Dsrna, or pharmaceutically acceptable salt thereof, conjugate thereof, and pharmaceutical composition thereof for inhibiting expression of receptor for advanced glycation end products gene
Patent Information
- Application Number
- PCT/CN2026/086633
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-08-04
- Filing Date
- 2026-03-27
- Publication Date
- 2026-10-01
Smart Images

Figure PCTCN2026086633-FTAPPB-I100001 
Figure PCTCN2026086633-FTAPPB-I100002 
Figure PCTCN2026086633-FTAPPB-I100003
Abstract
Description
dsRNA or a pharmaceutically acceptable salt thereof, conjugates thereof, and pharmaceutical compositions for inhibiting the expression of receptor genes for advanced glycation end products. Technical Field
[0001] This disclosure relates to the field of pharmaceutical technology, and in particular to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the receptor for advanced glycation end products (AGER or RAGE), a pharmaceutically acceptable salt thereof, a conjugate thereof, and a pharmaceutical composition. This disclosure also relates to a kit containing at least one of dsRNA, a pharmaceutically acceptable salt thereof, a conjugate thereof, and a pharmaceutical composition; a method for preventing and / or treating one or more diseases or symptoms associated with abnormal RAGE expression (e.g., abnormally enhanced or elevated membrane RAGE activity levels) using the aforementioned dsRNA or at least one of its pharmaceutically acceptable salts, conjugates thereof, and pharmaceutical compositions; and the use of the aforementioned dsRNA or at least one of its pharmaceutically acceptable salts, conjugates thereof, and pharmaceutical compositions in the preparation of a medicament for preventing and / or treating one or more diseases or symptoms associated with abnormal RAGE expression (e.g., abnormally enhanced or elevated membrane RAGE activity levels). Background Technology
[0002] The receptor for advanced glycation end products (RAGE, also known as AGER) is a transmembrane protein with a molecular weight of approximately 35 kDa, belonging to the immunoglobulin superfamily. As a pro-inflammatory pattern recognition receptor, RAGE plays an important role in various physiological and pathological processes.
[0003] The full length of a membrane-bound RAGE consists of three main functional domains: an extracellular ligand-binding domain, a transmembrane domain, and a cytoplasmic domain. The extracellular ligand-binding domain is responsible for recognizing and binding various ligands; the transmembrane domain is hydrophobic and anchors the receptor to the cell membrane; and the cytoplasmic domain mediates ligand-dependent signal transduction. Besides membrane-bound RAGEs, there exists a non-membrane-bound, soluble receptor form called soluble RAGE (sRAGE). sRAGEs contain only the extracellular ligand-binding domain and lack the transmembrane and cytoplasmic signal transduction domains. sRAGEs can be formed through proteolytic cleavage or selective splicing of full-length membrane-bound RAGEs. Because sRAGEs can bind ligands but do not possess signal transduction function, they can act as endogenous RAGE antagonists, regulating RAGE-mediated signaling pathways.
[0004] RAGE is constitutively highly expressed in lung tissue, primarily located in type 1 alveolar epithelial cells. While RAGE expression levels are typically low in other tissues, they are significantly upregulated under specific conditions, such as the presence of RAGE ligands and in a chronic inflammatory environment. RAGE and its ligand expression are significantly upregulated in various inflammatory diseases, including diabetic vascular complications, cardiovascular disease, and cancer. Upon binding to its ligand, RAGE regulates gene expression by activating multiple signaling pathways, such as transcription factors like nuclear factor κB (NF-κB), thereby triggering biological effects such as inflammatory responses, cell proliferation, migration, and immune evasion.
[0005] Studies have shown that abnormal expression or dysfunction of RAGE is associated with chronic pathological inflammation in many diseases, including: lung diseases (asthma, acute respiratory distress syndrome, idiopathic pulmonary fibrosis, chronic obstructive pulmonary disease, cystic fibrosis, pneumonia, lung cancer, bronchopulmonary dysplasia), cardiovascular diseases (atherosclerosis, myocardial infarction, heart failure, peripheral vascular disease), cancer, diabetes, chronic kidney disease, neurodegenerative diseases, rheumatoid arthritis, non-alcoholic steatohepatitis, damage caused by certain viral infections including SARS-CoV-2, certain ocular inflammatory conditions, and skeletal muscle atrophy.
[0006] It has been reported that when RAGE knockout (KO) mice are exposed to common allergens such as house dust mite allergens or ovalbumin, the symptoms of allergic asthma triggered by allergens are milder. Similarly, when RAGE knockout (KO) mice are exposed to high oxygen or lipopolysaccharide environments, the symptoms of induced acute lung injury and inflammation are milder. (See, for example, Oczypok et al., Paediatr Respir Rev., 23:40-49 (2017); Wang et al., Shock, 50:472-482 (2018)). Genome-wide association studies (GWAS) have linked gain-of-function RAGE allele (G82S) variants to an increased risk of various inflammation-related diseases, including increased inflammation, decreased lung function, and increased risk of asthma. (See, for example, Hancock et al., Nat Genet., 42:45-52 (2010); Repapi et al., Nat Genet., 42:36-44 (2010)).
[0007] In summary, the advanced glycation end products receptor (RAGE / AGER) is a multifunctional receptor that plays a crucial role in the pathogenesis of various diseases. Research on RAGE not only contributes to a deeper understanding of the pathogenesis of these diseases but also provides new targets and strategies for drug development. Therefore, this disclosure aims to explore the applications of RAGE / AGER in disease diagnosis and treatment, providing new methods and approaches for the prevention and treatment of related diseases.
[0008] RNAi, or RNA interference, is a specific gene silencing phenomenon mediated by dsRNA. RNAi is widespread in various organisms, from fungi to higher plants, from invertebrates to mammals, and is an important gene expression regulation mechanism preserved during biological evolution. RNAi is a highly efficient and specific gene silencing technology with broad application prospects in gene function research and disease treatment. Summary of the Invention
[0009] Based on the above, the purpose of this disclosure is to provide dsRNA (including modified or unmodified dsRNA) or a pharmaceutically acceptable salt thereof capable of effectively inhibiting AGER (RAGE) gene expression, or conjugates or pharmaceutical compositions containing said dsRNA or a pharmaceutically acceptable salt thereof, or kits containing at least one of said dsRNA or a pharmaceutically acceptable salt thereof, said dsRNA conjugates, or said pharmaceutical compositions; the use of said dsRNA or a pharmaceutically acceptable salt thereof, said dsRNA conjugates, or said pharmaceutical compositions in the preparation of medicaments for the prevention and / or treatment of one or more diseases or symptoms associated with abnormal RAGE expression (e.g., abnormally enhanced or elevated membrane RAGE activity levels); and methods for using said dsRNA or a pharmaceutically acceptable salt thereof, or said conjugates, or at least one of said pharmaceutical compositions for the prevention and / or treatment of one or more diseases or symptoms associated with abnormal RAGE expression (e.g., abnormally enhanced or elevated membrane RAGE activity levels). The AGER (RAGE) gene is located within cells, for example, cells in a subject (e.g., a human).
[0010] In a first aspect, this disclosure provides a dsRNA for inhibiting AGER (RAGE) gene expression, the dsRNA comprising a sense strand and an antisense strand, wherein the antisense strand comprises a core sequence of at least 15 consecutive nucleotides, differing by no more than 3 nucleotides from the anticomplementary sequence of at least 15 consecutive nucleotides in any of the AGER (RAGE) 21-mer mRNA target sequences shown in Table 2. In some embodiments, the antisense core sequence differs by no more than 3 nucleotides from the anticomplementary sequence of at least 15 consecutive nucleotides in any of the sense strands shown in Table 1. In some embodiments, the length of the antisense core sequence is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the length of the antisense core sequence is 17 nucleotides. In some embodiments, the length of the antisense core sequence is 19 nucleotides. In some embodiments, the length of the antisense core sequence is 21 nucleotides. In some embodiments, the length of the antisense core sequence is 23 nucleotides. Unless otherwise specified herein, at least a portion of the sequences of the sense and antisense strands are complementary. In some embodiments, the sense and antisense strands are at least partially complementary. In some embodiments, the sense and antisense strands form a double-stranded region of 12-23, 15-22, 17-21, 19-21, 19-22, or 19-23 nucleotide pairs in length. In some embodiments, this disclosure provides a pharmaceutically acceptable salt of the dsRNA of any of the foregoing embodiments. In some embodiments, this disclosure provides a dsRNA for inhibiting AGER (RAGE) gene expression, the dsRNA comprising a sense and antisense strand, wherein the sense strand comprises at least 16 consecutive nucleotides differing by no more than 3 nucleotides from the 19-22 consecutive nucleotides downstream of positions 1178-1191 (e.g., positions 1178-1188) of the nucleotide sequence of SEQ ID NO:1, and wherein the antisense strand is substantially complementary to the sense strand.
[0011] In a second aspect, this disclosure provides a dsRNA conjugate comprising the dsRNA or a pharmaceutically acceptable salt thereof, the dsRNA conjugate being obtained by conjugating the dsRNA to a conjugate molecule as described in any embodiment of the first aspect.
[0012] In a third aspect, this disclosure provides a pharmaceutical composition containing dsRNA or a pharmaceutically acceptable salt thereof as described in any embodiment of the first aspect, or a dsRNA conjugate as described in the second aspect.
[0013] In a fourth aspect, this disclosure provides a kit containing at least one of the following: dsRNA as described in the first aspect or a pharmaceutically acceptable salt thereof, or a dsRNA conjugate as described in the second aspect, and a pharmaceutical composition as described in the third aspect.
[0014] In a fifth aspect, this disclosure provides the use of dsRNA as described in any embodiment of the first aspect or a pharmaceutically acceptable salt thereof, or a dsRNA conjugate as described in the second aspect, or a pharmaceutical composition as described in the third aspect, in the preparation of a medicament for the prevention and / or treatment of one or more diseases or symptoms associated with abnormal RAGE expression (e.g., abnormally enhanced or elevated membrane RAGE activity levels). Alternatively, this disclosure provides the use of at least one of dsRNA as described in any embodiment of the first aspect or a pharmaceutically acceptable salt thereof, or a dsRNA conjugate as described in the second aspect, or a pharmaceutical composition as described in the third aspect for the prevention and / or treatment of one or more diseases or symptoms associated with abnormal RAGE expression (e.g., abnormally enhanced or elevated membrane RAGE activity levels). Alternatively, this disclosure provides dsRNA as described in any embodiment of the first aspect or a pharmaceutically acceptable salt thereof, or a dsRNA conjugate as described in the second aspect, or a pharmaceutical composition as described in the third aspect for the prevention and / or treatment of one or more diseases or symptoms associated with abnormal RAGE expression (e.g., abnormally enhanced or elevated membrane RAGE activity levels).
[0015] In a sixth aspect, this disclosure provides a method for preventing and / or treating one or more diseases or symptoms associated with enhanced or elevated membrane RAGE activity levels, the method comprising administering at least one of the following to a subject in need: dsRNA as described in any embodiment of the first aspect or a pharmaceutically acceptable salt thereof, or a dsRNA conjugate as described in the second aspect, or a pharmaceutical composition as described in the third aspect.
[0016] The dsRNA or its pharmaceutically acceptable salt, or dsRNA conjugate, or pharmaceutical composition disclosed herein may exhibit the desired activity of inhibiting RAGE expression in vitro or in vivo, and thus may be expected to exhibit beneficial therapeutic activity in subjects of need.
[0017] Other features and advantages of this disclosure will be described in detail in the following specific embodiments. Detailed Implementation
[0018] The following provides a detailed description of specific embodiments of this disclosure. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit this disclosure. Various modifications, alterations, or changes can be made based on the spirit and concept of this disclosure, and such modifications, alterations, or changes still fall within the scope of this disclosure.
[0019] In this disclosure, unless otherwise specified, the term "AGER (RAGE)" refers to a transmembrane protein of approximately 35 kDa belonging to the immunoglobulin superfamily, which is the receptor for advanced glycosylation products and is found in a variety of species, including but not limited to humans, mice, rats, guinea pigs, rabbits, macaques, goats, sheep, horses, cattle, pigs, chickens, and dogs. For example, the amino acid sequence and gene sequence of human AGER (RAGE) can be found in publicly available databases, such as GenBank NM_001136.5; the sequence shown in SEQ ID NO: 1. Other examples of AGER (RAGE) mRNA sequences are readily available using publicly available databases (e.g., GenBank, UniProt, OMIM, and the Macaca Genome Project website).
[0020] SEQ ID NO: 1 is as follows:
[0021] In this disclosure, unless otherwise specified, uppercase letters C, G, U, and A represent ribonucleotides containing the corresponding bases; dC, dG, dT, and dA represent the base composition of deoxyribonucleotides or deoxyribonucleotides containing the corresponding bases; lowercase letter m indicates that the nucleotide adjacent to the right of the letter m is a nucleotide modified with 2'-methoxy; identifier f indicates that the nucleotide adjacent to the right of the identifier f is a nucleotide modified with 2'-fluorine; lowercase letter h indicates that the nucleotide adjacent to the right of the letter h is a nucleotide modified with 2'-deoxy, 2'-O-MOE, 2'-O-CH2-C≡CH, 2'-O-CH2-C(O)-NH-CH3, 2'-O-CH2-CH=CH2, 2'-OCF3, or 2'-OC≡CH, or an unmodified nucleotide. Lowercase letter n indicates that the nucleotide adjacent to the right of the letter n is a nucleotide with 2'-O-MOE. The symbol * indicates that the two nucleotides adjacent to it on the left and right are linked by a thiophosphate group; the symbol # indicates that the two nucleotides adjacent to it on the left and right are linked by a methanesulfonyl phosphate bond (MsPA); the symbol (E)-VP indicates that the nucleotide adjacent to it on the right is a (E)-vinylphosphonate modified nucleotide ((E)-VP modified nucleotide); the symbol (Z)-VP indicates that the nucleotide adjacent to it on the right is a (Z)-vinylphosphonate modified nucleotide ((Z)-VP modified nucleotide); the underline “—” indicates that the nucleotide shown under the underline is glycerol nucleic acid (GNA); “T” is the S-isomer of thymidine-ethylene glycol nucleic acid (GNA).
[0022] As examples, the following show some exemplary structures of modifications (where each Base independently represents a base, and each X is independently selected from hydrogen, hydroxyl, amino, methyl, ethyl, methoxy, halogen, -CH2-O-CH3, -CH2-CH2-O-CH3, -O-CH2-CH3, -O-CH2-CH2-O-CH3, -CH2-CH2-O-CH3, -O-CH2-O-CH2-CH3, -O-CH=CH-CH3, -O-CH2-C≡CH, -O-CH2-C(O)-NH-CH3, -O-CH2-CH=CH2, -OC≡CH or -O-CF3, such as hydrogen, hydroxyl, methoxy or fluorine):
[0023] A debase residue (Ab), also referred to as a "debase site" or "debase nucleotide," is a nucleotide or nucleoside lacking a nucleobase at the 1' position of the sugar moiety. In some embodiments, an inverted debase residue (invAb) (also referred to in the art as an "inverted debase site") may be added. The (invAb) may have the following structure:
[0024] When located inside a sequence When located at the 3' end, it is When it is at the 5' end, it is
[0025] cPrpu can refer to 5'-cyclopropylphosphonate-2'-O-methyluridine, or it can refer to 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-phosphate. Furthermore, cPrpu* is 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-thiophosphate. Its structure is described below:
[0026] In this disclosure, unless otherwise specified, in the context of dsRNA (e.g., siRNA), "complementarity" means that in a dsRNA duplex molecule, the bases of one strand each pair complementaryly with the bases of the other strand, or that the bases of the antisense strand of the dsRNA each pair complementaryly with the bases of the target gene or target sequence. That is, when A / dA pairs with U / dT, and C / dC pairs with G / dG, the two strands are considered complementary. "Complementarity" as described in this disclosure can include base pairings formed by non-Watson-Crick base pairings and / or non-natural or modified nucleotides, as long as they hybridize and can form a duplex structure. Correspondingly, in this disclosure, unless otherwise specified, in the context of dsRNA, "mismatch" means that in the double-stranded region formed by the sense and antisense strands of the dsRNA molecule, the bases of the antisense strand in the double-stranded region are not paired with the bases at the corresponding positions on the sense strand, or the bases of the antisense strand in the double-stranded region are not paired with the bases at the corresponding positions on the target gene or target sequence.
[0027] In this disclosure, unless otherwise specified, the term "dsRNA" covers modified or unmodified double-stranded RNA.
[0028] Depending on the environment, the dsRNA described in this article may exhibit a state in which certain functional groups in its structure are protonated or deprotonated. Therefore, the dsRNA described in this article covers its free acid or salt form (including pharmaceutically acceptable salts, such as sodium salts, potassium salts, magnesium salts, calcium salts, triethylamine salts, spermine salts, or ammonium salts). Optionally, the dsRNA described in this article is in the sodium salt form.
[0029] In this disclosure, unless otherwise specified, "substantially complementary pairing" means that the number of mismatched nucleotides is no more than 3, for example, 2 mismatched nucleotides or 1 mismatched nucleotide.
[0030] In this disclosure, unless otherwise specified, "conjugation" refers to the covalent connection between two or more chemical moieties; "conjugated compound" refers to a compound formed by the covalent connection between two or more chemical moieties; and "dsRNA conjugated compound" refers to a compound formed by the covalent attachment of one or more chemical moieties to dsRNA. It should be noted that the chemical moieties can be directly attached to dsRNA or attached to dsRNA via a linker. For example, the conjugated molecule may optionally include a linker moiety for attachment to dsRNA and a targeting ligand moiety (e.g., a targeting moiety for targeting a specific tissue or cell, such as an integrin targeting ligand).
[0031] In this disclosure, unless otherwise specified, the "-" in "connector-targeting ligand" refers to the covalent connection between the connector and the targeting ligand.
[0032] In this disclosure, unless otherwise specified, the term "pharmaceutical acceptable" means that the carrier, delivery vehicle, diluent, excipient and / or the salt / ester / hydrate formed therefrom is generally chemically or physically compatible with other components constituting a drug dosage form and physiologically compatible with the receptor.
[0033] In this disclosure, unless otherwise specified, the terms "2'-fluorinated nucleotide" and "2'-fluoronucleotide" are used interchangeably herein, referring to a nucleotide containing a 2'-fluorinated nucleotide on its ribose group. Similarly, unless otherwise specified, the terms "2'-methoxylated nucleotide" and "2'-methoxynucleotide" are used interchangeably herein, referring to a nucleotide containing a 2'-methoxylated nucleotide on its ribose group. This designation of a 2'-fluoronucleotide does not exclude modifications at other positions on the nucleotide (e.g., other sites on the ribose group, bases, etc.). For example, a 2'-fluoronucleotide may also contain modifications at positions other than the 2' position of the ribose group in the nucleotide structure, and a 2'-methoxynucleotide may also contain modifications at positions other than the 2' position in the nucleotide structure.
[0034] In this disclosure, unless otherwise specified, "target sequence" refers to a continuous portion of the nucleotide sequence of an mRNA molecule formed during transcription of an AGER or RAGE gene, including mRNA of an RNA processing product that is a primary transcription product.
[0035] In this disclosure, unless otherwise specified, the term "suppression" refers to the down-regulation of target gene expression due to dsRNA-mediated mRNA degradation. "Down-regulation" means a decrease in target gene expression levels of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% or more, or even 100%, relative to the absence of dsRNA treatment. A 100% decrease in target gene expression levels means that there is no detectable level of target gene expression.
[0036] In this disclosure, unless otherwise specified, the terms "comprising, including, and containing" or equivalents are open-ended expressions, meaning that in addition to the listed elements, components, or steps, other unspecified elements, components, or steps may also be included.
[0037] In this disclosure, unless otherwise specified, the phrase “consisting essentially of…” limits the subject to the specified material or step and the material or step features that do not substantially affect the novelty of the scheme.
[0038] In this disclosure, unless otherwise specified, the term "identity" refers to the similarity between two nucleotide sequences or two amino acid sequences. The percentage of identity between sequences can be determined using algorithms known to those skilled in the art (e.g., Needleman-Wunsch algorithm, Smith-Waterman algorithm, BLAST algorithm). Sequence identity is independent of modifications.
[0039] In this disclosure, unless otherwise specified, the terms “fundamentally complementary / reverse complementary” or “substantially complementary / reverse complementary” mean that there are identical numbers of consecutive bases in two nucleic acid sequences that are completely complementary or that at least 80% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) of the nucleotides are complementary.
[0040] The term "at least partially complementary / anticomplementary" means substantially complementary to a consecutive portion of the nucleotide sequence of interest or mRNA (e.g., sense and antisense strands, mRNA and antisense strand of a target gene). For example, the sense strand is at least partially complementary to the antisense strand if more than 15 consecutive nucleotide sequences of the sense strand are substantially complementary to more than 15 consecutive nucleotide sequences of the antisense strand.
[0041] The term "core sequence" refers to the key nucleotide sequence in the double helix of dsRNA that is directly involved in recognition and binding, including the nucleotide sequence in the antisense strand used to recognize the target mRNA or bind to the sense strand, or the nucleotide sequence in the sense strand used to bind to the antisense strand.
[0042] The term "difference" refers to changes in the nucleotide sequence that result from the addition, deletion, or substitution of nucleotides.
[0043] The terms "optional," "optional," and "optionally" mean that the items described thereafter may or may not exist, and the events described thereafter may or may not occur. Furthermore, when the items exist or the events occur, the number of items or the number of events is unlimited, and those skilled in the art can make reasonable choices based on actual needs. For example, the following technical feature described in this disclosure: "The 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 18th, 20th, 21st, or 22nd positions of the antisense strand in the 5' to 3' direction are optionally 2'-fluorinated nucleotides," indicates that there are 0 or no limit to the number of 2'-fluorinated nucleotides at the 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 18th, 20th, 21st, or 22nd positions of the antisense strand in the 5' to 3' direction. Those skilled in the art can clearly determine from the number of such sites that the 2'-fluorinated nucleotides can be selected from 0 to 11. For example, the following technical feature described in this disclosure states: "The nucleotides at positions 2, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are all 2'-fluorinated nucleotides, and positions 3, 4, 5, 7, 8, 9, 10, 12, 18, 20, 21, or optionally position 22 are 2'-fluorinated nucleotides." The term "optionally" specifies position 22, indicating that position 22 in the 5' to 3' direction of the antisense strand may or may not be present. In embodiments where position 22 is present, it can be a 2'-fluorinated nucleotide. In some specific embodiments, two or more "optionally" terms may coexist in a single feature description. Those skilled in the art can make a clear and accurate understanding by referring to the explanation in this paragraph, without causing ambiguity regarding the scope of protection.
[0044] Unless otherwise stated, the parameter values representing the amount of an ingredient, its physicochemical properties, or reaction conditions, etc., shall be understood to be modified by the term “about” in all cases. When the term “about” is used to describe this application, the term “about” indicates an existing error value, for example, when used with a percentage, the term “about” means a variation within ±5%, such as ±1% or ±0.1% of a particular value.
[0045] The terms “subject,” “patient,” and “individual” are used interchangeably herein and include mammals or non-mammalian vertebrates (such as chickens, emus, and fish), including but not limited to domesticated animals (e.g., cattle, sheep, cats, dogs, pigs, and horses), primates (e.g., humans, non-human primates such as monkeys), rabbits, and rodents (e.g., mice, rats, guinea pigs, and hamsters), preferably humans.
[0046] The term “treating” in this article means reducing or alleviating a disease or symptom, slowing the onset or development of a disease or symptom, reducing the risk of developing a disease or symptom, or delaying the development of symptoms associated with a disease or symptom, reducing or terminating symptoms associated with a disease or symptom, producing a complete or partial reversal of a disease or symptom, curing a disease or symptom, or a combination of the above.
