Macrocyclic compound, preparation method therefor and pharmaceutical use thereof
Patent Information
- Application Number
- PCT/CN2026/086636
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-09-05
- Filing Date
- 2026-03-27
- Publication Date
- 2026-10-01
Smart Images

Figure CN2026086636_01102026_PF_FP_ABST
Abstract
Description
A macrocyclic compound, its preparation method and its pharmaceutical application Technical Field
[0001] This disclosure pertains to the pharmaceutical field and relates to a macrocyclic compound of general formula (I), a method for its preparation, a pharmaceutical composition containing the macrocyclic compound, and its use as a therapeutic agent, particularly as an NRF2 agonist, and in the preparation of medicaments for the treatment and / or prevention of NRF2-mediated or dependent diseases or conditions. Background Technology
[0002] NRF2 is a basic leucine zipper (bZIP) transcription factor that plays a crucial role in cellular defense mechanisms. Under homeostatic conditions, the cytoplasmic actin-binding repressor protein KEAP1 binds to NRF2 and mediates its degradation via the E3 ubiquitin-proteasome pathway. Under oxidative stress, electrophilic substances such as ROS cause a conformational change in KEAP1, releasing NRF2 and preventing its degradation, allowing it to enter the nucleus. In the nucleus, NRF2 forms a heterodimer with MAP protein, initiating the transcription of various downstream genes, including multiple antioxidant enzymes (GST, NQO1), by recognizing antioxidant response elements (AREs), thereby mitigating cellular damage caused by reactive oxygen species and electrophilic substances.
[0003] In inflammatory responses, the massive production of ROS significantly activates NRF2 expression, and in addition to inducing antioxidant enzyme expression, it also directly participates in the functional regulation of immune cells. Studies have found that IL-6, MCP-1, and MIP-2 expression are significantly upregulated in NRF2- / - neutrophils (Biochem. Biophys. Res. Commun. 2006, 351, 883–889.). In the CD4-Keap1-KO mouse model, increased NRF2 expression promotes the proliferation and activation of Treg cells.
[0004] Activation of NRF2 has a protective effect on cells under sustained oxidative stress. Studies have shown that compared with the control group, the expression level of NRF2 protein in the respiratory epithelial cells of COPD patients is significantly reduced, and the mRNA content is negatively correlated with the amount of smoking. Subsequent mechanistic studies have also shown that NRF2 knockdown can significantly promote CSE-induced apoptosis (BMC Pulm Med 16,27(2016)). This indicates that NRF2 activation may inhibit the inflammatory response in the lungs of COPD patients, alleviate pathological changes in lung tissue structure, and thus delay disease progression. Other studies have shown that NRF2 agonists can benefit COPD patients by regulating the function of alveolar macrophages (Sci Transl Med.2011 Apr 13;3(78):78ra32.). Among them, the expression level of NRF2 in alveolar macrophages of COPD patients is lower than that in the control group, and phagocytosis is significantly defective. Meanwhile, in the CSE-induced COPD model in mice, NRF2 knockout mice showed significantly suppressed phagocytic function of alveolar macrophages compared to wild-type mice, accompanied by aggravated lung infection and inflammatory response. These symptoms were all improved to some extent after treatment with the NRF2 agonist (sulforaphane, SFN).
[0005] In addition, NRF2 agonists also show promise in the treatment of various other respiratory diseases, such as acute and chronic asthma, acute lung injury / acute respiratory distress syndrome, and pulmonary fibrosis.
[0006] NRF2 activation regulates a variety of downstream genes with broad physiological functions such as anti-inflammatory, anti-oxidative, anti-fibrotic, and anti-apoptotic effects. Its agonists also have various potential applications in autoimmune diseases and neurodegenerative diseases.
[0007] In inflammatory bowel disease (IBD), damage to the intestinal epithelial cells leads to barrier dysfunction, triggering abnormal and persistent immune responses and inflammation. Current research has demonstrated that the expression levels of various oxidative stress factors regulated by NRF2 are associated with disease progression. A small molecule agonist of NRF2 (CPUY19208) has also been shown to have a cytoprotective effect in ulcerative colitis (UC) (Sci Rep 6,26585 (2016)). Dimethyl fumarate (DMF), approved for the treatment of psoriasis, has a bioactive metabolite (MMF) that has been shown to activate the expression of NRF2 and its downstream antioxidant genes in keratinocytes (J Pharmacol Exp Ther. 2017 Aug; 362(2):243-253).
[0008] NRF2 functional alterations have been found in various neurodegenerative diseases, including Parkinson's disease (PD), Huntington's disease (HD), Alzheimer's disease (AD), Friedreich ataxia (FRDA), and multiple sclerosis (MS), and may be related to changes in neuroinflammation, mitochondrial function, and cellular homeostasis during disease progression (Neurod, 2018 Oct 285(19), 3576-3590). Activation of NRF2 function can significantly inhibit lipid oxidation and ferroptosis in FRDA disease model mice, and its agonist, Omaveloxolone, has been approved for the treatment of FRDA (Redox Biology, Volume 38, 2021, 101791, ISSN 2213-2317).
[0009] Acute kidney injury caused by the accumulation of large amounts of oxidative stress molecules (such as ROS) or other electrophilic substances can also activate NRF2 function. Further upregulating NRF2 expression using drugs or other methods may alleviate this oxidative damage and delay the progression of acute kidney injury to chronic kidney disease (CKD). Previous studies have demonstrated that the NRF2 agonist bardoxolone can effectively improve glomerular filtration rate in stage 3 CKD patients and significantly enhance renal function (N Engl J Med 2011; 365:327-336).
[0010] Currently reported NRF2 small molecule agonists are basically indirect inhibitors of the Keap1-Nrf2 interaction, with two main modes of action. One is an electrophilic molecule that forms a covalent adduct with the thiol group on the cysteine residue of Keap1 through oxidation or alkylation. After binding to the cysteine residue of Keap1, it changes and locks the protein conformation, blocking the binding of KEAP1 to the ubiquitinase Cul3, thereby inhibiting the degradation of NRF2. Omaveloxolone, DMF, and SFN are all such molecules. However, due to their covalent binding nature, these agonists may lead to unrestricted overactivation of NRF2, increasing the risk of carcinogenesis. Targeting cysteine may also increase the possibility of molecular off-target effects. There are reports of heart failure risk caused by Bardoxolone off-target effects (Am J Nephrol. 2014; 39(6):499-508. doi:10.1159 / 000362906. Epub 2014 Jun 3.).
[0011] Based on the above considerations, developing a non-covalently binding NRF2 agonist that selectively inhibits the binding of Keap1-NRF2 would greatly benefit the clinical application of the drug molecule. Currently, both C4X Discovery and Chugai Pharmaceutical have developed such small molecule drugs. Chugai Pharmaceutical's small molecules 1-4 significantly increased NRF2 transcription levels in mouse lung tissue, but there are no preclinical efficacy reports in disease models. Summary of the Invention
[0012] The purpose of this disclosure is to provide a compound of general formula (I) or a pharmaceutically acceptable salt thereof.
[0013] in:
[0014] L 1 For (CR) 4 R 4’ ) x 、(CR 4a R 4b ) r NR 5 (CR 4a’ R 4b’ ) r0 、(CR 4c R 4d ) r1 NR 5’ C(O)(CR 4c’ R 4d’ ) r2 、(CR 4e R 4f ) r3 O(CR 4e’ R 4f’ ) r4 and (CR) 4g R 4h ) r5 C(O)(CR 4g’ R 4h’ ) r6 ;
[0015] L 2 For (CR) 41 R 41’ ) x1 、(CR 41a R 41b ) r7 NR 51 (CR 41a’ R 41b’ ) r8 、(CR 41c R 41d )r9 NR 51’ C(O)(CR 41c’ R 41d’ ) r10 、(CR 41e R 41f ) r11 O(CR 41e’ R 41f’ ) r12 and (CR) 41g R 41h ) r13 C(O)(CR 41g’ R 41h’ ) r14 ;
[0016] Q 1 Selected from key, CR Q01 R Q02 NR Q3 O, S, cycloalkyl, heterocyclic, aryl and heteroaryl, wherein the cycloalkyl, heterocyclic, aryl and heteroaryl are optionally substituted with one or more R*;
[0017] Q 2 Selected from key, CR Q11 R Q21 NR Q31 O, S, cycloalkyl, heterocyclic, aryl and heteroaryl, wherein the cycloalkyl, heterocyclic, aryl and heteroaryl are optionally substituted with one or more R*;
[0018] B 1 B 2 and B 3 Whether they are the same or different, each is independently a CR. B1 R B2 NR B3 O, C(O) or S;
[0019] R 4 R 4a R 4b R 4c R 4d R 4e R 4f R 4g R 4h R 4’ R 4a’ R 4b’ R 4c’ R 4d’ R 4e’ R 4f’ R 4g’ R 4h’ R 41 R 41a R41b R 41c R 41d R 41e R 41f R 41g R 41h R 41’ R 41a’ R 41b’ R 41c’ R 41d’ R 41e’ R 41f’ R 41g’ R 41h’ R Q01 R Q02 R Q11 R Q21 R B1 and R B2 The same or different, and each independently selected from hydrogen atoms, halogens, alkyl, alkenyl, alkynyl, haloalkyl, alkoxy, haloalkoxy, cyano, amino, hydroxy, hydroxyalkyl, cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, and heteroarylalkyl, wherein the alkyl, alkenyl, alkynyl, alkoxy, cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, and heteroarylalkyl are optionally selected by one or more R # replace;
[0020] R 5 R 51 R 5’ R 51’ R Q3 R Q31 and R B3 The same or different, and each independently selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl, wherein the cycloalkyl, heterocyclic, aryl, and heteroaryl are optionally separated by one or more R # Replace; or
[0021] R 4 R 4a R 4b R 4c R 4d R 4e R 4f R 4g R 4h R 4’ R 4a’ R 4b’ R 4c’ R 4d’ R 4e’ R 4f’ R 4g’ R4h’ R 41 R 41a R 41b R 41c R 41d R 41e R 41f R 41g R 41h R 41’ R 41a’ R 41b’ R 41c’ R 41d’ R 41e’ R 41f’ R 41g’ R 41h’ R 5 R 51 R 5’ and R 51’ Two identical or different atoms in the group, together with the attached atoms, form a cycloalkyl, heterocyclic, aryl, or heteroaryl group, wherein the cycloalkyl, heterocyclic, aryl, or heteroaryl group is optionally surrounded by one or more R groups. # replace;
[0022] R B1 R B2 and R B3 Two identical or different atoms in the group, together with the attached atoms, form a cycloalkyl, heterocyclic, aryl, or heteroaryl group, wherein the cycloalkyl, heterocyclic, aryl, or heteroaryl group is optionally surrounded by one or more R groups. # replace;
[0023] x, x1, r, r0 to r14 are the same or different, and each is independently 0, 1, 2, 3, 4, 5 or 6;
[0024] X 1 For CR X1 Or N;
[0025] Y 1 For CR Y1 Or N;
[0026] Y 2 For CR Y2 Or N;
[0027] Z 1 For CR Z1 Or N;
[0028] R X1 R X2 R X3 R Y1 R Y2 R Y3 R Y4 RZ1 R Z2 R Z3 and R Z4 Whether identical or different, each is independently selected from hydrogen atom, halogen, alkyl, heteroalkyl, alkenyl, alkynyl, alkoxy, haloalkyl, haloalkoxy, hydroxyalkyl, cyano, -NR 7a R 7b -NR 7a OR 7b -ONR 7a R 7b -NR 7c NR 7a R 7b hydroxyl group, -C(O)R 8 -C(O)OR 8 -C(O)NR 7a R 7b -C(O)NR 7a S(O) w R 8 -S(O) w R 8 Cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, and heteroarylalkyl, wherein the alkyl, heteroalkyl, alkenyl, alkynyl, cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, and heteroarylalkyl are each independently and optionally selected by one or more R * Replaced; or
[0029] R Y1 R Y2 Together with the attached atoms, it forms cycloalkyl, heterocyclic, aryl, or heteroaryl groups, and / or R Y3 R Y4 Together with the attached atoms, it forms cycloalkyl, heterocyclic, aryl, or heteroaryl groups, and / or R X1 R X2 Together with the attached atoms, it forms cycloalkyl, heterocyclic, aryl, or heteroaryl groups, and / or R X3 R X2 Together with the attached atoms, it forms cycloalkyl, heterocyclic, aryl, or heteroaryl groups, and / or R Z3 R Z2 Together with the attached atoms, it forms cycloalkyl, heterocyclic, aryl, or heteroaryl groups, and / or R X3 R X4 Together with the attached atoms, it forms a cycloalkyl, heterocyclic, aryl, or heteroaryl group, wherein the cycloalkyl, heterocyclic, aryl, or heteroaryl group is optionally surrounded by one or more R groups. * replace;
[0030] R 7a R7b R 7c They may be the same or different, and each is independently selected from hydrogen atoms, alkyl, heteroalkyl, hydroxyalkyl, aminoalkyl, cycloalkyl and heterocyclic groups, wherein each of the alkyl, heteroalkyl, hydroxyalkyl, aminoalkyl, cycloalkyl and heterocyclic groups is independently optionally substituted by one or more substituents selected from halogen, alkyl, alkoxy, haloalkyl and haloalkoxy;
[0031] Or R 7a and R 7b Together with the attached nitrogen atom, a heterocyclic group is formed, wherein the heterocyclic group is optionally substituted by one or more substituents selected from halogen, oxo, =S, alkyl, alkoxy, haloalkyl, haloalkoxy, cyano, amino, nitro, hydroxy, hydroxyalkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl.
[0032] R 8 The same or different, and each independently selected from hydrogen atoms, halogens, alkyl, alkenyl, alkynyl, haloalkyl, alkoxy, haloalkoxy, hydroxyl, hydroxyalkyl, cycloalkyl, and heterocyclic groups, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, and heterocyclic groups are each independently optionally selected by one or more R atoms. # replace;
[0033] Each R * and R #The same or different, and each independently selected from oxo, =S, =N-alkyl, =NH, halogen, alkyl, alkenyl, alkoxy, haloalkyl, haloalkoxy, hydroxy, hydroxyalkyl, alkoxyalkyl, cyano, alkylthio, amino, -NHalkyl, -N(alkyl)2, -alkylene-amino, -alkylene-NHalkyl, -alkylene-N(alkyl)2, amide, nitro, cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, heteroarylalkyl, cycloalkyloxy, heterocyclic oxy, aryloxy, and heteroaryloxy, wherein the =N-alkyl, alkyl, alkenyl, alkoxy, alkoxyalkyl, alkoxyalkyl, alkylthio, -NHalkyl, -N(alkyl)2, -alkylene-amino, -alkylene-NHalkyl, -alkylene -N(alkyl)2, cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, heteroarylalkyl, cycloalkyloxy, heterocyclic oxy, aryloxy, and heteroaryloxy are each independently and optionally substituted by one or more substituents selected from oxo, =S, halogen, alkyl, alkenyl, alkoxy, haloalkyl, haloalkoxy, hydroxy, hydroxyalkyl, alkoxyalkyl, cyano, alkylthio, amino, -NHalkyl, -N(alkyl)2, -alkylene-amino, -alkylene-NHalkyl, -alkylene-N(alkyl)2, amide, nitro, cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, heteroarylalkyl, cycloalkyloxy, heterocyclic oxy, aryloxy, and heteroaryloxy; and
[0034] w can be 0, 1, or 2.
[0035] In some embodiments of this disclosure, when L 1 For (CR) 4c R 4d ) r1 NR 5’ C(O)(CR 4c’ R 4d’ ) r2 When, direction is not distinguished, i.e., R 4c Connected carbon atoms or NR 5’ (When r1 is 0) can be used with Q 1 Connection, also with L 2 connect.
[0036] In some embodiments disclosed herein, Q 1 For NR Q3 Or optionally, a 3- to 6-membered heterocyclic group substituted with one or more R*, R Q3 R* is as defined in general formula (I); in some implementations, Q 1 For a 3- to 6-membered heterocyclic group optionally substituted with one or more R*, R* as defined in general formula (I); in some embodiments, Q1 A 6-membered heterocyclic group optionally substituted with one or more R*, where R* is as defined in general formula (I); in some embodiments, Q 1 The morpholino, piperazine, or piperidinyl group is optionally substituted with one or more R* groups, where R* is as defined in general formula (I); in some embodiments, Q 1 for G 1 It consists of carbon, nitrogen, or oxygen atoms, where q is 0, 1, 2, 3, 4, 5, or 6, and R... Q1 It is R*, or two Rs Q1 Together with the attached atoms, it forms a 3- to 6-membered cycloalkyl or a 3- to 6-membered heterocyclic group, wherein the 3- to 6-membered cycloalkyl or 3- to 6-membered heterocyclic group is optionally surrounded by one or more R... # Replacement, R*, R # As defined in general formula (I).
[0037] In some embodiments disclosed herein, Q 1 For NR Q3 R Q3 As defined in general formula I; in some implementations, Q 1 For NC 1-6 Alkyl or N-3 to 6-membered cycloalkyl; in some embodiments, Q 1 For NC 1-6 Alkyl; in some embodiments, Q 1 It is N-methyl.
[0038] In some embodiments disclosed herein, R Q3 C 1-6 Alkyl or 3- to 6-membered cycloalkyl; in some embodiments, R Q3 C 1-6 Alkyl or cyclopropyl; in some embodiments, R Q3 It is methyl, ethyl, or cyclopropyl;
[0039] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof is a compound represented by general formula (II) or a pharmaceutically acceptable salt thereof.
[0040] in:
[0041] G 1 It consists of carbon atoms, nitrogen atoms, or oxygen atoms;
[0042] R Q1 It is R*, or two Rs Q1 Together with the attached atoms, it forms a 3- to 6-membered cycloalkyl or a 3- to 6-membered heterocyclic group, wherein the 3- to 6-membered cycloalkyl or 3- to 6-membered heterocyclic group is optionally surrounded by one or more R...# replace;
[0043] q can be 0, 1, 2, 3, 4, 5, or 6;
[0044] M 1 For bonds, O, C(O), NHC(O) or NR 5 ;
[0045] M 2 For bond, O(CR) 41e’ R 41f’ ) r12 or NR 51 (CR 41a’ R 41b’ ) r8 ;
[0046] m is 0, 1, 2, 3, 4, 5, or 6;
[0047] n is 0, 1, 2, 3, 4, 5, or 6;
[0048] R 41e’ R 41f’ R 41a’ R 41b’ R 5 R 51 、R*、R # Q 2 R 4e R 4f R 41e R 41f r12, r8, X 1 R X2 R X3 Y 1 Y 2 R Y3 R Y4 Z 1 R Z2 R Z3 R Z4 B 1 B 2 B 3 As defined in general formula (I).
[0049] In some embodiments disclosed herein, B 1 CH2; and / or B 2 CH2; and / or B 3 It is O.
[0050] In some embodiments disclosed herein, B 1 It is CH2.
[0051] In some embodiments disclosed herein, B2 For CH2, O, NH and C(O); in some embodiments, B 2 It is CH2.
[0052] In some embodiments disclosed herein, B 3 For CH2, O, S, NH and C(O); in some embodiments, B 3 For O; in some implementations, B 3 It is CH2.
[0053] In some embodiments disclosed herein, X 1 For CH; and / or Y 1 For CR Y1 R Y1 As defined in general formula (I); and / or Y 2 For CH; and / or Z 1 For CH.
[0054] In some embodiments disclosed herein, X 1 For CR X1 R X1 Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1- 6-alkoxy, C 1-6 Halogenated alkyl and C 1-6 Halogenated alkoxy groups; in some embodiments, X 1 For CR X1 R X1 Selected from hydrogen atoms, halogens and C 1-6 Alkoxy; in some embodiments, X 1 For CH; in some implementations, X 1 For CF.
[0055] In some embodiments disclosed herein, Y 1 For CR Y1 R Y1 As defined in general formula (I); in some implementations, Y 1 For CR Y1 R Y1 Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl and cyano groups; in some embodiments, Y 1 For CR Y1 R Y1 It is halogen; in some implementations, Y 1 It is C-Cl.
[0056] In some embodiments disclosed herein, Y 2 For CR Y2 R Y2As defined in general formula (I); in some implementations, Y 2 For CR Y2 R Y2 Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 2-6 alkenyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, cyano, and 3- to 8-membered cycloalkyl; in some embodiments, Y 2 For CH.
[0057] In some embodiments disclosed herein, R Y3 Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 2-6 alkenyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, cyano, and 3- to 8-membered cycloalkyl; in some embodiments, R Y3 Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy; in some embodiments, R Y3 It is a hydrogen atom.
[0058] In some embodiments disclosed herein, Z 1 For CR Z1 R Z1 As defined in general formula (I); in some implementations, Z 1 For CR Z1 R Z1 Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Halogenated alkyl and C 1-6 Haloalkoxy; in some embodiments, Z 1 For CR Z1 R Z1 Selected from hydrogen atoms, halogens, C 1-6 Alkyl; in some embodiments, Z 1 For CH.
[0059] In some embodiments disclosed herein, R Z3 Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1-6 Alkoxy, C 1- 6-Hydroalkyl and C 1-6 Halogenated alkoxy groups; in some embodiments, R Z3 Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl; RZ3 It is a hydrogen atom.
[0060] In some embodiments disclosed herein, R Z4 It is a 5 to 10 aryl group, -C(O)OR 8 -C(O)NR 7a R 7b or -C(O)NR 7a S(O) w R 8 R 8 R 7a R 7b ,w as defined in general formula (I); in some implementations, R Z4 -C(O)OR 8 -C(O)NHR 7b or -C(O)NHS(O)2R 8 R 8 Selected from hydrogen atoms, C 1-6 Alkyl and C 1- 6-Hydroalkyl, R 7b Selected from hydrogen atoms, C 1-6 Alkyl and C 1-6 Halogenated alkyl; in some embodiments, R Z4 -C(O)OH or -C(O)OC 1-6 Alkyl; in some embodiments, R Z4 It is -C(O)OH.
[0061] In some embodiments of this disclosure, the compound represented by general formula (I) or (II) or a pharmaceutically acceptable salt thereof is a compound represented by general formula (III) or a pharmaceutically acceptable salt thereof.
[0062] in:
[0063] G 1 R Q1 , q, M 1 M 2 m, n, Q 2 R 4e R 4f R 41e R 41f R X2 R X3 R Y1 R Y4 R Z2 As defined in general formula (II).
[0064] In some embodiments disclosed herein, Q 1 and Selected from R Q1 As defined in general formula II, * and L 1 Or R 4e The attached atom or M 1 (When m is 0) connected; in some implementations, q is 0.
[0065] In some embodiments disclosed herein, R Q31 Selected from hydrogen atoms, C 1-6 Alkyl and 3- to 6-membered cycloalkyl; in some embodiments, R Q31 Selected from hydrogen atom, methyl, cyclopropyl and isopropyl.
[0066] In some embodiments disclosed herein, Q 2 Selected from key, NR Q31 and optional 3- to 8-membered heterocyclic groups substituted with one or more R*, R Q31 R* is as defined in general formula I; in some implementations, Q 2 Selected from key, NC 1-6 Alkyl, N-3 to 6-membered cycloalkyl, R Q2 It is R*, or two Rs Q2 Together with the attached atoms, it forms a 3- to 6-membered cycloalkyl or a 3- to 6-membered heterocyclic group, wherein the 3- to 6-membered cycloalkyl or 3- to 6-membered heterocyclic group is optionally surrounded by one or more R... # Replacement, q2 is 0, 1, 2, 3, 4, 5 or 6, R*, R # As defined in general formula I, *end and L 2 Or M 2 Connected; in some implementations, Q 2 As a key; in some implementations, Q 2 For NC 1-6 Alkyl or N-3 to 6-membered cycloalkyl; in some embodiments, Q 2 For NC 1-6 Alkyl or N-cyclopropyl; in some embodiments, Q 2 for R Q2 C 1-6 Alkyl, hydroxyl, C 1-6 alkoxy or 3- to 6-membered cycloalkyl, q2 is 0, 1 or 2; in some embodiments, Q 2 for R Q2 C 1-6Alkyl or 3- to 6-membered cycloalkyl, where q2 is 0, 1, or 2; in some embodiments, Q 2 for R Q2 C 1-6 Alkyl group, q2 is 0 or 1; in some embodiments, Q 2 for R Q2 C 1-6 Alkyl, hydroxyl, C 1-6 Alkoxy group, q2 is 0 or 1.
[0067] In some embodiments disclosed herein, R X2 R X3 Whether the elements are the same or different, they are each independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Halogenated alkyl and C 1-6 Halogenated alkoxy groups;
[0068] and / or R Y1 R Y4 Whether the elements are the same or different, they are each independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl, C 1-6 Halogenated alkyl groups and cyano groups;
[0069] and / or R Z2 For hydrogen atoms, halogens, C 1-6 Alkyl and C 1-6 Halogenated alkyl groups.
[0070] In some embodiments disclosed herein, R X2 R X3 Whether the elements are the same or different, they are each independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Halogenated alkyl and C 1-6 Haloalkoxy; in some embodiments, R X2 R X3 It is a hydrogen atom.
[0071] In some embodiments disclosed herein, R Y1 R Y4 Whether the elements are the same or different, they are each independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl, C 1-6 Halogenated alkyl and cyano groups; in some embodiments, R Y1 R Y4 Whether the atoms are the same or different, they are each independently selected from hydrogen atoms and halogens; in some embodiments, R Y1 RY4 Whether the halogens are the same or different, they are each independently halogens; in some implementations, R Y1 R Y4 It is Cl.
[0072] In some embodiments disclosed herein, R Z2 For hydrogen atoms, halogens, C 1-6 Alkyl and C 1-6 Halogenated alkyl; in some embodiments, R Z2 For halogen; in some implementations, R Z2 It is F.
[0073] In some embodiments disclosed herein, R Q1 They may be the same or different, and each is independently selected from oxo groups, halogens, and C. 1-6 Alkyl and C 1-6 Halogenated alkyl; and / or q is 0 or 1.
[0074] In some embodiments disclosed herein, R Q1 They may be the same or different, and each is independently selected from oxo groups, halogens, and C. 1-6 Alkyl and C 1-6 Halogenated alkyl; in some embodiments, R Q1 It is an oxygen group; in some embodiments, R Q1 They may be the same or different, and each is independently selected from halogens, C 1-6 Alkyl and C 1-6 Halogenated alkyl groups.
[0075] In some embodiments of this disclosure, q is 0 or 1; in some embodiments, q is 0; and in some embodiments, q is 1.
[0076] In some embodiments disclosed herein, R Q2 They may be the same or different, and each is independently selected from oxo groups, hydroxyl groups, and C groups. 1-6 Alkoxy, halogen, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and 3- to 6-membered cycloalkyl groups; in some embodiments, R Q2 They may be the same or different, and each is independently selected from oxo groups, hydroxyl groups, and C groups. 1-6 Alkoxy, halogen, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and 3- to 6-membered cycloalkyl groups; in some embodiments, R Q2 C 1-6 Alkyl, hydroxyl, C 1-6 Alkoxy; in some embodiments, R Q2 It is methyl, hydroxy, or methoxy; in some embodiments, R Q2 C 1-6Alkyl or 3- to 6-membered cycloalkyl; in some embodiments, R Q2 C 1-6 alkyl.
[0077] In some embodiments of this disclosure, q2 is 0, 1, or 2; in some embodiments, q2 is 0; and in some embodiments, q2 is 1.
[0078] In some embodiments disclosed herein, R 4e R 4f R 41e R 41f Whether the atoms are the same or different, and each is independently selected from hydrogen atoms, C atoms 1-6 Alkyl and C 1-6 Halogenated alkyl, or R 4e R 4f Together with the attached atoms, it forms a 3- to 6-membered cycloalkyl group or a 3- to 6-membered heterocyclic group, or R 41e R 41f Together with the attached atoms, it forms a 3- to 6-membered cycloalkyl or a 3- to 6-membered heterocyclic group, wherein the 3- to 6-membered cycloalkyl or 3- to 6-membered heterocyclic group is optionally surrounded by one or more R... * Instead, R* is as defined in general formula I;
[0079] and / or m is 1 or 2;
[0080] And / or n is 1, 2, 3 or 4.
[0081] In some embodiments disclosed herein, R 4e R 4f R 41e R 41f Whether the atoms are the same or different, and each is independently selected from hydrogen atoms, C atoms 1-6 Alkyl and C 1-6 Halogenated alkyl, or R 4e R 4f Together with the attached atoms, it forms a 3- to 6-membered cycloalkyl group or a 3- to 6-membered heterocyclic group, or R 41e R 41f Together with the attached atoms, it forms a 3- to 6-membered cycloalkyl or a 3- to 6-membered heterocyclic group, wherein the 3- to 6-membered cycloalkyl or 3- to 6-membered heterocyclic group is optionally surrounded by one or more R... * Instead, R* is as defined in general formula I; in some implementations, R 4e R 4f R 41e R 41f They may be the same or different, and each is independently a hydrogen atom or a carbon atom. 1-6 Alkyl, or R 4e R 4f Together with the attached atoms, they form 3- to 6-membered cycloalkyl groups, or R41e R 41f Together with the attached atoms, it forms a 3- to 6-membered cycloalkyl group; in some embodiments, R 4e R 4f R 41e R 41f They may be the same or different, and each independently consists of a hydrogen atom, a methyl group, or an ethyl group, or R. 4e R 4f Together with the attached atom, it forms a cyclopropyl group, or R 41e R 41f Together with the attached atom, it forms a cyclopropyl group; in some embodiments, R 4e R 4f R 41e R 41f They may be the same or different, and each is independently a hydrogen atom, methyl, or ethyl; in some embodiments, R 4e R 4f R 41e R 41f They may be the same or different, and each is independently a hydrogen atom or a halogen; in some embodiments, R 4e R 4f R 41e R 41f They may be the same or different, and each is independently a hydrogen atom or F; in some implementations, R 4e R 4f Together with the attached atom, it forms a cyclopropyl group; in some embodiments, R 41e R 41f Together with the attached atom, it forms a cyclopropyl group.
[0082] In some embodiments of this disclosure, m is 1 or 2.
[0083] In some embodiments of this disclosure, n is 1, 2, 3 or 4.
[0084] In some embodiments disclosed herein, M 1 It is O or NHC(O).
[0085] In some embodiments disclosed herein, M 2 For O, bond, OCH2 or CH2O; in some implementations, M 2 It is OCH2 or CH2O; in some implementations, M 2 For OCH2; in some implementations, M 2 For O or key.
[0086] In some embodiments disclosed herein, -L 1 -L 2 -*or for w1, w3, and w4 may be the same or different, and their values are 0, 1, 2, 3, and 4, respectively; w2 is 0 or 1. In some implementations, -L 1 -L 2 -*or for *Terminal and Q 2 Connected; in some implementations, -L 1 -L 2 -*or for *Terminal and Q 2 Connected; in some implementations, -L 1 -L 2 -*or for *Terminal and Q 2 Connected.
[0087] In some embodiments of this disclosure, R* is selected from oxo groups, halogens, and C. 1-6 Alkyl, C 1-6 Halogenated alkyl; in some embodiments, R* is an oxo group; in some embodiments, R* is an oxo group, hydroxyl group, C 1-6 Alkoxy, halogen, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and 3- to 6-membered cycloalkyl groups; in some embodiments, R* is C 1-6 Alkyl, hydroxyl, C 1-6 Alkoxy; in some embodiments, R Q2 R* is methyl, hydroxy, or methoxy; in some embodiments, R* is C 1-6 alkyl.
