter sequence, which is operably linked to one or more heterologous polynucleotides. In one or more particular embodiments, said expression cassette comprises a homologous promoter. In one embodiment, the promoter is one or more promoters selected from the group consisting of the following: an immediate early (IE) human cytomegalovirus (CMV) (hCMV) promoter, mouse CMV (mCMV) IE promoter, guinea pig CMV (gpCMV) IE promoter, an SV40 promoter, Pseudorabies Virus promoters such as that of glycoprotein X promoter, Herpes Simplex Virus-1 such as the alpha 4 promoter, Marek's Disease Viruses (including MDV-1, MDV-2 and HVT) promoters such as those driving glycoproteins gC, gB, gE, or gl expression, HHV3gB promoter (Human Herpesvirus Type 3 glycoprotein B promoter) , Infectious Laryngotracheitis Virus promoters such as those of glycoprotein gB, gE, gl, gD, gC genes, or other herpesvirus promoters. In one embodiment, said expression cassette comprises a mouse CMV promoter, e.g., an mCMV IE promoter.

[0176] In one or more embodiments, said expression cassette does not comprise a heterologous promoter.

[0177] In a preferred embodiment, the expression cassette does not comprise a heterologous promoter, but the insertion of the expression cassette into the target sequence of the MDV genome allows the heterologous polynucleotide in the expression cassette being operably linked to the endogenous promoter originally present in the MDV genome, e.g., via an Internal Ribosomal Entry Site (IRES) , or via a stop codon+IRES (wherein, the stop codon, TAA, TGA or TAG, is 5’ upstream to IRES, preferably directly 5’ flanking the IRES) or via a coding sequence for self-cleavage peptide or via a stop codon+ coding sequence for self-cleavage peptide (wherein, the stop codon, TAA, TGA or TAG, is 5’ upstream to coding sequence for self-cleavage peptide, preferably directly 5’ flanking the coding sequence for self-cleavage peptide) . In a particular embodiment, said endogenous promoter is the endogenous promoter of MDV UL26 gene, and / or the endogenous promoter of MDV UL26.5 gene.

[0178] In a particular embodiment, the IRES could be any IRES element, e.g., the optimized IRES of the present invention as hereinafter described. In a particular embodiment, the self-cleavage peptide is 2A peptide, e.g., P2A, T2A, E2A or F2A.

[0179] In one or more embodiments, said expression cassette comprises nucleic acid sequences coding for the signal of polyadenylation (i.e., polyA signal motif) , which are operably linked to one or more heterologous polynucleotides. In one or more particular embodiments, said polyA signal motif can promote the termination of the encountered transcriptional elongation, which is preferably along either of the two genome DNA strands. Therefore, in one or more particular embodiments, said polyA signal motif promotes to the transcriptional termination of said heterologous polynucleotides. In one or more particular embodiments, said polyA signal motif blocks the transcription of any endogenous genes flanking the expression cassette. In one or more embodiments, said polyA signal motif is one or more known polyA signal motifs, e.g., SV40 polyA signal motif, BGH poly A motif, and / or polyA signal motifs of the present invention as hereinafter described, e.g., the artificial reverse tandem polyA signal motif of the present invention, the novel bidirectional artificial polyA signal motif of the present invention, the MDV CVI988 MDV89 gene polyA signal motif of the present invention, the MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention, and / or the MDV UL26 endogenous polyA signal motif.

[0180] In one or more embodiments, said expression cassette does not comprise an exogenous polyA signal motif. In a preferred embodiment, the expression cassette does not comprise an exogenous polyA signal motif, but the insertion of the expression cassette into the target sequence of the MDV genome allows the heterologous polynucleotide in the expression cassette being operably linked to the endogenous polyA signal motif originally present in the MDV genome.

[0181] In an embodiment further to any one of the aforementioned embodiment involving the first expression cassette, the recombinant MDV comprises another heterologous polynucleotide, inserted at the “second insertion site” which is different from said novel insertion site.

[0182] Therefore, in another aspect, the recombinant MDV of the present invention further comprises another heterologous polynucleotide, inserted at the “second insertion site” which is different from said novel insertion site, thereby, the recombinant MDV comprises at least two heterologous polynucleotides coding for at least two avian pathogen antigens.

[0183] In some preferred embodiments, said heterologous polynucleotides encodes at least two polypeptides selected from the group consisting of an IBDV VP2 antigen, an ILTV gD antigen and an NDV F antigen. In some particular embodiments, not all or both of said heterologous polynucleotides encoding an IBDV VP2 antigen, an ILTV gD antigen and / or an NDV F antigen are inserted at the novel insertion site of the present invention (i.e., the intergenic region between UL26 and UL27 genes) .

[0184] In some particular embodiments, the recombinant MDV comprises three heterologous polynucleotides, a polynucleotide encoding an IBDV VP2 antigen, a polynucleotide encoding an ILTV gD antigen and a polynucleotide encoding an NDV F antigen.

[0185] In some particular embodiments, the recombinant MDV comprises a heterologous polynucleotide encoding an NDV F antigen, and a heterologous polynucleotide encoding an ILTV gD antigen and / or an IBDV VP2 antigen.

[0186] In some particular embodiments, one or two of the heterologous polynucleotides encoding IBDV VP2, ILTV gD and NDV F are inserted in the intergenic region between UL26 and UL27 genes. In some preferred embodiments, a first cassette comprising the heterologous polynucleotide encoding NDV F is inserted in the intergenic region between UL26 and UL27 genes, and a second cassette comprising (i) a heterologous polynucleotide encoding an ILTV gD antigen and / or an IBDV VP2 antigen; or (ii) a heterologous polynucleotide encoding IBDV VP2 and a heterologous polynucleotide encoding ILTV gD is inserted at the second insertion site.

[0187] In some preferred embodiments, one of said heterologous polynucleotides encodes an NDV F antigen and is inserted at said novel insertion site, preferably in the form of a first expression cassette. In some particular embodiments, the MDV comprises HVT. In some particular embodiments, the MDV is HVT. In some particular embodiments, the first expression cassette is inserted in between the HVT genome sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and ctatacaatttcatcatccgtctcagaatccgtgtcgttt (SEQ ID NO: 25) , more preferably inserted in between the HVT genome sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and aaagcggtgtgttaatgtcagagagctgta (SEQ ID NO: 24) . In some preferred embodiments, the first expression cassette comprising the heterologous polynucleotide is operably linked to the endogenous UL26 promoter of MDV and / or the endogenous UL26.5 promoter of MDV. In some preferred embodiments, the first expression cassette comprising the heterologous polynucleotide is linked at its 5’end to the 3’ end of the ORF of UL26 gene via an IRES element or via a stop codon+IRES (wherein, the stop codon, TAA, TGA or TAG, is 5’ upstream to IRES, preferably directly 5’ flanking the IRES) . In some preferred embodiments, the heterologous polynucleotide is placed after the stop codon of the endogenous UL26 / UL26.5 gene, preferably via an IRES element or via a stop codon+IRES (wherein, the stop codon, TAA, TGA or TAG, is 5’ upstream to IRES, preferably directly 5’ flanking the IRES) . In some embodiments, the first expression cassette comprising the heterologous polynucleotide is operably linked to the endogenous UL26 gene polyA signal motif and / or the endogenous UL26.5 gene polyA signal motif. In some preferred embodiments, the first cassette comprises the heterologous polynucleotide encoding NDV F and optionally an IRES element or a stop codon+IRES (wherein, the stop codon, TAA, TGA or TAG, is 5’ upstream to IRES, preferably directly 5’ flanking the IRES) , wherein the heterologous polynucleotide is placed after the stop codon of the endogenous UL26 / UL26.5 gene, preferably linked via an IRES element a stop codon+IRES; and / or the heterologous polynucleotide is placed under the control of the endogenous UL26 promoter of MDV, and / or under the control of the endogenous UL26.5 promoter of MDV. In some preferred embodiments, the first cassette comprises or consists of in 5’ to 3’ direction and in this order: (a) an IRES element or a stop codon+IRES, and (b) the heterologous polynucleotide encoding NDV F, and the heterologous polynucleotide is placed after the stop codon of the endogenous UL26 / UL26.5 gene, via the IRES element or the stop codon+IRES; and the heterologous polynucleotide is placed under the control of the endogenous UL26 promoter of MDV and / or the endogenous UL26.5 promoter of MDV, thereby the promoters and polyA signal motifs are operatively linked to the heterologous polynucleotide encoding NDV F.

[0188] In some preferred embodiments, the first expression cassette comprises the heterologous polynucleotide encoding NDV F, and further comprises a non-endogenous promoter and one or more non-endogenous polyA signal motifs operably linked to the heterologous polynucleotide, and preferably the first expression cassette is expressed in the same orientation as UL27 gene. In some more preferred embodiments, the heterologous polynucleotide encoding NDV F is directly 3’ flanked by a polyadenylation signal core sequence, and / or directly 5’ flanked by a Kozak sequence. In some more preferred embodiments, the first cassette comprises or consists of in 5’ to 3’ direction and in this order: (a) a polyA signal motif, (b) a non-endogenous promoter, (c) the heterologous polynucleotide encoding NDV F, and (d) one or more polyA signal motifs; and whereby the promoters and polyA signal motifs are operatively linked to the heterologous polynucleotide encoding NDV F. In some more preferred embodiments, the first cassette comprises or consists of in 5’ to 3’ direction and in this order: (a) a polyA signal motif, (b) a non-endogenous promoter, (c) a Kozak sequence, (d) the heterologous polynucleotide encoding NDV F, (e) a polyadenylation signal core sequence, and (f) one or more polyA signal motifs; and whereby the promoters and polyA signal motifs are operatively linked to the heterologous polynucleotide encoding NDV F.

[0189] In some preferred embodiments, said heterologous polynucleotides encodes an IBDV VP2 antigen and / or an ILTV gD antigen. In some more preferred embodiments, the heterologous polynucleotides encodes an IBDV VP2 antigen and / or an ILTV gD antigen are inserted at the second insertion site, preferably in the form of a second expression cassette.

[0190] In some embodiments, the second insertion site is located in a non-essential region of the MDV genome, which is selected from the intergenic region between UL55 and MDV71 genes, the intergenic region between UL3 and UL4 genes, the intergenic region between UL22 and UL23 genes, the intergenic region between UL44 and UL45 genes, the intergenic region between UL45 and UL46 genes, the intergenic region between UL48 and UL49 genes, the intergenic region between UL54 and MDV69 genes, the IG2 region, the intergenic region between US10 and US1 genes, the intergenic region between SORF3 and US2 genes, the US2 locus, the US6 locus, the US7 locus, the US8 locus, the US10 locus, and the intergenic region between US10 and SORF3 genes.

[0191] In some particular embodiments, the second insertion site is located in the intergenic region between UL55 and MDV71 genes, e.g., between the stop codon of UL55 gene and the stop codon of MDV71 gene. In some particular embodiments, the MDV comprises HVT. In some particular embodiments, the MDV is HVT. In some particular embodiments, the second expression cassette is inserted in between the HVT genome sequences atcgctatgcaaagagatgcgtgtgtacacgcgccgttga (SEQ ID NO: 26) and ttaagatgcaggagtaacaatgtgcatagtaggcgtagtt (SEQ ID NO: 29) , more preferably inserted in between the HVT genome sequences tatatgttattaaataaaataattgaccagtgaacaattt (SEQ ID NO: 27) and gtttaatgttagtttattcaatgcattggttgcaaatatt (SEQ ID NO: 28) .

[0192] In some preferred embodiments, said second expression cassette comprises two heterologous polynucleotides coding for two avian pathogen antigens, which are linked to each other via an IRES element or via a stop codon+IRES (wherein, the stop codon, TAA, TGA or TAG, is 5’ upstream to IRES, preferably directly 5’ flanking the IRES) or via a coding sequence for self-cleavage peptide or via a stop codon+ coding sequence for self-cleavage peptide (wherein, the stop codon, TAA, TGA or TAG, is 5’ upstream to coding sequence for self-cleavage peptide, preferably directly 5’ flanking the coding sequence for self-cleavage peptide) . In a particular embodiment, the IRES could be any IRES element, e.g., the optimized IRES of the present invention as hereinafter described. In a particular embodiment, the self-cleavage peptide is 2A peptide, e.g., P2A, T2A, E2A or F2A.

[0193] In some preferred embodiments, said second expression cassette comprises a promoter sequence, which is operably linked to the at least two heterologous polynucleotides in the expression cassette. In one embodiment, the promoter is one or more promoters selected from the group consisting of the following: an immediate early (IE) human cytomegalovirus (CMV) (hCMV) promoter, mouse CMV (mCMV) IE promoter, guinea pig CMV (gpCMV) IE promoter, an SV40 promoter, Pseudorabies Virus promoters such as that of glycoprotein X promoter, Herpes Simplex Virus-1 such as the alpha 4 promoter, Marek's Disease Viruses (including MDV-1, MDV-2 and HVT) promoters such as those driving glycoproteins gC, gB, gE, or gl expression, HHV3gB promoter (Human Herpesvirus Type 3 glycoprotein B promoter) , Infectious Laryngotracheitis Virus promoters such as those of glycoprotein gB, gE, gl, gD, gC genes, or other herpesvirus promoters. In general, it is advantageous to employ a strong promoter functional in eukaryotic cells. In one embodiment, said expression cassette comprises a mouse CMV promoter, e.g., an mCMV IE promoter.

[0194] In one or more embodiments, the second expression cassette does not comprise a heterologous promoter, but the insertion of the expression cassette into the target sequence of the MDV genome allows the heterologous polynucleotides in the expression cassette being operably linked to the endogenous promoter originally present in the MDV genome.

[0195] In one or more embodiments, said expression cassette comprises nucleic acid sequences coding for the signal of polyadenylation (i.e., polyA signal motif) , which are operably linked to the heterologous polynucleotides. In one or more particular embodiments, said polyA signal motif can promote the termination of the encountered transcriptional elongation, which is preferably along either of the two genome DNA strands. In one or more particular embodiments, said polyA signal motif blocks the transcription of any genes (e.g., endogenous viral genes) flanking the expression cassette. In one or more embodiments, said polyA signal motif is one or more known polyA signal motifs, e.g., SV40 polyA signal motif, BGH poly A motif, and / or polyA signal motifs of the present invention as hereinafter described, e.g., the artificial reverse tandem polyA signal motif of the present invention, the novel bidirectional artificial polyA signal motif of the present invention, the MDV CVI988 MDV89 gene polyA signal motif of the present invention, and / or the MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention.

[0196] In one or more embodiments, said second expression cassette comprises at least two polyA signal motifs at both ends of the cassette, thereby promoting the transcriptional termination of the heterologous polynucleotides in the cassette and blocking the expression of the genes flanking the cassette. In a preferred embodiment, the polyA signal motifs are at least two of the novel polyA signal motifs provided by the present invention as hereinafter described.

[0197] In one or more embodiments, the second cassette comprises a heterologous polynucleotide encoding IBDV VP2 and a heterologous polynucleotide encoding ILTV gD, respectively, preferably linked to each other via an IRES element or via a stop codon+IRES or via a self-cleaving peptide-coding sequence or via a stop codon+self-cleaving peptide-coding sequence, and cassette further comprises an exogenous promoter, operably linked to the heterologous polynucleotides. In some preferred embodiments, the second cassette further comprises one or more (e.g., one, two, or three in tandem) non-endogenous polyA signal motifs in each end, e.g., one or more (e.g., one, two, or three in tandem) polyA signal motif at the 5’ end (e.g., upstream to the promoter) ; and / or one or more (e.g., one, two, or three in tandem) polyA signal motif at the 3’ end (e.g., downstream to the heterologous polynucleotide) .

[0198] In one or more particular embodiments, the second cassette further comprises a nonfunctioning FRT site.

[0199] In one or more particular embodiments, the second cassette further comprises a nonfunctioning FRT site.

[0200] In some particular embodiments, the second cassette comprises or consists of in 5’ to 3’ direction and in this order: (a) a polyA signal motif; (b) an FRT site; (c) an exogenous promoter; (d) one of the heterologous polynucleotide encoding IBDV VP2 and the heterologous polynucleotide encoding ILTV gD;(e) IRES or stop codon+IRES, (f) the other one of the heterologous polynucleotide encoding IBDV VP2 and the heterologous polynucleotide encoding ILTV gD; and (g) one or two polyA signal motifs.

[0201] In some other particular embodiments, the second cassette comprises or consists of in 5’ to 3’ direction and in this order: (a) a polyA signal motif; (b) an exogenous promoter; (c) one of the heterologous polynucleotide encoding IBDV VP2 and the (heterologous polynucleotide encoding ILTV gD; (d) IRES or stop codon+IRES; (e) one or two polyA signal motifs; (f) an FRT site; and (g) a polyA signal motif.

[0202] In some other particular embodiments, the second cassette comprises or consists of in 5’ to 3’ direction and in this order: (a) a polyA signal motif; (b) an exogenous promoter; (c) one of the heterologous polynucleotide encoding IBDV VP2 and the (heterologous polynucleotide encoding ILTV gD; (d) IRES or stop codon+IRES; (e) the other one of the heterologous polynucleotide encoding IBDV VP2 and the heterologous polynucleotide encoding ILTV gD; (f) one or two polyA signal motifs; (g) an FRT site; and (h) a polyA signal motif.

[0203] In one aspect, the present invention provided an artificial reverse tandem polyA signal motif, which comprises or consists of:

[0204] (i) a nucleotide sequence set forth in SEQ ID NO: 16;

[0205] (ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or

[0206] (iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,

[0207] and can promote the termination of the encountered transcriptional elongation, which is preferably along either of the two genome DNA strands.

[0208] In one aspect, the present invention provided a novel bidirectional artificial polyA signal motif, which comprises or consists of :

[0209] (i) a nucleotide sequence set forth in SEQ ID NO: 17;

[0210] (ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or

[0211] (iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,

[0212] and can promote the termination of the encountered transcriptional elongation, which is preferably along either of the two genome DNA strands.

[0213] In one aspect, the present invention provided an MDV CVI988 MDV89 gene polyA signal motif, which comprises or consists of:

[0214] (i) a nucleotide sequence set forth in SEQ ID NO: 18;

[0215] (ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or

[0216] (iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,

[0217] and can promote the termination of the encountered transcriptional elongation, which is preferably along either of the two genome DNA strands.

[0218] In one aspect, the present invention provided an MDV39 / 40-intergenic bidirectional polyA signal motif, which comprises or consists of:

[0219] (i) a nucleotide sequence set forth in SEQ ID NO: 19;

[0220] (ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or

[0221] (iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,

[0222] and can promote the can promote the termination of the encountered transcriptional elongation, which is preferably along either of the two genome DNA strands.

[0223] In one or more particular embodiments of the recombinant MDV of the present invention comprising the second expression cassette, the polyA signal motif upstream to the promoter is an artificial reverse tandem polyA signal motif upstream to the promoter.

[0224] In one or more particular embodiments of the recombinant MDV of the present invention comprising the second expression cassette, the polyA signal motifs downstream to the heterologous polynucleotides are a combination of a novel bidirectional artificial polyA signal motif and an MDV39 / 40-intergenic bidirectional polyA signal motif in tandem downstream to the heterologous polynucleotides.

[0225] In one or more particular embodiments of the recombinant MDV of the present invention comprising the second expression cassette, the polyA signal motif upstream to the promoter is an MDV CVI988 MDV89 gene polyA signal motif upstream to the promoter.

[0226] In one or more particular embodiments of the recombinant MDV of the present invention comprising the second expression cassette, the polyA signal motifs downstream to the heterologous polynucleotides are a combination of a novel bidirectional artificial polyA signal motif, an MDV39 / 40-intergenic bidirectional polyA signal motif and an artificial reverse tandem polyA signal motif in tandem downstream to the heterologous polynucleotides.

[0227] In one or more embodiments, said expression cassette does not comprise an exogenous polyA signal motif. In a preferred embodiment, the expression cassette does not comprise a polyA signal motif, but the insertion of the expression cassette into the target sequence of the MDV genome allows the heterologous polynucleotides in the expression cassette being operably linked to the endogenous polyA signal motif originally present in the MDV genome.

[0228] In one or more particular embodiments of the recombinant MDV of the present invention comprising the first and the second expression cassettes, the first cassette comprises or consists of in 5’ to 3’ direction and in this order:

[0229] (a) a stop codon, e.g., SEQ ID NO: 57;

[0230] (b) an optimized IRES of the present invention;

[0231] (c) a heterologous polynucleotide encoding cleavage site-mutated NDV F (e.g., comprising or consisting of an amino acid sequence as shown in SEQ ID NO: 1) , e.g., comprising or consisting of a sequence as shown in SEQ ID NO: 4 or 63, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 4 or 63;

[0232] or

[0233] (a) a novel bidirectional artificial polyA signal motif of the present invention;

[0234] (b) an exogenous promoter which comprises or consists of a sequence of SEQ ID NO: 20, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 20 and can bind an RNA polymerase to initiate transcription; Generally in embodiments herein, reference to “exogenous” or “exogenously introduced” UL26, UL26.5, or UL27 promoters; or “exogenous” , “exogenously introduced” promoters that are identical to the (sequence of ) endogenous UL26, UL26.5 or UL27 promoter, these languages have the same meaning: specifically, the artificial placement (e.g., via an expression cassette) of a nucleic acid sequence that is identical to the endogenous UL26 promoter, UL26.5 promoter, or UL27 promoter at a specific site or region, where it functions as a promoter. In such a context, said “exogenous” , or “exogenously introduced” promoter essentially retains endogenous properties because it possesses the same sequence as the endogenous UL26, UL26.5, or UL27 promoter (e.g., the sequences shown in SEQ ID NO: 20 or 21) and is located at a genomic position very close to that of the endogenous UL26, UL26.5 promoter, or UL27 promoter, and thus effectively “mimics” the endogenous UL26 promoter, UL26.5 promoter, or UL27 promoter, although any of the languages highlighted the non-natural position of it. For example, it interacts (or is intended to interact) with other cellular components (such as transcription factors) in a manner similar to the endogenous UL26 promoter, UL26.5 promoter, or UL27 promoter in the naturally occurring position in the virus genome, and thus, for example, exhibits good efficacy in driving the expression of heterologous polynucleotides;

[0235] (c) a Kozak sequence;

[0236] (d) a heterologous polynucleotide encoding cleavage site-mutated NDV F (e.g., comprising or consisting of an amino acid sequence as shown in SEQ ID NO: 1) , e.g., comprising or consisting of a sequence as shown in SEQ ID NO: 4 or 63, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 4 or 63;

[0237] (e) Polyadenylation signal core sequence, e.g., SEQ ID NO: 61;

[0238] (f) an MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention;

[0239] and / or

[0240] the second cassette comprises or consists of in 5’ to 3’ direction and in this order:

[0241] (a) an artificial reverse tandem polyA signal motif of the present invention;

[0242] (b) an FRT site;

[0243] (c) an mCMV promoter, which comprises or consists of a sequence of SEQ ID NO: 14, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription;

[0244] (d) a heterologous polynucleotide encoding IBDV VP2 antigen, e.g., comprising or consisting of a sequence as shown in SEQ ID NO: 6 or 7, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 6 or 7;

[0245] (e) a stop codon, e.g., SEQ ID NO: 58;

[0246] (f) an optimized IRES, e.g., of the present invention;

[0247] (g) a heterologous polynucleotide encoding ILTV gD antigen, e.g., comprising or consisting of a sequence as shown in SEQ ID NO: 12, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 12; and

[0248] (h) a novel bidirectional artificial polyA signal motif of the present invention;

[0249] (i) an MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention;

[0250] or

[0251] (a) a MDV CVI988 MDV89 gene polyA signal motif of the present invention;

[0252] (b) an mCMV promoter, which comprises or consists of a sequence of SEQ ID NO: 14, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription;

[0253] (c) a heterologous polynucleotide encoding IBDV VP2 antigen, e.g., comprising or consisting of a sequence as shown in SEQ ID NO: 7, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 7;

[0254] (d) a stop codon, e.g., SEQ ID NO: 58;

[0255] (e) an optimized IRES of the present invention;

[0256] (f) a heterologous polynucleotide encoding ILTV gD antigen, e.g., comprising or consisting of a sequence as shown in SEQ ID NO: 12, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 12; and

[0257] (g) a novel bidirectional artificial polyA signal motif of the present invention;

[0258] (h) an MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention;

[0259] (i) an FRT site;

[0260] (j) an artificial reverse tandem polyA signal motif of the present invention.

