Proliferation of preadipocytes with stress-induced cellular factors

Abstract

The present invention relates to a method of preparing adipocytes, said method comprising or consisting of: (a) preparing a cell-free composition comprising adipogenic growth factors by: (i) subjecting cells to stress; and (ii) collecting factors produced by said cells when subjected to said stress, wherein said cells are in at least one first carrier and said collecting is effected by means of a second carrier, which is reversibly attached to and separated from said first carrier(s) by a device configured to allow the passage of said factors and prevent passage of said cells; thereby obtaining said cell-free composition comprising adipogenic growth factors; and (b) contacting preadipocytes and / or adipose-derived stem cells (ASCs) with the cell-free composition comprising adipogenic growth factors from step (a); thereby preparing adipocytes.

Description

[0001] New PCT-Patent Application

[0002] Machens Innovations Holding GmbH

[0003] Vossius Ref.: AJ3341 PCT

[0004] Proliferation of preadipocytes with stress-induced cellular factors

[0005] The present invention relates to a method of preparing adipocytes, said method comprising or consisting of: (a) preparing a cell-free composition comprising adipogenic growth factors by: (i) subjecting cells to stress; and (II) collecting factors produced by said cells when subjected to said stress, wherein said cells are in at least one first carrier and said collecting is effected by means of a second carrier, which is reversibly attached to and separated from said first carrier(s) by a device configured to allow the passage of said factors and prevent passage of said cells; thereby obtaining said cell-free composition comprising adipogenic growth factors; and (b) contacting preadipocytes and / or adipose-derived stem cells (ASCs) with the cell-free composition comprising adipogenic growth factors from step (a); thereby preparing adipocytes.

[0006] In this specification a number of documents are cited. The disclosure of these documents, while not considered relevant for the patentability of this invention is herewith incorporated by reference in its entirety. More specifically, all reference documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.

[0007] The field of regenerative medicine aims to replace, engineer or regenerate human or animal cells, tissues or organs to restore or establish normal function and structure, taking advantage of the body’s own repair mechanisms (Mason & Dunhill, 2007). As one such approach, autologous fat transplantation or lipotransfer has emerged as a promising strategy for its potential in soft tissue augmentation and the reconstruction of congenital or acquired tissue defects for both medical and cosmetic purposes. First described over a century ago, autologous fat transfer comprises harvesting adipose tissue from a patient and subsequently re-introducing the fat tissue in other body areas of the patient, that are in need of augmentation or repair. Since the autologous fat is host compatible, readily available and can be harvested easily and repeatedly, this method has been widely used in clinical cases (Toyserkani et al., 2016).

[0008] However, the long-term results of lipotransfer procedures have been highly variable with unpredictable degrees of resorption and volume loss. Graft survival rates vary unpredictably between subjects and are typically between 50 and 70%, leading to a reduced efficacy and loss of volume. (Parrish and Metzinger, 2010). In order to increase the survival rate of transplanted adipocytes, there have been attempts to add growth factors such as insulin or VEGF to the transplanted fat tissue or to enrich the fat tissue with adipose tissue-derived stromal cells (ASCs) in a process termed cell-assisted lipotransfer (CAL; Toyserkani et al., 2016). ASCs are a heterogenous population of multipotent stemcells including preadipocytes found in the stromal vascular fraction of adipose tissue. However, there have been concerns over the placement of adipocyte-derived stem cells into hormonally-active environments, such as the female breast, since this is believed to lead to the development of cancers (Parrish and Metzinger, 2010). Consequently, while CAL generally increases the survival rates of transplanted fat tissues, there remain practical, legal and logistical challenges as well as risks concerning the growth of cancer cells.

[0009] The growth of adipose tissue involves an increase in adipocyte size and the formation of new adipocytes from precursor cells, i.e., preadipocytes. This process, termed adipocyte differentiation, requires cells to integrate multiple signals, often from hormones and growth factors that activate specific receptors, triggering intracellular events essential for differentiation. Although serum is important for preadipocyte differentiation, the exact components of serum that influence this process remain poorly understood. Chemically defined serum-free media have helped identify the specific hormonal requirements, with insulin-like growth factor-l (IGF-I), cAMP, and glucocorticoids being generally considered essential for inducing differentiation (Gregoire et al., 1998). The development of more efficient methods for adipocyte differentiation may be beneficial for lipotransfer methods.

[0010] Exposing cells to hypoxia to induce production of angiogenic factors has widely been investigated (Cheema et al. 2008; Namiki et al. 1995; Di et al. 2009). Furthermore, pre-conditioning cells (e.g., bone marrow stem cells) to hypoxia has been shown to increase their survival and angiogenic potency upon transplantation (Kubo et al. 2009). Cellular hypoxia-induced signaling could induce directional angiogenesis in vitro and In vivo (Hadjlpanayl et al. 2010b). On the basis of this, an angiogenic therapy was developed that aims to deliver hypoxia-induced signaling without living cells (Hadjlpanayi et al. 2011; WO / 2009 / 136173), wherein hypoxia-induced signaling can be delivered in vivo, on-demand, without relying on ongoing production of factors by living cells. However, this therapy still faces certain limitations, such as being highly invasive, bearing common complications of surgery (e.g., bleeding, infection, thrombosis), and requiring multiple applications to provide angiogenic factors (e.g., VEGF) which are known to have a short half-life (Cao and Mooney 2007), and the lack to fully replicate the physiological environment wherein different factors are expressed at different times. In a patent published as EP2809333, stimulation of angiogenesis has been achieved by using stress (e.g., hypoxia) on cells in a first carrier, resulting in the secretion of growth factors which are captured In a second carrier, which Is a scaffold free from cells and contaminants. The collection of said factors Is achieved by using a device comprising the first carrier, second carrier and means of subjecting the cells in the first carrier to stress application of the obtained mixture of factors described a way to improve wound tissue healing and treating or preventing tissue damage. Providing damaged tissue with one or more compositions as described in EP2809333 has been shown to be suitable to replace the missing factors at the site of tissue damage such that healing proceeds further. The tissue damage treated or prevented is more specifically a wound caused by radiation, ulcers, Incisions, lacerations, abrasions, burns or post-wound or post-grafting ischemic tissue. Accordingly, the disorders which are described to be treated in the prior art by factors derived from hypoxia-treated cells, are associated with diseases of the vascular system, cartilage repair, muscle repair and growth, bone and tendon healing, and nerve regeneration.In summary, methods in the prior art describe the advantages of the utilization of products obtained by stress (e.g. hypoxia) induced cells which however are unrelated to the practice of lipotransfer. Recent developments in lipotransfer techniques, such as CAL as described above, still suffer from unpredictable graft survival rates and potential risks concerning cancer development. In view of the prior art as described above, the technical problem underlying the present invention can be seen in the provision of novel and improved means and methods for attending to clinical and cosmetic situations that can be treated with adipocytes. The technical problem is solved by the subject-matter of the enclosed claims.

[0011] Accordingly, in a first aspect the present invention relates to a method of preparing adipocytes, said method comprising or consisting of: (a) preparing a cell-free composition comprising adipogenic growth factors by: (i) subjecting cells to stress; and (II) collecting factors produced by said cells when subjected to said stress, wherein said cells are in at least one first carrier and said collecting is effected by means of at least one second carrier, which Is reversibly attached to and separated from said first carrler(s) by a device configured to allow the passage of said factors and prevent passage of said cells; thereby obtaining said cell-free composition comprising adipogenic growth factors; and (b) contacting preadipocytes and / or adipose-derived stem cells (ASCs) with the cell-free composition comprising adipogenic growth factors from step (a); thereby preparing adipocytes.

[0012] The term "stress" as used herein relates to any condition that deviates from the conditions a given cell Is subjected to when present in a homeostatic state without external disturbances affecting growth or function. Typically, stress may be triggered by subjecting cells to a stimulus. The term "stress" may also be defined in terms of Its result as regards the cells, which result is the raising of a cellular response, more specifically a change in the expression pattern of peptidic and / or proteinaceous factors. This change in expression pattern which occurs in response to a stimulus may change over time; see the enclosed examples. The change of expression pattern over time which is observed in vitro generally parallels that observed in vivo. Preferred forms of stress are disclosed further below. As a consequence of being subjected to stress, cells provide a response. Said response includes the production, preferably the secretion of factors. In addition to secreted factors, the term "produced factors" includes factors which are produced inside the cell and leave the cell by means of passive diffusion as opposed to active secretion. It Is furthermore contemplated that certain conditions of stress, such as electric stimulation using certain parameter settings such as 1 to 20 Hz for 30 to 60 min or mechanical stimulation may cause cells to be become leaky, which leakiness may entail that factors produced by the cells are set free.

[0013] Without wanting to be bound by theory, and as is shown in the Examples below, it was found by the inventor that the cell-free composition from cells that have been subjected to stress (such as HPS) according to the first aspect of the invention provides higher concentrations of adipogenic growth factors compared to compositions that have not been subjected to stress (such as NS or PRP).

[0014] The term "adipogenic growth factor" as used herein, in its broadest sense, refers to any chemical species produced by a cell when subjected to stress, which positively influences the growth, survival differentiation and / or proliferation of adipocytes. Preferred factors are biomolecules such as peptides,proteins, nucleic acids, lipids and carbohydrates. Particularly preferred are peptides and proteins, wherein it is understood that the term "protein" includes polypeptides. Peptides are polycondensates of amino acids containing up to 30 amino acids, whereas polypeptides typically contain 31 or more amino acids. Proteins, in addition to polypeptides, may further comprise other molecules, such as prosthetic groups. Moreover, one protein may comprise more than one polypeptide chain, as is the case with oligomeric such as dimeric, trimeric or tetrameric proteins. Preferred adipogenic growth factors are described in more detail below. The identity of certain factors produced by cells when subjected to stress is also apparent from the examples enclosed herewith.

[0015] A requirement that the identity of one or more adipogenic growth factors would be known, however, does not arise for the purposes of the present invention. Instead, and without wishing to be bound by a specific theory, it is considered that the method of the present invention permits to capture complex factor mixtures which may be difficult or even impossible to prepare by other means.

[0016] The method according to the first aspect of the present invention provides for the composition to be obtained to be cell-free, despite the fact that what is subjected to stress according to the invention are necessarily cells. This may be achieved, for example, by the means specified in the first aspect, namely by confining the cells to a first carrier while using a second carrier for the purpose of collecting said factors. Said second carrier is cell-free at the beginning and remains cell-free owing to its spatial distinctness from the first carrier. Preferred, more specific or additional means of ensuring that the second carrier remains cell-free are described in more detail further below. It is furthermore important that said first and second carriers are concomitantly present at least during step (ii) and preferably during both steps (I) and (ii). Such setup provides for a one-step procedure of preparing said cell-free composition, preferably without any need for further steps such as separation, filtration, centrifugation or purification. Such cumbersome steps are avoided by the present invention as are any losses, contaminations or biases which may be introduced by such steps.