[0088] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof, wherein Q 1 For NR Q3 R Q3 C 1-6 Alkyl or 3- to 6-membered cycloalkyl; other groups as defined in general formula I.
[0089] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof, wherein Q 1 For NR Q3 R Q3 C 1-6 Alkyl or 3- to 6-membered cycloalkyl; Q 2 For key, or Q 2For NC 1-6 Alkyl or N-3 to 6-membered cycloalkyl, or Q 2 for R Q2 C 1-6 Alkyl group, q2 is 0 or 1; X 1 For CR X1 R X1 Selected from hydrogen atoms, halogens and C 1-6 Alkoxy; R X2 R X3 Whether the elements are the same or different, they are each independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Halogenated alkyl and C 1-6 Haloalkoxy; Y 1 For CR Y1 ;Y 2 For CH; R Y1 R Y4 Whether the elements are the same or different, they are each independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl, C 1-6 Halogenated alkyl and cyano groups; R Y3 Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy; Z 1 For CR Z1 R Z1 Selected from hydrogen atoms, halogens, C 1-6 Alkyl; R Z2 For hydrogen atoms, halogens, C 1-6 Alkyl and C 1-6 Halogenated alkyl; R Z3 Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl; R Z4 -C(O)OH or -C(O)OC 1-6 Alkyl; B 1 CH2; B 2 CH2; B 3 For O; -L 1 -L 2 -for *Terminal and Q 2 Connected.
[0090] In some embodiments of this disclosure, the compound represented by general formula (III) or a pharmaceutically acceptable salt thereof, wherein Selected from *End and R 4e The atoms that are connected are connected; R Q1 They may be the same or different, and each is independently selected from halogens, C 1-6 Alkyl and C 1-6 Haloalkyl; q is 0 or 1; for *Terminal and Q 2 Connected; Q 2 For key, or Q 2 For NC 1-6 Alkyl or N-3 to 6-membered cycloalkyl, or Q 2 for R Q2 C 1-6 Alkyl group, q2 is 0 or 1; R X2 R X3 Whether the elements are the same or different, they are each independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Halogenated alkyl and C 1-6 Haloalkoxy; R Y1 R Y4 Whether the elements are the same or different, they are each independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl, C 1-6 Halogenated alkyl and cyano groups; R Z2 For hydrogen atoms, halogens, C 1-6 Alkyl and C 1-6 Halogenated alkyl groups.
[0091] This disclosure also includes the following implementation schemes:
[0092] Implementation Scheme 1. A compound of general formula (I) or a pharmaceutically acceptable salt thereof,
[0093] in:
[0094] L 1 For (CR) 4 R 4’ ) x 、(CR 4a R 4b ) r NR 5 (CR 4a’ R 4b’ ) r0 、(CR 4c R 4d ) r1 NR 5’ C(O)(CR4c’ R 4d’ ) r2 、(CR 4e R 4f ) r3 O(CR 4e’ R 4f’ ) r4 and (CR) 4g R 4h ) r5 C(O)(CR 4g’ R 4h’ ) r6 ;
[0095] L 2 For (CR) 41 R 41’ ) x1 、(CR 41a R 41b ) r7 NR 51 (CR 41a’ R 41b’ ) r8 、(CR 41c R 41d ) r9 NR 51’ C(O)(CR 41c’ R 41d’ ) r10 、(CR 41e R 41f ) r11 O(CR 41e’ R 41f’ ) r12 and (CR) 41g R 41h ) r13 C(O)(CR 41g’ R 41h’ ) r14 ;
[0096] Q 1 Selected from key, CR Q01 R Q02 NR Q3 O, S, cycloalkyl, heterocyclic, aryl and heteroaryl, wherein the cycloalkyl, heterocyclic, aryl and heteroaryl are optionally substituted with one or more R*;
[0097] Q 2 Selected from key, CR Q11 R Q21 NR Q31 O, S, cycloalkyl, heterocyclic, aryl and heteroaryl, wherein the cycloalkyl, heterocyclic, aryl and heteroaryl are optionally substituted with one or more R*;
[0098] B 1 B 2 and B 3 Whether they are the same or different, each is independently a CR. B1 R B2 NR B3 O, C(O) or S;
[0099] R 4 R 4a R 4b R 4c R 4d R 4e R 4f R 4g R 4h R 4’ R 4a’ R 4b’ R 4c’ R 4d’ R 4e’ R 4f’ R 4g’ R 4h’ R 41 R 41a R 41b R 41c R 41d R 41e R 41f R 41g R 41h R 41’ R 41a’ R 41b’ R 41c’ R 41d’ R 41e’ R 41f’ R 41g’ R 41h’ R Q01 R Q02 R Q11 R Q21 R B1 and R B2 The same or different, and each independently selected from hydrogen atoms, halogens, alkyl, alkenyl, alkynyl, haloalkyl, alkoxy, haloalkoxy, cyano, amino, hydroxy, hydroxyalkyl, cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, and heteroarylalkyl, wherein the alkyl, alkenyl, alkynyl, alkoxy, cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, and heteroarylalkyl are optionally selected by one or more R # replace;
[0100] R 5 R51 R 5’ R 51’ R Q3 R Q31 and R B3 The same or different, and each independently selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl, wherein the cycloalkyl, heterocyclic, aryl, and heteroaryl are optionally separated by one or more R # Replace; or
[0101] R 4 R 4a R 4b R 4c R 4d R 4e R 4f R 4g R 4h R 4’ R 4a’ R 4b’ R 4c’ R 4d’ R 4e’ R 4f’ R 4g’ R 4h’ R 41 R 41a R 41b R 41c R 41d R 41e R 41f R 41g R 41h R 41’ R 41a’ R 41b’ R 41c’ R 41d’ R 41e’ R 41f’ R 41g’ R 41h’ R 5 R 51 R 5’ and R 51’ Two identical or different atoms in the group, together with the attached atoms, form a cycloalkyl, heterocyclic, aryl, or heteroaryl group, wherein the cycloalkyl, heterocyclic, aryl, or heteroaryl group is optionally surrounded by one or more R groups. # replace;
[0102] R B1 R B2 and R B3Two identical or different atoms in the group, together with the attached atoms, form a cycloalkyl, heterocyclic, aryl, or heteroaryl group, wherein the cycloalkyl, heterocyclic, aryl, or heteroaryl group is optionally surrounded by one or more R groups. # replace;
[0103] x, x1, r, r0 to r14 are the same or different, and each is independently 0, 1, 2, 3, 4, 5 or 6;
[0104] X 1 For CR X1 Or N;
[0105] Y 1 For CR Y1 Or N;
[0106] Y 2 For CR Y2 Or N;
[0107] Z 1 For CR Z1 Or N;
[0108] R X1 R X2 R X3 R Y1 R Y2 R Y3 R Y4 R Z1 R Z2 R Z3 and R Z4 Whether identical or different, each is independently selected from hydrogen atom, halogen, alkyl, heteroalkyl, alkenyl, alkynyl, alkoxy, haloalkyl, haloalkoxy, hydroxyalkyl, cyano, -NR 7a R 7b -NR 7a OR 7b -ONR 7a R 7b -NR 7c NR 7a R 7b hydroxyl group, -C(O)R 8 -C(O)OR 8 -C(O)NR 7a R 7b -C(O)NR 7a S(O) w R 8 -S(O) w R 8Cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, and heteroarylalkyl, wherein the alkyl, heteroalkyl, alkenyl, alkynyl, cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, and heteroarylalkyl are each independently and optionally selected by one or more R * Replaced; or
[0109] R Y1 R Y2 Together with the attached atoms, it forms cycloalkyl, heterocyclic, aryl, or heteroaryl groups, and / or R Y3 R Y4 Together with the attached atoms, it forms cycloalkyl, heterocyclic, aryl, or heteroaryl groups, and / or R X1 R X2 Together with the attached atoms, it forms cycloalkyl, heterocyclic, aryl, or heteroaryl groups, and / or R X3 R X2 Together with the attached atoms, it forms cycloalkyl, heterocyclic, aryl, or heteroaryl groups, and / or R Z3 R Z2 Together with the attached atoms, it forms cycloalkyl, heterocyclic, aryl, or heteroaryl groups, and / or R X3 R X4 Together with the attached atoms, it forms a cycloalkyl, heterocyclic, aryl, or heteroaryl group, wherein the cycloalkyl, heterocyclic, aryl, or heteroaryl group is optionally surrounded by one or more R groups. * replace;
[0110] R 7a R 7b R 7c They may be the same or different, and each is independently selected from hydrogen atoms, alkyl, heteroalkyl, hydroxyalkyl, aminoalkyl, cycloalkyl and heterocyclic groups, wherein each of the alkyl, heteroalkyl, hydroxyalkyl, aminoalkyl, cycloalkyl and heterocyclic groups is independently optionally substituted by one or more substituents selected from halogen, alkyl, alkoxy, haloalkyl and haloalkoxy;
[0111] Or R 7a and R 7b Together with the attached nitrogen atom, a heterocyclic group is formed, wherein the heterocyclic group is optionally substituted by one or more substituents selected from halogen, oxo, =S, alkyl, alkoxy, haloalkyl, haloalkoxy, cyano, amino, nitro, hydroxy, hydroxyalkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl.
[0112] R 8The same or different, and each independently selected from hydrogen atoms, halogens, alkyl, alkenyl, alkynyl, haloalkyl, alkoxy, haloalkoxy, hydroxyl, hydroxyalkyl, cycloalkyl, and heterocyclic groups, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, and heterocyclic groups are each independently optionally selected by one or more R atoms. # replace;
[0113] Each R * and R # The same or different, and each independently selected from oxo, =S, =N-alkyl, =NH, halogen, alkyl, alkenyl, alkoxy, haloalkyl, haloalkoxy, hydroxy, hydroxyalkyl, alkoxyalkyl, cyano, alkylthio, amino, -NHalkyl, -N(alkyl)2, -alkylene-amino, -alkylene-NHalkyl, -alkylene-N(alkyl)2, amide, nitro, cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, heteroarylalkyl, cycloalkyloxy, heterocyclic oxy, aryloxy, and heteroaryloxy, wherein the =N-alkyl, alkyl, alkenyl, alkoxy, alkoxyalkyl, alkoxyalkyl, alkylthio, -NHalkyl, -N(alkyl)2, -alkylene-amino, -alkylene-NHalkyl, -alkylene -N(alkyl)2, cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, heteroarylalkyl, cycloalkyloxy, heterocyclic oxy, aryloxy, and heteroaryloxy are each independently and optionally substituted by one or more substituents selected from oxo, =S, halogen, alkyl, alkenyl, alkoxy, haloalkyl, haloalkoxy, hydroxy, hydroxyalkyl, alkoxyalkyl, cyano, alkylthio, amino, -NHalkyl, -N(alkyl)2, -alkylene-amino, -alkylene-NHalkyl, -alkylene-N(alkyl)2, amide, nitro, cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, heteroarylalkyl, cycloalkyloxy, heterocyclic oxy, aryloxy, and heteroaryloxy; and
[0114] w can be 0, 1, or 2.
[0115] Implementation Scheme 2. The compound of general formula (I) according to Implementation Scheme 1, or a pharmaceutically acceptable salt thereof, wherein Q 1 A 6-membered heterocyclic group is optionally substituted with one or more R*, where R* is defined in general formula (I).
[0116] Implementation Scheme 3. A compound of general formula (I) or a pharmaceutically acceptable salt thereof, according to Implementation Scheme 1 or 2, wherein the compound is a compound of general formula (II) or a pharmaceutically acceptable salt thereof.
[0117] in:
[0118] G1 It consists of carbon atoms, nitrogen atoms, or oxygen atoms;
[0119] R Q1 It is R*, or two Rs Q1 Together with the attached atoms, it forms a 3- to 6-membered cycloalkyl or a 3- to 6-membered heterocyclic group, wherein the 3- to 6-membered cycloalkyl or 3- to 6-membered heterocyclic group is optionally surrounded by one or more R... # replace;
[0120] q can be 0, 1, 2, 3, 4, 5, or 6;
[0121] M 1 For bonds, O, C(O), NHC(O) or NR 5 ;
[0122] M 2 For bond, O(CR) 41e’ R 41f’ ) r12 or NR 51 (CR 41a’ R 41b’ ) r8 ;
[0123] m is 0, 1, 2, 3, 4, 5, or 6;
[0124] n is 0, 1, 2, 3, 4, 5, or 6;
[0125] R 41e’ R 41f’ R 41a’ R 41b’ R 5 R 51 、R*、R # Q 2 R 4e R 4f R 41e R 41f r12, r8, X 1 R X2 R X3 Y 1 Y 2 R Y3 R Y4 Z 1 R Z2 R Z3 R Z4 B 1 B 2 and B 3 As defined in Implementation Scheme 1.
[0126] Implementation Scheme 4. A compound of general formula (I) according to any one of Implementation Schemes 1 to 3, or a pharmaceutically acceptable salt thereof, wherein B 1 CH2; and / or B 2 CH2; and / B 3 It is O.
[0127] Implementation Scheme 5. A compound of general formula (I) according to any one of Implementation Schemes 1 to 4, or a pharmaceutically acceptable salt thereof, wherein X 1 For CH; and / or Y 1 For CR Y1 R Y1 As defined in Implementation Scheme 1; and / or Y 2 For CH; and / or Z 1 For CH.
[0128] Implementation Scheme 6. A compound of general formula (I) according to any one of Implementation Schemes 1 to 5, or a pharmaceutically acceptable salt thereof, wherein R Z4 -C(O)OR 8 R 8 As defined in Implementation Scheme 1; preferably, R Z4 It is -C(O)OH.
[0129] Implementation Scheme 7. A compound of general formula (I) or a pharmaceutically acceptable salt thereof according to any one of Implementation Schemes 1 to 6, wherein the compound is a compound of general formula (III) or a pharmaceutically acceptable salt thereof.
[0130] in:
[0131] G 1 R Q1 , q, M 1 M 2 m, n, Q 2 R 4e R 4f R 41e R 41f R X2 R X3 R Y1 R Y4 and R Z2 As defined in Implementation Scheme 3.
[0132] Implementation Scheme 8. A compound of general formula (I) according to any one of Implementation Schemes 1 to 7, or a pharmaceutically acceptable salt thereof, wherein R X2 R X3 Whether the elements are the same or different, they are each independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl, C 1-6 Alkoxy, C 1-6Halogenated alkyl and C 1-6 Halogenated alkoxy groups;
[0133] and / or R Y1 R Y4 Whether the elements are the same or different, they are each independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl, C 1-6 Halogenated alkyl groups and cyano groups;
[0134] and / or R Z2 For hydrogen atoms, halogens, C 1-6 Alkyl and C 1-6 Halogenated alkyl groups.
[0135] Implementation Scheme 9. A compound of general formula (I) according to any one of Implementation Schemes 3 to 8, or a pharmaceutically acceptable salt thereof, wherein R Q1 They may be the same or different, and each is independently selected from oxo groups, halogens, and C. 1-6 Alkyl and C 1- 6-Hydroalkyl;
[0136] and / or q is 0 or 1;
[0137] and / or for *Terminal and Q 2 Connected;
[0138] and / or Q 2 Selected from key, NC 1-6 Alkyl, N-3 to 6-membered cycloalkyl, R Q2 It is R*, or two Rs Q2 Together with the attached atoms, it forms a 3- to 6-membered cycloalkyl or a 3- to 6-membered heterocyclic group, wherein the 3- to 6-membered cycloalkyl or 3- to 6-membered heterocyclic group is optionally surrounded by one or more R... # Replacement, q2 is 0, 1, 2, 3, 4, 5 or 6, R*, R # As defined in Implementation Scheme 1, *end and L 2 Or M 2 Connected.
[0139] Implementation Scheme 10. A compound of general formula (I) according to any one of Implementation Schemes 1 to 8, or a pharmaceutically acceptable salt thereof, wherein R 4e R 4f R 41e R 41f Whether the atoms are the same or different, and each is independently selected from hydrogen atoms, C atoms 1- 6-alkyl and C 1-6 Halogenated alkyl, or R4e R 4f Together with the attached atoms, it forms a 3- to 6-membered cycloalkyl group or a 3- to 6-membered heterocyclic group, or R 41e R 41f Together with the attached atoms, it forms a 3- to 6-membered cycloalkyl or a 3- to 6-membered heterocyclic group, wherein the 3- to 6-membered cycloalkyl or 3- to 6-membered heterocyclic group is optionally surrounded by one or more R... * Instead, R* is as defined in Implementation Scheme 1.
[0140] Implementation Scheme 11. The compound of general formula (I) according to any one of Implementation Schemes 3 to 8, 10, or a pharmaceutically acceptable salt thereof, wherein m is 1 or 2; and / or n is 1, 2, 3 or 4.
[0141] The compounds disclosed in Group A include, but are not limited to:
[0142] This disclosure provides a compound of general formula (IA) or a salt thereof:
[0143] in,
[0144] R XX It is a halogen;
[0145] Q 1 Q 2 L 1 L 2 B 1 B 2 B 3 R X2 X 1 R X3 Y 1 Y 2 R Y3 R Y4 Z 1 R Z2 R Z3 R Z4 As defined in general formula (I).
[0146] Furthermore, this disclosure provides a compound of general formula (IIA) or a salt thereof:
[0147] in:
[0148] R XX It is a halogen;
[0149] G 1 R Q1 , q, M 1 M 2 m, n, R 4e R 4f R 41e R 41f Q 2 B 1 B 2 B 3 R X2 X 1 R X3 Y 1 Y 2 R Y3 R Y4 Z 1 R Z2 R Z3 R Z4 As defined in general formula (II).
[0150] This disclosure provides a compound of general formula (IIIA) or a salt thereof:
[0151] in:
[0152] R XX It is a halogen;
[0153] R PP Selected from hydrogen atoms, C 1-6 Alkyl or C 1-6 Halogenated alkyl groups;
[0154] G 1 R Q1 , q, M 1 M 2 m, n, Q 2 R 4e R 4f R 41e R 41f R X2 R X3 R Y1 R Y4 R Z2 As defined in general formula (III).
[0155] The compounds disclosed in Group B include, but are not limited to:
[0156] Another aspect of this disclosure relates to a method for preparing a compound of general formula (I) or a pharmaceutically acceptable salt thereof, comprising:
[0157] The compound represented by general formula (IA) or its salt undergoes a cyclization reaction to give the compound represented by general formula (I) or its pharmaceutically usable salt;
[0158] in:
[0159] R XX It is a halogen;
[0160] Q 1 Q 2 L 1 L 2 B 1 B 2 B 3 R X2 X 1 R X3 Y 1 Y 2 R Y3 R Y4 Z 1 R Z2 R Z3 R Z4 As defined in general formula I.
[0161] Another aspect of this disclosure relates to a method for preparing a compound of general formula (II) or a pharmaceutically acceptable salt thereof, comprising:
[0162] Compounds of general formula (IIA) or their salts undergo cyclization reactions to yield compounds of general formula (II) or their pharmaceutically usable salts;
[0163] in:
[0164] R XX It is a halogen;
[0165] G 1 R Q1 , q, M 1 M 2 m, n, R 4e R 4f R 41e R 41f Q 2 B 1 B 2 B 3 R X2X 1 R X3 Y 1 Y 2 R Y3 R Y4 Z 1 R Z2 R Z3 R Z4 As defined in Formula II.
[0166] Another aspect of this disclosure relates to a method for preparing a compound of general formula (III) or a pharmaceutically acceptable salt thereof, comprising:
[0167] R PP Selected from hydrogen atoms, C 1-6 Alkyl or C 1-6 Halogenated alkyl groups;
[0168] When R PP When the atom is hydrogen, the compound represented by general formula (IIIA) or its salt undergoes a cyclization reaction to give the compound represented by general formula (III) or its pharmaceutically usable salt;
[0169] When R PP C 1-6 Alkyl or C 1-6 When alkyl halogenated, the compound of general formula (IIIA) or its salt undergoes a cyclization reaction followed by a hydrolysis reaction, or a hydrolysis reaction followed by a cyclization reaction, to obtain the compound of general formula (III) or its pharmaceutically usable salt.
[0170] in:
[0171] R XX It is a halogen;
[0172] G 1 R Q1 , q, M 1 M 2 m, n, Q 2 R 4e R 4f R 41e R 41f R X2 R X3 R Y1 R Y4 R Z2 As defined in general formula (III).
[0173] In some implementation schemes, R XX It can be F or Br.
[0174] In some embodiments, the cyclization reaction occurs under alkaline conditions in the presence of an optional catalyst.
[0175] In some implementations, the hydrolysis reaction occurs under alkaline conditions.
[0176] In some embodiments, the reagents providing the alkaline conditions include organic and inorganic bases. The organic bases include, but are not limited to, triethylamine, N,N-diisopropylethylamine, n-butyllithium, diisopropylaminolithium, potassium acetate, sodium tert-butoxide, potassium tert-butoxide, tetrabutylammonium fluoride, tetrahydrofuran solution of tetrabutylammonium fluoride, or 1,8-diazabicycloundec-7-ene. The inorganic bases include, but are not limited to, sodium hydride, potassium phosphate, sodium carbonate, sodium acetate, potassium acetate, potassium carbonate, cesium carbonate, sodium hydroxide, lithium hydroxide, lithium hydroxide monohydrate, cesium fluoride, and potassium hydroxide. In some embodiments, sodium hydride is used; in some embodiments, lithium hydroxide is used; in some embodiments, lithium hydroxide monohydrate is used; and in some embodiments, cesium carbonate is used.
[0177] In some embodiments, the catalyst includes, but is not limited to, tris(dibenzylacetone)dipalladium / 4,5-bis(diphenylphosphine)-9,9-dimethyloxane.
[0178] The above synthesis is preferably carried out in a solvent, including but not limited to: ethylene glycol dimethyl ether, acetic acid, methanol, ethanol, acetonitrile, n-butanol, toluene, tetrahydrofuran, dichloromethane, petroleum ether, ethyl acetate, n-hexane, dimethyl sulfoxide, 1,4-dioxane, water, N,N-dimethylformamide, N,N-dimethylacetamide, and mixtures thereof.
[0179] Another aspect of this disclosure relates to a pharmaceutical composition comprising a compound of formula (I), formula (II), formula (III) or group A of this disclosure or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable carriers, diluents or excipients.
[0180] This disclosure further relates to the use of compounds of general formula (I), general formula (II), general formula (III) or group A above, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising them, in the preparation of a medicament for activating NRF2.
[0181] This disclosure further relates to the use of compounds of the above general formula (I), general formula (II), general formula (III) or group A, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising them, in the preparation of medicaments for the treatment and / or prevention of diseases or conditions mediated or dependent on NRF2.
[0182] This disclosure further relates to the use of compounds of general formula (I), general formula (II), general formula (III) or group A above, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising thereof, in the preparation of medicaments for the treatment and / or prevention of neurodegenerative diseases, respiratory diseases, immune / inflammatory diseases, ophthalmic diseases, liver diseases, tumors, or kidney diseases.
[0183] This disclosure also relates to a method of activating NRF2 in a subject, comprising administering to a desired patient a compound of the above formula (I), formula (II), formula (III) or group A, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the above.
[0184] This disclosure also relates to a method of treating and / or preventing diseases or conditions mediated or dependent on NRF2, comprising administering to a desired patient a compound of the above formula (I), formula (II), formula (III) or group A, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the above.
[0185] This disclosure also relates to a method of treating and / or preventing neurodegenerative diseases, respiratory diseases, immune / inflammatory diseases, ophthalmic diseases, liver diseases, tumors, or kidney diseases, comprising administering to a desired patient a compound of the above formula (I), formula (II), formula (III), or group A, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the above.
[0186] This disclosure further relates to a compound of the above-described general formula (I), general formula (II), general formula (III) or group A, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the above, which is used as a medicine.
[0187] This disclosure further relates to a compound of the above general formula (I), general formula (II), general formula (III) or group A, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the above, used as a medicine for treating and / or preventing diseases or conditions mediated or dependent on NRF2.
[0188] This disclosure further relates to compounds of the above general formula (I), general formula (II), general formula (III) or group A, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising thereof, for activating NRF2 in a subject.
[0189] This disclosure further relates to compounds of the above-described formulas (I), (II), (III) or group A, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising thereof, for the treatment and / or prevention of diseases or conditions mediated or dependent on NRF2.
[0190] This disclosure further relates to compounds of the above general formula (I), general formula (II), general formula (III) or group A, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising thereof, for the treatment and / or prevention of neurodegenerative diseases, respiratory diseases, immune / inflammatory diseases, ophthalmic diseases, liver diseases, tumors, or kidney diseases.
[0191] In some implementations, the diseases or conditions mediated or dependent on NRF2 described in this disclosure are neurodegenerative diseases, respiratory diseases, immune / inflammatory diseases, ophthalmic diseases, liver diseases, tumors, or kidney diseases.
[0192] In some embodiments, the neurodegenerative diseases described in this disclosure include, but are not limited to, Alzheimer's disease, Parkinson's disease, Huntington's disease, Friedreich ataxia, and amyotrophic lateral sclerosis;
[0193] The respiratory diseases mentioned include, but are not limited to, idiopathic pulmonary fibrosis, acute respiratory distress syndrome, chronic obstructive pulmonary disease, pulmonary hypertension, asthma, acute lung injury, and acute respiratory distress syndrome.
[0194] The immune / inflammatory diseases mentioned include, but are not limited to, multiple sclerosis, rheumatoid arthritis, ulcerative colitis, psoriasis, osteoarthritis, etc.
[0195] The ophthalmic diseases mentioned include, but are not limited to, uveitis, glaucoma, age-related macular degeneration, dry age-related macular degeneration, corneal diseases, and retinal diseases;
[0196] The liver diseases mentioned include, but are not limited to, hepatitis such as non-alcoholic steatohepatitis;
[0197] The kidney diseases mentioned include, but are not limited to, chronic kidney disease, acute kidney injury, diabetic nephropathy, end-stage renal disease, and polycystic kidney disease.
[0198] In some embodiments, the tumors described in this disclosure are selected from thyroid cancer, head and neck cancer, esophageal cancer, gastric cancer, lung cancer, liver cancer, kidney cancer, renal cell carcinoma, pancreatic cancer, gallbladder cancer, brain cancer, skin cancer, testicular cancer, bile duct cancer, colorectal cancer, urothelial carcinoma, bladder cancer, renal pelvis / ureter cancer, breast cancer, ovarian cancer, uterine cancer, endometrial cancer, cervical cancer, prostate cancer, leukemia, lymphoma, myeloma, appendix cancer, melanoma, sarcoma, and glioblastoma.
[0199] In some implementations, the tumor described in this disclosure is a solid tumor.
[0200] In some embodiments, the tumors described in this disclosure are hematologic malignancies.
[0201] In some embodiments, the sarcomas described in this disclosure are angiosarcomas, fibrosarcomas, rhabdomyosarcomas, liposarcomas, chondrosarcomas, Ewing's sarcoma, and Kaposi's sarcoma.
[0202] In some embodiments, the colorectal cancer described in this disclosure is colon cancer or rectal cancer.
[0203] In some embodiments, the lymphomas described in this disclosure are diffuse large B-cell lymphomas, Hodgkin's disease, and non-Hodgkin's lymphomas.
[0204] In some embodiments, the lung cancer described in this disclosure is lung adenocarcinoma; in some embodiments, the lung cancer is squamous cell lung cancer, small cell lung cancer, or non-small cell lung cancer; and in some embodiments, it is non-small cell lung cancer (NSCLC).
[0205] In some implementations, the leukemias described in this disclosure are chronic lymphocytic leukemia (CLL), acute myeloid leukemia (AML), acute lymphoblastic leukemia, and chronic myeloid leukemia.
[0206] In some embodiments, the myeloma described in this disclosure is multiple myeloma.
[0207] In some implementations, the head and neck cancers described in this disclosure are head and neck squamous cell carcinoma (HNSCC), pharyngeal cancer, laryngeal cancer, and tongue cancer.
[0208] In some implementations, the esophageal cancer described in this disclosure is gastric esophageal cancer.
[0209] In some implementations, the liver cancer described in this disclosure is hepatocellular carcinoma, hepatoblastoma, or hepatocellular adenoma.
[0210] The active compound can be formulated in a form suitable for administration via any appropriate route, in some embodiments in the form of a unit dose or in a form that a patient can self-administer as a single dose. The unit dose of the disclosed compound or composition can be expressed as a tablet, capsule, sachet, bottled liquid, powder, granule, lozenge, suppository, regenerated powder, or liquid formulation.
[0211] As a general guideline, a suitable unit dose can be 0.1–1000 mg.
[0212] In addition to the active compound, the pharmaceutical compositions disclosed herein may contain one or more excipients selected from the following: fillers (diluents), binders, wetting agents, disintegrants, or excipients. Depending on the method of administration, the composition may contain 0.1 to 99% by weight of the active compound.
[0213] In some embodiments, the unit dose of the pharmaceutical composition is 0.001 mg to 1000 mg.
[0214] In some embodiments, the pharmaceutical composition contains 0.01-99.99% of the aforementioned compound or its pharmaceutically acceptable salt or isotopic substitution, based on the total weight of the composition. In some embodiments, the pharmaceutical composition contains 0.1-99.9% of the aforementioned compound or its pharmaceutically acceptable salt or isotopic substitution. In some embodiments, the pharmaceutical composition contains 0.5%-99.5% of the aforementioned compound or its pharmaceutically acceptable salt or isotopic substitution. In some embodiments, the pharmaceutical composition contains 1%-99% of the aforementioned compound or its pharmaceutically acceptable salt or isotopic substitution. In some embodiments, the pharmaceutical composition contains 2%-98% of the aforementioned compound or its pharmaceutically acceptable salt or isotopic substitution.
[0215] In some embodiments, the pharmaceutical composition contains 0.01% to 99.99% pharmaceutically acceptable excipients based on the total weight of the composition. In some embodiments, the pharmaceutical composition contains 0.1% to 99.9% pharmaceutically acceptable excipients. In some embodiments, the pharmaceutical composition contains 0.5% to 99.5% pharmaceutically acceptable excipients. In some embodiments, the pharmaceutical composition contains 1% to 99% pharmaceutically acceptable excipients. In some embodiments, the pharmaceutical composition contains 2% to 98% pharmaceutically acceptable excipients.
[0216] The pharmaceutically acceptable salts of the compounds described in this disclosure may be selected from inorganic or organic salts.
[0217] Pharmaceutical compositions containing active ingredients may be in forms suitable for oral administration, such as tablets, sugar lozenges, tablets, aqueous or oil suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs. Oral compositions may be prepared according to any method known in the art for preparing pharmaceutical compositions, and such compositions may contain one or more ingredients selected from sweeteners, flavoring agents, coloring agents, and preservatives to provide an appealing and palatable pharmaceutical formulation.
[0218] Tablets contain an active ingredient and non-toxic, pharmaceutically acceptable excipients suitable for tablet preparation, used for mixing. These excipients may be inert excipients, granulating agents, disintegrants, binders, and lubricants. These tablets may be uncoated or coated using known techniques that mask the taste of the drug or delay disintegration and absorption in the gastrointestinal tract, thus providing sustained release over a longer period.