[0261] In one or more embodiments, said expression cassette further comprises a heterologous polynucleotide coding for another avian pathogen antigen.

[0262] In some preferred embodiments of recombinant MDVs of the present invention, the mCMV promoter comprises or consists of a nucleic acid sequence as shown in SEQ ID NO: 14, or a nucleic acid sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription.

[0263] In some preferred embodiments of recombinant MDVs of the present invention, the amino acid sequence at the protease cleavage site of the NDV F antigen has been mutated. In some preferred embodiments of recombinant MDVs of the present invention, the coding sequence for the NDV F antigen is derived from the wildtype gene, or is codon-optimized, and thus the heterologous polynucleotide encoding NDV F antigen comprises or consists of a nucleic acid sequence as shown in any one of SEQ ID NOs: 2-4 and 63, or a nucleic acid sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with any one of SEQ ID NOs: 2-4 and 63.

[0264] In some preferred embodiments of recombinant MDVs of the present invention, the coding sequence for the ILTV gD antigen is wildtype or codon-optimized, and thus the heterologous polynucleotide encoding ILTV gD antigen comprises or consists of a nucleic acid sequence as shown in SEQ ID NO: 12 or 13, or a nucleic acid sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 12 or 13.

[0265] In some preferred embodiments of recombinant MDVs of the present invention, the coding sequence for the IBDV VP2 antigen is wildtype or codon-optimized, and thus the heterologous polynucleotide encoding IBDV VP2 antigen comprises or consists of a nucleic acid sequence as shown in SEQ ID NO: 6, 7, 9 or 10, or a nucleic acid sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 6, 7, 9 or 10.

[0266] Furthermore, the present invention provides a recombinant MDV comprising the heterologous polynucleotide encoding IBDV VP2 antigen. In some preferred embodiments, the IBDV VP2 antigen is an VP2 antigen from nVar IBDV, preferably said IBDV VP2 antigen

[0267] (a) is encoded by the heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 10, or 9, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 10, or 9, and / or

[0268] (b) comprises or consists of an amino acid sequence as shown in SEQ ID NO: 8, or an amino acid sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 8.

[0269] In some preferred embodiments, the heterologous polynucleotide encoding IBDV VP2 antigen is inserted into the intergenic region between UL55 and MDV71 genes, e.g., between the stop codon of UL55 gene and the stop codon of MDV71 gene, preferably between the HVT genome sequences atcgctatgcaaagagatgcgtgtgtacacgcgccgttga (SEQ ID NO: 26) and ttaagatgcaggagtaacaatgtgcatagtaggcgtagtt (SEQ ID NO: 29) , more preferably inserted in between the HVT genome sequences tatatgttattaaataaaataattgaccagtgaacaattt (SEQ ID NO: 27) and gtttaatgttagtttattcaatgcattggttgcaaatatt (SEQ ID NO: 28) . In some other embodiments, the heterologous polynucleotide is inserted atan insertion site located in the intergenic region between UL26 and UL27 genes.

[0270] In a preferred embodiment, the recombinant MDV comprises an mCMV promoter flanking the 5’end of the heterologous polynucleotide and being operably linked thereto.

[0271] In an exemplary embodiment of the present invention, the recombinant MDV further comprises a heterologous polynucleotide encoding an ILTV gD antigen, which lies preferably 3’ to the heterologous polynucleotide encoding the IBDV VP2 antigen. In a preferred embodiment, the two heterologous polynucleotides are linked by an IRES element or a stop codon+IRES.

[0272] In another exemplary embodiment of the present invention, the recombinant MDV comprises a heterologous polynucleotide encoding IBDV VP2 antigen and a heterologous polynucleotide encoding an ILTV gD antigen, wherein the heterologous polynucleotide encoding IBDV VP2 antigen comprises or consists of a nucleic acid sequence as shown in SEQ ID NO: 6, 7, 9 or 10, or a nucleic acid sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 6, 7, 9 or 10,

[0273] and / or

[0274] the heterologous polynucleotide encoding ILTV gD antigen comprises or consists of a nucleic acid sequence as shown in SEQ ID NO: 12 or 13, or a nucleic acid sequence sharing at least 80%identity, preferably at least 85%identity, preferably at least 90%identity, preferably at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 12 or 13.

[0275] In a preferred embodiment, the recombinant MDV comprises a heterologous polynucleotide encoding IBDV VP2 antigen and a heterologous polynucleotide encoding ILTV gD antigen, wherein, the IBDV VP2 antigen is encoded by the heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 7, or 10, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 7 or 10,

[0276] and / or

[0277] the ILTV gD antigen is encoded by the heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 13 or 12, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 13 or 12.

[0278] In a more preferred embodiment, the heterologous polynucleotide encoding IBDV VP2 antigen and the heterologous polynucleotide encoding ILTV gD antigen are operably linked to each other via an IRES element or via a stop codon+IRES or via a self-cleaving peptide-coding sequence or via a stop codon+ coding sequence for self-cleavage peptide.

[0279] In a more preferred embodiment, the heterologous polynucleotides are inserted to an insertion site located in the intergenic region between UL55 and MDV71 genes.

[0280] In another aspect, the present invention provides an optimized Internal Ribosomal Entry Site (IRES) element, which is derived from the IRES of Encephalomyocarditis Virus (EMCV) and engineered to be more potent in promoting the expression of the second gene in the bicistronic, comprising or consisting of a nucleic acid sequence as shown in SEQ ID NO: 15, or a nucleic acid sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 15 and can recruit the ribosome to initiate the translation. Therefore, in some preferred embodiments of recombinant MDVs of the present invention, the IRES element used therein is the novel optimized IRES of the present invention as described above.

[0281] As described in the background art, selecting available insertion sites in the MDV genome is restricted, and thus a further problem faced for the construction of recombinant MDV candidates of the present invention is that promoter resources are limited either in a multi-genes co-expression system. Heterologous strong promoters are conventionally used in the art, but in the previous study, the inventors found that the introduction of such heterologous promoters often interferes with the expression of endogenous genes, and the expression efficiency of heterologous genes is not so high either. In this regard, the inventors innovatively employ the MDV endogenous UL26 / 26.5 gene promoter. In a first way, the MDV endogenous UL26 / 26.5 gene promoter is copied to a different position as an exogenous element and found to be ideally compatible and potent for driving the transcription of the heterologous gene in MDV. In a second way, the heterologous gene was placed after the stop codon of the endogenous UL26 / UL26.5 gene, connected thereto via an IRES element or via a stop codon+IRES, so that when the transcription of said endogenous gene was initiated by its promoter, the heterologous gene also got transcribed and translated via said IRES.

[0282] In some embodiments of the present disclosure, the MDV endogenous promoter, e.g., any of UL26 / UL26.5 / UL27 gene promoters, is copied to a different position (e.g., in a neighboring region or adjacent region) as an exogenous element, and, not intended to be limited theoretically, due to its endogenous nature, the promoter possesses good compatibility to the endogenous genomic environment and is found to be ideally compatible and potent for driving the transcription of the heterologous gene (s) in MDV.

[0283] For expression cassettes using a heterologous strong promoter (e.g., mCMV promoter) , the inventors similarly introduced an IRES element or a self-cleavage sequence to express two heterologous genes as a bicistronic mRNA by a single promoter.

[0284] Due to the strong elongation ability of the MDV UL26 / 26.5 gene promoter or the mCMV promoter in transcription, both gene sequences were able to be well transcribed.

[0285] Meanwhile, to address the problem that the known IRES sequences usually translate the second gene less efficiently than the gene before IRES, we provided an optimized IRES element, which, combined with codon-optimized coding sequences, also significantly promoted the expression of the second gene in the bicistronic.

[0286] To solve the transcriptional interference problem of exogenous gene cassettes due to read-through of endogenous promoters, the inventors cleverly introduced MDV-derived short polyA signal motifs (70-110bp) and an artificial polyA motif of only 54bp, and placed one or more of polyA signal motifs to the upstream and / or downstream of the heterologous genes. In some preferred embodiments of the present invention, the polyA signal motifs of the present invention can promote the termination of the encountered transcriptional elongation, which is preferably along either of the two genome DNA strands. Thus, the polyA signal motifs in the recombinant MDV and / or expression cassette of the present invention would then provide stronger transcription termination and block the genes in the upstream and / or the downstream from transcriptionally extending / elongating into the insert. Due to the optimized short sequence, the polyA motifs of the present invention remain shorter even in tandem than the commonly used eukaryotic polyA motifs such as SV40 polyA signal motif, BGH polyA signal motif, and the like, thus allowing more room for antigenic genes.

[0287] In a further aspect of the present invention, provided is the use of one or more of the following elements in the manufacture of a recombinant virus:

[0288] (1) the optimized IRES element of the present invention,

[0289] (2) endogenous UL26 promoter of MDV, comprising or consisting of a sequence of SEQ ID NO: 21, or a sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 21 and can bind an RNA polymerase to initiate transcription;

[0290] (3) endogenous UL26.5 promoter of MDV, comprising or consisting of a sequence of SEQ ID NO: 20, or a sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 20 and can bind an RNA polymerase to initiate transcription;

[0291] (4) endogenous UL26 polyA signal of MDV, comprising or consisting of a sequence of SEQ ID NO: 22, or a sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 22;

[0292] (5) mCMV promoter, comprising or consisting of a sequence of SEQ ID NO: 14, or a sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription;

[0293] (6) the artificial reverse tandem polyA signal motif of the present invention;

[0294] (7) the novel bidirectional artificial polyA signal motif of the present invention;

[0295] (8) the MDV CVI988 MDV89 gene polyA signal motif of the present invention;

[0296] (9) the MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention, wherein, preferably, said recombinant virus is a recombinant MDV (such as recombinant HVT) comprising at least one heterologous polynucleotide encoding at least one (e.g., one) antigen of an avian pathogen, and wherein the at least one or more heterologous polynucleotides are operably linked to the one or more elements listed above.

[0297] In another aspect of the present invention, on the basis of the various kinds of gene elements (coding sequences, regulatory sequences, and the like) as described above, expression cassettes are provided, which are suitable for integration into various kinds of expression vectors, especially recombinant MDVs, for the purpose of expressing the heterologous polynucleotides comprised in the expression cassettes under appropriate conditions, preferably suitable for expressing the heterologous polynucleotides comprised therein under appropriate conditions when inserted at the preferable novel insertion site of the present invention.

[0298] In some embodiments, the expression cassettes of the present invention comprise one or more heterologous polynucleotides encoding at least one (e.g., one) antigen of an avian pathogen. In some preferred embodiments, said at least one antigen is one or more, e.g., one or two, selected from the group consisting of the NDV F antigen, IBDV (e.g., vv IBDV or nVar IBDV) VP2 antigen and ILTV gD antigen as described above herein. In some particular embodiments, the expression cassettes comprise a heterologous polynucleotide encoding NDV F antigen. In some particular embodiments, the expression cassettes comprise heterologous polynucleotides encoding IBDV (e.g., vv IBDV or nVar IBDV) VP2 antigen and ILTV gD antigen.

[0299] In some embodiments, the expression cassette expresses in the forward orientation. In some embodiments, the expression cassette expresses in the reverse orientation.

[0300] In some particular embodiments, the expression cassette further comprises a promoter sequence, which is operably linked to one or more heterologous polynucleotides. In some more particular embodiments, the promoter is heterologous. In some other more particular embodiments, the promoter is homologous.

[0301] In some other particular embodiments, said expression cassette does not comprise a promoter. In some preferred embodiments, the expression cassette does not comprise a promoter, but the insertion of the expression cassette into the target sequence (e.g., sequence of the viral genome) allows the heterologous polynucleotide in the expression cassette being operably linked to the endogenous promoter originally present in the MDV genome.

[0302] In one or more embodiments, said expression cassette comprises one or more polyA signal motifs to promote the transcriptional termination of said heterologous polynucleotides encoding avian pathogen antigens and / or to block the transcription of the flanking genes (e.g., endogenous viral genes) in either or both flanks.

[0303] In one or more embodiments, said polyA signal motif is BGH polyA signal motif and / or SV40 polyA signal motif. In one or more embodiments, said polyA signal motif is one or more polyA signal motifs of the present invention as above described.

[0304] In one or more embodiments, the expression cassette comprises a polyA signal motif at either end of the cassette. In one or more embodiments, the expression cassette comprises at least two polyA signal motifs at both ends of the cassette, thereby promoting the transcriptional termination of the heterologous polynucleotides in the cassette and blocking the expression of the genes flanking the cassette. In some other embodiments, said expression cassette does not comprise an exogenous polyA signal motif, but the insertion of the expression cassette into the target sequence of the viral genome allows the heterologous polynucleotide in the expression cassette being operably linked to the endogenous polyA signal motif originally present in the viral genome, e.g., the MDV genome, the HVT genome.

[0305] In some more particular embodiments, the expression cassette further comprises a recognition site of site-specific recombinases, e.g., a recognition site of Flp recombinase, a recognition site of CRE / lox recombinase, a recognition site of PHIC31 recombinase, a recognition site of DRE recombinase, a recognition site of VIKA recombinase, and the like. Unless otherwise indicated, when referring to the expression cassette in the context of the present invention, the recognition site is a scar sequence of the elimination of BAC vector during preorder operations of the construction, and is functionally silent without any disturbance to the functions of other elements in the expression cassette.

[0306] In some particular embodiments, the present invention provides an expression cassette comprising one or more of the following elements: (1) the optimized IRES element of the present invention, (2) the artificial reverse tandem polyA signal motif of the present invention; (3) the novel bidirectional artificial polyA signal motif of the present invention; (4) the MDV CVI988 MDV89 gene polyA signal motif of the present invention; (5) the MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention, and one or more heterologous polynucleotides encoding an antigen of an avian pathogen, preferably an IBDV VP2 antigen, an ILTV gD antigen and / or an NDV F antigen.

[0307] In some particular embodiments, the present invention provides an expression cassette comprising or consisting of in this order: (1) an optional polyA signal motif; (2) a promoter; (3) one or more heterologous polynucleotides encoding an antigen of an avian pathogen; (4) one or more polyA signal motifs in tandem, being operably linked, wherein said heterologous polynucleotide (s) encodes one or two polypeptides selected from the group consisting of an IBDV VP2 antigen, an ILTV gD antigen and an NDV F antigen, wherein the polyA signal motif of (1) , if any, could be the same or different with the polyA signal motif of (4) , and wherein the expression cassette could be used to insert into the genome of a recombinant MDV, expressing said heterologous polynucleotides in the forward orientation or the reverse orientation.

[0308] In some more particular embodiments, said heterologous polynucleotide encodes the IBDV VP2 antigen. In some more particular embodiments, the IBDV VP2 antigen is as defined above, and / or the promoter is the mCMV promoter as defined above, and / or the polyA signal motif of (1) is the artificial reverse tandem polyA signal motif of the present invention, and / or the polyA signal motifs of (4) are the novel bidirectional artificial polyA signal motif and the MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention. In some more particular embodiments, said heterologous polynucleotide encodes the IBDV VP2 antigen is followed by a backup stop codon.

[0309] In some more particular embodiments, said heterologous polynucleotide encodes the NDV F antigen. In some more particular embodiments, the NDV F antigen is as defined above. In some more particular embodiments, the promoter is exogenous and the same with the endogenous UL26.5 promoter of MDV. In some more particular embodiments, the polyA signal motif of (1) is absent. In some more particular embodiments, the polyA signal motif of (4) is the MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention. In some preferred embodiments, the heterologous polynucleotide is expressed in the reverse orientation. In some more particular embodiments, said heterologous polynucleotide encodes the NDV F antigen is followed by a backup stop codon.

[0310] In some more particular embodiments, said heterologous polynucleotides encode the IBDV VP2 antigen and the ILTV gD antigen. In some more particular embodiments, the heterologous polynucleotide encoding IBDV VP2 antigen and the heterologous polynucleotide encoding ILTV gD antigen are operably linked to each other via an IRES element or a 2A peptide-coding sequence, preferably an IRES element. In some more particular embodiments, the IBDV VP2 antigen and / or the ILTV gD antigen are as defined above, and / or the promoter is the mCMV promoter as defined above, and / or the IRES is the optimized IRES element of the present invention. In some more particular embodiments, said heterologous polynucleotide encodes the ILTV gD antigen is followed by a backup stop codon.

[0311] In some even more particular embodiments the polyA signal motif of (1) is the artificial reverse tandem polyA signal motif of the present invention, and / or the polyA signal motifs of (4) are the novel bidirectional artificial polyA signal motif and the MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention. In some preferred embodiments, the heterologous polynucleotides are expressed in the forward orientation.

[0312] In some other even more particular embodiments, the polyA signal motif of (1) is the artificial reverse tandem polyA signal motif of the present invention, and / or the polyA signal motifs of (4) are the novel bidirectional artificial polyA signal motif, the MDV39 / 40-intergenic bidirectional polyA signal motif and the MDV CVI988 MDV89 gene polyA signal motif of the present invention. In some preferred embodiments, the expression cassette further comprises a nonfunctioning FRT site inserted among the polyA signal motifs of (4) , and the heterologous polynucleotides are expressed in the reverse orientation.

[0313] In some particular embodiments, the present invention provides an expression cassette comprising or consisting of in this order: (1) an IRES element or a stop codon+IRES or a 2A peptide-coding sequence or a stop codon+2A peptide-coding sequence; (2) one or more heterologous polynucleotides encoding an antigen of an avian pathogen, being operably linked, wherein said heterologous polynucleotide (s) encodes one polypeptide selected from the group consisting of an IBDV VP2 antigen, an ILTV gD antigen and an NDV F antigen, and wherein the expression cassette could be used to insert into the genome of a recombinant MDV to be operably linked to an endogenous gene in the reverse orientation or preferably the forward orientation, and express said heterologous polynucleotide in a same orientation.

[0314] In some more particular embodiments, said heterologous polynucleotide encodes the NDV F antigen. In some more particular embodiments, the NDV F antigen is as defined above. In some more particular embodiments, the NDV F antigen comprises or consists of an amino acid sequence as shown in SEQ ID NO: 1, or an amino acid sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 1. In some more particular embodiments, the element of (1) is an optimized IRES element of the present invention. In some more particular embodiments, the element of (1) is a stop codon + an optimized IRES element of the present invention, wherein the stop codon is directly 5’ flanking the IRES.

[0315] In a preferred particular embodiment, the present invention provides Expression Cassette 1, which comprises a heterologous polynucleotide coding for and expressing an NDV F antigen, optionally codon-optimized, of the present invention. In some more preferred embodiments, the amino acid sequence at the protease cleavage site of the NDV F antigen has been mutated. In some more preferred embodiments, Expression Cassette 1 expresses in the forward orientation when inserted into the MDV genome, i.e., same with the orientation of UL26 and UL55. In some more preferred embodiments, Expression Cassette 1 further comprises an IRES element operably linked to the heterologous polynucleotide coding the NDV F antigen, e.g., the optimized IRES of the present invention. In some more preferred embodiments, Expression Cassette 1 is operably linked to, when inserted into the MDV genome, the endogenous UL26 promoter of MDV and / or the endogenous UL26.5 promoter of MDV, and / or the endogenous UL26 / UL26.5 polyA signal motif of MDV. In some even more particular embodiments, Expression Cassette 1 comprises or consists essentially of or consists of a heterologous polynucleotide coding for and expressing an NDV F antigen, and an optimized IRES of the present invention being upstream to and operably linked to the heterologous polynucleotide.

[0316] In some even more particular embodiments, Expression Cassette 1 comprises or consists of in 5’ to 3’ direction and in this order: (a) an IRES or a stop codon+IRES (wherein the stop codon is directly 5’flanking the IRES) , e.g., an optimized IRES, such as an optimized IRES of the present invention; (b) a heterologous polynucleotide encoding cleavage site-mutated NDV F, e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 4 or 63, 2, or 3, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 4 or 63, 2, or 3; and optional (c) a polyA signals core sequence, e.g., comprising or consisting of a sequence as shown in SEQ ID NO: 61 or 62, and preferably, Expression Cassette 1 is or is designed to be placed after the stop codon of the endogenous UL26 / UL26.5 gene, and under the control of the endogenous UL26 promoter of MDV, and / or under the control of the endogenous UL26.5 promoter of MDV, thereby the promoters and polyA signal motifs are operatively linked to the heterologous polynucleotide encoding NDV F.

[0317] In some particular embodiments, Expression Cassette 1 comprises element (c) . In some other particular embodiments, Expression Cassette 1 does not comprise element (c) .

[0318] In some even more particular embodiments, Expression Cassette 1 comprises or consists of SEQ ID NO: 31 or 64.

[0319] In some particular embodiments, the present invention provides a recombinant MDV comprising Expression Cassette 1, preferably inserted at the novel insertion site of the present invention.

[0320] In some particular embodiments, the present invention provides a recombinant HVT comprising SEQ ID NO: 31 or 64, preferably inserted at the site between the HVT genome DNA sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and aaagcggtgtgttaatgtcagagagctgta (SEQ ID NO: 24) , i.e., between the 30th nucleotide and the 31st nucleotide of the sequence as shown in SEQ ID NO: 36.

[0321] In a preferred particular embodiment, the present invention provides Expression Cassette 2, which comprises a heterologous polynucleotide coding for and expressing an IBDV VP2 antigen, optionally codon-optimized, of the present invention, and a heterologous polynucleotide coding for and expressing an ILTV gD antigen, optionally codon-optimized, of the present invention. In some more preferred embodiments, the heterologous polynucleotide encodes the IBDV VP2 antigen is followed by a backup stop codon. In some more preferred embodiments, the heterologous polynucleotide encodes the ILTV gD antigen is followed by a backup stop codon. In some more preferred embodiments, Expression Cassette 2 expresses in the forward orientation when inserted into the MDV genome, i.e., same with the orientation of UL26 and UL55. In some more preferred embodiments, Expression Cassette 2 further comprises an IRES element connecting the two heterologous polynucleotides, e.g., the optimized IRES of the present invention. In some more preferred embodiments, Expression Cassette 2 further comprises a polyA signal motif and a promoter operably linked to the heterologous polynucleotides. In some more preferred embodiments, Expression Cassette 2 comprises polyA signal motifs at both ends of the cassette, thereby promoting the transcriptional termination of the heterologous polynucleotides in the cassette and blocking the expression of the genes flanking the cassette. In some more preferred embodiments, Expression Cassette 2 further comprises a recognition site of site-specific recombinases, e.g., a recognition site of Flp recombinase, a recognition site of CRE / lox recombinase, a recognition site of PHIC31 recombinase, a recognition site of DRE recombinase, a recognition site of VIKA recombinase, and the like. In some more preferred embodiments, said promoter is a murine cytomegalovirus IE1 gene promoter (mCMV promoter) , e.g., as defined above. In some even more particular embodiments, Expression Cassette 2 comprises or consists essentially of or consists of from the 5’ end an artificial reverse tandem polyA signal motif of the present invention, an FRT site which is a scar sequence, an mCMV promoter as defined above, a codon-optimized vv IBDV VP2 gene, a stop codon, an optimized IRES of the present invention, a wildtype ILTV gD gene, and a novel bidirectional artificial polyA signal motif of the present invention and the MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention in tandem.