[0017] Said cells to be subjected to stress are comprised in the first carrier. Accordingly, the term “at least one first carrier” as used herein, refers to a substance that comprises cells, the cells being held together by endogenously produced molecules and thus is, but is not required to be, free of any exogenously added substances or prepared material. In one embodiment, the materials of the first carrier and / or of the second carrier are different from cells, chosen such that cells do not leave the first carrier and / or are not capable of entering to the second carrier. An option for the first carrier is a matrix wherein the cells are embedded and prevented from escaping. One example for a first carrier is a syringe. A different example is a glass, acrylic glass or plastic carrier, closed at the bottom and reversibly opened at the top with a connection to the second carrier configured to allow the factors to pass into the second carrier but to retain the cells in the first carrier. Means of preventing entry of cells Into the second carrier are disclosed in a preferred embodiment below.

[0018] In a further preferred embodiment according to the first aspect, (a) one or both carriers comprise one or more of (i) proteins, preferred proteins being collagen, fibrin, elastin and fibronectin; (ii) polysaccharides, preferred polysaccharides being chitin, alginate and cellulose; (iii) glycosaminoglycans, preferred glycosaminoglycans being chondroitin sulfate, dermatan sulfate, keratan sulfate, heparin sulfate, heparan sulfate and hyaluronic acid; (iv) synthetic polymers, preferred synthetic polymers being polyglycolic acid, polylactic co-glycolic acid, polylactic acid andpolycaprolactone, polystyrene and polyethylene terephtalate; (v) de-cellularised native tissue, preferred native tissues being dermis, small intestinal submucosa and bladder submucosa; and (vi) inorganic material, preferably calcium phosphate ceramics, alumina ceramics, zirconia ceramics, nitride ceramics, carbon nanotubes and metals selected from or alloys comprising titanium, tantalum, iron, magnesium, cobalt and chromium; (b) one or both carriers are selected from gel; sponge; mesh; microparticles; nanoparticles; microfibers; nanofibers; preferably electrospun microfibers or nanofibers; and nanotubes; (c) said first carrier or at least one of said first carrier(s) furthermore comprises an electric conductor; (d) said first carrier or (at least one of) said first carrier(s) is / are selected from cell sheet(s) and split-thickness or full-thickness skin graft(s), said graft(s) and cell sheet(s) preferably being autologous; and / or (e) said second carrier is selected from cream, emollient or ointment.

[0019] The term “at least one second carrier”, as used herein on the other hand is free from cells at the beginning and remains owing to its spatial distinctness from the first carrier. The at least one second carrier is used for the purpose of collecting the factors secreted by said cells subjected to stress as contained in the first carrier. It is furthermore Important that said first and second carriers are concomitantly present at least during step (li) and preferably during both steps (I) and (ii).

[0020] By using more than one second carrier it is possible to separate the total factor load generated by the cells in said first carrier(s) into a plurality of smaller doses. Using a plurality of second carriers can produce different compositions, in this case preferably in conjunction with one first carrier. The obtained compositions may differ with regard to factor composition and / or factor concentration. This may be achieved, for example, by exposing each second carrier for different time periods of stress, for example, four, eight or twelve days. Each different composition obtained after a certain amount of time may comprise a distinct variety of factors. Such different compositions may be administered once or several times In a distinct sequence of administration stages / steps. The administration of the composition in several stages / steps, i.e., a certain sequence, may be used for example to evaluate allergic reactions. In a first stage a second carrier may be used which has been concomitantly present with said first carrier for a short period of time. Said administration may be followed with (a) second (or further) second carrier(s) which has / have been conditioned, i.e., kept concomitantly present with the first carrier for a longer period of time. Second carriers may also be replaced, I.e., in a first step a particular second carrier may be concomitantly present with said first carrier for a given period of time, followed by removal of the second carrier.

[0021] The “device configured to allow the passage of said factors and prevent passage of said cells” is understood as to relate to a device effecting conditions excluding the cells subjected to stress or parts thereof, pathogens and / or exterior contaminants in the supernatant and accordingly in the composition. Means and methods to achieve such conditions are known in the art, including, for example sterile filtration using one or more filters) or diffusion through one or more membrane(s) of particular pore size(s) or a combination thereof. The means and methods for achieving conditions that prevent contamination also refer to the use of specific binding or inhibitory agents that exclude said contaminants by specific interaction. For example, the removal and / or inhibition of certain factors, such as inflammatory cytokines, matrix metalloproteinases and / or cellular metabolic products, may be desirable. This could be achieved for example with cytokine neutralizing antibodies (e.g., anti-TNFa monoclonal antibody), cytokine receptors (e.g., TNF-binding receptor; Etanercept) or enzymeinhibitors, in particular protease inhibitors (e.g., Tissue Inhibitors of Metalloproteinases; TIMP1, TIMP2, TIMP3, TIMP4).

[0022] It is understood that step (ii) is performed under conditions that prevent contamination by pathogens and / or non-pathologic cells and / or parts of pathogens or non-pathogenic cells in a preferably one-step setup. Such setup provides for the preparing of said composition, preferably without any need for further steps such as separation, filtration, centrifugation, or other means of purification.

[0023] The term “pathogen,” as used herein refers to any pathogenic microorganism or substances derived from such pathogenic microorganisms. The term “non-pathogenic cell” refers primarily to the cells subjected to stress, which are excluded from the supernatants. As used herein, the term “parts of cells” refers to parts of the cell membrane, organelles and other cell components as well as certain biomolecules counteracting the regenerative character of the factors in the composition to be obtained. It is understood that parts of pathogens and / or non-pathogenic cells of a size smaller than the size of the applied filter or biomolecules which are not bound to a specific agent as described above, such as nucleotides, may not be excluded from the supernatant and obtained composition. The skilled person may choose the pore size of the filter and specific agents to bind certain biomolecules and excludes certain contaminants in accordance with criteria used in the art. For example, the parts of pathogens and / or non-pathogenic cells excluded by the filter are larger than 1 nm, preferably larger than 0.22 pm.

[0024] The term “adipocyte” or “fat cell” as used herein refers to a mesodermal cell of mesenchymal origin that specializes In the storage of energy in the form of lipids, primarily triglycerides. Adipocytes are distinguished by a large lipid droplet that occupies most of the cell’s volume, pushing the nucleus and other organelles to the periphery. They are classified into white adipocytes, which store energy, and brown adipocytes, which are involved in heat generation through thermogenesis. White adipocytes are primarily located in white adipose tissue (WAT), which is composed of about 80 to 90% white adipocytes. Preferably, the first aspect relates to a method of preparing white adipose tissue.

[0025] The term “preadipocyte” as used herein refers to precursor cells of mature adipocytes that originate from mesenchymal stem cells. They are characterized by their ability to differentiate into adipocytes in response to specific signals, such as the adipogenic growth factors disclosed herein. The process of differentiation Includes accumulating lipid droplets and developing the features of mature adipocytes, including the expression of key transcription factors like PPARy and C / EBPs.

[0026] In Example 2 below, it is shown that a cell-free composition comprising adipogenic growth factors, herein specified as hypoxia preconditioned serum (HPS), contains significantly increased levels of several adipogenic growth factors compared to normal serum (NS) and patelet-rich plasma (PRP). This suggests an adipogenic potential of HPS, which will result in a beneficial effect on the volume and viability outcome of lipotransfer procedures. Accordingly, the effects of HPS having a concentration of 10% or 40% on preadipocytes have been demonstrated in the Examples 3 and 4 enclosed below. It is shown that the higher dose of 40% HPS stimulates particularly adipocyte differentiation better than the lower dose and also better than NS and PRP.

[0027] The term “adipose-derived stem cells” (ASCs) refers to mesenchymal stem cells that are isolated from adipose tissue. ASCs are characterized in that they are adherent on plastic culture flasks, can be expanded in vitro, and have the capacity to differentiate into multiple cell lineages. Unlike bonemarrow-derived MSCs, ASCs can be obtained from abundant adipose tissue by a minimally invasive procedure, which results in a high number of cells. This makes them promising for regenerating tissues and organs damaged by injury or diseases (Tsuji, W et al., World J. Stem Cells 6.3 (2014):

[0028] 312.)

[0029] The term “hypoxia preconditioned serum”, as used herein, and further abbreviated as “HPS” is a cell-free composition in accordance with the present invention, wherein blood cells have been stressed using hypoxic conditions. Means and methods to induce hypoxia are known in the art and are described in this specification elsewhere.

[0030] Accordingly, in some embodiments the method is an in vitro or ex vivo method.

[0031] In an alternative embodiment, the method is an in vivo method in the sense that the preadipocytes and / or adipose-derived stem cells (ASCs) are contacted in vivo with the cell-free composition comprising adipogenic growth factors. In this case, the cell-free composition is injected into the desired body site of a subject. It is envisioned that this enhanced survivability and proliferation of preadipocytes and adipocytes is also maintained in vivo after administration to a subject. In a preferred embodiment, the subject is a human.

[0032] In accordance with the present invention, the term “contacting” relates to a process which ensures that the cells and cell-free composition are sufficiently mixed for the adipogenic growth factors to be taken up into the cells. “Contacting” may or may not further comprise culturing the cells for an extended period of time together with the cell-free composition.

[0033] Accordingly, in a preferred embodiment of the first aspect, the preadipocytes and / or adipose-derived stem cells (ASCs) are contacted with the cell-free composition comprising adipogenic growth factors for at least 24 hours, more preferably at least 48 to 96 hours.

[0034] As is shown in Figure 4 herein below, incubation for 96 hours results in higher expression of various adipogenic markers compared to incubation for 48 hours. The finding that there was no significant difference in gene expression levels between the groups after 96 hours suggests that a cell free composition comprising adipogenic growth factors according to the invention (such as HPS) may promote a strong differentiation between hours 48 and 96, and its effects may converge with those of NS and PRP after 96 hours, as differentiation progresses. Even though contacting for at least 48 to 96 hours is preferred, in accordance with the present invention it is envisioned that contacting for 24 hours is sufficient in order to stimulate adipocyte differentiation. In this connection it is to be understood that the at least 24 hours contacting time is optional in order to increase the yield of adipocytes. It is envisioned that mixing, i.e., contacting the preadipocytes with the cell free composition comprising adipogenic growth factors is sufficient in order to stimulate adipogenic proliferation.

[0035] Preadipocytes are primarily found in the stromal-vascular fraction (SVF) of WAT, which further comprises hematopoietic cells, endothelial cells, pericytes, adipose-derived stem cells (ASCs) and stromal cells and is obtained from lipoaspirate. Lipoaspirate corresponds to the adipose tissue that is harvested from a subject by liposuction. The process of liposuction is well known in the art and relatesto a surgical procedure for removal of fat from a subject. It is understood that in accordance with the present invention, the preadipocytes do not need to be separated from the SVF or the lipoaspirate. It follows that in a preferred embodiment of the first aspect, the invention comprises in step (b) contacting lipoaspirate with the cell-free composition comprising adipogenic growth factors from step (a).