[0047] The term "prevention" refers to the process of exposing a subject to an active ingredient before the onset of a disease, thereby reducing the symptoms of the disease compared to when the subject is not exposed, without implying the complete suppression of the disease.
[0048] Those skilled in the art will readily understand and recognize that, depending on the environment in which the compound or composition is placed, the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state. Therefore, as used herein, the structures disclosed herein contemplate that certain functional groups (e.g., OH, SH, or NH) may be protonated or deprotonated. This disclosure is intended to cover the disclosed compounds and compositions regardless of their protonation state based on the environment (e.g., pH), as will be readily understood by those skilled in the art. Accordingly, compounds described herein having unstable protons or basic atoms should also be understood to represent salt forms of the respective compounds. The compounds described herein may be in the form of free acids, free bases, or salts. Pharmaceutically acceptable salts of the compounds described herein should be understood to be within the scope of this disclosure.
[0049] The various aspects of this disclosure will now be described in detail.
[0050] I. The disclosed dsRNA
[0051] In this disclosure, dsRNA encompasses unmodified dsRNA or its partially or wholly modified duplex.
[0052] In this disclosure, the term "dsRNA" refers to an RNA molecule that contains a sense strand and an antisense strand and has a partially or fully complementary double-stranded structure capable of sequence-specifically inducing RNAi (RNA interference).
[0053] The dsRNA disclosed in this paper is designed to target a specific location on the AGER (RAGE) gene (e.g., SEQ ID NO:1(NM_001136.5)).
[0054] In some embodiments, the dsRNA disclosed herein targets the AGER gene at or near the AGER sequence location shown in Table 2. In some embodiments, the antisense strand of the dsRNA disclosed herein includes a core sequence that is completely, substantially (e.g., about 85%, about 86%, about 87%, about 88%, about 89%, or about 90%), or at least partially complementary to any of the AGER (RAGE) 21-mer mRNA target sequences disclosed in Table 2.
[0055] The dsRNA disclosed herein targets the human AGER gene. In some embodiments, the dsRNA disclosed herein targets a portion of any of the AGER gene sequences disclosed in Table 2. In some embodiments, the dsRNA disclosed herein comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 16 consecutive nucleotides differing by no more than 3 nucleotides from the downstream 19-22 consecutive nucleotides of the nucleotide sequence of SEQ ID NO:1, starting from positions 1178-1191 (e.g., positions 1178-1188), and wherein the antisense strand is substantially complementary to the sense strand. In some preferred embodiments, the first nucleotide at the 5' end of the sense strand is identical to the first nucleotide at the 5' end of the target region in the corresponding nucleotide sequence of SEQ ID NO:1 (e.g., when the target region is the downstream 19-22 consecutive nucleotides starting from position 1178, the first nucleotide at the 5' end is the nucleotide at position 1178).
[0056] In some embodiments, the sense strand comprises at least 19 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO:1 by no more than 3, 2, or 1 nucleotides in the downstream direction of 19-22 consecutive nucleotides starting from positions 1178-1191 (e.g., positions 1178-1188), and wherein the antisense strand is substantially complementary to the sense strand.
[0057] In some embodiments, the sense strand comprises at least 19 consecutive nucleotides that differ from the downstream 19-22 consecutive nucleotides from positions 1180-1188 of the nucleotide sequence of SEQ ID NO:1 by no more than 3, 2, or 1 nucleotides, and wherein the antisense strand is substantially complementary to the sense strand.
[0058] In some embodiments, the sense strand comprises at least 19 consecutive nucleotides differing from the nucleotides at positions 1178-1198, 1180-1200, 1187-1207, 1188-1208, or 1191-1211 of the nucleotide sequence of SEQ ID NO:1 by no more than 3, 2, or 1 nucleotides, and wherein the antisense strand is substantially complementary to the sense strand. In some preferred embodiments, the sense strand is identical to the nucleotides at positions 1178-1198, 1180-1200, 1187-1207, 1188-1208, or 1191-1211 of the nucleotide sequence of SEQ ID NO:1.
[0059] In some embodiments, the sense strand comprises 19 to 23 consecutive nucleotides differing from the nucleotide sequence of SEQ ID NO:1 at positions 1178-1198, 1180-1200, 1187-1207, 1188-1208, or 1191-1211 by no more than 3, 2, or 1 nucleotides, and wherein the antisense strand is substantially complementary to the sense strand.
[0060] In some embodiments, the sense strand comprises 21 consecutive nucleotides differing from the nucleotides at positions 1178-1198, 1180-1200, 1187-1207, 1188-1208, or 1191-1211 of the nucleotide sequence of SEQ ID NO:1 by no more than 3, 2, or 1 nucleotides, and wherein the antisense strand is substantially complementary to the sense strand.
[0061] The antisense strand of the dsRNA described herein includes an antisense core sequence containing at least 15 consecutive nucleotides. The antisense core sequence differs from the inverse complementary sequence of at least 15 consecutive nucleotides in any of the nucleotide sequences shown in Table 2 by no more than 3, or the number of nucleotides in the antisense core sequence that are complementary to any of the nucleotide sequences shown in Table 2 is no less than 12.
[0062] The number of nucleotides that differ between the core sequence of the antisense strand of the dsRNA described herein and the reverse complementary sequence of at least 15 consecutive nucleotides in any of the sense strands shown in Table 1 is no more than 3 nucleotides.
[0063] In some alternative implementations, the antisense core segment sequence contains at least 15 consecutive nucleotides.
[0064] In some alternative implementations, the antisense core segment sequence contains 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides.
[0065] In some alternative implementations, the antisense core segment sequence contains 17 nucleotides.
[0066] In some alternative implementations, the antisense core segment sequence contains 19 nucleotides.
[0067] In some alternative implementations, the antisense core segment sequence contains 21 nucleotides.
[0068] In some alternative implementations, the antisense core segment sequence contains 23 nucleotides.
[0069] In some alternative implementations, the antisense strand of the dsRNA has 19-27 nucleotides.
[0070] In some alternative implementations, the antisense strand contains 16-23, 16-22, 17-23, 19-23, or 21-23 nucleotides.
[0071] In some alternative implementations, the antisense strand of the dsRNA has 19 nucleotides.
[0072] In some alternative implementations, the antisense strand of the dsRNA has 21 nucleotides.
[0073] In some alternative implementations, the antisense strand of the dsRNA has 22 nucleotides.
[0074] In some alternative implementations, the antisense strand of the dsRNA has 23 nucleotides.
[0075] In some alternative implementations, the antisense strand of the dsRNA has 24 nucleotides.
[0076] In some alternative implementations, the antisense strand of the dsRNA has 25 nucleotides.
[0077] In some alternative implementations, the antisense strand of the dsRNA has 26 nucleotides.
[0078] In some alternative implementations, the antisense strand of the dsRNA has 27 nucleotides.
[0079] The positive strand of the dsRNA described herein includes a positive strand core sequence of at least 15 consecutive nucleotides, which differs from at least 15 consecutive nucleotide sequences in any of the AGER (RAGE) 21-mer mRNA target sequences shown in Table 2 by no more than 3 nucleotides.
[0080] The core sequence of the positive strand of the dsRNA described in this article differs from at least 3 nucleotides in any of the 15 consecutive nucleotides in the positive strand shown in Table 1.
[0081] In some alternative implementations, the core segment sequence of the justice chain contains 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides.
[0082] In some alternative implementations, the core segment sequence of the justice chain contains 17 nucleotides.
[0083] In some alternative implementations, the core segment sequence of the justice chain contains 19 nucleotides.
[0084] In some alternative implementations, the core segment sequence of the justice chain contains 21 nucleotides.
[0085] In some alternative implementations, the core segment sequence of the justice chain contains 23 nucleotides.
[0086] In some alternative implementations, the number of nucleotides in the sense strand of the dsRNA is 16-25.
[0087] In some alternative implementations, the justice chain contains 16-21, 16-20, 17-21, 19-21, or 20-21 nucleotides.
[0088] In some alternative implementations, the number of nucleotides in the sense strand of the dsRNA is 16.
[0089] In some alternative implementations, the number of nucleotides in the sense strand of the dsRNA is 17.
[0090] In some alternative implementations, the number of nucleotides in the sense strand of the dsRNA is 18.
[0091] In some alternative implementations, the number of nucleotides in the sense strand of the dsRNA is 19.
[0092] In some alternative implementations, the number of nucleotides in the sense strand of the dsRNA is 20.
[0093] In some alternative implementations, the number of nucleotides in the sense strand of the dsRNA is 21.
[0094] In some alternative implementations, the number of nucleotides in the sense strand of the dsRNA is 22.
[0095] In some alternative implementations, the number of nucleotides in the sense strand of the dsRNA is 23.
[0096] In some alternative implementations, the number of nucleotides in the sense strand of the dsRNA is 24.
[0097] In some alternative implementations, the number of nucleotides in the sense strand of the dsRNA is 25.
[0098] In some alternative implementations, the sense strand core sequence and the antisense strand core sequence are fully complementary or substantially complementary, so that the sense strand core sequence is identical to the same length nucleotide sequence (sometimes referred to as, for example, the target sequence) present in the AGER mRNA target sequence, or the two sequences are identical or have at least about 80% similarity. The sense strand core sequence and the corresponding antisense strand core sequence may be the same length or different in length.
[0099] In some embodiments, the positive strand of the dsRNA comprises at least 16 consecutive nucleotides, and the positive strand differs from the nucleotide sequence shown in SEQ ID NO:377, 255, or 2187 by no more than 3 nucleotides. In some embodiments, the positive strand of the dsRNA comprises 16-23 consecutive nucleotides, and the positive strand differs from the nucleotide sequence shown in SEQ ID NO:377, 255, or 2187 by no more than 3 nucleotides. In some embodiments, the positive strand of the dsRNA comprises 19-23 consecutive nucleotides, and the positive strand differs from the nucleotide sequence shown in SEQ ID NO:377, 255, or 2187 by no more than 3 nucleotides. In some embodiments, the positive strand of the dsRNA comprises 21 consecutive nucleotides, and the positive strand differs from the nucleotide sequence shown in SEQ ID NO:377, 255, or 2187 by no more than 3 nucleotides. In some embodiments, the positive strand differs from the nucleotide sequence shown in SEQ ID NO:377, 255, or 2187 by no more than 2 nucleotides. In some embodiments, the positive strand differs from the nucleotide sequence shown in SEQ ID NO:377, 255 or 2187 by no more than one nucleotide.
[0100] In some alternative implementations, the complementary binding regions of the sense and antisense strands contain at least 15 consecutive nucleotides, such as 15-25 consecutive nucleotides (e.g., at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25).
[0101] In some alternative implementations, the sense and / or antisense strands may optionally extend by 1, 2, 3, 4, 5, or 6 nucleotides from the 3', 5', or 3' and 5' ends of the core sequence. If so, the extended nucleotides on the antisense strand may be complementary to or not complementary to the corresponding sequence in the AGER mRNA. The extended nucleotides on the sense strand may be the same as or different from the corresponding sequence in the AGER mRNA. The extended nucleotides on the antisense strand may be complementary to or not complementary to the extended nucleotides on the corresponding sense strand.
[0102] In some alternative implementations, the 5' and / or 3' extensions of the positive and / or negative strand core sequences comprise 1, 2, 3, 4, 5, or 6 nucleotides. The extended nucleotides on the positive strand core sequence may be complementary to or not complementary to the corresponding nucleotides on the negative strand core sequence. Correspondingly, the extended nucleotides on the negative strand core sequence may be complementary to or not complementary to the corresponding nucleotides on the positive strand core sequence.
[0103] In some alternative implementations, both the sense and antisense strands of the dsRNA contain 3' and 5' extended nucleotides.
[0104] In some alternative implementations, one or more 3' elongated nucleotides in one strand pair with one or more 5' elongated nucleotide bases in another strand.
[0105] In some alternative implementations, one or more 3' elongated nucleotides in one strand do not pair with one or more 5' elongated nucleotide bases in another strand.
[0106] In some alternative implementations, the dsRNA comprises an antisense strand with a 3' extended nucleotide and a sense strand with a 5' extended nucleotide.
[0107] In some alternative implementations, the extended nucleotides do not form pairs and instead form overhangs.
[0108] In this disclosure, "dangling portion" refers to one or more unpaired nucleotides located at the end of the sense or antisense strand that do not hybridize with the dsRNA in this disclosure to form a double-stranded portion.
[0109] In some alternative implementations, the antisense strand of the dsRNA contains 1, 2, 3, 4, 5, or 6 3' extended nucleotides.
[0110] In some alternative implementations, the antisense strand of the dsRNA contains one, two, or three 3' extended nucleotides.
[0111] In some alternative implementations, one or more extended nucleotides in the antisense strand are complementary to the corresponding AGER mRNA sequence.
[0112] In some alternative implementations, one or more extended nucleotides in the antisense strand are not complementary to the corresponding AGER mRNA sequence.
[0113] In some alternative implementations, the extended nucleotide of the antisense strand contains one or more nucleotides that contain adenosine, uracil, AT dinucleotides, or nucleotides that correspond to or are identical to nucleotides in the AGER mRNA sequence.
[0114] In some alternative implementations, the 5' extended nucleotide of the antisense strand includes, but is not limited to, one of the following sequences or consists of: U or UU (each listed freely from 5' to 3').
[0115] In some implementations, the 3' extended nucleotide of the antisense strand includes, but is not limited to, one of or consists of, the following sequences: T, UT, TT, UU, UUT, TTT, or TTTT (each listed freely from 5' to 3').
[0116] The positive strand may have a 3' extension and / or a 5' extension. In some alternative embodiments, the positive strand of the dsRNA contains 1, 2, 3, 4, 5, or 6 5' extended nucleotides.
[0117] In some alternative implementations, the extended nucleotides of the positive strand contain one or more nucleotides that correspond to or are identical to nucleotides in the AGER mRNA sequence. Table 1 provides examples of siRNA sequences used to form dsRNA.
[0118] In some alternative implementations, the positive strand of the dsRNA contains 1, 2, 3, 4, or 5 3' extended nucleotides.
[0119] In some alternative implementations, the extended nucleotide of the positive strand comprises one or more adenosine, uracil or thymidine nucleotides, AT dinucleotides, or nucleotides that correspond to or are identical to nucleotides in the AGER mRNA sequence.
[0120] In some alternative implementations, the 3' extension nucleotide of the positive strand includes, but is not limited to, one of the following sequences or consists of: T, UT, AU, AT, AA, TT, UU, UUT, TTT, or TTTT (each listed freely from 5' to 3').
[0121] In some alternative implementations, the 3' extension nucleotide of the positive strand is AA.
[0122] In some alternative implementations, the sense and antisense strands of the dsRNA described herein contain the same number of nucleotides.
[0123] In some alternative implementations, the sense and antisense strands of the dsRNA described herein contain different numbers of nucleotides.
[0124] In some alternative implementations, the 5' end of the sense strand and the 3' end of the antisense strand of the dsRNA form blunt / obtuse ends.
[0125] In some alternative implementations, the 3' end of the sense strand and the 5' end of the antisense strand of the dsRNA form blunt / obtuse ends.
[0126] In some alternative implementations, both ends of the dsRNA are formed as blunt / obtuse ends.
[0127] In some alternative implementations, neither end of the dsRNA forms blunt / obtuse ends. As used herein, "blunt / obtuse end" refers to the terminal nucleotides of the two annealed strands of the dsRNA forming complementary pairs at the ends.
[0128] In some alternative implementations, the 5' end of the sense strand and the 3' end of the antisense strand of the dsRNA form a frayed end.
[0129] In some alternative implementations, the 3' end of the sense strand and the 5' end of the antisense strand of the dsRNA form a sputtered end.
[0130] In some alternative implementations, both ends of the dsRNA are formed as sputtered ends.
[0131] In some alternative implementations, neither end of the dsRNA is a broken end.
[0132] As used in this article, a sparse end refers to the end of the two annealed strands of dsRNA where the terminal nucleotides form a pair (i.e., no overhang) but are not complementary (i.e., a non-complementary pair).
[0133] In some alternative implementations, one or more unpaired nucleotides at the end of one strand of the dsRNA form a dangling portion. The unpaired nucleotides may be located on either the sense or antisense strand, thus creating a 3' or 5' dangling portion.
[0134] In some alternative implementations, the antisense strand in the dsRNA includes a 1-5 nucleotide end overhang at the 3' end.
[0135] In some alternative implementations, the antisense strand in the dsRNA includes a 1-4 nucleotide long end overhang at the 3' end.
[0136] In some alternative implementations, the antisense strand in the dsRNA has a 1-3 nucleotide length end overhang at the 3' end.
[0137] In some alternative implementations, the antisense strand in the dsRNA includes a 2-nucleotide-long end overhang at the 3' end.
[0138] In some alternative implementations, the antisense strand in the dsRNA has a 3' end overhang containing one or more adenosine, uracil, or thymidine nucleotides, AT dinucleotides, or nucleotides that correspond to or are identical to nucleotides in the AGER mRNA sequence.
[0139] In some alternative embodiments, the terminal dangling nucleotide at the 3' end of the antisense strand includes, but is not limited to, one of the following sequences or consists of: U, T, UT, AU, AT, AA, TT, UU, UUT, TTT, or TTTT (each listed freely from 5' to 3').
[0140] In some alternative implementations, the terminal dangling nucleotide at the 3' end of the antisense strand is UU.
[0141] In some alternative implementations, the 5' end of the antisense strand in the dsRNA is blunt.
[0142] Table 1 provides examples of the sense and antisense strands of certain dsRNAs disclosed herein. In some alternative embodiments, this disclosure provides a dsRNA that inhibits the expression of the AGER (RAGE) gene, the dsRNA comprising a sense strand and an antisense strand, wherein the antisense strand of the dsRNA contains no more than 3, 2, or 1 nucleotide differences from the nucleotide sequence of any antisense strand in Table 1.
[0143] In some alternative implementations, the antisense strand in the dsRNA differs from the antisense strand in any of Table 1 by no more than 3 nucleotides.
[0144] In some alternative implementations, the antisense strand in the dsRNA contains no more than two nucleotides different from any of the antisense strands in Table 1.
[0145] In some alternative implementations, the antisense strand in the dsRNA contains no more than one nucleotide different from any of the antisense strands in Table 1.
[0146] In some alternative implementations, the antisense strand in the dsRNA differs from any antisense strand in Table 3 or Table 4 by no more than 3, 2, or 1 nucleotides.
[0147] In some alternative implementations, the antisense strand contains no more than 3, 2, or 1 nucleotide differences from any of the antisense strands in Table 1, and the antisense strand contains at least 19 consecutive nucleotides.
[0148] In some alternative implementations, the antisense strand contains no more than three nucleotide differences from any of the antisense strands shown in Table 1, and the antisense strand contains at least 19 consecutive nucleotides.
[0149] In some alternative implementations, the antisense strand contains no more than two nucleotide differences from any of the antisense strands shown in Table 1, and the antisense strand contains at least 19 consecutive nucleotides.
[0150] In some alternative implementations, the antisense strand contains no more than one nucleotide difference from any of the antisense strands shown in Table 1, and the antisense strand comprises at least 19 consecutive nucleotides.
[0151] In some alternative embodiments, the antisense strand contains no more than 3, 2, or 1 nucleotides different from any of the antisense strands provided in Table 3 or Table 4, and the antisense strand contains at least 19 consecutive nucleotides.
[0152] In this disclosure, “differences” in nucleotide sequences may include changes in the nucleotide sequence resulting from the addition, deletion, or substitution of nucleotides.
[0153] In some alternative implementations, the dsRNA is siRNA.
[0154] In some alternative implementations, the antisense strand in the siRNA differs from any of the antisense strands in Table 1 by no more than three nucleotides.
[0155] In some alternative implementations, the antisense strand in the siRNA differs from any of the antisense strands in Table 1 by no more than two nucleotides.
[0156] In some alternative implementations, the antisense strand in the siRNA differs from any of the antisense strands in Table 1 by no more than one nucleotide.
[0157] In some embodiments of this disclosure, the antisense strand in the siRNA is any of the antisense strands shown in Table 1.
[0158] In some alternative implementations, the sense strand of the siRNA differs from any sense strand in Table 1 by no more than three nucleotides.
[0159] In some alternative implementations, the sense strand of the siRNA differs from any sense strand in Table 1 by no more than two nucleotides.
[0160] In some alternative implementations, the sense strand of the siRNA differs from any sense strand in Table 1 by no more than one nucleotide.
[0161] In some alternative implementations, the sense strand in the siRNA is any of the sense strands shown in Table 1.
[0162] In some alternative implementations, there is at least one mismatch between the sense and antisense strands in the dsRNA.
[0163] In some alternative implementations, there are at most three mismatches between the sense and antisense strands in the dsRNA.
[0164] In some alternative implementations, there are at most two mismatches between the sense and antisense strands in the dsRNA.
[0165] In some alternative implementations, the sense and antisense strands in the dsRNA have at most one mismatch.
[0166] In some alternative implementations, there is no mismatch between the sense and antisense strands in the dsRNA.
[0167] In some alternative implementations, the antisense strand in the dsRNA has at most four mismatches with the target sequence.
[0168] In some alternative implementations, the antisense strand in the dsRNA has at most three mismatches with the target sequence.
[0169] In some alternative implementations, the antisense strand in the dsRNA may have at most two mismatches with the target sequence.
[0170] In some alternative implementations, the antisense strand in the dsRNA has at most one mismatch with the target sequence.
[0171] In some alternative implementations, the first nucleotide of the dsRNA antisense strand in the 5' to 3' direction is mismatched with the target sequence.
[0172] In some alternative implementations, the first nucleotide of the dsRNA antisense strand in the 5' to 3' direction is mismatched with the target sequence, and at the site of the mismatch, the nucleotides of the antisense strand and the target sequence are different.
[0173] In some alternative implementations, the first nucleotide of the dsRNA antisense strand in the 5' to 3' direction is mismatched with the target sequence, and at the site of the mismatch, the nucleotides of the antisense strand and the sense strand are complementary.
[0174] In some alternative implementations, the first nucleotide of the dsRNA antisense strand in the 5' to 3' direction is mismatched with the target sequence. At the site of the mismatch between the antisense strand and the target sequence, the nucleotides of the antisense strand and the target sequence are not the same, and the nucleotides of the antisense strand and the sense strand are complementary.
[0175] In some alternative implementations, the first nucleotide in the 5' to 3' direction of the dsRNA antisense strand is U or A.
[0176] In some alternative implementations, the first nucleotide in the 5' to 3' direction of the dsRNA antisense strand is U or A, and the nucleotide in the sense strand that is complementary to said nucleotide is A or U.
[0177] In some alternative implementations, the sense strand of the dsRNA differs from any of the sense strands in Table 1 by no more than three nucleotides.
[0178] In some alternative implementations, the sense strand of the dsRNA differs from any sense strand in Table 1 by no more than two nucleotides.
[0179] In some alternative implementations, the sense strand of the dsRNA differs from any sense strand in Table 1 by no more than one nucleotide.
[0180] In some alternative implementations, the nucleotide differences between the sense strand of the dsRNA and the modified sense strand in any of Tables 3 or 4 are no more than 3, 2, or 1.
[0181] In some alternative implementations, the nucleotides at positions 16 to 23 in the 5' to 3' direction of the dsRNA antisense strand have at most one mismatch with the target sequence.
[0182] In some alternative implementations, the nucleotide at position 16 in the 5' to 3' direction of the dsRNA antisense strand is mismatched with the target sequence.
[0183] In some alternative implementations, the nucleotide at position 17 in the 5' to 3' direction of the dsRNA antisense strand is mismatched with the target sequence.
[0184] In some alternative implementations, the nucleotide at position 18 in the 5' to 3' direction of the dsRNA antisense strand is mismatched with the target sequence.