[0322] In some even more particular embodiments, Expression Cassette 2 comprises or consists of in 5’ to 3’ direction and in this order: (a) an artificial reverse tandem polyA signal motif, e.g., an artificial reverse tandem polyA signal motif of the present invention; (b) an FRT site; (c) an mCMV promoter, e.g., an mCMV promoter comprising or consisting of a sequence of SEQ ID NO: 14, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription; (d) a heterologous polynucleotide encoding IBDV VP2 antigen, e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 6 or 7, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 6 or 7; (e) a stop codon, e.g., SEQ ID NO: 58; (f) an optimized IRES, e.g., an IRES of the present invention; (g) a heterologous polynucleotide encoding ILTV gD antigen, e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 12, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 12; and (h) a combination of a novel bidirectional artificial polyA signal motif and an MDV39 / 40-intergenic bidirectional polyA signal motif in tandem, e.g., a combination of a novel bidirectional artificial polyA signal motif of the present invention and an MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention in tandem.

[0323] In some even more particular embodiments, Expression Cassette 2 comprises or consists of SEQ ID NO: 32 or 56.

[0324] In some particular embodiments, the present invention provides a recombinant MDV comprising Expression Cassette 2, preferably inserted at the insertion site between UL55 and MDV71 genes of the MDV genome as described above.

[0325] In some particular embodiments, the present invention provides a recombinant HVT comprising SEQ ID NO: 32 or 56, preferably inserted at the site between the HVT genome DNA sequences tatatgttattaaataaaataattgaccagtgaacaattt (SEQ ID NO: 27) and gtttaatgttagtttattcaatgcattggttgcaaatatt (SEQ ID NO: 28) , i.e., between the 118th nucleotide and the 119th nucleotide of the sequence as shown in SEQ ID NO: 37.

[0326] In a preferred particular embodiment, the present invention provides Expression Cassette 3, which comprises a heterologous polynucleotide coding for and expressing an IBDV VP2 antigen, which is wildtype or codon-optimized, preferably wildtype, of the present invention, and a heterologous polynucleotide coding for and expressing an ILTV gD antigen, which is wildtype or codon-optimized, preferably wildtype, of the present invention. In some more preferred embodiments, the heterologous polynucleotide encodes the IBDV VP2 antigen is followed by a backup stop codon. In some more preferred embodiments, the heterologous polynucleotide encodes the ILTV gD antigen is followed by a backup stop codon. In some more preferred embodiments, Expression Cassette 3 expresses in the reverse orientation when inserted into the MDV genome, i.e., same with the orientation of UL27 and MDV71. In some more preferred embodiments, Expression Cassette 3 further comprises an IRES element connecting the two heterologous polynucleotides, e.g., the optimized IRES of the present invention. In some more preferred embodiments, Expression Cassette 3 further comprises a polyA signal motif and a promoter operably linked to the heterologous polynucleotides. In some more preferred embodiments, Expression Cassette 3 comprises polyA signal motifs at both ends of the cassette, thereby promoting the transcriptional termination of the heterologous polynucleotides in the cassette and blocking the expression of the genes flanking the cassette. In some more preferred embodiments, Expression Cassette 3 further comprises a recognition site of site-specific recombinases, e.g., a recognition site of Flp recombinase, a recognition site of CRE / lox recombinase, a recognition site of PHIC31 recombinase, a recognition site of DRE recombinase, a recognition site of VIKA recombinase, and the like. In some more preferred embodiments, said promoter is a murine cytomegalovirus IE1 gene promoter (mCMV promoter) , e.g., as defined above. In some even more particular embodiments, Expression Cassette 3 comprises or consists essentially of or consists of from the 5’ end a MDV CVI988 MDV89 gene polyA signal motif of the present invention, an mCMV promoter as defined above, a wildtype vv IBDV VP2 gene, a stop codon, an optimized IRES of the present invention, a wildtype ILTV gD gene, a novel bidirectional artificial polyA signal motif of the present invention and the MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention in tandem, an FRT site which is a scar sequence, and an artificial reverse tandem polyA signal motif of the present invention.

[0327] In some even more particular embodiments, Expression Cassette 3 comprises or consists of in 5’ to 3’ direction and in this order: (a) a MDV CVI988 MDV89 gene polyA signal motif, e.g., a MDV CVI988 MDV89 gene polyA signal motif of the present invention; (b) an mCMV promoter, e.g., an mCMV promoter comprising or consisting of a sequence of SEQ ID NO: 14, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription; (c) a heterologous polynucleotide encoding IBDV VP2 antigen, e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 6, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 6; (d) a stop codon, e.g., SEQ ID NO: 58; (e) an optimized IRES, e.g., an IRES of the present invention; (f) a heterologous polynucleotide encoding ILTV gD antigen, e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 12, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 12; and (g) a combination of a novel bidirectional artificial polyA signal motif and an MDV39 / 40-intergenic bidirectional polyA signal motif in tandem, e.g., a combination of a novel bidirectional artificial polyA signal motif of the present invention and an MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention in tandem; (h) an FRT site; and (i) an artificial reverse tandem polyA signal motif, e.g., an artificial reverse tandem polyA signal motif of the present invention.

[0328] In some even more particular embodiments, Expression Cassette 3 comprises or consists of SEQ ID NO: 33.

[0329] In some particular embodiments, the present invention provides a recombinant MDV comprising Expression Cassette 3, preferably inserted at the insertion site between UL55 and MDV71 genes of the MDV genome as described above.

[0330] In a preferred particular embodiment, the present invention provides Expression Cassette 4, which comprises a heterologous polynucleotide coding for and expressing an nVar IBDV VP2 antigen, optionally codon-optimized, of the present invention. In some more preferred embodiments, the heterologous polynucleotide encodes the IBDV VP2 antigen is followed by a backup stop codon. In some more preferred embodiments, Expression Cassette r expresses in the forward orientation when inserted into the MDV genome, i.e., same with the orientation of UL26 and UL55. In some more preferred embodiments, Expression Cassette 4 further comprises a polyA signal motif and a promoter operably linked to the heterologous polynucleotide. In some more preferred embodiments, Expression Cassette 4 comprises polyA signal motifs at both ends of the cassette, thereby promoting the transcriptional termination of the nVar IBDV VP2 gene in the cassette and blocking the expression of the genes flanking the cassette. In some more preferred embodiments, Expression Cassette 4 further comprises a recognition site of site-specific recombinases, e.g., a recognition site of Flp recombinase, a recognition site of CRE / lox recombinase, a recognition site of PHIC31 recombinase, a recognition site of DRE recombinase, a recognition site of VIKA recombinase, and the like. In some more preferred embodiments, said promoter is a murine cytomegalovirus IE1 gene promoter (mCMV promoter) , e.g., as defined above. In some even more particular embodiments, Expression Cassette 4 comprises or consists essentially of or consists of from the 5’ end an artificial reverse tandem polyA signal motif of the present invention, an FRT site which is a scar sequence, an mCMV promoter as defined above, a codon-optimized nVar IBDV VP2 gene, an optimized IRES of the present invention, a wildtype ILTV gD gene, and a novel bidirectional artificial polyA signal motif of the present invention and the MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention in tandem.

[0331] In some even more particular embodiments, Expression Cassette 4 comprises or consists of in 5’ to 3’ direction and in this order: (a) an artificial reverse tandem polyA signal motif, e.g., an artificial reverse tandem polyA signal motif of the present invention; (b) an FRT site; (c) an mCMV promoter, e.g., an mCMV promoter comprising or consisting of a sequence of SEQ ID NO: 14, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription; (d) a heterologous polynucleotide encoding IBDV VP2 antigen, e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 9 or 10, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 9 or 10; and (e) a combination of a novel bidirectional artificial polyA signal motif and an MDV39 / 40-intergenic bidirectional polyA signal motif in tandem, e.g., a combination of a novel bidirectional artificial polyA signal motif of the present invention and an MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention in tandem.

[0332] In some even more particular embodiments, Expression Cassette 4 comprises or consists of SEQ ID NO: 34.

[0333] In some particular embodiments, the present invention provides a recombinant MDV comprising Expression Cassette 4, preferably inserted at the insertion site between UL55 and MDV71 genes of the MDV genome as described above.

[0334] In a preferred particular embodiment, the present invention provides Expression Cassette 5, which comprises a heterologous polynucleotide coding for and expressing an NDV F antigen, optionally codon-optimized, of the present invention. In some more preferred embodiments, the amino acid sequence at the protease cleavage site of the NDV F antigen has been mutated. In some more preferred embodiments, the heterologous polynucleotide encodes the NDV F antigen is followed by a backup stop codon. In some more preferred embodiments, Expression Cassette 5 expresses in the reverse orientation when inserted into the MDV genome, i.e., same with the orientation of UL27. In some more preferred embodiments, Expression Cassette 5 further comprises an UL26.5 gene promoter, which is thus homologous but exogenously introduced, operably linked to the heterologous polynucleotide coding the NDV F antigen. In some more preferred embodiments, Expression Cassette 5 further comprises a Kozak sequence. In some more preferred embodiments, Expression Cassette 5 comprises a polyadenylation signal core sequence. In some more preferred embodiments, Expression Cassette 5 comprises polyA signal motifs at 3; or both ends of the cassette, thereby promoting the transcriptional termination of the NDV F gene in the cassette and blocking the expression of the genes flanking the cassette. In some even more particular embodiments, Expression Cassette 5 comprises or consists essentially of or consists of a novel bidirectional artificial polyA signal motif of the present invention, an UL26.5 gene promoter as defined above, a Kozak sequence, a heterologous polynucleotide coding for and expressing an NDV F antigen, a polyadenylation signal core sequence, and MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention.

[0335] In some even more particular embodiments, Expression Cassette 5 comprises or consists of in 5’ to 3’ direction and in this order: (a) a novel bidirectional artificial polyA signal motif, e.g., a novel bidirectional artificial polyA signal motif of the present invention; (b) an exogenous promoter same with an MDV endogenous UL26.5 promoter, e.g., a promoter comprises or consists of a sequence of SEQ ID NO: 20, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 20 and can bind an RNA polymerase to initiate transcription; (c) a Kozak sequence; (d) a heterologous polynucleotide encoding cleavage site-mutated NDV F, e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 4, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 4; (e) a polyadenylation signal core sequence, e.g., SEQ ID NO: 61; and (f) an MDV39 / 40-intergenic bidirectional polyA signal motif, e.g., an MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention.

[0336] In some even more particular embodiments, Expression Cassette 5 comprises or consists of SEQ ID NO: 35.

[0337] In some particular embodiments, the present invention provides a recombinant MDV comprising Expression Cassette 5, preferably inserted at the novel insertion site of the present invention.

[0338] In one or more embodiments, the present invention provides recombinant MDV comprising one or more of the above-described expression cassettes of the present invention.

[0339] In one or more embodiments, the present invention provides recombinant MDV comprising one of the above-described expression cassettes of the present invention inserted at the novel insertion site of the present invention.

[0340] In one or more embodiments, the present invention provides recombinant MDV comprising one of the above-described expression cassettes of the present invention inserted at a different insertion site than the novel insertion site of the present invention. In a preferred embodiment, the insertion site is the intergenic region between UL55 and MDV71 genes.

[0341] In one or more embodiments, the present invention provides recombinant MDV comprising two or more of the above-described expression cassettes of the present invention, preferably inserted at two different insertion sites. In some preferred embodiments, a first expression cassette is inserted at the novel insertion site of the present invention, and a second expression cassette is inserted at the following insertion site of the MDV genome: the intergenic region between UL55 and MDV71 genes, the intergenic region between UL3 and UL4 genes, the intergenic region between UL22 and UL23 genes, the intergenic region between UL44 and UL45 genes, the intergenic region between UL45 and UL46 genes, the intergenic region between UL48 and UL49 genes, the intergenic region between UL54 and MDV69 genes, the IG2 region, the intergenic region between US10 and US1 genes, the intergenic region between SORF3 and US2 genes, the US2 locus, the US6 locus, the US7 locus, the US8 locus, the US10 locus, and the intergenic region between US10 and SORF3 genes, preferably the intergenic region between UL55 and MDV71 genes.

[0342] In one particular embodiment, the present invention provides a recombinant HVT rHVT-nVarIBD (clone codename of the strain: HVT14) .

[0343] As shown in Table 1 and Figure 2, Exemplary Expression Cassette 4 is inserted into the intergenic sequence between HVT065 (UL55) and HVT066 (MDV71) in the UL region of the HVT genome, thereby constructing strain HVT14.

[0344] In HVT14, the insertion site is between the sequence 112048bp-tatatgttattaaataaaataattgaccagtgaacaattt -112087bp (SEQ ID NO: 27) and 112088bp-gtttaatgttagtttattcaatgcattggttgcaaatatt-112127bp (SEQ ID NO: 28) of the HVT genome (Genbank accession ID: NC_002641) .

[0345] Exemplary Expression Cassette 4 (SEQ ID NO: 34) consists essentially of an artificial reverse tandem polyA signal motif (SEQ ID NO: 34, 1-50bp, i.e., SEQ ID NO: 16) , an FRT site sequence which is a sequence scar left by the elimination of BAC vector (SEQ ID NO: 34, 51-84bp, i.e., SEQ ID NO: 30) , an mCMV promoter (SEQ ID NO: 34, 85-1505bp, i.e., SEQ ID NO: 14) , a codon-optimized nVar IBDV VP2 gene (SEQ ID NO: 34, 1506-2867bp, i.e., SEQ ID NO: 10) , and a novel bidirectional artificial polyA signal motif (SEQ ID NO: 34, 2868-2916bp, i.e., SEQ ID NO: 17) and the MDV39 / 40-intergenic bidirectional polyA signal motif (SEQ ID NO: 34, 2917-2986bp, i.e., SEQ ID NO: 19) in tandem.

[0346] According to experimental data not shown herein, the codon-optimized nVar IBDV VP2 gene could be replaced by wildtype / codon-optimized nVar IBDV VP2 gene or vv IBDV VP2 gene, e.g., SEQ ID NO: 6, 7 or 10.

[0347] Table 1. Elements of Exemplary Expression Cassette 4

[0348] In one particular embodiment, the present invention provides a recombinant HVT rHVT-ND (clone codename of the strain: HVT15) .

[0349] As shown in Table 2 and Figure 1, Exemplary Expression Cassette 1 is inserted into the intergenic sequence between HVT033 (UL26) and HVT035 (UL27) genes in the UL region of the HVT genome, thereby constructing strain HVT15.

[0350] In HVT15, the insertion site is between the sequence 52408bp-tttattagccacatgatgacccatcgctga-52437bp (SEQ ID NO: 23) and 52438bp-aaagcggtgtgttaatgtcagagagctgta-52467bp (SEQ ID NO: 24) of the HVT genome (Genbank accession ID: NC_002641) .

[0351] Exemplary Expression Cassette 1 (SEQ ID NO: 31) does not comprise any promoter sequence. Upon insertion into the genome, Exemplary Expression Cassette 1 would be operably linked to and driven by endogenous HVT033 promoter (SEQ ID NO: 21) and endogenous HVT034 promoter (SEQ ID NO: 20) together, and the transcription would be terminated by endogenous HVT033 / HVT034 polyA signal motif (SEQ ID NO: 22) which is also operably linked to Exemplary Expression Cassette 1. The heterologous NDV F gene would be co-transcribed with HVT033 and HVT034 to obtain one multicistronic messenger RNA.

[0352] Exemplary Expression Cassette 1 consists essentially of a codon-optimized NDV F gene (SEQ ID NO: 31, 632-2293bp, i.e., SEQ ID NO: 4) and a stop codon (SEQ ID NO: 31, 1-3 bp, i.e., SEQ ID NO: 57) + an Encephalomyocarditis Virus (EMCV) -derived optimized IRES (SEQ ID NO: 31, 4-631bp, i.e., SEQ ID NO: 15) upstream to the NDV F gene, wherein the NDV F antigen comprise a mutated amino acid sequence of the protease cleavage site. The IRES element would initiate the translation and obtain the expected NDV F antigen protein (SEQ ID NO: 1) .

[0353] For the purpose of facilitating the cloning protocol, Exemplary Expression Cassette 1 may be modified to its equivalent variant, Exemplary Expression Cassette 1', which differs from Exemplary Expression Cassette 1 by only 4～10 nucleotides at the 3’ end (i.e., more than 99.5%sequence identity therebetween) . for example, by further introducing a polyA signals core sequence AATAAA (SEQ ID NO: 62) , and / or by substituting several nucleotides (e.g., 4 substitutions) at the 3’ end of the NDV F gene, e.g., obtaining the NDV F gene sequence as shown in SEQ ID NO: 63. The present invention provides a specific embodiment of Exemplary Expression Cassette 1’ , with the sequence as shown in SEQ ID NO: 64, incorporating both of the aforementioned modifications.

[0354] According to experimental data not shown herein, the codon-optimized gene of cleavage site-mutated NDV F could be replaced by other NDV F gene derived from the wildtype, or codon-optimized, e.g., SEQ ID NO: 2 or 3.

[0355] Table 2. Elements of Exemplary Expression Cassette 1 or 1’

[0356] In one particular embodiment, the present invention provides a recombinant HVT rHVT-IBD-ILT (clone codename of the strain: HVT22) .

[0357] As shown in Table 3 and Figure 3, Exemplary Expression Cassette 2 is inserted at the preferable second insertion site, i.e., the intergenic sequence between HVT065 (UL55) and HVT066 (MDV71) in the UL region of the HVT genome, thereby constructing strain HVT22. The insertion site is between the sequence 112048bp-tatatgttattaaataaaataattgaccagtgaacaattt -112087bp (SEQ ID NO: 27) and 112088bp-gtttaatgttagtttattcaatgcattggttgcaaatatt-112127bp (SEQ ID NO: 28) of the HVT genome (Genbank accession ID: NC_002641) .

[0358] Exemplary Expression Cassette 2 (SEQ ID NO: 32) consists essentially of an artificial reverse tandem polyA signal motif (SEQ ID NO: 32, 1-50bp, i.e., SEQ ID NO: 16) , an FRT site sequence which is a scar sequence left by the elimination of BAC vector (SEQ ID NO: 32, 51-84bp, i.e., SEQ ID NO: 30) , an mCMV promoter (SEQ ID NO: 32, 85-1505bp, i.e., SEQ ID NO: 14) , a codon-optimized vv IBDV VP2 gene (SEQ ID NO: 32, 1506-2867bp, i.e., SEQ ID NO: 7) , a (backup) stop codon (SEQ ID NO: 32, 2868-2870bp, i.e., SEQ ID NO: 58) , an EMCV-derived optimized IRES (SEQ ID NO: 32, 2871-3498bp, i.e., SEQ ID NO: 14) , a wildtype ILTV gD gene (SEQ ID NO: 32, 3499-4803bp, i.e., SEQ ID NO: 12) and a novel bidirectional artificial polyA signal motif (SEQ ID NO: 32, 4804-4852bp, i.e., SEQ ID NO: 17) and the MDV39 / 40-intergenic bidirectional polyA signal motif (SEQ ID NO: 32, 4853-4922bp, i.e., SEQ ID NO: 19) in tandem.

[0359] According to experimental data not shown herein, the codon-optimized vv IBDV VP2 gene could be replaced by wildtype / codon-optimized nVar IBDV VP2 gene or vv IBDV VP2 gene, e.g., SEQ ID NO: 6, 9 or 10; the wildtype ILTV gD gene could be replaced by codon-optimized ILTV gD gene, e.g., SEQ ID NO: 13.

[0360] Table 3. Elements of Exemplary Expression Cassette 2

[0361] In one particular embodiment, the present invention provides a multivalent recombinant HVT rHVT-ND-IBD-ILT (clone codename of the strain: HVT35) .

[0362] Exemplary Expression Cassette 1, identical with that in HVT15, and Exemplary Expression Cassette 2, identical with that in HVT22, are inserted at two different sites in the UL region of the HVT genome, respectively, thereby constructing strain HVT35, which expresses three heterologous antigens (see Figure 4) .

[0363] Exemplary Expression Cassette 1 consists of the same elements and nucleic acid sequences as Exemplary Expression Cassette 1 in HVT15, and is also inserted at the same site.

[0364] Exemplary Expression Cassette 2 consists of the same elements and nucleic acid sequences as Exemplary Expression Cassette 2 in HVT22, and is also inserted at the same site.

[0365] In one particular embodiment, the present invention provides a multivalent recombinant HVT rHVT-ND-IBD-ILT (clone codename of the strain: HVT38) .

[0366] Exemplary Expression Cassette 1 and Exemplary Expression Cassette 3 are inserted at two different sites in the UL region of the HVT genome, respectively, thereby constructing strain HVT38, which expresses three heterologous antigens (see Figure 5) .

[0367] Exemplary Expression Cassette 1' (SEQ ID NO: 64) , as described above, involves tiny modifications to the sequence of the 3'end of Exemplary Expression Cassette 1 in HVT15 and HVT35, and is also inserted at the same site.

[0368] As shown in Table 4, Exemplary Expression Cassette 3 is also inserted at the same site where Exemplary Expression Cassette 2 is inserted in HVT22 and HVT35. However, Exemplary Expression Cassette 3 expressed in an opposite orientation, that is, Exemplary Expression Cassette 3 lies in the complementary strand of Exemplary Expression Cassette 2. Moreover, e.g., going from Exemplary Expression Cassette 2 to Exemplary Expression Cassette 3, the codon-optimised IBDV VP2 gene is also replaced with a wild-type IBDV VP2 gene.

[0369] Exemplary Expression Cassette 3 (SEQ ID NO: 33) consists essentially of an MDV CVI988 MDV89 gene polyA signal motif (SEQ ID NO: 33, 1-110bp, i.e., SEQ ID NO: 14) , an mCMV promoter (SEQ ID NO: 33, 111-1531bp, i.e., SEQ ID NO: 14) , a wildtype vv IBDV VP2 gene (SEQ ID NO: 33, 1532-2893bp, i.e., SEQ ID NO: 6) , a (backup) stop codon (SEQ ID NO: 33, 2894-2896bp, i.e., SEQ ID NO: 58) , an EMCV-derived optimized IRES (SEQ ID NO: 33, 2897-3524bp, i.e., SEQ ID NO: 15) , a wildtype ILTV gD gene (SEQ ID NO: 33, 3525-4829bp, i.e., SEQ ID NO: 12) , a novel bidirectional artificial polyA signal motif (SEQ ID NO: 33, 4830-4878bp, i.e., SEQ ID NO: 17) and the MDV39 / 40-intergenic bidirectional polyA signal motif (SEQ ID NO: 33, 4879-4948bp, i.e., SEQ ID NO: 19) in tandem, an FRT site sequence which is a scar sequence left by the elimination of BAC vector (SEQ ID NO: 33, 4949-4982bp, i.e., complementary to SEQ ID NO: 30) and an artificial reverse tandem polyA signal motif (SEQ ID NO: 33, 4983-5032bp, i.e., complementary to SEQ ID NO: 16) .

[0370] According to experimental data not shown herein, the wildtype vv IBDV VP2 gene could be replaced by wildtype / codon-optimized nVar IBDV VP2 gene or vv IBDV VP2 gene, e.g., SEQ ID NO: 7, 9 or 10; the wildtype ILTV gD gene could be replaced by codon-optimized ILTV gD gene, e.g., SEQ ID NO: 13.

[0371] Table 4. Elements of Exemplary Expression Cassette 3

[0372] In one particular embodiment, the present invention provides a multivalent recombinant HVT rHVT-ND-IBD-ILT (clone codename of the strain: HVT39) .

[0373] Exemplary Expression Cassette 5 and Exemplary Expression Cassette 3 are inserted at two different sites in the UL region of the HVT genome, respectively, thereby constructing strain HVT39, which expresses three heterologous antigens (see Figure 6) .

[0374] Exemplary Expression Cassette 3 consists of the same elements and nucleic acid sequences as Exemplary Expression Cassette 3 in HVT38, and is also inserted at the same site and expresses in the same orientation.

[0375] As shown in Table 5, Exemplary Expression Cassette 5 is also inserted at the same site where Exemplary Expression Cassette 1 is inserted in HVT15, and expresses the same antigen with Exemplary Expression Cassette 1. However, Exemplary Expression Cassette 5 expressed in an opposite orientation that is, Exemplary Expression Cassette 5 lies in the complementary strand of Exemplary Expression Cassette 1. Moreover, rather than getting co-transcribed with UL27gene, the NDV F gene in Exemplary Expression Cassette 5 is expressed separately instead, by the regulation of an exogenous promoter, which has a same sequence with endogenous UL26.5 promoter, preferably.