[0219] Oral formulations can also be provided using soft gelatin capsules in which the active ingredient is mixed with an inert solid diluent or in which the active ingredient is mixed with a water-soluble carrier or an oil solvent.
[0220] Aqueous suspensions contain active substances and excipients suitable for preparing aqueous suspensions for mixing. These excipients are suspending agents, dispersing agents, or wetting agents. Aqueous suspensions may also contain one or more preservatives, one or more coloring agents, one or more flavoring agents, and one or more sweeteners.
[0221] Oil suspensions are formulated by suspending the active ingredient in vegetable or mineral oil. Oil suspensions may contain thickeners. Sweeteners and flavoring agents mentioned above may be added to provide palatable formulations. These compositions may be preserved by adding antioxidants.
[0222] The pharmaceutical compositions disclosed herein may also be in the form of an oil-in-water emulsion. The oil phase may be vegetable oil, mineral oil, or a mixture thereof. Suitable emulsifiers may be naturally occurring phospholipids, and the emulsion may also contain sweeteners, flavoring agents, preservatives, and antioxidants. Such formulations may also contain modifiers, preservatives, colorants, and antioxidants.
[0223] The pharmaceutical compositions disclosed herein may be in the form of sterile injectable aqueous solutions. Acceptable solvents or media that can be used include water, Ringer's solution, and isotonic sodium chloride solution. The sterile injectable formulation may be a sterile injectable oil-in-water microemulsion in which the active ingredient is dissolved in the oil phase, which can be injected into the patient's bloodstream via local large-volume injection. Alternatively, the solution and microemulsion are preferably administered in a manner that maintains a constant circulating concentration of the compounds disclosed herein. To maintain such a constant concentration, a continuous intravenous delivery device may be used. An example of such a device is the Deltec CADD-PLUS™ 5400 intravenous infusion pump.
[0224] The pharmaceutical compositions disclosed herein may be in the form of sterile injectable aqueous or oil suspensions for intramuscular and subcutaneous administration. These suspensions may be formulated using suitable dispersants or wetting agents and suspending agents according to known techniques. The sterile injectable formulations may also be sterile injectable solutions or suspensions prepared in parenteral acceptable non-toxic diluents or solvents. Furthermore, sterile fixative oils can be conveniently used as solvents or suspension media. Any blended fixative oil may be used for this purpose. Additionally, fatty acids may also be used to prepare injectable formulations.
[0225] The disclosed compounds can be administered in suppository form for rectal administration. These pharmaceutical compositions can be prepared by mixing the drug with a suitable, non-irritating excipient that is solid at normal temperatures but liquid in the rectum, and thus dissolves in the rectum to release the drug.
[0226] As is well known to those skilled in the art, the dosage of a drug depends on a variety of factors, including but not limited to: the activity of the specific compound used, the patient's age, the patient's weight, the patient's health status, the patient's behavior, the patient's diet, the timing of administration, the route of administration, the rate of excretion, the combination of drugs, the severity of the disease, etc.; in addition, the optimal treatment mode, such as the treatment pattern, the daily dosage of the compound, or the type of medicinal salt can be validated based on conventional treatment protocols.
[0227] Terminology Explanation
[0228] Unless otherwise stated, the terms used in the specification and claims have the following meanings.
[0229] The term "alkyl" refers to a saturated, straight-chain or branched aliphatic hydrocarbon group having 1 to 20 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) carbon atoms (i.e., C2). 1-20 Alkyl group). In some embodiments, the alkyl group is an alkyl group having 1 to 12 carbon atoms (i.e., C12). 1-12 Alkyl groups, in some embodiments, alkyl groups having 1 to 6 carbon atoms (i.e., C14-C6 ... 1-6Alkyl groups). Non-limiting examples include: methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, sec-butyl, n-pentyl, 1,1-dimethylpropyl, 1,2-dimethylpropyl, 2,2-dimethylpropyl, 1-ethylpropyl, 2-methylbutyl, 3-methylbutyl, n-hexyl, 1-ethyl-2-methylpropyl, 1,1,2-trimethylpropyl, 1,1-dimethylbutyl, 1,2-dimethylbutyl, 2,2-dimethylbutyl, 1,3-dimethylbutyl, 2-ethylbutyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 2,3-dimethylbutyl, n-heptyl, 2-methylhexyl, 3-methylhexyl, 4-methylhexyl, 5-methylhexyl, 2 3-Dimethylpentyl, 2,4-Dimethylpentyl, 2,2-Dimethylpentyl, 3,3-Dimethylpentyl, 2-Ethylpentyl, 3-Ethylpentyl, n-Octyl, 2,3-Dimethylhexyl, 2,4-Dimethylhexyl, 2,5-Dimethylhexyl, 2,2-Dimethylhexyl, 3,3-Dimethylhexyl, 4,4-Dimethylhexyl, 2-Ethylhexyl, 3-Ethylhexyl, 4-Ethylhexyl, 2-Methyl-2-Ethylpentyl, 2-Methyl-3-Ethylpentyl, n-Nonyl, 2-Methyl-2-Ethylhexyl, 2-Methyl-3-Ethylhexyl, 2,2-Diethylpentyl, n-Decyl, 3,3-Diethylhexyl, 2,2-Diethylhexyl, and their various branched isomers, etc. Alkyl groups can be substituted or unsubstituted. When substituted, they can be substituted at any usable connection point. The substituents are selected from one or more of the following: D atom, halogen, alkoxy, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, hydroxy, hydroxyalkyl, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.
[0230] The term "alkylene" refers to a divalent alkyl group, wherein the alkyl group, as defined above, has 1 to 20 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) carbon atoms (i.e., C2). 1-20 Alkylene). In some embodiments, the alkylene has 1 to 10 carbon atoms (i.e., C10). 1-10 Alkylenes), in some embodiments, alkylenes having 1 to 8 carbon atoms (i.e., C1646-C ... 1-8 Alkylenes), in some embodiments, alkylenes having 2 to 7 carbon atoms (i.e., C646-C ... 2-7 Alkylenes or alkylenes having 1, 2 or 3 carbon atoms (i.e., C14) 1-6Alkylenes. Non-limiting examples include: -CH2-, -CH(CH3)-, -C(CH3)2-, -CH2CH2-, -CH(CH2CH3)-, -CH2CH(CH3)-, -CH2C(CH3)2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, etc. Alkylenes can be substituted or unsubstituted, and when substituted, they can be substituted at any usable linking point. Substituents are selected from one or more of the following: D atom, halogen, alkoxy, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, hydroxy, hydroxyalkyl, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.
[0231] The term "heteroalkyl" refers to an alkyl group in which one or more (e.g., 1, 2, 3, 4, 5, or 6) carbon atoms are replaced by heteroatoms selected from N, O, S, S(O), and S(O)2, and the nitrogen atom may optionally be quaternized, wherein the alkyl group is as defined above; in some embodiments, the heteroalkyl group is C 1-6 One, two, or three carbon atoms in the alkyl group are replaced by heteroatoms selected from N, O, S, S(O), and S(O)2; in some embodiments, the heteroalkyl group is a 2- to 6-membered heteroalkyl group (i.e., a total number of 2 to 6 atoms). The heteroalkyl group can be substituted or unsubstituted, and when substituted, it can be substituted at any usable linker, with the substituent selected from one or more of the following: D atom, halogen, alkoxy, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, hydroxy, hydroxyalkyl, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.
[0232] The term "alkenyl" refers to an alkyl group in which the molecule contains at least one carbon-carbon double bond, wherein the alkyl group is defined as described above and has 2 to 12 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) carbon atoms (i.e., C atoms). 2-12 Alkenyl group). In some embodiments, the alkenyl group has 2 to 6 carbon atoms (i.e., C16). 2-6 Alkenyl). Non-limiting examples include vinyl, propenyl, isopropenyl, butenyl, etc. Alkenyl groups can be substituted or unsubstituted, and when substituted, they can be substituted at any usable linker. Substituents are selected from one or more of the following: D atom, alkoxy, halogen, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, hydroxy, hydroxyalkyl, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.
[0233] The term "alkynyl" refers to an alkyl group in a molecule that contains at least one carbon-carbon triple bond, wherein the alkyl group is defined as described above and has 2 to 12 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) carbon atoms (i.e., C64, C74, C84, C9 ... 2-12(Alynyl group). In some embodiments, the alkynyl group has 2 to 6 carbon atoms (i.e., C12). 2-6 (Alynyl). Non-limiting examples include: ethynyl, propynyl, butynyl, pentyynyl, hexynyl, etc. The alkynyl group can be substituted or unsubstituted, and when substituted, it can be substituted at any usable linker. The substituent is selected from one or more of the following: D atom, alkoxy, halogen, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, hydroxy, hydroxyalkyl, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.
[0234] The term "alkoxy" refers to -O-(alkyl), where alkyl is defined as described above. Non-limiting examples include methoxy, ethoxy, propoxy, and butoxy, etc. Alkoxy groups can be substituted or unsubstituted, and when substituted, they can be substituted at any usable linker. Substituents are selected from one or more of the following: D atom, halogen, alkoxy, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, hydroxy, hydroxyalkyl, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.
[0235] The term "cycloalkyl" refers to a saturated or partially unsaturated monocyclic carbocyclic (i.e., monocyclic cycloalkyl) or polycyclic system (i.e., polycyclic cycloalkyl) having 3 to 20 (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) ring atoms (i.e., 3 to 20 membered cycloalkyl). In some embodiments, the cycloalkyl is a cycloalkyl having 3 to 12 ring atoms (i.e., 3 to 12 membered cycloalkyl) or a cycloalkyl having 4 to 11 ring atoms (i.e., 4 to 11 membered cycloalkyl), in some embodiments, a cycloalkyl having 3 to 8 ring atoms (i.e., 3 to 8 membered cycloalkyl), and in some embodiments, a cycloalkyl having 3 to 6 ring atoms (i.e., 3 to 6 membered cycloalkyl).
[0236] Non-limiting examples of the monocyclic cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cyclohexadienyl, cycloheptyl, cyclohepttrienyl, and cyclooctyl.
[0237] The polycyclic alkyl groups include: spirocyclic alkyl groups, fused cyclic alkyl groups, and bridged cyclic alkyl groups.
[0238] The term "spirocycloalkyl" refers to a polycyclic system in which rings share a single carbon atom (called a spiro atom), and the ring may contain one or more double bonds, or one or more heteroatoms selected from nitrogen, oxygen, and sulfur (the nitrogen may optionally be oxidized to form nitrogen oxides; the sulfur may optionally be oxidized to form sulfoxides or sulfones, but excluding -OO-, -OS-, or -SS-), provided that it contains at least one full carbon ring with a bonding point on that full carbon ring, having 5 to 20 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) ring atoms (i.e., 5 to 20-membered spirocycloalkyl). In some embodiments, the spirocycloalkyl is a spirocycloalkyl having 6 to 14 ring atoms (i.e., 6 to 14-membered spirocycloalkyl), and in some embodiments, it is a spirocycloalkyl having 7 to 10 ring atoms (i.e., 7 to 10-membered spirocycloalkyl). The spirocycloalkyl group includes monospirocycloalkyl and polyspirocycloalkyl (such as bispirocycloalkyl, etc.). In some embodiments, it is a monospirocycloalkyl or bispirocycloalkyl group. In some embodiments, it is a 3-membered / 4-membered, 3-membered / 5-membered, 3-membered / 6-membered, 4-membered / 4-membered, 4-membered / 5-membered, 4-membered / 6-membered, 5-membered / 3-membered, 5-membered / 4-membered, 5-membered / 5-membered, 5-membered / 6-membered, 5-membered / 7-membered, 6-membered / 3-membered, 6-membered / 4-membered, 6-membered / 5-membered, 6-membered / 6-membered, 6-membered / 7-membered, 7-membered / 5-membered, or 7-membered / 6-membered monospirocycloalkyl group. Non-limiting examples include:
[0239] Its connection point can be anywhere;
[0240] wait.
[0241] The term "fused cycloalkyl" refers to a polycyclic system in which two adjacent carbon atoms are shared between rings. This system is a monocyclic cycloalkyl group fused with one or more monocyclic cycloalkyl groups, or a monocyclic cycloalkyl group fused with one or more heterocyclic, aryl, or heteroaryl groups, wherein the bonding point is on the monocyclic cycloalkyl group, which may contain one or more double bonds and has 5 to 20 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) ring atoms (i.e., 5 to 20-membered fused cycloalkyl). In some embodiments, the fused cycloalkyl group is a fused cycloalkyl group having 6 to 14 ring atoms (i.e., 6 to 14-membered fused cycloalkyl), and in some embodiments, it is a fused cycloalkyl group having 7 to 10 ring atoms (i.e., 7 to 10-membered fused cycloalkyl). The fused cyclic alkyl group includes bicyclic fused cyclic alkyl groups and polycyclic fused cyclic alkyl groups (such as tricyclic fused cyclic alkyl groups, tetracyclic fused cyclic alkyl groups, etc.). In some embodiments, it is a bicyclic fused cyclic alkyl group or a tricyclic fused cyclic alkyl group. In some embodiments, it is a ternary / quadrivalent, ternary / quinary, ternary / six-membered, quadrivalent / quadrivalent, quadrivalent / five-membered, quadrivalent / six-membered, quadrivalent / quadrivalent, quadrivalent / six-membered, 5-member / tertiary, 5-member / quadrivalent, 5-member / five-membered, 5-member / six-membered, 5-member / seven-membered, 6-member / tertiary, 6-member / quadrivalent, 6-member / four-membered, 6-member / five-membered, 6-member / six-membered, 6-member / seven-membered, 7-member / five-membered, or 7-member / six-member bicyclic fused cyclic alkyl group. Non-limiting examples include:
[0242] Its connection point can be anywhere;
[0243] wait.
[0244] The term "bridged cycloalkyl" refers to a fully carbon polycyclic system in which two non-directly connected carbon atoms are shared between rings, and the ring may contain one or more double bonds and have 5 to 20 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) carbon atoms (i.e., 5 to 20-membered bridged cycloalkyl). In some embodiments, the bridged cycloalkyl is a bridged cycloalkyl with 6 to 14 carbon atoms (i.e., 6 to 14-membered bridged cycloalkyl), and in some embodiments, it is a bridged cycloalkyl with 7 to 10 carbon atoms (i.e., 7 to 10-membered bridged cycloalkyl). The bridged cycloalkyl includes bicyclic bridged cycloalkyl and polycyclic bridged cycloalkyl (e.g., tricyclic bridged cycloalkyl, tetracyclic bridged cycloalkyl, etc.), and in some embodiments, it is a bicyclic bridged cycloalkyl or a tricyclic bridged cycloalkyl. Non-limiting examples include:
[0245] Its connection point can be anywhere.
[0246] The cycloalkyl group can be substituted or unsubstituted. When substituted, it can be substituted at any usable connection point. The substituent is selected from one or more of the following: D atom, halogen, alkyl, alkoxy, haloalkyl, haloalkoxy, cycloalkyloxy, alkylthio, haloalkylthio, cycloalkylthio, heterocyclic thio, heterocyclic oxy, hydroxy, hydroxyalkyl, oxo, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.
[0247] The term "heterocyclic group" refers to a saturated or partially unsaturated monocyclic heterocycle (i.e., monocyclic heterocyclic group) or polycyclic heterocyclic system (i.e., polycyclic heterocyclic group) containing at least one (e.g., 1, 2, 3 or 4) heteroatoms selected from nitrogen, oxygen and sulfur (the nitrogen may optionally be oxidized, i.e., to form nitrogen oxides; the sulfur may optionally be oxidized, i.e., to form sulfoxides or sulfones, but excluding -OO-, -OS- or -SS-), and having 3 to 20 (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20) ring atoms (i.e., 3 to 20 membered heterocyclic groups). In some embodiments, the heterocyclic group is a heterocyclic group having 3 to 12 ring atoms (i.e., a 3 to 12-membered heterocyclic group) or a heterocyclic group having 4 to 11 ring atoms (i.e., a 4 to 11-membered heterocyclic group); in some embodiments, a heterocyclic group having 3 to 9 ring atoms (i.e., a 3 to 9-membered heterocyclic group); in some embodiments, a heterocyclic group having 3 to 8 ring atoms (i.e., a 3 to 8-membered heterocyclic group); in some embodiments, a heterocyclic group having 3 to 6 ring atoms (i.e., a 3 to 6-membered heterocyclic group); in some embodiments, a heterocyclic group having 5 or 6 ring atoms (i.e., a 5 or 6-membered heterocyclic group).
[0248] Non-limiting examples of the monocyclic heterocyclic group include: pyrrolidinyl, tetrahydropyranyl, 1,2,3,6-tetrahydropyridyl, piperidinyl, piperazinyl, morpholinyl, thiomorpholinyl, and homopiperazinyl, etc.
[0249] The polycyclic heterocyclic groups include spirocyclic heterocyclic groups, fused heterocyclic groups, and bridged heterocyclic groups.
[0250] The term "spiroheterocyclic group" refers to a polycyclic heterocyclic system in which rings share a single atom (called a spiro atom), which may contain one or more double bonds and at least one (e.g., 1, 2, 3, or 4) heteroatoms selected from nitrogen, oxygen, and sulfur (the nitrogen may optionally be oxidized to form nitrogen oxides; the sulfur may optionally be oxidized to form sulfoxides or sulfones, but excluding -OO-, -OS-, or -SS-), provided that at least one monocyclic heterocyclic group is present and the bonding point is on the monocyclic heterocyclic group, which has 5 to 20 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) ring atoms (i.e., 5 to 20-membered spiroheterocyclic groups). In some embodiments, the spiroheterocyclic group is a spiroheterocyclic group having 6 to 14 ring atoms (i.e., a 6 to 14-membered spiroheterocyclic group), and in some embodiments, it is a spiroheterocyclic group having 7 to 11 ring atoms (i.e., a 7 to 11-membered spiroheterocyclic group). The spiroheterocyclic group includes monospirocyclic and polyspirocyclic groups (such as bispirocyclic groups). In some embodiments, it is a monospirocyclic or bispirocyclic group. In some embodiments, it is a 3-membered / 4-membered, 3-membered / 5-membered, 3-membered / 6-membered, 4-membered / 4-membered, 4-membered / 5-membered, 4-membered / 6-membered, 5-membered / 3-membered, 5-membered / 4-membered, 5-membered / 5-membered, 5-membered / 6-membered, 5-membered / 7-membered, 6-membered / 3-membered, 6-membered / 4-membered, 6-membered / 5-membered, 6-membered / 6-membered, 6-membered / 7-membered, 7-membered / 5-membered, or 7-membered / 6-membered monospirocyclic group. Non-limiting examples include: wait.
[0251] The term "fused heterocyclic group" refers to a polycyclic heterocyclic system in which two adjacent atoms are shared between rings. The ring may contain one or more double bonds and at least one (e.g., 1, 2, 3, or 4) heteroatoms selected from nitrogen, oxygen, and sulfur (the nitrogen may optionally be oxidized to form nitrogen oxides; the sulfur may optionally be oxidized to form sulfoxides or sulfones, but excluding -OO-, -OS-, or -SS-). It is a monocyclic heterocyclic group fused with one or more monocyclic heterocyclic groups, or a monocyclic heterocyclic group fused with one or more cycloalkyl, aryl, or heteroaryl groups, wherein the bonding point is on the monocyclic heterocyclic group and has 5 to 20 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) ring atoms (i.e., 5 to 20 membered fused heterocyclic groups). In some embodiments, the fused heterocyclic group is a fused heterocyclic group having 6 to 14 ring atoms (i.e., a 6 to 14-membered fused heterocyclic group), and in some embodiments, a fused heterocyclic group having 7 to 11 ring atoms (i.e., a 7 to 11-membered fused heterocyclic group). The fused heterocyclic group includes bicyclic and polycyclic fused heterocyclic groups (such as tricyclic fused heterocyclic groups, tetracyclic fused heterocyclic groups, etc.). In some embodiments, it is a bicyclic or tricyclic fused heterocyclic group. In some embodiments, it is a 3-membered / 4-membered, 3-membered / 5-membered, 3-membered / 6-membered, 4-membered / 4-membered, 4-membered / 5-membered, 4-membered / 6-membered, 5-membered / 3-membered, 5-membered / 4-membered, 5-membered / 5-membered, 5-membered / 6-membered, 5-membered / 7-membered, 6-membered / 3-membered, 6-membered / 4-membered, 6-membered / 5-membered, 6-membered / 6-membered, 6-membered / 7-membered, 7-membered / 5-membered, or 7-membered / 6-membered bicyclic fused heterocyclic group. Non-limiting examples include: wait.
[0252] The term "bridged heterocyclic group" refers to a polycyclic heterocyclic system in which two non-directly bonded atoms are shared between the rings. The rings may contain one or more double bonds, and the system contains at least one (e.g., 1, 2, 3, or 4) heteroatoms selected from nitrogen, oxygen, and sulfur (the nitrogen may optionally be oxidized to form nitrogen oxides; the sulfur may optionally be oxidized to form sulfoxides or sulfones, but excluding -OO-, -OS-, or -SS-). The system has 5 to 20 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) ring atoms (i.e., a 5- to 20-membered bridged heterocyclic group). In some embodiments, the bridged heterocyclic group has 6 to 14 ring atoms (i.e., a 6- to 14-membered bridged heterocyclic group), and in some embodiments, it has 7 to 10 ring atoms (i.e., a 7- to 10-membered bridged heterocyclic group). Based on the number of constituent rings, heterocyclic groups can be classified into bicyclic bridged heterocyclic groups and multicyclic bridged heterocyclic groups (such as tricyclic bridged heterocyclic groups, tetracyclic bridged heterocyclic groups, etc.). In some embodiments, they are bicyclic bridged heterocyclic groups or tricyclic bridged heterocyclic groups. Non-limiting examples include:
[0253] wait.
[0254] The heterocyclic group can be substituted or unsubstituted. When substituted, it can be substituted at any usable connection point. The substituent is selected from one or more of the following: D atom, halogen, alkyl, alkoxy, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, alkylthio, haloalkylthio, cycloalkylthio, heterocyclic thio, hydroxy, hydroxyalkyl, oxo, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.
[0255] The term "aryl" refers to a monocyclic all-carbon aromatic ring (i.e., monocyclic aryl) or a polycyclic aromatic ring system (i.e., polycyclic aryl) having a conjugated π-electron system, having 6 to 14 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, or 14) ring atoms (i.e., 6 to 14-membered aryl). In some embodiments, the aryl group has 6 to 10 ring atoms (i.e., 6 to 10-membered aryl). The monocyclic aryl group is, for example, phenyl. Non-limiting examples of the polycyclic aryl group include naphthyl, anthraceneyl, phenanthrene, etc. The polycyclic aryl group further includes fusion of the phenyl group with one or more heterocyclic groups or cycloalkyl groups, or fusion of the naphthyl group with one or more heterocyclic groups or cycloalkyl groups, wherein the bonding point is on the phenyl or naphthyl group, and in this case, the number of ring atoms continues to represent the number of ring atoms in the polycyclic aromatic ring system, non-limiting examples including:
[0256] wait.
[0257] The aryl group can be substituted or unsubstituted. When substituted, it can be substituted at any usable connection point. The substituent is selected from one or more of the following: D atom, halogen, alkyl, alkoxy, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, hydroxyl, alkylthio, haloalkylthio, cycloalkylthio, heterocyclic thio, hydroxyalkyl, oxo, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.
[0258] The term "heteroaryl" refers to a monocyclic heteroaryl ring (i.e., monocyclic heteroaryl) or a polycyclic heteroaryl ring system (i.e., polycyclic heteroaryl) having a conjugated π-electron system, containing at least one (e.g., 1, 2, 3, or 4) heteroatoms selected from nitrogen, oxygen, and sulfur (the nitrogen may optionally be oxidized, i.e., to form nitrogen oxides; the sulfur may optionally be oxidized, i.e., to form sulfoxides or sulfones, but excluding -OO-, -OS-, or -SS-), having 5 to 14 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14) ring atoms (i.e., 5 to 14-membered heteroaryl). In some embodiments, the heteroaryl has 5 to 10 ring atoms (i.e., 5 to 10-membered heteroaryl), and in some embodiments, it has 5 or 6 ring atoms (i.e., 5 or 6-membered heteroaryl).
[0259] Non-limiting examples of the aforementioned monocyclic heteroaryl groups include: furanyl, thiopheneyl, thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiadiazolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, furazonyl, pyrroleyl, N-alkylpyrroleyl, pyridyl, pyrimidinyl, pyridoneyl, N-alkylpyridone (e.g.) (etc.), pyrazinyl, pyridazinyl, etc.
[0260] Non-limiting examples of the polycyclic heteroaryl groups include: indolyl, indazole, quinolinyl, isoquinolinyl, quinoxalinyl, phthalazinyl, benzimidazolyl, benzothiophene, quinazolinyl, benzothiazolyl, carbazole, etc. The polycyclic heteroaryl groups also include monocyclic heteroaryl groups fused with one or more aryl groups, wherein the connecting point is on the aromatic ring, and in this case, the number of ring atoms continues to represent the number of ring atoms in the polycyclic heteroaryl ring system. The polycyclic heteroaryl groups also include monocyclic heteroaryl groups fused with one or more cycloalkyl or heterocyclic groups, wherein the connecting point is on the monocyclic heteroaryl ring, and in this case, the number of ring atoms continues to represent the number of ring atoms in the polycyclic heteroaryl ring system. Non-limiting examples include: wait.
[0261] The heteroaryl group can be substituted or unsubstituted. When substituted, it can be substituted at any usable connection point. The substituent is selected from one or more of the following: D atom, halogen, alkyl, alkoxy, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, hydroxyl, alkylthio, haloalkylthio, cycloalkylthio, heterocyclic thio, hydroxyalkyl, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.
[0262] The aforementioned cycloalkyl, heterocyclic, aryl, and heteroaryl groups include residues derived from removing one hydrogen atom from a parent ring atom, or residues derived from removing two hydrogen atoms from the same ring atom or two different ring atoms of the parent ring, i.e., "cycloalkylene", "heterocyclicene", "arylene", and "heteroarylene". Non-limiting examples include: wait.
[0263] When a polycyclic system formed by the fusion of a monocyclic heterocyclic group with a cycloalkyl, aryl, or heteroaryl group is divalent, the polycyclic system is considered a "fused heterocyclic group" as long as one of the linking sites is on the monocyclic heterocyclic group; non-limiting examples include:
[0264] The term "cycloalkylalkyl" refers to an alkyl group that is substituted by one or more cycloalkyl groups, wherein the cycloalkyl and alkyl groups are as defined above.
[0265] The term "heterocyclic alkyl" refers to an alkyl group that is substituted by one or more heterocyclic groups, wherein the heterocyclic group and the alkyl group are as defined above.
[0266] The term "arylalkyl" refers to an alkyl group that is substituted with one or more aryl groups, wherein the aryl and alkyl groups are as defined above.
[0267] The term "heteroarylalkyl" refers to an alkyl group that is substituted by one or more heteroaryl groups, wherein the heteroaryl and alkyl groups are as defined above.
[0268] The term "cycloalkylalkenyl" refers to an alkenyl group that is substituted by one or more cycloalkyl groups, wherein the cycloalkyl and alkenyl groups are as defined above.
[0269] The term "heterocyclic alkenyl" refers to an alkenyl group that is replaced by one or more heterocyclic groups, wherein the heterocyclic group and alkenyl group are as defined above.
[0270] The term "aryl-alkenyl" refers to an alkenyl group that is replaced by one or more aryl groups, where the aryl and alkenyl groups are as defined above.
[0271] The term "heteroaryl-alkenyl" refers to an alkenyl group that is substituted by one or more heteroaryl groups, wherein the heteroaryl and alkenyl groups are as defined above.
[0272] The term "cycloalkylynyl" refers to an ynyl group being replaced by one or more cycloalkyl groups, wherein the cycloalkyl and ynyl groups are as defined above.
[0273] The term "heterocyclic alkynyl" refers to an alkynyl group that is replaced by one or more heterocyclic groups, wherein the heterocyclic group and the alkynyl group are as defined above.
[0274] The term "aryl-alkynyl" refers to an alkynyl group being replaced by one or more aryl groups, where the aryl and alkynyl groups are as defined above.
[0275] The term "heteroaryl-alkynyl" refers to an alkynyl group being replaced by one or more heteroaryl groups, where the heteroaryl and alkynyl groups are as defined above.
[0276] The term "cycloalkyloxy" refers to -O-cycloalkyl, where the cycloalkyl is as defined above.
[0277] The term "heterocyclic oxygen group" refers to an -O-heterocyclic group, wherein the heterocyclic group is as defined above.
[0278] The term "aryloxy group" refers to -O-aryl, where the aryl group is as defined above.
[0279] The term "heteroaryloxy" refers to -O-heteroaryl, where the heteroaryl is as defined above.
[0280] The term "aminoalkyl" refers to an alkyl group that is substituted with one or more amino groups, wherein the alkyl group is as defined above.
[0281] The term "alkoxyalkyl" refers to an alkyl group that is substituted with one or more alkoxy groups, wherein the alkoxy groups and alkyl groups are as defined above.
[0282] The term "haloalkyl" refers to an alkyl group that has been substituted with one or more halogens, wherein the alkyl group is as defined above.
[0283] The term "haloalkoxy" refers to an alkoxy group that is substituted by one or more halogens, wherein the alkoxy group is as defined above.
[0284] The term "hydroxyalkyl" refers to an alkyl group that is replaced by one or more hydroxyl groups, wherein the alkyl group is as defined above.
[0285] The term "halogen" refers to fluorine, chlorine, bromine, or iodine.
[0286] The term "hydroxyl group" refers to -OH.
[0287] The term "thiol" refers to -SH.
[0288] The term "amino" refers to -NH2.
[0289] The term "cyano" refers to -CN.
[0290] The term "nitro" refers to -NO2.
[0291] The term "oxo" or "oxo group" refers to "=O".
[0292] The term "carbonyl" refers to C=O.
[0293] The term "alkylthio" refers to -S-alkyl, where the alkyl group is as defined above.
[0294] The term "haloalkylthio" refers to an alkylthio group that is replaced by one or more halogens, wherein the alkylthio group is as defined above.
[0295] The term "cycloalkylthio" refers to -S-cycloalkyl, where the cycloalkyl group is as defined above.
[0296] The term "heterocyclic thio" refers to a -S-heterocyclic group, where the heterocyclic group is as defined above.
[0297] "THP" refers to 2-tetrahydropyranyl.
[0298] “TBDPS” refers to tert-butyldiphenylsilyl.
[0299] “Ms” refers to sulfonyl group.
[0300] “Cbz” refers to benzyloxycarbonyl.
[0301] “Boc” refers to tert-butyloxycarbonyl.
[0302] “Ac” refers to acetyl.
[0303] “Bn” refers to benzyl.
[0304] A "leaving group," or simply a group, is an atom or functional group that breaks off from a larger molecule in a chemical reaction. It's a term used in nucleophilic substitution and elimination reactions. In a nucleophilic substitution reaction, the reactant attacked by the nucleophile is called the substrate, and the atom or group of atoms that breaks off with a pair of electrons from the substrate molecule is called the leaving group. Groups that readily accept electrons and have a strong ability to accept negative charges are desirable leaving groups. The smaller the pKa of the conjugate acid of the leaving group, the easier it is for the leaving group to break off from other molecules. This is because a smaller pKa means the leaving group doesn't need to bond with other atoms and has a stronger tendency to exist as an anion (or an electrically neutral leaving group). Common leaving groups include, but are not limited to, halogens, -OTs, or -OH.