[0185] In some alternative implementations, the nucleotide at position 19 in the 5' to 3' direction of the dsRNA antisense strand is mismatched with the target sequence.
[0186] In some alternative implementations, the nucleotide at position 20 in the 5' to 3' direction of the dsRNA antisense strand is mismatched with the target sequence.
[0187] In some alternative implementations, the nucleotide at position 21 of the dsRNA antisense strand in the 5' to 3' direction is mismatched with the target sequence.
[0188] In some alternative implementations, the nucleotide at position 22 in the 5' to 3' direction of the dsRNA antisense strand is mismatched with the target sequence.
[0189] In some alternative implementations, the nucleotide at position 23 in the 5' to 3' direction of the dsRNA antisense strand is mismatched with the target sequence.
[0190] In some alternative implementations, the antisense strand in the dsRNA has at least one mismatch with the target sequence.
[0191] In some alternative implementations, the nucleotides at positions 16 to 21 of the dsRNA antisense strand in the 5' to 3' direction have at most one mismatch with the target sequence.
[0192] In some alternative implementations, the nucleotides at positions 16 to 22 in the 5' to 3' direction of the dsRNA antisense strand have at most three mismatches with the target sequence.
[0193] In some alternative implementations, one nucleotide in the 5' to 3' direction of the dsRNA antisense strand, at positions 16 to 21, may be mismatched with the target sequence.
[0194] In some alternative implementations, two nucleotides at positions 16 to 21 of the dsRNA antisense strand in the 5' to 3' direction may optionally be mismatched with the target sequence.
[0195] In some alternative implementations, three nucleotides at positions 16 to 21 of the dsRNA antisense strand in the 5' to 3' direction may optionally be mismatched with the target sequence.
[0196] In some alternative implementations, one of the nucleotides at positions 19, 20, and 21 in the 5' to 3' direction of the dsRNA antisense strand may be mismatched with the target sequence.
[0197] In some alternative implementations, the nucleotides at positions 19, 20, and 21 in the 5' to 3' direction of the dsRNA antisense strand,
[0198] Two mismatches with the target sequence can be selected at random.
[0199] In some alternative implementations, the nucleotides at positions 19 and 21 of the dsRNA antisense strand in the 5' to 3' direction are mismatched with the target sequence.
[0200] In some alternative implementations, the nucleotides at positions 19 and 20 of the dsRNA antisense strand in the 5' to 3' direction are mismatched with the target sequence.
[0201] In some alternative implementations, the nucleotides at positions 20 and 21 of the dsRNA antisense strand in the 5' to 3' direction are mismatched with the target sequence.
[0202] In some alternative implementations, the nucleotides at positions 19, 20, and 21 in the 5' to 3' direction of the dsRNA antisense strand are all mismatched with the target sequence.
[0203] In some alternative implementations, the dsRNA antisense strand and the target sequence have mismatched sites where the nucleotides of the antisense strand and the target sequence are identical.
[0204] In some alternative implementations, there are mismatched sites between the dsRNA antisense strand and the target sequence, where the nucleotides of the target sequence are complementary to those of the dsRNA sense strand.
[0205] In some alternative implementations, at sites in the dsRNA antisense strand where there is a mismatch with the target sequence, the nucleotides of the antisense and sense strands are interchanged.
[0206] In some alternative implementations, at sites in the dsRNA antisense strand where there is a mismatch with the target sequence, the nucleotides of the antisense and sense strands are complementary.
[0207] In some alternative implementations, at sites in the dsRNA antisense strand where there is a mismatch with the target sequence, the nucleotides of the antisense and sense strands are interchanged, and the nucleotides of the antisense and sense strands are complementary.
[0208] In some alternative implementations, the antisense strand in the dsRNA does not mismatch with the target sequence.
[0209] Those skilled in the art will recognize that mismatches are permissible for dsRNA activity. The methods described herein and / or methods known in the art can be used to determine whether mismatched AGER or RAGE dsRNAs effectively inhibit the expression of AGER or RAGE genes. Table 1 shows exemplary nucleotide sequences of the unmodified sense and antisense strands, where all nucleotide sequences are siRNAs.
[0210] Table 1. Exemplary nucleotide sequences of the unmodified sense and antisense strands.
[0211] In some alternative implementations, the unmodified duplex of dsRNA is selected from duplexes containing the sense and antisense strand sequences in the same row of Table 1.
[0212] In some alternative embodiments, the unmodified duplex of dsRNA comprises a sense strand having the sequence shown in SEQ ID NO:377 and an antisense strand having the sequence shown in SEQ ID NO:459.
[0213] In some alternative embodiments, the unmodified duplex of dsRNA comprises a sense strand having the sequence shown in SEQ ID NO:377 and an antisense strand having the sequence shown in SEQ ID NO:2079.
[0214] In some alternative embodiments, the unmodified duplex of dsRNA comprises a sense strand having the sequence shown in SEQ ID NO:2187 and an antisense strand having the sequence shown in SEQ ID NO:2079.
[0215] The sense and antisense strand sequences of the dsRNA include any one of the sense strand nucleotide sequences in Table 1 and its corresponding antisense strand nucleotide sequence, and the nucleotides in the sequences are modified nucleotides or unmodified nucleotides.
[0216] In some alternative implementations, the sense and antisense strand sequences of the dsRNA comprise any one of the sense strand nucleotide sequences and its corresponding antisense strand nucleotide sequence in Table 1, and all or substantially all of the sequences are modified nucleotides.
[0217] In some alternative implementations, the dsRNA disclosed herein targets the AGER gene location at or near the AGER sequence location shown in Table 2.
[0218] In some alternative implementations, the core antisense strand sequence of the dsRNA disclosed herein includes sequences that are fully, substantially, or at least partially complementary to any of the AGER (RAGE)21 polymer mRNA target sequences disclosed in Table 2.
[0219] Table 2. AGER (RAGE) 21-mer mRNA target sequence (derived from the human late glycosylation advanced product specific receptor (AGER), transcriptomorph 1, GenBank NM_001136.5 (SEQ ID NO:1))
[0220] In some alternative implementations, the dsRNA may also contain modified nucleotides or nucleotide analogs as needed, which do not cause a significant reduction or loss of the dsRNA's ability to inhibit AGER or RAGE gene expression.
[0221] Currently, there are various ways to modify dsRNA in this field, including backbone modification (such as phosphate group modification), ribose group modification and base modification (Watts, JK, G.F. Deleavey, and M.J. Damha, Chemically modified siRNA: tools and applications. Drug Discov Today, 2008, 13(19-20): p.842-55).
[0222] In some alternative embodiments, at least one nucleotide in the sense or antisense strand of the dsRNA is a modified nucleotide. For example, the modified nucleotide includes, but is not limited to, ribose group modifications and optional phosphate group modifications.
[0223] In some alternative embodiments, the modified nucleotide is a 2' position modification of the ribose of the nucleotide, for example having the following 2' position modifications: 2'-deoxy, 2'-fluorinated, 2'-amino, 2'-methyl, 2'-ethyl, 2'-CH2-O-CH3, 2'-CH2-CH2-O-CH3, 2'-methoxy (2'-OMe), 2'-O-CH2-CH3, 2'-O-CH2-CH2-O-CH3 (2'-O-MOE), 2'-O-CH2-C≡CH, 2'-O-CH2-C(O)-NH-CH3, 2'-OCF3, 2'-OC≡CH, or 2'-O-CH2-CH=CH2.
[0224] In some alternative implementations, the sense strand of the dsRNA contains at least one modified nucleotide.
[0225] In some alternative implementations, all nucleotides in the sense strand of the dsRNA are modified nucleotides.
[0226] In some alternative implementations, the antisense strand of the dsRNA contains at least one modified nucleotide.
[0227] In some alternative implementations, all nucleotides in the antisense strand of the dsRNA are modified nucleotides.
[0228] In some alternative embodiments, the modification is selected from at least one of: 2'-methoxy, 2'-fluorine, 2'-deoxy, 2'-CH2-CH2-O-CH3, 2'-amino, 2'-methyl, 2'-ethyl, 2'-CH2-O-CH3, 2'-O-CH2-CH3, 2'-O-CH2-CH2-O-CH3(2'-O-MOE), 2'-O-CH2-C≡CH, 2'-O-CH2-C(O)-NH-CH3, 2'-OCF3, 2'-OC≡CH, 2'-O-CH2-CH=CH2, 2'-alkyl, and 3'-methoxy, but this disclosure is not limited thereto.
[0229] In some alternative embodiments, the modification is selected from 2'-deoxy, 2'-O-MOE, 2'-methoxy, or 2'-fluorine.
[0230] In some alternative implementations, the positive strand contains up to six 2'-fluorine modified nucleotides.
[0231] In some alternative implementations, the positive strand comprises 0, 1, 2, 3, 4, 5, or 6 2'-fluorine modified nucleotides.
[0232] In some alternative implementations, the positive strand comprises at least two, at least three, or at least four consecutive 2'-fluorine modified nucleotides.
[0233] In some alternative embodiments, the positive strand comprises up to five spaced-apart 2'-fluorine modified nucleotide regions, the nucleotide regions comprising consecutive 2'-fluorine modifications.
[0234] In some alternative embodiments, the positive strand includes one, two, three, four, or five spaced-apart 2'-fluorine modified nucleotide regions, the nucleotide regions containing consecutive 2'-fluorine modifications.
[0235] In some alternative implementations, the positive strand comprises 10-21 2'-methoxy modified nucleotides.
[0236] In some alternative implementations, the positive chain comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides modified with 2'-methoxy groups.
[0237] In some alternative embodiments, the positive strand comprises up to five spaced-apart 2'-fluorine modified nucleotide regions, each containing a sequential 2'-methoxy modification.
[0238] In some alternative embodiments, the positive strand comprises one, two, three, four, or five spaced-apart 2'-methoxy modified nucleotide regions, the nucleotide regions comprising consecutive 2'-methoxy modifications.
[0239] In some alternative embodiments, the positive strand comprises one or two spaced-apart 2'-methoxy modified nucleotide regions, the nucleotide regions comprising at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten consecutive 2'-methoxy modified nucleotides.
[0240] In some alternative embodiments, the positive strand comprises two spaced-apart 2'-methoxy modified nucleotide regions of equal or different lengths, each of which independently comprises at least three, four, five, six, seven, eight, nine, or ten consecutive 2'-methoxy modified nucleotides.
[0241] In some alternative implementations, the antisense strand comprises 0-15 2'-fluorine modified nucleotides.
[0242] In some alternative embodiments, the antisense strand comprises 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 2'-fluorine modified nucleotides.
[0243] In some alternative implementations, the 2'-fluorine modified nucleotides in the antisense strand are partially or completely discontinuous.
[0244] In some alternative implementations, the 2'-fluorine modified nucleotides in the antisense strand are all discontinuous.
[0245] In some alternative embodiments, the antisense strand comprises 0-15 2'-methoxy modified nucleotides.
[0246] In some alternative embodiments, the antisense strand comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 2'-methoxy modified nucleotides.
[0247] In some alternative embodiments, the 2'-methoxy-modified nucleotides in the antisense strand are partially or completely discontinuous.
[0248] In some alternative implementations, the 2'-methoxy modified nucleotides in the antisense strand are all discontinuous.
[0249] In some alternative embodiments, the modified nucleotide includes phosphate analog-modified nucleotides.
[0250] In some alternative embodiments, the phosphate analog modified nucleotide may include (E)-vinylphosphonate ((E)-VP) modified nucleotides, (Z)-vinylphosphonate ((Z)-VP) modified nucleotides, phosphate thiophosphate modified (Ps) nucleotides, Sp-configured phosphate thiophosphate modified nucleotides, Rp-configured phosphate thiophosphate modified nucleotides (Anastasia Khvorova, Jonathan K. Watts, The chemical evolution of oligonucleotide therapies of clinical utility. Nature Biotichnology, 2017, 35(3): p.238-248), or methanesulfonylaminophosphate modified (MsPA) nucleotides, etc.
[0251] In some alternative embodiments, the nucleotide analogue refers to a group that can replace a nucleotide in a nucleic acid, but whose ribose structure is different from that of adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide.
[0252] In some alternative implementations, these nucleotide analogs may include locked nucleic acid (LNA), unlocked nucleic acid (UNA), or glycerol nucleic acid (GNA).
[0253] In some alternative implementations, the nucleotide analogues include locked nucleic acids (LNA) or glycerol nucleic acids (GNA).
[0254] In this disclosure, unless otherwise specified, each nucleotide may have two or more modifications at the same time. For example, a nucleotide may be a nucleotide modified with both 2'-fluoronucleotide and (E)-vinylphosphonate ((E)-VP).
[0255] In some alternative embodiments, the 5' end of the antisense strand contains an (E)-VP modified nucleotide.
[0256] In some alternative implementations, all nucleotides in the sense and / or antisense strands of the dsRNA are modified nucleotides or nucleotide analogs.
[0257] In some alternative implementations, each nucleotide in the sense and antisense strands of the dsRNA may be independently a 2'-methoxynucleotide, a 2'-fluoronucleotide, or a 2'-deoxynucleotide or a thiophosphate nucleotide (a nucleotide containing a thiophosphate group, such as an Rp-configured thiophosphate group or a Sp-configured thiophosphate group).
[0258] In some alternative implementations, the antisense chain comprises one or more open-loop monomers.
[0259] In some alternative implementations, the open-loop monomer is located at the 5' end of the dsRNA antisense strand.
[0260] In some alternative embodiments, the 5' and / or 3' ends of the antisense strand may include a debase residue (Ab), which may also be referred to as a "debase site" or "debase nucleotide". A debase residue (Ab) is a nucleotide or nucleoside lacking a nucleobase at the 1' position of the sugar moiety.
[0261] In some alternative implementations, the debase residues are located inside the nucleotide sequence.
[0262] In some alternative implementations, the 3' end of the antisense strand may include a debasement residue (Ab).
[0263] In some alternative implementations, the 5' end of the positive chain may include one or more debased residues (e.g., (Ab) or (AbAb)).
[0264] In some alternative implementations, UUAb, UAb, or Ab is added to the 3' end of the justice chain.
[0265] In some alternative implementations, the debased (deoxyribose) residues can be replaced with ribitol (debased ribose) residues.
[0266] In some alternative implementations, the nucleotide sequence includes an inverted debase residue (invAb), which is also referred to as an "inverted debase site".
[0267] In some alternative embodiments, the inverted debase residues are located at the 5' end, 3' end, or both 5' and 3' ends of the positive strand.
[0268] In some alternative implementations, the 5' end and / or 3' end of the positive chain may include two or more inverted debasement residues.
[0269] In some alternative implementations, the 3' end of the positive chain includes one or more inverted debase residues (invAb).
[0270] In some alternative implementations, the 5' end of the positive chain includes one or more inverted debase residues (invAb).
[0271] In some alternative implementations, one or more inverted debase residues or inverted debase sites are included between the targeting ligand and the positive strand nucleotide sequence of the dsRNA.
[0272] In some alternative implementations, the dsRNA contains one or more inverted debase residues or inverted debase sites at or near the end of the positive strand, which have properties that allow for enhanced dsRNA activity or other desired properties.
[0273] The inverted debase residue can be linked via a phosphate ester, a thiophosphate ester (e.g., shown herein as (invAb)*), or other nucleoside bonds. In some embodiments, the inverted debase residue is linked to other nucleotides via a thiophosphate ester. In some embodiments, the 3' end of the positive strand includes an inverted debase residue (invAb), and said inverted debase residue can be linked to other nucleotides via a thiophosphate ester.
[0274] In some alternative implementations, for certain specific target sequences, the first base of the antisense strand has a preferred base. For example, for the sequence UACAGCUGAGGACCAGCACCCA, the first base U is preferred over the first base C.
[0275] In some alternative embodiments, the positive strand has three, four, five, or six nucleotides that are 2'-fluoronucleotides. In some alternative embodiments, the positive strand has three, four, five, or six nucleotides that are 2'-fluoronucleotides, wherein the nucleotides at positions 11 and 13 in the 3' to 5' direction of the positive strand are both 2'-fluoronucleotides, and the nucleotides at positions 1, 3, 5, 6, 7, 9, 12, 15, 17, 19, and optionally 21 are optionally 2'-fluoronucleotides.
[0276] In some alternative embodiments, the positive strand has three, four, or five nucleotides that are 2'-fluoronucleotides, wherein the nucleotides at positions 7, 9, and 11 in the 5'-to-3' direction of the positive strand are all 2'-fluoronucleotides, and optionally one or more of the nucleotides at positions 5, 10, and 13 may be 2'-fluoro modified nucleotides. In some alternative embodiments, the positive strand has three, four, or five nucleotides that are 2'-fluoronucleotides, wherein the nucleotides at positions 8, 10, and 12 in the 5'-to-3' direction of the positive strand are 2'-fluoro modified nucleotides, and optionally one or more of the nucleotides at positions 6 and 14 may be 2'-fluoro modified nucleotides.
[0277] In some alternative embodiments, the positive strand has four, five, or six nucleotides that are 2'-fluoronucleotides, the nucleotides at positions 11, 12, and 13 in the 3' to 5' direction of the positive strand are all 2'-fluoronucleotides, and the nucleotides at positions 1, 3, 5, 6, 7, 9, 15, 17, 19, and optionally 21 are optionally 2'-fluoronucleotides.
[0278] In some alternative embodiments, the positive strand has four, five, or six nucleotides that are 2'-fluoronucleotides, the nucleotides at positions 9, 11, 12, and 13 in the 3' to 5' direction of the positive strand are all 2'-fluoronucleotides, and the nucleotides at positions 1, 3, 5, 6, 7, 15, 17, 19, and optionally 21 are optionally 2'-fluoronucleotides.
[0279] In some alternative embodiments, the positive strand has four, five, or six nucleotides that are 2'-fluoronucleotides, wherein the nucleotides at positions 5, 11, 12, and 13 in the 3' to 5' direction of the positive strand are all 2'-fluoronucleotides, and the nucleotides at positions 1, 3, 6, 7, 9, 15, 17, 19, and optionally 21 are optionally 2'-fluoronucleotides.
[0280] In some alternative embodiments, the positive strand has four, five, or six nucleotides that are 2'-fluoronucleotides, and the nucleotides at positions 5, 9, 11, 12, and 13 in the 3' to 5' direction of the positive strand are all 2'-fluoronucleotides, and the nucleotides at positions 1, 3, 7, 17, 19, and optionally 21 are optionally 2'-fluoronucleotides.
[0281] In some alternative embodiments, the positive strand has three nucleotides that are 2'-fluoronucleotides located at positions 9, 11, and 13 in the direction from the 3' end to the 5' end of the positive strand.
[0282] In some alternative embodiments, the positive strand has three nucleotides that are 2'-fluoronucleotides located at positions 11, 13, and 15 in the direction from the 3' end to the 5' end of the positive strand.
[0283] In some alternative embodiments, the positive strand has three nucleotides that are 2'-fluoronucleotides located at positions 11, 12, and 13 in the direction from the 3' end to the 5' end of the positive strand.
[0284] In some alternative embodiments, the positive strand has four nucleotides that are 2'-fluoronucleotides located at positions 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the positive strand.
[0285] In some alternative embodiments, the positive strand has four nucleotides that are 2'-fluoronucleotides located at positions 9, 11, 13, and 15 in the direction from the 3' end to the 5' end of the positive strand.
[0286] In some alternative embodiments, the positive strand has five nucleotides that are 2'-fluoronucleotides located at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the positive strand.
[0287] In some alternative embodiments, the positive strand has six nucleotides that are 2'-fluoronucleotides located at positions 5, 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the positive strand.
[0288] In some alternative embodiments, the positive strand has three nucleotides that are 2'-fluoronucleotides located at positions 7, 9, and 11 in the direction from the 5' end to the 3' end of the positive strand.
[0289] In some optional embodiments, the positive strand has four nucleotides that are 2'-fluoronucleotides, located at positions 5, 7, 9, and 11 in the 5'-to-3' direction of the positive strand. In some optional embodiments, the positive strand has four nucleotides that are 2'-fluoronucleotides, located at positions 6, 8, 10, and 12 in the 5'-to-3' direction of the positive strand. In some optional embodiments, the positive strand has four nucleotides that are 2'-fluoronucleotides, located at positions 8, 10, 12, and 14 in the 5'-to-3' direction of the positive strand.
[0290] In some optional embodiments, the antisense strand has four, five, six, or seven nucleotides that are 2'-fluorinated nucleotides, and the nucleotides at positions 2 and 14 in the 5'-3' direction of the antisense strand are both 2'-fluorinated nucleotides, and at least two of positions 4, 6, 7, 12, 16, 18, and 20 are 2'-fluorinated nucleotides. In some optional embodiments, the nucleotide at position 1 in the 5'-3' direction of the antisense strand may further be a 2'-O-MOE nucleotide.
[0291] In some alternative embodiments, the antisense strand has four, five, six, or seven nucleotides that are 2'-fluoronucleotides, wherein the nucleotides at positions 2, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are all 2'-fluoronucleotides, and the nucleotides at positions 3, 4, 5, 7, 8, 9, 10, 18, 20, 21, and optionally 22 are optionally 2'-fluoronucleotides.
[0292] In some alternative embodiments, the antisense strand has four, five, six, or seven nucleotides that are 2'-fluoronucleotides, wherein the nucleotides at positions 2, 6, 14, 16 and optionally 22 in the 5' to 3' direction of the antisense strand are all 2'-fluoronucleotides, and the nucleotides at positions 3, 4, 5, 7, 8, 9, 10, 18, 20, and 21 are optionally 2'-fluoronucleotides.
[0293] In some alternative embodiments, the antisense strand has five nucleotides that are 2'-fluoronucleotides, wherein the 2nd, 6th, 14th, and 16th positions from the 5' end to the 3' end of the antisense strand are all 2'-fluoronucleotides, and the nucleotides at the 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 18th, 20th, 21st, and optionally the 22nd position are optionally 2'-fluoronucleotides.
[0294] In some alternative embodiments, the antisense strand has five nucleotides that are 2'-fluoronucleotides located at positions 2, 6, 14, 16, and 22 in the 5' to 3' direction of the antisense strand.
[0295] In some alternative embodiments, the antisense strand has six nucleotides that are 2'-fluoronucleotides, wherein the nucleotides at positions 2, 6, 14, 16 and optionally 22 in the 5' to 3' direction of the antisense strand are optionally 2'-fluoronucleotides, and the nucleotides at positions 3, 4, 5, 7, 8, 9, 10, 18, 20 and 21 are optionally 2'-fluoronucleotides.
[0296] In some alternative embodiments, the antisense strand has six nucleotides that are 2'-fluoronucleotides, wherein the nucleotides at positions 2, 6, 14, 16 and optionally 22 in the 5' to 3' direction of the antisense strand are optionally 2'-fluoronucleotides, and the nucleotides at positions 4, 7, 8, 10, 18 and 20 are optionally 2'-fluoronucleotides.
[0297] In some alternative embodiments, the antisense strand has six nucleotides that are 2'-fluoronucleotides, and the nucleotides at positions 2, 6, 7, 14, 16 and 22 in the 5' to 3' direction of the antisense strand are all 2'-fluoronucleotides.
[0298] In some alternative embodiments, the antisense strand has seven nucleotides that are 2'-fluoronucleotides, wherein the nucleotides at positions 2, 6, 14, 16 and optionally 22 in the 5' to 3' direction of the antisense strand are optionally 2'-fluoronucleotides, and the nucleotides at positions 3, 4, 5, 7, 8, 9, 10, 18, 20 and 21 are optionally 2'-fluoronucleotides.
[0299] In some alternative embodiments, the antisense strand has one nucleotide that is a 2'-fluoronucleotide, which is located at position 14 in the direction from the 5' end to the 3' end of the antisense strand.