[0036] Contacting lipoaspirate directly with the cell free composition comprising adipogenic growth factors leads to fewer overall steps and allows for direct application of the treated lipoaspirate afterwards. Furthermore, it is envisioned that the cell free composition comprising adipogenic growth factors according to the invention has a positive effect on proliferation and viability of preadipocytes as well as on viability or lifespan of adipocytes. The skilled person is aware that both adipocytes and preadipocytes are comprised in lipoaspirate.

[0037] In a more preferred embodiment of the first aspect, the lipoaspirate is allowed to separate into a lipophilic fraction and a hydrophilic fraction and the lipophilic fraction of the lipoaspirate is contacted with the cell-free composition comprising adipogenic growth factors. It is understood that the lipophilic fraction of the lipoaspirate comprises adipocytes and preadipocytes, while the hydrophilic fraction contains mostly water which is undesirable for lipotransfer.

[0038] In addition, it is known in the art that adipose-tissue derived stromal cells (ASCs) comprising preadipocytes can be isolated from the SVF. This can be effected by culturing the SVF, which results in only the plastic adherent cells surviving. This cell population is termed ASCs and they are more homologous in their phenotype than SVF cells and resemble mesenchymal stem cells obtained from the bone marrow (Toyserkani et al., 2016). It follows that in another preferred embodiment of the first aspect, the invention comprises in step (b) contacting ASCs with the cell-free composition comprising adipogenic growth factors from step (a).

[0039] The definitions and preferred embodiments of the first aspect of the invention apply mutatis mutandis to the second and third aspect of the invention as far a being amenable therewith.

[0040] The inventor also identified that the cell-free composition comprising adipogenic growth factors increases the viability of mature adipocytes. Accordingly, in second aspect, the invention relates to a method for prolonging the life cycle of adipocytes by contacting lipoaspirate with a cell-free composition comprising adipogenic growth factors, wherein the cell-free composition comprising adipogenic growth factors is prepared by: I. subjecting cells to stress; and ii. collecting factors produced by said cells when subjected to said stress, wherein said cells are in at least one first carrier and said collecting is effected by means of a second carrier, which is reversibly attached to and separated from said first carrier(s) by a device configured to allow the passage of said factors and prevent passage of said cells.

[0041] In accordance with the present invention, “prolonging the life cycle” relates to an extension of the functional lifespan or viability of cells by delaying or preventing their natural degeneration, senescence or programmed cell death (apoptosis). It is also understood that “prolonging the life cycle” relates toany extension of viability, functionality, and / or replicative capacity of cells, as well as resilience to stress that occurs e.g. when cells are transplanted. In the context of lipotransfer, “prolonging the life cycle” will result in a higher survival rate of transplanted adipocytes in the host comparted to adipocytes that were not treated with the cell-free composition comprising adipogenic growth factors. As the skilled person is aware, a major obstacle in lipotransfer procedures are low survival rates of transplanted adipcytes. As is shown in Examples 3 and 4 and Figures 2 and 3, a cell-free composition comprising adipogenic growth factors according to the invention (in this case HPS) demonstrated a positive effect on proliferation and viability of preadipocytes. It is envisioned that this positive effect also translates to mature adipocytes, enhancing survivability and thereby volume and viability outcomes of lipofill ing procedures. It is further envisioned that this enhanced survivability of adipocytes is also maintained in vivo after administration of the adipocytes.

[0042] In a more preferred embodiment of the second aspect, the lipoaspirate is allowed to separate into a lipophilic fraction and a hydrophilic fraction and the lipophilic fraction of the lipoaspirate is contacted with the cell-free composition comprising adipogenic growth factors. It is understood that the lipophilic fraction of the lipoaspirate comprises adipocytes.

[0043] In another preferred embodiment of the second aspect, the lipoaspirate is obtained from a human subject.

[0044] In a preferred embodiment of the first or second aspect of the invention, the method further comprises producing a pharmaceutical or cosmetic composition comprising said adipocytes.

[0045] In accordance with the present invention, the terms “pharmaceutical composition” and “cosmetic composition” relate to a composition for administration to a patient, preferably a human patient. The pharmaceutical or cosmetic composition of the invention comprises the adipocytes recited above. It may, optionally, comprise further components capable of altering the characteristics of the adipocytes of the invention thereby, for example, stabilizing, modulating and / or activating their function. The composition may be in solid, liquid or gaseous form and may be, inter alia, in the form of (a) solution(s), (an) emulsion(s) or (a) suspension(s). The pharmaceutical or cosmetic composition of the present Invention may, optionally and additionally, comprise a pharmaceutically acceptable carrier, excipient or diluent.

[0046] The term "pharmaceutically acceptable carrier” refers to a carrier that can be administered to a subject with the pharmaceutical composition of the present invention when administered in a dose sufficient to deliver a therapeutic amount of the compound, without destroying its pharmacological activity and without being toxic to the recipient. The pharmaceutically acceptable carrier can be a solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type (see also Handbook of Pharmaceutical Excipients 6 ed. 2010, Published by the Pharmaceutical Press). Examples of suitable pharmaceutical carriers, excipients or diluents are well known in the art and include phosphate buffered saline solutions, water, emulsions, such as oil / water emulsions, various types of wetting agents, sterile solutions, organic solvents including DMSO etc. Compositions comprising such carriers can be formulated by well-known conventional methods. Exemplary compositions, in particular for cosmetic applications, may be, without limitation, cremes or hydrogels.The term "excipient", as used herein, refers to an inert constituent of a pharmaceutical composition, which imparts a beneficial physical property to a formulation such as increased stability and / or decreased viscosity. An “excipient” can be used as a diluent, vehicle, preservative, binder or stabilizing agent for drugs.

[0047] In another preferred embodiment of the first aspect, the invention comprises a method of treating a human in need thereof with the pharmaceutical or cosmetic composition herein disclosed. In a more preferred embodiment of the invention, the invention comprises a method of treating lipodystrophy, lipoatrophy, or soft tissue defects in a human patient in need thereof, preferably the soft tissue defects are traumatic or post-inflammatory soft tissue defects, more preferably defects of subcutaneous tissue, or oncological soft tissue defects, preferably soft tissue defects after breast-conserving tumor resection of the female breast. In a further preferred embodiment, the method further comprises administering the pharmaceutical composition or cosmetic composition to an individual in need thereof.

[0048] In another preferred embodiment of the first and second aspect, the adipogenic growth factors are at least one of VEGF-A, PDGF-BB, bFGF, IGF-1 and Adiponectin.

[0049] The term “VEGF-A” relates to Vascular Endothelial Growth Factor A, which is a signaling protein involved in regulating blood vessel growth (angiogenesis). It belongs to the VEGF family and plays a crucial role In vascular permeability, endothelial cell proliferation, migration, and survival. VEGF-A exerts its effects primarily through binding to the tyrosine kinase receptors VEGFR-1 (FLT1) and VEGFR-2 (KDR / FLK1) on endothelial cells, with VEGFR-2 being the main mediator of its angiogenic and mitogenic functions (Takahashi and Shibuya, 2005). It has further been shown that VEGFs are highly expressed in adipose tissues and the expression of VEGF-A is up-regulated during WAT expansion. Without wanting to be bound by theory, it is believed that VEGF-A is an adipogenic growth factor, promoting the growth of WAT (Jin et al., 2018).

[0050] The term “PDGF-BB” relates to Patelet-Derived Growth Factor, which is a potent mitogenic and chemotactic factor Involved in cell proliferation, migration, and tissue remodeling. As a dimeric protein belonging to the PDGF family, it primarily signals through PDGFR-P, playing a crucial role in angiogenesis, fibrosis, and wound healing. Without wanting to be bound by theory, it is believed that PDGFR-p also has a positive effect on adipogenic differentiation.

[0051] The term “bFGF” or “FGF2” relates to basic Fibroblast Growth Factor, which is a signaling protein binding to Fibroblast Growth Factor Receptor (FGFR) genes. bFGF is known to be involved in processes such as angiogenesis and adipogenesis. Specifically, It has been shown that bFGF promotes adipocyte differentiation in MSCs (Song et al., 2014).

[0052] The term “IGF-1” relates to Insulin-like Growth Factor 1, which Is a peptide hormone primarily produced in the liver in response to growth hormone stimulation. IGF-1 plays a crucial role in cell growth, differentiation, and metabolism by promoting anabolic processes in muscle, bone, and other tissues. Furthermore, it has been shown that IGF-1 significantly stimulates adipocyte proliferation, lipid accumulation, and the expression of adipogenic markers such as adiponectin, leptin, and PPARy.IGF-1 activates the IGF-1 receptor (IGF-1R) and the PI3K / Akt signaling pathway, which are crucial for its pro-adipogenic effects (Zhao et al., 2013).

[0053] Adiponectin (encoded by the ADIPOQ gene) is a protein hormone primarily secreted by adipocytes and plays a significant role in regulating glucose metabolism, fatty acid oxidation, and insulin sensitivity. During adipogenesis, adiponectin is involved in the maturation of adipocytes and the regulation of lipid metabolism. It enhances the expression of genes involved in fatty acid oxidation and inhibits lipid accumulation in adipocytes. Adiponectin also promotes the differentiation of preadipocytes into mature adipocytes, partly by activating key signaling pathways such as AMP-activated protein kinase (AMPK) and peroxisome proliferator-activated receptor-y (PPARy), which are crucial for adipocyte function and energy balance (Wang et al., 2018).

[0054] With increasing preference, the adipogenic growth factors are at least one, two, three, four or all of VEGF-A, PDGF-BB, bFGF, IGF-1 and ADIPOQ.

[0055] In another preferred embodiment of the first or second aspect, the subjecting to stress of step (a) is effected by exposing said cells to (i) hypoxia; (ii) mechanical stress; and / or (ill) electric stimulation.

[0056] The term “hypoxia” is known in the art and refers to the condition of lower oxygen in comparison to the partial pressure prevailing in normal air (about 21% (v / v) O2; (v / v) indicating volume percentage. Preferably, hypoxic conditions are established at oxygen levels between 0 and 10% (v / v) O2 and / or after additions of a chemical inducer of hypoxia, such as C0CI2. As used herein, the term “mechanical stress” refers preferably to compressive, tensile, shear and / or hydrostatic stress. The skilled person is aware of methods to exert mechanical stress. “Electrical stimulation” can be effected with certain parameter settings, such as a frequency of 1 to 20 Hz for 30 to 60 min, preferably the electric field strength is between 1 mV / mm and 1 kV / mm.