[0305] The compounds disclosed herein can exist in specific stereoisomer forms. The term "stereoisomer" refers to isomers with the same structure but different spatial arrangements of atoms. These include cis and trans (or Z and E) isomers, (-)- and (+)- isomers, (R)- and (S)- enantiomers, diastereomers, (D)- and (L)- isomers, tautomers, blocked isomers, conformational isomers, and mixtures thereof (such as racemic mixtures and mixtures of diastereomers). Substituents in the compounds disclosed herein may contain additional asymmetric atoms. All such stereoisomers and mixtures thereof are included within the scope of this disclosure. Optically active (-)- and (+)- isomers, (R)- and (S)- enantiomers, and (D)- and (L)- isomers can be prepared by chiral synthesis, chiral reagents, or other conventional techniques. This disclosure discloses an isomer of a compound, which can be prepared by asymmetric synthesis or with chiral auxiliaries, or, when the molecule contains a basic functional group (such as an amino group) or an acidic functional group (such as a carboxyl group), by forming a salt of the diastereomer with a suitable optically active acid or base, followed by diastereomer resolution using conventional methods known in the art to obtain the pure isomer. Furthermore, the separation of enantiomers and diastereomers is typically performed by chromatography.
[0306] In the chemical structure of the compounds described in this disclosure, the bonds... This indicates that the configuration is not specified; that is, if chiral isomers exist in the chemical structure, the bond... It can be Or simultaneously include Two configurations. For all carbon-carbon double bonds, even if only one configuration is named, both the Z-type and E-type are included.
[0307] The compounds disclosed herein may exist in various tautomer forms, and all such forms are included within the scope of this disclosure. The terms "tautomer" or "tautomer form" refer to a structural isomer that exists in equilibrium and readily transforms from one isomer to another. This includes all possible tautomers, i.e., existing as a single isomer or as a mixture of said tautomers in any proportion. Non-limiting examples include: keto-enols, imine-enamines, lactam-lactamimides, etc. Examples of lactam-lactamimide equilibrium are shown below:
[0308] When referring to the pyrazolyl group, it should be understood to include any one or a mixture of two tautomers of the following two structures:
[0309] All tautomers are within the scope of this disclosure, and the naming of compounds does not exclude any tautomers.
[0310] The compounds disclosed herein may comprise transisomers. The term "transisomer" refers to a conformational stereoisomer resulting from restricted or significantly slowed rotation around a single bond in a molecule (as a result of spatial interactions with other parts of the molecule and asymmetric substituents at the ends of the single bond), whose interconversion is slow enough to allow separation and isolation under predetermined conditions. For example, some compounds of this disclosure may exist as mixtures of transisomers (e.g., equal-proportion mixtures, mixtures enriched with one transisomer, etc.) or as a purified transisomer. The configuration of the transisomer can be specified using nomenclature (M)- and (P)- to designate the absolute configuration (see WO2021124222A1, WO2022109242A1, etc.).
[0311] The compounds disclosed herein, or pharmaceutically acceptable salts thereof, include solvates (e.g., hydrates, non-aqueous solvates) or non-solvents of the compounds thereof or pharmaceutically acceptable salts thereof.
[0312] The compounds disclosed herein include all suitable isotopic derivatives thereof. The term "isotopic derivative" refers to a compound in which at least one atom is replaced by an atom having the same atomic number but a different atomic mass. Examples of isotopes that may be introduced into the compounds of this disclosure include stable and radioactive isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, chlorine, bromine, and iodine, for example, […]. 2 H (deuterium, D) 3 H (tritium, T) 11 C 13 C 14 C 15 N、 17 O、 18 O、32 p、 33 p、 33 S, 34 S, 35 S, 36 S, 18 F, 36 Cl、 82 Br、 123 I, 124 I, 125 I, 129 I and 131 In some implementations, I is deuterium.
[0313] Compared to undeuterated drugs, deuterated drugs offer advantages such as reduced toxicity, increased drug stability, enhanced efficacy, and prolonged biological half-life. All isotopic variations of the compounds disclosed herein, regardless of radioactivity, are included within the scope of this disclosure. Each available hydrogen atom bonded to a carbon atom can be independently replaced by a deuterium atom, wherein the deuterium substitution can be partial or complete; partial deuterium substitution refers to the replacement of at least one hydrogen atom with at least one deuterium atom.
[0314] When a site is specifically designated as deuterium D, the site should be understood as having a deuterium abundance of at least 1,000 times greater than the natural abundance of deuterium (which is 0.015%) (i.e., at least 15% deuterium incorporation). The compounds in the examples having a natural abundance greater than deuterium can be at least 1000 times abundant deuterium (i.e., at least 15% deuterium doping), at least 2000 times abundant deuterium (i.e., at least 30% deuterium doping), at least 3000 times abundant deuterium (i.e., at least 45% deuterium doping), at least 3340 times abundant deuterium (i.e., at least 50.1% deuterium doping), at least 3500 times abundant deuterium (i.e., at least 52.5% deuterium doping), at least 4000 times abundant deuterium (i.e., at least 60% deuterium doping), or at least 4500 times abundant deuterium (i.e., at least 67.5% deuterium doping). The abundance of deuterium is at least 5000 times (i.e., at least 75% deuterium doping), at least 5500 times (i.e., at least 82.5% deuterium doping), at least 6000 times (i.e., at least 90% deuterium doping), at least 6333.3 times (i.e., at least 95% deuterium doping), at least 6466.7 times (i.e., at least 97% deuterium doping), at least 6600 times (i.e., at least 99% deuterium doping), at least 6633.3 times (i.e., at least 99.5% deuterium doping), or higher.
[0315] "Optional" or "optional" means that the event or situation described below may but is not necessarily to occur; it includes both the possibility that the event or situation may occur or not occur. For example, "C that is optionally substituted with a halogen or cyano group..." 1-6"Alkyl" includes cases where the alkyl group is substituted with a halogen or cyano group and cases where the alkyl group is not substituted with a halogen or cyano group.
[0316] "Substitution" or "substituted" refers to one or more hydrogen atoms in a group, in some embodiments 1 to 6, and in some embodiments 1 to 3 hydrogen atoms, which are independently substituted by the corresponding number of substituents. Those skilled in the art can determine possible or impossible substitutions without much effort (through experimentation or theory). For example, an amino or hydroxyl group with free hydrogen may be unstable when combined with a carbon atom having an unsaturated bond (such as an alkene).
[0317] "Pharmaceutical composition" means a mixture containing one or more of the compounds described herein or their pharmaceutically acceptable salts, along with other chemical components, such as pharmaceutically acceptable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration to a living organism, thereby promoting the absorption of the active ingredient and its biological activity.
[0318] "Pharmacologically acceptable salt" refers to the salt of the compounds disclosed herein, which may be selected from inorganic or organic salts. Such salts are safe and effective when used in mammals and possess the expected biological activity. They can be prepared separately during the final isolation and purification of the compound, or by reacting a suitable group with a suitable base or acid. Bases commonly used to form pharmaceutically acceptable salts include inorganic bases, such as sodium hydroxide and potassium hydroxide, and organic bases, such as ammonia. Acids commonly used to form pharmaceutically acceptable salts include both inorganic and organic acids.
[0319] For the purposes of pharmaceuticals or pharmacologically active agents, the term "therapeutic effective amount" refers to the amount of a drug or agent sufficient to achieve or at least partially achieve the intended effect. The determination of the therapeutic effective amount varies from person to person, depending on the recipient's age and general condition, as well as the specific active substance. The appropriate therapeutic effective amount in a given case can be determined by a person skilled in the art based on routine testing.
[0320] As used herein, the term "pharmaceutically acceptable" means that these compounds, materials, compositions, and / or dosage forms are suitable for contact with patient tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications, within reasonable medical judgment, have a reasonable benefit / risk ratio, and are effective for their intended use.
[0321] As used herein, the singular forms of “a,” “an,” and “the” include plural references, and vice versa, unless the context clearly indicates otherwise.
[0322] When the term "about" is applied to parameters such as pH, concentration, temperature, etc., it indicates that the parameter can vary by ±10%, and in some embodiments within ±5%. As those skilled in the art will understand, when a parameter is not critical, figures are typically given for illustrative purposes only and not as limitations. Detailed Implementation
[0323] The following embodiments are used to further describe this disclosure, but these embodiments are not intended to limit the scope of this disclosure.
[0324] Example
[0325] The structure of the compound was determined by nuclear magnetic resonance (NMR) and / or mass spectrometry (MS). NMR shifts (δ) were expressed in 10⁻¹⁰ ohms. -6 The unit (ppm) is given. NMR measurements were performed using a Bruker AVANCE-400 NMR spectrometer. The solvents used were deuterated dimethyl sulfoxide (DMSO-d6), deuterated chloroform (CDCl3), and deuterated methanol (CD3OD), with tetramethylsilane (TMS) as the internal standard.
[0326] MS measurements were performed using a Finnigan LCQAd (ESI) mass spectrometer (manufacturer: Thermo, model: Finnigan LCQ advantage MAX).
[0327] High-performance liquid chromatography (HPLC) analysis was performed using an Agilent HPLC 1200DAD, an Agilent HPLC 1200VWD, and a Waters HPLC e2695-2489 high-performance liquid chromatograph.
[0328] Chiral HPLC analysis was performed using an Agilent 1260 DAD high-performance liquid chromatograph.
[0329] High performance liquid chromatography (HPLC) was performed using Waters 2767, Waters 2767-SQ Detecor2, Shimadzu LC-20AP, and Gilson-281 preparative chromatographs.
[0330] Chiral preparation was performed using a Shimadzu LC-20AP preparative chromatograph.
[0331] The CombiFlash rapid preparation system uses a CombiFlash Rf200 (TELEDYNE ISCO).
[0332] Thin-layer chromatography silica gel plates are Yantai Huanghai HSGF254 or Qingdao GF254. The silica gel plates used in thin-layer chromatography (TLC) have a diameter of 0.15 mm to 0.2 mm, and the diameter of the silica gel plates used for thin-layer chromatography separation and purification products is 0.4 mm to 0.5 mm.
[0333] Silica gel column chromatography generally uses Yantai Huanghai silica gel with a mesh size of 200-300 as the carrier.
[0334] Mean inhibition rate of kinases and IC 50 The values were determined using a NovoStar microplate reader (BMG GmbH, Germany).
[0335] The known starting materials disclosed herein can be synthesized using or in accordance with methods known in the art, or can be purchased from companies such as ABCR GmbH & Co. KG, Acros Organics, Aldrich Chemical Company, Accela ChemBio Inc, and Darui Chemicals.
[0336] Unless otherwise specified in the examples, the reactions can be carried out under an argon or nitrogen atmosphere.
[0337] Argon or nitrogen atmosphere refers to a reaction flask connected to an argon or nitrogen gas balloon with a volume of approximately 1L.
[0338] A hydrogen atmosphere refers to a reaction vessel connected to a hydrogen balloon with a volume of approximately 1L.
[0339] The pressurized hydrogenation reaction was performed using a Parr 3916EKX hydrogenator and a Qinglan QL-500 hydrogen generator or an HC2-SS hydrogenator.
[0340] The hydrogenation reaction is usually carried out under vacuum, filled with hydrogen gas, and repeated 3 times.
[0341] The microwave reaction was performed using a CEM Discover-S 908860 microwave reactor.
[0342] Unless otherwise specified in the examples, "solution" refers to an aqueous solution.
[0343] Unless otherwise specified in the examples, the reaction temperature is room temperature, which is 20℃~30℃.
[0344] The reaction process in the examples was monitored using thin-layer chromatography (TLC). The developing solvent used in the reaction, the eluent system for column chromatography used to purify the compounds, and the developing solvent system for TLC included: A: dichloromethane / methanol system, B: n-hexane / ethyl acetate system, D: ethyl acetate / methanol, E: dichloromethane / ethyl acetate. The volume ratio of the solvent was adjusted according to the polarity of the compounds, and small amounts of basic or acidic reagents such as triethylamine and acetic acid could also be added for adjustment.
[0345] Example 1
[0346] 5 2 5 6 -dichloro-2 4 -Fluoro-4,10-dioxo-3 3 ,3 4 -dihydro-3 2 H-6-oxa-11-aza-3(8,3)-benzo[e][1,3]oxazinaza-1(4,2)-morpholinaza-2(1,3),5(1,4)-diphenylhexacyclic dodecaban-2 6 -Carboxylic acid 1
[0347] first step
[0348] 4-Bromo-2-(2-(((tert-butoxycarbonyl)amino)methyl)morpholine)-5-fluorobenzoic acid 1c
[0349] 4-Bromo-2,5-difluorobenzoic acid 1a (3 g, 12.66 mmol, Shanghai Bide) and (morpholino-2-ylmethyl)carbamate tert-butyl ester 1b (3.3 g, 15.26 mmol, Shanghai Bide) were dispersed in tetrahydrofuran (20 mL). Bis(trimethylsilyl)aminolithium (1 M, 50.80 mmol, 50.80 mL) was slowly added dropwise. After the addition was complete, the reaction was allowed to proceed for 12 hours. 2 M hydrochloric acid was slowly added dropwise to the system until it reached a weakly acidic state. The mixture was extracted with ethyl acetate, and the organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system A to give the title compound 1c (3.86 g, yield: 70.4%).
[0350] MS m / z(ESI):433.2[M+1].
[0351] Step 2
[0352] 4-Bromo-2-(2-(((tert-butoxycarbonyl)amino)methyl)morpholine)-5-fluorobenzoate methyl ester 1d
[0353] Compound 1c (3.8 g, 8.77 mmol) was dispersed in N,N-dimethylformamide (30 mL). Anhydrous potassium carbonate (2 g, 14.47 mmol) and methyl iodide (1.9 g, 13.38 mmol) were added sequentially to the above system. The mixture was reacted at room temperature for 30 minutes, extracted with ethyl acetate, and the organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system B to give the title compound 1d (3.10 g, yield: 79.0%).
[0354] MS m / z(ESI):447.3[M+1].
[0355] Step 3
[0356] (5-(2-(((tert-butoxycarbonyl)amino)methyl)morpholine)-2-fluoro-4-(methoxycarbonyl)phenyl)boronic acid 1e
[0357] Compound 1d (0.5 g, 1.12 mmol) was dispersed in 1,4-dioxane (15 mL), followed by the addition of pinacol diborate (0.43 g, 1.69 mmol), potassium acetate (0.3 g, 3.06 mmol), and 1,1'-bis(diphenylphosphino)ferrocene]palladium dichloride (80 mg, 0.11 mmol). The mixture was purged with nitrogen three times and heated to 100 °C for 16 hours. The mixture was then concentrated under reduced pressure to obtain crude title compound 1e (0.46 g), which was used directly in the next reaction without purification.
[0358] MS m / z(ESI): 413.2 [M+1].
[0359] Step 4
[0360] (3-Bromo-2-hydroxybenzyl) tert-butyl carbamate 1h
[0361] 1f of 3-bromo-2-hydroxybenzaldehyde (5.00 g, 24.9 mmol) and 1g of tert-butyl carbamate (8.74 g, 74.6 mmol) were dispersed in acetonitrile (35 mL) and cooled to 0 °C in an ice bath. Triethylsilane (11.9 mL, 74.6 mmol) and trifluoroacetic acid (3.81 mL, 49.7 mmol) were added dropwise to the system, and the mixture was heated to 35 °C and reacted for 5 hours. The reaction was continued to be stirred at room temperature for 15 hours, and water was added and the mixture was stirred for another 1.5 hours. The mixture was filtered, and the filter cake was washed with a mixed solvent of acetonitrile and water (V / V = 1:2), then washed with n-hexane, and dried under reduced pressure to obtain crude title compound 1h (8.6 g), which was used directly in the next reaction without purification.
[0362] MS m / z(ESI): 300.1 [M-1].
[0363] Step 5
[0364] 8-Bromo-2H-benzo[e][1,3]oxazine-3(4H)-tert-butyl formate 1i
[0365] Compound 1h (4.60 g, 15.22 mmol) was dissolved in acetonitrile (30 mL), and formaldehyde aqueous solution (5 g, 61.61 mmol) and formic acid (14 g, 0.31 mol) were added sequentially. The mixture was heated to 56 °C and reacted for 7 hours. The reaction was continued to be stirred at room temperature for 30 minutes, and water was added and the mixture was stirred for another 0.5 hours. The mixture was filtered, and the filter cake was washed with a mixed solvent of acetonitrile and water (V / V = 1:2). After drying under reduced pressure, the title compound 1i (3.5 g, yield: 73.2%) was obtained.
[0366] MS m / z(ESI):214.1[M-99].
[0367] Step 6
[0368] 8-Bromo-3,4-dihydro-2H-benzo[e][1,3]oxazine1j
[0369] Compound 1i (0.2 g, 0.64 mmol) was dissolved in dichloromethane (6 mL), and a solution of 1,4-dioxane (4 M, 6.36 mmol, 1.59 mL) of hydrogen chloride was added to this system. The reaction was carried out at room temperature for 2 hours. The solution was evaporated under reduced pressure to obtain crude title compound 1j (160 mg), which was used directly in the next step of the reaction without purification.
[0370] Step 7
[0371] (8-Bromo-2H-benzo[e][1,3]oxazine-3(4H)-yl)(2,6-dichloro-4-fluorophenyl)methyl ketone 1k
[0372] Compound 1j (160 mg, 0.64 mmol) was dispersed in dichloromethane (10 mL). 2,6-Dichloro-4-fluorobenzoyl chloride (300 mg, 1.32 mmol, prepared by the method disclosed in intermediate L2 on page 75 of patent application "WO2023235305") and diisopropylethylamine (0.5 g, 3.87 mmol, 0.64 mL) were added to the above system, and the mixture was stirred for 12 hours. The filtrate was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 1k (116 mg, yield: 44.8%).
[0373] MS m / z(ESI):404.0[M+1].
[0374] Step 8
[0375] 1l of tert-butyl 4-(4-(8-bromo-3,4-dihydro-2H-benzo[e][1,3]oxazine-3-carbonyl)-3,5-dichlorophenoxy)butyrate
[0376] 4-Hydroxybutyrate tert-butyl ester (110 mg, 0.69 mmol) was dispersed in N-methylpyrrolidone (1 mL), potassium tert-butoxide (1 M, 0.68 mmol) was added to the above system, and the mixture was stirred for 10 minutes. Then, compound 1k (55 mg, 135.78 μmol) was added to the above mixture, and the mixture was stirred for another hour. The filtrate was concentrated under reduced pressure, and the residue was purified by column chromatography with eluent system B to give the title compound 1l (20 mg, yield: 27.0%).
[0377] Step 9
[0378] 4-(3-(4-(4-(tert-butoxy)-4-oxobutoxy)-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-2-(2-(((tert-butoxycarbonyl)amino)methyl)morpholine)-5-fluorobenzoate methyl 1m
[0379] Compound 1l (10 mg, 18.34 μmol) and (5-(2-(((tert-butoxycarbonyl)amino)methyl)morpholine)-2-fluoro-4-(methoxycarbonyl)phenyl)boronic acid 1e (40 mg, 97.04 μmol) were dispersed in 1,4-dioxane (3 mL). Tetraphenylphosphine palladium (10 mg, 8.65 μmol), sodium carbonate (25 mg, 0.24 mmol), and water (0.8 mL) were added sequentially to the above system. The mixture was purged with nitrogen three times and heated to 100 °C for 3 hours. The filtrate was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 1m (15 mg, yield: 98.2%). MS m / z (ESI): 778.2 [M-55].
[0380] Step 10
[0381] 4-(4-(8-(5-(2-(aminomethyl)morpholine)-2-fluoro-4-(methoxycarbonyl)phenyl)-3,4-dihydro-2H-benzo[e][1,3]oxazine-3-carbonyl)-3,5-dichlorophenoxy)butyric acid 1n
[0382] Compound 1m (21 mg, 0.27 mmol) was dissolved in dichloromethane (2 mL), and a solution of 1,4-dioxane in hydrogen chloride (3 mL) was added to the above system. The reaction was carried out at room temperature for 1 hour, and the crude title compound 1n (19 mg) was obtained by evaporation under reduced pressure. It was used directly in the next reaction without purification.
[0383] MS m / z(ESI): 676.3 [M+1].
[0384] Step 11
[0385] 5 2 5 6 -dichloro-2 4 -Fluoro-4,10-dioxo-3 3 ,3 4 -dihydro-3 2 H-6-oxa-11-aza-3(8,3)-benzo[e][1,3]oxazinaza-1(4,2)-morpholinaza-2(1,3),5(1,4)-diphenylhexacyclic dodecaban-2 6 -Methyl carboxylate 1o
[0386] Compound 1n (10 mg, 0.15 mmol) was dispersed in dichloromethane (10 mL). Bis(dimethylamino)methylenetriazole[4,5-B]pyridine 3-oxide, hexafluorophosphate (12 mg, 0.32 mmol), and N,N-diisopropylethylamine (20 mg, 0.16 mmol) were added sequentially to the above system. The mixture was stirred and reacted for half an hour. The crude product, title compound 1o (10 mg), was concentrated under reduced pressure and used directly in the next reaction without purification.
[0387] MS m / z(ESI): 658.1 [M+1].
[0388] Step Twelve
[0389] 5 2 5 6 -dichloro-2 4 -Fluoro-4,10-dioxo-3 3 ,3 4 -dihydro-3 2 H-6-oxa-11-aza-3(8,3)-benzo[e][1,3]oxazinaza-1(4,2)-morpholinaza-2(1,3),5(1,4)-diphenylhexacyclic dodecaban-2 6 -Carboxylic acid 1
[0390] Compound 1o (10 mg, 0.15 mmol) and lithium hydroxide (6 mg, 142.98 μmol) were dispersed in methanol (2 mL). 1,4-dioxane (1 mL) and water (0.5 mL) were added sequentially to the above system. The mixture was stirred for 12 hours, filtered, and the filtrate was purified by high performance liquid chromatography (column: ODS-BIO C18, 5 μm 30*250 mm; mobile phase: aqueous phase (0.1% ammonium bicarbonate) and acetonitrile, gradient ratio: acetonitrile 20%-95%) to obtain title compound 1 (3 mg, yield: 10.7%).
[0391] MS m / z(ESI): 644.2 [M+1].
[0392] 1 H NMR(500MHz,CD3OD)δ7.25-7.23(m,2H),7.24-7.05(m,5H),5.37-5.31(m,1H),5.29-5 .27(m,1H),5.01-4.99(m,1H),4.92-4.88(m,1H),4.19-4.15(m,1H),3.83-3.78(m,1H) ,3.76-3.72(m,1H),3.64-3.60(m,1H),3.27-3.26(m,3H),3.04-2.95(m,2H),2.61-2. 57(m,1H),2.37-2.26(m,2H),2.20-2.17(t,1H),2.16-2.14(m,1H),2.10-2.06(m,1H).
[0393] Example 2
[0394] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-6,11-dioxa-3(8,3)-benzo[e][1,3]oxazinza-1(4,2)-morpholinza-2(1,3),5(1,4)-diphenylhexacyclododecano-2 6 -Carboxylic acid 2
[0395] first step
[0396] 8-(4,4,5,5-Tetramethyl-1,3,2-dioxoborhexacyclopentan-2-yl)-2H-benzo[e][1,3]oxazine-3(4H)-tert-butyl formate 2a
[0397] Compound 1i (1.2 g, 3.82 mmol) was dispersed in 1,4-dioxane (15 mL), followed by the addition of pinacol diborate (1.3 g, 5.12 mmol), potassium acetate (1.32 g, 13.45 mmol), and 1'-bis(diphenylphosphino)ferrocene]palladium dichloride (280 mg, 0.38 mmol). The mixture was purged with nitrogen three times and heated to 100 °C for 16 hours. The filtrate was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 2a (1.35 g, yield: 97.8%).
[0398] MS m / z(ESI):262.2[M-99].
[0399] Step 2
[0400] (R)-2-((4-((tert-butyldimethylsilyl)oxy)butoxy)methyl)morpholine-4-carboxylic acid tert-butyl ester 2d
[0401] (R)-2-(hydroxymethyl)morpholine-4-carboxylic acid tert-butyl ester 2b (2 g, 9.21 mmol, Shanghai Titan) was dissolved in N,N-dimethylformamide (30 mL), cooled to 0°C in an ice bath, and sodium hydrogen (0.75 g, 19.57 mmol) was added in portions. The reaction was stirred for another half hour, and then 4-bromobutoxy-tert-butyl-dimethylsilane 2c (3 g, 11.22 mmol, Shanghai Titan) was added. The mixture was allowed to rise naturally to room temperature, stirred for 12 hours, and the reaction was quenched with water. The mixture was extracted with dichloromethane, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was then purified by column chromatography using eluent system B to obtain the title compound, yielding title compound 2d (2.2 g, yield: 59.2%).
[0402] Step 3
[0403] (R)-4-(morpholino-2-ylmethoxy)but-1-ol 2e
[0404] Compound 2d (2.2 g, 5.45 mmol) was dissolved in dichloromethane (5 mL), and a 1,4-dioxane solution of hydrogen chloride (4 M, 10 mL) was added to the above system. The mixture was stirred for 4 hours and concentrated under reduced pressure to obtain crude title compound 2e (1 g), which was used directly in the next reaction without purification.
[0405] Step 4
[0406] (R)-4-bromo-5-fluoro-2-(2-((4-hydroxybutoxy)methyl)morpholine)benzoic acid 2f
[0407] 4-Bromo-2,5-difluorobenzoic acid (1.2 g, 5.06 mmol, Shanghai Shaoyuan) and compound 2e (1 g, 5.28 mmol) were dispersed in tetrahydrofuran (10 mL), and a tetrahydrofuran solution of bis(trimethylsilyl)aminolithium (1 M, 25.28 mmol) was added dropwise. The mixture was stirred for 12 hours, neutralized with 2 M formic acid solution, added with water, extracted with dichloromethane, dried over anhydrous sodium sulfate, filtered, and the filtrate was evaporated under reduced pressure to obtain crude title compound 2f (2 g), which was used directly in the next reaction without purification.
[0408] Step 5
[0409] 2g of (R)-4-bromo-5-fluoro-2-(2-((4-hydroxybutoxy)methyl)morpholine)benzoate
[0410] Compound 2f (2 g, 4.92 mmol) was dissolved in N,N-dimethylformamide (10 mL). Anhydrous potassium carbonate (2 g, 14.47 mmol) and iodomethane (1.4 g, 9.86 mmol) were added sequentially to the above system. The mixture was stirred for 12 hours, concentrated under reduced pressure, and then purified by column chromatography with eluent system B to give the title compound 2 g (1.65 g, yield: 79.8%).
[0411] MS m / z(ESI):420.2[M+1].
[0412] Step 6
[0413] (R)-8-(2-fluoro-5-(2-((4-hydroxybutoxy)methyl)morpholine)-4-(methoxycarbonyl)phenyl)-2H-benzo[e][1,3]oxazine-3(4H)-tert-butyl formate 2h
[0414] Compound 2a (0.1 g, 276.82 μmol), compound 2 g (0.12 g, 0.29 mmol), tetraphenylphosphine palladium (16 mg, 0.14 mmol), and sodium carbonate (100 mg, 0.94 mmol) were dispersed sequentially in 1,4-dioxane (8 mL). Water (0.8 mL) was then added to the above system, the mixture was purged with nitrogen three times, and heated to 100 °C for 3 hours. 15 mL of water was added to the reaction solution, and the mixture was extracted with dichloromethane (15 mL × 3). The organic phase was dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system B to obtain the title compound 2h (156 mg, yield: 98.1%).
[0415] MS m / z(ESI): 575.5 [M+1].
[0416] Step 7 (R)-4-(3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluoro-2-(2-((4-hydroxybutoxy)methyl)morpholine)methyl benzoate 2i
[0417] Compound 2h (150 mg, 0.26 mmol) was dissolved in dichloromethane (10 mL), and a 1,4-dioxane solution of hydrogen chloride (4 M, 2.63 mmol) was added to the above system. The mixture was stirred until the starting material disappeared, and then concentrated under reduced pressure to obtain crude title compound 2i (133 mg). The product was directly used for the next reaction without purification.
[0418] Step 8
[0419] (R)-4-(3-(2,6-dichloro-4-fluorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluoro-2-(2-((4-hydroxybutoxy)methyl)morpholine)methyl benzoate 2j
[0420] Compound 2i (30 mg, 0.59 mmol) was dispersed in dichloromethane (3 mL). 2,6-Dichloro-4-fluorobenzoyl chloride (21 mg, 0.92 mmol, prepared by the method disclosed in intermediate L2 on page 75 of patent application "WO2023235305") and diisopropylethylamine (50 g, 0.39 mmol) were added to the above system, and the mixture was stirred for 12 hours. The filtrate was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 2j (15 mg, yield: 38.4%).
[0421] MS m / z(ESI): 665.3 [M+1].
[0422] Step 9
[0423] (R)-4-(3-(2,6-dichloro-4-fluorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluoro-2-(2-((4-hydroxybutoxy)methyl)morpholine)benzoic acid 2k
[0424] Compound 2j (15 mg, 0.23 mmol) was dissolved in N,N-dimethylformamide (1 mL). Lithium hydroxide (15 mg, 0.36 mmol) and water (0.5 mL) were added to the above system in sequence. The mixture was stirred until the starting material disappeared. The mixture was then concentrated under reduced pressure to obtain the crude title compound 2k (15 mg).
[0425] MS m / z(ESI): 651.2 [M+1].
[0426] Step 10
[0427] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-6,11-dioxa-3(8,3)-benzo[e][1,3]oxazinza-1(4,2)-morpholinza-2(1,3),5(1,4)-diphenylhexacyclododecano-2 6 -Carboxylic acid 2
[0428] Compound 2k (15 mg, 0.23 mmol) was dispersed in N,N-dimethylformamide (1 mL), sodium hydride (12 mg, 0.30 mmol) was added, the mixture was heated to 70 °C and reacted for 12 hours, quenched with methanol (2 mL), filtered, and the filtrate was purified by high performance liquid chromatography (HPLC) (column: ODS-BIO C18, 5 μm 30*250 mm; mobile phase: aqueous phase (0.1% FA) and acetonitrile, gradient ratio: aqueous phase 40%-75%) to give title compound 2 (2 mg, yield: 13.8%). MS m / z (ESI): 631.2 [M+1].
[0429] 1 H NMR(500MHz,CD3OD)δ7.57(brs,1H),7.43(brs,1H),7.31(d,1H),7.25(d,1H),7.17(d,1H),7. 10(t,1H),7.09-7.08(m,1H),5.39-5.33(m,2H),5.08-5.03(m,1H),4.60(s,1H),4.42-4.38(m, 1H),4.19-4.14(m,1H),4.11-4.05(m,1H),3.91-3.87(m,1H),3.61-3.55(m,3H),3.44-3.37(m ,3H),3.22-3.16(m,1H),3.02(d,1H),2.84-2.78(m,1H),2.02-1.93(m,2H),1.80-1.73(m,2H).