[0376] Exemplary Expression Cassette 5 (SEQ ID NO: 35) consists essentially of a novel bidirectional artificial polyA signal motif (SEQ ID NO: 35, 1-49bp, i.e., complementary to SEQ ID NO: 17) , an UL26.5 gene promoter (SEQ ID NO: 35, 50-636bp, i.e., SEQ ID NO: 20) , a Kozak sequence (SEQ ID NO: 35, 637-642bp, i.e., SEQ ID NO: 60) , a codon-optimized gene of cleavage site-mutated NDV F (SEQ ID NO: 35, 643-2304bp, i.e., SEQ ID NO: 4) , a polyadenylation signals core sequence (SEQ ID NO: 35, 2305-2309bp, i.e., SEQ ID NO: 61) , and an MDV39 / 40-intergenic bidirectional polyA signal motif (SEQ ID NO: 35, 2310-2379bp, i.e., complementary to SEQ ID NO: 19) .

[0377] According to experimental data not shown herein, the codon-optimized gene of cleavage site-mutated NDV F could be replaced by other NDV F gene derived from the wildtype, or codon-optimized, e.g., SEQ ID NO: 2 or 3 or 63. However, as compared to other promoters, the exogenous UL26.5 promoter confers a better expression efficiency.

[0378] Table 5. Elements of Exemplary Expression Cassette 5

[0379] In one particular embodiment, the present invention provides a multivalent recombinant HVT rHVT-ND-IBD-ILT (clone codename of the strain: HVT310) .

[0380] Exemplary Expression Cassette 5 and Exemplary Expression Cassette 2’a re inserted at two different sites in the UL region of the HVT genome, respectively, thereby constructing strain HVT310, which expresses three heterologous antigens (see Figure 7) .

[0381] Exemplary Expression Cassette 5 consists of the same elements and nucleic acid sequences as Exemplary Expression Cassette 5 in HVT39, and is also inserted at the same site.

[0382] Exemplary Expression Cassette 2’ consists of almost the same elements as Exemplary Expression Cassette 2 in HVT22, and is also inserted at the same site. The only difference between Exemplary Expression Cassette 2’a nd 2 is that the former comprises SEQ ID NO: 6 as the vv IBDV VP2 gene instead of SEQ ID NO: 7 in the latter.

[0383] In one particular embodiment, the present invention provides a multivalent recombinant HVT rHVT-ND-IBD-ILT (clone codename of the strain: HVT35WT) .

[0384] Exemplary Expression Cassette 1 and Exemplary Expression Cassette 2’a re inserted at two different sites in the UL region of the HVT genome, respectively, thereby constructing strain HVT35WT, which expresses three heterologous antigens (see Figure 46) .

[0385] Exemplary Expression Cassette 1 consists of the same elements and nucleic acid sequences as Exemplary Expression Cassette 1 in HVT15 and HVT35, and is also inserted at the same site.

[0386] Exemplary Expression Cassette 2’ consists of the same elements and nucleic acid sequences as Exemplary Expression Cassette 2’ in HVT310, and is also inserted at the same site.

[0387] In some preferred embodiments of the recombinant MDVs and expression cassettes of the present invention, a stop codon is introduced therein. It follows and be downstream to a gene ORF, and sometimes it is 5’ upstream to, preferably 5’ flanking an IRES element ( “stop codon+IRES” ) , or a self-cleavage peptide-coding sequence (such as 2A-coding sequence) . Such an extra stop codon, in relative to the real stop codon in the gene ORF, is expected to be present downstream of genes to act as a backup in case of read-through of the real stop codon. A term “backup stop codon” may be used to name such a stop codon in view of its potential function. Not intended to be limited theoretically, translation read-through of the real stop codon, although rare, would be more disadvantageous for a multicistronic mRNA once happens. Therefore, a backup stop codon may be introduced and is hypothesized to be useful.

[0388] The recombinant MDV according to the invention can be amplified by common techniques, preferably by replication in vitro, e.g. in cultures of avian cells, typically primary chicken embryo fibroblast cells (CEF) . These can be prepared by trypsin isolation of chicken embryos, all well-known in the art. The CEF are plated in monolayers and infected with the recombinant MDV. This process can be scaled up to industrial size production.

[0389] In one aspect, the present invention provides virus particles, which comprises any one of recombinant MDVs of the present invention as described above, encapsulated by the protein coat.

[0390] Therefore, in a further aspect, the invention relates to a host cell comprising the recombinant MDV according to the invention. A “host cell” for the invention, is a cell that is susceptible to infection and replication by an HVT. Examples of such cells are avian cells, and in particular lymphocytes or fibroblasts.

[0391] Preferably the host cell according to the invention is a host cell kept under in vitro conditions.

[0392] In an embodiment, the host cell according to the invention is a primary avian cell.

[0393] In an embodiment the primary avian host cell for the invention is a primary chicken embryo fibroblast (CEF) .

[0394] As described, the main advantageous use of the recombinant MDV according to the invention is in a vaccine for poultry, providing a safe, stable and effective vaccination against MD, IBD, ND and / or ILT or associated signs of disease, and can be administered to poultry at a very young age.

[0395] Therefore, a further aspect of the invention relates to the recombinant MDV according to the invention, and / or to the host cell according to the invention, for use in a vaccine for poultry.

[0396] Different ways of a ‘use in a vaccine’ of the recombinant MDV or of the host cell, both according to the invention, have been outlined above, and comprise the use as cell-free virus or as cell-associated virus in a host cell, in a vaccine composition for inoculation of poultry.

[0397] Also, in a further aspect the invention relates to a vaccine for poultry comprising the recombinant MDV according to the invention and / or the host cell according to the invention, and a pharmaceutically acceptable carrier.

[0398] In one aspect, the present invention provides a composition or vaccine comprising any one of recombinant MDVs of the present invention as described above, optionally further comprising a pharmaceutically or veterinarily acceptable carrier, excipient, vehicle or adjuvant.

[0399] In an embodiment the vaccine for poultry according to the invention is a cell-associated vaccine. “Cell-associated” means that the recombinant MDV according to the invention is comprised in host cells in vitro, according to the invention. Consequently a vaccine of this type comprises both the host cells as well as the recombinant MDV, both according to the invention.

[0400] In some embodiments for the present invention, the vaccine is in the form of cell-associated MDV, and the pharmaceutically acceptable carrier is preferably a mixture of culture medium, serum, and DMSO. This carrier also provides for the stabilization of the recombinant MDV-infected host cells during freezing and frozen storage. The serum can be any serum routinely used for cell culturing such as foetal-or new-born calf serum. The vaccine according to the invention is prepared from an recombinant MDV according to the invention by methods as described herein, which are readily applicable by a person skilled in the art. For example, the recombinant MDV according to the invention is constructed by insertion of the expression cassettes as described for the invention by transfection and recombination. Next the desired recombinant MDV is selected, and is amplified industrially in smaller or larger volumes, preferably in in vitro cell cultures, e.g. in CEF. From such cultures a suspension of host cells infected with the recombinant MDV is harvested, either as whole infected cells or as a cell-free preparation obtained by cell-disruption. This suspension is formulated into a vaccine with a suitable pharmaceutical carrier, and the final product is packaged. Cell-associated vaccine is then stored in liquid nitrogen, and freeze-dried vaccine at -20 or at +4 ℃.

[0401] The present invention also provides a combination comprising the recombinant MDV, the virus particles, the host cells, and / or the composition or vaccine of the present invention, wherein the combination further comprises other agents. It can be advantageous to make further combinations with additional immunoactive components. This can serve to enhance the immune protection already provided, or to expand it to other pathogens.

[0402] In one aspect, the present invention provides use of any one of recombinant MDVs of the present invention as described above in the manufacture of vaccines vaccinating, or inducing an immune or protective response in an animal against one or more avian pathogens.

[0403] In one aspect, the present invention provides the vaccine of the present invention for use in vaccinating an avian species against one or more diseases caused by one or more avian pathogens, preferably against Marek's disease and one or more diseases caused by one or more avian pathogens. In one embodiment the one or more diseases are caused by one or more of infectious bursal disease virus (IBDV) , infectious laryngotracheitis virus (ILTV) , and / or Newcastle disease virus (NDV) . The vaccine is further provided for use in protecting an avian species against clinical symptoms caused by one or more avian pathogens, preferably against clinical symptoms caused by Marek's disease virus and clinical symptoms caused by one or more avian pathogens. In one embodiment the one or more avian pathogen causing the diseases or clinical symptoms is selected from the group consisting of Newcastle disease virus, infectious bursal disease virus and avian infectious laryngotracheitis virus.

[0404] The avian species may be poultry, preferably the avian species is chicken, duck, goose, turkey, quail, guinea or pigeon, more preferably the avian species is turkey or chicken, even more preferably chicken. The vaccine according to the invention may be administered by spray administration, in ovo, subcutaneously, intramuscularly, orally or nasally. In a particular embodiment the vaccine is administered in ovo preferably in ovo in 18 day old embryonated eggs. In an alternative embodiment the vaccine is administered in subcutaneously or intramuscularly in chicks, preferably in 1 day old chicks.

[0405] In one aspect, the present invention provides a method of vaccinating, or inducing an immune or protective response in an animal against one or more avian pathogens, at least one administration of recombinant MDVs, the virus particles, compositions, or vaccines of the present invention. In some particular embodiments, the the avian pathogen is selected from the group consisting of Newcastle Disease Virus (NDV) , Infectious Bursal Disease Virus (IBDV) , Infectious Laryngotracheitis Virus (ILTV) , avian encephalomyelitis virus, avian reovirus, avian paramyxovirus, avian metapneumovirus, avian adenovirus, fowl pox virus, avian coronavirus, avian rotavirus, avian parvovirus, avian astrovirus and chick anemia virus coccidiosis (Eimeria sp. ) , Campylobacter sp., Salmonella sp., Mycoplasma gallisepticum, Mycoplasma synoviae, Pasteurella sp., Avibacterium sp., E. coli and Clostridium sp.

[0406] Therefore, the present invention provides vaccines based on the recombinant MDVs of the present invention. Not intended to be limited theoretically, the vaccines provide a multivalent immunity: against IBD, ND, and ILT by the expression of the heterologous inserts, and in addition against MD by the HVT vector itself, therefore, the vaccines could prevent four epidemics, when used to immunizing poultry: the HVT itself protects against Marek's disease (MD) caused by Marek's disease virus (MDV) , the expressed NDV F protects against Newcastle disease (ND) caused by Newcastle disease virus (NDV) , the expressed IBDV VP2 protects against Infectious bursal disease (IBD) caused by Infectious Bursal Disease Virus (IBDV) , and the expressed ILTV gD protects against chicken infectious laryngotracheitis (ILT) caused by chicken Infectious Laryngotracheitis Virus (ILTV) .

[0407] Variants include allelic variants. The term "allelic variant" refers to a polynucleotide or a polypeptide containing polymorphisms that lead to changes in the amino acid sequences of a protein and that exist within a natural population (e.g., a virus species or variety) . Such natural allelic variations can typically result in 1-5%variance in a polynucleotide or a polypeptide. Allelic variants can be identified by sequencing the nucleic acid sequence of interest in a number of different species, which can be readily carried out by using hybridization probes to identify the same gene genetic locus in those species. Any and all such nucleic acid variations and resulting amino acid polymorphisms or variations that are the result of natural allelic variation and that do not alter the functional activity of gene of interest, are intended to be within the scope of the invention.

[0408] The term "identity" with respect to sequences can refer to, for example, the number of positions with identical nucleotides or amino acids divided by the number of nucleotides or amino acids in the shorter of the two sequences wherein alignment of the two sequences can be determined in accordance with the Wilbur and Lipman algorithm (Wilbur and Lipman) . The sequence identity or sequence similarity of two amino acid sequences, or the sequence identity between two nucleotide sequences can be determined using Vector NTI software package (Invitrogen, 1600 Faraday Ave., Carlsbad, CA) . When RNA sequences are said to be similar, or have a degree of sequence identity or homology with DNA sequences, thymidine (T) in the DNA sequence is considered equal to uracil (U) in the RNA sequence. Thus, RNA sequences are within the scope of the invention and can be derived from DNA sequences, by thymidine (T) in the DNA sequence being considered equal to uracil (U) in RNA sequences.

[0409] The terms "identical" or "percent identity, " in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60%identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., the NCBI web site found at https:  / / blast. ncbi. nlm. nih. gov / Blast. cqi or the like) . Such sequences are then referred to as "substantially identical. " This definition also refers to, or applies to, the compliment of a particular sequence. The definition may also include sequences that have deletions, additions, and / or substitutions.

[0410] For sequence comparison, one sequence typically serves as a reference sequence, to which other sequences are compared. When using a sequence comparison algorithm, reference and comparison sequences may be entered into a computer, and sequence algorithm program parameters are selected as desired. Percent sequence identities are then generated for the comparison sequences relative to the reference sequence, based on the parameters selected. An example of an algorithm that may be suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., (Nuc Acids Res 25: 3389-3402, 1977) and Altschul et al., (J Mol Biol 215: 403-410, 1990) , respectively. BLAST and BLAST 2.0 are well known in the art and may be used to determine percent sequence identity for any nucleic acids or proteins, such as those described herein. When RNA sequences are said to be similar, or have a degree of sequence identity or homology with DNA sequences, thymidine (T) in the DNA sequence is considered equal to uracil (U) in the RNA sequence. Thus, RNA sequences are within the scope of the invention and can be derived from DNA sequences, by thymidine (T) in the DNA sequence being considered equal to uracil (U) in RNA sequences.

[0411] The polynucleotides of the disclosure include sequences that are degenerate as a result of the genetic code, e.g., optimized codon usage for a specific host. As used herein, "optimized" refers to a polynucleotide that is genetically engineered to increase its expression in a given species. To provide optimized polynucleotides coding for NDV F, IBDV VP2 or ILTV gD polypeptides, the DNA sequence of these genes can be modified to 1) comprise codons preferred by highly expressed genes in a particular species; 2) comprise an A+T or G+C content in nucleotide base composition to that substantially found in said species; 3) form an initiation sequence of said species; or 4) eliminate sequences that cause destabilization, inappropriate polyadenylation, degradation and termination of RNA, or that form secondary structure hairpins or RNA splice sites. Increased expression of NDV F, IBDV VP2 or ILTV gD protein in said species can be achieved by utilizing the distribution frequency of codon usage in eukaryotes and prokaryotes, or in a particular species. The term "frequency of preferred codon usage" refers to the preference exhibited by a specific host cell in usage of nucleotide codons to specify a given amino acid. There are 20 natural amino acids, most of which are specified by more than one codon. Therefore, all degenerate nucleotide sequences are included in the disclosure as long as the amino acid sequence of the NDV F, IBDV VP2 or ILTV gD polypeptide encoded by the nucleotide sequence is functionally unchanged.

[0412] Methods for producing a recombinant MDV

[0413] The recombinant MDVs of the present invention could be constructed by any molecular cloning methods and / or recombination methods that are commonly known in the art, only if constructs with a same or similar structures are produced, wherein each element is operably linked in a predetermined order and functions as expected.

[0414] In some particular embodiments, the present invention provides a method of construction of recombinant herpes virus, comprising:

[0415] (1) constructing infectious clones of said recombinant herpes virus in E. coli by recombineering, wherein the genome of said recombinant herpes virus carries a vector comprising replicons and screening tags in E. coli, and wherein the vector is linked to FRT sites at its both ends,

[0416] (2) eliminating the vector sequence by the recombination between the two FRT sites mediated by FLP recombinase in E. coli expressing FLP recombinase, to obtain the circular genome of the recombinant herpes virus,

[0417] (3) infecting susceptible cells using the circular genome of the recombinant herpes virus, and then rescuing the recombinant herpes virus to obtain a pure culture.

[0418] In some more particular embodiments, the present invention provides a method of construction of recombinant herpes virus, comprising:

[0419] (1) constructing infectious clones of said recombinant herpes virus in E. coli by recombineering, wherein the genome of said recombinant herpes virus carries a BAC vector with FRT sites linked to its both ends,

[0420] (2) eliminating the BAC vector sequence by the recombination between the two FRT sites mediated by FLP recombinase in E. coli expressing FLP recombinase, to obtain the circular genome of the recombinant herpes virus,

[0421] (3) infecting susceptible cells using the circular genome of the recombinant herpes virus, and then rescuing the recombinant herpes virus to obtain a pure culture.

[0422] In some more particular embodiments, the BAC vector has a structure as follows:

[0423] (1) Site-specific recombinase recognition sites in the same direction, such as the FRT site recognized by Flp recombinase, are introduced into both flanks for deletion of the BAC vector at the completion of subsequent cloning. For example, one FRT site is integrated at one end or flank of the BAC vector, and the other FRT site in the same direction is provided by the expression cassette which would be inserted in to the same region, preferably quite or immediately close to the BAC vector sequence. Alternatively, two FRT sites in the same direction are integrated into both ends or flanks of the BAC vector, respectively.

[0424] Thereby the BAC vector sequence is or is designed to be sandwiched by the two FRT sites.

[0425] (2) an expression cassette of a resistance gene -gpt gene, for screening and purification of recombinant virus, is inserted;

[0426] (3) Optional structural reduction: for example, on the basis of any known or conventionally used BAC vector, deleting the cos sequence, the wild-type loxP sequence and the lacZ gene expression cassette, that are not needed.

[0427] Also provided is a method of producing a recombinant MDV comprising (a) providing an MDV, (b) inserting one or more heterologous polynucleotide (s) coding for and expressing at least one antigen of an avian pathogen into the intergenic loci between UL26 and UL27 genes and / or between UL55 and MDV71 genes of the MDV genome, and optionally (c) amplifying the MDV comprising one or more heterologous polynucleotide (s) coding for at least one antigen of an avian pathogen of step (b) .

[0428] The present invention further provides a method for producing a recombinant MDV comprising the introduction of one, two or more polynucleotides into the intergenic loci between UL26 and UL27 genes and / or between UL55 and MDV71 genes of the MDV genome, wherein the MDV is preferably an HVT.

[0429] The pharmaceutically or veterinarily acceptable carriers or adjuvant or vehicles or excipients are well known to the one skilled in the art. For example, a pharmaceutically or veterinarily acceptable carrier or adjuvant or vehicle or excipient can be Marek's disease vaccine diluent used for MD vaccines. Other pharmaceutically or veterinarily acceptable carrier or adjuvant or vehicle or excipients that can be used for methods of this invention include, but are not limited to, 0.9%NaCl (e.g., saline) solution or a phosphate buffer, poly- (L-glutamate) , the Lactated Ringer's Injection diluent (sodium chloride, sodium lactate, potassium chloride and calcium chloride) , or polyvinylpyrrolidone. The pharmaceutically or veterinarily acceptable carrier or vehicle or adjuvant or excipients may be any compound or combination of compounds facilitating the administration of the vector (or protein expressed from an inventive vector in vitro) , or facilitating transfection or infection and / or improve preservation of the vector (or protein) . Doses and dose volumes are herein discussed in the general description and can also be determined by the skilled artisan from this disclosure read in conjunction with the knowledge in the art, without any undue experimentation.

[0430] Optionally other compounds may be added as pharmaceutically or veterinarily acceptable carriers or adjuvants or vehicles or excipients, including, but not limited to, alum; CpG oligonucleotides (ODN) , in particular ODN 2006, 2007, 2059, or 2135 (Pontarollo R.A. et al, Vet. Immunol. Immunopath, 2002, 84: 43-59; Wernette CM. et al., Vet. Immunol. Immunopath, 2002, 84: 223-236; Mutwiri G. et al., Vet. Immunol. Immunopath, 2003, 91 : 89-103) ; polyA-polyU, dimethyldioctadecylammonium bromide (DDA) ( "Vaccine Design The Subunit and Adjuvant Approach" , edited by Michael F. Powell and Mark J. Newman, Pharmaceutical Biotechnology, 6: p. 03, p. 157) ; N, N-dioctadecyl-N', N'-bis (2-hydroxyethyl) propanediamine (such as  ) (Ibid, p. 148) ; carbomer, chitosan (see US Patent Serial No. 5, 980.912) .

[0431] The pharmaceutical compositions and vaccines according to the invention may comprise or consist essentially of one or more adjuvants. Suitable adjuvants for use in the practice of the present invention are (1) polymers of acrylic or methacrylic acid, maleic anhydride and alkenyl derivative polymers, (2) immunostimulating sequences (ISS) , such as oligodeoxyribonucleotide sequences having one or more non-methylated CpG units (Klinman et al., 1996; W098 / 16247) , (3) an oil in water emulsion, such as the SPT emulsion described on p 147 of "Vaccine Design, The Subunit and Adjuvant Approach" published by M. Powell, M. Newman, Plenum Press 1995, and the emulsion MF59 described on p 183 of the same work, (4) cation lipids containing a quaternary ammonium salt, e.g., DDA (5) cytokines, (6) aluminum hydroxide or aluminum phosphate, (7) saponin or (8) other adjuvants discussed in any document cited and incorporated by reference into the instant application, or (9) any combinations or mixtures thereof.

[0432] In one embodiment, the adjuvant may include TS6 TS7, TS8 and TS9 (US7,371,395) , LR2, LR3 and LR4 (US7,691,368) , TSAP (US20110129494) , TRIGENTM (Newport Labs) , synthetic dsRNAs (e.g. poly-IC, poly-ICLC ) , and MONTANIDETM adjuvants (W / O, W / OAV, OAV, IMS and Gel; all produced by SEPPIC) .

[0433] In another embodiment, the invention provides for the administration of a therapeutically effective amount of a vaccine or composition for the delivery of recombinant MDVs in a target cell. Determination of the therapeutically effective amount is routine experimentation for one of ordinary skill in the art.

[0434] Another aspect of the invention relates to a method for inducing an immunological response in an animal against one or more antigens or a protective response in an animal against one or more avian pathogens, which method comprises inoculating the animal at least once with the vaccine or pharmaceutical composition of the present invention. Yet another aspect of the invention relates to a method for inducing an immunological response in an animal to one or more antigens or a protective response in an animal against one or more avian pathogens in a prime-boost administration regimen, which is comprised of at least one primary administration and at least one booster administration using at least one common polypeptide, antigen, epitope or immunogen. The immunological composition or vaccine used in primary administration may be same, may be different in nature from those used as a booster.

[0435] A vaccine may generally be used for prophylactic and / or therapeutic purposes. For example, in accordance with the invention, the vaccine may be provided to a subject, such as an avian species, to vaccinate against one or more diseases caused by one or more avian pathogens. Typically, the vaccine is administered prior to infection with or exposure to an avian pathogen in order to provide protection against infection with one or more avian pathogen or development of clinical symptoms caused by one or more avian pathogen. Preferably the avian pathogen is an avian virus.

[0436] The avian pathogens may be Newcastle Disease Virus (NDV) , Infectious Bursal Disease Virus (i.e., IBDV or Gumboro Disease virus) , Infectious Laryngotracheitis Virus (ILTV) , avian encephalomyelitis virus, avian reovirus, avian paramyxovirus, avian metapneumovirus, avian adenovirus, fowl pox virus, avian coronavirus, avian rotavirus, avian parvovirus, avian astrovirus and chick anemia virus coccidiosis (Eimeria sp. ) , Campylobacter sp., Salmonella sp., Mycoplasma gallisepticum, Mycoplasma synoviae, Pasteurella sp., Avibacterium sp., E. coli or Clostridium sp.

[0437] Usually, one administration of the vaccine in avian is performed either at one day-of-age by the subcutaneous or intramuscular route or in ovo in 17-19 day-old embryo. A second administration can be done within 0-30 days after the first administration.

[0438] A variety of administration routes in day-old chicks may be used such as subcutaneously or intramuscularly, intradermally, transdermally. The in ovo vaccination can be performed in the amniotic sac and / or the embryo. Commercially available in ovo and SC administration devices can be used for vaccination.