[0057] Certain conditions of stress, such as electric stimulation or mechanical stimulation may cause cells to be become leaky, which leakiness may entail that factors produced by the cells are set free. In the case where the cells are subjected to mechanical stress, the duration for which the cells are subjected to mechanical stress can be as low as 5 minutes, preferably at least 10 minutes or more. In the case where the cells are subjected to hypoxic stress, the duration for which the cells are subjected to hypoxic stress can be as low as 12 hours, preferably at least 24 hours, more preferably at least 48 hours or more.

[0058] In a more preferred embodiment of the first or second aspect, the subjecting to stress of step (a) is effected by exposing said cells to hypoxia.

[0059] In another preferred embodiment of the first or second aspect, said cells are autologous, allogeneic or xenogeneic (i) fibroblasts, preferably dermal or cardiac fibroblasts; bone-marrow derived stromal cells; skeletal, smooth or cardiac muscle cells; epithelial cells such as endothelial cells; adult stem cells, preferably obtained from bone marrow or adipose tissue; blood cells, preferably leukocytes; or adipose tissue-derived stromal cells; (II) myoblasts; osteocytes; osteoblasts; osteoclasts; chondrocytes; skeletal, smooth or cardiac muscle cells; dermal, tendon or cardiac fibroblasts; endothelial cells; oradult stem cells; and / or (ill) nerve cells; glial cells; skeletal, smooth or cardiac muscle cells; fibroblasts; osteocytes; osteoblasts; osteoclasts; chondrocytes; or adult stem cells including neural stem cells.

[0060] The term “autologous” refers to cells that have been obtained from the subject to be treated. The use of autologous cells is a form of personalized therapy and minimizes patient’s risks of immune rejection and disease transmission. The term “allogenic” refers to cells that have been obtained from a donor of the same species as the subject to be treated. Allogenic cells pose higher risks of immune rejection than autologous cells but offer better scalability. The term “xenogenic” refers to cells that have been obtained from a donor of a different species as the subject to be treated. Xenogenic cells offer even better scalability and availability than allogenic cells, however they also pose higher risks of immune rejection and cross-species disease transmission.

[0061] In an even more preferred embodiment, the cells are blood cells. The advantages of using such cells are the facilitated harvesting procedures from individuals and the relatively low technical costs for procurement of the relevant factors. Also, an upscaling of harvesting is possible through application of the harvesting procedure in large animal models like mini-pigs. It was shown that the amount and type of harvested factors in mini-pigs is very similar to harvested factor amounts in humans (Jiang et al., 2024).

[0062] The term “blood cells” herein relates to the cells present in a sample of whole blood, preferably peripheral venous blood. Accordingly, the method for the preparation of the cell-free composition comprising adipogenic growth factors preferably comprises (i) subjecting peripheral venous blood to stress; and (ii) collecting factors produced by said peripheral venous blood when subjected to said stress.

[0063] Accordingly, in a most preferred embodiment of the first or second aspect, the cell free composition obtained by subjecting cells to stress is hypoxia-preconditioned serum (HPS).

[0064] In another preferred embodiment of the first or second aspect of the present invention, the device configured to allow the passage of said factors and prevent passage of said cells is configured to contain at least one filter positioned between said first and second carrier which prevents any cells or parts of cells and pathogens present in (any of) said first carrier(s) from entering into said second carrier.

[0065] This preferred embodiment refers to means of further ensuring that cells or pathogens as they may be present within the first carrier do not enter the second carrier. It is understood that the one or more filter(s) preferably is / are one or more nano-porous filter(s), more preferably with a pore width of 1 to 1000 nm, most preferably 0.22 pm. More than one filter may be used in an array of filters, preferably with decreasing pore size, wherein the filter with the smallest pore size is facing the composition to be obtained.

[0066] Another alternative to obtain several factor mixtures is envisaged in the repetition of the steps (i) and (ii). Each collected factor mixture is representative of the state of said cells at the given point in time or period of time, the given point in time or beginning of said period of time being separated by definedtime span from the beginning of the exposal to stress.

[0067] Thus, in another preferred embodiment of the first or second aspect, during preparation of the cell free composition comprising adipogenic growth factors, steps (i) and / or (ii) are repeated two or more times. In other words, said stress may be continuously applied for a defined amount of time, preferably from minutes to week(s), such as 5, 10, 20, 30 minutes, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 16, 20 hours, 1, 2, 3, 4, 5 or 6 days or 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 weeks, or the stress may be applied repeatedly, each repetition characterized by a given time period which may always be the same or different, said periods where stress is applied being separated by periods of time where no stress is applied. This intermittent pattern (regularly or irregularly spaced intervals) of stress application is preferred in that it may be used to prevent development of cellular adaptation / habituation to the stress applied in vitro or ex vivo, similar to that observed in vivo under chronic stress exposure, and therefore prevent / diminish the adaptive downregulation / reduction of cellular factor expression / production. The repetition of steps (i) and / or (ii) also allows for the collection of an even more advantageous higher concentration of adipogenic growth factors in a composition.

[0068] In another preferred embodiment of the first or second aspect, the cells are mammalian cells. In an even more preferred embodiment of the first or second aspect, the cells are porcine, bovine, galline, primate or human cells, most preferably the cells are human or porcine cells.

[0069] Since the method of the present invention Is primarily envisioned for human preadipocytes, adipogenic factors produced by human cells are expected to be best suited for promoting the growth of human adipocytes. The usage of porcine cells has been studied in experiments by the inventors and enables the obtention of compositions having factors which are like those obtained when using human cells. The production of compositions comprising adipogenic factors using porcine cells indicates the possibility to use the present invention at industrial scale (Jiang et al., 2024). It is envisioned that a cell-free composition comprising adipogenic growth factors can in principle be obtained from any livestock animal, which will be beneficial for upscaling the treatment.

[0070] In another preferred embodiment of the first aspect, the preadipocytes are additionally contacted with a growth medium and heparin, preferably the growth medium is Dulbecco’s modified Eagle’s medium (DMEM) containing 3% fetal calf serum or a 1:1 mixture of DMEM and Ham’s F 12 nutrient mix or alpha MEM or preadipocyte growth medium.

[0071] DMEM, Ham’s F 12 nutrient mix and alpha MEM are standardized growth media for cell culture. The compositions of these media are known in the art. As the skilled person will appreciate, cultivating the preadipocytes in a suitable growth medium in addition to the cell free composition comprising adipogenic growth factors according to the invention, is expected to further support growth and viability of the cells. That is because a suitable growth medium provides additional nutrients, growth factors and optimal pH that contributes to growth and viability of cells.In another preferred embodiment of the first aspect, the ratio of cell-free composition to growth medium is between 1:100 to 1:2. In a more preferred embodiment of the first aspect, the ratio of cell-free composition to growth medium is between 1:10 and 1 :2.5.

[0072] It is understood that a ratio of cell-free composition to growth medium of 1:100 corresponds to a concentration of cell-free composition of 1%. It is further understood that a ratio of cell-free composition to growth medium of 1:2 corresponds to a concentration of cell-free composition of 50%. Consequently, the ratios of 1:10 and 1:2.5 correspond to 10% and 40% respectively.

[0073] In another embodiment of the first aspect, the ratio of cell-free composition to growth medium is 1:10. In another embodiment of the first aspect, the ratio of cell-free composition to growth medium is between 1:10 and 1:5. In a more preferred embodiment of the first aspect, the ratio of cell-free composition to growth medium is between 1:5 and 1:2.5. In a most preferred embodiment of the first aspect, the ratio of cell-free composition to growth medium is 1:2.5.

[0074] In an alternative embodiment of the first aspect, the ratio of cell-free composition to growth medium is between 1:2 and 2:1. In another alternative embodiment of the first aspect, the preadipocytes are contacted with pure cell-free composition.

[0075] Adipogenic differentiation with ratios of cell-free composition to growth medium of 1:10 and 1:2.5 has been tested in Examples 3, 4 and 5. It is shown that a ratio of 1:2.5 leads to superior adipocyte differentiation, compared to the ratio of 1 :10 (Figure 3).

[0076] In another preferred embodiment of the first aspect, the preadipocytes are mammalian. In a more preferred embodiment of the first aspect, the preadipocytes are human.

[0077] When transplanting cells to a human subject, it is generally understood in the art that it is advantageous to transplant human cells, since human cells are better suited to integrate and function in the human environment for functional and immunogenic reasons, for example reducing the risk of immune rejection. Further, xenogeneic cells such as porcine cells carry a certain risk of transmitting zoonotic diseases.

[0078] As the skilled person will appreciate, optimal immune compatibility is expected when the preadipocytes are obtained from the same subject, which shall receive the adipocytes produced by the method of the first aspect.

[0079] Accordingly, in another preferred embodiment of the first aspect, the preadipocytes are autologous and obtained from the subject in need of medical or cosmetic lipotransfer.

[0080] In an alternative preferred embodiment of the first aspect, the preadipocytes are allogeneic or xenogeneic.

[0081] Allogenic and xenogenic cells offer advantageous availability and scalability compared to allogenic cells, but pose higher risks of immune rejection or disease transmission.In another preferred embodiment of the first or second aspect, the adipocytes are administered to a subject into the body area(s) in need of cosmetic lipotransfer or lipofilling, wherein methods for treatment of the human or animal body by surgery or therapy are excluded.

[0082] Accordingly, the method of the first or second aspect relates to a cosmetic treatment of a subject. In a more preferred embodiment of the first or second aspect, the subject is a human.

[0083] The terms “lipofilling” or “lipotransfer”, also known as fat grafting or autologous fat transplantation, refer to a process of relocating autologous fat to change the shape, volume, consistency and profile of tissues. Specifically, lipofilling is a cosmetic procedure in which fat is harvested from one area of a patient's body (typically through liposuction) and then purified and injected into another area to restore volume, contour, or improve skin appearance. It is commonly used for facial rejuvenation, breast enhancement, body contouring, and to correct imperfections caused by aging, scarring, or medical conditions. The procedure is minimally invasive and utilizes the patient’s own fat cells, reducing the risk of rejection or allergic reactions. Accordingly, lipofilling or lipotransfer is not considered a surgical method excluded from patentability before the EPO under Article 53(c) EPC.

[0084] It is understood that the term “lipotransfer” herein also refers to advanced methods such as cell-assisted lipotransfer (CAL), where the purified fat tissue is additionally contacted with either the stromal vascular fraction (SVF) or adipose-tissue derived stromal cells (ASCs) obtained from the SVF, thereby enriching the fat graft with menenchymal stem cells and preadipocytes. It is understood that in accordance with the present invention, the SVF or isolated ASCs may be contacted with the cell free composition comprising adipogenic growth factors in order to promote adipocyte differentiation, leading to an increased graft survival rate and thereby improved cosmetic outcome.