[0430] Example 3
[0431] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2H-6,10-dioxa-3(8,3)-benzo[e][1,3]oxazinza-1(4,2)-morpholinza-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 3
[0432] first step
[0433] (R)-2-((3-((tert-butyldimethylsilyl)oxy)propoxy)methyl)morpholine-4-carboxylic acid tert-butyl ester 3a
[0434] Compound 2b (2 g, 9.21 mmol) was dissolved in N,N-dimethylformamide (30 mL), sodium hydrogen (0.7 g, 18.27 mmol) was added at 0 °C, and the reaction was carried out for 0.5 h. (3-bromopropoxy)tert-butyldimethylsilane (2.8 g, 11.06 mmol) was added, and the reaction was continued for 18 h. Water (30 mL) was added, and the mixture was extracted with ethyl acetate (20 mL × 3). The organic phases were combined, washed with saturated sodium chloride solution (30 mL), dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure, and the residue was purified by silica gel column chromatography with eluent system B to give title compound 3a (1.6 g, yield 44.6%).
[0435] Step 2
[0436] (R)-3-(morpholino-2-ylmethoxy)prop-1-ol 3b
[0437] Compound 3a (1.6 g, 4.11 mmol) was dissolved in dichloromethane (2 mL), and 1,4-dioxane hydrochloric acid solution (10 mL, 4 M) was added. The mixture was stirred at room temperature for 3 hours, and the reaction solution was concentrated to give the title compound 3b (0.71 g, 98.7% yield).
[0438] MS m / z(ESI):176.1[M+1].
[0439] Step 3
[0440] (R)-4-bromo-5-fluoro-2-(2-(3-hydroxypropoxy)methyl)morpholine)benzoic acid 3c
[0441] 4-Bromo-2,5-difluorobenzoic acid (0.95 g, 4.01 mmol) and compound 3b (0.71 g, 4.05 mmol) were dissolved in tetrahydrofuran (10 mL), and hexamethyldisilamide lithium (1 M, 20.08 mmol) was added dropwise. The mixture was reacted at room temperature for 16 hours, followed by the addition of 2 M formic acid solution (2 mL), water (10 mL), and extraction with ethyl acetate (20 mL × 3). The organic phases were combined, washed with saturated sodium chloride solution (10 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to give the title compound 3c (1.5 g, 95.4% yield).
[0442] Step 4
[0443] (R)-4-bromo-5-fluoro-2-(2-(3-hydroxypropoxy)methyl)morpholine)methyl benzoate 3d
[0444] Compound 3c (1.5 g, 3.82 mmol), anhydrous potassium carbonate (1.59 g, 11.50 mmol), and iodomethane (1.63 g, 11.48 mmol) were dissolved in N,N-dimethylformamide (20 mL) and reacted at room temperature for 18 hours. Water (50 mL) was added, and the mixture was extracted with ethyl acetate (50 mL × 3). The organic phases were combined, washed with saturated sodium chloride solution (10 mL), dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure, and purified by silica gel column chromatography with eluent system B to give the title compound 3d (0.9 g, yield 57.9%).
[0445] MS m / z(ESI):406.1[M+1].
[0446] Step 5
[0447] (R)-8-(2-fluoro-5-(2-((3-hydroxypropoxy)methyl)morpholine)-4-(methoxycarbonyl)phenyl)-2H-benzo[e][1,3]oxazine-3(4H)-tert-butyl carboxylate
[0448] Compound 3d (0.3 g, 738.47 μmol) and compound 2a (0.27 g, 747.43 μmol), tetrakis(triphenylphosphine)palladium (85 mg, 73.56 μmol), sodium carbonate (0.23 g, 2.17 mmol), 1,4-dioxane (5 mL), and water (1 mL) were mixed and reacted at 100 °C for 3 hours under nitrogen atmosphere. The mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography with eluent system B to give the title compound 3e (0.38 g, yield 91.8%).
[0449] MS m / z(ESI): 561.8 [M+1].
[0450] Step 6
[0451] (R)-4-(3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluoro-2-(2-((3-hydroxypropoxy)methyl)morpholine)methyl benzoate 3f
[0452] Compound 3e (0.1 g, 178.38 μmol) was dissolved in dichloromethane (3 mL), and 1,4-dioxane hydrochloric acid solution (3 mL, 4 M) was added. The mixture was stirred at room temperature for 4 hours, and then concentrated under reduced pressure to give the title compound 3f (80 mg, crude product). The product was directly used in the next reaction without purification.
[0453] Step 7
[0454] (R)-4-(3-(2,6-dichloro-4-fluorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluoro-2-(2-((3-hydroxypropoxy)methyl)morpholine)methyl benzoate 3g
[0455] Compound 3f (80 mg, 173.73 μmol) was dissolved in dichloromethane (2 mL), and N,N-diisopropylethylamine (0.1 g, 773.74 μmol) was added. Then, 2,6-dichloro-4-fluorobenzoyl chloride (60 mg, 263.80 μmol, prepared by the method disclosed in Example L2 on page 75 of patent application "WO2023235305") was added dropwise. The mixture was stirred at room temperature for 14 hours, concentrated under reduced pressure, and the residue was purified by silica gel column chromatography with eluent system B to give the title compound 3 g (0.1 g, yield 88.4%).
[0456] MS m / z(ESI): 651.2 [M+1].
[0457] Step 8
[0458] (R)-4-(3-(2,6-dichloro-4-fluorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluoro-2-(2-(3-hydroxypropoxy)methyl)morpholine)benzoic acid 3h
[0459] 3 g (0.1 g, 153.50 μmol) of the compound was dissolved in N,N-dimethylformamide (3 mL) and water (1 mL), and lithium hydroxide (65 mg, 1.55 μmol) was added. The mixture was reacted at room temperature for 18 hours and concentrated under reduced pressure to obtain crude product 3h (97 mg). The product was directly used for the next reaction without purification.
[0460] MS m / z(ESI): 637.0 [M+1].
[0461] Step 9
[0462] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-6,10-dioxa-3(8,3)-benzo[e][1,3]oxazinza-1(4,2)-morpholinza-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 3
[0463] Compound 3h (97 mg, 152.17 μmol) was dissolved in N,N-dimethylformamide (2 mL), sodium hydride (61 mg, 1.53 μmol) was added, and the reaction was carried out at room temperature for 0.5 h, followed by a reaction at 70 °C for 4 h. Methanol (2 mL) and formic acid (0.1 mL) were added, and the reaction solution was concentrated. The residue was purified by preparative high performance liquid chromatography (Waters 2545, column: BostonPhlex ODS C18; 30*250 mm, 5 μm; mobile phase: water (0.1% TFA) and acetonitrile; flow rate: 30 mL / min, gradient ratio: acetonitrile 15%-95%) to give title compound 3 (10 mg, yield 16.4%). MS m / z (ESI): 617.0 [M+1].
[0464] 1 H NMR(500MHz, CDCl3)δ8.06(d,1H),7.74(d,1H),7.34(d,1H),7.27–7.22(m,2H) ,7.12(t,1H),6.99(d,1H),5.67(d,1H),5.08–4.97(m,2H),4.61(dd,2H),4.25 (dd,1H),4.11(dt,1H),3.99–3.91(m,2H),3.69(ddd,2H),3.56(ddd,1H),3.39 (dt,2H),3.01–2.95(m,2H),2.83(t,1H),2.10-2.05(m,1H),2.00-1.88(m,1H).
[0465] Example 4
[0466] (1 2 S)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2H-6,10-dioxa-3(8,3)-benzo[e][1,3]oxazinza-1(4,2)-morpholinza-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 4
[0467] Using the synthetic route of Example 3, the first step starting material 2b was replaced with (S)-2-hydroxymethylmorpholine-4-carboxylic acid tert-butyl ester (Shanghai Bide Pharmaceutical Co., Ltd.) to obtain title compound 4 (20 mg, yield: 15.1%).
[0468] MS m / z(ESI): 617.1 [M+1].
[0469] 1 H NMR(500MHz, CDCl3)δ8.06(d,1H),7.74(d,1H),7.34(d,1H),7.27–7.23(m,2H),7 .12(t,1H),6.98(d,1H),5.67(d,1H),5.05(dd,1H),5.00(d,1H),4.62(d,2H),4. 25(dd,1H),4.15–4.08(m,1H),3.98–3.91(m,2H),3.69(td,2H),3.60–3.53(m,1H ),3.43–3.35(m,2H),2.98(dd,2H),2.83(d,1H),2.03(m,1H),1.98–1.89(m,1H).
[0470] Example 5
[0471] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-6,9-dioxa-3(8,3)-benzo[e][1,3]oxazinza-1(4,2)-morpholinza-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 5
[0472] first step
[0473] (R)-2-((2-((tert-butyldimethylsilyl)oxy)ethoxy)methyl)morpholine-4-carboxylic acid tert-butyl ester 5a
[0474] Compound 2b (2 g, 9.21 mmol) was dissolved in N,N-dimethylformamide (30 mL), sodium hydrogen (0.7 g, 18.27 mmol) was added under ice bath, and the reaction was carried out under ice bath for half an hour. 2-bromoethoxy-tert-butyl-dimethylsilane (2.64 g, 11.04 mmol) was added, and the reaction was carried out overnight at room temperature. Water (50 mL) was added, and the mixture was extracted with dichloromethane (30 mL × 3). The organic phases were combined, washed with saturated sodium chloride solution (100 mL), dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure, and the residue was purified by silica gel column chromatography with eluent system B to give title compound 5a (2.8 g, 80.9% yield).
[0475] Step 2
[0476] (R)-2-((2-hydroxyethoxy)methyl)morpholine-4-carboxylic acid tert-butyl ester 5b
[0477] Compound 5a (2.8 g, 7.46 mmol) was dissolved in dichloromethane (5 mL) and 1,4-dioxane hydrochloric acid solution (3 mL, 4 M). The mixture was stirred at room temperature for 4 hours, and then concentrated under reduced pressure to give crude title compound 5b (1.45 g). The product was directly used in the next reaction without purification.
[0478] Step 3
[0479] (R)-2-(morpholino-2-ylmethoxy)ethanol-1-ol 5c
[0480] 4-Bromo-2,5-difluorobenzoic acid (1.7 g, 7.17 mmol) and compound 5b (1.45 g, 7.34 mmol) were dissolved in tetrahydrofuran (10 mL), and hexamethyldisilamide lithium (1 M, 35.86 mmol) was added dropwise. The mixture was reacted at room temperature for 18 hours. The solution was neutralized with 2 M formic acid (13 mL), water (30 mL) was added, and the mixture was extracted with dichloromethane (30 mL × 3). The combined organic phases were washed with saturated sodium chloride solution (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to give crude title compound 5c (2.5 g). The product was used directly for the next reaction without purification.
[0481] MS m / z(ESI): 378.0 [M+1].
[0482] Step 4
[0483] (R)-4-bromo-5-fluoro-2-(2-(2-hydroxyethoxy)methyl)morpholine)methyl benzoate 5d
[0484] Compound 5c (1.9 g, 5.02 mmol) was dissolved in N,N-dimethylformamide (12 mL). Anhydrous potassium carbonate (2.1 g, 15.19 mmol) and iodomethane (1 g, 7.05 mmol) were added to the reaction solution. The mixture was reacted at room temperature for 30 minutes until all the starting material was converted to the product. The product was concentrated under reduced pressure and the residue was purified by silica gel column chromatography with eluent system B to give the title compound 5d (2.5 g, 92.1% yield).
[0485] MS m / z(ESI):392.0[M+1].
[0486] Step 5
[0487] (R)-8-(2-fluoro-5-(2-((2-hydroxyethoxy)methyl)morpholine)-4-(methoxycarbonyl)phenyl)-2H-benzo[e][1,3]oxazine-3(4H)-tert-butyl carboxylate 5e
[0488] Compound 5d (0.12 g, 305.95 μmol), compound 2a (0.12 g, 332.19 μmol), tetraphenylphosphine palladium (35 mg, 30.29 μmol), sodium carbonate (0.1 g, 943.50 μmol), 1,4-dioxane (5 mL), and water (0.7 mL) were mixed and reacted at 100 °C for 3 hours under nitrogen purging protection. After cooling to room temperature, the mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography with eluent system B to give the title compound 5e (135 mg, 80.7%).
[0489] MS m / z(ESI): 547.2 [M+1].
[0490] Step 6
[0491] (R)-4-(3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluoro-2-(2-(2-hydroxyethoxy)methyl)morpholine)methyl benzoate 5f
[0492] Compound 5e (85 mg, 155.51 μmol) was dissolved in dichloromethane (3 mL), and 1,4-dioxane hydrochloric acid solution (3 mL, 4 M) was added. The mixture was stirred at room temperature for 4 hours, and then concentrated under reduced pressure to obtain the crude title compound 5f (69 mg). The product was directly used in the next reaction without purification.
[0493] Step 7
[0494] (R)-4-(3-(2,6-dichloro-4-fluorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluoro-2-(2-(2-hydroxyethoxy)methyl)morpholine)methyl benzoate 5g
[0495] Compound 5f (40 mg, 89.59 μmol) was dissolved in dichloromethane (4 mL) and N,N-diisopropylethylamine (58 mg, 448.77 μmol) was added. 2,6-dichloro-4-fluorobenzoyl chloride (25 mg, 109.92 μmol) was added dropwise using the method disclosed in intermediate L2 on page 75 of patent application "WO2023235305". The mixture was left at room temperature overnight, concentrated under reduced pressure, and the residue was purified by silica gel column chromatography with eluent system B to give 5 g (35 mg, yield 61.3%) of the title compound.
[0496] MS m / z(ESI): 637.1 [M+1].
[0497] Step 8
[0498] (R)-4-(3-(2,6-dichloro-4-fluorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluoro-2-(2-(2-hydroxyethoxy)methyl)morpholine)benzoic acid 5h
[0499] 5 g (25 mg, 39.22 μmol) of the compound was dissolved in N,N-dimethylformamide (2 mL) and water (1 mL), and lithium hydroxide (25 mg, 595.75 μmol) was added. The mixture was reacted at room temperature for 18 hours and then concentrated under reduced pressure to obtain crude product 5 h (24 mg). The product was directly used for the next reaction without purification.
[0500] MS m / z(ESI): 623.2 [M+1].
[0501] Step 9
[0502] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-6,9-dioxa-3(8,3)-benzo[e][1,3]oxazinza-1(4,2)-morpholinza-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 5
[0503] Compound 5h (24 mg, 38.50 μmol) was dissolved in N,N-dimethylformamide (2.5 mL), and sodium hydride (8 mg, 208.79 μmol) was added. The mixture was reacted at room temperature for 0.5 h, followed by reaction at 70 °C for 18 h. The reaction solution was concentrated, and the residue was purified by high performance liquid chromatography (Waters 2545, column: BostonPhlex ODS C18; 30*250 mm, 5 μm; mobile phase: water (0.1% TFA) and acetonitrile; flow rate: 30 mL / min, gradient ratio: acetonitrile 15%-95%) to give title compound 5 (4 mg, yield 17.2%).
[0504] MS m / z(ESI): 603.6 [M+1].
[0505] 1 H NMR(500MHz, CDCl3)δ8.08(d,1H),7.68(d,1H),7.61(d,1H),7.25(td,2H) ,7.11(t,1H),6.97(d,1H),5.74–5.68(m,1H),5.05(dd,1H),4.96(d,1H),4 .56(dd,2H),4.35–4.29(m,1H),4.25(dd,1H),3.99(td,1H),3.93–3.70(m ,4H),3.63(dd,1H),3.34(td,1H),3.17(t,1H),3.01(dt,1H),2.93(d,1H).
[0506] Example 6
[0507] (1 2 S)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-6,9-dioxa-3(8,3)-benzo[e][1,3]oxazinza-1(4,2)-morpholinza-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 6
[0508] Using the synthetic route of Example 5, the first-step starting material 2b (Shanghai Titan Pharmaceutical Co., Ltd.) was replaced with (S)-2-hydroxymethylmorpholine-4-carboxylic acid tert-butyl ester (Shanghai Bide Pharmaceutical Co., Ltd.) to obtain title compound 6 (30 mg), yield: 31.7%.
[0509] MS m / z(ESI): 603.2 [M+1].
[0510] 1 H NMR(500MHz,DMSO-d6)δ7.84(d,1H),7.62(d,1H),7.55(d,1H),7.37(d,1H),7.25(dd,1H),7.16–7.06(m,2H),5.44(dd,1H),5.17(d,1H),4.94( dd,1H),4.67(d,1H),4.54(dd,1H),4.34(dd,1H),4.11(dd,1H),3.75(d t,3H),3.70–3.57(m,3H),3.21–3.10(m,2H),2.99(d,1H),2.89(t,1H).
[0511] Example 7
[0512] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-7,10-dioxa-3(8,3)-benzo[e][1,3]oxazinza-1(4,2)-morpholinza-6(1,3)-azabutaneza-2(1,3)5(1,4)-diphenylhexacyclodecaban-2 6 -Carboxylic acid 7
[0513] first step
[0514] (R)-4-(3-(4-bromo-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluoro-2-(2-((2-hydroxyethoxy)methyl)morpholine)methyl benzoate 7a
[0515] Compound 5f (0.23 g, 515.16 μmol) was dissolved in dichloromethane (10 mL), and N,N-diisopropylethylamine (0.33 g, 2.55 mmol) was added. Then, 2,6-dichloro-4-bromobenzoyl chloride (0.16 g, 554.88 μmol, prepared by the method disclosed on page 63 of patent application "WO2012160464, Intermediate 10") was added dropwise. The mixture was stirred at room temperature for 14 hours, concentrated under reduced pressure, and the residue was purified by silica gel column chromatography using eluent system A to give title compound 7a (0.23 g, 97.1% yield).
[0516] MS m / z(ESI): 697.0 [M+1].
[0517] Step 2
[0518] (R)-4-(3-(4-bromo-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluoro-2-(2-(2-(2-(methanesulfonyl)oxy)ethoxy)methyl)morpholine)methyl benzoate 7b
[0519] Compound 7a (50 mg, 71.60 μmol) was dissolved in dichloromethane (3 mL), and triethylamine (22 mg, 217.41 μmol) was added dropwise, followed by methanesulfonyl chloride (20 mg, 174.59 μmol). The mixture was kept at room temperature for 2 hours, then water (5 mL) was added, and the mixture was extracted with dichloromethane (10 mL × 3). The organic phases were combined, washed with saturated sodium chloride solution (10 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to give the title compound 7b (55 mg, 98.9% yield).
[0520] MS m / z(ESI):775.0[M+1].
[0521] Step 3
[0522] (R)-4-(3-(4-bromo-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-2-(2-((2-((1-(tert-butoxycarbonyl)azabutane-3-yl)oxy)ethoxy)methyl)morpholine)-5-fluorobenzoic acid 7c
[0523] 3-hydroxyazacyclobutane-1-carboxylic acid tert-butyl ester (25 mg, 144.33 μmol) was dissolved in N,N-dimethylformamide (4 mL), sodium hydride (9 mg, 225.02 μmol) was added, and the mixture was stirred for 10 minutes. Compound 7b (55 mg, 70.84 μmol) was then added, and the mixture was reacted overnight at room temperature. The reaction was quenched with methanol (1 mL), and the reaction solution was concentrated. The residue was purified by high performance liquid chromatography (Waters 2545, column: BostonPhlex ODS C18; 30*250 mm, 5 μm; mobile phase: water (0.1% TFA) and acetonitrile; flow rate: 30 mL / min, gradient ratio: acetonitrile 15%-95%) to obtain the title compound 7c (10 mg, yield 16.8%).
[0524] MS m / z(ESI):838.1[M+1].
[0525] Step 4
[0526] (R)-2-(2-((2-(azabutane-3-yloxy)ethoxy)methyl)morpholine)-4-(3-(4-bromo-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluorobenzoic acid 7d
[0527] Compound 7c (10 mg, 11.91 μmol) was dissolved in dichloromethane (0.5 mL), and 1,4-dioxane hydrochloric acid solution (2 mL, 4 M) was added. The mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated to give the title compound 7d (8 mg, 90.8% yield).
[0528] MS m / z(ESI):738.1[M+1].
[0529] Step 5
[0530] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-7,10-dioxa-3(8,3)-benzo[e][1,3]oxazinza-1(4,2)-morpholinza-6(1,3)-azabutaneza-2(1,3)5(1,4)-diphenylhexacyclodecaban-2 6 -Carboxylic acid 7
[0531] Compound 7d (8 mg, 9.37 μmol) was dissolved in 1,4-dioxane (1 mL), tris(dibenzylacetone)dipalladium (2 mg, 2.18 μmol), 4,5-bis(diphenylphosphine-9,9-dimethyloxanthracene) (3 mg, 5.19 μmol), and cesium carbonate (15 mg, 46.04 μmol). The mixture was purged with nitrogen, heated to 110 °C, and stirred for 14 hours. The reaction solution was concentrated, and the residue was purified by high performance liquid chromatography (Waters 2545, column: BostonPhlex ODS C18; 30*250 mm, 5 μm; mobile phase: water (0.1% TFA) and acetonitrile; flow rate: 30 mL / min, gradient ratio: acetonitrile 15%-95%) to give title compound 7 (2 mg, yield 32.4%).
[0532] MS m / z(ESI): 658.0 [M+1].
[0533] 1H NMR(500MHz, CDCl3)δ8.06(d,1H),7.73(d,1H),7.38(d,1H),7.24(d,1H),7 .11(t,1H),6.55–6.51(m,1H),6.42(d,1H),5.62(d,1H),5.16(d,1H),5.01 (d,1H),4.62(d,1H),4.42–4.23(m,4H),4.02-3.97(m,4H),3.85(dd,2H),3 .72(d,1H),3.59(d,2H),3.44(d,2H),3.03–2.94(m,2H),2.46–2.36(m,1H).
[0534] Example 8
[0535] (1 2 S)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-7,10-dioxa-3(8,3)-benzo[e][1,3]oxazinza-1(4,2)-morpholinza-6(1,3)-azabutaneza-2(1,3)5(1,4)-diphenylhexacyclodecaban-2 6 -Carboxylic acid 8
[0536] Using the synthetic route from step one to step six of Example 5, compound 8a was prepared by replacing the starting material 2b (Shanghai Titan Pharmaceutical Co., Ltd.) in step one of Example 5 with (S)-2-hydroxymethylmorpholine-4-carboxylic acid tert-butyl ester (Shanghai Bide Pharmaceutical Co., Ltd.). Using the synthetic route of Example 7, compound 5f was replaced with compound 8a to prepare the title compound 8 (5 mg, yield: 16.8%).
[0537] MS m / z(ESI): 658.1 [M+1].
[0538] 1H NMR(500MHz, CDCl3)δ8.04(d,1H),7.70(d,1H),7.39–7.32(m,1H),7.22(d,1H) ),7.09(t,1H),6.51(s,1H),6.40(s,1H),5.60(d,1H),5.13(d,1H),4.98(d,1H ),4.60(d,1H),4.37(q,2H),4.30–4.20(m,2H),4.07–3.88(m,4H),3.88–3.78( m,2H),3.70(d,1H),3.56(d,2H),3.42(d,2H),3.03–2.90(m,2H),2.40(t,1H).
[0539] Example 9
[0540] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-7,10-dioxa-3-(8,3)-benzo[e][1,3]oxazin-1(4,2-morpholina-6-(1,4-piperidina-2-(1,3),5(1,4-diphenylcyclodecaenoban-2) 6 -Carboxylic acid 9
[0541] first step
[0542] (R)-4-(3-(4-bromo-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-2-(2-((2-((1-(tert-butoxycarbonyl)piperidin-4-yl)oxy)ethoxy)methyl)morpholine)-5-fluorobenzoic acid 9a
[0543] 4-Hydroxypiperidine-1-carboxylic acid tert-butyl ester (0.12 g, 596.24 μmol) was dissolved in N,N-dimethylformamide (1 mL), and sodium hydride (24 mg, 626.36 μmol) was added. The mixture was reacted at room temperature for 20 minutes, and then compound 7b (80 mg, 103.03 μmol) was added. The mixture was reacted at room temperature for 4 hours. After the reaction was completed, methanol (1 mL) was added to quench the reaction. The reaction solution was concentrated, and the residue was purified by high performance liquid chromatography (Waters 2545, column: BostonPhlex ODS C18; 30*250 mm, 5 μm; mobile phase: water (0.1% TFA) and acetonitrile; flow rate: 30 mL / min, gradient ratio: acetonitrile 15%-95%) to obtain title compound 9a (15 mg, yield 16.8%).
[0544] MS m / z(ESI):866.0[M+1].
[0545] Step 2
[0546] (R)-4-(3-(4-bromo-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluoro-2-(2-((2-(piperidin-4-yloxy)ethoxy)methyl)morpholine)benzoic acid 9b
[0547] Compound 9a (15 mg, 17.29 μmol) was dissolved in dichloromethane (0.5 mL), and 1,4-dioxane hydrochloric acid solution (2 mL, 4 M) was added. The mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated to give the title compound 9b (13 mg, 97.9% yield).
[0548] MS m / z(ESI):766.0[M+1].
[0549] Step 3
[0550] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-7,10-dioxa-3-(8,3)-benzo[e][1,3]oxazin-1(4,2-morpholina-6-(1,4-piperidina-2-(1,3),5(1,4-diphenylcyclodecaenoban-2) 6 -Carboxylic acid 9
[0551] Compound 9b (13 mg, 16.17 μmol) was dissolved in 1,4-dioxane (1 mL), bis(dibenzylacetone)palladium (4 mg, 4.37 μmol), 4,5-bisdiphenylphosphine-9,9-dimethyloxanthracene (5 mg, 8.65 μmol), and cesium carbonate (20 mg, 61.38 μmol). The mixture was purged with nitrogen, heated to 110 °C, and stirred for 14 hours. The reaction solution was concentrated, and the residue was purified by preparative high-performance liquid chromatography (Waters 2545, column: BostonPhlex ODS C18; 30*250 mm, 5 μm; mobile phase: water (0.1% TFA) and acetonitrile; flow rate: 30 mL / min, gradient ratio: acetonitrile 15%-95%) to give title compound 9 (1 mg, yield 9.0%).
[0552] MS m / z(ESI): 686.2 [M+1].
[0553] 1 H NMR(500MHz, CDCl3)δ8.07(d,1H),7.60(d,1H),7.32(d,2H),7.29(s,1H),7.13(t, 2H),5.50(d,1H),5.11–4.97(m,2H),4.75(d,1H),4.21(d,1H),4.02(s,1H),3.99–3 .92(m,1H),3.89(t,2H),3.80(t,1H),3.75(s,1H),3.69(dd,1H),3.59(dd,2H),3. 45–3.25(m,4H),3.21(d,1H),3.00(dd,2H),2.55(t,1H),2.12(d,3H),1.89(d,1H).
[0554] Example 10
[0555] (1 2 S)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-7,10-dioxa-3-(8,3)-benzo[e][1,3]oxazin-1(4,2-morpholina-6-(1,4-piperidina-2-(1,3),5(1,4-diphenylcyclodecaenoban-2) 6 -Carboxylic acid 10
[0556] Using the synthetic route of Example 9, compound 7b was replaced with compound 8c to obtain title compound 10 (3 mg, yield: 19.7%).
[0557] MS m / z(ESI): 686.2 [M+1].
[0558] 1 H NMR(500MHz, CDCl3)δ8.04(d,1H),7.61(d,1H),7.31(d,1H),7.23(d,1H),7.15–7.00 (m,2H),6.95(s,1H),5.49(d,1H),5.08(t,1H),4.98(d,1H),4.70(d,1H),4.64(s,1H) ,4.29–4.19(m,1H),4.01–3.77(m,4H),3.74–3.51(m,4H),3.36(dt,4H),3.11(d,1H) ,2.96(d,1H),2.43(t,1H),2.39–2.29(m,1H),2.01(s,2H),1.89(s,1H),1.80(s,1H).
[0559] Example 11
[0560] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-9-oxa-3(8,3)-benzo[e][1,3]oxazin-1(4,2)-morpholina-6(1,4)-piperazin-2(1,3),5(1,4)-diphenylcyclodecaban-2 6 -Carboxylic acid 11
[0561] first step
[0562] (R)-4-(3-(4-bromo-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluoro-2-(2-((2-oxoethoxy)methyl)morpholine)methyl benzoate 11a
[0563] Compound 7a (80 mg, 114.55 μmol) was dissolved in dichloromethane (5 mL), and Dysmartin oxidant (80 mg, 188.62 μmol) was added. The mixture was reacted at room temperature for 1.5 hours. After the reaction was completed, the mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography with eluent system B to give title compound 11a (40 mg, yield 50.1%). MS m / z (ESI): 695.2 [M+1].
[0564] Step 2
[0565] (R)-4-(2-((4-(5-(3-(4-bromo-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-4-fluoro-2-(methoxycarbonyl)phenyl)morpholin-2-yl)methoxy)ethyl)piperazine-1-carboxylic acid tert-butyl ester 11b
[0566] Compound 11a (40 mg, 57.44 μmol) and tert-butyl piperazine-1-carboxylate (21 mg, 112.75 μmol) were dissolved in dichloromethane (4 mL), stirred for 0.5 h, and sodium triethoxyborohydride (43 mg, 202.89 μmol) were added. The mixture was reacted at room temperature for 0.5 h. After the reaction was completed, water (5 mL) was added, and the mixture was extracted with dichloromethane (10 mL × 3). The organic phases were combined, washed with saturated sodium chloride solution (10 mL), dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure, and the residue was purified by silica gel column chromatography with eluent system B to give title compound 11b (8 mg, yield 16.1%). MS m / z (ESI): 865.0 [M+1].
[0567] Step 3
[0568] (R)-4-(3-(4-bromo-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluoro-2-(2-((2-(piperazin-1-yl)ethoxy)methyl)morpholine)methyl benzoate 11c
[0569] Compound 11b (8 mg, 9.23 μmol) was dissolved in dichloromethane (0.5 mL), and 1,4-dioxane hydrochloric acid solution (2 mL, 4 M) was added. The mixture was stirred at room temperature for 1 hour. The reaction solution was concentrated to give the title compound 11c (7 mg, 98.9% yield).
[0570] MS m / z(ESI):765.0[M+1].
[0571] Step 4
[0572] (1 2 R)-5 2 56 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-9-oxa-3(8,3)-benzo[e][1,3]oxazinza-1(4,2)-morpholinza-6(1,4)-piperazinza-2-(1,3),5-(1,4)-dibenzocyclodecaban-2 6 -Methyl carboxylate 11d
[0573] Compound 11c (7 mg, 8.72 μmol) was dissolved in dioxane (1 mL), bis(dibenzylacetone)palladium (2 mg, 2.18 μmol), 4,5-bisdiphenylphosphine-9,9-dimethyloxanthracene (3 mg, 5.19 μmol), and cesium carbonate (15 mg, 46.04 μmol). The mixture was purged with nitrogen, heated to 110 °C, and stirred for 14 hours. The reaction mixture was concentrated, and the crude product, title compound 11d (6 mg), was obtained without purification. The product was then directly used in the next reaction without purification.
[0574] MS m / z(ESI): 685.2 [M+1].