[0439] The composition or vaccine may contain a dose from about 102 to about 1020 , about 103 to about 1020 , about 103 to about 1018 , about 104 to about 1016 recombinant virus produced in vitro or in vivo. The recombinant virus may be titrated based on any virus titration methods including, but not limited to, FFA (Focus Forming Assay) or FFU (Focus Forming Unit) , TCID50 (50%Tissue Culture Infective Dose) , PFU (Plaque Forming Units) , and FAID50 (50%Fluorescent Antibody Infectious Dose) , and the VLPs produced in vitro can be titrated by hemagglutination assay, ELISA, and electron microscopy. Other methods may also be applicable.

[0440] The composition or vaccine may contain, for example, from about 102.0 to about 107.0 PFU / dose, from about 102.0 to about 107.0 PFU / dose, from about 102.5 to about 106.5 PFU / dose, from about 103.0 to about 106.0 PFU / dose, or from about 103.5 to about 105.5 PFU / dose. The dose volumes can be between about 0.01 and about 10 ml, between about 0.01 and about 5 ml.

[0441] Embodiment set 1

[0442] The present invention also provides the following exemplary embodiments:

[0443] 1. A recombinant MDV or expression cassette, comprising at least one or more heterologous polynucleotides encoding an antigen of an avian pathogen, wherein one of the heterologous polynucleotides encodes NDV F antigen (e.g., comprising or consisting of an amino acid sequence as shown in SEQ ID NO: 1) and comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 3, 4 or 63, and optionally being 3’ flanked by a backup stop codon.

[0444] 2. A recombinant MDV or expression cassette, comprising at least one or more heterologous polynucleotides encoding an antigen of an avian pathogen, wherein one of the heterologous polynucleotides encodes IBDV VP2 antigen (e.g., comprising or consisting of an amino acid sequence as shown in SEQ ID NO: 5 or 8) and comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 7, 9 or 10, and optionally being 3’ flanked by a backup stop codon.

[0445] 3. A recombinant MDV or expression cassette, comprising at least one or more heterologous polynucleotides encoding an antigen of an avian pathogen, wherein one of the heterologous polynucleotides encodes ILTV gD antigen (e.g., comprising or consisting of an amino acid sequence as shown in SEQ ID NO: 11) and comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 13, and optionally being 3’ flanked by a backup stop codon.

[0446] 4. A recombinant MDV or expression cassette, comprising at least one or more heterologous polynucleotides encoding an antigen of an avian pathogen, wherein a first heterologous polynucleotide encodes IBDV VP2 antigen and comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 7, 9 or 10, and optionally being 3’ flanked by a backup stop codon, and a second heterologous polynucleotide encodes ILTV gD antigen and comprises or consists of the nucleotide sequence as shown in SEQ ID NO: 13, and optionally being 3’ flanked by a backup stop codon.

[0447] 5. A recombinant MDV or expression cassette, comprising at least one or more heterologous polynucleotides encoding an antigen of an avian pathogen, wherein the recombinant MDV vector or expression cassette further comprises one or more elements selected from the following:

[0448] (1) the optimized IRES element of the present invention,

[0449] (2) endogenous UL26 promoter of MDV, comprising or consisting of a sequence of SEQ ID NO: 21, or a sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 21 and can bind an RNA polymerase to initiate transcription;

[0450] (3) endogenous UL26.5 promoter of MDV, comprising or consisting of a sequence of SEQ ID NO: 20, or a sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 20 and can bind an RNA polymerase to initiate transcription;

[0451] (4) endogenous UL26 polyA signal of MDV, comprising or consisting of a sequence of SEQ ID NO: 22, or a sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 22;

[0452] (5) mCMV promoter, comprising or consisting of a sequence of SEQ ID NO: 14, or a sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription;

[0453] (6) the artificial reverse tandem polyA signal motif of the present invention;

[0454] (7) the novel bidirectional artificial polyA signal motif of the present invention;

[0455] (8) the MDV CVI988 MDV89 gene polyA signal motif of the present invention;

[0456] (9) the MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention.

[0457] 6. An expression cassette, comprising or consisting of in this order:

[0458] (1) a polyA signal motif or not exist;

[0459] (2) a promoter;

[0460] (3) one or more heterologous polynucleotides encoding at least one antigen of an avian pathogen;

[0461] (4) one or more polyA signal motifs in tandem,

[0462] being operably linked,

[0463] wherein, said heterologous polynucleotide (s) encodes one or two polypeptides selected from the group consisting of an IBDV VP2 antigen, an ILTV gD antigen and an NDV F antigen,

[0464] wherein the polyA signal motif of (1) , if any, could be the same or different with the polyA signal motif of (4) ,

[0465] wherein, said heterologous polynucleotide (s) are 3’ flanked by a backup stop codon,

[0466] wherein, the expression cassette could be used to insert into the genome of a recombinant MDV vector, expressing said heterologous polynucleotides in the forward orientation or the reverse orientation.

[0467] 7. The expression cassette of embodiment 5 or 6, wherein said heterologous polynucleotide encodes the IBDV VP2 antigen.

[0468] 8. The expression cassette of embodiment 6, wherein, the IBDV VP2 antigen is as defined herein, and / or the promoter is the mCMV promoter of the present invention, and / or the polyA signal motif of (1) is the artificial reverse tandem polyA signal motif of the present invention , and / or the polyA signal motifs of (4) are the novel bidirectional artificial polyA signal motif the present invention and the MDV39 / 40-intergenic bidirectional polyA signal motif the present invention, preferably in tandem.

[0469] 9. The expression cassette of embodiment 6, wherein said heterologous polynucleotide encodes the NDV F antigen, preferably, said heterologous polynucleotide is 3’ flanked by a polyadenylation signal core sequence, and / or 5’ flanked by a Kozak sequence.

[0470] 10. The expression cassette of embodiment 9, wherein, the NDV F antigen is as defined herein, and / or the promoter is exogenous and the same with the endogenous UL26.5 promoter of MDV, and / or the polyA signal motif of (1) is absent (does not exist) or the novel bidirectional artificial polyA signal motif the present invention, and / or the polyA signal motif of (4) is the MDV39 / 40-intergenic bidirectional polyA signal motif or a polyA signal motif same with the endogenous UL26 polyA signal of MDV.

[0471] 11. The expression cassette of embodiment 9 or 10, wherein the heterologous polynucleotide is expressed in the reverse orientation.

[0472] 12. The expression cassette of embodiment 6, wherein said heterologous polynucleotides encode the IBDV VP2 antigen and the ILTV gD antigen.

[0473] 13. The expression cassette of embodiment 12, wherein, the heterologous polynucleotide encoding IBDV VP2 antigen and the heterologous polynucleotide encoding ILTV gD antigen are operably linked to each other via:

[0474] an IRES element, or

[0475] a stop codon+IRES (wherein, the stop codon, TAA, TGA or TAG, is 5’ upstream to IRES, preferably directly 5’ flanking the IRES) , or

[0476] a 2A peptide-coding sequence, preferably an IRES element, or

[0477] a stop codon+ coding sequence for 2A peptide (wherein, the stop codon, TAA, TGA or TAG, is 5’upstream to coding sequence for 2A peptide, preferably directly 5’ flanking the coding sequence for 2A peptide) .

[0478] 14. The expression cassette of embodiment 13, wherein, the IBDV VP2 antigen is as defined herein, and / or the ILTV gD antigen is as defined herein, and / or the promoter is the mCMV promoter, and / or the IRES is the optimized IRES element, and / or the polyA signal motif of (1) is the artificial reverse tandem polyA signal motif, and / or the polyA signal motifs of (4) are the novel bidirectional artificial polyA signal motif and the MDV39 / 40-intergenic bidirectional polyA signal motif.

[0479] 15. The expression cassette of embodiment 14, wherein the heterologous polynucleotide is expressed in the forward orientation.

[0480] 16. The expression cassette of embodiment 13, wherein, the IBDV VP2 antigen is as defined herein, and / or the ILTV gD antigen is as defined herein, and / or the promoter is the mCMV promoter, and / or the IRES is the optimized IRES element, and / or the polyA signal motif of (1) is the artificial reverse tandem polyA signal motif, and / or the polyA signal motifs of (4) are the novel bidirectional artificial polyA signal motif, the MDV39 / 40-intergenic bidirectional polyA signal motif and the MDV CVI988 MDV89 gene polyA signal motif,

[0481] and wherein the expression cassette comprises a nonfunctioning FRT site inserted among the polyA signal motifs of (4) .

[0482] 17. The expression cassette of embodiment 16, wherein the heterologous polynucleotide is expressed in the reverse orientation.

[0483] 18. An expression cassette, comprising or consisting of from 5’ to 3’ direction and in this order:

[0484] (1) an IRES element or a stop codon+IRES or a 2A peptide-coding sequence or a stop codon+2A peptide-coding sequence;

[0485] (2) a heterologous polynucleotide encoding an antigen of an avian pathogen;

[0486] being operably linked,

[0487] wherein, said heterologous polynucleotide encodes one polypeptide selected from the group consisting of an IBDV VP2 antigen, an ILTV gD antigen and an NDV F antigen,

[0488] wherein, the expression cassette could be used to insert into the genome of a recombinant MDV to be operably linked to an endogenous gene in the forward orientation or the reverse orientation, and express said heterologous polynucleotides in a same orientation,

[0489] wherein said expression cassette:

[0490] (a) is designed to be inserted into the non-coding intergenic region between UL26 and UL27 genes; and / or

[0491] (b) is designed to be operably linked to the endogenous UL26 promoter of MDV, and / or the endogenous UL26.5 promoter of MDV via the element of (1) ; and / or operably linked to the endogenous UL26 / UL26.5 gene via the element of (1) ; and / or

[0492] (c) is designed to be flanked by sequences which the same with or reverse complementary to a sequence that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with at least part of SEQ ID NO: 36,

[0493] preferably flanked by SEQ ID NOs: 23 and 25,

[0494] more preferably flanked by SEQ ID NOs: 23 and 24; and / or; and / or

[0495] (d) further comprises, or is designed to be flanked by 5’ homology arm sequence at 5’ end and 3’ homology arm sequence at 3’ end, wherein either of the homology arm sequences is the same with or reverse complementary to a sequence that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with at least part of SEQ ID NO: 36,

[0496] preferably, said 5’ homology arm sequence comprises or consists of a portion of at least 15 contiguous nucleotides that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with an equal length portion of SEQ ID NO: 23, and said 3’ homology arm sequence comprises or consists of a portion of at least 15 contiguous nucleotides that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with an equal length portion of SEQ ID NO: 25,

[0497] more preferably, said 5’ homology arm sequence comprises or consists of a portion of at least 15 contiguous nucleotides that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with an equal length portion of SEQ ID NO: 23, and said 3’ homology arm sequence comprises or consists of a portion of at least 15 contiguous nucleotides that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with an equal length portion of SEQ ID NO: 24.

[0498] 19. The expression cassette of embodiment 18, wherein said heterologous polynucleotide encodes the NDV F antigen.

[0499] 20. The expression cassette of embodiment 19, wherein, the NDV F antigen is as defined herein.

[0500] 21. The expression cassette of any of embodiments 18-20, wherein said element (1) is selected from a coding sequence coding for P2A, T2A, E2A or F2A.

[0501] 22. The expression cassette of any of embodiments 18-20, wherein, said element (1) is an optimized IRES element.

[0502] 23 The expression cassette of any of embodiments 18-20, comprising or consisting of in 5’ to 3’ direction and in this order:

[0503] (a) an IRES element, and

[0504] (b) the heterologous polynucleotide encoding NDV F,

[0505] and the expression cassette is designed to place the heterologous polynucleotide after the stop codon of the endogenous UL26 / UL26.5 gene via the IRES element and to place the heterologous polynucleotide under the control of the endogenous UL26 promoter of MDV and / or the endogenous UL26.5 promoter of MDV, thereby the promoters and polyA signal motifs are operatively linked to the heterologous polynucleotide encoding NDV F.

[0506] 24. The expression cassette of any of embodiments 18-23, expresses in the forward orientation as UL26 gene.

[0507] 25. An expression cassette, comprising or consisting of from 5’ to 3’ direction and in this order:

[0508] (1) a polyA signal motif;

[0509] (2) an exogenous promoter;

[0510] (3) one or more heterologous polynucleotides encoding an antigen of an avian pathogen;

[0511] (4) one polyA signal motif or more polyA signal motifs in tandem,

[0512] being operably linked,

[0513] wherein, said heterologous polynucleotide (s) encodes one or two polypeptides selected from the group consisting of an IBDV VP2 antigen, an ILTV gD antigen and an NDV F antigen,

[0514] wherein the polyA signal motif of (1) could be the same or different with the polyA signal motif of (4) ,

[0515] wherein, said heterologous polynucleotide (s) is 3’ flanked by a polyadenylation signal core sequence, and / or 5’ flanked by a Kozak sequence,

[0516] wherein, the expression cassette could be used to insert into the genome of a recombinant MDV, expressing said heterologous polynucleotides in the forward orientation or the reverse orientation, wherein, said expression cassette:

[0517] (a) is designed to be inserted into the non-coding intergenic region between UL26 and UL27 genes; and / or

[0518] (b) is designed to be operably linked to the endogenous UL26 promoter of MDV, and / or the endogenous UL26.5 promoter of MDV via the element of (1) ; and / or operably linked to the endogenous UL26 / UL26.5 gene via the element of (1) ; and / or

[0519] (c) is designed to be flanked by sequences which the same with or reverse complementary to a sequence that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with at least part of the reverse complementary sequence of SEQ ID NO: 36,

[0520] preferably flanked by the reverse complementary sequences of SEQ ID NOs: 23 and 25,

[0521] more preferably flanked by the reverse complementary sequences of SEQ ID NOs: 23 and 24; and / or

[0522] (d) further comprising or is designed to be flanked by 5’ homology arm sequence at 5’ end and 3’ homology arm sequence at 3’ end, wherein either of the homology arm sequences is the same with or reverse complementary to a sequence that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with at least part of the reverse complementary sequence of SEQ ID NO: 36,

[0523] preferably, said 5’ homology arm sequence comprises or consists of a portion of at least 15 contiguous nucleotides that is at least 80%complementary to, at least 85%complementary to, at least 90%complementary to, at least 95%complementary to, at least 96%complementary to, at least 97%complementary to, at least 98%complementary to, at least 99%complementary to or 100%complementary to an equal length portion of SEQ ID NO: 23, and said 3’ homology arm sequence comprises or consists of a portion of at least 15 contiguous nucleotides that is at least 80%complementary to, at least 85%complementary to, at least 90%complementary to, at least 95%complementary to, at least 96%complementary to, at least 97%complementary to, at least 98%complementary to, at least 99%complementary to or 100%complementary to with an equal length portion of SEQ ID NO: 25,

[0524] more preferably, said 5’ homology arm sequence comprises or consists of a portion of at least 15 contiguous nucleotides that is at least 80%complementary to, at least 85%complementary to, at least 90%complementary to, at least 95%complementary to, at least 96%complementary to, at least 97%complementary to, at least 98%complementary to, at least 99%complementary to or 100%complementary to an equal length portion of SEQ ID NO: 23, and said 3’ homology arm sequence comprises or consists of a portion of at least 15 contiguous nucleotides that is at least 80%complementary to, at least 85%complementary to, at least 90%complementary to, at least 95%complementary to, at least 96%complementary to, at least 97%complementary to, at least 98%complementary to, at least 99%complementary to or 100%complementary to an equal length portion of SEQ ID NO: 24.

[0525] 26. The expression cassette of embodiment 25, wherein said heterologous polynucleotide encodes the NDV F antigen, and is preferably 3’ flanked by a polyadenylation signal core sequence, and / or 5’ flanked by a Kozak sequence.

[0526] 27. The expression cassette of embodiment 26, wherein, the NDV F antigen is as defined herein.

[0527] 28. The expression cassette of any one of embodiments 24-26, the cassette comprises or consists of in 5’ to 3’ direction and in this order:

[0528] (1) a polyA signal motif or not exist;

[0529] (2) a non-endogenous promoter;

[0530] (3) the heterologous polynucleotide encoding NDV F; and

[0531] (4) one polyA signal motif or more polyA signal motifs in tandem,

[0532] and whereby the promoters and polyA signal motifs are operatively linked to the heterologous polynucleotide encoding NDV F.

[0533] 29. The expression cassette of any one of embodiments 24-28, wherein, the promoter is exogenous and the same with the endogenous UL26.5 promoter of MDV, and / or the polyA signal motif of (1) is the novel bidirectional artificial polyA signal motif, and / or the polyA signal motif of (4) is the MDV39 / 40-intergenic bidirectional polyA signal motif.

[0534] 30. The expression cassette of any one of embodiments 24-29, wherein the heterologous polynucleotide is expressed in the reverse orientation.

[0535] 31. An expression cassette, comprising one or more heterologous polynucleotides encoding an antigen of an avian pathogen, wherein the antigen is selected from the group consisting of an IBDV VP2 antigen, an ILTV gD antigen and an NDV F antigen, and wherein

[0536] said heterologous polynucleotide encoding NDV F antigen comprises or consists of a sequence as shown in SEQ ID NO: 3 or 4 or 63, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 3 or 4 or 63, and / or

[0537] said heterologous polynucleotide encoding IBDV VP2 antigen comprises or consists of a sequence as shown in SEQ ID NO: 7 or 10, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 7 or 10, and / or

[0538] said heterologous polynucleotide encoding ILTV gD antigen comprises or consists of a sequence as shown in SEQ ID NO: 13, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 13.

[0539] 32. The expression cassette of embodiment 31, wherein said expression cassette comprises or consists of two heterologous polynucleotides that are linked via an IRES element or a stop codon+IRES,

[0540] wherein the IRES comprises or consists of a sequence of SEQ ID NO: 15, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 15 and can recruit the ribosome to initiate the translation.

[0541] 33. The expression cassette of embodiments 25-32, wherein said expression cassette comprises or consists of in 5’ to 3’ direction and in this order

[0542] (1) a polyA signal motif;

[0543] (2) a promoter;

[0544] (3) one or more heterologous polynucleotides encoding an antigen of an avian pathogen;

[0545] (4) one or more polyA signal motifs in tandem,

[0546] being operably linked,

[0547] wherein, said heterologous polynucleotide (s) encodes one or two polypeptides selected from the group consisting of an IBDV VP2 antigen, an ILTV gD antigen and an NDV F antigen,

[0548] wherein the polyA signal motif of (1) could be the same or different with the polyA signal motif of (4) ,

[0549] wherein, the expression cassette could be used to insert into the genome of a recombinant MDV, expressing said heterologous polynucleotides in the forward orientation or the reverse orientation.

[0550] 34. The expression cassette of embodiment 33, wherein said heterologous polynucleotide encodes the IBDV VP2 antigen.

[0551] 35. The expression cassette of embodiment 34, wherein, the IBDV VP2 antigen is as defined herein, and / or the promoter is the mCMV promoter of the present invention, and / or the polyA signal motif of (1) is the artificial reverse tandem polyA signal motif, and / or the polyA signal motifs of (4) are the novel bidirectional artificial polyA signal motif and the MDV39 / 40-intergenic bidirectional polyA signal motif.

[0552] 36. the expression cassettes of any of the embodiments 1-35, further comprising an FRT site among the elements, preferably upstream or downstream immediately to a polyA signal motif,

[0553] preferably, the FRT site is non-functioning.

[0554] 37. A recombinant MDV, which comprises any one of the expression cassettes of embodiments 1-35, or any combination thereof.

[0555] 38. A recombinant MDV comprising a heterologous polynucleotide encoding IBDV VP2 antigen,

[0556] wherein, the IBDV VP2 antigen is an VP2 antigen from nVar IBDV, which:

[0557] (a) is encoded by the heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 10, or 9, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 10, or 9, and / or

[0558] (b) comprises or consists of an amino acid sequence as shown in SEQ ID NO: 8, or an amino acid sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 8,

[0559] optionally, the heterologous polynucleotide is 3’ flanked by a backup stop codon,

[0560] optionally, the heterologous polynucleotide is inserted at an insertion site located in the intergenic region between UL26 and UL27 genes, or an insertion site located in the intergenic region between UL55 and MDV71 genes, preferably an insertion site located in the intergenic region between UL55 and MDV71 genes,

[0561] preferably, the MDV further comprises an exogenous promoter optionally linked to the heterologous polynucleotide.

[0562] 39. The recombinant MDV of embodiment 38, wherein the exogenous promoter is an mCMV promoter.

[0563] 40. The recombinant MDV of embodiment 38 or 39, wherein the heterologous polynucleotide is operably linked to one or more (e.g., one, two, or three in tandem) non-endogenous polyA signal motifs upstream and / or downstream to the heterologous polynucleotide or heterologous polynucleotides.

[0564] 41. The recombinant MDV of embodiment 40, wherein the heterologous polynucleotide is operably linked to an artificial reverse tandem polyA signal motif located upstream to the promoter,

[0565] wherein the reverse tandem polyA signal motif is the reverse tandem polyA signal motif of the present invention.

[0566] 42. The recombinant MDV of embodiment 41 or 40, wherein the heterologous polynucleotide are operably linked to a novel bidirectional artificial polyA signal motif, e.g., the novel bidirectional artificial polyA signal motif of the present invention, and an MDV39 / 40-intergenic bidirectional polyA signal motif, e.g., the MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention, in tandem located downstream to the heterologous polynucleotide or the heterologous polynucleotides,

[0567] 43. The recombinant MDV of any one of embodiments 38-42, wherein the heterologous polynucleotide is expressed in the same orientation as UL55 gene.

[0568] 44. The recombinant MDV of any one of embodiments 38-43, wherein the recombinant MDV is a recombinant HVT, and comprises or consists essentially of or consists of the following gene and elements in 5’ to 3’ direction and in this order: (a) an artificial reverse tandem polyA signal motif, e.g., an artificial reverse tandem polyA signal motif of the present invention; (b) an FRT site; (c) an mCMV promoter, e.g., an mCMV promoter comprising or consisting of a sequence of SEQ ID NO: 14, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription; (d) a heterologous polynucleotide encoding IBDV VP2 antigen, e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 9 or 10, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 9 or 10; and (e) a combination of a novel bidirectional artificial polyA signal motif and an MDV39 / 40-intergenic bidirectional polyA signal motif in tandem, e.g., a combination of a novel bidirectional artificial polyA signal motif of the present invention and an MDV39 / 40-intergenic bidirectional polyA signal motif of the present invention in tandem,

[0569] preferably, inserted at the site in the intergenic region between UL55 and MDV71 genes, preferably in the region between the HVT genome DNA sequences atcgctatgcaaagagatgcgtgtgtacacgcgccgttga (SEQ ID NO: 26) and ttaagatgcaggagtaacaatgtgcatagtaggcgtagtt (SEQ ID NO: 29) , more preferably at the site between the FC-126 genome DNA sequences tatatgttattaaataaaataattgaccagtgaacaattt (SEQ ID NO: 27) and gtttaatgttagtttattcaatgcattggttgcaaatatt (SEQ ID NO: 28) , i.e., between the 118th nucleotide and the 119th nucleotide of the sequence as shown in SEQ ID NO: 37.

[0570] Embodiment set 2

[0571] The present invention provides the following exemplary embodiments, which may further be combined with one or more other embodiments in the description as would be understood by the skilled person:

[0572] Insertion site

[0573] 1. A recombinant Marek’s Disease Virus (MDV) comprising at least one or more heterologous polynucleotides encoding an antigen of an avian pathogen, wherein at least a first heterologous polynucleotide encoding an antigen of an avian pathogen is inserted at a first insertion site in the non-coding intergenic region of the genome of said MDV between UL26 and UL27 genes.

[0574] 2. The recombinant MDV of embodiment 1, wherein the first heterologous polynucleotide is inserted between the stop codon of UL26 gene and the stop codon of UL27 gene.