[0085] In a more preferred embodiment of the first or second aspect of the invention, the adipocytes are administered subcutaneously to a subject into the body area(s) in need of cosmetic lipotransfer or lipofilling. The term “subcutaneous administration” refers to the injection of a substance, such as the adipocytes produced by the present invention or a pharmaceutical composition thereof into the layer of fat and tissue just beneath the skin, known as the subcutaneous layer. It is understood that the majority of lipofilling procedures target the subcutaneous fat layer.

[0086] In an alternative embodiment of the first or second aspect of the invention, the adipocytes are administered intradermally (meaning in between the dermis and the epidermis layer of the skin). Intradermal administration of adipocytes may be desirable for fine wrinkle correction, e.g., in the face. In another alternative embodiment of the first or second aspect of the invention, the adipocytes are administered intramuscularly, such as for buttock augmentation.

[0087] In a third aspect, the present invention relates to the adipocytes obtained or obtainable by the first or second aspect of the invention.

[0088] In a preferred embodiment of the second aspect, the adipocytes obtained or obtainable by the first or second aspect of the invention are characterized in that they express adipogenic marker genes at higher levels compared to preadipocytes. The expression of adipogenic marker genes can be readily measured by quantitative real-time PCR (qRT-PCR), an analytic technique the person skilled in the artis familiar with.

[0089] In a more preferred embodiment of the second aspect, the adipogenic marker genes comprise, with increasing preference, at least one of, at least two of, at least three of, at least four of or all of adiponectin (ADIPOQ), fatty acid binding protein 4 (FABP-4), CCAAT / enhancer-binding protein alpha (CEBPA), Leptin (LEP) and Lipoprotein lipase (LPL). qRT-PCR of these genes requires primers that specifically bind to those genes, such as the primers disclosed in Example 1. Exemplary qRT-PCR-measurements of these marker genes in adipocytes according to the invention can be found in Figure 4.

[0090] In another preferred embodiment of the third aspect, the adipocytes produced by the first aspect have a higher viability compared to adipocytes not contacted with a cell-free composition comprising adipogenic growth markers. The skilled person is aware of methods to assess cellular viability.

[0091] In another preferred embodiment of the third aspect, the pharmaceutical composition or adipocytes prepared according to the first or second aspect of the invention are for use in a medical lipotransfer for the treatment of lipodystrophy, lipoatrophy, and soft tissue defects, preferably traumatic or post-inflammatory soft tissue defects, more preferably defects of subcutaneous tissue, or oncological soft tissue defects, preferably soft tissue defects after breast-conserving tumor resection of the female breast.

[0092] The term “lipodystrophy” refers to a rare medical condition characterized by complete or partial loss of adipose tissue. Not Infrequently, lipodystrophy occurs In combination with pathological accumulation of adipose tissue at distinct anatomical sites. Patients with lipodystrophy exhibit numerous metabolic complications (Fiorenza et al., 2011). Lipodystrophy can be inherited or acquired, although the most prevalent type of lipodystrophy is an acquired form that occurs among HIV-infected individuals treated with highly active antiretroviral therapy. Methods for management of lipodystrophy currently employed include lifestyle changes and aggressive, evidence-based treatment of comorbidities, such as leptin replacement therapy (Araujo and Santini, 2019). Autologous fat grafting has also been employed for treatment of lipodystrophy (Shuck et al., 2013).

[0093] The term “lipoatrophy” refers to a heterogeneous group of rare syndromes characterized by a paucity of adipose tissue, which can have a genetic, immune, or infectlous / drug-assoclated etiology. Lipoatrophy is characterized by the localized or generalized loss of subcutaneous fat, often resulting in skin depressions, contour irregularities, and metabolic complications (Reitman et al., 2000). Lipoatrophy is a form of lipodystrophy and can also be treated with autologous fat grafting, while causal treatment options are generally not available (Martin and Mallon, 2005).

[0094] The term “soft tissue defects” relates to loss or damage of skin, fat, muscle, or connective tissue, leading to structural and functional impairments. They can result from trauma, surgery, infection, burns, congenital conditions, or diseases like cancer. Soft tissue defects may be treated by reconstructive surgery such as adipose tissue grafting (Yazar et al., 2004).In another preferred embodiment of the third aspect of the invention, herein disclosed is the use of the cosmetic composition or adipocytes prepared according to the method of the first or second aspect of the invention for cosmetic lipotransfer, lipofilling or autologous fat transplantation in a human subject.

[0095] In a fourth aspect, the invention relates to a composition comprising (a) a cell-free composition comprising adipogenic growth factors as defined in step (a) of the first aspect; and (b) optionally preadipocytes and / or adipose-derived stem cells (ASCs); and (c) optionally erythropoietin (EPO) for use in the treatment of arthritis in a patient.

[0096] The term “arthritis” herein relates to a medical condition defined by inflammation and / or swelling of one or more joints in a patient, which is typically accompanied by pain and redding. Arthritis can occur for various reasons including wear of joints and age (osteoarthritis) and autoimmune disorders (rheumatoid arthritis). A subtype of osteoarthritis is trapeziometacarpal arthritis (TMC OA), which occurs between the trapezium bone of the wrist and the metacarpal bone of the thumb. TMC OA frequently occurs in higher-age patients (Becker, Stephanie JE, et al. CORR 471.12 (2013): 3738-3744.).

[0097] As is shown in Example 7 herein below, the cell-free composition comprising adipogenic growth factors as defined in step (a) of claim 1 has been successfully used for the treatment of various forms of arthritis. The cell-free composition comprising adipogenic growth factors, which is preferably HPS, can be injected either alone or in combination with preadipocytes and / or adipose-derived stem cells (ASCs) and / or erythropoietin into the afflicted joints by surgery. The results in Table 1 indicate that this is an advantageous alternative to the established treatment with ASC injection alone, which only leads to “good” results on average. The results can be generally enhanced by additional injection of EPO. The best results were generally achieved with HPS, EPO and ASCs in combination (“excellent” results in all treated patients. Accordingly, in a preferred embodiment, the composition comprises the cell-free composition comprising adipogenic growth factors as defined in step (a) of claim 1 and preadipocytes or alternatively the cell-free composition comprising adipogenic growth factors as defined in step (a) of claim 1 and ASCs. Most preferably, the composition comprises the cell-free composition comprising adipogenic growth factors as defined in step (a) of claim 1 , ASCs and EPO.

[0098] As defined in claim 1 , the cell-free composition comprising adipogenic growth factors is obtained by (i) subjecting cells to stress; and (ii) collecting factors produced by said cells when subjected to said stress, wherein said cells are in at least one first carrier and said collecting is effected by means of a second carrier, which is reversibly attached to and separated from said first carrier(s) by a device configured to allow the passage of said factors and prevent passage of said cells.

[0099] In a preferred embodiment, the patient is a mammal, most preferably a human.

[0100] In a preferred embodiment of the fourth aspect, the arthritis is osteoarthritis, preferably trapeziometacarpal arthritis (TMC OA).As can be taken from Table 1, particularly osteoarthritis and TMC OA have been treated with the cell-free composition comprising adipogenic growth factors, optionally in conjunction with ASCs and EPO.

[0101] In an alternative embodiment, the fourth aspect provides a method of treating arthritis, comprising administration of a composition comprising (a) a cell-free composition comprising adipogenic growth factors as defined in step (a) of the first aspect; and (b) optionally preadipocytes and / or adipose-derived stem cells (ASCs); and (c) optionally erythropoietin (EPO) to a patient in need thereof.

[0102] As regards the embodiments characterized in this specification, in particular in the claims, it is intended that each embodiment mentioned in a dependent claim is combined with each embodiment of each claim (independent or dependent) said dependent claim depends on. For example, in case of an independent claim 1 reciting 3 alternatives A, B and C, a dependent claim 2 reciting 3 alternatives D, E and F and a claim 3 depending from claims 1 and 2 and reciting 3 alternatives G, H and I, it is to be understood that the specification unambiguously discloses embodiments corresponding to combinations A, D, G; A, D, H; A, D, I; A, E, G; A, E, H; A, E, I; A, F, G; A, F, H; A, F, I; B, D, G; B, D, H; B, D, I; B, E, G; B, E, H; B, E, I; B, F, G; B, F, H; B, F, I; C, D, G; C, D, H; C, D, I; C, E, G; C, E, H; C, E, I; C, F, G; C, F, H; C, F, I, unless specifically mentioned otherwise.

[0103] Similarly, and also in those cases where independent and / or dependent claims do not recite alternatives, it is understood that if dependent claims refer back to a plurality of preceding claims, any combination of subject-matter covered thereby Is considered to be explicitly disclosed. For example, in case of an independent claim 1 , a dependent claim 2 referring back to claim 1 , and a dependent claim 3 referring back to both claims 2 and 1 , it follows that the combination of the subject-matter of claims 3 and 1 Is clearly and unambiguously disclosed as is the combination of the subject-matter of claims 3, 2 and 1. In case a further dependent claim 4 is present which refers to any one of claims 1 to 3, it follows that the combination of the subject-matter of claims 4 and 1 , of claims 4, 2 and 1 , of claims 4, 3 and 1 , as well as of claims 4, 3, 2 and 1 is clearly and unambiguously disclosed.

[0104] The Figures show:

[0105] Figure 1. Quantitative analysis of adipogenic growth factors in HPS, NS, and PRP. (A-F) Protein quantification of the (A) VEGF-A, (B) PDGF-BB, (C) bFGF, (D) IGF-1, (E) ADIPOQ, and (F) Leptin. One-way ANOVA with Tukey’s multiple comparison test. Data points are means ± SEM, blood donors: n = 10. * p < 0.05, ** p < 0.01.

[0106] Figure 2. The effect of HPS, NS, and PRP on viability and proliferation of human preadipocytes.

[0107] Preadipocytes were stimulated by HPS / NS-10%, -40%, and PRP-10%, -40%, compared to positive control (growth medium) and negative control (basal medium). (A) Plot showing Alamar Blue proliferation assay measured in optical density (OD) after 2 and 4 days of stimulation. (B) Cell count after 2 and 4 days of stimulation. Two-way repeated-measures ANOVA with Tukey’s multiplecomparisons test. Data points are means ± SEM, Preadipocyte donors: n = 3. * p < 0.05, ** p < 0.01, *** p < 0.001.

[0108] Figure 3. Assessment of adipogenic differentiation by Oil Red staining of lipid droplets. (A-G) Representative high-power fields of Oil red staining of HPS / NS-10%, -40%, and PRP-10%, -40% stimulated preadipocytes compared to negative control (basal media) at day 4. Scale bar = 50 pm. (H) Quantification of Oil red staining by optical density (OD) absorbance at 510 nm. Two-way repeated-measures ANOVA with Tukey’s multiple comparisons test. Data points are means ± SEM, Preadipocyte donors: n = 3. * p < 0.05, ** p < 0.01 , *** p < 0.001.