[0300] In some alternative embodiments, the antisense strand has two nucleotides that are 2'-fluoronucleotides located at positions 14 and 16 in the 5' to 3' direction of the antisense strand.
[0301] In some alternative embodiments, the antisense strand has three nucleotides that are 2'-fluoronucleotides located at positions 2, 12, and 14 in the 5' to 3' direction of the antisense strand.
[0302] In some alternative embodiments, the antisense strand has three nucleotides that are 2'-fluoronucleotides located at positions 2, 6, and 12 in the 5' to 3' direction of the antisense strand.
[0303] In some alternative embodiments, the antisense strand has three nucleotides that are 2'-fluoronucleotides located at positions 2, 12, and 16 in the 5' to 3' direction of the antisense strand.
[0304] In some alternative embodiments, the antisense strand has three nucleotides that are 2'-fluoronucleotides located at positions 2, 14, and 16 in the 5' to 3' direction of the antisense strand.
[0305] In some alternative embodiments, the antisense strand has three nucleotides that are 2'-fluoronucleotides located at positions 2, 6, and 16 in the 5' to 3' direction of the antisense strand.
[0306] In some alternative embodiments, the antisense strand has three nucleotides that are 2'-fluoronucleotides located at positions 2, 12, and 15 in the 5' to 3' direction of the antisense strand.
[0307] In some alternative embodiments, the antisense strand has four nucleotides that are 2'-fluoronucleotides located at positions 2, 6, 14, and 16 in the 5' to 3' direction of the antisense strand.
[0308] In some alternative embodiments, the antisense strand has four nucleotides that are 2'-fluoronucleotides located at positions 2, 12, 14, and 16 in the 5' to 3' direction of the antisense strand.
[0309] In some alternative embodiments, the antisense strand has four nucleotides that are 2'-fluoronucleotides located at positions 2, 6, 14, and 16 in the 5' to 3' direction of the antisense strand.
[0310] In some optional embodiments, the antisense strand has five nucleotides that are 2'-fluoronucleotides, located at positions 2, 4, 6, 14, and 16 in the 5'-to-3' direction of the antisense strand.
[0311] In some alternative embodiments, the antisense strand has five nucleotides that are 2'-fluoronucleotides located at positions 2, 6, 12, 14, and 16 in the 5' to 3' direction of the antisense strand.
[0312] In some alternative embodiments, the antisense strand has six nucleotides that are 2'-fluoronucleotides located at positions 2, 4, 6, 12, 14, and 16 in the 5' to 3' direction of the antisense strand.
[0313] In some optional embodiments, the antisense strand has seven nucleotides that are 2'-fluoronucleotides, located at positions 2, 4, 6, 7, 12, 14, and 16 along the 5' to 3' direction of the antisense strand. In some optional embodiments, the antisense strand has seven nucleotides that are 2'-fluoronucleotides, located at positions 2, 4, 6, 12, 14, 16, and 18 along the 5' to 3' direction of the antisense strand. In some optional embodiments, the antisense strand has seven nucleotides that are 2'-fluoronucleotides, located at positions 2, 4, 6, 12, 14, 16, and 20 along the 5' to 3' direction of the antisense strand.
[0314] In some alternative embodiments, the antisense strand has five or six nucleotides that are 2'-fluoronucleotides, wherein the nucleotides at position 20 and optionally position 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at positions 2, 4, 6, 7, 8, 10, 14, 16, and 18 are optionally 2'-fluoronucleotides.
[0315] In some alternative embodiments, the antisense strand has five or six nucleotides that are 2'-fluoronucleotides, wherein the nucleotides at positions 4, 8, 20 and optionally 22 in the 5' to 3' direction of the antisense strand are all 2'-fluoronucleotides, and the nucleotides at positions 2, 6, 10, 14, 16 and 18 are optionally 2'-fluoronucleotides.
[0316] In some alternative embodiments, the antisense strand has seven nucleotides that are 2'-fluoronucleotides, and the nucleotides at positions 2, 4, 6, 12, 14, 16, and 18 in the 5' to 3' direction of the antisense strand are all 2'-fluoronucleotides.
[0317] In some alternative embodiments, the antisense strand has eight nucleotides that are 2'-fluoronucleotides, and the nucleotides at positions 2, 4, 6, 10, 12, 14, 16, and 18 in the 5' to 3' direction of the antisense strand are all 2'-fluoronucleotides.
[0318] In some alternative embodiments, the antisense strand has eight nucleotides that are 2'-fluoronucleotides, and the nucleotides at positions 2, 4, 6, 8, 12, 14, 16, and 18 in the 5' to 3' direction of the antisense strand are all 2'-fluoronucleotides.
[0319] In some alternative embodiments, the dsRNA contains at least four 2'-fluoronucleotides, wherein the nucleotides at positions 11, 12, 13, and 15 in the 3' to 5' direction of the positive strand are all 2'-fluoronucleotides, and the antisense strand contains at least four 2'-fluoronucleotides, wherein the nucleotides at positions 2, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are all 2'-fluoronucleotides.
[0320] In some alternative embodiments, the dsRNA comprises at least four 2'-fluoronucleotides located at positions 11, 12, 13, and 15, and at least one of positions 1, 3, 5, 7, 9, and 19, in the 3'-to-5' direction of the positive strand; and at least five 2'-fluoronucleotides located at positions 2, 6, 14, and 16, and at least one of positions 3, 4, 5, 7, 8, 9, 10, 18, 20, 21, 22, 23, 24, 25, and 26, in the 5'-to-3' direction of the negative strand.
[0321] In some optional embodiments, the dsRNA comprises at least five 2'-fluoronucleotides located at positions 9, 11, 12, 13, and 15 in the 3'-to-5' direction of the positive strand, and optionally at least one of positions 1, 3, 5, 7, and 19; and the antisense strand comprises at least five 2'-fluoronucleotides located at positions 2, 6, 14, 16, and 22 in the 5'-to-3' direction of the antisense strand, and optionally at least one of positions 3, 4, 5, 7, 8, 9, 10, 18, 20, 21, 23, 24, 25, and 26.
[0322] In some alternative embodiments, the dsRNA contains at least six 2'-fluoronucleotides at positions 11, 12, 13, and 15, and at least two of positions 1, 3, 5, 6, 7, 9, and 19 in the 3' to 5' direction of the positive strand.
[0323] In some alternative embodiments, the sense strand has five nucleotides that are 2'-fluoronucleotides, and the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are all 2'-fluoronucleotides; the antisense strand has five nucleotides that are 2'-fluoronucleotides, and the nucleotides at positions 2, 6, 14, 16, and 22 in the direction from the 5' end to the 3' end of the antisense strand are all 2'-fluoronucleotides.
[0324] In some optional embodiments, the sense strand has five nucleotides that are 2'-fluoronucleotides, wherein the nucleotides at positions 11, 12, and 13 in the 3' to 5' direction of the sense strand are all 2'-fluoronucleotides, and the nucleotides at positions 1, 3, 5, 7, 9, 15, 17, 19, and optionally 21 are optionally 2'-fluoronucleotides; the antisense strand has six nucleotides that are 2'-fluoronucleotides, wherein the nucleotides at positions 2, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are all 2'-fluoronucleotides, and the nucleotides at positions 4, 8, 10, 18, 20, and optionally 22 are optionally 2'-fluoronucleotides.
[0325] In some optional embodiments, the sense strand has six nucleotides that are 2'-fluoronucleotides, wherein the nucleotides at positions 11, 12, and 13 in the 3' to 5' direction of the sense strand are all 2'-fluoronucleotides, and the nucleotides at positions 1, 3, 5, 6, 7, 9, 15, 17, 19, and optionally 21 are 2'-fluoronucleotides. The antisense strand has five nucleotides that are 2'-fluoronucleotides, wherein the nucleotides at positions 2, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are all 2'-fluoronucleotides, and the nucleotides at positions 3, 4, 5, 7, 8, 9, 10, 18, 20, 21, and optionally 22 are 2'-fluoronucleotides.
[0326] In some alternative embodiments, the sense strand has six nucleotides that are 2'-fluoronucleotides, and the nucleotides at positions 5, 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are all 2'-fluoronucleotides; the antisense strand has five nucleotides that are 2'-fluoronucleotides, and the nucleotides at positions 2, 6, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are all 2'-fluoronucleotides.
[0327] In some optional embodiments, the sense strand has six nucleotides that are 2'-fluoronucleotides, wherein the nucleotides at positions 11, 12, and 13 in the 3' to 5' direction of the sense strand are all 2'-fluoronucleotides, and the nucleotides at positions 1, 3, 5, 6, 7, 9, 15, 17, 19, and optionally 21 are optionally 2'-fluoronucleotides; the antisense strand has six nucleotides that are 2'-fluoronucleotides, wherein the nucleotides at positions 2, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are all 2'-fluoronucleotides, and the nucleotides at positions 3, 4, 5, 7, 8, 9, 10, 18, 20, 21, and optionally 22 are optionally 2'-fluoronucleotides.
[0328] In some optional embodiments, the sense strand has six nucleotides that are 2'-fluoronucleotides, with the 5th, 9th, 11th, 12th, 13th, and 15th positions from the 3' end to the 5' end of the sense strand being 2'-fluoronucleotides. The antisense strand has six nucleotides that are 2'-fluoronucleotides, with the nucleotides at the 2nd, 6th, 14th, 16th, and optionally the 22nd position from the 5' end to the 3' end of the antisense strand being 2'-fluoronucleotides, and the nucleotides at the 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 18th, 20th, and 21st positions being 2'-fluoronucleotides.
[0329] In some alternative embodiments, the positive strand has at least one nucleotide that is a 2'-deoxyribonucleotide, and optionally the positive strand has one, two, three, four or five nucleotides that are 2'-deoxyribonucleotides.
[0330] In some alternative implementations, the positive strand has one 2'-deoxyribonucleotide.
[0331] In some optional embodiments, the positive strand has one nucleotide that is a 2'-deoxyribonucleotide, and the 2'-deoxyribonucleotide is selected from any position 10, 11, 12, 13, or 14 in the direction from the 3' end to the 5' end of the positive strand. In some optional embodiments, the positive strand has one nucleotide that is a 2'-deoxyribonucleotide, and the 2'-deoxyribonucleotide is located at position 8, 10, or 11 in the direction from the 5' end to the 3' end of the positive strand.
[0332] In some alternative implementations, the positive strand has one nucleotide that is a 2'-deoxyribonucleotide, and the 2'-deoxyribonucleotide is located at position 10 in the direction from the 3' end to the 5' end of the positive strand.
[0333] In some alternative implementations, the positive strand has one nucleotide that is a 2'-deoxyribonucleotide, and the 2'-deoxyribonucleotide is located at position 11 in the direction from the 3' end to the 5' end of the positive strand.
[0334] In some alternative implementations, the positive strand has one nucleotide that is a 2'-deoxyribonucleotide, located at position 12 in the direction from the 3' end to the 5' end of the positive strand.
[0335] In some alternative implementations, the positive strand has one nucleotide that is a 2'-deoxyribonucleotide, and the 2'-deoxyribonucleotide is located at position 13 in the direction from the 3' end to the 5' end of the positive strand.
[0336] In some alternative implementations, the positive strand has one nucleotide that is a 2'-deoxyribonucleotide, located at position 14 in the direction from the 3' end to the 5' end of the positive strand.
[0337] In some alternative embodiments, the positive strand has two nucleotides that are 2'-deoxyribonucleotides, and the 2'-deoxyribonucleotides are selected from any two of the 10, 11, 12, 13 and 14 positions in the direction from the 3' end to the 5' end.
[0338] In some alternative implementations, the positive strand has three nucleotides that are 2'-deoxyribonucleotides, and the 2'-deoxyribonucleotides are selected from any three of the 10, 11, 12, 13 and 14 positions in the direction from the 3' end to the 5' end.
[0339] In some alternative implementations, the positive strand has four nucleotides that are 2'-deoxyribonucleotides, and the 2'-deoxyribonucleotides are selected from any four of the 10, 11, 12, 13 and 14 positions in the direction from the 3' end to the 5' end.
[0340] In some alternative implementations, the positive strand has five nucleotides that are 2'-deoxyribonucleotides, and the 2'-deoxyribonucleotides are selected from any five of the 10, 11, 12, 13 and 14 positions from the 3' end to the 5' end.
[0341] In some alternative embodiments, the antisense strand has three nucleotides that are 2'-deoxyribonucleotides located at positions 2, 5, and 7 in the 5' to 3' direction of the antisense strand.
[0342] In some alternative embodiments, the antisense strand has four nucleotides that are 2'-deoxyribonucleotides located at positions 2, 5, 7, and 12 in the 5' to 3' direction of the antisense strand.
[0343] In some alternative implementations, each of the nucleotides in the sense strand of the dsRNA is independently 2'-methoxynucleotide, 2'-fluoronucleotide, or 2'-deoxynucleotide.
[0344] In some alternative implementations, the entire nucleotide sequence of the sense and antisense strands of the dsRNA is independently either a 2'-methoxynucleotide or a 2'-fluoronucleotide.
[0345] In some alternative embodiments, the nucleotides at least at positions 11, 12, and 13 in the 3' to 5' direction of the positive strand are 2'-fluoronucleotides, and the nucleotides at other sites of the positive strand can be 2'-methoxynucleotides.
[0346] In some alternative embodiments, the nucleotides at least at positions 11, 12, and 13 in the 3' to 5' direction of the positive strand are 2'-fluoronucleotides, and the nucleotides at other sites of the positive strand may include 2'-methoxynucleotides or 2'-deoxynucleotides.
[0347] In some alternative implementations, the nucleotides at positions 11, 12, 13, and 15 in the 3' to 5' direction of the positive strand are 2'-fluoronucleotides, while the nucleotides at other sites of the positive strand can be 2'-methoxynucleotides.
[0348] In some alternative embodiments, the nucleotides at positions 11, 12, 13, and 15 in the 3' to 5' direction of the positive strand are 2'-fluoronucleotides, and the nucleotides at other sites of the positive strand can be 2'-methoxynucleotides or 2'-deoxynucleotides.
[0349] In some alternative embodiments, the nucleotides at positions 1, 3, 5, 6, 7, 9, 11, 12, 13, 15, 17, 19 and optionally 21 in the 3' to 5' direction of the positive strand are 2'-fluoronucleotides, and the nucleotides at other sites of the positive strand can be 2'-methoxynucleotides.
[0350] In some alternative embodiments, the nucleotides at positions 1, 3, 5, 6, 7, 9, 11, 12, 13, 15, 17, 19 and optionally 21 in the 3' to 5' direction of the positive strand are 2'-fluoronucleotides, and the nucleotides at other sites of the positive strand may include 2'-methoxynucleotides or 2'-deoxynucleotides.
[0351] In some alternative implementations, the nucleotides at positions 11, 12, 13, and 15 in the 3' to 5' direction of the positive strand are 2'-fluoronucleotides, and the nucleotides at at least one of positions 1, 3, 5, 6, 7, 9, 17, 19, and 21 can be 2'-fluoronucleotides.
[0352] In some alternative implementations, the nucleotides at positions 11, 12, 13, and 15 in the 3' to 5' direction of the positive strand are 2'-fluoronucleotides, and at least two of the nucleotides at positions 1, 3, 5, 7, and 9 can be 2'-fluoronucleotides.
[0353] In some alternative implementations, the nucleotide at position 1 in the 5' to 3' direction of the antisense strand may be a 2'-O-MOE nucleotide.
[0354] In some alternative embodiments, at least the nucleotides at positions 2, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.
[0355] In some alternative embodiments, the nucleotides at positions 2, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.
[0356] In some alternative embodiments, the nucleotides at positions 2, 4, 6, 8, 10, 14, 16, 18, and optionally 22 in the 5' to 3' direction of the antisense strand are optionally 2'-fluoronucleotides, and the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.
[0357] In some alternative embodiments, the nucleotides at positions 2, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and at least one of the nucleotides at positions 3, 4, 5, 7, 8, 9, 10, 18, 20, 21, and 22 is a 2'-fluoronucleotide.
[0358] In some alternative embodiments, the nucleotides at positions 2, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and at least one of the nucleotides at positions 4, 8, 10, 18, 20, and 22 is a 2'-fluoronucleotide.
[0359] In some alternative embodiments, the nucleotides at positions 2, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and at least two of the nucleotides at positions 3, 4, 5, 7, 8, 9, 10, 18, 20, 21, and 22 are 2'-fluoronucleotides.
[0360] In some alternative embodiments, the nucleotides at positions 2, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and at least two of the nucleotides at positions 4, 8, 10, 18, 20, and 22 are 2'-fluoronucleotides.
[0361] In some alternative embodiments, the nucleotides at positions 2, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and at least three of the positions at positions 3, 4, 5, 7, 8, 9, 10, 18, 20, 21, and 22 are 2'-fluoronucleotides.
[0362] In some alternative embodiments, the nucleotides at positions 2, 4, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.
[0363] In some alternative embodiments, the nucleotides at positions 2, 6, 8, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.
[0364] In some alternative embodiments, the nucleotides at positions 2, 6, 14, 16, 20, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.
[0365] In some alternative embodiments, the nucleotides at positions 2, 4, 6, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.
[0366] In some alternative embodiments, the nucleotides at positions 2, 6, 10, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.
[0367] In some alternative embodiments, the nucleotides at positions 2, 4, 6, 14, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.
[0368] In some alternative embodiments, the nucleotides at positions 2, 4, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.
[0369] In some alternative embodiments, the nucleotides at positions 2, 6, 9, 14, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.
[0370] In some alternative embodiments, the nucleotides at positions 2, 6, 12, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.
[0371] In some alternative embodiments, the nucleotides at positions 2, 5, 6, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.
[0372] In some alternative embodiments, the nucleotides at positions 2, 6, 7, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other sites of the antisense strand can be 2'-methoxynucleotides.
[0373] In some optional embodiments, the nucleotides at positions 9, 11, and 13 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 12, and 14 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0374] In some optional embodiments, the nucleotides at positions 9, 11, and 13 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides or 2'-deoxynucleotides. The nucleotides at positions 2, 12, and 14 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0375] In some alternative embodiments, the nucleotides at positions 9, 11, and 13 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 12, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0376] In some optional embodiments, the nucleotides at positions 9, 11, and 13 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides or 2'-deoxynucleotides. The nucleotides at positions 2, 12, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0377] In some optional embodiments, the nucleotides at positions 9, 11, and 13 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, and 12 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0378] In some optional embodiments, the nucleotides at positions 9, 11, and 13 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides or 2'-deoxynucleotides. The nucleotides at positions 2, 6, and 12 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0379] In some optional embodiments, the nucleotides at positions 11, 12, and 13 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, and 16 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0380] In some optional embodiments, the nucleotides at positions 11, 12, and 13 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 4, 6, 10, 12, 14, 16, and 18 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0381] In some optional embodiments, the nucleotides at positions 11, 12, and 13 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 4, 6, 8, 12, 14, 16, and 18 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0382] In some optional embodiments, the nucleotides at positions 11, 12, and 13 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 4, 6, 12, 14, 16, and 18 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.
[0383] In some alternative embodiments, the nucleotides at positions 11, 12, and 13 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and position 15 is a 2'-deoxy-modified nucleotide. The nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. In the antisense strand, the nucleotides at positions 2, 5, and 7 in the 5' to 3' direction of the antisense strand are 2'-deoxy-modified nucleotides, and positions 14 and 16 are 2'-fluoronucleotides. The nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0384] In some optional embodiments, the nucleotides at positions 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 5, 7, and 12 in the 5' to 3' direction of the antisense strand are 2'-deoxy-modified nucleotides, and the nucleotide at position 14 is a 2'-fluoronucleotide. The nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0385] In some optional embodiments, the nucleotides at positions 11, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 12, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0386] In some optional embodiments, the nucleotides at positions 11, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 12, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0387] In some alternative embodiments, the nucleotides at positions 11, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 12, and 14 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0388] In some alternative embodiments, the nucleotides at positions 11, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 12, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0389] In some alternative embodiments, the nucleotides at positions 11, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, and 12 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0390] In some optional embodiments, the nucleotides at positions 9, 11, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 12, and 14 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0391] In some optional embodiments, the nucleotides at positions 9, 11, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 5, 7, 13, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0392] In some optional embodiments, the nucleotides at positions 9, 11, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 12, and 15 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0393] In some alternative embodiments, the nucleotides at positions 9, 11, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, and 12 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0394] In some optional embodiments, the nucleotides at positions 9, 11, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides or 2'-deoxynucleotides. The nucleotides at positions 2, 4, 6, 12, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0395] In some optional embodiments, the nucleotides at positions 9, 11, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides or 2'-deoxynucleotides. The nucleotides at positions 2, 4, 6, 12, and 14 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0396] In some optional embodiments, the nucleotides at positions 9, 11, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides or 2'-deoxynucleotides. The nucleotides at positions 2, 4, 6, 12, 14, 16, and 18 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0397] In some alternative embodiments, the nucleotides at positions 9, 11, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides or 2'-deoxynucleotides. The nucleotides at positions 2, 4, 6, 12, 14, 16, and 20 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0398] In some alternative embodiments, the nucleotides at positions 9, 11, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides or 2'-deoxynucleotides. The nucleotides at positions 2, 4, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0399] In some optional embodiments, the nucleotides at positions 9, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides or 2'-deoxynucleotides. The nucleotides at positions 2, 4, 6, 11, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0400] In some alternative embodiments, the nucleotides at positions 9, 11, 12, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand include 2'-methoxynucleotides or 2'-deoxynucleotides. The nucleotides at positions 2, 4, 6, 13, 14, and 16 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand are 2'-methoxynucleotides.
[0401] In some optional embodiments, the nucleotides at positions 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, and 16 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0402] In some optional embodiments, the nucleotides at positions 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 8, 9, 14, and 16 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0403] In some optional embodiments, the nucleotides at positions 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 10, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0404] In some optional embodiments, the nucleotides at positions 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 18 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0405] In some optional embodiments, the nucleotides at positions 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 20 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0406] In some optional embodiments, the nucleotides at positions 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 21 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0407] In some optional embodiments, the nucleotides at positions 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 22 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0408] In some optional embodiments, the nucleotides at positions 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 4, 6, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0409] In some optional embodiments, the nucleotides at positions 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 8, 14, and 16 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0410] In some optional embodiments, the nucleotides at positions 11, 12, 13, 15, and 21 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 10, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0411] In some optional embodiments, the nucleotides at positions 11, 12, 13, 15, and 19 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 10, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0412] In some optional embodiments, the nucleotides at positions 11, 12, 13, 15, and 17 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 10, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0413] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 4, 6, 14, and 16 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0414] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 8, 14, and 16 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0415] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 10, 14, and 16 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.
[0416] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 18 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0417] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 20 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0418] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0419] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, 20, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.
[0420] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 8, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0421] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 4, 6, 14, 16, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.
[0422] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 4, 6, 14, 16, and 22 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0423] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 6, 8, 14, 16, and 22 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0424] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 6, 14, 16, 18, and 22 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0425] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 4, 6, 14, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.
[0426] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 8, 14, and 22 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0427] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 18, and 22 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0428] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 4, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0429] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 8, 14, 16, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.
[0430] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 6, 9, 14, 16, and 22 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0431] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 9, 14, 16, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.
[0432] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 9, 14, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.
[0433] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 8, 9, 14, 16, and 22 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0434] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 10, 14, 16, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.
[0435] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 3, 6, 10, 14, 16, and 22 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0436] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 5, 6, 14, 16, and 22 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0437] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 7, 14, 16, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.
[0438] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 9, 10, 14, 16, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.
[0439] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 26 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0440] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 25 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.
[0441] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 24 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0442] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 23 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.
[0443] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 21 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0444] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 7, 10, 14, 16, and 18 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0445] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 10, 14, 16, and 20 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0446] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 7, 14, 16, and 20 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0447] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 7, 10, 14, 16, and 20 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.