[0575] 3. The recombinant MDV of embodiment 1 or 2, wherein the MDV comprises MDV type 3 (HVT) , such as HVT strain FC-126, MDV type 1, such as strain CVI-988, CVTR, SC9-1, and / or 814, MDV type 2 (avian herpesvirus type 3) , such as strain SB-1, and the like, and prevalent strains and their attenuated strains by passaging, mutagenesis, and / or genetic engineering,

[0576] preferably herpesvirus of turkeys (HVT) , optionally HVT strain FC-126 or any prevalent strain or their attenuated strain by passaging, mutagenesis, and / or genetic engineering,

[0577] wherein the first insertion site is located in the non-coding intergenic region between HVT033 and HVT035 genes.

[0578] 4. The recombinant MDV of any preceding embodiment, wherein the first heterologous polynucleotide is inserted between the stop codon of HVT033 gene and the stop codon of HVT035 gene.

[0579] 5. The recombinant MDV of any preceding embodiment, wherein

[0580] (i) when the MDV comprises HVT FC-126, said insertion site in the intergenic region between UL26 and UL27 genes is located in the region between the FC-126 genome DNA sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and ctatacaatttcatcatccgtctcagaatccgtgtcgttt (SEQ ID NO: 25) ;

[0581] (ii) when the MDV comprises MDV1, MDV2 or HVT strains other than FC-126, said insertion site in the intergenic region between UL26 and UL27 genes is located in the genome region which is corresponding to the region between FC-126 genome DNA sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and ctatacaatttcatcatccgtctcagaatccgtgtcgttt (SEQ ID NO: 25) .

[0582] 6. The recombinant MDV of any preceding embodiment, wherein the flanking sequence of the insertion site is the same with or reverse complementary to a sequence that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with at least part of SEQ ID NO: 36, wherein the flanking sequence is the upstream flanking sequence or the downstream flanking sequence.

[0583] 7. The recombinant MDV of any preceding embodiment, wherein

[0584] (i) when the MDV comprises HVT FC-126, said insertion site in the intergenic region between UL26 and UL27 genes is located at the site between the FC-126 genome DNA sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and aaagcggtgtgttaatgtcagagagctgta (SEQ ID NO: 24) , i.e., between the 30th nucleotide and the 31st nucleotide of the sequence as shown in SEQ ID NO: 36;

[0585] (ii) when the MDV comprises MDV1, MDV2 or HVT strains other than FC-126, said insertion site in the intergenic region between UL26 and UL27 genes is located at the site which is corresponding to the site between FC-126 genome DNA sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and aaagcggtgtgttaatgtcagagagctgta (SEQ ID NO: 24) .

[0586] First heterologous polynucleotide

[0587] 8. The recombinant MDV of any preceding embodiment, wherein the first heterologous polynucleotide encodes an antigen of an avian pathogen selected from the group consisting of Newcastle Disease Virus (NDV) , Infectious Bursal Disease Virus (IBDV) , Infectious Laryngotracheitis Virus (ILTV) , avian encephalomyelitis virus, avian reovirus, avian paramyxovirus, avian metapneumovirus, avian adenovirus, fowl pox virus, avian coronavirus, avian rotavirus, avian parvovirus, avian astrovirus, avian retrovirus, avian picornavirus, and chick anemia virus, coccidiosis (Eimeria sp. ) , Campylobacter sp., Salmonella sp., Mycoplasma gallisepticum, Mycoplasma synoviae, Pasteurella sp., Avibacterium sp., Escherichia coli and Clostridium sp.

[0588] 9. The recombinant MDV of any preceding embodiment, wherein the first heterologous polynucleotide encodes an antigen selected from the group consisting of Newcastle Disease Virus fusion protein (NDV F) , Newcastle Disease Virus hemagglutinin neuraminidase (NDV-HN) , Infectious Bursal Disease Virus (IBDV) VP2, IBDV VPX, IBDV VP3, IBDV VP4, ILTV glycoprotein B, ILTV glycoprotein I, ILTV UL32, ILTV glycoprotein D, ILTV glycoprotein E, ILTV glycoprotein C, protective genes derived from Mycoplasma gallisepticum (MG) , or Mycoplasma synoviae (MS) , or combinations thereof.

[0589] 10. The recombinant MDV of any preceding embodiment, wherein the first heterologous polynucleotide encodes an antigen selected from the group consisting of an NDV F antigen, an IBDV VP2 antigen and an ILTV gD antigen.

[0590] 11. The recombinant MDV of any preceding embodiment, wherein the first heterologous polynucleotide encodes an NDV F antigen.

[0591] 12. The recombinant MDV of embodiment 11, wherein the amino acid sequence at the protease cleavage site of the NDV F antigen has been mutated.

[0592] 13. The recombinant MDV of embodiment 11 or 12, wherein the NDV F antigen is encoded by the heterologous polynucleotide comprising or consisting of the sequence as shown in SEQ ID NO: 4 or 63, 2, or 3, or a sequence sharing at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 4 or 63, 2, or 3.

[0593] 14. The recombinant MDV of any of embodiments 11 to 13, wherein the NDV F antigen comprises or consists of an amino acid sequence as shown in SEQ ID NO: 1, or an amino acid sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 1.

[0594] 15. The recombinant MDV of any preceding embodiment, wherein the first heterologous polynucleotide is codon-optimised for expression in an avian.

[0595] 16. The recombinant MDV of any preceding embodiment, wherein the first heterologous polynucleotide is codon-optimised for expression in poultry.

[0596] 17. The recombinant MDV of any preceding embodiment, wherein the first heterologous polynucleotide is codon-optimised for expression in a chicken.

[0597] Endogenous promoter

[0598] 18. The recombinant MDV of any preceding embodiment, wherein the first heterologous polynucleotide is operably linked to an endogenous promoter of the MDV.

[0599] 19. The recombinant MDV of any preceding embodiment, wherein the first heterologous polynucleotide is operably linked to the endogenous UL26 promoter of the MDV, the endogenous UL26.5 promoter of the MDV, and / or the endogenous UL27 promoter of the MDV.

[0600] 20. The recombinant MDV of any preceding embodiment, wherein the first heterologous polynucleotide is operably linked to the endogenous UL26 promoter of the MDV and / or the endogenous UL26.5 promoter of the MDV.

[0601] 21. The recombinant MDV of any preceding embodiment, wherein the first heterologous polynucleotide is operably linked to the endogenous UL26 promoter of the MDV.

[0602] 22. The recombinant MDV of any preceding embodiment, wherein the first heterologous polynucleotide expresses in the same orientation as the orientation of the UL26 gene.

[0603] 23. The recombinant MDV of any preceding embodiment, wherein the heterologous polynucleotide is linked at its 5’ end to the flanking sequence of the insertion site via an IRES element.

[0604] 24. The recombinant MDV of embodiment 23, wherein the IRES element comprises or consists of the sequence of SEQ ID NO: 15, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 15 and can recruit the ribosome to initiate the translation.

[0605] 25. The recombinant MDV of embodiment 23 or 24, wherein there is a stop codon 5’ upstream to, e.g. directly 5’ flanking, the IRES.

[0606] 26. The recombinant MDV of any preceding embodiment, wherein the heterologous polynucleotide is linked at its 5’ end to the flanking sequence of the insertion site via a self-cleaving peptide-coding sequence.

[0607] 27. The recombinant MDV of any preceding embodiment, wherein the recombinant MDV comprises a first expression cassette comprising an IRES element and the first heterologous polynucleotide, wherein the first heterologous polynucleotide is placed after the stop codon of the endogenous UL26 / UL26.5 gene via the IRES element; the first heterologous polynucleotide is placed under the control of the endogenous UL26 promoter of MDV and / or under the control of the endogenous UL26.5 promoter of MDV.

[0608] 28. The recombinant MDV of any preceding embodiment, wherein the recombinant MDV comprises a first expression cassette comprising or consisting of in 5’ to 3’ direction and in this order:

[0609] (a) an IRES element, and

[0610] (b) the first heterologous polynucleotide,

[0611] wherein the first heterologous polynucleotide is placed after the stop codon of the endogenous UL26 / UL26.5 gene via the IRES element, and the first heterologous polynucleotide is placed under the control of the endogenous UL26 promoter of MDV and / or the endogenous UL26.5 promoter of MDV.

[0612] 29. The recombinant MDV of embodiment 27 or 28, wherein the first expression cassette comprises or consists of in 5’ to 3’ direction and in this order:

[0613] (a) an IRES, e.g., SEQ ID NO: 15; and

[0614] (b) a first heterologous polynucleotide encoding NDV F antigen (e.g., comprising or consisting of an amino acid sequence as shown in SEQ ID NO: 1) , e.g., a heterologous polynucleotide comprising or consisting of the sequence as shown in SEQ ID NO: 4 or 63, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 4 or 63.

[0615] 30. The recombinant MDV of any of embodiments 27 to 29, wherein the first expression cassette comprises or consists of in 5’ to 3’ direction and in this order:

[0616] (a) a stop codon, e.g., SEQ ID NO: 57;

[0617] (b) an optimized IRES, e.g., SEQ ID NO: 15;

[0618] (c) a first heterologous polynucleotide encoding cleavage site-mutated NDV F (e.g., comprising or consisting of an amino acid sequence as shown in SEQ ID NO: 1) , e.g., a heterologous polynucleotide comprising or consisting of the sequence as shown in SEQ ID NO: 4 or 63, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 4 or 63.

[0619] 31. The recombinant MDV of any of embodiments 27 to 30, wherein the first expression cassette comprises or consists of SEQ ID NO: 31 or 64.

[0620] Non-endogenous promoter

[0621] 32. The recombinant MDV of any of embodiments 1 to 17, wherein the first heterologous polynucleotide is operably linked to a non-endogenous promoter.

[0622] 33. The recombinant MDV of any of embodiments 1 to 17 or 32, wherein the first heterologous polynucleotide is operably linked to a non-endogenous promoter.

[0623] 34. The recombinant MDV of any preceding embodiment, wherein the first heterologous polynucleotide expresses in the same orientation as the orientation of the UL27 gene.

[0624] 35. The recombinant MDV of any of embodiments 1 to 17 or 32 to 34, wherein the recombinant MDV comprises a first expression cassette comprising the first heterologous polynucleotide, and further comprises a non-endogenous promoter and one or more non-endogenous polyA signal motifs operably linked to the first heterologous polynucleotide.

[0625] 36. The recombinant MDV of embodiment 35, wherein the first expression cassette comprises or consists of in 5’ to 3’ direction and in this order:

[0626] (a) a non-endogenous promoter,

[0627] (b) the first heterologous polynucleotide, and

[0628] (c) one or more non-endogenous polyA signal motifs;

[0629] whereby the promoters and polyA signal motifs are operatively linked to the first heterologous polynucleotide.

[0630] 37. The recombinant MDV of embodiment 36, wherein the first heterologous polynucleotide is 3’ flanked by a polyadenylation signal core sequence, and / or 5’ flanked by a Kozak sequence.

[0631] 38. The recombinant MDV of any preceding embodiments, wherein the recombinant MDV comprises a first expression cassette comprising or consisting of in 5’ to 3’ direction and in this order:

[0632] (a) a novel bidirectional artificial polyA signal motif;

[0633] (b) an exogenously introduced MDV UL26.5 promoter;

[0634] (c) a Kozak sequence;

[0635] (d) the first heterologous polynucleotide;

[0636] (e) a polyadenylation signal core sequence; and

[0637] (f) an MDV39 / 40-intergenic bidirectional polyA signal motif.

[0638] 39. The recombinant MDV of any of embodiments 32 to 38, wherein the promoter comprises or consists of the sequence of SEQ ID NO: 20, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 20 and can bind an RNA polymerase to initiate transcription.

[0639] 40. The recombinant MDV of embodiment 38 or 39, wherein the polyadenylation signal core sequence comprises or consists of:

[0640] (i) the nucleotide sequence set forth in SEQ ID NO: 61;

[0641] (ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or

[0642] (iii) a nucleotide sequence complementary to any sequence in (i) or (ii) , and can promote the termination of the encountered transcriptional elongation.

[0643] 41. The recombinant MDV of any of embodiments 38 to 40, wherein the novel bidirectional artificial polyA signal motif comprises or consists of:

[0644] (i) the nucleotide sequence set forth in SEQ ID NO: 17;

[0645] (ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or

[0646] (iii) a nucleotide sequence complementary to any sequence in (i) or (ii) , and can promote the termination of the encountered transcriptional elongation.

[0647] 42. The recombinant MDV of any of embodiments 38 to 41, wherein the MDV39 / 40-intergenic bidirectional polyA signal motif comprises or consists of:

[0648] (i) the nucleotide sequence set forth in SEQ ID NO: 19;

[0649] (ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or

[0650] (iii) a nucleotide sequence complementary to any sequence in (i) or (ii) , and can promote the termination of the encountered transcriptional elongation.

[0651] 43. The recombinant MDV of any of embodiments 35 to 42, wherein the first expression cassette comprises or consists of in 5’ to 3’ direction and in this order:

[0652] (a) one or more optional polyA signal motifs;

[0653] (b) an exogenous promoter, e.g. an exogenous promoter same with an MDV endogenous UL26.5 promoter, e.g., a promoter comprises or consists of the sequence of SEQ ID NO: 20, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 20 and can bind an RNA polymerase to initiate transcription;

[0654] (c) optionally a Kozak sequence, e.g., SEQ ID NO: 60;

[0655] (d) a heterologous polynucleotide encoding NDV F (e.g., comprising or consisting of an amino acid sequence as shown in SEQ ID NO: 1) , e.g., a heterologous polynucleotide comprising or consisting of the sequence as shown in SEQ ID NO: 4 or 63, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 4 or 63; and

[0656] (e) one or more optional polyA signal motifs.

[0657] 44. The recombinant MDV of any of embodiments 35 to 43, wherein the first expression cassette comprises or consists of in 5’ to 3’ direction and in this order:

[0658] (a) a polyA signal motif, e.g. a novel bidirectional artificial polyA signal motif, e.g., SEQ ID NO: 17;

[0659] (b) an exogenous promoter, e.g. an exogenous promoter same with an MDV endogenous UL26.5 promoter, e.g., a promoter comprises or consists of the sequence of SEQ ID NO: 20, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 20 and can bind an RNA polymerase to initiate transcription;

[0660] (c) optionally a Kozak sequence, e.g., SEQ ID NO: 60;

[0661] (d) a first heterologous polynucleotide encoding NDV F antigen (e.g., comprising or consisting of an amino acid sequence as shown in SEQ ID NO: 1) , e.g., a heterologous polynucleotide comprising or consisting of the sequence as shown in SEQ ID NO: 4 or 63, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 4 or 63;

[0662] (e) a polyA signal motif, e.g. a polyadenylation signal core sequence, e.g., SEQ ID NO: 61;

[0663] (f) an optional further polyA signal motif, e.g. an MDV39 / 40-intergenic bidirectional polyA signal motif, e.g., SEQ ID NO: 19.

[0664] 45. The recombinant MDV of any of embodiments 35 to 44, wherein the first expression cassette comprises or consists of in 5’ to 3’ direction and in this order:

[0665] (a) a novel bidirectional artificial polyA signal motif, e.g., SEQ ID NO: 17;

[0666] (b) an exogenous promoter same with an MDV endogenous UL26.5 promoter, e.g., a promoter comprises or consists of the sequence of SEQ ID NO: 20, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 20 and can bind an RNA polymerase to initiate transcription;

[0667] (c) a Kozak sequence, e.g., SEQ ID NO: 60;

[0668] (d) a first heterologous polynucleotide encoding cleavage site-mutated NDV F (e.g., comprising or consisting of an amino acid sequence as shown in SEQ ID NO: 1) , e.g., a heterologous polynucleotide comprising or consisting of the sequence as shown in SEQ ID NO: 4 or 63, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 4 or 63;

[0669] (e) a polyadenylation signal core sequence, e.g., SEQ ID NO: 61;

[0670] (f) an MDV39 / 40-intergenic bidirectional polyA signal motif, e.g., SEQ ID NO: 19.

[0671] 46. The recombinant MDV of any of embodiments 35 to 46, wherein the first expression cassette comprises or consists of SEQ ID NO: 35.

[0672] Functions

[0673] 47. The recombinant MDV of any preceding embodiment, wherein the recombinant MDV elicits a protective immune response against said avian pathogen.

[0674] 48. The recombinant MDV of any preceding embodiment, wherein the recombinant MDV provides protection against challenge with said avian pathogen.

[0675] 49. The recombinant MDV of any preceding embodiment, wherein the recombinant MDV provides protection against one or more clinical symptoms of said avian pathogen.

[0676] 50. The recombinant MDV of any preceding embodiment, wherein the recombinant MDV provides protection against one or more clinical signs of said avian pathogen.

[0677] 51. The recombinant MDV of any preceding embodiment, wherein the recombinant MDV provides 100%protection against said avian pathogen.

[0678] 52. The recombinant MDV of any of embodiments 47 to 51, wherein said avian pathogen is NDV.

[0679] Further heterologous polynucleotides

[0680] 53. The recombinant MDV of any preceding embodiment, wherein the recombinant MDV comprises a second heterologous polynucleotide encoding an antigen of a second avian pathogen and an optional third heterologous polynucleotide encoding an antigen of a third avian pathogen.

[0681] 54. The recombinant MDV of embodiment 53, wherein the recombinant MDV comprises the third heterologous polynucleotide encoding an antigen of a third avian pathogen.

[0682] 55. The recombinant MDV of embodiment 53 or 54, wherein the second heterologous polynucleotide and the third heterologous polynucleotide, where present, are inserted at a second insertion site in the MDV genome which is different from the first insertion site.

[0683] 56. The recombinant MDV of embodiment 55, wherein the second insertion site is located in a region selected from the group consisting of the following: the intergenic region between UL55 and MDV71 genes, the intergenic region between UL3 and UL4 genes, the intergenic region between UL22 and UL23 genes, the intergenic region between UL44 and UL45 genes, the intergenic region between UL45 and UL46 genes, the intergenic region between UL48 and UL49 genes, the intergenic region between UL54 and MDV69 genes, the IG2 region, the intergenic region between US10 and US1 genes, the intergenic region between SORF3 and US2 genes, the US2 locus, the US6 locus, the US7 locus, the US8 locus, the US10 locus, and the intergenic region between US10 and SORF3 genes,

[0684] 57.The recombinant MDV of embodiment 55 or 56, wherein the second insertion site is located in the intergenic region between the UL55 and MDV71 genes.

[0685] 58. The recombinant MDV of any of embodiments 55 to 57, wherein the second insertion site is located between the stop codon of UL55 gene and the stop codon of MDV71 gene.

[0686] 59. The recombinant MDV of any of embodiments 55 to 58, wherein the second heterologous polynucleotide and third heterologous polynucleotide, where present, are expressed in the same orientation as UL55 gene.

[0687] 60. The recombinant MDV of any of embodiments 55 to 59, wherein

[0688] (i) when the MDV comprises HVT FC-126, said second insertion site in the intergenic region between UL55 and MDV71 genes is located in the region between the FC-126 genome DNA sequences atcgctatgcaaagagatgcgtgtgtacacgcgccgttga (SEQ ID NO: 26) and ttaagatgcaggagtaacaatgtgcatagtaggcgtagtt (SEQ ID NO: 29) ;

[0689] (ii) when the MDV comprisesMDV1, MDV2 or HVT strains other than FC-126, said second insertion site in the intergenic region between UL55 and MDV71 genes is located in the genome region which is corresponding to the region between FC-126 genome DNA sequences atcgctatgcaaagagatgcgtgtgtacacgcgccgttga (SEQ ID NO: 26) and ttaagatgcaggagtaacaatgtgcatagtaggcgtagtt (SEQ ID NO: 29) .

[0690] 61. The recombinant MDV of any of embodiments 55 to 60, wherein the MDV is HVT FC-126, and the flanking sequence of the second insertion site is the same with or reverse complementary to a sequence that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with at least part of SEQ ID NO: 37, wherein the flanking sequence is the upstream flanking sequence or the downstream flanking sequence.

[0691] 62. The recombinant MDV of any of embodiments 55 to 61, wherein

[0692] (i) when the MDV comprises HVT FC-126, said second insertion site in the intergenic region between UL55 and MDV71 genes is located at the site between the FC-126 genome DNA sequences tatatgttattaaataaaataattgaccagtgaacaattt (SEQ ID NO: 27) and gtttaatgttagtttattcaatgcattggttgcaaatatt (SEQ ID NO: 28) , i.e., between the 118th nucleotide and the 119th nucleotide of the sequence as shown in SEQ ID NO: 37;

[0693] (ii) when the MDV comprises MDV1, MDV2 or HVT strains other than FC-126, said second insertion site in the intergenic region between UL55 and MDV71 genes is located at the site which is corresponding to the site between FC-126 genome DNA sequences tatatgttattaaataaaataattgaccagtgaacaattt (SEQ ID NO: 27) and gtttaatgttagtttattcaatgcattggttgcaaatatt (SEQ ID NO: 28) .

[0694] 63. The recombinant MDV of any of embodiments 53 to 62, wherein the second heterologous polynucleotide and third heterologous polynucleotide, where present, independently encode an antigen of avian pathogen selected from the group consisting of Newcastle Disease Virus (NDV) , Infectious Bursal Disease Virus (IBDV) , Infectious Laryngotracheitis Virus (ILTV) , avian encephalomyelitis virus, avian reovirus, avian paramyxovirus, avian metapneumovirus, avian adenovirus, fowl pox virus, avian coronavirus, avian rotavirus, avian parvovirus, avian astrovirus, avian retrovirus, avian picornavirus, and chick anemia virus, coccidiosis (Eimeria sp. ) , Campylobacter sp., Salmonella sp., Mycoplasma gallisepticum, Mycoplasma synoviae, Pasteurella sp., Avibacterium sp., Escherichia coli and Clostridium sp.

[0695] 64. The recombinant MDV of any of embodiments 53 to 63, wherein the second heterologous polynucleotide and third heterologous polynucleotide, where present, independently encode a polypeptide selected from the group consisting of Newcastle Disease Virus fusion protein (NDV F) , Newcastle Disease Virus hemagglutinin neuraminidase (NDV-HN) , Infectious Bursal Disease Virus (IBDV) VP2, IBDV VPX, IBDV VP3, IBDV VP4, ILTV glycoprotein B, ILTV glycoprotein I, ILTV UL32, ILTV glycoprotein D, ILTV glycoprotein E, ILTV glycoprotein C, protective genes derived from Mycoplasma gallisepticum (MG) , or Mycoplasma synoviae (MS) , or combinations thereof.

[0696] 65. The recombinant MDV of any of embodiments 53 to 64, wherein the second heterologous polynucleotide and the third heterologous polynucleotide, where present, independently encode a polypeptide selected from the group consisting of an IBDV VP2 antigen, an ILTV gD antigen and an NDV F antigen.

[0697] 66. The recombinant MDV of any of embodiments 53 to 65, wherein the second heterologous polynucleotide encodes an IBDV VP2 antigen.

[0698] 67. The recombinant MDV of any of embodiments 53 to 66, wherein the third heterologous polynucleotide, where present, encodes an ILTV gD antigen.

[0699] 68. The recombinant MDV of any of embodiments 53 to 67, wherein the second heterologous polynucleotide encodes an IBDV VP2 antigen and the third heterologous polynucleotide, where present, encodes an ILTV gD antigen.

[0700] 69. The recombinant MDV of any of embodiments 53 to 68, wherein the first heterologous polynucleotide encodes an NDV F antigen, the second heterologous polynucleotide encodes an IBDV VP2 antigen, and the third heterologous polynucleotide, where present, encodes an ILTV gD antigen.

[0701] 70. The recombinant MDV of any of embodiments 66 to 69, wherein the second heterologous polynucleotide encoding IBDV VP2 is not codon-optimised for expression in an avian, e.g. poultry, e.g. a chicken.

[0702] 71. The recombinant MDV of any of embodiments 66 to 70, wherein the level of expression of the second heterologous polynucleotide encoding IBDV VP2 is the same, substantially the same or a similar level of expression to SEQ ID NO: 6, when expressed in an avian, e.g. poultry, e.g. a chicken, from the same recombinant MDV.