[0575] Step 5
[0576] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-9-oxa-3(8,3)-benzo[e][1,3]oxazin-1(4,2)-morpholina-6(1,4)-piperazin-2(1,3),5(1,4)-diphenylcyclodecaban-2 6 -Carboxylic acid 11
[0577] Compound 11d (6 mg) was dissolved in methanol (2 mL) and water (1 mL), and lithium hydroxide (4 mg, 95.32 μmol) was added. The mixture was reacted at room temperature for 3 hours, and then concentrated directly. The residue was purified by high performance liquid chromatography (Waters 2545, column: BostonPhlex ODS C18; 30*250 mm, 5 μm; mobile phase: water (0.1% TFA) and acetonitrile; flow rate: 30 mL / min, gradient ratio: acetonitrile 15%-95%) to give title compound 11 (1 mg, yield 20.4%).
[0578] MS m / z(ESI): 671.2 [M+1].
[0579] 1 H NMR(500MHz, CDCl3)δ8.06(d,1H),7.70(d,1H),7.38(dd,1H),7.28–7.23(m,1H),7.15–7.13(m,1H),6.88(s,1H),6.81(d,1H),5.61(s,1H) ),5.24(d,1H),5.07(d,1H),4.69(s,1H),4.22(d,1H),4.05–3.64(m,9H),3.45-3.55(m,4H),3.34(t,2H),3.18-2.99(m,4H),2.73(s,1H).
[0580] Example 12
[0581] (1 2 S)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-9-oxa-3(8,3)-benzo[e][1,3]oxazin-1(4,2)-morpholina-6(1,4)-piperazin-2(1,3),5(1,4)-diphenylcyclodecaban-2 6 -Carboxylic acid 12
[0582] Using the synthetic route of Example 11, compound 7a was replaced with compound 8b to obtain title compound 12 (10 mg), yield: 21.3%.
[0583] MS m / z(ESI): 671.2 [M+1].
[0584] 1 H NMR(500MHz,DMSO-d6)δ7.67(d,1H),7.61(d,1H),7.34(d,1H),7.30(dd,1 H),7.13–7.04(m,2H),7.00(d,1H),5.15(d,1H),5.04(d,1H),4.99–4.88(m ,2H),4.04(d,1H),3.87(dd,2H),3.72–3.62(m,2H),3.56–3.49(m,2H),3. 43(ddd,5H),3.14(d,1H),3.11–2.94(m,4H),2.80(ddd,1H),2.63(dd,3H).
[0585] Example 13
[0586] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-7,11-dioxa-3(8,3)-benzo[e][1,3]oxazinza-1(4,2)-morpholinza-6(1,3)-azabutaneza-2(1,3),5(1,4)-diphenylhexacyclic dodecaban-2 6 -Carboxylic acid 13
[0587] first step
[0588] (R)-4-(3-(4-bromo-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluoro-2-(2-((3-hydroxypropoxy)methyl)morpholine)methyl benzoate 13a
[0589] Compound 3f (250 mg, 0.50 mmol) was dissolved in dichloromethane (10 mL). Diisopropylethylamine (326 mg, 2.52 mmol) and 4-bromo-2,6-dichlorobenzoyl chloride (160 mg, 0.56 mmol, prepared by the method disclosed in intermediate 10 on page 63 of patent application "WO2012160464") were added sequentially to the above system. The mixture was stirred for 12 hours. The filtrate was concentrated under reduced pressure and the residue was purified by column chromatography with eluent system B to obtain title compound 13a (358 mg, yield: 99.9%).
[0590] MS m / z(ESI):711.1[M+1].
[0591] Step 2
[0592] (R)-4-(3-(4-bromo-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluoro-2-(2-((3-(((methanesulfonyl)oxy)propoxy)methyl)morpholine)methyl benzoate 13b
[0593] Compound 13a (0.2 g, 0.28 mmol) was dissolved in dichloromethane (2 mL). Triethylamine (66 mg, 0.65 mmol) and methanesulfonyl chloride (46 mg, 0.40 mmol) were added sequentially to the above system. The mixture was stirred for 20 minutes, extracted with saturated brine and ethyl acetate, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain crude title compound 13b (309 mg). The product was directly used for the next reaction without purification.
[0594] MS m / z(ESI):789.0[M+1].
[0595] Step 3
[0596] (R)-4-(3-(4-bromo-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-2-(2-((3-((1-
[0597] (tert-Butoxycarbonyl)azabutane-3-yl)oxy)propoxy)methyl)morpholine)-5-fluorobenzoic acid 13c: tert-butyl 3-hydroxyazabutane-1-carboxylate (0.22 g, 1.27 mmol, Shanghai Shaoyuan) was dissolved in N,N-dimethylformamide (2 mL). Sodium hydrogen (50 mg, 1.30 mmol) was added to the above system, and the mixture was stirred for 20 minutes. Then, compound 13b (0.1 g, 0.13 mmol) was added, and the mixture was stirred for 1 hour. The pH of the system was adjusted to 4 with 2 M formic acid solution. The mixture was extracted with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The filtrate was purified by column chromatography using eluent system B to give the title compound 13c (20 mg, yield: 18.5%).
[0598] MS m / z(ESI):852.0[M+1].
[0599] Step 4
[0600] (R)-2-(2-((3-(azabutane-3-yloxy)propoxy)methyl)morpholine)-4-(3-(4-bromo-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluorobenzoic acid 13d
[0601] Compound 13c (20 mg, 0.02 mmol) was dissolved in dichloromethane (3 mL), and trifluoroacetic acid (0.5 mL) was added to the above system. The mixture was stirred for 3 hours. The reaction solution was concentrated under reduced pressure to obtain the title compound 13d (19 mg, crude product).
[0602] MS m / z(ESI):752.0[M+1].
[0603] Step 5
[0604] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2H-7,11-dioxa-3(8,3)-benzo[e][1,3]oxazinza-1(4,2)-morpholinza-6(1,3)-azabutaneza-2(1,3),5(1,4)-diphenylhexacyclic dodecaban-2 6 -Carboxylic acid 13
[0605] Compound 13d (19 mg, 25 μmol) was dissolved in 1,4-dioxane (3 mL). Tris(dibenzylacetone)dipalladium (6 mg, 6.55 μmol), 4,5-bis(diphenylphosphine)-9,9-dimethyloxanthracene (12 mg, 20.74 μmol), and cesium carbonate (50 mg, 153.46 μmol) were added sequentially to the above system. The mixture was purged with nitrogen three times, heated to 110 °C, stirred for 10 hours, cooled to room temperature, and the pH was adjusted to 3 with 2 M formic acid. The mixture was filtered, and the filtrate was purified by high performance liquid chromatography (column: ODS-BIO C18, 5 μm 30*250 mm; mobile phase: aqueous phase (0.1% FA) and acetonitrile, gradient ratio: aqueous phase 40%-75%) to obtain title compound 13 (3 mg, yield: 17.7%).
[0606] MS m / z(ESI): 672.3 [M+1].
[0607] 1 H NMR(500MHz,CD3Cl3)δ8.03(d,1H),7.92(d,1H),7.42-7.39(m,1H),7.20(d,1H),7.08(t,1H),6.49(s,1H) ,6.38(s,1H),5.67(d,1H),5.20(d,1H),5.04(d,1H),4.53(d,1H),4.46-4.44(m,1H),4.27(d,1H),4.18-4 .15(m,1H),4.05-4.02(m,2H),3.99-3.94(m,2H),3.76(d,1H),3.68-3.65(m,1H),3.61-3.57(m,2H),3.53 -3.49(m,2H),3.39(t,1H),3.29(d,1H),2.98(d,1H),2.83(d,1H),2.31(t,1H),1.91(t,1H),1.77(t,1H).
[0608] Example 14
[0609] (1 2 S)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,34 -dihydro-3 2 H-7,11-dioxa-3(8,3)-benzo[e][1,3]oxazinza-1(4,2)-morpholinza-6-(1,3)-azabutaneza-2(1,3,5(1,4)-diphenylhexacyclic dodecaban-2 6 -Carboxylic acid 14
[0610] Method 1
[0611] Using the synthetic route from step one to step six of Example 3, the starting material 2b (Shanghai Titan Pharmaceutical Co., Ltd.) in step one of Example 3 was replaced with (S)-2-hydroxymethylmorpholine-4-carboxylic acid tert-butyl ester (Shanghai Bide Pharmaceutical Co., Ltd.) to obtain intermediate 14a. Using the synthetic route from step one to step five of Example 13, compound 3f was replaced with compound 14a to obtain title compound 14 (2 mg), yield: 5.2%.
[0612] MS m / z(ESI): 672.1 [M+1].
[0613] 1 H NMR(500MHz, CDCl3)δ8.06(d,1H),7.95(d,1H),7.46–7.42(m,1H),7.23(d,1H),7.14–7.07(m,1H) ,6.53(d,1H),6.41(s,1H),5.70(d,1H),5.23(d,1H),5.07(d,1H),4.56(d,1H),4.49(s,1H),4.30( d,1H),4.20(t,1H),4.07(d,2H),4.04–3.97(m,2H),3.79(d,1H),3.69(s,1H),3.62(t,2H),3.53( d,2H),3.42(t,1H),3.33(d,1H),3.02(d,1H),2.87(d,1H),2.35(t,1H),1.94(s,1H),1.81(m,1H).
[0614] Method 2
[0615] first step
[0616] (S)-2-((3-((tert-butyldimethylsilyl)oxy)propoxy)methyl)morpholine-4-carboxylic acid tert-butyl ester 14g
[0617] Compound 14f (5 g, 23.01 mmol) and (3-bromopropoxy) tert-butyldimethylsilane (7 g, 27.64 mmol) were dissolved in N,N-dimethylformamide (50 mL), and sodium hydrogen (2.7 g, 70.47 mmol, 60% purity) was added in portions. The mixture was stirred overnight, extracted with ethyl acetate and water, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated to give 14 g (9.5 g) of crude product.
[0618] Step 2
[0619] (S)-3-(morpholino-2-ylmethoxy)prop-1-ol 14h
[0620] 14 g (9.5 g, 24.38 mmol) of the compound was dissolved in dichloromethane (15 mL), and dioxane hydrochloride (4 M, 48.00 mmol, 12 mL) was added. The mixture was reacted at room temperature for 1 hour, and then concentrated to dryness to obtain crude product 14 h (11 g).
[0621] MS m / z(ESI): 176.2 [M+1].
[0622] Step 3
[0623] (S)-4-bromo-5-fluoro-2-(2-((3-hydroxypropoxy)methyl)morpholine)benzoic acid 14i
[0624] Compound 4-bromo-2,5-difluorobenzoic acid (6 g, 25.32 mmol) was dissolved in tetrahydrofuran (20 mL) for 14 h (5.36 g, 25.32 mmol), and bis(trimethylsilylamino)lithium (1 M, 126.70 mmol) was added dropwise. The reaction was carried out at room temperature for 12 h, neutralized with 2 mol / L formic acid aqueous solution, extracted with dichloromethane and water, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated to give crude product 14i (11 g).
[0625] MS m / z(ESI):392.1[M+1].
[0626] Step 4
[0627] (S)-4-bromo-5-fluoro-2-(2-((3-hydroxypropoxy)methyl)morpholine)methyl benzoate 14j
[0628] Compound 14i (11 g, 28.05 mmol) was dissolved in N,N-dimethylformamide (30 mL), and anhydrous potassium carbonate (7.8 g, 56.44 mmol) and iodomethane (4.5 g, 31.71 mmol) were added sequentially. The mixture was reacted at room temperature for 30 minutes, extracted with ethyl acetate and water, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated to obtain the crude product. The residue was purified by column chromatography using eluent system B to give the title compound, orange oil 14j (2.4 g, yield: 21.1%).
[0629] MS m / z(ESI):406.1[M+1].
[0630] Step 5
[0631] (S)-4-bromo-5-fluoro-2-(2-((3-(((methylsulfonyl)oxy)propoxy)methyl)morpholine)methyl benzoate 14k
[0632] Compound 14j (2.4 g, 5.91 mmol) was dissolved in dichloromethane (30 mL), followed by the addition of triethylamine (1.2 g, 118.58 mmol) and methanesulfonyl chloride (2.18 g, 19.02 mmol). The mixture was reacted at room temperature for 30 minutes, then extracted with dichloromethane and water. The organic phase was dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated to give crude product 14k (2.8 g). MS m / z (ESI): 486.1 [M+1].
[0633] Step 6
[0634] (S)-4-bromo-2-(2-((3-((1-(tert-butoxycarbonyl)aza-3-yl)oxy)propoxy)methyl)morpholine)-5-fluorobenzoic acid 14l
[0635] 1.4 g (8.08 mmol) of tert-butyl 3-hydroxyazacyclobutane-1-carboxylate was dissolved in 20 mL of N,N-dimethylformamide. Sodium hydrogen (620 mg, 15.50 mmol, 60%) was added, and the mixture was stirred for 10 minutes. Then, 14 kJ (2.5 g, 5.16 mmol) was added, and the mixture was reacted at room temperature for 1 hour. The reaction was quenched with water, neutralized with a 2 mol / L aqueous formic acid solution, extracted with ethyl acetate and water, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated to give 14 L (4.2 g) of crude product.
[0636] MS m / z(ESI): 547.1 [M+1].
[0637] Step 7
[0638] (S)-3-(3-((4-(5-bromo-4-fluoro-2-(methoxycarbonyl)phenyl)morpholin-2-yl)methoxy)propoxy)azacyclobutane-1-carboxylic acid tert-butyl ester 14m
[0639] Compound 14l (4.2 g, 7.67 mmol) was dissolved in N,N-dimethylformamide (20 mL), followed by the sequential addition of anhydrous potassium carbonate (3.2 g, 23.15 mmol) and methyl iodoforme (1.8 g, 12.68 mmol). The reaction was carried out at room temperature for 1 hour, followed by extraction with ethyl acetate and water. The organic phase was dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated to obtain the crude product. The residue was purified by column chromatography using eluent system B to obtain the title compound 14m (1.12 g, yield: 26.0%).
[0640] MS m / z(ESI): 563.1 [M+1].
[0641] Step 8
[0642] (S)-8-(5-(2-((3-((1-(tert-butoxycarbonyl)aza-3-yl)oxy)propoxy)methyl)morpholine)-2-fluoro-4-(methoxycarbonyl)phenyl)-2H-benzo[e][1,3]oxazine-3(4H)-tert-butyl carboxylate 14n
[0643] Compound 14m (1.1 g, 1.96 mmol), 2a (780 mg, 2.16 mmol), [1,1'-bis(diphenylphosphine)ferrocene]palladium(II) dichloride (148 mg, 202.27 μmol), sodium carbonate (416 mg, 3.93 mmol), 1,4-dioxane (15 mL), and water (3 mL) were mixed and reacted at 100 °C for 3 hours under nitrogen protection. The mixture was extracted with ethyl acetate and water, and the organic phase was dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated to obtain the crude product. The residue was purified by column chromatography using eluent system B to give the title compound 14n (636 mg, yield: 45.3%).
[0644] MS m / z(ESI): 716.3 [M+1].
[0645] Step 9
[0646] (S)-2-(2-((3-(azacyclobut-3-yloxy)propoxy)methyl)morpholine)-4-(3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluorobenzoate methyl 14o
[0647] Compound 14n (636 mg, 888.51 μmol) was dissolved in dichloromethane (8 mL) and trifluoroacetic acid (2 mL) solution, and reacted at room temperature for 30 minutes. The mixture was then extracted with dichloromethane and water. The organic phase was dried with anhydrous sodium sulfate, filtered, and the filtrate was concentrated to obtain crude product 14o (660 mg).
[0648] Step 10, Step 11
[0649] (S)-3-(3-((4-(5-(3-(2,6-dichloro-4-fluorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-4-fluoro-2-(methoxycarbonyl)phenyl)morpholin-2-yl)methoxy)propoxy)azacyclobutane-1-tert-butyl ester 14q
[0650] Compound 14o (700 mg, 941.34 μmol) was dissolved in dichloromethane (10 mL), triethylamine (958 mg, 9.47 mmol, 1.32 mL) was added, and di-tert-butyl dicarbonate (206 mg, 943.88 μmol) was added dropwise. The mixture was reacted at room temperature for 1 hour, and 2,6-dichloro-4-fluorobenzoyl chloride (429 mg, 1.87 mmol) was added dropwise. The mixture was reacted at room temperature overnight. The mixture was evaporated to dryness under reduced pressure, and the residue was purified by column chromatography using eluent system B to obtain the title compound 14q (468 mg, yield: 61.6%).
[0651] MS m / z(ESI): 807.2 [M+1].
[0652] Step Twelve
[0653] (S)-2-(2-((3-(azabutane-3-yloxy)propoxy)methyl)morpholine)-4-(3-(2,6-dichloro-4-fluorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluorobenzoate methyl 14r
[0654] Compound 14q (468 mg, 580.16 μmol) was dissolved in dichloromethane (6 mL), and trifluoroacetic acid (2 mL) was added. The mixture was stirred for 30 minutes and then concentrated to dryness to obtain crude product 14r (560 mg).
[0655] MS m / z(ESI): 706.3 [M+1].
[0656] Step Thirteen
[0657] (1 2 S)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,34 -dihydro-3 2 H-7,1 1 -dioxazine-3(8,3)-benzo[e][1,3]oxazine-1(4,2)-morpholina-6(1,3)-azabutane-2(1,3),5(1,4)-diphenylcyclododecane-2 6 -Methyl carboxylate 14s
[0658] Compound 14r (400 mg, 487.45 μmol) was dissolved in dimethyl sulfoxide (30 mL), and N,N-diisopropylethylamine (1.26 g, 9.75 mmol) was added. The mixture was heated to 80 °C and reacted for 12 hours. The mixture was extracted with ethyl acetate and water. The organic phase was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to obtain the crude product. The residue was purified by column chromatography using eluent system B to obtain the title compound 14s (170 mg, yield: 50.8%).
[0659] MS m / z(ESI): 686.2 [M+1].
[0660] Step Fourteen
[0661] (1 2 S)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-7,11-dioxa-3(8,3)-benzo[e][1,3]oxazinza-1(4,2)-morpholinza-6(1,3)-azabutaneza-2(1,3),5(1,4)-diphenylhexacyclic dodecaban-2 6 -Carboxylic acid 14
[0662] Compound 14 (150 mg, 218.48 μmol) was dissolved in methanol (3 mL) and water (3 mL), and lithium hydroxide monohydrate (40 mg, 953.38 μmol) was added. The mixture was reacted at room temperature for 1 hour, neutralized with 2 mol / L formic acid solution, extracted with ethyl acetate and water, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated to obtain the crude product. The residue was purified by high performance liquid chromatography (column: ODS-BIO C18, 5 μm 30*250 mm; mobile phase: aqueous phase (0.1% FA) and acetonitrile, gradient ratio: aqueous phase (30%-60%)) to obtain title compound 14 (20 mg, yield: 13.6%).
[0663] Example 15
[0664] (1 2 R)-5 2 56 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-7,11-dioxa-3(8,3)-benzo[e][1,3]oxazin-1(4,2)-morpholina-6(1,4)-piperidine-2(1,3),5(1,4)-diphenylhexacyclododecano-2 6 -Carboxylic acid 15
[0665] first step
[0666] (R)-4-(3-(4-bromo-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-2-(2-((3-((1-tert-butoxycarbonyl)piperidin-4-yl)oxy)propoxy)methyl)morpholine)-5-fluorobenzoic acid 15a
[0667] 4-Hydroxypiperidine-1-carboxylic acid tert-butyl ester (68 mg, 0.34 mmol, Shanghai Shaoyuan) was dissolved in N,N-dimethylformamide (1 mL). Sodium hydrogen (16 mg, 0.42 mmol) was added to the above system, and the mixture was stirred for 20 minutes. Then, compound 13b (0.1 g, 126.5060 μmol) was added, and the mixture was stirred for another hour. The pH was adjusted to 3 with 2 M formic acid, and the mixture was extracted with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system B to give the title compound 15a (12 mg, yield: 10.8%).
[0668] MS m / z(ESI):880.0[M+1].
[0669] Step 2
[0670] (R)-4-(3-(4-bromo-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluoro-2-(2-((3-piperidin-4-yloxy)propoxy)methyl)morpholine)benzoic acid 15b
[0671] Compound 15a (12 mg, 13.6 μmol) was dispersed in dichloromethane (1 mL), and a 1,4-dioxane solution of hydrogen chloride (4 M, 2.74 mmol) was added to the above system. The mixture was stirred for 2 hours. The reaction solution was concentrated under reduced pressure to obtain crude title compound 15b (11 mg). The product was directly used for the next reaction without purification.
[0672] MS m / z(ESI):780.1[M+1].
[0673] Step 3
[0674] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-7,11-dioxa-3(8,3)-benzo[e][1,3]oxazin-1(4,2)-morpholina-6(1,4)-piperidine-2(1,3),5(1,4)-diphenylhexacyclododecano-2 6 -Carboxylic acid 15
[0675] Compound 15b (11 mg, 13.45 μmol) was dispersed in 1,4-dioxane (2 mL). Tris(dibenzylacetone)dipalladium (5 mg, 5.46 μmol), 4,5-bis(diphenylphosphine)-9,9-dimethyloxanthracene (10 mg, 17.28 μmol), and cesium carbonate (30 mg, 92.07 μmol) were added sequentially to the above system. The mixture was purged with nitrogen three times, heated to 110 °C, stirred for 10 hours, cooled to room temperature, and the pH was adjusted to 3 with 2 M formic acid. The mixture was filtered, and the filtrate was purified by high performance liquid chromatography (column: ODS-BIO C18, 5 μm 30*250 mm; mobile phase: aqueous phase (0.1% FA) and acetonitrile, gradient ratio: aqueous phase 40%-70%) to obtain title compound 15 (1 mg, yield: 10.6%).
[0676] MS m / z(ESI): 700.2 [M+1].
[0677] 1 H NMR(500MHz,CD3Cl3)δ8.03(d,1H),7.86(d,1H),7.49(s,1H),7.46-7.43(m,1H),7.25(d,1H),7.13(t,1H),7.07(s,1H),5.40-5.34(m,2H ),5.22(d,1H),5.09(d,1H),4.88(d,1H),4.12-3.86(m,5H),3.67-3.34(m,6H),3.33-2.51(m,4H),2.49-2.12(m,2H),2.05-1.63(m,6H).
[0678] Example 16
[0679] (1 2 S)-5 2 5 6 -dichloro-2 4-Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-7,11-dioxa-3(8,3)-benzo[e][1,3]oxazin-1(4,2)-morpholina-6(1,4)-piperidine-2(1,3),5(1,4)-diphenylhexacyclododecano-2 6 -Carboxylic acid 16
[0680] The synthetic route of Example 15, by replacing compound 14c with compound 13b, yielded title compound 16 (1.6 mg, yield: 3.7%).
[0681] MS m / z(ESI): 700.2 [M+1].
[0682] 1 H NMR(500MHz, CDCl3)δ8.00(d,1H),7.50(t,1H),7.45–7.41(m,1H),7.35(d,1H),7.24( d,1H),7.16(t,1H),7.08(t,1H),5.64(d,1H),5.19(d,1H),5.06(d,2H),4.55(s,1H), 4.18–4.12(m,1H),4.04–3.81(m,4H),3.69–3.54(m,4H),3.53–3.47(m,2H),3.27(s,2 H),3.13–3.05(m,2H),3.00–2.90(m,2H),2.04(d,2H),1.95(s,2H),1.89–1.83(m,2H).
[0683] Example 17
[0684] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-10-oxa-3(8,3)-benzo[e][1,3]oxazin-1(4,2)-morpholina-6(1,4)-piperazina-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 17
[0685] first step
[0686] (R)-4-(3-(4-bromo-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluoro-2-(2-((3-oxopropoxy)methyl)morpholine)methyl benzoate 17a
[0687] Compound 13a (80 mg, 112.30 μmol) was dissolved in dichloromethane (3 mL), and Desmartin oxidant (72 mg, 169.75 μmol) was added to the above system. The mixture was stirred for 1.5 hours. The reaction solution was concentrated under reduced pressure, and the residue was purified by column chromatography with eluent system B to give title compound 17a (60 mg, yield: 75.2%).
[0688] MS m / z(ESI):709.0[M+1].
[0689] Step 2
[0690] (R)-4-(3-(4-bromo-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-2-(2-((3-(4-(tert-butoxycarbonyl)piperazin-1-yl)propoxy)methyl)morpholine)-5-fluorobenzoate methyl 17b
[0691] Compound 17a (60 mg, 84.46 μmol) and tert-butyl piperazine-1-carboxylate (30 mg, 161.07 μmol) were dissolved in dichloromethane (5 mL) and stirred for 30 minutes. Then, sodium borohydride triacetate (60 mg, 283.10 μmol) was added to the above system and stirred for 15 minutes. The reaction solution was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system A to give the title compound 17b (25 mg, yield: 33.6%).
[0692] MS m / z(ESI): 879.2 [M+1].
[0693] Step 3
[0694] (R)-4-(3-(4-bromo-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluoro-2-(2-((3-(piperazin-1-yl)propoxy)methyl)morpholine)methyl benzoate 17c
[0695] Compound 17b (25 mg, 28.39 μmol) was dissolved in dichloromethane (3 mL), and a 1,4-dioxane solution of hydrogen chloride (4 M, 4.11 mmol) was added. The mixture was stirred at room temperature until the starting material disappeared. The reaction solution was concentrated under reduced pressure to obtain crude title compound 17c (23 mg). The product was directly used for the next reaction without purification.
[0696] Step 4
[0697] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-10-oxa-3(8,3)-benzo[e][1,3]oxazine-1(4,2)-morpholina-6(1,4)-piperazine-2(1,3),5(1,4)-diphenylhexacycloundecano-2 6 -Methyl carboxylate 17d
[0698] Compound 17c (23 mg, 28.15 μmol) was dissolved in 1,4-dioxane (3 mL). Tris(dibenzylacetone)dipalladium (6 mg, 6.55 μmol), 4,5-bis(diphenylphosphine)-9,9-dimethyloxanthracene (12 mg, 20.74 μmol), and cesium carbonate (60 mg, 184.15 μmol) were added sequentially to the above system. The mixture was purged with nitrogen three times, heated to 110 °C, stirred for 10 hours, hot filtered, and the filtrate was concentrated under reduced pressure to obtain the target compound 17d (20 mg).
[0699] MS m / z(ESI): 699.3 [M+1].
[0700] Step 5
[0701] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-10-oxa-3(8,3)-benzo[e][1,3]oxazin-1(4,2)-morpholina-6(1,4)-piperazina-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 17
[0702] Compound 17d (20 mg, 28.59 μmol) was dispersed in methanol (2 mL). Water (1 mL) and lithium hydroxide monohydrate (12 mg, 285.96 μmol) were added sequentially to the above system. The mixture was stirred for 3 hours, and the pH was adjusted to 4 with 2 M formic acid. The mixture was filtered, and the filtrate was purified by high performance liquid chromatography (column: ODS-BIO C18, 5 μm 30*250 mm; mobile phase: aqueous phase (0.1% FA) and acetonitrile, gradient ratio: aqueous phase 20%-50%) to obtain title compound 17 (6 mg, yield: 30.6%).
[0703] MS m / z(ESI): 685.3 [M+1].
[0704] 1 H NMR(500MHz,CD3Cl3)δ8.39(brs,1H),7.57(d,1H),7.35(d,1H),7.31(d,1H),7.2 4(d,1H),7.16(s,1H),7.13-7.09(m,2H),5.21(d,1H),5.14-5.07(m,2H),5.00(d, 1H),4.85-4.82(m,2H),4.07(d,1H),3.89-3.73(m,5H),3.62-3.46(m,4H),3.18-3 .09(m,3H),3.04-2.92(m,4H),2.81(t,1H),2.00-1.97(m,1H),1.90-1.82(m,1H).
[0705] Example 18
[0706] (1 2 S)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-10-oxa-3(8,3)-benzo[e][1,3]oxazin-1(4,2)-morpholina-6(1,4)-piperazina-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 18
[0707] Using the synthetic route of Example 17, compound 13a was replaced with compound 14b to obtain title compound 18 (8 mg, yield: 16.3%).
[0708] MS m / z(ESI): 685.2 [M+1].
[0709] 1H NMR(500MHz, CDCl3)δ8.08(d,1H),7.47(d,1H),7.31(s,1H),7.27(s,1H),7.16 (t,1H),6.81(s,2H),5.22(d,1H),5.15(d,1H),5.05(d,1H),4.95(d,1H),4.18 (d,1H),3.93(d,2H),3.75(s,4H),3.61(s,1H),3.54(s,2H),3.44(d,1H),3.30 (d,1H),3.14(d,1H),2.96(d,1H),2.89–2.62(m,6H),2.50(s,1H),1.90(s,2H).
[0710] Example 19
[0711] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-9-oxa-3(8,3)-benzo[e][1,3]oxazin-1(4,2)-morpholina-6(1,4)-piperidine-2(1,3),5(1,4)-diphenylcyclodecaban-2 6 -Carboxylic acid 19
[0712] first step
[0713] (R)-4-bromo-5-fluoro-2-(2-(hydroxymethyl)morpholino)benzoic acid 19c
[0714] 4-Bromo-2,5-difluorobenzoic acid 19a (3.3 g, 13.92 mmol, Shanghai Bide) and (R)-morpholino-2-ylmethanol 19b (2.2 g, 14.32 mmol, Shanghai Haohong) were dispersed in tetrahydrofuran (20 mL). Bis(trimethylsilyl)aminolithium (1 M, 57.37 mmol, 57.37 mL) was slowly added dropwise. After the addition was complete, the reaction was allowed to proceed for 12 hours. 2 M hydrochloric acid was slowly added dropwise to the system until it reached a weakly acidic state. The mixture was extracted with ethyl acetate, and the organic phases were combined. The organic phases were washed with saturated sodium chloride solution and dried over anhydrous sodium sulfate. The mixture was filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system A to obtain the crude title compound 19c (5.1 g).
[0715] MS m / z(ESI):334.1[M+1].
[0716] Step 2
[0717] (R)-4-(3-(tert-butoxycarbonyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluoro-2-(2-(hydroxymethyl)morpholino)benzoic acid 19d
[0718] Compound 19c (1.2 g, 3.59 mmol), compound 2a (1.43 g, 3.95 mmol), tetrakis(triphenylphosphine)palladium (100 mg, 86.53 mmol), and sodium carbonate (800 mg, 7.55 mmol) were dispersed in 1,4-dioxane (20 mL). Water (4 mL) was added to the above system, the mixture was purged with nitrogen three times, heated to 100 °C and reacted for 3 hours, cooled to room temperature, diluted with water, extracted with dichloromethane, dried over anhydrous sodium sulfate, filtered, concentrated the filtrate under reduced pressure, and purified the residue by column chromatography with eluent system B to give title compound 19d (1.7 g, yield: 96.9%).
[0719] MS m / z(ESI):489.2[M+1].
[0720] Step 3
[0721] (R)-8-(2-fluoro-5-(2-hydroxymethyl)morpholino)-4-(methoxycarbonyl)phenyl)-2H-benzo[e][1,3]oxazine-3(4H)-tert-butyl carboxylate 19e
[0722] Compound 19d (1.7 g, 3.48 mmol) and potassium carbonate (1 g, 7.24 mmol) were dispersed in N,N-dimethylformamide (6 mL), and iodomethane (500 mg, 3.52 mmol) was added. The mixture was stirred for 30 minutes. The mixture was then concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 19e (1.6 g, yield: 94.9%).