[0448] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 7, 14, 16, and 21 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.
[0449] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 7, 14, 16, and 23 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.
[0450] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 14, and 16 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.
[0451] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0452] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 of the sense strand from the 3' end to the 5' end are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 5, 7, 14, and 16 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0453] In some optional embodiments, the nucleotides at positions 9, 11, 12, 13, and 15 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 5, 7, 13, and 16 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.
[0454] In some optional embodiments, the nucleotides at positions 11, 13, and 15 in the 3' to 5' direction of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 12, 14, 16, and 22 in the 5' to 3' direction of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0455] In some optional embodiments, the nucleotides at positions 9, 11, and 13 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 12, 14, 16, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides.
[0456] In some alternative embodiments, the nucleotides at positions 11, 12, and 13 in the direction from the 3' end to the 5' end of the sense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the sense strand can be 2'-methoxynucleotides. The nucleotides at positions 2, 6, 14, 16, and 22 in the direction from the 5' end to the 3' end of the antisense strand are 2'-fluoronucleotides, while the nucleotides at other positions in the antisense strand can be 2'-methoxynucleotides.
[0457] In some alternative embodiments, at least one of the following connections is a thiophosphate group, an Rp-configured thiophosphate group, or a Sp-configured thiophosphate group: between the 1st and 2nd nucleotides at the 5' end of the sense strand, between the 2nd and 3rd nucleotides at the 5' end of the sense strand, between the 1st and 2nd nucleotides at the 3' end of the sense strand, between the 2nd and 3rd nucleotides at the 3' end of the antisense strand, between the 3rd and 4th nucleotides at the 3' end of the antisense strand, between the 1st and 2nd nucleotides at the 5' end of the antisense strand, between the 2nd and 3rd nucleotides at the 5' end of the antisense strand, and between the 3rd and 4th nucleotides at the 5' end of the antisense strand.
[0458] In some alternative embodiments, the nucleotides at positions 1 and 2 of the 5' end of the sense strand, the nucleotides at positions 2 and 3 of the 5' end of the sense strand, the nucleotides at positions 1 and 2 of the 3' end of the sense strand, the nucleotides at positions 1 and 2 of the 3' end of the antisense strand, the nucleotides at positions 2 and 3 of the 3' end of the antisense strand, the nucleotides at positions 3 and 4 of the 3' end of the antisense strand, the nucleotides at positions 1 and 2 of the 5' end of the antisense strand, and the nucleotides at positions 2 and 3 of the 5' end of the antisense strand are linked by thiophosphate groups (including thiophosphate groups with Rp or Sp configurations).
[0459] In some alternative embodiments, the nucleotides at positions 1 and 2 of the 5' end of the sense strand, the nucleotides at positions 2 and 3 of the 5' end of the sense strand, the nucleotides at positions 1 and 2 of the 3' end of the antisense strand, the nucleotides at positions 2 and 3 of the 3' end of the antisense strand, the nucleotides at positions 3 and 4 of the 3' end of the antisense strand, the nucleotides at positions 1 and 2 of the 5' end of the antisense strand, and the nucleotides at positions 2 and 3 of the 5' end of the antisense strand are linked by thiophosphate groups (including thiophosphate groups with Rp or Sp configurations).
[0460] In some alternative embodiments, the nucleotides at positions 1 and 2 at the 5' end of the sense strand, the nucleotides at positions 1 and 2 at the 3' end of the sense strand, the nucleotides at positions 1 and 2 at the 3' end of the antisense strand, the nucleotides at positions 2 and 3 at the 3' end of the antisense strand, the nucleotides at positions 1 and 2 at the 5' end of the antisense strand, and the nucleotides at positions 2 and 3 at the 5' end of the antisense strand are linked by thiophosphate groups (including thiophosphate groups of the Rp configuration or the Sp configuration).
[0461] In some alternative embodiments, the nucleotides at positions 1 and 2 at the 5' end of the sense strand, the nucleotides at positions 1 and 2 at the 3' end of the antisense strand, the nucleotides at positions 1 and 2 at the 5' end of the antisense strand, the nucleotides at positions 2 and 3 at the 5' end of the antisense strand, and the nucleotides at positions 3 and 4 at the 5' end of the antisense strand are linked by thiophosphate groups (including thiophosphate groups of the Rp configuration and type or thiophosphate groups of the Sp configuration).
[0462] In some alternative embodiments, the nucleotides at positions 1 and 2 at the 5' end of the sense strand, the nucleotides at positions 1 and 2 at the 3' end of the antisense strand, the nucleotides at positions 2 and 3 at the 3' end of the antisense strand, the nucleotides at positions 1 and 2 at the 5' end of the antisense strand, and the nucleotides at positions 2 and 3 at the 5' end of the antisense strand are linked by thiophosphate groups (including thiophosphate groups of the Rp configuration or the Sp configuration).
[0463] In some alternative embodiments, at least one of the following connections is a thiophosphate group, an Rp-configured thiophosphate group, or a Sp-configured thiophosphate group: between the 1st and 2nd nucleotides at the 5' end of the sense strand, between the 2nd and 3rd nucleotides at the 5' end of the sense strand, between the 1st and 2nd nucleotides at the 3' end of the antisense strand, between the 2nd and 3rd nucleotides at the 5' end of the antisense strand, and between the 2nd and 3rd nucleotides at the 5' end of the antisense strand.
[0464] In some alternative embodiments, the nucleotides at positions 1 and 2 at the 5' end of the sense strand, the nucleotides at positions 2 and 3 at the 5' end of the sense strand, and the nucleotides at positions 1 and 2 at the 3' end of the sense strand are all connected by thiophosphate groups, Rp-configured thiophosphate groups, or Sp-configured thiophosphate groups.
[0465] In some alternative embodiments, at least four or six of the following connections are phosphate thioester groups, Rp-configured phosphate thioester groups, or Sp-configured phosphate thioester groups: between the first and second nucleotides at the 5' end of the sense strand, between the second and third nucleotides at the 5' end of the sense strand, between the first and second nucleotides at the 5' end of the antisense strand, between the first and second nucleotides at the 5' end of the antisense strand, and between the second and third nucleotides at the 5' end of the antisense strand.
[0466] In some alternative embodiments, the nucleotides at positions 1 and 2 and positions 2 and 3 of the 5' end of the positive strand are linked by a thiophosphate group, an Rp-configured thiophosphate group, or a Sp-configured thiophosphate group.
[0467] In some optional embodiments, the nucleotides at positions 1 and 2, and positions 2 and 3, of the 5' end of the sense strand are linked by a phosphate thioester group, an Rp-configured phosphate thioester group, or a Sp-configured phosphate thioester group, and the nucleotides at positions 1 and 2, and positions 2 and 3, of the 3' end of the sense strand are linked by a phosphate thioester group, an Rp-configured phosphate thioester group, or a Sp-configured phosphate thioester group. In some embodiments, the nucleotides at positions 1 and 2, and positions 2 and 3, of the 5' end of the antisense strand are linked by a phosphate thioester group, an Rp-configured phosphate thioester group, or a Sp-configured phosphate thioester group.
[0468] In some alternative embodiments, the nucleotides at positions 1 and 2 at the 3' end of the antisense strand are linked by a thiophosphate group, an Rp-configured thiophosphate group, or a Sp-configured thiophosphate group.
[0469] In some alternative embodiments, the nucleotides at positions 1 and 2 and positions 2 and 3 of the 3' end of the antisense strand are linked by a thiophosphate group, an Rp-configured thiophosphate group, or a Sp-configured thiophosphate group, and the nucleotides at positions 1 and 2 and positions 2 and 3 of the 5' end of the antisense strand are linked by a thiophosphate group, an Rp-configured thiophosphate group, or a Sp-configured thiophosphate group.
[0470] In some alternative embodiments, the nucleotides at positions 1 and 2, 2 and 3, 3 and 4, and 4 and 5 of the 3' end of the antisense strand are linked by thiophosphate groups, Rp-configured thiophosphate groups, or Sp-configured thiophosphate groups, and the nucleotides at positions 1 and 2, and 2 and 3 of the 5' end of the antisense strand are linked by thiophosphate groups, Rp-configured thiophosphate groups, or Sp-configured thiophosphate groups.
[0471] In some alternative implementations, the second nucleotide at the 3' end of the positive strand is a heat-labile nucleotide.
[0472] In some alternative implementations, at least one nucleotide at positions 6, 7, and 8 of the 5' end of the antisense strand is a heat-labile nucleotide.
[0473] In some alternative implementations, the 6th nucleotide at the 5' end of the antisense strand is a heat-labile nucleotide.
[0474] In some alternative implementations, the 7th nucleotide at the 5' end of the antisense strand is a heat-labile nucleotide.
[0475] In some alternative implementations, the 8th nucleotide at the 5' end of the antisense strand is a heat-labile nucleotide.
[0476] In some alternative implementations, the heat-labile nucleotide may be selected from LNA, UNA, or GNA.
[0477] In some alternative implementations, the heat-labile nucleotide may be GNA.
[0478] In some alternative implementations, the first nucleotide at the 5' end of the antisense strand may be an (E)-VP modified nucleotide.
[0479] In some alternative implementations, the first nucleotide at the 5' end of the antisense strand is an (E)-VP modified nucleotide.
[0480] In some alternative embodiments, the dsRNA disclosed herein comprises, substantially comprises, or includes an antisense strand consisting of, or substantially comprises, an antisense strand consisting of, or substantially comprises, an antisense strand consisting of, zero or one nucleotide sequence that is mismatched with any antisense strand selected from Table 1, wherein the dsRNA further comprises a sense strand that is at least partially complementary to the antisense strand; and wherein all or substantially all nucleotides on both the antisense strand and the sense strand are modified nucleotides.
[0481] In some alternative implementations, any of the sense strands in Table 1 may hybridize with any of the antisense strands in Table 1, wherein the hybridization is conditional on the presence of at least 85% complementary regions in consecutive 15, 16, 17, 18, 19, 20, or 21 nucleotide sequences between the two sequences.
[0482] In some implementations, any of the sense strands in Tables 1, 2, 3, or 4 may hybridize with any of the antisense strands in Tables 1, 3, or 4, wherein the hybridization is conditional on the presence of at least 85% complementary regions in consecutive 15, 16, 17, 18, 19, 20, or 21 nucleotide sequences between the two sequences.
[0483] In some alternative embodiments, the dsRNA disclosed herein comprises, substantially comprises, or includes an antisense strand consisting of, or substantially comprises, an antisense strand consisting of, or comprises, a nucleotide sequence having 0 or 1 nucleotides mismatched with any antisense strand selected from Table 1, wherein the dsRNA further comprises a sense strand that is at least partially complementary to the antisense strand; wherein all or substantially all nucleotides on both the antisense strand and the sense strand are modified nucleotides; and wherein the sense strand further comprises having inverted debasement residues at the 3' and 5' ends of the nucleotide sequence.
[0484] In some embodiments, the dsRNA disclosed herein comprises, substantially comprises, or includes an antisense strand selected from any of the items in Table 1, wherein the dsRNA further comprises a sense strand that is at least partially complementary to the antisense strand; all or substantially all nucleotides on both the antisense strand and the sense strand are modified nucleotides; and wherein the sense strand further comprises having inverted debasement residues at the 3' and 5' ends of the nucleotide sequence.
[0485] In some alternative implementations, the sense strand has nucleotides modified as follows:
[0486] The nucleotides at positions 9, 10, and 11 in the direction from the 5' end to the 3' end of the positive strand are 2'-fluoronucleotides, and the nucleotides at other positions of the positive strand can be 2'-methoxynucleotides. The inverted debase residue at the 5' end of the positive strand and the nucleotide at position 1 are linked by a phosphate thioester group, and optionally the 3' end and 5' end of the positive strand have an (invAb).
[0487] The nucleotides at positions 9, 10, and 11 in the direction from the 5' end to the 3' end of the positive strand are 2'-fluoronucleotides. The positive strand has one (invAb) at the 3' end and 5' end. The nucleotides at other positions of the positive strand can be 2'-methoxynucleotides. Furthermore, the inverted debase residue at the 5' end of the positive strand and the nucleotide at position 1 are linked by a phosphate thioester group, as are the inverted debase residue at the 3' end and the nucleotide at position 1.
[0488] As an example, the justice chain can be 5'-(inVAb)*(mC)(mC)(mC)(mG)(mU)(mC)(mC)(mC)(fA)(fC)(fC)(mU)(mU)(mC)(mU)(mC)(mU)(mC)(mC)(mU)(mG)(mU)(mA)*(inVAb)-3'(SEQ ID NO:807).
[0489] In some alternative implementations, the antisense strand has nucleotides modified as follows:
[0490] The nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 of the antisense strand in the 5' to 3' direction are 2'-fluoronucleotides, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides. The nucleotides at positions 1 and 2, 2 and 3, 3 and 4, and 1 and 2 of the 3' end of the antisense strand are linked by phosphate thioester groups, and optionally the nucleotide at position 1 in the 5' to 3' direction of the antisense strand is an (E)-VP modified nucleotide. The nucleotides at positions 2, 12, 14, and 16 of the antisense strand from the 5' end to the 3' end are 2'-fluoronucleotides, the first position of the antisense strand from the 5' end to the 3' end is cPrpu, and the nucleotides at other positions of the antisense strand can be 2'-methoxynucleotides. Furthermore, the nucleotides at positions 1 and 2 of the 5' end, positions 2 and 3 of the 5' end, positions 3 and 4 of the 5' end, and positions 1 and 2 of the 3' end are linked by phosphate thioester groups.
[0491] As an example, the antisense chain could be 5'-((E)-VP-mU)*(fA)*(mC)*(fA)(mG)(fG)(mA)(fG)(mA)(fA)(mG)(fG)(mU)(fG)(mG)(fG)(mA)(fC)(mG)(fG)*(mG)-3'(SEQ ID NO:956).
[0492] In some implementations, the dsRNA disclosed herein has the modified nucleotides shown in Table 3 below.
[0493] Table 3. Sensitive and antisense strands with chemical modifications
[0494] In some implementations, the dsRNA disclosed herein has the following modified nucleotides.
[0495] Table 4. Sensitive and antisense strands with chemical modifications
[0496] In some implementations, the dsRNA disclosed herein includes the following modifications:
[0497] (1) The nucleotides at positions 2, 4, 6, 12, 14, 16, and 18 in the 5' to 3' direction of the antisense strand are 2'-fluorinated nucleotides, the nucleotide at position 1 is a 2'-O-MOE and (E)-VP modified nucleotide, the nucleotides at other positions of the antisense strand are 2'-methoxy modified nucleotides, and the nucleotides at positions 1 and 2, 2 and 3, 1 and 2, 2 and 3, and 3 and 4 of the 3' end of the antisense strand are linked by phosphate thioester groups.
[0498] The nucleotides at positions 7, 9, 11, and 13 from the 5' end to the 3' end of the positive strand are 2'-fluorinated nucleotides, the nucleotide at position 10 is a 2'-deoxy nucleotide, the nucleotides at other positions of the positive strand are 2'-methoxy nucleotides, the nucleotides at positions 1 and 2 of the 5' end of the positive strand are linked by thiophosphate groups, and the nucleotides at positions 2 and 3 of the 5' end of the positive strand are linked by thiophosphate groups;
[0499] (2) The nucleotides at positions 2, 4, 6, 12, 14, 16, and 20 in the 5' to 3' direction of the antisense strand are 2'-fluorinated nucleotides, the nucleotide at position 1 is a 2'-O-MOE and (E)-VP modified nucleotide, the nucleotides at other positions of the antisense strand are 2'-methoxy modified nucleotides, and the nucleotides at positions 1 and 2, 2 and 3, 1 and 2, 2 and 3, and 3 and 4 of the 3' strand of the antisense strand are linked by phosphate thioester groups.
[0500] The nucleotides at positions 7, 9, 11, and 13 from the 5' end to the 3' end of the positive strand are 2'-fluorinated nucleotides, the nucleotide at position 10 is a 2'-deoxy nucleotide, the nucleotides at other positions of the positive strand are 2'-methoxy nucleotides, the nucleotides at positions 1 and 2 of the 5' end of the positive strand are linked by thiophosphate groups, and the nucleotides at positions 2 and 3 of the 5' end of the positive strand are linked by thiophosphate groups;
[0501] (3) The nucleotides at positions 2, 4, 6, 12, and 14 in the 5' to 3' direction of the antisense strand are 2'-fluorinated nucleotides, the nucleotide at position 1 is a 2'-O-MOE and (E)-VP modified nucleotide, the nucleotides at other positions of the antisense strand are 2'-methoxy modified nucleotides, and the nucleotides at positions 1 and 2, 2 and 3, 1 and 2, 2 and 3, and 3 and 4 of the antisense strand are linked by phosphate thioester groups.
[0502] The nucleotides at positions 7, 9, 11, and 13 in the direction from the 5' end to the 3' end of the positive strand are 2'-fluorinated nucleotides, the nucleotide at position 10 is a 2'-deoxy nucleotide, the nucleotides at other positions of the positive strand are 2'-methoxy nucleotides, and the nucleotides at positions 1 and 2, 2 and 3 of the 5' end of the positive strand, and 1 and 2 of the 3' end of the positive strand are linked by phosphate thioester groups.
[0503] (4) The nucleotides at positions 2, 4, 6, 12, 14, 16, and 18 in the 5' to 3' direction of the antisense strand are 2'-fluorinated nucleotides, the nucleotide at position 1 is a 2'-O-MOE and (E)-VP modified nucleotide, the nucleotides at other positions of the antisense strand are 2'-methoxy modified nucleotides, and the nucleotides at positions 1 and 2, 2 and 3, 1 and 2, 2 and 3, and 3 and 4 of the antisense strand are linked by phosphate thioester groups.
[0504] The nucleotides at positions 5, 7, 9, and 11 in the direction from the 5' end to the 3' end of the positive strand are 2'-fluorinated nucleotides, the nucleotide at position 8 is a 2'-deoxy nucleotide, the nucleotides at other positions of the positive strand are 2'-methoxy nucleotides, and the nucleotides at positions 1 and 2 of the 5' end of the positive strand, the nucleotides at positions 2 and 3 of the 5' end, and the nucleotides at positions 1 and 2 of the 3' end of the positive strand are linked by phosphate thioester groups.
[0505] (5) The nucleotides at positions 2, 4, 6, 12, 14, 16, and 18 in the 5' to 3' direction of the antisense strand are 2'-fluorinated nucleotides, the nucleotide at position 1 is a 2'-O-MOE and (E)-VP modified nucleotide, the nucleotides at other positions of the antisense strand are 2'-methoxy modified nucleotides, and the nucleotides at positions 1 and 2, 2 and 3, 1 and 2, 2 and 3, and 3 and 4 of the 3' end of the antisense strand are linked by phosphate thioester groups.
[0506] The nucleotides at positions 6, 8, 10, and 12 in the direction from the 5' end to the 3' end of the positive strand are 2'-fluorinated nucleotides, the nucleotide at position 10 is a 2'-deoxy nucleotide, the nucleotides at other positions of the positive strand are 2'-methoxy nucleotides, and the nucleotides at positions 1 and 2 of the 5' end of the positive strand, the nucleotides at positions 2 and 3 of the positive strand, and the nucleotides at positions 1 and 2 of the 3' end of the positive strand are linked by phosphate thioester groups.
[0507] (6) The nucleotides at positions 2, 4, 6, 7, 12, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluorinated nucleotides, the nucleotide at position 1 is a 2'-O-MOE and (E)-VP modified nucleotide, the nucleotides at other positions of the antisense strand are 2'-methoxy modified nucleotides, and the nucleotides at positions 1 and 2 of the 5' end, 2 and 3 of the 5' end, 1 and 2 of the 3' end, and 2 and 3 of the 3' end are linked by phosphate thioester groups.
[0508] The nucleotides at positions 8, 10, 12, and 14 along the 5' to 3' direction of the positive strand are 2'-fluorinated nucleotides, the nucleotide at position 11 is a 2'-deoxy nucleotide, and the nucleotides at other positions of the positive strand can be 2'-methoxy nucleotides. The nucleotides at positions 1 and 2 of the 5' end of the positive strand, and at positions 1 and 2 of the 3' end of the positive strand, are linked by phosphate thioester groups; or
[0509] (7) The nucleotides at positions 2, 12, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluorinated nucleotides, the nucleotide at position 1 in the 5' to 3' direction is (E)-VP modified nucleotide, the nucleotides at other positions of the antisense strand are 2'-methoxy modified nucleotides, and the nucleotides at positions 1 and 2 of the 5' end, positions 2 and 3 of the 5' end, positions 3 and 4 of the 5' end, and positions 1 and 2 of the 3' end are linked by phosphate thioester groups.
[0510] The nucleotides at positions 7, 9, and 11 in the direction from the 5' end to the 3' end of the positive strand are 2'-fluorinated nucleotides, and the nucleotides at other positions of the positive strand are 2'-methoxylated nucleotides. The nucleotides at positions 1 and 2 of the 5' end of the positive strand are linked by a thiophosphate group, and (invAb) is linked to the nucleotide at position 1 of the 3' end of the positive strand via the thiophosphate group.
[0511] (8) The nucleotides at positions 2, 12, 14, and 16 in the 5' to 3' direction of the antisense strand are 2'-fluorinated nucleotides, the nucleotide at position 1 in the 5' to 3' direction is a nucleotide modified with 2'-O-MOE and (E)-VP, the nucleotides at other sites of the antisense strand are 2'-methoxylated nucleotides, and the nucleotides at positions 1 and 2 of the 5' end, positions 2 and 3 of the 5' end, positions 3 and 4 of the 5' end, and positions 1 and 2 of the 3' end are linked by phosphate thioester groups.
[0512] The nucleotides at positions 7, 9, and 11 in the direction from the 5' end to the 3' end of the positive strand are 2'-fluorinated nucleotides, and the nucleotides at other positions of the positive strand are 2'-methoxylated nucleotides. The nucleotides at positions 1 and 2 of the 5' end of the positive strand are linked by a thiophosphate group, and (invAb) is linked to the nucleotide at position 1 of the 3' end of the positive strand via the thiophosphate group.
[0513] (9) The nucleotides at positions 2, 4, 6, 12, 14, 16, and 18 of the antisense strand from the 5' end to the 3' end are 2'-fluorinated nucleotides, the nucleotide at position 1 from the 5' end to the 3' end is a nucleotide modified with 2'-O-MOE and (E)-VP, the nucleotides at other positions of the antisense strand are 2'-methoxylated nucleotides, and the nucleotides at positions 1 and 2 of the 5' end, positions 2 and 3 of the 5' end, positions 1 and 2 of the 3' end, and positions 2 and 3 of the 3' end are linked by phosphate thioester groups.
[0514] The nucleotides at positions 7, 9, and 11 in the direction from the 5' end to the 3' end of the positive strand are 2'-fluorinated nucleotides, the nucleotide at position 8 is a 2'-deoxy nucleotide, the nucleotides at other positions of the positive strand are 2'-methoxy nucleotides, and the nucleotides at positions 1 and 2, 2 and 3 of the 5' end of the positive strand, and 1 and 2 of the 3' end of the positive strand are linked by phosphate thioester groups.
[0515] In some embodiments, the dsRNA disclosed herein includes one or more modified double strands of the following: 01AMD00410, 01AMD00439, 01AMD00440, 01AMD00441, 01AMD00442, 01AMD00443, 01AMD00454, 01AMD00455, 01AMD00456, 01AMD00457, 01AMD00458, 01AMD00461, 01AMD00462, 01AMD00463, 01AMD00464, 01AMD00465, 01AMD00466, 01AMD00467, 01AMD00468, 01AMD00469, and 01AMD00470.