[0109] Figure 4. Analysis of adipogenic gene expression. Gene expression analysis was performed using qRT-PCR and the resulted expression data were normalized to GAPDH for the assessment of adipogenesis. Gene expression of adipogenic-specific marker genes (A) AdipoQ (Adiponectin) (B) FABP4, (C) CEBP-alpha, (D) Leptin, (E) PPAR-gamma, (F) LPL at day 2 and day 4 of HPS / NS-10%, -40%, and PRP-10%, -40% stimulated preadipocytes compared to negative control (basal media). Two-way repeated-measures ANOVA with Tukey’s multiple comparisons test. Data points are means ± SEM, Preadipocyte donors: n = 3. Main effect day 2 vs day 4 was significant (p < 0.05) for AdipoQ, FABP4, CEBP-alpha, Leptin, and LPL.

[0110] Figure 5. Preparation of Hypoxia Preconditioned Serum (HPS). HPS was generated using a hypoxia-adjusted in vitro preconditioning method. Peripheral venous blood was collected, and 5 mL of air was filtered through a 0.2 pm filter into the syringe, which was then placed upright in a temperature-controlled incubator (37 °C, 5% CO2). During coagulation and incubation, passive sedimentation separated the sample into three layers: serum at the top, a fibrin clot with peripheral blood cells in the middle, and red blood cells (RBCs) at the bottom. Local pericellular hypoxia (~1% O2) developed within the closed syringe as a result of cellular oxygen consumption. Over 4 days, this environment stimulated production and secretion of cell-derived protein factors into the serum. At the end of incubation, the growth factor-rich HPS was collected and sterile-filtered to remove residual cellular debris.

[0111] The invention is illustrated by the examples.

[0112] Example 1 : Material and Methods.

[0113] Production of Hypoxia Preconditioned Serum (HPS)

[0114] 20 mL of peripheral venous blood was collected into a 30 mL syringe (Omnifix®, B Braun AG, Melsungen, Germany), and then 5 mL of air was drawn through a 0.2 pm filter (Sterifix®, B Braun AG, Melsungen, Germany). The syringe was subsequently sealed, creating a pericellular hypoxia (-1% 02) by PBCs’ oxygen consumption during an incubation period of 4 days at 37 °C and 5% CO2. Postincubation, three distinct layers were formed, with the top ‘clear’ layer representing the HPS, whichwas filtered (Sterifix®, B Braun AG, Melsungen, Germany) into a new syringe for further pooled or individual aliquots at -80 °C until experimental testing (for a maximum of 3 months).

[0115] Production of Normal Serum (NS)

[0116] Peripheral venous blood was drawn under sterile conditions and collected into separate 30 mL polypropylene syringes (Omnifix®, B Braun AG, Melsungen, Germany). For the preparation of normal serum, the syringes were placed upright for 4 h at room temperature to achieve simple sedimentation. Then, the serum supernatant was filtered (Sterifix®, B Braun AG, Melsungen, Germany) into a new syringe using the same procedure as HPS. The normal serum was stored both separately and pooled at -80 °C until experimental testing.

[0117] Production of Platelet-rich Plasma (PRP)

[0118] 6 mL of peripheral venous blood was collected into 6 mL-blood collection tubes (366575, BD Vacutainer, Becton, Dickinson and Company, Franklin Lakes, NJ, USA) prefilled with trisodium citrate and centrifuged at 1300* g for 20 min. The blood was then separated into platelet-poor plasma (top layer), buffy coat (middle layer containing platelets and white blood cells), and erythrocytes (bottom layer). The upper two layers, which account for 60% of the whole blood volume, were pipetted into a new falcon. To minimize any loss of platelets, a few erythrocytes beneath the buffy coat layer were permitted to be collected. A secondary centrifugation of 1800* g ensued for 15 min to separate the bottom PRP (approx. 0.5 mL) from the upper serum component. The serum component was then removed, and the PRP was activated by adding 0.5 mL of 1 I.U. / mL Thrombin and 8.88 pg / mL CaCI2 (Tisseel, Baxter, Illinois, USA), which were solved in DMEM and FCS 3%. After incubating the mixture for 30 min at 37 °C, a third centrifugation was carried out at 2500* g for 20 min to attain an activated PRP supernatant, which is an equivalent of a releasate of the PRP-secretome dissolved in DMEM and FCS 3%. PRP was then collected by a sterile syringe and filtered (Sterifix®, B Braun AG, Melsungen, Germany) into pooled or individual aliquots, which were stored at -80 °C until experimental testing (for a maximum of 3 months).

[0119] Cell Culture

[0120] Cryopreserved subcutaneous human white preadipocytes were obtained from PromoCell (PromoCell GmbH, Heidelberg, Germany) and cultured in T175 flasks using PromoCell’s preadipocyte growth medium (C-27410, PromoCell GmbH, Heidelberg, Germany) according to the manufacturer’s instructions. Cells were maintained in a humidified incubator at 37°C with 5% CO2, and the medium was replaced every 2-3 days. Cells were passaged as needed to obtain the required cell numbers for experimental use.

[0121] Three donors were utilized for the study: (1) Male, 22 years old, Caucasian, (2) Female, 40 years old, Caucasian, (3) Female, 20 years old, Caucasian

[0122] For each experiment, 30.000 cells were seeded in a total volume of 1 mL preadipocyte growth medium in 24-well plates. The plates were incubated at 37°C with 5% CO2for 24 hours to allow cell attachment.Test media included hypoxia preconditioned serum (HPS), normal serum (NS), and platelet-rich plasma (PRP), each at two concentrations (low: 10% and high: 40%). The media were prepared by diluting HPS, NS or PRP in DMEM containing 3% FCS, with the addition of heparin to prevent PRP clotting. The final concentration of heparin was 75 IU in 150 ml_ DMEM 3% FCS.

[0123] After aspirating the preadipocyte growth medium, the test media were applied as follows:

[0124] • HPS 40%, HPS 10%

[0125] • NS 40%, NS 10%

[0126] • PRP 40%, PRP 10%

[0127] • Negative control: DMEM, 3% FCS

[0128] • Positive control: Preadipocyte growth medium

[0129] Assays

[0130] The effects of the test media were evaluated at two time points: 48 hours (Test Day 2) and 96 hours (Test Day 4). For each time point, four 24-well plates per donor were used. All conditions were tested in triplicates. Wells without cells (blanks) were included to account for background absorbance.

[0131] Alamar Blue Assay

[0132] Metabolic activity was assessed using the Alamar Blue assay. The medium was aspirated, and wells were filled with 1 ml_ of a freshly prepared Alamar Blue mix (28 mL DMEM with 3% FCS and 2.8 mL Alamar Blue reagent, 1:10 dilution). Plates were incubated at 37°C for 1.5 hours (optimized in preliminary experiments). After incubation, 100 pL of supernatant was collected and transferred to a 96-well plate. Fluorescence was measured using a Mithras microplate reader (Berthold Technologies GmbH & Co. KG, Bad Wildbad, Germany).

[0133] LDH Assay

[0134] Cytotoxicity was determined by measuring lactate dehydrogenase (LDH) release using the LDH Cytotoxicity Assay Kit (Hoffmann-La Roche, Basel, Switzerland). Cell culture supernatant (100 pL) was collected from each well and transferred to a 96-well plate. Corresponding blanks were also Included for each condition. A fresh LDH reaction mixture was prepared for 48 wells (calculated for 53 wells to ensure sufficient volume) by combining 2.5 pL catalyst and 112.5 pL dye solution per well. After adding 100 pL of the reaction mix to each well, the plate was incubated in the dark at room temperature for 30 minutes. Absorbance was measured at 490 nm with a reference wavelength of 600 nm using a Mithras microplate reader (Berthold Technologies GmbH & Co. KG, Bad Wildbad, Germany). Absorbance values from blanks were subtracted from the test wells to account for background absorbance.

[0135] Oil Red O Staining and Quantification

[0136] Lipid accumulation, as an Indicator of adipogenesis, was assessed using OH Red O staining. One 24-well plate per donor was dedicated to this assay for each test day (Test Day 2 and Test Day 4). An OilRed O stock solution was prepared by dissolving 150 mg Oil Red O in 50 mL isopropanol and stirring overnight using a magnetic stirrer. The stock solution was filtered through a 0.2 pm filter and stored at 4°C. The working solution was prepared fresh each day by mixing 3 parts Oil Red O stock solution with 2 parts ultrapure water, vortexed, and left to sit for 20 minutes. The solution was filtered through a Whatman filter and stored in a light-protected container.

[0137] The culture medium was aspirated, and the wells were washed with PBS. Cells were fixed with 500 pL of 3.7% formaldehyde for 10 minutes at room temperature, followed by two PBS washes. Subsequently, 600 pL of Oil Red O working solution was added to each well, and plates were incubated for 15 minutes at room temperature. The wells were then extensively washed with ultrapure water to remove excess stain.

[0138] Microscopic images were captured. After imaging, plates were left to dry overnight. For quantification, 800 pL of 100% isopropanol was added to each well the following day, and plates were incubated for 10-20 minutes on a shaker. After incubation, 100 pL of the isopropanol solution was transferred to a 96-well plate, and the optical density was measured at 500 nm using a Mithras plate reader (Berthold Technologies GmbH & Co. KG, Bad Wildbad, Germany).

[0139] ELISA

[0140] To quantify secreted factors, ELISAs for FGF6, TNF-a, VEGF, Adiponectin, Leptin, and IGF-1 were performed using DuoSet ELISA kits (R&D Systems), following the manufacturer’s protocol. The optical density was measured using a Mithras plate reader (Berthold Technologies GmbH & Co. KG, Bad Wildbad, Germany).

[0141] Analysis of Gene Expression

[0142] Total RNA was extracted using the RNeasy Mini Kit (Qiagen) following the manufacturer’s instructions. Reverse transcription into cDNA was performed using the STEMscript cDNA Synthesis Kit with Oligo(dT) Primer (Stemcell Technologies). Quantitative PCR (qPCR) was conducted using SYBR Green (Eurogentec, Luttich, Belgium). The following human primers were used:

[0143] 1. PPAR gamma (PPARG):

[0144] • Forward: AGCCTGCGAAAGCCTTTTGGTG

[0145] • Reverse: GGCTTCACATTCAGCAAACCTGG

[0146] 2. CEBP Alpha (CEBPA):

[0147] • Forward: AGGAGGATGAAGCCAAGCAGCT

[0148] • Reverse: AGTGCGCGATCTGGAACTGCAG

[0149] 3. FABP4:

[0150] Forward: ACGAGAGGATGATAAACTGGTGG

[0151] Reverse: GCGAACTTCAGTCCAGGTCAAC4. Adiponectin (ADIPOQ):

[0152] • Forward: CAGGCCGTGATGGCAGAGATG

[0153] • Reverse: GGTTTCACCGATGTCTCCCTTAG

[0154] 5. Leptin (LEP):

[0155] • Forward: GCTGTGCCCATCCAAAAAGTCC

[0156] • Reverse: CCCAGGAATGAAGTCCAAACCG

[0157] 6. Lipoprotein lipase (LPL):

[0158] • Forward: CTGCTGGCATTGCAGGAAGTCT

[0159] • Reverse: CATCAGGAGAAAGACGACTCGG

[0160] 7. GAPDH (reference gene):

[0161] • Forward: GTCTCCTCTGACTTCAACAGCG

[0162] • Reverse: ACCACCCTGTTGCTGTAGCCAA

[0163] Relative gene expression was calculated using the 2A-AACt method. GAPDH served as the housekeeping gene.