[0723] MS m / z(ESI): 503.2 [M+1].
[0724] Step 4
[0725] (R)-4-(3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluoro-2-(2-(hydroxymethyl)morpholino)methyl benzoate 19f
[0726] Compound 19e (0.8 g, 1.59 mmol) was dissolved in dichloromethane (10 mL), and a solution of 1,4-dioxane (4 M, 15.9 mmol, 3.97 mL) of hydrogen chloride was added to this system. The mixture was reacted at room temperature for 3 hours. The solution was evaporated under reduced pressure to obtain the crude title compound 19f, which was used directly in the next step of the reaction without purification.
[0727] Step 5
[0728] (R)-4-(3-(4-bromo-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluoro-2-(2-(hydroxymethyl)morpholino)methyl benzoate 19g
[0729] Compound 19f (0.69 g, 1.59 mmol) and diisopropylethylamine (1.53 mL, 9.29 mmol) were dispersed in dichloromethane (20 mL), and 2,6-dichloro-4-bromobenzoyl chloride (0.69 g, 2.39 mmol, prepared by the method disclosed in intermediate 10 on page 63 of patent application "WO2012160464") was added dropwise. The mixture was stirred at room temperature for 12 hours, concentrated under reduced pressure, and the residue was purified by silica gel column chromatography with eluent system A to give title compound 19f (1.08 g, crude product).
[0730] MS m / z(ESI): 655.1 [M+1].
[0731] Step 6
[0732] (R)-4-(3-(4-bromo-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-2-[2-((2-[1-(tert-butoxycarbonyl)piperidin-4-yl)ethoxy)methyl)morpholinyl)-5-fluorobenzoic acid 19h
[0733] 19 g (100 mg, 150 μmol) of compound was dissolved in N,N-dimethylformamide (4 mL), sodium hydride (40 mg, 1.67 mmol) was added, and the mixture was stirred for 20 minutes. Then, 1-(tert-butoxycarbonyl)-4-(2-(methanesulfonyloxy)ethyl)piperidine (140 mg, 455 μmol, prepared by the method disclosed on page 145 of patent application "WO2022161414, intermediate 12") was added, and the mixture was reacted at room temperature for 8 hours. The pH was adjusted to 3 with 2 M formic acid, and the mixture was filtered. The filtrate was purified by high performance liquid chromatography (column: ODS-BIO C18, 5 μm 30*250 mm; mobile phase: aqueous phase (0.1% ammonium bicarbonate) and acetonitrile, gradient ratio: acetonitrile 35%-95%) to obtain the title compound 19h (20 mg, yield 15.4%).
[0734] MS m / z(ESI): 852.2 [M+1].
[0735] Step 7 (R)-4-(3-(4-bromo-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluoro-2-(2-((2-(piperidin-4-yl)ethoxy)methyl)morpholinyl)benzoic acid 19i
[0736] Compound 19h (15 mg, 17.61 μmol) was dissolved in dichloromethane (2 mL), and a solution of 1,4-dioxane containing hydrogen chloride (1 mL) was added to the system. The mixture was reacted at room temperature for 3 hours. The mixture was then evaporated under reduced pressure to obtain the crude title compound 19i, which was used directly in the next step of the reaction without purification.
[0737] MS m / z(ESI):752.0[M+1].
[0738] Step 8
[0739] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-9-oxa-3(8,3)-benzo[e][1,3]oxazin-1(4,2)-morpholina-6(1,4)-piperidine-2(1,3),5(1,4)-diphenylcyclodecaban-2 6 -Carboxylic acid 19
[0740] Compound 19i (15 mg, 19.04 μmol) was dispersed in toluene (5 mL). Tris(dibenzylacetone)dipalladium (6 mg, 6.55 μmol), 1,1'-binaphthyl-2,2'-bis(diphenylphosphine) (BINAP) (12 mg, 19.27 μmol), and sodium tert-butoxide (12 mg, 124.87 μmol) were added sequentially to the above system. The mixture was purged with nitrogen three times, heated to 120 °C, stirred for 2 hours, cooled to room temperature, and the pH was adjusted to 3 with 2 M formic acid. The mixture was filtered, and the filtrate was purified by high performance liquid chromatography (column: ODS-BIO C18, 5 μm 30*250 mm; mobile phase: aqueous phase (0.1% ammonium bicarbonate) and acetonitrile, gradient ratio: acetonitrile 20%-95%) to obtain title compound 19 (1 mg, yield: 7.8%).
[0741] MS m / z(ESI): 670.2 [M+1].
[0742] 1H NMR(500MHz, CDCl3)δ8.05(d,1H),7.69(d,1H),7.36(d,1H),7.23(d,1H),7.12(t,1H ),7.10(s,1H),6.82(s,1H),5.41(d,1H),5.25(d,1H),5.06(d,1H),4.81(d,1H),4.20 (d,1H),3.89(d,2H),3.85–3.74(m,2H),3.53(t,2H),3.48–3.43(m,1H),3.33(t,1H), 3.13(dt,3H),2.96(t,2H),2.74(t,1H),1.95(s,2H),1.79(d,2H),1.38–1.26(m,3H).
[0743] Example 20
[0744] (1 2 S)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-9-oxa-3(8,3)-benzo[e][1,3]oxazin-1(4,2)-morpholina-6(1,4)-piperidine-2(1,3),5(1,4)-diphenylcyclodecaban-2 6 -Carboxylic acid 20
[0745] Using the synthetic route of Example 19, compound 19b was replaced with (S)-2-hydroxymethylmorpholine to obtain title compound 20 (1.5 mg, yield: 8.8%).
[0746] MS m / z(ESI): 670.2 [M+1].
[0747] 1H NMR(500MHz, CDCl3)δ8.06(d,1H),7.70(d,1H),7.37(d,1H),7.25(d,1H),7.12(t, 1H),6.82(s,2H),5.43(d,1H),5.26(d,1H),5.03(d,1H),4.81(d,1H),4.20(d,1H) ,3.89(d,2H),3.85–3.74(m,2H),3.53(t,2H),3.48–3.43(m,1H),3.33(t,1H),3.1 3(dt,3H),2.98(t,2H),2.74(t,1H),1.93(s,2H),1.79(d,2H),1.38–1.26(m,3H).
[0748] Example 21
[0749] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-6-methyl-4-oxo-3 3 ,3 4 -dihydro-3 2 H-10-oxa-6-aza-3(8,3)-benzo[e][1,3]oxazinza-1(4,2)-morpholinza-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 21
[0750] Using steps two through five of the synthetic route in Example 17, tert-butyl piperazine-1-carboxylate was replaced with methylamine to prepare title compound 21 (0.5 mg, yield: 2.96%).
[0751] MS m / z(ESI): 630.2 [M+1].
[0752] 1H NMR(500MHz, CDCl3)δ8.06(d,1H),7.69(d,1H),7.49(d,1H),7.23-7.19(m,2H),7.10-7.07(m,1H),6.98-6.96(m,1H), 5.73–5.68(m,1H),5.17–5.11(m,2H),4.99-4.97(m,1H),4.27–4.23(m,1H),3.96–3.91(m,3H),3.81–3.69(m,2H),3.67 -3.62(m,2H),3.52–3.46(m,2H),3.37–3.30(m,2H),3.19–3.15(m,1H),3.10–3.06(m,1H),2.98–2.90(m,2H),1.73-1.69(m,2H).
[0753] Example 22
[0754] (1 2 S)-5 2 5 6 -dichloro-2 4 -Fluoro-6-methyl-4-oxo-3 3 ,3 4 -dihydro-3 2 H-10-oxa-6-aza-3(8,3)-benzo[e][1,3]oxazinza-1(4,2)-morpholinza-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 22
[0755] Using steps two through five of the synthetic route in Example 17, compound 17a was replaced with 18a, and tert-butyl piperazine-1-carboxylate was replaced with methylamine to obtain title compound 22 (28 mg, yield: 17.2%). MS m / z (ESI): 630.2 [M+1].
[0756] 1H NMR(500MHz, CDCl3)δ8.06(d,1H),7.69(d,1H),7.27–7.21(m,2H),7.10(t,1H),6. 98(d,1H),6.60(d,1H),5.68(d,1H),5.13(dd,1H),4.99(d,1H),4.57(d,1H),4.22( dd,1H),3.93(d,2H),3.79(dd,1H),3.69–3.61(m,1H),3.49(q,3H),3.38–3.28(m, 2H),3.18(t,1H),3.07(d,1H),2.96(s,1H),2.94(s,3H),1.91(t,1H),1.77(s,1H).
[0757] Example 23
[0758] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-6-methyl-4-oxo-3 3 ,3 4 -dihydro-3 2 H-9-oxa-6-aza-3(8,3)-benzo[e][1,3]oxazinza-1(4,2)-morpholinza-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 23
[0759] first step
[0760] (R)-4-(3-(4-bromo-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluoro-2-(2-((2-(methylamino)ethoxy)methyl)morpholinyl)benzoic acid 23a
[0761] Compound 7b (50 mg, 64.40 μmol) was dissolved in methanol (10 mL) and water (2 mL) in a sealed tube. Lithium hydroxide (30 mg, 714.91 μmol) was added and the mixture was reacted at room temperature for 3 hours to generate an intermediate for the hydrolysis of methyl ester to acid. Then, methylamine ethanol solution (3 mL, 30%) was added to the reaction solution and the mixture was heated to 60 °C for 1 hour. After the reaction was completed, water (5 mL) was added and the mixture was extracted with dichloromethane (15 mL × 3). The organic phase was dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain the title compound 23a (44 mg, yield: 98.1%).
[0762] MS m / z(ESI): 698.0 [M+1].
[0763] Step 2
[0764] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-6-methyl-4-oxo-3 3 ,3 4 -dihydro-3 2 H-9-oxa-6-aza-3(8,3)-benzo[e][1,3]oxazinza-1(4,2)-morpholinza-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 23
[0765] Compound 23a (44 mg, 63.09 μmol) was dissolved in 1,4-dioxane (5 mL), bis(di-benzylacetone)palladium (17 mg, 18.56 μmol), 4,5-bisdiphenylphosphine-9,9-dimethyloxanthracene (22 mg, 38.06 μmol), and cesium carbonate (103 mg, 316.13 μmol). The mixture was purged with nitrogen, heated to 110 °C, and stirred for 4 hours. The reaction solution was concentrated, and the residue was purified by high performance liquid chromatography (Waters 2545, column: BostonPhlex ODS C18; 30*250 mm, 5 μm; mobile phase: water (0.1% TFA) and acetonitrile; flow rate: 30 mL / min, gradient ratio: acetonitrile 15%-95%) to give title compound 23 (5 mg, yield 12.86%).
[0766] MS m / z(ESI): 616.0 [M+1].
[0767] 1 H NMR(500MHz, CDCl3)δ8.07(d,1H),7.67(d,1H),7.35(d,1H),7.23(d,2H), 7.09(t,1H),6.57(d,1H),5.75–5.67(m,1H),5.11(dd,1H),4.94(d,1H),4. 55(d,1H),4.24(dd,1H),4.01–3.86(m,3H),3.81–3.66(m,2H),3.64(dd,2 H),3.35(m,1H),3.27–3.15(m,2H),3.03(d,1H),2.98(s,3H),2.91(d,1H).
[0768] Example 24
[0769] (1 2 S)-5 2 56 -dichloro-2 4 -Fluoro-6-methyl-4-oxo-3 3 ,3 4 -dihydro-3 2 H-9-oxa-6-aza-3(8,3)-benzo[e][1,3]oxazinza-1(4,2)-morpholinza-2(1,3),5(1,4)-diphenylhexacyclodecan-26-carboxylic acid 24
[0770] Using the synthetic method of Example 21, compound 17a was replaced with 12a to obtain title compound 24 (2 mg, yield: 12.03%).
[0771] MS m / z(ESI): 616.0 [M+1].
[0772] 1 H NMR(500MHz,DMSO-d6)δ7.84(d,1H),7.60(d,1H),7.35(d,1H),7.22(d,2H),7.09(d,1H),6.69(d,1H),5.41(s,1H),5.33(t,1H),5 .16(d,1H),4.95(s,1H),4.63(d,1H),4.35(t,2H),3.45(qd,5H),3.18(d,2H),2.95(s,1H),2.91(d,1H),2.74(s,1H),2.64(p,3H).
[0773] Example 25
[0774] (1 2 R)-5 2 5 6 -Dichloro-6-cyclopropyl-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-9-oxa-6-aza-3(8,3)-benzo[e][1,3]oxazinza-1(4,2)-morpholinza-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 25
[0775] first step
[0776] (R)-4-bromo-5-fluoro-2-(2-((2-(((methylsulfonyl)oxy)ethoxy)methyl)morpholino)methyl benzoate 25a
[0777] Compound 5d (0.5 g, 1.27 mmol) was dissolved in dichloromethane (10 mL), and triethylamine (0.4 g, 3.95 mmol) and methanesulfonyl chloride (0.29 g, 2.53 mmol) were added. The mixture was reacted at room temperature for 2 hours, and water (10 mL) was added. The mixture was extracted with dichloromethane (20 mL × 3). The organic phases were combined, washed with saturated sodium chloride solution (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to give the title compound 25a (0.90 g, crude product).
[0778] MS m / z(ESI):470.0[M+1].
[0779] Step 2
[0780] (R)-4-bromo-5-fluoro-2-(2-((methanesulfonyl)oxy)ethoxy)methyl)morpholinyl)benzoic acid 25b
[0781] Compound 25a (0.35 g, 0.74 mmol) was dissolved in methanol (10 mL) and water (30 mL), and lithium hydroxide (0.3 g, 28.10 mmol) was added. The mixture was reacted at room temperature for 2 hours, and the solution was directly evaporated to dryness to give the title compound 25b (0.33 g).
[0782] MS m / z(ESI):456.0[M+1].
[0783] Step 3
[0784] (R)-4-bromo-2-(2-(2-(cyclopropylamino)ethoxy)methyl)morpholino)-5-fluorobenzoic acid 25c
[0785] Compound 25b (0.33 g, crude product) was dissolved in N,N-dimethylformamide (10 mL), and cyclopropylamine (2 g, 35.03 mmol) was added. The mixture was heated and sealed at 60°C for 16 hours, then evaporated to dryness. The mixture was prepared by high performance liquid chromatography (separation conditions: Welch Ultimate C18 column, 5 μm 30*150 mm; mobile phase: aqueous phase (0.1% ammonium bicarbonate) and acetonitrile, gradient ratio: acetonitrile 25%-95%, flow rate: 30 mL / min). The corresponding fractions were collected and freeze-dried to obtain the title compound 25c (0.18 g, yield: 59.6%).
[0786] MS m / z(ESI):419.2[M+1].
[0787] Step 4
[0788] (R)-4-bromo-2-(2-((tert-butoxycarbonyl)(cyclopropyl)amino)ethoxy)methyl)morpholino)-5-fluorobenzoic acid 25d
[0789] Compound 25c (0.18 g, 431.38 μmol) was dissolved in dichloromethane (5 mL), and triethylamine (0.23 g, 2.27 mmol) and di-tert-butyl dicarbonate (0.20 g, 0.92 mmol) were added. The mixture was reacted at room temperature for 1 hour, and the solution was directly evaporated to dryness to give the crude title compound 25d (0.2 g).
[0790] MS m / z(ESI): 519.0 [M+1].
[0791] Step 5
[0792] (R)-4-bromo-2-(2-((2-((tert-butoxycarbonyl)(cyclopropyl)amino)ethoxy)methyl)morpholino)-5-fluorobenzoate methyl ester 25e
[0793] Compound 25d (0.2 g, 386.56 μmol) was dissolved in N,N-dimethylformamide (DMF) (5 mL) and reacted at room temperature for 16 hours. Water (10 mL) was added, and the mixture was extracted with dichloromethane (30 mL × 3). The organic phases were combined, washed with saturated sodium chloride solution (50 mL), dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure, and the residue was purified by silica gel column chromatography with eluent system B to give the title compound 25e (0.16 g, yield: 77.9%).
[0794] MS m / z(ESI): 533.0 [M+1].
[0795] Step 6
[0796] (R)-8-(5-(2-((2-((tert-butoxycarbonyl)(cyclopropyl)amino)ethoxy)methyl)morpholine)-2-fluoro-4-(methoxycarbonyl)phenyl)-2H-benzo[e][1,3]oxazine-3(4H)-carboxylic acid tert-butyl ester 25f
[0797] Compound 25e (0.15 g, 0.28 mmol), compound 2a (0.11 g, 304.51 μmol), tetraphenylphosphine palladium (33 mg, 28.56 μmol), sodium carbonate (90 mg, 849.15 μmol), 1,4-dioxane (6 mL), and water (0.8 mL) were mixed and reacted at 100 °C for 3 hours under nitrogen purging protection. After cooling to room temperature, the mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography using eluent system B to give the title compound 25f (150 mg, 77.5%). MS m / z (ESI): 686.2 [M+1].
[0798] Step 7
[0799] (R)-2-(2-((2-(cyclopropylamino)ethoxy)methyl)morpholino)-4-(3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-5-fluorobenzoate methyl ester 25g
[0800] Compound 25f (0.15 g, 218.73 μmol) was dissolved in dichloromethane (3 mL), and 1,4-dioxane hydrochloric acid solution (3 mL, 4 M) was added. The mixture was stirred at room temperature for 4 hours, and then concentrated under reduced pressure to give crude title compound 25 g (106 mg). The product was directly used in the next reaction without purification.
[0801] MS m / z(ESI):486.1[M+1].
[0802] Step 8
[0803] (R)-4-(3-(4-bromo-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-2-(2-((2-(tert-butoxycarbonyl)(cyclopropyl)amino)ethoxy)methyl)morpholinyl)-5-fluorobenzoate methyl ester 25h
[0804] 25 g (0.11 g, 218.31 μmol) of compound was dissolved in dichloromethane (5 mL), and triethylamine (0.11 g, 1.09 mmol) and di-tert-butyl dicarbonate (48 mg, 219.94 μmol) were added. The mixture was reacted at room temperature for 2 hours. Then, triethylamine (0.11 g, 1.09 mmol) was added, followed by dropwise addition of 2,6-dichloro-4-bromobenzoyl chloride (126 mg, 436.96 μmol, prepared by the method disclosed on page 63 of patent application "Intermediate 10" in WO2012160464). The mixture was stirred at room temperature for 14 hours, concentrated under reduced pressure, and the residue was purified by silica gel column chromatography using eluent system A to give the title compound 25h (0.14 g, 76.5% yield).
[0805] MS m / z(ESI):838.0[M+1].
[0806] Step 9
[0807] (R)-4-(3-(4-bromo-2,6-dichlorobenzoyl)-3,4-dihydro-2H-benzo[e][1,3]oxazin-8-yl)-2-(2-((2-(cyclopropylamino)ethoxy)methyl)morpholinyl)-5-fluorobenzoate methyl ester 25i
[0808] Compound 25h (0.14 g, 167.15 μmol) was dissolved in dichloromethane (3 mL), and 1,4-dioxane hydrochloric acid solution (3 mL, 4 M) was added. The mixture was stirred at room temperature for 4 hours, and then concentrated under reduced pressure to give crude title compound 25i (50 mg). The product was directly used in the next reaction without purification.
[0809] MS m / z(ESI):738.0[M+1].
[0810] Step 10
[0811] Methyl (1 2 R)-5 2 5 6 -Dichloro-6-cyclopropyl-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-9-oxa-6-aza-3(8,3)-benzo[e][1,3]oxazine-1(4,2)-morpholina-2(1,3),5(1,4)-dibenzocyclodecapan-2 6 -Carboxylic acid ester 25j
[0812] Compound 25i (45 mg, 61.02 μmol) was dissolved in toluene (20 mL). Tris(dibenzylacetone)dipalladium (17 mg, 18.56 μmol), 1,1'-binaphthyl-2,2'-bis(diphenylphosphine) (23 mg, 36.94 μmol), and sodium tert-butoxide (30 mg, 312.16 μmol) were added sequentially to the above system. The mixture was purged with nitrogen three times, heated to 80 °C for 1.5 h, and then heated to 100 °C for 4 h. The residue was purified by column chromatography with eluent system B to obtain the title compound 25j (20 mg, yield: 49.9%).
[0813] MS m / z(ESI): 656.2 [M+1].
[0814] Step 11
[0815] (1 2 R)-5 2 5 6 -Dichloro-6-cyclopropyl-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-9-oxa-6-aza-3(8,3)-benzo[e][1,3]oxazinza-1(4,2)-morpholinza-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 25
[0816] Compound 25j (20 mg, 30.46 μmol) was dissolved in methanol (5 mL) and water (2 mL), and lithium hydroxide (30 mg, 714.9 μmol) was added. The mixture was reacted at room temperature for 3 hours, and then directly concentrated. The residue was purified by high performance liquid chromatography (Waters 2545, column: BostonPhlex ODS C18; 30*250 mm, 5 μm; mobile phase: water (0.1% TFA) and acetonitrile; flow rate: 30 mL / min, gradient ratio: acetonitrile 15%-95%) to give title compound 25 (12 mg, yield 61.3%).
[0817] MS m / z(ESI): 644.2 [M+1].
[0818] 1 H NMR(500MHz, CDCl3)δ8.07(d,1H),7.71(d,1H),7.44(d,1H),7.24(d,2H),7.16( d,1H),7.09(t,1H),5.71(d,1H),5.13(dd,1H),4.96(d,1H),4.56(d,1H),4.24( d,1H),3.97(t,1H),3.81(ddd,4H),3.60–3.50(m,3H),3.36(s,1H),3.24(s,1H) ,3.04(s,1H),2.91(d,1H),2.57(s,1H),0.95(d,1H),0.85(dd,2H),0.61(s,1H).
[0819] Example 26
[0820] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-6-isopropyl-4-oxo-3 3 ,3 4 -dihydro-3 2 H-9-oxa-6-aza-3(8,3)-benzo[e][1,3]oxazinza-1(4,2)-morpholinza-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 26
[0821] Example 27
[0822] (1 2 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-33 ,3 4 -dihydro-3 2 H-9-oxa-3(8,3)-benzo[e][1,3]oxazin-1(4,2),6(4,3)-dimorpholina-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 27
[0823] (1 2 R,6 3 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-9-oxa-3(8,3)-benzo[e][1,3]oxazin-1(4,2),6(4,3)-dimorpholina-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 27-1
[0824] (1 2 R,6 3 S)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-9-oxa-3(8,3)-benzo[e][1,3]oxazin-1(4,2),6(4,3)-dimorpholina-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 27-2
[0825] Using steps six through eight of the synthetic route in Example 19, 1-(tert-butoxycarbonyl)-4-(2-(methanesulfonyloxy)ethyl)piperidine (prepared using the method disclosed in Intermediate 12 on page 145 of patent application "WO2022161414") was replaced with 3-(2-(methanesulfonyloxy)ethyl)morpholine-4-carboxylic acid tert-butyl ester (prepared using the method disclosed in Example 81 on page 145 of patent application "WO2022104079") to obtain title compound 27. Compound 27 (18 mg, 0.03 mmol) was prepared by high performance liquid chromatography (separation conditions: ODS-BIO C18 column, 5 μm 30*250 mm; mobile phase: aqueous phase (0.1% ammonium bicarbonate) and acetonitrile, gradient ratio: acetonitrile 20%-95%, flow rate: 30 mL / min). The corresponding fractions were collected and freeze-dried to obtain the title compound (1 mg, yield: 1.49%) and (2 mg, yield: 2.97%).
[0826] Single-configuration compounds (shorter retention time):
[0827] MS m / z(ESI): 672.2 [M+1].
[0828] 1 H NMR(500MHz, CDCl3)δ8.02(d,1H),7.52(s,1H),7.23-7.19(m,2H),7.08-7.06(m,1H),6.88(s,1H),6.80 (s,1H),5.57(s,1H),4.96(s,2H),4.59(s,1H),4.14(d,1H),3.98–3.91(m,3H),3.85–3.75(m,2H),3.69 -3.64(m,3H),3.56–3.50(m,2H),3.39–3.31(m,2H),3.26–3.10(m,2H),2.93–2.91(m,1H),2.11–1.96(m,2H),1.76-1.60(m,2H).
[0829] High performance liquid chromatography (HPLC) preparative chromatography: retention time 12.08 minutes.
[0830] Single-configuration compounds (longer retention time):
[0831] MS m / z(ESI): 672.2 [M+1].
[0832] 1H NMR(500MHz, CDCl3)δ8.08(d,1H),7.72(s,1H),7.33-7.30(m,1H),7.27-7.25(m,1H),7.17(s,1H),7.13-7.10(m,1H),6.68(s,1H ),5.71(d,1H),5.22(d,1H),5.02(d,1H),4.56(d,1H),4.22(d,1H),4.04–3.98(m,2H),3.95–3.92(m,2H),3.79–3.75(m,2H),3.70 -3.66(m,1H),3.51 -3.48(m,2H),3.43–3.34(m,2H),3.19–3.10(m,3H),3.02–2.90(m,2H),2.23–2.19(m,1H),1.76-1.65(m,2H).
[0833] High performance liquid chromatography (HPLC) preparative chromatography: retention time 13.77 minutes.
[0834] Example 28
[0835] (1 2 S)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-9-oxa-3(8,3)-benzo[e][1,3]oxazin-1(4,2),6(4,3)-dimorpholina-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 28
[0836] (1 2 S,6 3 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-9-oxa-3(8,3)-benzo[e][1,3]oxazin-1(4,2),6(4,3)-dimorpholina-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 28-1
[0837] (1 2 S,6 3 S)-5 2 5 6 -dichloro-2 4-Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-9-oxa-3(8,3)-benzo[e][1,3]oxazin-1(4,2),6(4,3)-dimorpholina-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 28-2
[0838] Using the synthetic route of Example 19, 19b was replaced with 28a, and 1-(tert-butoxycarbonyl)-4-(2-(methanesulfonyloxy)ethyl)piperidine (prepared by the method disclosed in Intermediate 12 on page 145 of patent application "WO2022161414") was replaced with 3-(2-(methanesulfonyloxy)ethyl)morpholine-4-carboxylic acid tert-butyl ester (prepared by the method disclosed in Example 81 on page 145 of patent application "WO2022104079"), to obtain title compound 28.
[0839] Compound 28 (8 mg, 0.01 mmol) was prepared by high performance liquid chromatography (separation conditions: Welch ultimate C18 column, 5 μm 30*150 mm; mobile phase: aqueous phase (0.1% ammonium bicarbonate) and acetonitrile, gradient ratio: acetonitrile 25%-95%, flow rate: 30 mL / min). The corresponding fractions were collected and freeze-dried to obtain the title compound (1.8 mg, yield: 1.8%) and (2.5 mg, yield: 2.6%).
[0840] Single-configuration compounds (shorter retention time):
[0841] Preparative chromatography: retention time 13.52 minutes.
[0842] MS m / z(ESI): 672.2 [M+1].
[0843] 1 H NMR(500MHz, CDCl3)δ8.05(d,1H),7.55(s,1H),7.27–7.21(m,2H),7.12–7.07(m,1H),6.91(s,1H),6.83(s,1H),5.60(s,1H),4.99(s,2H),4. 61(s,1H),4.16(s,1H),3.97(dd,3H),3.87(d,1H),3.81(s,1H),3.76– 3.63(m,4H),3.61–3.50(m,3H),3.33(d,2H),3.23(s,4H),2.95(d,1H).
[0844] Single-configuration compounds (longer retention time):
[0845] Preparative chromatography: retention time 15.17 minutes.
[0846] MS m / z(ESI): 672.2 [M+1].
[0847] 1 H NMR(500MHz, CDCl3)δ8.08(d,1H),7.72(d,1H),7.33(s,1H),7.26(d,1H),7.18(d,1H) ,7.12(t,1H),6.68(d,1H),5.71(d,1H),5.22(dd,2.2Hz,1H),5.02(d,1H),4.57(d,1H ),4.22(d,1H),4.00(d,2H),3.95–3.91(m,2H),3.81–3.74(m,2H),3.68(d,2H),3.50( dd,2H),3.44–3.34(m,3H),3.19(s,2H),3.16–3.09(m,2H),3.03(s,1H),2.95(s,1H).
[0848] Example 29
[0849] 5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-9-oxa-3(8,3)-benzo[e][1,3]oxazin-1(4,2),6(4,3)-dimorpholina-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 29
[0850] (1 2 R,6 3 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-9-oxa-3(8,3)-benzo[e][1,3]oxazin-1(4,2),6(4,3)-dimorpholina-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 29-1
[0851] (1 2 S,63 S)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-9-oxa-3(8,3)-benzo[e][1,3]oxazin-1(4,2),6(4,3)-dimorpholina-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 29-2
[0852] (1 2 R,6 3 S)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-9-oxa-3(8,3)-benzo[e][1,3]oxazin-1(4,2),6(4,3)-dimorpholina-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 29-3
[0853] (1 2 S,6 3 R)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-9-oxa-3(8,3)-benzo[e][1,3]oxazin-1(4,2),6(4,3)-dimorpholina-2(1,3),5(1,4)-dibenzocyclodecaban-2 6 -Carboxylic acid 29-4
[0854] Compound 29a was prepared by replacing 19b with 2-(morpholino-2-yl)ethanol in steps one through five of the synthetic route in Example 19. Compound 29a was prepared by replacing 19g with 29a in the synthetic method of Example 27. The title compound 29 was then prepared.
[0855] The reaction solution of compound 29 was prepared by high performance liquid chromatography (separation conditions: ODS-BIO C18 column, 5μm 30*250mm; mobile phase: aqueous phase (0.1% ammonium bicarbonate) and acetonitrile, gradient ratio: acetonitrile 20%-95%, flow rate: 30mL / min). The corresponding components were collected and freeze-dried to obtain the target product (0.68mg, yield: 3.45%) and (0.38mg, yield: 1.93%).
[0856] Compounds with shorter retention times:
[0857] High performance liquid chromatography (HPLC) for preparative chromatography: retention time 12.63 min.
[0858] MS m / z(ESI): 686.2 [M+1].
[0859] Compounds with longer retention times:
[0860] High performance liquid chromatography (HPLC) for preparative chromatography: retention time 15.47 min.
[0861] MS m / z(ESI): 686.2 [M+1].
[0862] Example 30
[0863] (1 2 S)-5 2 5 6 -dichloro-2 4 -Fluoro-4-oxo-3 3 ,3 4 -dihydro-3 2 H-8,11-dioxa-3(8,3)-benzo[e][1,3]oxazinza-1(4,2-morpholinza-6-(1,3-azacyclobutaneza-2-(1,3),5(1,4-diphenylhexacyclic dodecaban-2) 6 -Carboxylic acid 30
[0864] Using the synthetic method of Example 25, cyclopropylamine was replaced with tert-butyl 3-(hydroxymethyl)azacyclobutane-1-carboxylate to prepare title compound 30 (5 mg, yield: 6.63%).
[0865] MS m / z(ESI): 674.0 [M+1].