[0516] In some embodiments, dsRNA is prepared or provided as a salt, mixed salt, or free acid. In some embodiments, dsRNA is prepared or provided as a pharmaceutically acceptable salt. In some embodiments, dsRNA is prepared or provided as a pharmaceutically acceptable sodium or potassium salt. Those skilled in the art will recognize that the dsRNA described herein can be obtained using conventional dsRNA preparation methods in the art (e.g., solid-phase synthesis and liquid-phase synthesis), both of which are commercially available custom services. Those skilled in the art will also recognize that modified nucleotide groups can be introduced into the dsRNA described herein using appropriately modified nucleotide monomers. Methods for preparing appropriately modified nucleotide monomers are well known to those skilled in the art, and commercially available monomers are available.
[0517] II. The dsRNA conjugate disclosed herein
[0518] The dsRNA conjugates disclosed herein are obtained by conjugating the dsRNA of the present disclosure with a pharmaceutically acceptable conjugate molecule, said conjugate molecule comprising a pharmaceutically acceptable targeting ligand and a linker.
[0519] A "connector" is an organic part that connects two parts of a compound, for example, by covalently attaching two parts of a compound. A connector typically includes a direct bond or an atom such as oxygen or sulfur, a unit such as NR, C(O), C(O)NH, SO, SO2, SO2NH, or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalenyl, arylalkynyl, heteroarylalkyl, heteroarylalenyl, heteroarylalkynyl, heterocyclic alkyl, heterocyclic alkenyl, heterocyclic alkenyl, aryl, heteroaryl, heterocyclic, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalenyl, alkylheteroarylalkyl, alkylheteroarylalenyl, alkyl Heteroarylynyl, alkenylheteroarylalkyl, alkenylheteroarylalenyl, alkenylheteroarylynyl, alkenylheteroarylalkyl, alkenylheteroarylalenyl, alkenylheteroarylynyl, alkylheterocyclic alkyl, alkylheterocyclic alkenyl, alkylheterocyclic ynyl, alkenylheterocyclic alkenyl, alkenylheterocyclic ynyl, alkenylheterocyclic alkenyl, alkenylheterocyclic ynyl, alkylaryl, alkenylaryl, alkenylaryl, alkylheteroaryl, alkenylheteroaryl, alkenylheterocyclic ynyl, alkylaryl, alkenylaryl, alkenylaryl, alkylheteroaryl, alkenylheteroaryl, alkenylheteroaryl, alkenylheteroaryl, alkylaryl, alkenylheteroaryl, alkenylheteroaryl, alkylaryl, alkenylheteroaryl, ynylaryl, wherein one or more methylene groups may be interrupted or capped by: O, S, S(O), SO2, N(R), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic; wherein R is hydrogen, acyl, aliphatic or substituted aliphatic.
[0520] In some embodiments of this disclosure, the dsRNA is covalently conjugated to the conjugated molecule. To reduce the potential impact of conjugation on dsRNA activity, the conjugation site between the dsRNA and the conjugated molecule can be at the 3' or 5' end of the sense strand of the dsRNA, or at the 5' end of the antisense strand. In some embodiments, the conjugation site between the dsRNA and the conjugated molecule can also be within the internal sequence of the dsRNA.
[0521] Pharmaceutically acceptable targeting ligands can be those conventionally used in the field of dsRNA drug delivery. In some embodiments of this disclosure, the targeting ligand may include, but is not limited to, one or more of the following targeting ligands or their derivatives: lipophilic molecules, polymers, peptides, aptamers, antibodies, chimeric antigen receptors, quantum dots, carbohydrates, folate, and receptor ligands expressed by liver or lung parenchymal cells. In some embodiments of this disclosure, the lipophilic molecule may include at least one of cholesterol, bile acids, vitamins (e.g., vitamin E), and lipid molecules of varying chain lengths (e.g., phospholipids, phospholipid ethers (PLEs)). In some embodiments of this disclosure, the polymer may include polyethylene glycol. In some embodiments of this disclosure, the peptide may include a transmembrane peptide. In some embodiments of this disclosure, the carbohydrate may include at least one of galactose, lactose, polylactose, mannose, N-acetylgalactosamine (GalNAc), and CMM (Chemically Modified Mannose). In some embodiments of this disclosure, the receptor ligand expressed by hepatocytes may include at least one of desialyl glycoprotein, desialyl sugar residues, lipoproteins (such as high-density lipoprotein, low-density lipoprotein, etc.), glucagon, neurotransmitters (such as adrenaline), growth factors, and transferrin. In some embodiments of this disclosure, the receptor ligand expressed by lung cells may include at least one of ACE2-binding peptide / antibody, surfactant protein analog, integrin avβ-targeting ligand (e.g., avβ6), and PDGF mimic peptide. In some embodiments of this disclosure, the receptor ligand expressed by lung cells is a targeting ligand with affinity for receptors present on lung epithelial cells or lung epithelial cells.
[0522] In some embodiments of this disclosure, the targeting ligand is N-acetylgalactosamine or CMM.
[0523] In some embodiments of this disclosure, the targeting ligand can be directly attached to the 3' end of the dsRNA positive strand. In some embodiments of this disclosure, the targeting ligand can be attached to the 3' end of the dsRNA positive strand via a adapter.
[0524] In some embodiments of this disclosure, the targeting ligand can be directly attached to the 5' end of the dsRNA positive strand. In some embodiments of this disclosure, the targeting ligand can be attached to the 5' end of the dsRNA positive strand via a adapter.
[0525] In some embodiments, the dsRNA disclosed herein comprises, substantially comprises, or includes an antisense strand consisting of, a nucleotide sequence differing from any antisense strand selected from Table 1 by 0 or 1 nucleotide bases, wherein the dsRNA further comprises a sense strand that is at least partially complementary to the antisense strand; and wherein all or substantially all nucleotides on both the antisense strand and the sense strand are modified nucleotides, and the sense strand further comprises a targeting ligand covalently linked to the 5' end.
[0526] In some embodiments, the dsRNA disclosed herein comprises, substantially comprises, or includes an antisense strand consisting of, or substantially comprises, an antisense strand consisting of, or substantially comprises, an antisense strand consisting of, a nucleotide sequence differing from any antisense strand selected from Table 1 by 0 or 1 nucleobase, wherein the dsRNA further comprises a sense strand that is at least partially complementary to the antisense strand; wherein all or substantially all nucleotides on both the antisense strand and the sense strand are modified nucleotides; and wherein the sense strand further comprises an inverted debasement residue at the 3' or 5' end of the nucleotide sequence, and the sense strand further comprises a targeting ligand covalently linked to the 5' end.
[0527] In some embodiments, the dsRNA disclosed herein comprises, substantially comprises, or includes an antisense strand consisting of, or substantially comprises, an antisense strand consisting of, or substantially comprises, an antisense strand consisting of, a nucleotide sequence differing from any antisense strand selected from Table 1 by 0 or 1 nucleobase, wherein the dsRNA further comprises a sense strand that is at least partially complementary to the antisense strand; wherein all or substantially all nucleotides on both the antisense strand and the sense strand are modified nucleotides; and wherein the sense strand further comprises inverted debasement residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand further comprises a targeting ligand covalently linked to the 5' end.
[0528] In some embodiments, the dsRNA disclosed herein comprises, substantially comprises, or includes an antisense strand consisting of, a nucleotide sequence differing from any antisense strand selected from Table 1 by 0 or 1 nucleotide base, wherein the dsRNA further comprises a sense strand at least partially complementary to the antisense strand; wherein all or substantially all nucleotides on both the antisense strand and the sense strand are modified nucleotides; and wherein the sense strand further comprises an inverted debasement residue at the 3' or 5' end of the nucleotide sequence, and the sense strand further comprises a targeting ligand covalently linked to the 3' end. In some embodiments, the dsRNA disclosed herein comprises, substantially comprises, or includes an antisense strand consisting of, a nucleotide sequence differing from any antisense strand selected from Table 1 by 0 or 1 nucleotide base, wherein the dsRNA further comprises a sense strand at least partially complementary to the antisense strand; wherein all or substantially all nucleotides on both the antisense strand and the sense strand are modified nucleotides; and the sense strand further comprises a targeting ligand covalently linked to the 3' end.
[0529] In some embodiments, the dsRNA disclosed herein comprises, substantially comprises, or includes an antisense strand selected from any of the items in Table 1, wherein the dsRNA further comprises a sense strand that is at least partially complementary to the antisense strand; all or substantially all nucleotides on both the antisense strand and the sense strand are modified nucleotides; and wherein the sense strand further comprises inverted debase residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand further comprises a targeting ligand covalently linked to the 5' end.
[0530] In some embodiments, the dsRNA disclosed herein comprises, substantially comprises, or includes an antisense strand selected from any of the items in Table 1, wherein the dsRNA further comprises a sense strand that is at least partially complementary to the antisense strand; wherein all or substantially all nucleotides on both the antisense strand and the sense strand are modified nucleotides; and wherein the sense strand further comprises an inverted debasement residue at the 3' end of the nucleotide sequence, and the sense strand further comprises a targeting ligand covalently linked to the 5' end.
[0531] In some embodiments, the targeting ligand may include a cell receptor ligand, such as an integrin targeting ligand. Integrins are a family of transmembrane receptors that promote cell-extracellular matrix (ECM) adhesion. In particular, integrin α-v-β-6 (αvβ6) is an epithelial-specific integrin, known as a receptor for the TGF-β potential related peptide (LAP), and is expressed in a variety of cells and tissues. Integrin αvβ6 is known to be highly upregulated in damaged lung epithelium. In some embodiments, the dsRNA targeting RAGE described herein is attached to an integrin targeting ligand with affinity for integrin αvβ6. As referred to herein, an "αvβ6 integrin targeting ligand" is a compound with affinity for integrin αvβ6 that can be used as a ligand to facilitate the targeting and delivery of its attached dsRNA to desired cells and / or tissues (i.e., cells expressing integrin αvβ6). In some embodiments, multiple αvβ6 integrin-targeting ligands or clusters of αvβ6 integrin-targeting ligands are linked to dsRNA. In some embodiments, the dsRNA-αvβ6 integrin-targeting ligand conjugate is selectively internalized by lung epithelial cells via receptor-mediated endocytosis or by other means.
[0532] In some embodiments, the targeting ligand may be attached to a phosphate group, a 2'-hydroxyl group, or a base of a nucleotide. In some embodiments, the targeting ligand may also be attached to a 3'-hydroxyl group, in which case the nucleotides are linked by a 2',5'-phosphodiester bond. When the targeting ligand is attached to the end of the dsRNA chain, it is typically attached to a phosphate group of the nucleotide; when the targeting ligand is attached to the inner sequence of the dsRNA, it is typically attached to a ribose ring or a base, for example, via a phosphate ester bond or a thiophosphate ester bond.
[0533] Examples of targeting ligands that can be used to deliver dsRNA, including the αvβ6 integrin targeting ligand, are disclosed in, for example, International Patent Application Publication No. WO 2018 / 085415, U.S. Patent Application US16399073, International Patent Application Publication No. WO 2019 / 089765, U.S. Patent Application US16759610, International Patent Application Publication No. WO2019 / 210200, U.S. Patent Application US17078331, U.S. Patent Application US17050041, International Patent Application Publication No. WO2022 / 056286, and U.S. Patent Application US18181340, the contents of which are incorporated herein by reference in their entirety.
[0534] In some embodiments, the targeting ligand comprises an integrin targeting ligand.
[0535] In some embodiments, the targeting ligand comprises the following structure:
[0536] Or its pharmaceutically acceptable salt, or
[0537] Or its pharmaceutically acceptable salt.
[0538] Or its pharmaceutically acceptable salt, or
[0539] Or its pharmaceutically acceptable salt.
[0540] in, This indicates the site of connection with the dsRNA or adapter.
[0541] In some embodiments, the conjugated molecule has a structure selected from the following:
[0542] in, This indicates the site of connection with the dsRNA.
[0543] In some embodiments, the modified or unmodified dsRNA is coupled to the conjugate molecule according to the following schematic diagram:
[0544] in, X represents dsRNA, where X is O or S. In some preferred embodiments, X is O.
[0545] Alternatively, other linker groups known in the art may be used. In many cases, the linker groups are commercially available or alternatively incorporated into commercially available nucleotide phosphorylamides, see, for example, International Patent Application Publication No. WO 2019 / 161213, which is incorporated herein by reference in its entirety.
[0546] In some implementations, dsRNA targeting the RAGE gene is delivered without conjugation to a target ligand or conjugation molecule (referred to as "naked" or "naked dsRNA").
[0547] In some implementations, dsRNA targeting the RAGE gene is conjugated to a targeting ligand or conjugate molecule to facilitate dsRNA delivery to selected cells or tissues, such as epithelial cells in vivo.
[0548] In some embodiments, dsRNA may be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, or other delivery systems available in the art for nucleic acid delivery. dsRNA may also be chemically conjugated to targeting groups, lipids (including but not limited to cholesterol groups and cholesterol derivatives), encapsulated in nanoparticles, liposomes, micelles, conjugated to polymers or DPCs (see, for example, WO 2000 / 053722, WO 2008 / 022309, WO 2011 / 104169 and WO 2012 / 083185, WO2013 / 032829, WO 2013 / 158141, each incorporated herein by reference), via iontophoresis, or by incorporation into other delivery media or systems available in the art, such as hydrogels, cyclodextrins, biodegradable nanocapsules, bioadhesive microspheres, or protein carriers. In some embodiments, dsRNA may be conjugated to antibodies with affinity for lung epithelial cells. In some implementations, dsRNA may be linked to a targeting ligand that has affinity for lung epithelial cells or receptors present on lung epithelial cells.
[0549] This disclosure also provides dsRNA or conjugates thereof whose sense strands and antisense strands have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the full-length nucleotide sequences of the aforementioned sense strands and antisense strands, respectively, wherein the siRNA or conjugates thereof can effectively inhibit the expression of AGER or RAGE genes.
[0550] In some embodiments, the dsRNA conjugates disclosed herein comprise the conjugates shown in Table 12 below.
[0551] Table 12 Targeted Ligand Conjugates of Double-Stranded Compounds
[0552] The Tri-SM6.1-avβ6-(TA14) in Table 12 has the following structure:
[0553] in, This indicates the connection point with dsRNA (siRNA).
[0554] In Table 12, (L00)-avβ6-1.1-Tri has the following structure:
[0555] in, This indicates the connection point with dsRNA (siRNA).
[0556] In some embodiments, the dsRNA conjugates of this disclosure include one or more of the following conjugates: 01AC00002, 01AC00003, 01AC00004, 01AC00005, 01AC00006, 01AC00007, 01AC00009, 01AC00010, 01AC00011, 01AC00012, 01AC00013, 01A C00014, 01AC00015, 01AC00017, 01AC00018, 01AC00019, 01AC00020, 01AC00021, 01AC00024, 01AC00026, 01AC00027, 01AC00028, 01AC00029, 01AC00030, 01AC00032, and 01AC00033.
[0557] III. The dsRNA pharmaceutical composition disclosed herein
[0558] This disclosure also provides a pharmaceutical composition comprising, as an active ingredient and a pharmaceutically acceptable carrier, the dsRNA, dsRNA conjugate or a pharmaceutically acceptable salt thereof, or a pharmaceutically acceptable salt thereof as described in any embodiment of this disclosure.
[0559] In some embodiments of this disclosure, the pharmaceutical composition contains one dsRNA (including modified or unmodified dsRNA or dsRNA conjugates) as described in any embodiment of this disclosure, or a pharmaceutically acceptable salt thereof. In other embodiments of this disclosure, the pharmaceutical composition contains at least two dsRNAs or dsRNA conjugates (including, but not limited to, two, three, four, five, six, seven, eight, nine, ten, or more) as described in any embodiment of this disclosure, or pharmaceutically acceptable salts thereof, as active ingredients. In some embodiments of this disclosure, the at least two dsRNAs or dsRNA conjugates or pharmaceutically acceptable salts thereof as described in any embodiment of this disclosure each target different target sequences in the AGER or RAGE gene, thereby expecting a synergistic effect from acting simultaneously on different target sequences. Here, "different target sequences" means that there is no overlap between target sequences or that the number of overlapping consecutive nucleotides between target sequences is less than 5 (e.g., the number of overlapping consecutive nucleotides is 4, 3, 2, 1, or 0). In this case, the at least two dsRNAs or dsRNA conjugates or their pharmaceutically acceptable salts as described in any embodiment of this disclosure may be present in any different proportions. In some embodiments of this disclosure, the at least two dsRNAs or dsRNA conjugates or their pharmaceutically acceptable salts as described herein as in the first aspect may be present in a molar ratio of 1:100 to 100:1. In some embodiments of this disclosure, the at least two dsRNAs or dsRNA conjugates or their pharmaceutically acceptable salts as described herein as in the first aspect may be present in a molar ratio of 1:70 to 70:1. In some embodiments of this disclosure, the at least two dsRNAs as described herein as in the first aspect or dsRNA conjugates or their pharmaceutically acceptable salts as described herein as in the second aspect may be present in a molar ratio of 1:50 to 50:1. In some embodiments of this disclosure, the at least two dsRNAs as described herein as in the first aspect or dsRNA conjugates as described herein as in the second aspect may be present in a molar ratio of 1:10 to 10:1. In some embodiments of this disclosure, the at least two dsRNAs as described herein in the first aspect or dsRNA conjugates as described in the second aspect, or their pharmaceutically acceptable salts, may be present in a molar ratio of 1:5 to 5:1. In some embodiments of this disclosure, the at least two dsRNAs as described herein in the first aspect or dsRNA conjugates as described in the second aspect, or their pharmaceutically acceptable salts, may be present in a molar ratio of 1:2 to 2:1. In some embodiments of this disclosure, the at least two dsRNAs as described herein in the first aspect or dsRNA conjugates as described in the second aspect, or their pharmaceutically acceptable salts, may be present in a molar ratio of 1:1.
[0560] Pharmaceutically acceptable carriers are substances other than the active pharmaceutical ingredient (API, therapeutic product, such as RAGE RNAi agent) intentionally included in a drug delivery system. The carrier does not exert or is not intended to exert a therapeutic effect at the intended dose. The carrier may act to: a) facilitate the processing of the drug delivery system during manufacturing, b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the API, c) facilitate product identification, and / or d) enhance any other property of the overall safety and efficacy of the API during storage or use. Pharmaceutically acceptable carriers may or may not be inert substances.
[0561] In some embodiments of this disclosure, the pharmaceutically acceptable carrier may include, but is not limited to, magnetic nanoparticles (such as Fe3O4, Fe2O3), gold nanoparticles, quantum dots, silica nanoparticles, carbon nanotubes, mesoporous silica, calcium phosphate nanoparticles, polyethyleneimine, polyamide-amine dendritic polymers, poly-L-lysine, chitosan, poly-D- or L-type lactic acid / glycolic acid copolymers, poly(2-aminoethyl ethylene phosphate), and one or more of their derivatives. There are no particular requirements regarding the content of the pharmaceutically acceptable carrier in the pharmaceutical compositions of this disclosure. In some embodiments of this disclosure, the ratio of the total weight of dsRNA contained in the pharmaceutical composition to the total weight of the pharmaceutically acceptable carrier may be 1:(1-500). In some embodiments of this disclosure, the ratio of the total weight of dsRNA contained in the pharmaceutical composition to the total weight of the pharmaceutically acceptable carrier may be 1:(1-300). In some embodiments of this disclosure, the ratio of the total weight of dsRNA contained in the pharmaceutical composition to the total weight of the pharmaceutically acceptable carrier may be 1:(1-100). In some embodiments of this disclosure, the ratio of the total weight of dsRNA or dsRNA conjugate contained in the pharmaceutical composition to the total weight of a pharmaceutically acceptable carrier may be 1:(1-50).
[0562] In some embodiments of this disclosure, the pharmaceutical composition may further comprise a cationic component to assist in vivo drug delivery. In some embodiments of this disclosure, the cationic component may include, but is not limited to, at least one of positively charged peptides or proteins, cationic lipids, positively charged polymers, and cationic nanoemulsions (e.g., formed by mixing DOTAP with squalene, sorbitan trioleate, and polysorbate 80 in a citrate buffer at pH 6.5). In some embodiments of this disclosure, the positively charged peptide or protein may include at least one of oligo-arginine, oligo-lysine, and protamine. In some embodiments of this disclosure, the cationic lipid may be selected from at least one of dimethyl di(octadecyl)ammonium bromide (DDAB), 1,2-dimyristoyl-3-trimethylammonium propane, and 1,2-dioleoyl-3-trimethylammonium propane (DOTAP). In some embodiments of this disclosure, the positively charged polymer may be selected from at least one of poly-L-lysine, poly-L-arginine, and polyethyleneimine.
[0563] For the same purpose, the pharmaceutical composition may further comprise a non-cationic component. The non-cationic component may include, but is not limited to, at least one of neutral membrane-fused lipids, anionic lipids, and amphiphilic polymers. In some embodiments of this disclosure, the membrane-fused lipid may include at least one of dioleoylphosphatidylethanolamine, dioleoylphosphatidylcholine, and transphosphatidylethanolamine. By adding the above-mentioned membrane-fused lipids to the pharmaceutical composition of this disclosure, the transport and delivery efficiency of the pharmaceutical composition in mammals can be further improved. In some embodiments of this disclosure, the amphiphilic polymer may include at least one of polyethylene glycol-polylactic acid diblock copolymer, polyethylene glycol-polylactic acid triblock copolymer, and polyethylene glycol-poly(lactic acid-glycolic acid) diblock copolymer.
[0564] In some embodiments of this disclosure, the pharmaceutical composition may further comprise other pharmaceutically acceptable excipients. In some embodiments of this disclosure, the other pharmaceutically acceptable excipients may include at least one of a pH buffer, a protective agent, and an osmotic pressure regulator. In some embodiments of this disclosure, the pH buffer may be one or both of a tris(hydroxymethyl)aminomethane hydrochloride buffer with a pH of 7.5-8.5 and a phosphate buffer with a pH of 5.5-8.5. In some embodiments of this disclosure, the pH buffer may be a phosphate buffer with a pH of 5.5-8.5. In some embodiments of this disclosure, the protective agent may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose, and glucose. In some embodiments of this disclosure, the protective agent may constitute 0.01%-30% of the total weight of the pharmaceutical composition. In some embodiments of this disclosure, the protective agent may constitute 0.1%-25% of the total weight of the pharmaceutical composition. In some embodiments of this disclosure, the protective agent may comprise 1%-20% of the total weight of the pharmaceutical composition. In some embodiments of this disclosure, the protective agent may comprise 5%-15% of the total weight of the pharmaceutical composition. In some embodiments of this disclosure, the protective agent may comprise 10%-12% of the total weight of the pharmaceutical composition. In some embodiments of this disclosure, the osmotic pressure regulator may be one or both of sodium chloride and potassium chloride. In some embodiments of this disclosure, the content of the osmotic pressure regulator results in an osmotic pressure of 200-700 mOsmol / kg of the pharmaceutical composition. In some embodiments of this disclosure, the content of the osmotic pressure regulator results in an osmotic pressure of 300-600 mOsmol / kg of the pharmaceutical composition. In some embodiments of this disclosure, the content of the osmotic pressure regulator results in an osmotic pressure of 400-500 mOsmol / kg of the pharmaceutical composition. The content of the osmotic pressure regulator can be readily determined by those skilled in the art based on the desired osmotic pressure.
[0565] In some embodiments of this disclosure, the pharmaceutical composition may be a liquid formulation, such as an injection. In some embodiments of this disclosure, the pharmaceutical composition may also be a lyophilized powder for injection, which is mixed with liquid excipients to form a liquid formulation for administration. In some embodiments of this disclosure, the liquid formulation may be for subcutaneous, intramuscular, or intravenous administration. In some embodiments of this disclosure, the liquid formulation may be for administration via a spray to the lungs, or via a spray to other organs or tissues (such as the liver). In some embodiments of this disclosure, the pharmaceutical composition is for intravenous administration.