[0703] 72. The recombinant MDV of any of embodiments 53 to 69, wherein the second heterologous polynucleotide is codon-optimised for expression in an avian.

[0704] 73. The recombinant MDV of any of embodiments 53 to 69 or 72, wherein the second heterologous polynucleotide is codon-optimised for expression in poultry.

[0705] 74. The recombinant MDV of any of embodiments 53 to 69 or 72 or 73, wherein the second heterologous polynucleotide is codon-optimised for expression in a chicken.

[0706] 75. The recombinant MDV of any of embodiments 66 to 74, wherein the IBDV VP2 antigen is an VP2 antigen from vvIBDV or nVar IBDV

[0707] 76. The recombinant MDV of any of embodiments 66 to 75, wherein the IBDV VP2 antigen

[0708] (a) is encoded by the heterologous polynucleotide comprising or consisting of the sequence as shown in SEQ ID NO: 7, 6, 9 or 10, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 7, 6, 9 or 10, preferably SEQ ID NO: 6, and / or

[0709] (b) comprises or consists of an amino acid sequence as shown in SEQ ID NO: 5 or 8, or an amino acid sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 5 or 8.

[0710] 77. The recombinant MDV of any of embodiments 53 to 76, wherein the third heterologous polynucleotide is codon-optimised for expression in an avian.

[0711] 78. The recombinant MDV of any of embodiments 53 to 77, wherein the third heterologous polynucleotide is codon-optimised for expression in poultry.

[0712] 79. The recombinant MDV of any of embodiments 53 to 78, wherein the third heterologous polynucleotide is codon-optimised for expression in a chicken.

[0713] 80. The recombinant MDV of any of embodiments 67 to 79, wherein the ILTV gD antigen

[0714] (a) is encoded by the heterologous polynucleotide comprising or consisting of the sequence as shown in SEQ ID NO: 12 or 13, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 12 or 13, and / or

[0715] (b) comprises or consists of an amino acid sequence as shown in SEQ ID NO: 11, or an amino acid sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 11.

[0716] 81. The recombinant MDV of any of embodiments 54 to 80, wherein the second heterologous polynucleotide and the third heterologous polynucleotide are operably linked to each other via an IRES element or a stop codon+IRES (astop codon 5’ upstream to, preferably directly 5’ flanking, the IRES) .

[0717] 82. The recombinant MDV of any of embodiments 53 to 81, wherein the second heterologous polynucleotide and the third heterologous polynucleotide, where present, are operably linked to an exogenous promoter.

[0718] 83. The recombinant MDV of embodiment 82, wherein the exogenous promoter is an mCMV promoter.

[0719] 84. The recombinant MDV of embodiment 83, wherein the mCMV promoter comprises or consists of the sequence of SEQ ID NO: 14, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription.

[0720] 85. The recombinant MDV of any of embodiments 53 to 84, wherein the second heterologous polynucleotide and the third heterologous polynucleotide, where present, are operably linked to one or more (e.g., one, two, or three in tandem) non-endogenous polyA signal motifs upstream and / or downstream to the heterologous polynucleotide or heterologous polynucleotides.

[0721] 86. The recombinant MDV of any of embodiments 53 to 85, wherein the second heterologous polynucleotide and the third heterologous polynucleotide, where present, are operably linked to one or more (e.g., one, two, or three in tandem) non-endogenous polyA signal motifs in each end, e.g., one or more (e.g., one, two, or three in tandem) polyA signal motif at the 5’ end (e.g., upstream to the promoter) ; and / or one or more (e.g., one, two, or three in tandem) polyA signal motif at the 3’ end (e.g., downstream to the heterologous polynucleotide) .

[0722] 87. The recombinant MDV of any of embodiments 53 to 86, wherein the second heterologous polynucleotide is operably linked to an artificial reverse tandem polyA signal motif located upstream to the exogenous promoter,

[0723] 88. The recombinant MDV of embodiment 87, wherein the artificial reverse tandem polyA signal motif comprises or consists of:

[0724] (i) the nucleotide sequence set forth in SEQ ID NO: 16;

[0725] (ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%

[0726] identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or

[0727] (iii) a nucleotide sequence complementary to any sequence in (i) or (ii) , and can promote the termination of the encountered transcriptional elongation.

[0728] 89. The recombinant MDV of any of embodiments 53 to 88, wherein the second heterologous polynucleotide and the third heterologous polynucleotide, where present, are operably linked to a novel bidirectional artificial polyA signal motif located downstream to the second heterologous polynucleotide and the third heterologous polynucleotide, where present.

[0729] 90. The recombinant MDV of any of embodiments 53 to 89, wherein the second heterologous polynucleotide and the third heterologous polynucleotide, where present, are operably linked to a MDV39 / 40-intergenic bidirectional polyA signal motif located downstream to the second heterologous polynucleotide and the third heterologous polynucleotide, where present.

[0730] 91. The recombinant MDV of any of embodiments 53 to 90, wherein the second heterologous polynucleotide and the third heterologous polynucleotide, where present, are operably linked to a novel bidirectional artificial polyA signal motif and an MDV39 / 40-intergenic bidirectional polyA signal motif in tandem located downstream to the second heterologous polynucleotide and the third heterologous polynucleotide, where present.

[0731] 92. The recombinant MDV of embodiment 89 or 91, wherein the novel bidirectional artificial polyA signal motif comprises or consists of:

[0732] (i) the nucleotide sequence set forth in SEQ ID NO: 17;

[0733] (ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or

[0734] (iii) a nucleotide sequence complementary to any sequence in (i) or (ii) , and can promote the termination of the encountered transcriptional elongation.

[0735] 93. The recombinant MDV of any of embodiments 90 to 92, wherein the MDV39 / 40-intergenic bidirectional polyA signal motif comprises or consists of:

[0736] (i) the nucleotide sequence set forth in SEQ ID NO: 19;

[0737] (ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or

[0738] (iii) a nucleotide sequence complementary to any sequence in (i) or (ii) , and can promote the termination of the encountered transcriptional elongation.

[0739] 94. The recombinant MDV of any of embodiments 53 to 93, wherein the recombinant MDV comprises a first expression cassette comprising the first heterologous polynucleotide encoding NDV F inserted in the intergenic region between UL26 and UL27 genes, and a second expression cassette comprising the second heterologous polynucleotide and the third heterologous polynucleotide, where present, inserted at a second insertion site that is different from the first insertion site.

[0740] 95. The recombinant MDV of embodiment 94, wherein the second expression cassette comprises or consists of in 5’ to 3’ direction and in this order:

[0741] (a) a polyA signal motif;

[0742] (b) an exogenous promoter;

[0743] (c) one of the second heterologous polynucleotide or the third heterologous polynucleotide;

[0744] (d) a stop codon,

[0745] (e) an IRES,

[0746] (f) the other one of the second heterologous polynucleotide and the third heterologous polynucleotide; and

[0747] (g) polyA signal motif;

[0748] 96. The recombinant MDV of embodiment 94, wherein the second expression cassette comprises or consists of in 5’ to 3’ direction and in this order:

[0749] (a) a polyA signal motif;

[0750] (b) an exogenous promoter;

[0751] (c) one of the second heterologous polynucleotide and the third heterologous polynucleotide;

[0752] (d) a stop codon,

[0753] (e) an IRES,

[0754] (f) the other one of the second heterologous polynucleotide and the third heterologous polynucleotide;

[0755] (g) a polyA signal motif or polyA signal motifs;

[0756] 97. The recombinant MDV of embodiment 94, wherein the second expression cassette comprises or consists of in 5’ to 3’ direction and in this order:

[0757] (a) a polyA signal motif;

[0758] (b) an FRT site;

[0759] (c) an exogenous promoter;

[0760] (d) one of the second heterologous polynucleotide and the third heterologous polynucleotide;

[0761] (e) a stop codon,

[0762] (f) an IRES,

[0763] (g) the other one of the second heterologous polynucleotide and the third heterologous polynucleotide; and

[0764] (h) polyA signal motif;

[0765] 98. The recombinant MDV of embodiment 94, wherein the second expression cassette comprises or consists of in 5’ to 3’ direction and in this order:

[0766] (a) a polyA signal motif;

[0767] (b) an exogenous promoter;

[0768] (c) one of the second heterologous polynucleotide and the third heterologous polynucleotide;

[0769] (d) a stop codon,

[0770] (e) an IRES,

[0771] (f) the other one of the second heterologous polynucleotide and the third heterologous polynucleotide;

[0772] (g) a polyA signal motif or polyA signal motifs;

[0773] (h) an FRT site; and

[0774] (i) a polyA signal motif.

[0775] 99. The recombinant MDV of any of embodiments 95 to 98, wherein the exogenous promoter is an mCMV promoter.

[0776] 100. The recombinant MDV of any of embodiments 95 to 99, wherein the promoter comprises or consists of the sequence of SEQ ID NO: 14 or 20, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 or 20 and can bind an RNA polymerase to initiate transcription.

[0777] 101. The recombinant MDV of any of embodiments 95 to 100, wherein the IRES element comprises or consists of the sequence of SEQ ID NO: 15, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 15 and can recruit the ribosome to initiate the translation.

[0778] 102. The recombinant MDV of any of embodiments 94 to 101, wherein the second expression cassette is expressed in the same orientation as UL55 gene.

[0779] 103. The recombinant MDV of any of embodiments 94 to 102, wherein the second expression cassette is expressed in the same orientation as MDV71 gene.

[0780] 104. The recombinant MDV of any of embodiments 95 to 103, wherein the polyA signal motif upstream to the promoter is an MDV CVI988 MDV89 gene polyA signal motif upstream to the promoter, e.g., the MDV CVI988 MDV89 gene polyA signal motif comprising or consisting of:

[0781] (i) the nucleotide sequence set forth in SEQ ID NO: 18;

[0782] (ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or

[0783] (iii) a nucleotide sequence complementary to any sequence in (i) or (ii) , and can promote the termination of the encountered transcriptional elongation.

[0784] 105. The recombinant MDV of any of embodiments 95 to 104, wherein the polyA signal motifs downstream to the heterologous polynucleotides are a combination of a novel bidirectional artificial polyA signal motif, an MDV39 / 40-intergenic bidirectional polyA signal motif and an artificial reverse tandem polyA signal motif in tandem downstream to the heterologous polynucleotides, e.g., the novel bidirectional artificial polyA signal motif comprising or consisting of:

[0785] (i) the nucleotide sequence set forth in SEQ ID NO: 17;

[0786] (ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or

[0787] (iii) a nucleotide sequence complementary to any sequence in (i) or (ii) , and can promote the termination of the encountered transcriptional elongation;

[0788] the MDV39 / 40-intergenic bidirectional polyA signal motif comprising or consisting of:

[0789] (i) the nucleotide sequence set forth in SEQ ID NO: 19;

[0790] (ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or

[0791] (iii) a nucleotide sequence complementary to any sequence in (i) or (ii) , and can promote the termination of the encountered transcriptional elongation; and / or the reverse tandem polyA signal motif comprising or consisting of:

[0792] (i) the nucleotide sequence set forth in SEQ ID NO: 16;

[0793] (ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or

[0794] (iii) a nucleotide sequence complementary to any sequence in (i) or (ii) , and can promote the termination of the encountered transcriptional elongation.

[0795] 106. The recombinant MDV of embodiment 94, wherein the second expression cassette comprises or consists of in 5’ to 3’ direction and in this order:

[0796] (a) one or more optional polyA signal motifs;

[0797] (b) a promoter, e.g. an mCMV promoter, e.g., an mCMV promoter comprising or consisting of the sequence of SEQ ID NO: 14, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription;

[0798] (c) a second heterologous polynucleotide encoding IBDV VP2 antigen (e.g., comprising or consisting of an amino acid sequence as shown in SEQ ID NO: 5 or 8) , e.g., a heterologous polynucleotide comprising or consisting of the sequence as shown in SEQ ID NO: 7, 6, 9 or 10, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 7, 6, 9 or 10;

[0799] (d) a stop codon, e.g., SEQ ID NO: 58;

[0800] (e) an IRES, e.g., SEQ ID NO: 15;

[0801] (f) a third heterologous polynucleotide encoding ILTV gD antigen (e.g., comprising or consisting of an amino acid sequence as shown in SEQ ID NO: 11) , e.g., a heterologous polynucleotide comprising or consisting of the sequence as shown in SEQ ID NO: 12, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 12; and[0...