[0164] Statistical Analysis

[0165] Data sets were analyzed by repeated measures of one-way analysis of variance (ANOVA), with subsequent comparisons using Tukey’s post hoc analysis. If two independent variables were present, two-way ANOVA with subsequent comparisons using Tukey’s post hoc analysis was performed. All values are expressed as means ± standard error of the mean (SEM). A value of p < 0.05 was considered statistically significant (* p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001).

[0166] Example 2: Quantitative Analysis of Adipoqenic Growth Factors in Different Human Blood-Derived Secretomes

[0167] The levels of adipogenic growth factors were qualitatively analyzed in three blood-derived preparations (HPS = Hypoxia-preconditioned Serum, NS = normal serum, and PRP = Platelet-rich Plasma). Here it was found that the levels of VEGF-A, PDGF-BB, bFGF, IGF-1, and ADIPOQ (=adiponectin) were significantly increased in HPS compared to NS and PRP (Figure 1). Only leptin was found to be lower in HPS and PRP compared to NS. These results suggest that HPS may have adipogenic potential and beneficial effect on lipofilling outcome.

[0168] Example 3: The Effect of Different Human Blood-Derived Secretomes on the Proliferation and Viability of Preadipocytes

[0169] Next, the adipogenic effect of the above mentioned blood-derived secretome on preadipocytes was investigated. It was decided to use a low (10%) and a high (40%) dose concentration for the following experiments. Here a higher proliferation of all blood-derived conditions on day 4 compared to day 2 was found (Figure 2). On day 4, the highest cell count was achieved with NS-40% and PRP-40% stimulated preadipocytes, while HPS-40% stimulated cell count was comparable to the positive control (growth medium). The Alamar Blue viability assay detects viable cells by mitchondrial reduction reaction. Together with the low LDH cytotoxicity detection, all blood-derived conditions are unlikely tocause cytotoxic effects on human preadipocytes and may even promote viability.

[0170] Example 4: HPS Promotes Adipoqenic Differentiation

[0171] The degree of adipogenic differentiation was assessed by oil red staining of lipid droplets. Here, remarkable lipid dropled formation was found already on day 2 in HPS-40% stimulated preadipocytes, which increased towards day 4, when it showed the highest amount of lipid droplet formation (Figure 3). This indicates a superior adipogenic differentiation capacity of HPS, which stimulates preadipocytes to differentiate into adipocytes. This effect may be beneficial for the volume and viability outcome of lipofilling procedures.

[0172] Example 5: Analysis of Adipoqenic Gene Expression

[0173] Finally, the adipogenic gene expression profiles of the preadipocyte simulation cultures were analyzed. Here, an increase of the adipogenic differentiation markers AdipoQ, FABP4, CEBP-alpha, Leptin and LPL was observed in all blood-derived conditions from day 2 to day 4 (Figure 4). However, there was no discernible difference in expression at day 4 in any of the groups.

[0174] Example 6: Discussion

[0175] This study aimed to explore the effects of different blood-derived secretomes - Hypoxia Preconditioned Serum (HPS), Normal Serum (NS), and Platelet-Rich Plasma (PRP) - on the proliferation, viability, and differentiation of human preadipocytes. The findings demonstrate the potential of HPS as a promoter of adipocyte survival and adipogenic differentiation. HPS exhibited superior performance in enhancing lipid droplet formation and upregulating adipogenic markers. These findings suggest that HPS could be a valuable tool in regenerative medicine, particularly for improving the outcomes of adipose tissue grafting.

[0176] Our results demonstrated that HPS had significantly higher levels of adipogenic growth factors such as VEGF-A, PDGF-BB, bFGF, IGF-1, and adiponectin compared to NS and PRP. These factors are critical in promoting adipocyte differentiation, proliferation, and survival (Jin et al., 2018; Song et al., 2014; Zhao et al., 2013). The elevated levels of these factors in HPS suggest that this serum could have a superior adipogenic potential compared to NS and PRP. Interestingly, leptin levels were found to be lower in both HPS and PRP compared to NS. Leptin is involved in regulating energy balance and adipose tissue metabolism, but also inflammation (Ikuni et al., 2008). The role of leptin in adipogenesis is complex, and its downregulation in this context might be beneficial for reducing inflammation and promoting tissue repair, as has been suggested in other studies (Kiernan and Maclver, 2021). In general, the use of hypoxia-induced growth factor compositions in lipofilling procedures, which are subject to hypoxic stress after adipose tissue transplantation, may improve the graft outcome, as hypoxia-induced survival signalling is already complemented by HPS.

[0177] The proliferation and viability assays, including the Alamar Blue and LDH assays, revealed that all blood-derived secretomes — HPS, NS, and PRP — promoted preadipocyte proliferation without cytotoxic effects. The highest cell counts were observed with NS-40% and PRP-40%, while HPS-40%stimulation led to a cell count comparable to the positive control (preadipocyte growth medium). These results suggest that while HPS may not significantly increase cell proliferation compared to NS and PRP, it does not exert any detrimental effects on cell viability. It is worth noting that the higher proliferation observed with NS and PRP may only stimulate cell division of preadipocytes and do not promote differentiation into adipocytes, as differentiated adipocytes cannot proliferate. This observation is most probably due to the different secretome composition of platelet-derived growth factors versus hypoxia-induced growth factors. Indeed, several studies reported that PRP inhibits the adipogenic differentiation but promote adipose derived stem cell proliferation (Chignon-Sicard et al., 2017; Liao et al., 2015). Nevertheless, studies have shown that PRP promotes adipocyte and fat graft survival, but its use in lipofilling procedures is controversial (Chignon-Sicard et al., 2017; Atashi et al., 2019; D’Esposito et al, 2015).

[0178] The Oil Red O staining and quantification provided further insights into the adipogenic potential of the tested secretomes. HPS-40% exhibited remarkable lipid droplet formation on both day 2 and day 4, indicating its superior capacity to promote adipogenic differentiation compared to NS and PRP. This finding is significant because lipid droplet formation is a key marker of adipocyte differentiation, and enhanced lipid accumulation suggests that HPS may drive preadipocytes towards a more mature adipocyte phenotype. The increased adipogenic differentiation observed with HPS can be attributed to its high levels of growth factors such as IGF-1 and adiponectin, which are known to play critical roles in adipogenesis (Zhao et al., 2013; Fu et al., 2005). IGF-1, for instance, promotes the differentiation of preadipocytes Into mature adipocytes by activating signaling pathways such as the PI3K / Akt pathway, which is essential for adipogenesis (Zhao et al., 2013). Adiponectin, on the other hand, promotes lipid metabolism in adipocytes, further contributing to the differentiation process (Fu et al., 2005). The ability of HPS to enhance adipogenic differentiation has important implications for regenerative medicine, particularly in the context of lipofilling procedures where adipocyte survival and differentiation are critical for maintaining tissue volume and function.

[0179] The gene expression analysis provided additional evidence of the adipogenic effects of HPS, NS, and PRP. All conditions showed an increase in the expression of adipogenic markers such as AdipoQ, FABP4, CEBP-alpha, Leptin, and LPL from day 2 to day 4. These markers are well-established Indicators of adipocyte differentiation and lipid metabolism [Kiernan and Maclver 2001; Fu et al., 2005; Enerback et al., 1992; Furuhashi et al., 2014; Lee et al., 2016; Rosen et al., 2002). However, there was no significant difference in gene expression levels between the groups at day 4, suggesting that HPS may promote differentiation between day 2 and 4, and its effects may converge with those of NS and PRP at day 4, as differentiation progresses.

[0180] The findings of this study have several potential implications for clinical applications, particularly in the fields of regenerative medicine and tissue engineering. HPS, with its high levels of adipogenic growth factors and its ability to promote preadipocyte differentiation and survival, could be a valuable tool for enhancing the outcomes of adipose tissue transplantation, such as in lipofilling procedures. The hypoxia preconditioning process appears to create a secretome that is particularly well-suited forpromoting adipogenesis, which could lead to better graft survival and improved tissue volume retention in clinical settings.

[0181] Moreover, the lack of cytotoxic effects observed with all secretomes suggests that these blood-derived products could be safely used in clinical applications without the risk of harming preadipocytes or other cell types. The ability to modulate the concentration of these secretomes (e.g., using 10% or 40% HPS) provides flexibility in tailoring treatments to specific patient needs, further enhancing their clinical utility.

[0182] For further evaluation of the effects of HPS on preadipocyte proliferation, future studies should focus on validating these findings in animal models or clinical trials to demonstrate the efficacy of HPS in promoting adipose tissue regeneration in vivo.

[0183] Additionally, the mechanisms by which hypoxia preconditioning enhances adipogenic differentiation remain to be fully elucidated. Further research is needed to explore the signaling pathways activated by HPS in preadipocytes and to determine how these pathways contribute to the observed effects on adipogenesis.

[0184] Example 7: Treatment of osteoarthritis in human patients with ASCs and HPS.