[0566] In some embodiments, the pharmaceutical compositions described herein are administered by inhalation (e.g., dry powder inhalation or aerosol inhalation), intranasal administration, intratracheal administration, or oropharyngeal aspiration.
[0567] IV. The reagent kit disclosed herein
[0568] The kit disclosed herein contains at least one of the dsRNAs (including modified or unmodified dsRNAs, dsRNA conjugates) as described in any embodiment of this disclosure, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition. Where multiple dsRNAs are present, each dsRNA may exist individually or in a mixture of two or more.
[0569] In some embodiments of this disclosure, in addition to the dsRNA, dsRNA conjugate or its pharmaceutically acceptable salt, or pharmaceutical composition, the kit may also contain components necessary or beneficial for achieving one or more specific applications of this disclosure, including but not limited to: (1) one or more components for achieving the desired cell transfection; (2) one or more components for achieving the diagnosis, treatment or prevention of a specific disease, such as one or more additional therapeutic compounds or compositions, one or more diagnostic reagents; (3) one or more buffers; (4) positive or negative control samples; and (5) at least one of excipients, stabilizers or preservatives. In some embodiments of this disclosure, the kit may also include instructions for use.
[0570] In some embodiments of this disclosure, the components used to achieve the desired cell transfection include viruses (such as adenovirus, lentivirus, adeno-associated virus, retrovirus, herpes simplex virus) or virus-like particles (VLPs).
[0571] In some embodiments of this disclosure, the dsRNA, dsRNA conjugates, or pharmaceutical compositions in the kit may be provided in any form, such as liquid, dry, or lyophilized. In some embodiments of this disclosure, the dsRNA, dsRNA conjugates, or pharmaceutical compositions in the kit are substantially pure and / or sterile.
[0572] V. Use of the disclosed dsRNA (including modified or unmodified dsRNA), dsRNA conjugates, or pharmaceutically acceptable salts thereof, and pharmaceutical compositions.
[0573] By administering at least one of the dsRNA, dsRNA conjugates, or pharmaceutically acceptable salts thereof, and pharmaceutical compositions thereof (e.g., in a therapeutically effective amount) to a subject in need, the expression level of the AGER or RAGE gene can be effectively reduced in the subject, thereby potentially enabling its use in the prevention and / or treatment of symptoms and diseases including, but not limited to, the following in said subjects: various lung diseases (asthma, acute respiratory distress syndrome, idiopathic pulmonary fibrosis, chronic obstructive pulmonary disease, cystic fibrosis, pneumonia, lung cancer, bronchopulmonary dysplasia), cardiovascular diseases (atherosclerosis, myocardial infarction, heart failure, peripheral vascular disease), cancer, diabetes, chronic kidney disease, neurodegenerative diseases, rheumatoid arthritis, non-alcoholic steatohepatitis, inflammatory damage caused by certain viral infections including SARS-CoV-2, certain ocular inflammatory conditions, and skeletal muscle atrophy.
[0574] In another aspect, this disclosure is characterized by compositions, including pharmaceutical compositions comprising one or more of the disclosed modified or unmodified dsRNAs or their modifications or pharmaceutically acceptable salts and conjugates capable of selectively and effectively reducing AGER gene expression. Compositions comprising one or more of the dsRNAs described herein, or their pharmaceutically acceptable salts or their modifications and conjugates, may be administered to subjects, such as human or animal subjects, for the treatment (including prophylactic treatment or inhibition) of symptoms and diseases associated with RAGE receptor activity.
[0575] In another aspect, this disclosure is characterized by a method for delivering dsRNA or a pharmaceutically acceptable salt thereof, or modifications thereof and conjugates thereof, to lung epithelial cells of a subject (e.g., a mammal) in vivo. Compositions for such methods are also described herein. In some embodiments, this disclosure discloses a method for delivering dsRNA or a pharmaceutically acceptable salt thereof, or modifications thereof and conjugates thereof, to lung cells (including epithelial cells, macrophages, smooth muscle cells, endothelial cells, and preferably type 1 alveolar epithelial cells) of a subject in vivo. In some embodiments, the subject is a human subject.
[0576] In some implementations, abnormal RAGE expression refers to a significant increase in RAGE expression levels in a subject, such as at lesion sites, compared to RAGE expression levels in healthy subjects, to a degree that indicates the occurrence of disease, causes disease, or presents a risk of disease.
[0577] Upon delivery to cells expressing RAGE, such as lung cells (including, more specifically, type 1 alveolar epithelial cells), the dsRNA described herein, or its pharmaceutically acceptable salts or modifications and conjugates thereof, inhibit the expression of one or more AGER genes in vivo and / or in vitro.
[0578] The methods disclosed herein include administering one or more dsRNAs or their pharmaceutically acceptable salts or modifications and conjugates to a subject, such as a human or animal subject, using any suitable means known in the art. The pharmaceutical compositions disclosed herein comprising one or more dsRNAs or their modifications and conjugates can be administered in a variety of ways, depending on whether local or systemic therapy is desired. Administration may be, but is not limited to, intravenous, intra-arterial, subcutaneous, intraperitoneal, subdermal (e.g., via an implanted device), and intraparenchymal administration. In some embodiments, the pharmaceutical compositions described herein are administered by inhalation (e.g., dry powder inhalation or aerosol inhalation), intranasal administration, intratracheal administration, or oropharyngeal aspiration.
[0579] In some implementations, it is desired that the dsRNA described herein, or a pharmaceutically acceptable salt thereof, or modifications and conjugates thereof, inhibit AGER gene expression in the lung epithelium, for administration by inhalation (e.g., via an inhaler device such as a metered inhaler, or a nebulizer such as a jet or vibrating sieve nebulizer, or a soft mist inhaler).
[0580] One or more dsRNAs, or pharmaceutically acceptable salts thereof, or modifications and conjugates thereof, can be delivered to target cells or tissues using any oligonucleotide delivery technology known in the art. In some embodiments, dsRNAs, or pharmaceutically acceptable salts thereof, or modifications and conjugates thereof, are delivered to cells or tissues by covalently linking the dsRNAs, or modifications and conjugates thereof, to a targeting group. In some embodiments, the targeting group may include a cell receptor ligand, such as an integrin targeting ligand. Integrins are a family of transmembrane receptors that promote cell-extracellular matrix (ECM) adhesion. In particular, integrin α-v-β-6 (αvβ6) is an epithelial-specific integrin known as a receptor for ECM proteins and the TGF-β potential related peptide (LAP), and is expressed in a variety of cells and tissues.
[0581] Examples of targeting ligands that can be used to deliver RAGE RNAi agents, including αvβ6 integrin targeting ligands, are disclosed, for example, in International Patent Application Publication No. WO 2018 / 085415 and International Patent Application Publication No. WO 2019 / 089765, the contents of which are incorporated herein by reference in their entirety.
[0582] The use of dsRNA, or pharmaceutically acceptable salts thereof, or modifications and conjugates thereof, provides a method for the therapeutic (including prophylactic) treatment of diseases or disorders in which reduced RAGE receptor activity can provide therapeutic benefits. The dsRNA, or pharmaceutically acceptable salts thereof, or modifications and conjugates thereof disclosed herein can be used to treat a variety of respiratory diseases, including lung diseases (asthma, acute respiratory distress syndrome, idiopathic pulmonary fibrosis, chronic obstructive pulmonary disease, cystic fibrosis, pneumonia, lung cancer, bronchopulmonary dysplasia), cardiovascular diseases (atherosclerosis, myocardial infarction, heart failure, peripheral vascular disease), cancer, diabetes, chronic kidney disease, neurodegenerative diseases, rheumatoid arthritis, non-alcoholic steatohepatitis, damage caused by certain viral infections including SARS-CoV-2, certain inflammatory eye conditions, and skeletal muscle atrophy. In some embodiments, the dsRNA, or pharmaceutically acceptable salts thereof, or modifications and conjugates thereof disclosed herein can be used to treat inflammatory lung diseases or conditions. dsRNA, or pharmaceutically acceptable salts thereof, or modifications and conjugates thereof, can be further used to treat, for example, various inflammatory eye diseases and disorders. Such treatments involve administering dsRNA or its pharmaceutically acceptable salts or modifications and conjugates thereof to humans or animals with elevated or enhanced RAGE receptor levels or RAGE receptor activity exceeding desired levels.
[0583] As used herein, the term "administration" refers to the placement of dsRNA or a pharmaceutically acceptable salt thereof into a subject by means of a method or route that at least partially targets a desired site to produce a desired effect. Routes of administration suitable for the methods of this disclosure include local administration and systemic administration. Generally, local administration results in the delivery of more dsRNA or a pharmaceutically acceptable salt thereof to a specific site compared to the subject's entire body; systemic administration results in the delivery of said dsRNA or a pharmaceutically acceptable salt thereof to substantially the entire body of the subject.
[0584] The drug can be administered to the subject via any suitable route known in the art. In some embodiments of this disclosure, the routes include, but are not limited to, oral or parenteral routes, including at least one of intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), pulmonary, nasal, rectal, and local administration (including oral and sublingual administration). In some embodiments of this disclosure, the frequency of administration may be once or more daily, weekly, monthly, or annually. The dosage of the dsRNA or its pharmaceutically acceptable salt described herein can be determined based on various parameters, particularly the subject's age, weight, and sex. Toxicity and efficacy can be determined in cell culture or laboratory animals using standard pharmaceutical procedures, such as determining LD50. 50 (The dose that would cause death in 50% of the population) and ED 50 (In quantitative responses, the dose that elicits 50% of the maximum response intensity; in qualitative responses, the dose that elicits a positive response in 50% of the test subjects.) The dose ratio between toxicity and efficacy is the therapeutic index, which can be expressed as the LD50. 50 / ED 50 The ratio is used to express the therapeutic index. Preferably, it is a dsRNA exhibiting a high therapeutic index or a pharmaceutically acceptable salt, dsRNA conjugate, or pharmaceutical composition thereof. The “therapeutic effective amount” or “therapeutic effective dose” of the dsRNA described herein can be determined based on disease severity, patient condition, age, sex, weight, etc., and can be derived from data obtained from cell culture analysis and animal studies, within the capabilities of those skilled in the art.
[0585] In some embodiments of this disclosure, the dsRNA of this disclosure or its pharmaceutically acceptable salts, dsRNA conjugates, and / or pharmaceutical compositions are used as a single active ingredient for the prevention and / or treatment of a disease. In some embodiments of this disclosure, the dsRNA of this disclosure or its pharmaceutically acceptable salts, dsRNA conjugates, and / or pharmaceutical compositions are used in combination with other active ingredients for the prevention and / or treatment of a disease.
[0586] Those skilled in the art will understand that the above description of this disclosure is exemplary, and the embodiments disclosed herein can be readily modified into other specific forms without altering the technical spirit or essential characteristics of this disclosure. Therefore, it should be understood that the embodiments described above are exemplary in all respects and not restrictive.
[0587] Unless otherwise specified, singular terms encompass plural terms, and plural terms encompass singular terms. Unless otherwise specified, the words "a" or "an" may encompass "at least one" or "at least one". Unless otherwise specified, the use of "or" means "and / or".
[0588] For purposes of description and disclosure, all patents, patent applications, and other identified publications are expressly incorporated herein by reference. These publications are provided solely because their publication predates the filing date of this application. All statements regarding the dates of these documents or representations of their contents are based on information available to the applicant and do not constitute any acknowledgment of the accuracy of the dates or contents of these documents. Furthermore, in any country, any reference to these publications herein does not constitute an endorsement that such publication is part of the general knowledge in the art.
[0589] Example
[0590] In the following description, exemplary embodiments will be provided to aid in understanding this disclosure. However, the following embodiments are provided merely for the purpose of facilitating understanding of this disclosure and are not intended to limit its scope. Unless otherwise specified, the materials, instruments, and reagents used in the embodiments are commercially available or can be prepared according to conventional knowledge in the art. The nucleic acid electrophoresis, real-time PCR, and other operations used are performed according to conventional protocols, for example, as described in Molecular Cloning (Cold Spring Harbor Laboratory Press (1989)).
[0591] Example 1: Synthesis of siRNA and its conjugates
[0592] 1.1 Synthesis of siRNA
[0593] The siRNAs used in this embodiment can all be commercially available or synthesized. The specific synthesis method is as follows.
[0594] For the sense and antisense strands of the siRNA duplex disclosed herein, deprotection, coupling, capping, and sequence synthesis were performed on an oligonucleotide high-throughput synthesizer. The phosphoramide monomer was used at a concentration of 0.05 M, and the activator was 0.3 M BTT.
[0595] Using standard CPG as a solid support, universal CPG was used for both the sense and antisense strands of the modified double strand. For siRNAs with ligands coupled to the 3' end of the sense strand, chain extension was performed by ligand extension using the standard phosphorus amide method after linking the target ligand or a linker structure (such as phthalamide (aminohexanol (ODMTr)) monomer) to a long-chain amino CPG vector. For siRNAs with ligands coupled to the 5' end of the sense strand, ligand phosphorus amide or a linker structure (such as CF3CONHCH2CH2CH2CH2CH2CH2ODMTr) was prepared and used in the final coupling reaction.
[0596] The synthesized sequences were cleaved and deprotected using a 1:1 mixture of ammonia and methylamine ethanol, followed by removal of the 2'-protecting group using triethylamine trifluoride. Sequences containing complete 2'-position modifications required ammonia hydrolysis. The cleaved and deprotected sequences were precipitated using an acetone-ethanol mixture (80:20 v / v) and dissolved in RNase-free water. Sequence accuracy was determined by LC-MS, quantification by spectrophotometry, and purity by HPLC.
[0597] After HPLC purification, lyophilization and quality control, the salt was replaced by sodium acetate alcohol precipitation, and desalted using a 3KD ultrafiltration tube. After desalting, the sense and antisense strands were quantitatively determined by spectrophotometer. The sense and antisense strands were mixed in a 1:1 molar ratio and annealed to form the siRNA duplex of this disclosure (including the duplexes and modified duplexes shown in Tables 1 and 3-4).
[0598] 1.2 Synthesis of siRNA duplex conjugates
[0599] Exemplary conjugates used in the experiments of this disclosure include Tri-SM6.1-avβ6-(TA14) and (L00)-avβ6-1.1-Tri; the synthesis method of Tri-SM6.1-avβ6-(TA14) is shown in 1.2.1 below, and the synthesis method of (L00)-avβ6-1.1-Tri is shown in 1.2.2 below.
[0600] 1.2.1 Synthesis method of conjugate 1
[0601] The targeting ligand (including SM6.1) and the linker portion (including the triyne linker) and their conjugation with siRNA were performed based on the methods disclosed in Example 1 of International Patent Application Publication No. WO2022 / 216920 and Example 1 of International Patent Application Publication No. WO2023 / 183814, to obtain the conjugate of the siRNA duplex in Example 1.1 (the contents of which are incorporated herein by reference in their entirety).
[0602] Exemplary conjugates used in the experiment include:
[0603] Chain of Justice:
[0604] 5'-Tri-SM6.1-avβ6-(TA14)(inVAb)*(mC)(mC)(mC)(mG)(mU)(mC)(mC)(mC)( fA)(fC)(fC)(mU)(mU)(mC)(mU)(mC)(mC)(mU)(mG)(mU)(mA)*(inVAb)-3'(SEQ ID NO:2063);
[0605] antisense chain:
[0606] 5'-((E)-VP-mU)*(fA)*(mC)*(fA)(mG)(fG)(mA)(fG)(mA)(fA)(mG)(fG)(mU)(fG)(mG)(fG)(mA)(fC)(mG)(fG)*(mG)-3' (SEQ ID NO: 956).
[0607] The molecular formula of Tri-SM6.1-avβ6-(TA14) is:
[0608] in, This indicates the junction point with siRNA.
[0609] 1.2.2 Synthesis method of conjugate 2
[0610] (1) Synthesis of binder
[0611] The synthesis of 3-{6-[2-(2-propynoxyethoxy)acetamyl]-1,4-bis[2-(2-propynoxyethoxy)acetyl]-1,4-diazacycloheptane-6-yl}propionic acid is shown below.
[0612] Compound 1 (2-nitroethanol) (50.0 g, 549 mmol, 38.7 mL, 1.0 eq) was reacted with formaldehyde (49.46 g, 1.65 mol, 45.37 mL, 3.0 eq), compound 1a (198 g, 549 mmol, 1.0 eq), and toluene (400 mL) in ethanol (400 mL). The mixture was heated to 100 °C and reacted for 16 h. The reaction was monitored by TLC (Hex:EA = 3:1). The mixture was concentrated under reduced pressure, diluted with water, extracted with ethyl acetate, and the combined organic phases were washed with an aqueous sodium chloride solution. After drying, the mixture was washed with ethyl acetate, concentrated under reduced pressure, and purified on a silica gel column using a Hex / EA ratio of 100:0 to 70:30. This yielded a yellow oily compound 2 (84.0 g). LCMS: Calculated values [M+H] + 355.19, measured value 356.1.
[0613] Compound 2 (21.0 g, 51.4 mmol, 1.0 eq) and t-BuOK (6.92 g, 61.7 mmol, 1.2 eq) were added to THF (360 mL). After reacting for 10 min, compound 2a (13.2 g, 103 mmol, 14.9 mL, 2.0 eq in THF (130 mL)) was added to the mixture, and the reaction was allowed to proceed at room temperature for 15 h. The reaction was monitored by TLC (Hex:EA = 5:1). The product was purified by a Hex:EA gradient on a silica gel column to give compound 3 (22.0 g) as a white solid. LCMS: Calculated [M+H] + 453.26, measured value 454.3.
[0614] Compound 3 (22.0 g, 48.5 mmol, 1.0 eq) was mixed with ethanol (220 mL), and a catalyst was added. The mixture was stirred at 25 °C for 16 h under hydrogen atmosphere. After filtration and concentration under reduced pressure, the crude product was purified on a silica gel column using a 10 mM ammonium bicarbonate aqueous solution: ACN = 20%-50% gradient. A pale yellow oily compound 3A (18.0 g) was obtained. LCMS: Calculated [M+H] + 423.29, measured value 424.3.
[0615] Compound 3A (9.00 g, 21.2 mmol, 1.0 eq) was mixed with Pd / C (4.52 g, 10%) under a nitrogen atmosphere, and 1,1,1,3,3,3-hexafluoropropane-2-ol (130 mL) was added. The mixture was heated to 45 °C and reacted under a hydrogen atmosphere for 16 h. The mixture was filtered, concentrated, and lyophilized to give a pale yellow oil – compound 4 (8.5 g). LCMS: Calculated [M+H] + 243.19, measured value 244.2.
[0616] Compound 4 (4.00 g, 16.4 mmol, 1 eq), obtained by concentration, was mixed with DMF (40 mL), DIEA (7.65 g, 59.2 mmol, 10.3 mL, 3.6 eq), 2-(2-(prop-2-alkynyloxy)ethoxy)acetic acid (9.36 g, 59.2 mmol, 3.6 eq), and HATU (22.5 g, 59.2 mmol, 3.6 eq) and stirred at room temperature for 16 h. The reaction mixture was diluted with water, extracted with ethyl acetate, washed with sodium chloride solution, dried, filtered, and washed again with ethyl acetate. The filtrate was concentrated under reduced pressure. The concentrate was purified on a preparative column using a 10 mM ammonium bicarbonate aqueous solution: ACN = 20%–60% gradient. Compound 5 (4.20 g) was obtained as a pale yellow oil. LCMS: Calculated values [M+H] +663.34, measured value 664.4.
[0617] Compound 5 (4.20 g, 6.33 mmol, 1.0 eq) was mixed with DCM (42 mL) and TFA (14.4 g, 126 mmol, 9.4 mL, 20 eq), and the mixture was stirred at 25 °C for 16 h. After the reaction, the mixture was concentrated under reduced pressure, and the product was purified on a preparative column using a gradient of 0.1% trifluoroacetic acid aqueous solution: ACN = 20%-50%. This yielded a pale yellow solid, compound 6 (2.60 g). LCMS: Calculated values [M+H] + 607.27, (calculated value / measured value) 608.3; 1 HNMR(400MHz,METHANOL-d4)δ=8.00-7.81(m,1H),4.31-4.07(m,11H),4.02-3.91(m,3H),3.7 6-3.66(m,15H),3.51-3.39(m,1H),3.32-3.28(m,1H),2.89-2.84(m,3H),2.59-2.25(m,4H).
[0618] (2) Ligand synthesis
[0619] The ligand used in this embodiment is αvβ6 integrin ligand II. The synthesis method of αvβ6 integrin ligand II is as follows:
[0620] Synthesis of 3-(6-(4-((14-azido-3,6,9,12-tetraoxotetradecyl)oxy)naphth-1-yl)pyridin-3-yl)-3-(2-(4-((4-methylpyridin-2-yl)amino)butamido)acetamido)propionic acid.
[0621] Compound 1 (2-bromo-5-cyanopyridine) (6.07 g, 32.8 mmol, 1.0 eq) and compound 2 (potassium monoethyl malonate) (8.66 g, 49.3 mmol, 1.5 eq) were mixed in a flask, sealed, and the air in the flask was purged with nitrogen (repeated three times). DCE (40 mL), ZnCl2 (33 mL, 0.5 M dissolved in THF, 0.5 eq), and DIEA (0.6 mL, 3.3 mmol, 0.1 eq) were added, and the mixture was heated to 95 °C for 12 hs. The reaction was monitored by TLC (Hex:EA = 10:1). After removing THF, DCM and saturated brine were added, and the precipitated solid was filtered. The filtrate was extracted with DCM (30 mL) three times, and the organic phases were combined. The organic phase was purified on a silica gel column using Hex:EA ratios from 80:1 to 20:1 to obtain compound 3. LCMS: Calculated values [M+H] +271.11, measured value 273.0.
[0622] Compound 3 ((E)-3-amino-3-(6-bromopyridin-3-yl)ethyl acrylate) (7.10 g, 26.3 mmol, 1.0 eq) was mixed with (Boc)₂O (14.59 g, 65.7 mmol, 2.5 eq), TEA (5.77 g, 55.2 mmol, 2.0 eq), and DMAP (0.67 g, 5.3 mmol, 0.2 eq), and DCM (30 mL, 4.2 V) was added. The mixture was reacted at room temperature for 12 hours. The reaction was monitored by TLC (Hex:EA = 10:1). The product was purified on a silica gel column using Hex:EA ratios from 50:1 to 10:1 to give compound 4. LCMS: Calculated values [M+H] + 471.35, measured value 471.3.
[0623] Compound 4 ((E)-3-bis(tert-butoxycarbonyl)amino-3-(6-bromopyridin-3-yl)ethyl acrylate) (2.09 g, 4.2 mmol, 1.0 eq) was mixed with compound 5 ((4-methoxy-1-naphthyl)boronic acid) (1.31 g, 6.4 mmol, 1.5 eq), K3PO4 (1.86 g, 8.4 mmol, 2.0 eq), and Pd(pph3)2Cl2 (0.16 g, 0.2 mmol, 0.04 eq), purged three times with nitrogen, and then deoxygenated THF / water at a ratio of 4:1 (40 mL, 20 V). The mixture was heated to 60 °C and maintained for 6 hours. The reaction was monitored by TLC (Hex:EA = 5:1). 1.00 g of activated carbon was added to the mixture at room temperature and stirred for 1 h. After filtration, water (40 mL) was added, and the mixture was extracted with EA (40 mL). The extraction was repeated three times. The organic phases were combined and purified on a silica gel column using Hex:EA ratios of 50:1 to 10:1 to obtain compound 6. LCMS: Calculated value [M+H] + 548.64, measured value 549.5.