Claims

A recombinant Marek’s Disease Virus (MDV) comprising at least one or more heterologous polynucleotides encoding an antigen of an avian pathogen, wherein at least one of said heterologous polynucleotides is inserted at an insertion site in the non-coding intergenic region of the genome of said MDV, between UL26 and UL27 genes, e.g., between the stop codon of UL26 gene and the stop codon of UL27 gene.A recombinant Marek’s Disease Virus (MDV) comprising at least one or more heterologous polynucleotides encoding an antigen of an avian pathogen, wherein at least one of said heterologous polynucleotides is inserted at an insertion site in the non-coding intergenic region of the genome of said MDV, between UL26 and UL27 genes, e.g., between the stop codon of UL26 gene and the stop codon of UL27 gene,wherein the heterologous polynucleotide inserted into said insertion site is placed under the control of the endogenous UL26 promoter of MDV, and / or under the control of the endogenous UL26.5 promoter of MDV, and / or under the control of the endogenous UL27 promoter of MDV.The recombinant MDV of any one of the preceding claims, wherein the avian pathogen is selected from the group consisting of Newcastle Disease Virus (NDV) , Infectious Bursal Disease Virus (IBDV) , Infectious Laryngotracheitis Virus (ILTV) , avian encephalomyelitis virus, avian reovirus, avian paramyxovirus, avian metapneumovirus, avian adenovirus, fowl pox virus, avian coronavirus, avian rotavirus, avian parvovirus, avian astrovirus, avian retrovirus, avian picornavirus, and chick anemia virus, coccidiosis (Eimeria sp. ) , Campylobacter sp., Salmonella sp., Mycoplasma gallisepticum, Mycoplasma synoviae, Pasteurella sp., Avibacterium sp., Escherichia coli and Clostridium sp., optionally, the antigen is selected from the group consisting of Newcastle Disease Virus fusion protein (NDV F) , Newcastle Disease Virus hemagglutinin neuraminidase (NDV-HN) , Infectious Bursal Disease Virus (IBDV) VP2, IBDV VPX, IBDV VP3, IBDV VP4, ILTV glycoprotein B, ILTV glycoprotein I, ILTV UL32, ILTV glycoprotein D, ILTV glycoprotein E, ILTV glycoprotein C, protective genes derived from Mycoplasma gallisepticum (MG) , or Mycoplasma synoviae (MS) , or combinations thereof.The recombinant MDV of any one of the preceding claims, wherein the antigen is selected from the group consisting of Newcastle Disease Virus fusion protein (NDV F) , Newcastle Disease Virus hemagglutinin neuraminidase (NDV-HN) , Infectious Bursal Disease Virus (IBDV) VP2, IBDV VPX, IBDV VP3, IBDV VP4, ILTV glycoprotein B, ILTV glycoprotein I, ILTV UL32, ILTV glycoprotein D, ILTV glycoprotein E, ILTV glycoprotein C, protective genes derived from Mycoplasma gallisepticum (MG) , or Mycoplasma synoviae (MS) , or combinations thereof.The recombinant MDV of any one of the preceding claims, wherein the MDV comprises three heterologous polynucleotides, a polynucleotide encoding an IBDV VP2 antigen, a polynucleotide encoding an ILTV gD antigen and a polynucleotide encoding an NDV F antigen.The recombinant MDV of any one of the preceding claims, wherein, one or two of the heterologous polynucleotides encoding IBDV VP2, ILTV gD and NDV F are inserted in the intergenic region between UL26 and UL27 genes;preferably, a first cassette comprising the heterologous polynucleotide encoding NDV F is inserted in the intergenic region between UL26 and UL27 genes, and a second cassette comprising a heterologous polynucleotide encoding IBDV VP2 and a heterologous polynucleotide encoding ILTV gD is inserted at the second insertion site.The recombinant MDV of any one of the preceding claims, wherein a first cassette comprising the heterologous polynucleotide encoding NDV F is inserted in the intergenic region between UL26 and UL27 genes, and a second cassette comprising a heterologous polynucleotide encoding IBDV VP2 and a heterologous polynucleotide encoding ILTV gD is inserted at the second insertion site.The recombinant MDV of any one of the preceding claims, wherein at least another heterologous polynucleotide is inserted at a second insertion site which is different from the insertion site between UL26 and UL27 genes, optionally, the second insertion site is located in a region selected from the group consisting of the following: the intergenic region between UL55 and MDV71 genes, the intergenic region between UL3 and UL4 genes, the intergenic region between UL22 and UL23 genes, the intergenic region between UL44 and UL45 genes, the intergenic region between UL45 and UL46 genes, the intergenic region between UL48 and UL49 genes, the intergenic region between UL54 and MDV69 genes, the IG2 region, the intergenic region between US10 and US1 genes, the intergenic region between SORF3 and US2 genes, the US2 locus, the US6 locus, the US7 locus, the US8 locus, the US10 locus, and the intergenic region between US10 and SORF3 genes,preferably, the second insertion site is located in the intergenic region between UL55 and MDV71 genes, e.g., between the stop codon of UL55 gene and the stop codon of MDV71 gene.The recombinant MDV of any one of the preceding claims, wherein the second insertion site is located in a region selected from the group consisting of the following: the intergenic region between UL55 and MDV71 genes, the intergenic region between UL3 and UL4 genes, the intergenic region between UL22 and UL23 genes, the intergenic region between UL44 and UL45 genes, the intergenic region between UL45 and UL46 genes, the intergenic region between UL48 and UL49 genes, the intergenic region between UL54 and MDV69 genes, the IG2 region, the intergenic region between US10 and US1 genes, the intergenic region between SORF3 and US2 genes, the US2 locus, the US6 locus, the US7 locus, the US8 locus, the US10 locus, and the intergenic region between US10 and SORF3 genes,preferably, the second insertion site is located in the intergenic region between UL55 and MDV71 genes, e.g., between the stop codon of UL55 gene and the stop codon of MDV71 gene.The recombinant MDV of any one of the preceding claims, wherein the first cassette comprises the heterologous polynucleotide encoding NDV F and optionally an IRES element or a stop codon+IRES (a stop codon 5’ upstream to, preferably directly 5’ flanking the IRES) , wherein the heterologous polynucleotide is placed after the stop codon of the endogenous UL26 / UL26.5 gene, preferably via an IRES element or a stop codon+IRES; andthe heterologous polynucleotide is placed under the control of the endogenous UL26 promoter of MDV, and / or under the control of the endogenous UL26.5 promoter of MDV,and the first expression cassette is expressed in the same orientation as UL26 gene;preferably, the first cassette comprises or consists of in 5’ to 3’ direction and in this order:(a) an IRES element or a stop codon+IRES, and(b) the heterologous polynucleotide encoding NDV F,and the heterologous polynucleotide is placed after the stop codon of the endogenous UL26 / UL26.5 gene, preferably via an IRES element; and the heterologous polynucleotide is placed under the control of the endogenous UL26 promoter of MDV and / or the endogenous UL26.5 promoter of MDV, thereby the promoters and polyA signal motifs are operatively linked to the heterologous polynucleotide encoding NDV F.The recombinant MDV of any one of the preceding claims, wherein the first cassette comprises the heterologous polynucleotide encoding NDV F, and further comprises a non-endogenous promoter and one or more non-endogenous polyA signal motifs operably linked to the heterologous polynucleotide, and the first expression cassette is expressed in the same orientation as UL27 gene; preferably the first cassette comprises or consists of in 5’ to 3’ direction and in this order:(a) a non-endogenous promoter,(b) the heterologous polynucleotide encoding NDV F, optionally 3’ flanked by a polyadenylation signal core sequence, and / or 5’ flanked by a Kozak sequence, and(c) one or more non-endogenous polyA signal motifs;and whereby the promoters and polyA signal motifs are operatively linked to the heterologous polynucleotide encoding NDV F.The recombinant MDV of any one of the preceding claims, wherein the second cassette comprises a heterologous polynucleotide encoding IBDV VP2 and a heterologous polynucleotide encoding ILTV gD, respectively, preferably linked to each other via an IRES element or via a stop codon+IRES (astop codon 5’ upstream to, preferably directly 5’ flanking the IRES) or via a coding sequence for self-cleavage peptide or via a stop codon+ coding sequence for self-cleavage peptide (astop codon 5’ upstream to, preferably directly 5’ flanking the coding sequence for self-cleavage peptide) , and further comprises an exogenous promoter, operably linked to the heterologous polynucleotides;optionally, the second cassette further comprises one or more (e.g., one, two, or three in tandem) non-endogenous polyA signal motifs in each end, e.g., one or more (e.g., one, two, or three in tandem) polyA signal motif at the 5’ end (e.g., upstream to the promoter) ; and / or one or more (e.g., one, two, or three in tandem) polyA signal motif at the 3’ end (e.g., downstream to the heterologous polynucleotide) ; andoptionally the second cassette further comprises a nonfunctioning FRT site.The recombinant MDV of any one of the preceding claims, wherein the second cassette comprises or consists of in 5’ to 3’ direction and in this order:(a) a polyA signal motif;(b) an FRT site;(c) an exogenous promoter;(d) one of the heterologous polynucleotide encoding IBDV VP2 and the heterologous polynucleotide encoding ILTV gD;(e) a stop codon,(f) an IRES,(g) the other one of the heterologous polynucleotide encoding IBDV VP2 and the heterologous polynucleotide encoding ILTV gD; and(h) polyA signal motif;or(a) a polyA signal motif;(b) an exogenous promoter;(c) one of the heterologous polynucleotide encoding IBDV VP2 and the heterologous polynucleotide encoding ILTV gD;(d) a stop codon,(e) an IRES,(f) the other one of the heterologous polynucleotide encoding IBDV VP2 and the heterologous polynucleotide encoding ILTV gD;(g) a polyA signal motif or polyA signal motifs;(h) an FRT site; and(i) a polyA signal motif.The recombinant MDV of any one of the preceding claims, wherein the exogenous promoter is an mCMV promoter.The recombinant MDV of any one of the preceding claims, wherein the polyA signal motif upstream to the promoter is an artificial reverse tandem polyA signal motif,e.g., the reverse tandem polyA signal motif comprises or consists of a sequence of:(i) a nucleotide sequence set forth in SEQ ID NO: 16;(ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or(iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,and can promote the termination of the encountered transcriptional elongation.The recombinant MDV of any one of the preceding claims, wherein the polyA signal motifs downstream to the heterologous polynucleotides are a combination of a novel bidirectional artificial polyA signal motif and an MDV39 / 40-intergenic bidirectional polyA signal motif in tandem;e.g., the novel bidirectional artificial polyA signal motif comprises or consists of :(i) a nucleotide sequence set forth in SEQ ID NO: 17;(ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or(iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,and can promote the termination of the encountered transcriptional elongation, and / orthe MDV39 / 40-intergenic bidirectional polyA signal motif comprises or consists of :(i) a nucleotide sequence set forth in SEQ ID NO: 19;(ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or(iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,and can promote the termination of the encountered transcriptional elongation.The recombinant MDV of any one of the preceding claims, wherein the second cassette is expressed in the same orientation as UL55 gene.The recombinant MDV of any one of the preceding claims, wherein the polyA signal motif upstream to the promoter is an MDV CVI988 MDV89 gene polyA signal motif upstream to the promoter,e.g., the MDV CVI988 MDV89 gene polyA signal motif comprises or consists of :(i) a nucleotide sequence set forth in SEQ ID NO: 18;(ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or(iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,and can promote the termination of the encountered transcriptional elongation.The recombinant MDV of any one of the preceding claims, wherein the polyA signal motifs downstream to the heterologous polynucleotides are a combination of a novel bidirectional artificial polyA signal motif, an MDV39 / 40-intergenic bidirectional polyA signal motif and an artificial reverse tandem polyA signal motif in tandem downstream to the heterologous polynucleotides,e.g., the novel bidirectional artificial polyA signal motif comprises or consists of :(i) a nucleotide sequence set forth in SEQ ID NO: 17;(ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or(iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,and can promote the termination of the encountered transcriptional elongation,the MDV39 / 40-intergenic bidirectional polyA signal motif comprises or consists of :(i) a nucleotide sequence set forth in SEQ ID NO: 19;(ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or(iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,and can promote the termination of the encountered transcriptional elongation, and / orthe reverse tandem polyA signal motif comprises or consists of :(i) a nucleotide sequence set forth in SEQ ID NO: 16;(ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or(iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,and can promote the termination of the encountered transcriptional elongation.The recombinant MDV of any one of the preceding claims, wherein the second cassette is expressed in the same orientation as MDV71 gene.The recombinant MDV of any one of the preceding claims, wherein the promoter comprises or consists of a sequence of SEQ ID NO: 14 or 20,or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 or 20 and can bind an RNA polymerase to initiate transcription.The recombinant MDV of any one of the preceding claims, wherein the IRES element comprises or consists of a sequence of SEQ ID NO: 15,or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 15 and can recruit the ribosome to initiate the translation.The recombinant MDV of any one of the preceding claims, wherein the amino acid sequence at the protease cleavage site of the NDV F antigen has been mutated,preferably, said NDV F antigen(a) is encoded by the heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 4, 63, 2, or 3, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 4, 63, 2, or 3, and / or(b) comprises or consists of an amino acid sequence as shown in SEQ ID NO: 1, or an amino acid sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 1.The recombinant MDV of any one of the preceding claims, wherein the IBDV VP2 antigen is an VP2 antigen from vvIBDV or nVar IBDV, preferably said IBDV VP2 antigen(a) is encoded by the heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 7, 6, 9 or 10, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 7, 6, 9 or 10, and / or(b) comprises or consists of an amino acid sequence as shown in SEQ ID NO: 5 or 8, or an amino acid sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 5 or 8.The recombinant MDV of any one of the preceding claims, wherein the ILTV gD antigen(a) is encoded by the heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 12 or 13, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 12 or 13, and / or(b) comprises or consists of an amino acid sequence as shown in SEQ ID NO: 11, or an amino acid sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 11.The recombinant MDV of any one of the preceding claims, wherein:the first cassette comprises or consists of in 5’ to 3’ direction and in this order:(a) a stop codon, e.g., SEQ ID NO: 57;(b) an optimized IRES, e.g., an IRES as defined in claim 22;(c) a heterologous polynucleotide encoding cleavage site-mutated NDV F (e.g., comprising or consisting of an amino acid sequence as shown in SEQ ID NO: 1) , e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 4 or 63, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 4 or 63;or(a) a novel bidirectional artificial polyA signal motif, e.g., a novel bidirectional artificial polyA signal motif as defined in claim 16;(b) an exogenous promoter same with an MDV endogenous UL26.5 promoter, e.g., a promoter comprises or consists of a sequence of SEQ ID NO: 20, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 20 and can bind an RNA polymerase to initiate transcription;(c) a Kozak sequence, e.g., SEQ ID NO: 60;(d) a heterologous polynucleotide encoding cleavage site-mutated NDV F (e.g., comprising or consisting of an amino acid sequence as shown in SEQ ID NO: 1) , e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 4 or 63, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97% identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 4 or 63;(e) a polyadenylation signal core sequence, e.g., SEQ ID NO: 61;(f) an MDV39 / 40-intergenic bidirectional polyA signal motif, e.g., an MDV39 / 40-intergenic bidirectional polyA signal motif as defined in claim 16;and / orthe second cassette comprises or consists of in 5’ to 3’ direction and in this order:(a) an artificial reverse tandem polyA signal motif, e.g., an artificial reverse tandem polyA signal motif as defined in claim 15;(b) an FRT site;(c) an mCMV promoter, e.g., an mCMV promoter comprising or consisting of a sequence of SEQ ID NO: 14, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription;(d) a heterologous polynucleotide encoding IBDV VP2 antigen (e.g., comprising or consisting of an amino acid sequence as shown in SEQ ID NO: 5 or 8) , e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 7, 6, 9 or 10, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 7, 6, 9 or 10;(e) a stop codon, e.g., SEQ ID NO: 58;(f) an optimized IRES, e.g., an IRES as defined in claim 22;(g) a heterologous polynucleotide encoding ILTV gD antigen (e.g., comprising or consisting of an amino acid sequence as shown in SEQ ID NO: 11) , e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 12, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 12; and(h) a combination of a novel bidirectional artificial polyA signal motif and an MDV39 / 40-intergenic bidirectional polyA signal motif in tandem, e.g., a combination of a novel bidirectional artificial polyA signal motif as defined in claim 16 and an MDV39 / 40-intergenic bidirectional polyA signal motif as defined in claim 16 in tandem;or(a) a MDV CVI988 MDV89 gene polyA signal motif, e.g., a MDV CVI988 MDV89 gene polyA signal motif as defined in claim 18;(b) an mCMV promoter, e.g., an mCMV promoter comprising or consisting of a sequence of SEQ ID NO: 14, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription;(c) a heterologous polynucleotide encoding IBDV VP2 antigen (e.g., comprising or consisting of an amino acid sequence as shown in SEQ ID NO: 5 or 8) , e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 6, 7, 9 or 10, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 6, 7, 9 or 10;(d) a stop codon, e.g., SEQ ID NO: 58;(e) an optimized IRES, e.g., an IRES as defined in claim 22;(f) a heterologous polynucleotide encoding ILTV gD antigen (e.g., comprising or consisting of an amino acid sequence as shown in SEQ ID NO: 11) , e.g., a heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 12 or 13, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 12 or 13; and(g) a combination of a novel bidirectional artificial polyA signal motif and an MDV39 / 40-intergenic bidirectional polyA signal motif in tandem, e.g., a combination of a novel bidirectional artificial polyA signal motif as defined in claim 16 and an MDV39 / 40-intergenic bidirectional polyA signal motif as defined in claim 16 in tandem;(h) an FRT site;(i) an artificial reverse tandem polyA signal motif, e.g., an artificial reverse tandem polyA signal motif as defined in claim 15.The recombinant MDV of any one of the preceding claims, wherein:the first cassette comprises or consists of SEQ ID NO: 31, 64 or 35, and / or the second cassette comprises or consists of SEQ ID NO: 32, 33 or 56.The recombinant MDV of any one of the preceding claims, wherein the MDV comprises a heterologous polynucleotide encoding a polypeptide selected from the group consisting of an Infectious Bursal Disease Virus (IBDV) VP2 antigen, an Infectious Laryngotracheitis Virus (ILTV) glycoprotein D (gD) antigen and a Newcastle Disease Virus F (NDV F) antigen.The recombinant MDV of any one of the preceding claims, wherein the heterologous polynucleotide encodes NDV F antigen.The recombinant MDV of any one of the preceding claims, wherein NDV F antigen is as defined in claim 23.The recombinant MDV of any one of the preceding claims, wherein said heterologous polynucleotide is operably linked to the endogenous UL26 promoter of MDV and / or the endogenous UL26.5 promoter of MDV, and expresses in an orientation same with the orientation of UL26,optionally, said heterologous polynucleotide is linked at its 5’ end to the flanking sequence of the insertion site via an IRES element or a self-cleaving peptide-coding sequence.The recombinant MDV of any one of the preceding claims, wherein said IRES element is as defined in claim 22.The recombinant MDV of any one of the preceding claims, wherein said heterologous polynucleotide is operably linked to a non-endogenous promoter.The recombinant MDV of any one of the preceding claims, wherein the MDV comprises two heterologous polynucleotides, and whereinthe first polynucleotide comprises or consists of a polynucleotide encoding a polypeptide selected from the group consisting of an IBDV VP2 antigen, an ILTV gD antigen and an NDV F antigen, and whereinthe second polynucleotide comprises or consists of a polynucleotide encoding a polypeptide selected from the group consisting of an IBDV VP2 antigen, an ILTV gD antigen and an NDV F antigen.A recombinant MDV comprising a heterologous polynucleotide encoding IBDV VP2 antigen, wherein, the IBDV VP2 antigen is an VP2 antigen from nVar IBDV, which:(a) is encoded by the heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 10 or 9, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 10 or 9, and / or(b) comprises or consists of an amino acid sequence as shown in SEQ ID NO: 8, or an amino acid sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 8,optionally, the heterologous polynucleotide inserted at an insertion site located in the intergenic region between UL26 and UL27 genes, or an insertion site located in the intergenic region between UL55 and MDV71 genes, preferably an insertion site located in the intergenic region between UL55 and MDV71 genes,preferably, the MDV further comprises an exogenous promoter optionally linked to the heterologous polynucleotide.A recombinant MDV comprising a heterologous polynucleotide encoding IBDV VP2 antigen and a heterologous polynucleotide encoding ILTV gD antigen,wherein, the IBDV VP2 antigen (e.g., comprising or consisting of an amino acid sequence as shown in SEQ ID NO: 5 or 8) is encoded by the heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 7, 10, 6 or 9, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 7, 10, 6 or 9, and / orwherein, the ILTV gD antigen (e.g., comprising or consisting of an amino acid sequence as shown in SEQ ID NO: 11) is encoded by the heterologous polynucleotide comprising or consisting of a sequence as shown in SEQ ID NO: 13 or 12, or a sequence sharing at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity, preferably 100%identity with SEQ ID NO: 13 or 12;optionally, the heterologous polynucleotides are inserted at an insertion site located in the intergenic region between UL55 and MDV71 genes;preferably, wherein, the heterologous polynucleotide encoding IBDV VP2 antigen and the heterologous polynucleotide encoding ILTV gD antigen are operably linked to each other via:an IRES element, ora stop codon+IRES (astop codon 5’ upstream to, preferably directly 5’ flanking the IRES) , ora self-cleaving peptide-coding sequence, preferably an IRES element, ora stop codon+ self-cleaving peptide-coding sequence (astop codon 5’ upstream to, preferably directly 5’ flanking the self-cleaving peptide-coding sequence) .The recombinant MDV of claim 35 or 36, wherein the exogenous promoter is an mCMV promoter.The recombinant MDV of any one of claims 35-37, wherein the heterologous polynucleotide or heterologous polynucleotides are operably linked to one or more (e.g., one, two, or three in tandem) non-endogenous polyA signal motifs upstream and / or downstream to the heterologous polynucleotide or heterologous polynucleotides.The recombinant MDV of any one of the preceding claims, wherein the heterologous polynucleotide is operably linked to an artificial reverse tandem polyA signal motif located upstream to the promoter,wherein the reverse tandem polyA signal motif is as defined in claim 15.The recombinant MDV of any one of the preceding claims, wherein the heterologous polynucleotide or heterologous polynucleotides are operably linked to a novel bidirectional artificial polyA signal motif and an MDV39 / 40-intergenic bidirectional polyA signal motif in tandem located downstream to the heterologous polynucleotide or the heterologous polynucleotides,wherein the novel bidirectional artificial polyA signal motif is as defined in claim 16, and the MDV39 / 40-intergenic bidirectional polyA signal motif is as defined in claim 16.The recombinant MDV of any one of claims 33-40, wherein the heterologous polynucleotide is expressed in the same orientation as UL55 gene.An optimized IRES element, which comprises or consists of a sequence of SEQ ID NO: 15, or a sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 15 and can recruit the ribosome to initiate the translation.An artificial reverse tandem polyA signal motif, which comprises or consists of :(i) a nucleotide sequence set forth in SEQ ID NO: 16;(ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or(iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,and can promote the termination of the encountered transcriptional elongation.A novel bidirectional artificial polyA signal motif, which comprises or consists of :(i) a nucleotide sequence set forth in SEQ ID NO: 17;(ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or(iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,and can promote the termination of the encountered transcriptional elongation.An MDV CVI988 MDV89 gene polyA signal motif, which comprises or consists of :(i) a nucleotide sequence set forth in SEQ ID NO: 18;(ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or(iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,and can promote the termination of the encountered transcriptional elongation.An MDV39 / 40-intergenic bidirectional polyA signal motif, which comprises or consists of :(i) a nucleotide sequence set forth in SEQ ID NO: 19;(ii) a nucleotide sequence which has at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity thereto; or(iii) a nucleotide sequence complementary to any sequence in (i) or (ii) ,and can promote the termination of the encountered transcriptional elongation.Use of one or more of the following elements in the manufacture of recombinant MDVs comprising at least one or more heterologous polynucleotide encoding an antigen of an avian pathogen:(1) the IRES element of claim 42,(2) endogenous UL26 promoter of MDV, comprising or consisting of a sequence of SEQ ID NO: 21, or a sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 21 and can bind an RNA polymerase to initiate transcription;(3) endogenous UL26.5 promoter of MDV, comprising or consisting of a sequence of SEQ ID NO: 20, or a sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 20 and can bind an RNA polymerase to initiate transcription;(4) endogenous UL26 polyA signal of MDV, comprising or consisting of a sequence of SEQ ID NO: 22, or a sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 22;(5) mCMV promoter, comprising or consisting of a sequence of SEQ ID NO: 14, or a sequence which has at least 95%identity, preferably at least 96%identity, preferably at least 97%identity, preferably at least 98%identity, preferably at least 99%identity with SEQ ID NO: 14 and can bind an RNA polymerase to initiate transcription;(6) the polyA signal motif of claim 43;(7) the polyA signal motif of claim 44;(8) the polyA signal motif of claim 45;(9) the polyA signal motif of claim 46,wherein, said at least one or more heterologous polynucleotides are operably linked to said one or more elements and / or are regulated thereby.The use of claim 47, wherein the at least one or more heterologous polynucleotides encode NDV F antigen, and / or the IBDV VP2 antigen, and / or the ILTV gD antigen.The use of claim 47 or 48, wherein the recombinant MDV is the recombinant MDV of any one of claims 1-41.An expression cassette, comprising one or more of the following elements:(1) the IRES element of claim 42,(2) the polyA signal motif of claim 43;(3) the polyA signal motif of claim 44;(4) the polyA signal motif of claim 45;(5) the polyA signal motif of claim 46,and one or more heterologous polynucleotides encoding an antigen of an avian pathogen,preferably, the one or more heterologous polynucleotides encodes one or more polypeptides selected from the group consisting of an IBDV VP2 antigen, an ILTV gD antigen and an NDV F antigen, e.g., one or two.The expression cassette of claim 50, which further comprises one or more of the following elements:(1) mCMV promoter as defined in claim 45;(2) a promoter having a same sequence with the sequence of endogenous UL26 promoter of MDV, e.g., the endogenous UL26 promoter of MDV as defined in claim 45;(3) a promoter having a same sequence with the sequence of endogenous UL26.5 promoter of MDV, e.g., the endogenous UL26.5 promoter of MDV as defined in claim 45;(4) a polyA signal motif having a same sequence with the sequence of endogenous UL26 polyA signal motif of MDV, e.g., the endogenous UL26 polyA signal motif of MDV as defined in claim 45;(5) FRT site, e.g., comprising or consisting of a sequence of SEQ ID NO: 30, preferably a nonfunctioning FRT site.The expression cassette of claim 50 or 51, wherein, the NDV F antigen is as defined in claim 23, and / or the IBDV VP2 antigen is as defined in claim 25, 33 or 34, and / or the ILTV gD antigen is as defined in claim 26 or 34.A recombinant MDV comprising the expression cassette of any one of claims 50-52.The recombinant MDV of any one of the preceding claims, wherein the MDV comprises MDV-1, MDV-2, MDV-3 (herpesvirus of turkeys, HVT) or any combinations thereof.The recombinant MDV of any one of claims 1-41 and 53-54, wherein the MDV comprises HVT, e.g., strain FC-126, or any prevalent strain or their attenuated strain by passaging, mutagenesis, and / or genetic engineering.The recombinant MDV of any one of claims 1-41 and 53-55, wherein the MDV comprises MDV-1, e.g., strain CVI-988, strain CVTR, strain SC9-1, or strain 814, or any prevalent strain or their attenuated strain by passaging, mutagenesis, and / or genetic engineering.The recombinant MDV of any one of claims 1-41 and 53-56, wherein the MDV comprises MDV-2, e.g., strain SB-1, or any prevalent strain or their attenuated strain by passaging, mutagenesis, and / or genetic engineering.The recombinant MDV of any one of claims 1-41 and 53-57, wherein(i) when the MDV comprises HVT FC-126, said insertion site in the intergenic region between UL26 and UL27 genes is located in the region between the FC-126 genome DNA sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and ctatacaatttcatcatccgtctcagaatccgtgtcgttt (SEQ ID NO: 25) ;(ii) when the MDV comprises MDV1, MDV2 or HVT strains other than FC-126, said insertion site in the intergenic region between UL26 and UL27 genes is located in the genome region which is corresponding to the region between FC-126 genome DNA sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and ctatacaatttcatcatccgtctcagaatccgtgtcgttt (SEQ ID NO: 25) .The recombinant MDV of any one of claims 1-41 and 53-58, wherein the MDV is HVT FC-126, and the flanking sequence of the insertion site is the same with or reverse complementary to a sequence that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with at least part of SEQ ID NO: 36, wherein the flanking sequence is the upstream flanking sequence or the downstream flanking sequence.The recombinant MDV of any one of claims 1-41 and 53-59, wherein(i) when the MDV comprises HVT FC-126, said insertion site in the intergenic region between UL26 and UL27 genes is located at the site between the FC-126 genome DNA sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and aaagcggtgtgttaatgtcagagagctgta (SEQ ID NO: 24) , i.e., between the 30th nucleotide and the 31st nucleotide of the sequence as shown in SEQ ID NO: 36;(ii) when the MDV comprises MDV1, MDV2 or HVT strains other than FC-126, said insertion site in the intergenic region between UL26 and UL27 genes is located at the site which is corresponding to the site between FC-126 genome DNA sequences tttattagccacatgatgacccatcgctga (SEQ ID NO: 23) and aaagcggtgtgttaatgtcagagagctgta (SEQ ID NO: 24) .The recombinant MDV of any one of claims 1-41 and 53-60, wherein(i) when the MDV comprises HVT FC-126, said insertion site in the intergenic region between UL55 and MDV71 genes is located in the region between the FC-126 genome DNA sequences atcgctatgcaaagagatgcgtgtgtacacgcgccgttga (SEQ ID NO: 26) and ttaagatgcaggagtaacaatgtgcatagtaggcgtagtt (SEQ ID NO: 29) ;(ii) when the MDV comprisesMDV1, MDV2 or HVT strains other than FC-126, said insertion site in the intergenic region between UL55 and MDV71 genes is located in the genome region which is corresponding to the region between FC-126 genome DNA sequences atcgctatgcaaagagatgcgtgtgtacacgcgccgttga (SEQ ID NO: 26) and ttaagatgcaggagtaacaatgtgcatagtaggcgtagtt (SEQ ID NO: 29) .The recombinant MDV of claim 61, wherein the MDV is HVT FC-126, and the flanking sequence of the insertion site is the same with or reverse complementary to a sequence that have at least 80%identity, at least 85%identity, at least 90%identity, at least 95%identity, at least 96%identity, at least 97%identity, at least 98%identity, at least 99%identity or 100%identity with at least part of SEQ ID NO: 37, wherein the flanking sequence is the upstream flanking sequence or the downstream flanking sequence.The recombinant MDV of claim 62, wherein(i) when the MDV comprises HVT FC-126, said insertion site in the intergenic region between UL55 and MDV71 genes is located at the site between the FC-126 genome DNA sequences tatatgttattaaataaaataattgaccagtgaacaattt (SEQ ID NO: 27) and gtttaatgttagtttattcaatgcattggttgcaaatatt (SEQ ID NO: 28) , i.e., between the 118th nucleotide and the 119th nucleotide of the sequence as shown in SEQ ID NO: 37;(ii) when the MDV comprises MDV1, MDV2 or HVT strains other than FC-126, said insertion site in the intergenic region between UL55 and MDV71 genes is located at the site which is corresponding to the site between FC-126 genome DNA sequences tatatgttattaaataaaataattgaccagtgaacaattt (SEQ ID NO: 27) and gtttaatgttagtttattcaatgcattggttgcaaatatt (SEQ ID NO: 28) .virus particles comprising the recombinant MDV of any one of claims 1-41 and 53-63 encapsulated by the protein coat.A host cell comprising the recombinant MDV of any one of claims 1-41 and 53-63, or the virus particles of claim 64.A composition or vaccine comprising the recombinant MDV of any one of claims 1-41 and 53-63, the virus particles of claim 64, and / or the host cell of claim 65, optionally further comprising a pharmaceutically or veterinarily acceptable carrier, excipient, vehicle or adjuvant.A combination comprising the recombinant MDV of any one of claims 1-41 and 53-63, the virus particles of claim 64, and / or the host cell of claim 65, and / or the composition or vaccine of claim 66, wherein the combination further comprises other agents.The recombinant MDV of any one of claims 1-41 and 53-63, the virus particles of claim 64, and / or the host cell of claim 65, and / or the composition or vaccine of claim 66, and / or the combination of claim 67 for use in the prophylaxis and / or treatment of against one or more avian pathogens in an animal,preferably, the avian pathogen is selected from the group consisting of Newcastle Disease Virus (NDV) , Infectious Bursal Disease Virus (IBDV) , Infectious Laryngotracheitis Virus (ILTV) , avian encephalomyelitis virus, avian reovirus, avian paramyxovirus, avian metapneumovirus, avian adenovirus, fowl pox virus, avian coronavirus, avian rotavirus, avian parvovirus, avian astrovirus and chick anemia virus coccidiosis (Eimeria sp. ) , Campylobacter sp., Salmonella sp., Mycoplasma gallisepticum, Mycoplasma synoviae, Pasteurella sp., Avibacterium sp., E. coli and Clostridium sp.Use of the recombinant MDV of any one of claims 1-41 and 53-63, the virus particles of claim 64, and / or the host cell of claim 65, and / or the composition or vaccine of claim 66, and / or the combination of claim 67 for the prophylaxis and / or treatment of against one or more avian pathogens in an animal.Use of the recombinant MDV of any one of claims 1-41 and 53-63, the virus particles of claim 64, and / or the host cell of claim 65, and / or the composition or vaccine of claim 66, and / or the combination of claim 67 in the manufacture of vaccines or immunological preparations vaccinating, or inducing an immune or protective response in an animal against one or more avian pathogens.A method of vaccinating, or inducing an immune or protective response in an animal against one or more avian pathogens, comprising at least one administration of the recombinant MDV of any one of claims 1-41 and 53-63, the virus particles of claim 64, and / or the host cell of claim 65, and / or the composition or vaccine of claim 66, and / or the combination of claim 67.The use of claim 69 or 70 or the method of claim 71, wherein the avian pathogen is selected from the group consisting of Newcastle Disease Virus (NDV) , Infectious Bursal Disease Virus (IBDV) , Infectious Laryngotracheitis Virus (ILTV) , avian encephalomyelitis virus, avian reovirus, avian paramyxovirus, avian metapneumovirus, avian adenovirus, fowl pox virus, avian coronavirus, avian rotavirus, avian parvovirus, avian astrovirus and chick anemia virus coccidiosis (Eimeria sp. ) , Campylobacter sp., Salmonella sp., Mycoplasma gallisepticum, Mycoplasma synoviae, Pasteurella sp., Avibacterium sp., E. coli and Clostridium sp.A method of construction of recombinant herpes virus, comprising:(1) constructing infectious clones of said recombinant herpes virus in E. coli by recombineering, wherein the genome of said recombinant herpes virus carries a vector comprising replicons and screening tags for E. coli, and wherein the vector is linked to FRT sites at its both ends,(2) eliminating the vector sequence by the recombination between the two FRT sites mediated by FLP recombinase in E. coli expressing FLP recombinase, to obtain the circular genome of the recombinant herpes virus,(3) infecting susceptible cells using the circular genome of the recombinant herpes virus, and then rescuing the recombinant herpes virus to obtain a pure culture.The method of claim 73, wherein the recombinant herpes virus is the recombinant MDV of any one of preceding claims 1-41 and 53-63.The use of the method of claim 73 or 74 in the preparation of the recombinant MDV of any one of claims 1-41 and 53-63.

Images