[0866] 1H NMR(500MHz, CDCl3)δ8.04(d,1H),7.81(d,1H),7.38(dd,1H),7.21(d,1H),7.08(t, 1H),6.42(s,1H),6.32(s,1H),5.62(d,1H),5.22(d,1H),5.03(d,1H),4.57(d,1H),4 .26–4.17(m,1H),4.13(t,1H),4.01(t,1H),3.94(q,3H),3.85(q,3H),3.75–3.65(m, 2H),3.61(dd,1H),3.52(dd,2H),3.37–3.27(m,2H),3.02–2.88(m,3H),2.40(t,1H).
[0867] Example 31
[0868] (2'S)-2',6'-dichloro-4'-fluoro-4'-oxospiro[cyclopropane-1,9'-7,11-dioxa-3(8,3)-benzo[e][1,3]oxazinza-1(4,2-morpholinza-6-(1,3)-azacyclobutaneza-2(1,3,5(1,4-diphenylheterocyclic dodecanone]-6'-carboxylic acid 31
[0869] first step
[0870] (S)-4-bromo-5-fluoro-2-(2-(hydroxymethyl)morpholine)benzoic acid 31b
[0871] Compound 19a (1.4 g, 5.91 mmol) (Shanghai Bide Pharmaceutical Co., Ltd.) and intermediate 31a (Shanghai Bide Pharmaceutical Co., Ltd.) (848 mg, 5.52 mmol, HCl) were dissolved in tetrahydrofuran (10 mL), and hexamethyldisilamide lithium (1 M, 28.09 mmol, 28.09 mL) was added dropwise. The mixture was reacted at room temperature for 18 hours, neutralized with 2 M formic acid solution (13 mL), and water (20 mL) was added. The mixture was extracted with dichloromethane (30 mL × 3), the organic phases were combined, washed with saturated sodium chloride solution (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to give the title compound 31b (1.90 g, crude product).
[0872] MS m / z(ESI): 335.1 [M+1].
[0873] Step 2
[0874] (S)-4-bromo-5-fluoro-2-(2-(hydroxymethyl)morpholine)methyl benzoate 31c
[0875] Compound 31b (1.1 g, 3.29 mmol) was dissolved in N,N-dimethylformamide (10 mL). Anhydrous potassium carbonate (910 mg, 6.58 mmol) and iodomethane (608 mg, 4.28 mmol) were added to the reaction solution. The mixture was reacted at room temperature for 30 minutes until all the starting material was converted to the product. The product was concentrated under reduced pressure and the residue was purified by silica gel column chromatography with eluent system B to give the title compound 31c (1.1 g, 100% yield).
[0876] MS m / z(ESI): 349.3 [M+1].
[0877] Step 3
[0878] (S)-4-bromo-2-(2-(((1-(((1-(tert-butoxycarbonyl)azacyclobut-3-yl)oxy)methyl)cyclopropyl)methoxy)methyl)morpholine)-5-fluorobenzoic acid 31e
[0879] Compound 31c (500 mg, 1.44 mmol) was dissolved in N,N-dimethylformamide (20 mL), sodium hydride (173 mg, 4.33 mmol, 60% purity) was added, and the mixture was stirred for 20 minutes. Then, 3-((1-(bromomethyl)cyclopropyl)methoxy)azacyclobutane-1-carboxylic acid tert-butyl ester 31d (506 mg, 1.58 mmol, prepared by the method disclosed in Example 0417, page 135 of patent application EP3971176) was added, and the mixture was reacted at room temperature for 12 hours. The pH was adjusted to 3-5 using 2M formic acid, ethyl acetate and water were added, the mixture was separated, the organic phase was washed once with water and then with brine, dried over anhydrous sodium sulfate, and concentrated to obtain the title compound 31e (900 mg, crude product).
[0880] MS m / z(ESI): 573.1 [M+1].
[0881] Step 4
[0882] (S)-3-(1-(((4-(5-bromo-4-fluoro-2-(methoxycarbonyl)phenyl)morpholin-2-yl)methoxy)methyl)cyclopropyl)methoxy)azacyclobutane-1-carboxylic acid tert-butyl ester 31f
[0883] Compound 31e (1.5 g, 2.62 mmol) was dissolved in N,N-dimethylformamide (10 mL). Anhydrous potassium carbonate (543 mg, 3.9 mmol) and iodomethane (483 mg, 3.40 mmol) were added to the reaction solution. The mixture was reacted at room temperature for one hour, and all the starting material was converted into the product. The product was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography with eluent system B to give the title compound 31f (1.2 g, yield 78.1%).
[0884] MS m / z(ESI): 589.2 [M+1].
[0885] Using the synthetic route from step 5 to step 11 of Example 2, compound 2g was replaced with 31f to obtain title compound 31 (15mg, yield: 21.9%).
[0886] MS m / z(ESI): 698.1 [M+1].
[0887] 1 H NMR(500MHz, CDCl3)δ8.06(d,1H),7.95(d,1H),7.47–7.42(m,1H),7.23(dd,1.6Hz,1H),7.11(t,1H),6 .54(d,1H),6.42(d,1H),5.70(d,1H),5.24(d,1H),5.07(d,1H),4.56(d,1H),4.46(s,1H),4.34–4.28( m,1H),4.22–4.17(m,1H),4.11(dd,2H),4.02(q,4H),3.85(d,1H),3.57(d,1H),3.46(t,1H),3.33(d,1 H),3.02(d,1H),2.85(dd,2H),2.70(d,1H),2.37(t,1H),0.69–0.63(m,1H),0.52(dq,2H),0.43(s,1H).
[0888] Biological evaluation
[0889] The following test examples further describe and explain this disclosure, but these test examples are not intended to limit the scope of this disclosure.
[0890] Test Example 1: Homogeneous Time-Resolved Fluorescence (HTRF) Detection of Keap1 Kelch-NRF2 Binding Experiment
[0891] The inhibitory activity of the compound on the binding between the KEAP1 protein kelch domain and the 9-mer amino acid sequence of NRF2 was detected by HTRF method.
[0892] Experimental steps:
[0893] HTRF combines fluorescence resonance energy transfer (FRET) and time-resolved technology (TR) to detect intermolecular interactions through the signal generated by fluorescence resonance energy transfer between the donor and acceptor. This experiment used 384-well white plates. 30 nM human Keap1 protein (N-terminus, residues 321-609), 50 nM FITC-labeled NRF2 protein (FITC-LDEETGEFL-NH2), and 5 μL of serially diluted analyte were added to each well. The final volume was adjusted to 15 μL using assay buffer (50 mM Tris-HCl, 100 nM NaCl, 0.01% Tween-20, 1 mM DTT, 0.01% BSA, pH 7.5), and incubated at room temperature for 1 hour. Then, 5 μL of HTRF mAb Anti-6His Gold Tb-Conjugate (Revity) diluted with assay buffer was added to each well, and the plates were incubated at room temperature for 1 hour. The excitation light readings at 490 nm and 520 nm were measured using the PHERAstar microplate reader with the LanthaScreen module, and the inhibition rate of the compound on intermolecular interactions was calculated. DMSO wells were used as negative controls, and wells with a 10000 nM positive compound concentration were used as positive controls. Concentration-response curves of the compound concentration versus Keap1-NRF2 binding inhibition were obtained using four-parameter nonlinear fitting with GraphPad PRISM software (Version 9.00; GraphPad San Diego, CA), and the relative IC50 values were calculated to evaluate the inhibitory activity of the compound on KEAP1-NRF2 binding.
[0894] Table 1. Inhibitory activity of the compounds disclosed herein against Keap-NRF2 binding.
[0895] Conclusion: The compound disclosed herein exhibits good inhibitory effect on the intermolecular binding of Keap1-NRF2.
[0896] Test Example 2: Detection of NQO1 mRNA Transcription Level in Beas-2B Cells
[0897] The expression level of the NQO1 gene downstream of NRF2 in Beas-2B cells was detected by real-time quantitative PCR, and the activation activity of the compound on NRF2 function was evaluated by EC50.
[0898] Experimental steps:
[0899] This experiment detected the mRNA level of the NQO1 gene in human lung epithelial cells (Beas-2B) to reflect the transcription factor activity of NRF2. Adherent Beas-2B cells were digested, resuspended in BEGM complete medium (Lonza, CC-3170), and the cell concentration was adjusted to 2.667 x 10^5 / ml before being seeded into 96-well cell culture plates. 75 μL was added to each well, and the cells were incubated overnight at 37°C with 5% CO2. On the second day, different concentration gradients of the compound were added, 25 μL per well, and the cells were incubated for another 24 hours at 37°C with 5% CO2. On the third day, cDNA was extracted using the EZ-press Cell to cDNA kit (EZBioscience), as follows:
[0900] Aspirate the cell culture medium and wash each well once with approximately 200 μL of PBS. After aspirating the PBS, add 20 μL of Cell Lysis Buffer to each well and vortex at 800 rpm for 5 minutes. Observe under a microscope to confirm complete cell lysis. Immediately aspirate 8 μL of the lysis product into a 96-well PCR plate pre-filled with 2 μL of gDNA Remover and gently pipette 10 times to mix. Incubate at room temperature for 8 minutes to remove the genome. After completion, add 5 μL of 4x Color CRT Mix and 5 μL of RNase-free ddH2O to each well of the lysis product, pipette 10 times to mix, and then perform reverse transcription (42℃, 15 min; 95℃, 3 min). Transfer to ice after completion.
[0901] The reverse transcription product was diluted 5-fold with 80 μL of RNase-free ddH2O and used as a qPCR template. GAPDH was used as an internal control gene. The reaction system and amplification primers are as follows (dye-based qPCR kit, EZBioscience):
[0902] 2x SYBR Green qPCR Master Mix 5μL
[0903] 0.2 μL of forward primer
[0904] 0.2 μL of reverse primer
[0905] 1 μL of cDNA template
[0906] ddH2O 0.6μL
[0907] NQO1 forward primer: GTCGGCAGAAGAGCACTGAT (SEQ ID NO:1)
[0908] NQO1 reverse primer: CACCACCTCCCATCCTTTCTT (SEQ ID NO:2)
[0909] GAPDH forward primer: GTTCGACAGTCAGCCGCATC (SEQ ID NO:3)
[0910] GAPDH reverse primer: GGAATTTGCCATGGGTGGA (SEQ ID NO:4)
[0911] qPCR reactions were performed using QuantStudio TM The 6Flex (Applied Biosystem) program settings are as follows:
[0912] Relative quantification of the NQO1 gene was performed using the comparative CT method. The DMSO treatment group served as a negative control, and the 110 nM positive molecule treatment group served as a positive control. Data processing was performed using GraphPad Prism 9 to obtain EC50 values. 50 The aim was to evaluate the activation activity of the compound on NQO1 transcription level, i.e. NRF2 function.
[0913] Table 2. Activation activity of the disclosed compounds on NQO transcriptional levels.
[0914] Conclusion: The compound disclosed in this study has a good activating effect on the transcriptional level of NQO1.
[0915] Test Example 3: NRF2 ARE reporter gene experiment in HepG2-hNQO1-ARE-Luc Cells
[0916] The expression level of reporter genes in HepG2-hNQO1-ARE-Luc Cells was detected using a luciferase reporter gene system, and the activation activity of the compounds on NRF2 transcriptional function was evaluated by EC50.
[0917] Experimental steps:
[0918] The luciferase reporter gene system is a reporter system that uses luciferin as a substrate to detect enzyme activity. By cloning the ARE transcriptional regulatory element upstream of the luciferase gene, rapid and sensitive quantitative detection of the activity of this signal transduction pathway can be achieved. In this experiment, two copies of the ARE sequence of the human NQO1 gene, the minP promoter, and the luciferase gene (Luc) were integrated into a stable cell pool of ATCC-derived HepG2 cells after lentiviral transfection and selection with puromycin. When the cells were treated with compounds, the agonist promoted the intracellular accumulation and nuclear translocation of NRF2, further binding to the ARE sequence and initiating the expression of the luciferase gene. The transcriptional activity of NRF2 was determined by measuring luciferase activity using the ONE-Glo assay reagent. In this experiment, stable HepG2 cells resuspended in DEME medium containing 10% FSB and 2 u / ml puromycin were seeded into 96-well transparent black plates and cultured at 37°C and 5% CO2 for 24 hours. Different concentration gradients of compounds were added, and the mixture was incubated at 37°C with 5% CO2 for 24 hours before adding ONE-Glo assay reagent. After shaking and equilibration to room temperature, the fluorescence intensity, i.e., luciferase activity, was detected using a Pherastar FSX microplate reader. Wells treated with DMSO served as blank controls, and wells treated with 200 nM positive molecules served as positive controls. Concentration-response curves of compound concentration versus fluorescence intensity were obtained using four-parameter nonlinear fitting with GraphPad Prism 9 software, and EC50 values were calculated to assess compound activity.
[0919] Table 3. Activation activity of the disclosed compound HepG2-hNQO1-ARE-Luc Cells on NRF2 transcriptional function.
[0920] Conclusion: The compound disclosed in this study has a good activating effect on NRF2 transcriptional function.
[0921] Test Example 4: Pharmacokinetic Evaluation
[0922] 1. Abstract
[0923] Using C57 mice as test animals, the drug concentration in plasma of C57 mice at different time points after intravenous injection (iv) and gavage (ig) administration of the compound of the present invention was determined by LC / MS / MS to study the pharmacokinetic behavior of the compound in C57 mice and evaluate its pharmacokinetic characteristics.
[0924] 2. Test Plan
[0925] 2.1 Test Drugs
[0926] Compound 14.
[0927] 2.2. Test Animals
[0928] Eighteen female C57 mice were divided into two groups. They were provided by Vital River Laboratory Animal Technology Co., Ltd. (SCXK (Jing) 2021-0006).
[0929] 2.3. Drug Preparation
[0930] A certain amount of the test compound was weighed separately, and DMSO was added to prepare a 4 mg / ml solution. 250 μL of 4 mg / mL compound solution + 250 μL DMSO + 500 μL Tween 80 + 9 mL normal saline was mixed to prepare a 0.1 mg / mL clear solution.
[0931] 2.4. Administration
[0932] Intravenous injection group: the administration dose was 1 mg / kg, and the administration volume was 10 mL / kg;
[0933] Intragastric administration group: the administration dose was 2 mg / kg, and the administration volume was 20 mL / kg;
[0934] 3. Procedure
[0935] C57 mice were administered via intravenous injection (i.v.) and intragastric administration (i.g.) respectively.
[0936] In the intravenous injection group, 0.1 mL blood samples were collected from the orbital sinus of the mice at 5 min, 0.25 h, 0.5 h, 1 h, 2 h, 4 h, 8 h, 11 h and 24 h after administration (3 mice at each time point, blood collected alternately). The blood was collected into EDTA anticoagulant tubes, centrifuged at 10,000 rpm for 2 minutes at 4°C to separate plasma, and then stored at -80°C until analysis. All operations were performed on ice and completed within 1 hour.
[0937] In the intragastric administration group, 0.1 mL blood samples were collected from the orbital sinus of the mice in each group at 0.25, 0.5, 1.0, 2.0, 4.0, 6.0, 8.0, 11 and 24.0 hours after administration (3 mice at each time point, blood collected alternately). The blood was collected into EDTA anticoagulant tubes, centrifuged at 10,000 rpm for 2 minutes at 4°C to separate plasma, and then frozen or stored at -80°C until analysis. All operations were performed on ice and completed within 1 hour.
[0938] Plasma samples at each time point after administration were analyzed by LC / MS / MS.
[0939] Table 4 Pharmacokinetic parameters of the compound of the present disclosure in C57 mice
[0940] Conclusion: The compound disclosed herein exhibits high blood concentrations, high exposure, and high bioavailability in C57 mice, demonstrating pharmacokinetic advantages.
Claims
1. A compound of general formula (I) or a pharmaceutically acceptable salt thereof, in: L 1 is (CR 4 R 4’ ) x , (CR 4a R 4b ) r NR 5 (CR 4a’ R 4b’ ) r0 , (CR 4c R 4d ) r1 NR 5’ C(O)(CR 4c’ R 4d’ ) r2 , (CR 4e R 4f ) r3 O(CR 4e’ R 4f’ ) r4 and (CR 4g R 4h ) r5 C(O)(CR 4g’ R 4h’ ) r6 ; L 2 is (CR 41 R 41’ ) x1 , (CR 41a R 41b ) r7 NR 51 (CR 41a’ R 41b’ ) r8 , (CR 41c R 41d ) r9 NR 51’ C(O)(CR 41c’ R 41d’ ) r10 , (CR 41e R 41f ) r11 O(CR 41e’ R 41f’ ) r12 and (CR 41g R 41h ) r13 C(O)(CR 41g’ R 41h’ ) r14 ; Q 1 Selected from key, CR Q01 R Q02 NR Q3 O, S, cycloalkyl, heterocyclic, aryl and heteroaryl, wherein the cycloalkyl, heterocyclic, aryl and heteroaryl are optionally substituted with one or more R*; Q 2 Selected from key, CR Q11 R Q21 NR Q31 O, S, cycloalkyl, heterocyclic, aryl and heteroaryl, wherein the cycloalkyl, heterocyclic, aryl and heteroaryl are optionally substituted with one or more R*; B 1 B 2 and B 3 Whether they are the same or different, each is independently a CR. B1 R B2 NR B3 O, C(O) or S; R 4 R 4a R 4b R 4c R 4d R 4e R 4f R 4g R 4h R 4’ R 4a’ R 4b’ R 4c’ R 4d’ R 4e’ R 4f’ R 4g’ R 4h’ R 41 R 41a R 41b R 41c R 41d R 41e R 41f R 41g R 41h R 41’ R 41a’ R 41b’ R 41c’ R 41d’ R 41e’ R 41f’ R 41g’ R 41h’ R Q01 R Q02 R Q11 R Q21 R B1 and R B2 The same or different, and each independently selected from hydrogen atoms, halogens, alkyl, alkenyl, alkynyl, haloalkyl, alkoxy, haloalkoxy, cyano, amino, hydroxy, hydroxyalkyl, cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, and heteroarylalkyl, wherein the alkyl, alkenyl, alkynyl, alkoxy, cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, and heteroarylalkyl are optionally selected by one or more R # replace; R 5 R 51 R 5’ R 51’ R Q3 R Q31 and R B3 The same or different, and each independently selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl, wherein the cycloalkyl, heterocyclic, aryl, and heteroaryl are optionally separated by one or more R # Replace; or R 4 R 4a R 4b R 4c R 4d R 4e R 4f R 4g R 4h R 4’ R 4a’ R 4b’ R 4c’ R 4d’ R 4e’ R 4f’ R 4g’ R 4h’ R 41 R 41a R 41b R 41c R 41d R 41e R 41f R 41g R 41h R 41’ R 41a’ R 41b’ R 41c’ R 41d’ R 41e’ R 41f’ R 41g’ R 41h’ R 5 R 51 R 5’ and R 51’ Two identical or different atoms in the group, together with the attached atoms, form a cycloalkyl, heterocyclic, aryl, or heteroaryl group, wherein the cycloalkyl, heterocyclic, aryl, or heteroaryl group is optionally surrounded by one or more R groups. # replace; R B1 R B2 and R B3 Two identical or different atoms in the group, together with the attached atoms, form a cycloalkyl, heterocyclic, aryl, or heteroaryl group, wherein the cycloalkyl, heterocyclic, aryl, or heteroaryl group is optionally surrounded by one or more R groups. # replace; x, x1, r, r0 to r14 are the same or different, and each is independently 0, 1, 2, 3, 4, 5 or 6; X 1 For CR X1 Or N; Y 1 For CR Y1 Or N; Y 2 For CR Y2 Or N; Z 1 For CR Z1 Or N; R X1 R X2 R X3 R Y1 R Y2 R Y3 R Y4 R Z1 R Z2 R Z3 and R Z4 Whether identical or different, each is independently selected from hydrogen atom, halogen, alkyl, heteroalkyl, alkenyl, alkynyl, alkoxy, haloalkyl, haloalkoxy, hydroxyalkyl, cyano, -NR 7a R 7b -NR 7a OR 7b -ONR 7a R 7b -NR 7c NR 7a R 7b hydroxyl group, -C(O)R 8 -C(O)OR 8 -C(O)NR 7a R 7b -C(O)NR 7a S(O) w R 8 -S(O) w R 8 Cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, and heteroarylalkyl, wherein the alkyl, heteroalkyl, alkenyl, alkynyl, cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, and heteroarylalkyl are each independently and optionally selected by one or more R * Replaced; or R Y1 R Y2 Together with the attached atoms, it forms cycloalkyl, heterocyclic, aryl, or heteroaryl groups, and / or R Y3 R Y4 Together with the attached atoms, it forms cycloalkyl, heterocyclic, aryl, or heteroaryl groups, and / or R X1 R X2 Together with the attached atoms, it forms cycloalkyl, heterocyclic, aryl, or heteroaryl groups, and / or R X3 R X2 Together with the attached atoms, it forms cycloalkyl, heterocyclic, aryl, or heteroaryl groups, and / or R Z3 R Z2 Together with the attached atoms, it forms cycloalkyl, heterocyclic, aryl, or heteroaryl groups, and / or R X3 R X4 Together with the attached atoms, it forms a cycloalkyl, heterocyclic, aryl, or heteroaryl group, wherein the cycloalkyl, heterocyclic, aryl, or heteroaryl group is optionally surrounded by one or more R groups. * replace; R 7a R 7b R 7c They may be the same or different, and each is independently selected from hydrogen atoms, alkyl, heteroalkyl, hydroxyalkyl, aminoalkyl, cycloalkyl and heterocyclic groups, wherein each of the alkyl, heteroalkyl, hydroxyalkyl, aminoalkyl, cycloalkyl and heterocyclic groups is independently optionally substituted by one or more substituents selected from halogen, alkyl, alkoxy, haloalkyl and haloalkoxy; Or R 7a and R 7b Together with the attached nitrogen atom, a heterocyclic group is formed, wherein the heterocyclic group is optionally substituted by one or more substituents selected from halogen, oxo, =S, alkyl, alkoxy, haloalkyl, haloalkoxy, cyano, amino, nitro, hydroxy, hydroxyalkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl. R 8 The same or different, and each independently selected from hydrogen atoms, halogens, alkyl, alkenyl, alkynyl, haloalkyl, alkoxy, haloalkoxy, hydroxyl, hydroxyalkyl, cycloalkyl, and heterocyclic groups, wherein the alkyl, alkenyl, alkynyl, cycloalkyl, and heterocyclic groups are each independently optionally selected by one or more R atoms. # replace; Each R * and R # The same or different, and each independently selected from oxo, =S, =N-alkyl, =NH, halogen, alkyl, alkenyl, alkoxy, haloalkyl, haloalkoxy, hydroxy, hydroxyalkyl, alkoxyalkyl, cyano, alkylthio, amino, -NHalkyl, -N(alkyl)2, -alkylene-amino, -alkylene-NHalkyl, -alkylene-N(alkyl)2, amide, nitro, cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, heteroarylalkyl, cycloalkyloxy, heterocyclic oxy, aryloxy, and heteroaryloxy, wherein the =N-alkyl, alkyl, alkenyl, alkoxy, alkoxyalkyl, alkoxyalkyl, alkylthio, -NHalkyl, -N(alkyl)2, -alkylene-amino, -alkylene-NHalkyl, -alkylene -N(alkyl)2, cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, heteroarylalkyl, cycloalkyloxy, heterocyclic oxy, aryloxy, and heteroaryloxy are each independently and optionally substituted by one or more substituents selected from oxo, =S, halogen, alkyl, alkenyl, alkoxy, haloalkyl, haloalkoxy, hydroxy, hydroxyalkyl, alkoxyalkyl, cyano, alkylthio, amino, -NHalkyl, -N(alkyl)2, -alkylene-amino, -alkylene-NHalkyl, -alkylene-N(alkyl)2, amide, nitro, cycloalkyl, heterocyclic, aryl, heteroaryl, cycloalkylalkyl, heterocyclic alkyl, arylalkyl, heteroarylalkyl, cycloalkyloxy, heterocyclic oxy, aryloxy, and heteroaryloxy; and w can be 0, 1, or 2.
2. The compound of formula (I) according to claim 1, or a pharmaceutically acceptable salt thereof, wherein Q 1 A 6-membered heterocyclic group is optionally substituted with one or more R*, where R* is defined in general formula (I).
3. The compound of general formula (I) according to claim 1 or 2, or a pharmaceutically acceptable salt thereof, wherein the compound is of general formula (II) or a pharmaceutically acceptable salt thereof. in: G 1 It consists of carbon atoms, nitrogen atoms, or oxygen atoms; R Q1 It is R*, or two Rs Q1 Together with the attached atoms, it forms a 3- to 6-membered cycloalkyl or a 3- to 6-membered heterocyclic group, wherein the 3- to 6-membered cycloalkyl or 3- to 6-membered heterocyclic group is optionally surrounded by one or more R... # replace; q can be 0, 1, 2, 3, 4, 5, or 6; M 1 For bonds, O, C(O), NHC(O) or NR 5 ; M 2 For bond, O(CR) 41e’ R 41f’ ) r12 or NR 51 (CR 41a’ R 41b’ ) r8 ; m is 0, 1, 2, 3, 4, 5, or 6; n is 0, 1, 2, 3, 4, 5, or 6; R 41e’ R 41f’ R 41a’ R 41b’ R 5 R 51 、R*、R # Q 2 R 4e R 4f R 41e R 41f r12, r8, X 1 R X2 R X3 Y 1 Y 2 R Y3 R Y4 Z 1 R Z2 R Z3 R Z4 B 1 B 2 and B 3 As defined in claim 1.
4. The compound of general formula (I) according to any one of claims 1 to 3, or a pharmaceutically acceptable salt thereof, wherein B 1 CH2; and / or B 2 CH2; and / B 3 It is O.
5. The compound of general formula (I) according to any one of claims 1 to 4, or a pharmaceutically acceptable salt thereof, wherein X 1 For CH; and / or Y 1 For CR Y1 R Y1 As defined in claim 1; and / or Y 2 For CH; and / or Z 1 For CH.
6. The compound of general formula (I) according to any one of claims 1 to 5, or a pharmaceutically acceptable salt thereof, wherein R Z4 -C(O)OR 8 R 8 As defined in claim 1; preferably, R Z4 It is -C(O)OH.
7. The compound of general formula (I) according to any one of claims 1 to 6, wherein it is the compound of general formula (III) or a pharmaceutically acceptable salt thereof. in: G 1 R Q1 , q, M 1 M 2 m, n, Q 2 R 4e R 4f R 41e R 41f R X2 R X3 R Y1 R Y4 and R Z2 As defined in claim 3.
8. The compound of formula (I) according to any one of claims 1 to 7, or a pharmaceutically acceptable salt thereof, wherein R X2 R X3 Whether the elements are the same or different, they are each independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Halogenated alkyl and C 1-6 Halogenated alkoxy groups; and / or R Y1 R Y4 Whether the elements are the same or different, they are each independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl, C 1-6 Halogenated alkyl groups and cyano groups; and / or R Z2 For hydrogen atoms, halogens, C 1-6 Alkyl and C 1-6 Halogenated alkyl groups.
9. The compound of formula (I) according to any one of claims 3 to 8, or a pharmaceutically acceptable salt thereof, wherein R Q1 They may be the same or different, and each is independently selected from oxo groups, halogens, and C. 1-6 Alkyl and C 1-6 Halogenated alkyl groups; and / or q is 0 or 1; and / or for *Terminal and Q 2 Connected; and / or Q 2 Selected from key, NC 1-6 Alkyl, N-3 to 6-membered cycloalkyl, R Q2 It is R*, or two Rs Q2 Together with the attached atoms, it forms a 3- to 6-membered cycloalkyl or a 3- to 6-membered heterocyclic group, wherein the 3- to 6-membered cycloalkyl or 3- to 6-membered heterocyclic group is optionally surrounded by one or more R... # Replacement, q2 is 0, 1, 2, 3, 4, 5 or 6, R*, R # As defined in claim 1, *end and L 2 Or M 2 Connected.
10. The compound of formula (I) according to any one of claims 1 to 8, or a pharmaceutically acceptable salt thereof, wherein R 4e R 4f R 41e R 41f Whether the atoms are the same or different, and each is independently selected from hydrogen atoms, C atoms 1-6 Alkyl and C 1-6 Halogenated alkyl, or R 4e R 4f Together with the attached atoms, it forms a 3- to 6-membered cycloalkyl group or a 3- to 6-membered heterocyclic group, or R 41e R 41f Together with the attached atoms, it forms a 3- to 6-membered cycloalkyl or a 3- to 6-membered heterocyclic group, wherein the 3- to 6-membered cycloalkyl or 3- to 6-membered heterocyclic group is optionally surrounded by one or more R... * Instead, R* as defined in claim 1.
11. The compound of formula (I) according to any one of claims 3 to 8, 10, or a pharmaceutically acceptable salt thereof, wherein m is 1 or 2; and / or n is 1, 2, 3 or 4.
12. The compound of general formula (I) according to any one of claims 1 to 11, or a pharmaceutically acceptable salt thereof, selected from the group consisting of: And all compounds in Group A of the instructions and their pharmaceutically acceptable salts.
13. A compound of general formula (IIIA) or a salt thereof, in: R XX It is a halogen; R PP For hydrogen atoms, C 1-6 Alkyl or C 1-6 Halogenated alkyl groups; G 1 R Q1 , q, M 1 M 2 m, n, Q 2 R 4e R 4f R 41e R 41f R X2 R X3 R Y1 R Y4 and R Z2 As defined in claim 7.
14. A compound or a salt thereof, selected from the following compounds: And all compounds and their salts in Group B of the instruction manual.
15. A method for preparing a compound of formula (III) according to claim 1 or a pharmaceutically acceptable salt thereof, comprising: R PP For hydrogen atoms, C 1-6 Alkyl or C 1-6 Halogenated alkyl groups; When R PP When the atom is hydrogen, the compound represented by general formula (IIIA) or its salt undergoes a cyclization reaction to give the compound represented by general formula (III) or its pharmaceutically usable salt; When R PP C 1-6 Alkyl or C 1-6 When alkyl halogenated, the compound of general formula (IIIA) or its salt undergoes a cyclization reaction followed by a hydrolysis reaction, or a hydrolysis reaction followed by a cyclization reaction, to obtain the compound of general formula (III) or its pharmaceutically usable salt. in: R XX It is a halogen; G 1 R Q1 , q, M 1 M 2 m, n, Q 2 R 4e R 4f R 41e R 41f R X2 R X3 R Y1 R Y4 and R Z2 As defined in claim 7.
16. A pharmaceutical composition comprising a compound or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 12, and one or more pharmaceutically acceptable carriers, diluents or excipients.
17. Use of the compound of any one of claims 1 to 12 or a pharmaceutically acceptable salt thereof or the pharmaceutical composition of claim 16 in the preparation of a medicament for activating NRF2.
18. Use of the compound of any one of claims 1 to 12 or a pharmaceutically acceptable salt thereof or the pharmaceutical composition of claim 16 in the preparation of a medicament for treating and / or preventing diseases or conditions mediated or dependent on NRF2.
19. Use of the compound of any one of claims 1 to 12 or a pharmaceutically acceptable salt thereof or a pharmaceutical composition of claim 16 in the preparation of a medicament for the treatment and / or prevention of neurodegenerative diseases, respiratory diseases, immune / inflammatory diseases, ophthalmic diseases, liver diseases, tumors or kidney diseases; preferably in the preparation of a medicament for the treatment of chronic obstructive pulmonary disease (COPD).