[0624] Compound 6 ((E)-3-bis(tert-butoxycarbonyl)amino-3-(6-(4-methoxynaphth-1-yl)pyridin-3-yl)ethyl acrylate) (2.02 g, 4.2 mmol, 1.0 eq) was mixed with Pd / C (1.00 g, 50% w / w) in a flask. MeOH (20 mL, 10.0 V) was added, and the flask was sealed. The air in the flask was replaced with H₂ (repeated three times), and the mixture was heated to 50 °C and held for 12 hs. The reaction was monitored by TLC (Hex:EA = 5:1). The mixture was filtered and concentrated to give compound 7. LCMS: Calculated values [M+H] +550.65, measured value 551.5.
[0625] The concentrated compound 7 (ethyl 3-bis(tert-butoxycarbonyl)amino-3-(6-(4-methoxynaphth-1-yl)pyridin-3-yl)propionate) was stirred with DCM (5 mL, 2.5 V) and TFA (10 mL, 5.0 V) at room temperature for 1 h. The reaction was monitored by TLC (Hex:EA = 1:1). The mixture was concentrated and purified by silica gel column chromatography with Hex:EA = 50:1 to pure EA to give compound 8. LCMS: Calculated values [M+H] + 350.42, measured value 351.3; 1 H NMR (400MHz, DMSO) δ8.83(d,J=2.1Hz,1H),8.49(s,2H),8.27(dd,J=6.5,3.4Hz,1H),8.09(ddd,J=10.6,6.8,2.2Hz,2H),7.75(d,J=8.2Hz,1H ),7.61–7.52(m,3H),7.10(d,J=8.1Hz,1H),4.82(s,1H),4.09(tt,J=7.1,3.6Hz,2H),4.04(s,3H),3.19–3.08(m,2H),1.14(t,J=7.1Hz,3H).
[0626] Compound 8 (ethyl 3-amino-3-[6-(4-methoxynaphth-1-yl)pyridin-3-yl]propionate) (0.1 g, 0.3 mmol, 1.0 eq) was placed in a sealed flask, and the air in the flask was purged with nitrogen (repeated three times). Anhydrous DCM (5 mL, 50 V) was added to the flask, and the mixture was cooled to -78 °C with liquid nitrogen. Then, a solution of BBr3 in dichloromethane (0.9 mL, 1 M, 3 eq) was added, and the mixture was heated to room temperature and held for 3 hours. The reaction was monitored by TLC (DCM:MeOH = 10:1). The reaction was quenched with methanol to remove the solvent, and the product was dissolved in methanol and the solvent was removed again (repeated twice). The product was purified on a silica gel column using DCM:MeOH ratios from 50:1 to 20:1 to give compound 9. LCMS: Calculated values [M+H] + 336.39, (calculated value / measured value) 337.2.
[0627] Compound 10 (4-[(tert-Butoxycarbonyl)(4-methylpyridin-2-yl)amino]butyrylglycine) (0.08 g, 0.24 mmol, 1.0 eq) was mixed with EDCI (0.06 g, 0.26 mmol, 1.1 eq) and compound 11 (pentafluorophenol) (0.07 g, 0.26 mmol, 1.1 eq), and DCM (5 mL) was added. The mixture was reacted for 1 h. Saturated sodium bicarbonate solution was added to the mixture, and DCM (15 mL) was added for extraction (repeated three times). The organic phases were combined. After concentrating the organic phase, compound 9 (ethyl 3-amino-3-[6-(4-hydroxynaphthyl-1-yl)pyridin-3-yl]propionate) (0.08 g, 0.24 mmol, 1.0 eq) was added, along with two drops of DIEA. The mixture was reacted at room temperature for 2 h s. The reaction was monitored by TLC (DCM:MeOH = 10:1). The product was purified on a silica gel column using DCM:MeOH at ratios of 50:1 to 20:1 to give compound 12. LCMS: Calculated values [M+H] + 669.78, measured value 670.7.
[0628] Compound 12 (ethyl 14-[6-(4-hydroxynaphthyl-1-yl)pyridin-3-yl]-2,2-dimethyl-5-(4-methylpyridin-2-yl)-4,9,12-trioxo-3-oxa-5,10,13-triazahexadecane-16-oate) (0.115 g, 0.17 mmol, 1.0 eq) was mixed with compound 13 (14-azido-3,6,9,12-tetraoxotetradecyl-4-methylbenzenesulfonate) (0.090 g, 0.19 mmol, 1.1 eq) and Cs₂CO₃ (0.120 g, 0.34 mmol, 2.0 eq), and THF (10 mL, 87 V) was added. The mixture was heated to 50 °C and maintained for 2 h. The reaction was monitored by TLC (DCM:MeOH = 10:1). Water was added to the mixture, and the mixture was extracted with EA (10 mL) (repeated three times). The organic phases were combined. The organic phase was purified on a silica gel column using DCM:MeOH at ratios of 50:1 to 40:1 to give compound 14. LCMS: Calculated values [M+H] + 915.06, measured value 915.9.
[0629] Compound 14 (14-(6-(4-((14-azido-3,6,9,12-tetraoxatetradecyl)oxy)naphth-1-yl)pyridin-3-yl)-2,2-dimethyl-5-(4-methylpyridin-2-yl)-4,9,12-trioxo-3-oxa-5,10,13-triazahexadecane-16-olate) (0.104 g, 0.11 mmol, 1.0 eq) was mixed with THF (5 mL) and LiOH aqueous solution (0.4 mL, 1 M) and reacted at 30 °C for 2 h. Citric acid was added to adjust the pH of the mixture to 6-7. The mixture was extracted with EA (10 mL) (repeated three times), and the organic phases were combined. The organic phase was concentrated and dissolved in DCM (0.5 mL), and TFA (0.1 mL) and Tis (0.1 mL) were added. The mixture was reacted at 25 °C for 4 h. The reaction was monitored by TLC (DCM:MeOH = 8:1 / 5:1). The reaction was quenched with saturated sodium bicarbonate solution, and extracted with DCM (10 mL) (repeated three times). The organic phases were combined. The organic phases were purified on a silica gel column using DCM:MeOH ratios from 40:1 to 7:1 to give compound 15, which is ligand II. LCMS: Calculated values [M+H] + 786.89, measured value 787.8; 1 H NMR (400MHz, CDCl3) δ9.94–9.70(m,1H),9.30(s,1H),8.78(s,1H),8.34(s,1H),8.02( s,1H),7.79(s,1H),7.44(m,6H),6.85(s,1H),6.44(s,2H),5.37(d,J=16.0Hz,1H),4.3 2(s,2H),4.01(s,2H),3.80(d,J=4.9Hz,3H),3.73–3.70(m,2H),3.68–3.61(m,12H),3 .36(t,J=4.6Hz,2H),3.29(m,2H),2.87(m,2H),2.49(m,2H),2.31(s,3H),2.06(m,2H).
[0630] (3) Coupling of the linker to siRNA
[0631] Two eqs of the linker, two eqs of HATU, and two eqs of DIEA were dissolved in DMF. Then, one eq of water-dissolved positive-sense strand was added, and the reaction was carried out for 2 hours to obtain the conjugated structure of the linker and the positive-sense strand. The conjugated structure of the linker and the positive-sense strand was purified by HPLC, concentrated by ultrafiltration, and desalted. The desalted conjugated structure of the linker and the positive-sense strand was mixed with the antisense strand and annealed to form a conjugated structure of the linker and the siRNA duplex.
[0632] (4) Coupling of the linker with the siRNA duplex and the ligand groups
[0633] The conjugate structure formed by the linker and the siRNA duplex is further coupled with the ligand.
[0634] 1. Prepare a solution of 0.5M tris(3-hydroxypropyltriazolylmethyl)amine (THPTA), 0.5M copper sulfate pentahydrate (Cu(II)SO4·5H2O) and 2M sodium ascorbate in deionized water.
[0635] 2. Dissolve αvβ6 integrin ligand II in DMSO and prepare a 75 mg / mL solution.
[0636] 3. In a 1.5 mL centrifuge tube containing the conjugate structure formed by the ligand and the siRNA double strand (3 mg, 75 μL, 40 mg / mL, in deionized water, ~15,000 g / mol), add 25 μL of 1 M Hepes pH 8.5 buffer and 35 μL of DMSO, and vortex to dissolve.
[0637] 4. Add αvβ6 integrin ligand II to a centrifuge tube (conjugated structure (6), alkyne (2 eq), ~15 μL), and vortex the solution. Check the pH with pH paper and confirm that it is ~8.
[0638] 5. In a separate 1.5 mL centrifuge tube, mix 50 μL of 0.5 M THPTA with 10 μL of 0.5 M Cu(II)SO4·5H2O, vortex, and incubate at room temperature for 5 minutes.
[0639] 6. After 5 minutes, add 7.2 μL of THPTA / Cu solution (6 equivalents 5:1 THPTA:Cu) to the reaction centrifuge tube and vortex.
[0640] 7. Immediately afterwards, add 2M ascorbate (5 μL, 50 equivalents / doublet, 16.7 equivalents / alkyne) to the reaction centrifuge tube and vortex. Once the reaction is complete (usually within 0.5–1 hour), immediately purify the reactants by non-denaturing anion exchange chromatography.
[0641] Example 2: In vitro activity detection
[0642] Cell culture: A549 cells (in which RAGE is expressed, and inhibiting RAGE expression can inhibit A549 cell migration to a certain extent and promote apoptosis) were cultured in F12K complete medium (Gibco, supplemented with 10% FBS, 1% penicillin and streptomycin) at 37°C and 5% CO2 until approximately 80% confluence. Cells were then trypsinized and seeded in 24-well plates, with 1.0 × 10⁶ cells added to each well.5 A549 cells and 1.0 mL of F12K complete medium were cultured at 37°C and 5% CO2 for 16-24 hours before transfection.
[0643] Cell transfection: Add 3 μL of lipofectamine RNAiMax (Invitrogen) to each well of 47 μL opti-MEM, then add 50 μL of opt-MEM dilution buffer for each siRNA listed in Table 5 below, mix well, add to centrifuge tubes, and incubate at room temperature for 15 min. Finally, add the siRNA transfection complex to the cells and continue culturing for 24 h before RNA extraction. Single-dose experiments were performed at a concentration of 1 nM siRNA duplex.
[0644] RNA extraction: Using the Total RNA Isolation Kit (NewBio, cat: N1002-A96): Follow the instructions for the RNA isolation kit, and finally add 70 μL of RNase-free water to dissolve.
[0645] cDNA synthesis: cDNA synthesis was performed using a gDNA removal and cDNA synthesis kit (VAZYME, cat: RC333-01). 900 ng of total RNA was added to each sample, and cDNA synthesis was performed using a gradient thermal cycler (Bio-rad, T100) following the manufacturer's instructions.
[0646] Real-time quantitative PCR: The synthesized cDNA and the mixed stock solution (containing primers, qPCR premix and ultrapure water) were added to a 96-well plate (Thermofisher, Cat: A36924). The final real-time quantitative PCR system contained: target gene (RAGE) or internal reference gene (GADPH), 0.4 μM each of forward and reverse primers, and 1×SYBR Green premix (Thermofisher, Cat: A25742).
[0647] Real-time PCR was performed using the ΔΔCt assay in an ABI QuantStudio 5 real-time PCR system, with each duplex measured in triplicate (N=3).
[0648] Table 5. In vitro assays of dsRNA
[0649] Where "-" indicates that the data is not shown.
[0650] Example 3: In vitro activity assay of modified double strands
[0651] This embodiment provides an in vitro activity assay for dsRNA-modified duplexes used to inhibit the RAGE gene. The experimental subjects are some of the dsRNA-modified duplexes listed in Table 3, prepared according to the method in Example 1.
[0652] In vitro evaluation was performed on some of the dsRNA-modified duplexes prepared in Example 1 as shown in Table 3 by transfecting NCI-H2009 cells (overexpressing Human AGER mRNA; Cyagen Biosciences): Each group of dsRNA-modified duplexes shown in Table 6 was added to 96-well plates (Thermofisher, Cat: A36924) at concentrations of 0.01 nM and 0.0001 nM using the transfection reagent Lipofectamine RNAiMax (Invitrogen). NCI-H2009 cells were added at approximately 2.4 × 10⁶ cells per well. 4 Cells were plated and cultured at 37°C and 5% CO2 for 16-24 h. RNA was extracted as described in Example 2, and the extracted RNA was used to synthesize cDNA. The expression of RAGE mRNA was then compared with the endogenous control (wells seeded with only NCI-H2009 cells without transfection with dsRNA-modified duplexes) using real-time quantitative PCR. The inhibition of the relative expression level of RAGE gene by dsRNA-modified duplexes in each group was analyzed using the ΔΔCt assay. Each group of dsRNA-modified duplexes was subjected to 2-3 independent transfection tests, and each transfection was performed with triple-replicated RT-qPCR. The results are shown in Table 6.
[0653] Table 6. Results of in vitro activity assays for modified double strands
[0654] As can be seen from the results in the table above, the dsRNA-modified duplex of this application can exhibit in vitro inhibitory activity against RAGE gene expression.
[0655] Example 4: In vitro activity assay of modified double strands
[0656] This embodiment provides an in vitro activity assay for dsRNA-modified duplexes used to inhibit the RAGE gene. The experimental subjects were some of the dsRNA-modified duplexes listed in Table 3, prepared according to the method in Example 1. Each group of dsRNA-modified duplexes shown in Table 7 was transfected and detected by RT-qPCR according to the method in Example 3 (each modified duplex was measured in triplicate), and the detection results are shown in Table 7.
[0657] Table 7. Results of in vitro activity assays for modified double strands
[0658] As can be seen from the results in the table above, the dsRNA-modified duplexes provided in this disclosure can exhibit in vitro inhibitory activity against RAGE gene expression.
[0659] Example 5: In vitro activity assay of modified double strands
[0660] This embodiment provides an in vitro activity assay for dsRNA-modified duplexes used to inhibit the RAGE gene. The experimental subjects were some of the dsRNA-modified duplexes listed in Table 3, prepared according to the method in Example 1. Each group of dsRNA-modified duplexes shown in Table 8 was transfected and detected by RT-qPCR according to the method in Example 3 (each modified duplex was measured in triplicate), and the detection results are shown in Table 8.
[0661] Table 8. Results of in vitro activity assays for modified double strands
[0662] As can be seen from the results in the table above, the dsRNA-modified duplex of this application can exhibit in vitro inhibitory activity against RAGE gene expression.
[0663] Example 6: In vitro activity assay of modified double strands
[0664] This embodiment provides an in vitro activity assay for dsRNA-modified duplexes used to inhibit the RAGE gene. The experimental subjects were some of the dsRNA-modified duplexes listed in Table 3, prepared according to the method in Example 1. Each group of dsRNA-modified duplexes shown in Table 9 was transfected and detected by RT-qPCR according to the method in Example 3 (each modified duplex was measured in triplicate), and the detection results are shown in Table 9.
[0665] Table 9. Results of in vitro activity assays for modified double strands.
[0666] As can be seen from the results in the table above, the dsRNA-modified duplex of this application can exhibit in vitro inhibitory activity against RAGE gene expression.
[0667] Example 7: In vivo activity assay of modified double strands and their conjugates
[0668] Humanized mice (male C57BL / 6N-Agertm2(AGER)Bcgen / Bcgen strain mice, abbreviated as B-hRAGE mice, formed by replacing the mouse RAGE gene encoding the full-length protein with the human RAGE gene in C57BL / 6N strain mice) were administered the following drugs: For the experimental group mice, the modified double strands listed in Table 10 (AMD numbers) and the conjugates prepared according to the synthesis method of conjugate 1 in step 1.2.1 of Example 1 (AC numbers) were used as test drugs, administered at a dose of 1.2 mg / kg via intratracheal nebulization. One dose was administered, and the day of administration was recorded as day 0. The solvent control group received 0.9% sodium chloride injection via nebulization simultaneously.
[0669] On day 7 after administration, venous blood was collected (serum was separated and stored at -80℃), mice were euthanized by exsanguination of the abdominal aorta, lung tissue (including trachea) was collected, weighed, placed in EP tubes containing Trizol and cut into small pieces; homogenization was performed using a cryo-grinding device, total RNA was extracted from the whole lung tissue using the Trizol method, and finally dissolved in 70 μL of RNase-free water.
[0670] cDNA synthesis: cDNA synthesis was performed using a gDNA removal and cDNA synthesis kit (VAZYME, cat: RC333-01). 1000 ng of total RNA was added to each sample, and cDNA synthesis was performed using a gradient thermal cycler (Bio-rad, T100) following the manufacturer's instructions.
[0671] Real-time quantitative PCR: The synthesized cDNA and the mixed stock solution (containing primers, qPCR premix and ultrapure water) were added to a 96-well plate (Thermofisher, Cat: A36924). The final real-time quantitative PCR system contained: target gene (RAGE) or internal reference gene (GADPH), 0.4 μM each of forward and reverse primers, and 1×SYBR Green premix (Thermofisher, Cat: A25742).
[0672] Real-time fluorescence PCR was performed using the ΔΔCt assay on an ABI QuantStudio 5 real-time fluorescence PCR system. The results are shown in Table 10.
[0673] Table 10. In vivo activity assay results of modified double strands and their conjugates
[0674] Example 8
[0675] Drug administration to humanized mice (male B-hRAGE mice): For the experimental group mice, the conjugates prepared according to the synthesis method of conjugate 2 in 1.2.2 of Example 1 were used as the test drugs (01AC00005-01AC0007 and 01AC00009-01AC00015 in Table 12). The drugs were administered via nebulization in the trachea using a mouse nebulizer, with a dosage of 1.2 mg / kg, administered once. The day of administration was recorded as day 0. The control group was simultaneously administered sodium chloride injection via nebulization in the trachea.
[0676] Blood was collected on day 7 after drug administration (serum was separated and stored at -80℃). Mice were euthanized by exsanguination of the abdominal aorta, and lung tissue (including trachea) was collected, weighed, placed in EP tubes containing Trizo, and minced. The whole tissue was homogenized using a cryo-grinding device, and total RNA was extracted from the whole lung tissue using the Trizol method. Finally, 70 μL of RNase-free water was added to dissolve the whole tissue.
[0677] cDNA synthesis: cDNA synthesis was performed using a gDNA removal and cDNA synthesis kit (VAZYME, cat: RC333-01). 1000 ng of total RNA was added to each sample, and cDNA synthesis was performed using a gradient thermal cycler (Bio-rad, T100) following the manufacturer's instructions.
[0678] Real-time quantitative PCR: The synthesized cDNA and the mixed stock solution (containing primers, qPCR premix and ultrapure water) were added to a 96-well plate (Thermofisher, Cat: A36924). The final real-time quantitative PCR system contained: target gene (RAGE) or internal reference gene (GADPH), 0.4 μM each of forward and reverse primers, and 1×SYBR Green premix (Thermofisher, Cat: A25742).
[0679] Real-time fluorescence PCR was performed using the ΔΔCt assay in the ABI QuantStudio 5 real-time fluorescence PCR system.
[0680] The inhibition rate of the RAGE gene is shown in Table 11.
[0681] Table 11 Results of in vivo activity assay
[0682] Example 9
[0683] The experimental method of Example 9 is the same as that of Example 8. The sequence structure of the drug to be tested is 01AC000017-01AC000021, 01AC000024-01AC00030, 01AC00032-01AC00033 in Table 12.
[0684] The inhibition rates of the RAGE gene in the tested conjugates are shown in Table 13.
[0685] Table 13 Results of in vivo activity assay
[0686] While specific embodiments of this disclosure have been described above, those skilled in the art should understand that these are merely illustrative examples, and various changes or modifications can be made to these embodiments without departing from the principles and essence of this disclosure. Therefore, the scope of protection of this disclosure is defined by the appended claims.
Claims
1. A dsRNA for inhibiting AGER gene expression, said dsRNA comprising a sense strand and an antisense strand, wherein, The antisense strand includes an antisense core sequence containing at least 15 consecutive nucleotides, and the antisense core sequence differs from the reverse complementary sequence of at least 15 consecutive nucleotides in any of the nucleotide sequences shown in Table 2 by no more than 3.
2. The dsRNA as described in claim 1, wherein, The length of the core segment sequence of the antisense strand is 15, 16, 17, 18, 19, 20, 21, 22 or 23 nucleotides; Preferably, the length of the antisense strand core segment sequence is 17, 19, 21 or 23 nucleotides.
3. The dsRNA as described in claim 1 or 2, wherein, The positive chain includes a positive chain core sequence containing at least 15 consecutive nucleotides, preferably 15, 16, 17, 18, 19, 20, 21, 22 or 23 nucleotides.
4. The dsRNA according to any one of claims 1-3, wherein, The antisense strand core segment sequence differs from the reverse complementary sequence of any of the nucleotide sequences shown in Table 2 by no more than 3 nucleotides. Preferably, the antisense strand core segment sequence differs from the reverse complementary sequence of any of the nucleotide sequences shown in Table 2 by no more than 2 or 1 nucleotides.
5. The dsRNA according to any one of claims 1-4, wherein, The number of nucleotides mismatched between the sense strand and the antisense strand is 0, 1, 2, or 3; and / or The antisense strand differs from any antisense strand in Table 1 by no more than three parts; or the antisense strand contains a nucleotide sequence selected from any antisense strand shown in Table 1.
6. The dsRNA according to any one of claims 1-5, wherein, The antisense strand of the dsRNA has a 1-5 nucleotide overhang at the 3' end; Preferably, the antisense strand of the dsRNA has a 1-4 nucleotide overhang at the 3' end; Preferably, the antisense strand of the dsRNA has a 1-3 nucleotide overhang at the 3' end; Preferably, the antisense strand of the dsRNA has a 2-nucleotide end overhang at the 3' end.
7. The dsRNA according to any one of claims 1-6, wherein, The dsRNA is selected from any double strand composed of the sense and antisense strands shown in Table 1.
8. The dsRNA according to any one of claims 1-4, wherein, The sense strand comprises at least 16 consecutive nucleotides that differ by no more than 3 nucleotides from the downstream 19-22 consecutive nucleotides of the nucleotide sequence of SEQ ID NO:1, and wherein the antisense strand is substantially complementary to the sense strand.
9. The dsRNA according to any one of claims 1-6, wherein, The positive strand of the dsRNA contains at least 16 consecutive nucleotides, and the positive strand differs from the nucleotide sequence shown in SEQ ID NO:377, 255 or 2187 by no more than 3 nucleotides.
10. The dsRNA according to any one of claims 1-9, wherein, The dsRNA contains at least one modified nucleotide or nucleotide analog; Preferably, all nucleotides in the sense strand and / or antisense strand are modified nucleotides or nucleotide analogs.
11. The dsRNA according to any one of claims 1-10, wherein, The dsRNA is a pharmaceutically acceptable salt.
12. A dsRNA conjugate, wherein, The dsRNA conjugate is obtained by conjugating the dsRNA as described in any one of claims 1-11 with a conjugate molecule; Preferably, the conjugated molecule has a structure selected from the following: in, This indicates the site of connection with the dsRNA.
13. A pharmaceutical composition, wherein, The pharmaceutical composition contains dsRNA as described in any one of claims 1-11, or dsRNA conjugate as described in claim 12, as the active ingredient and a pharmaceutically acceptable carrier.
14. A reagent kit, wherein, The kit contains at least one of the following: dsRNA as described in any one of claims 1-11, or the dsRNA conjugate as described in claim 12, or the pharmaceutical composition as described in claim 13.
15. At least one of the dsRNAs as described in any one of claims 1-11, the dsRNA conjugate as described in claim 12, or the pharmaceutical composition as described in claim 13, for the prevention and / or treatment of one or more diseases or symptoms associated with enhanced or elevated membrane RAGE activity levels.