[0185] In a clinical setting, patients diagnosed with osteoarthritis (e.g., thumb carpometacarpal osteoarthritis or trapeziometacarpal arthritis (TMC OA)) were treated with either HPS or fat stem cells (i.e., adipose-derived stem cells, ASCs) or a mixture of HPS and ASCs and optionally erythropoietin (EPO) by injection. The outcome after 3, 6, 12, 18 and 24 months was assessed (satisfactory (=), good (+), very good (++), excellent (+++)), where applicable (see Table 1). The best results were generally achieved by a combination of HPS, ASCs and EPO.able 1: Treatment of osteoarthritis in human patients with HPS and / or ASCs

[0186] Year of Year of Result Result Result Result Result

[0187]

[0188] Patient birth surgery Diagnosis Surgery 3 M 6 M 12 M 18 M 24 M Patient 1 1964 2023 TMC OA right autologous fat stem cell injection + + + = = Patient 1 1964 2023 TMC OA left autologous fat stem cell injection + + + = = Patient 2 1956 2024 TMC OA right autologous fat stem cell injection + + + + = Osteoarthritis IP and autologous fat stem cell injection and EPO- Patient3 1960 2024 TMC OA right injection 5.0001. E. ++ ++ ++ ++ ++ Enchondroma Resection Enchondroma metacarpal-ill right,

[0189] metacarpal-l Il-head right defect filling with HPS und autologous fat stem

[0190] Patient 4 1957 2024 TMC OA right cells. TMC: injection with HPS and fat stem cells +++ +++ +++ +++

[0191] autologous fat stem cell injection, HPS-injection

[0192] Patients 1957 2024 TMC OA right and EPO-injection +++ +++ +++ +++

[0193] autologous fat stem cell injection, HPS-injection

[0194] Patient6 1940 2024 TMC OA left and EPO-injection +++ +++ +++ +++

[0195] Osteoarthritis PIP-joint

[0196] Patient 7 1947 2024 D3 right HPS-injection ++ ++ ++ ++

[0197] Heberden’s node D II - D

[0198] Patients 1963 2024 IV left and right HPS-injection and EPO-injection ++ ++ ++

[0199] autologous fat stem cell injection, HPS-injection

[0200] Patient 9 1957 2025 TMC OA left and right and EPO-injection +++ +++

[0201] autologous fat stem cell injection, HPS-injection

[0202] Patient 10 1961 2025 TMC OA right and EPO-injection +++ +++

[0203] Patient 11 1948 2025 TMC OA left and right HPS-injection ++ ++

[0204] Patient 12 1970 2025 TMC OA left HPS-injection ++ ++

[0205] TMC OA right HPS-injection in the area of CMC 1

[0206] Tendinitis FCR right Triam injection into the FCR tendon sheath

[0207] stenosing tenosynovitis

[0208] Patient 13 1949 2025 A1 D I right Cleavage of annular ligament A1 DI right ++ ++

[0209] Patient 13 1949 2025 TMC OA right HPS-injection and EPO-injection ++

[0210] Osteoarthritis CMC l / r,

[0211] Patient 14 1959 2025 MCP1 l / r, IP DI right HPS-injection and EPO-injection ++

[0212] HPS-injection and autologous fat stem cell

[0213] Patient 15 1954 2026 TMC OA right injectionHPS-injection and autologous fat stem cell Patient 16 1973 2026 TMC OA right injection

[0214] HPS-injection and autologous fat stem cell Patient 17 1945 2026 Osteoarthritis DU D2 left injectionReferences

[0215] Mason, C., & Dunnill, P. A Brief Definition of Regenerative Medicine. Regenerative Medicine 2007, 3(1), 1-5.

[0216] Toyserkani, N. M., Quaade, M. L, & Sorensen, J. A. Cell-assisted lipotransfer: a systematic review of its efficacy. Aesthetic plastic surgery 2016, 40, 309-318.

[0217] James N. Parrish, Stephen E. Metzinger, Autogenous Fat Grafting and Breast Augmentation: A Review of the Literature, Aesthetic Surgery Journal 2010, Volume 30, Issue 4, Pages 549-556.

[0218] Gregoire, F. M., Smas, C. M., & Sul, H. S. Understanding adipocyte differentiation. Physiological reviews 1998, 78(3), 783-809.

[0219] Hiroyuki Takahashi, Masabumi Shibuya; The vascular endothelial growth factor (VEGF) / VEGF receptor system and its role under physiological and pathological conditions. Clin. Sci. 2005; 109 (3): 227-241.

[0220] Honghong Jin, Dan Li, Xutong Wang, Jia Jia, Yang Chen, Yapeng Yao, Chunlan Zhao, Xiaodan Lu, Shujie Zhang, Jacques Togo, Yan Ji, Luqing Zhang, Xuechao Feng, Yaowu Zheng, VEGF and VEGFB Play Balancing Roles in Adipose Differentiation, Gene Expression, and Function, Endocrinology, Volume 159, Issue 5, 2018, Pages 2036-2049.

[0221] Xinghui Song, Yanwei Li, Xiao Chen, Guoli Yin, Qiong Huang, Yingying Chen, Guowei Xu, Linlin Wang; bFGF promotes adipocyte differentiation in human mesenchymal stem cells derived from embryonic stem cells, Genet. Mol. Biol 2014, 37 (1).

[0222] Zhao, P., Deng, Y., Gu, P., Wang, Y., Zhou, H., Hu, Y., Chen, P. & Fan, X. (2013). Insulin-like growth factor 1 promotes the proliferation and adipogenesis of orbital adipose-derived stromal cells in thyroid-associated ophthalmopathy. Experimental eye research, 107, 65-73.

[0223] Yang, W., Yang, C., Luo, J., Wei, Y., Wang, W., & Zhong, Y. (2018). Adiponectin promotes preadipocyte differentiation via the PPARy pathway. Molecular Medicine Reports, 17(1), 428-435. Jiang J, Man T, Kirsch M, Knoedler S, Andersen K, Reiser J, Werner J, Trautz B, Cong X, Forster S, Alageel S, Dornseifer U, Schilling AF, Machens HG, Kukrek H, Moog P. Hypoxia Preconditioned Serum Hydrogel (HPS-H) Accelerates Dermal Regeneration in a Porcine Wound Model. Gels. 2024 Nov 17; 10(11):748.

[0224] Fiorenza, C., Chou, S. & Mantzoros, C. Lipodystrophy: pathophysiology and advances in treatment. Nat. Rev. Endocrinol. 7, 137-150 (2011).

[0225] Araujo-Vilar, D., Santini, F. Diagnosis and treatment of lipodystrophy: a step-by-step approach. J. Endocrinol. Invest. 42, 61-73 (2019).

[0226] Shuck, John M.D.; Iorio, Matthew L. M.D.; Hung, Rex B.S.; Davison, Steven P. M.D., D.D.S.. Autologous Fat Grafting and Injectable Dermal Fillers for Human Immunodeficiency Virus-Associated Facial Lipodystrophy: A Comparison of Safety, Efficacy, and Long-Term Treatment Outcomes. Plastic and Reconstructive Surgery 131 (3):p 499-506, 2013.

[0227] Reitman, M. L., Arioglu, E., Gavrilova, O., Taylor, S. I., Lipoatrophy revisited, Trends in Endocrinology & Metabolism 2000, Volume 11 , Issue 10, 410 - 416.Yazar, Sukru M.D.; Lin, Chih-Hung M.D.; Wei, Fu-Chan M.D.. One-Stage Reconstruction of Composite Bone and Soft-Tissue Defects in Traumatic Lower Extremities. Plastic and Reconstructive Surgery 2004, 114(6):p 1457-1466.

[0228] likuni N, Lam QL, Lu L, Matarese G, La Cava A. Leptin and Inflammation. Curr Immunol Rev.

[0229] 2008;4(2):70-79.

[0230] Kiernan, K., & Maclver, N. J. The role of the adipokine leptin in immune cell function in health and disease. Frontiers in immunology 2021 , 11, 622468.

[0231] Chignon-Sicard, B., Kouidhi, M., Yao, X. et al. Platelet-rich plasma respectively reduces and promotes adipogenic and myofibroblastic differentiation of human adipose-derived stromal cells via the TGF|3 signalling pathway. Sci. Rep. 2017, 7, 2954.

[0232] Liao, H. T., James, I. B., Marra, K. G., & Rubin, J. P. The effects of platelet-rich plasma on cell proliferation and adipogenic potential of adipose-derived stem cells. Tissue Engineering Part A 2015, 21(21-22), 2714-2722.

[0233] Atashi, F., Andre-Levigne, D., Colin, D. J., Germain, S., Pittet-Cuenod, B., & Modarressi, A. Does nonactivated platelet-rich plasma (PRP) enhance fat graft outcome? An assessment with 3D CT-scan in mice. Journal of Plastic, Reconstructive & Aesthetic Surgery 2019, 72(4), 669-675.

[0234] D'Esposito, V., Passaretti, F., Perruolo, G., et al. Platelet-rich plasma increases growth and motility of adipose tissue-derived mesenchymal stem cells and controls adipocyte secretory function. Journal of Cellular Biochemistry 2015, 116(10), 2408-2418.

[0235] Fu, Y., Luo, N., Klein, R. L., & Garvey, W. T. Adiponectin promotes adipocyte differentiation, insulin sensitivity, and lipid accumulation. Journal of lipid research 2005, 46(7), 1369-1379.

[0236] Enerback, S., Ohlsson, B. G., Samuelsson, L., & Bjursell, G. Characterization of the human lipoprotein lipase (LPL) promoter: evidence of two cis-regulatory regions, LP-a and LP-0, of importance for the differentiation-linked induction of the LPL gene during adipogenesis. Molecular and cellular biology 1992, 12(10), 4622-4633.

[0237] Furuhashi, M., Saitoh, S., Shimamoto, K., & Miura, T. Fatty acid-binding protein 4 (FABP4): pathophysiological insights and potent clinical biomarker of metabolic and cardiovascular diseases. Clinical medicine insights: cardiology 2014, 8, CMC-S17067.

[0238] Lee, J. H., Lee, S. H., Lee, H. S. et al. Lnk is an important modulator of insulin-like growth factor-1 / Akt / peroxisome proliferator-activated receptor-gamma axis during adipogenesis of mesenchymal stem cells. The Korean Journal of Physiology & Pharmacology: Official Journal of the Korean Physiological Society and the Korean Society of Pharmacology 2016, 20(5), 459.

[0239] Rosen, E. D., Hsu, C. H., Wang, X., Sakai, S., Freeman, M. W., Gonzalez, F. J., & Spiegelman, B. M. C / EBPa induces adipogenesis through PPARy: a unified pathway. Genes & development 2002, 16(1), 22-26.

[0240] Tsuji, Wakako, J. Peter Rubin, and Kacey G. Marra. "Adipose-derived stem cells: Implications in tissue regeneration." World journal of stem cells 6.3 (2014): 312.

Claims

CLAIMS1. A method of preparing adipocytes, said method comprising or consisting of:(a) preparing a cell-free composition comprising adipogenic growth factors by:i. subjecting cells to stress; andii. collecting factors produced by said cells when subjected to said stress, wherein said cells are in at least one first carrier and said collecting is effected by means of a second carrier, which is reversibly attached to and separated from said first carrier(s) by a device configured to allow the passage of said factors and prevent passage of said cells;thereby obtaining said cell-free composition comprising adipogenic growth factors; and (b) contacting preadipocytes and / or adipose-derived stem cells (ASCs) with the cell-free composition comprising adipogenic growth factors from step (a);thereby preparing adipocytes.

2. The method of claim 1 , wherein in step (b) the preadipocytes and / or adipose-derived stem cells (ASCs) are contacted with the cell-free composition comprising adipogenic growth factors for at least 24 hours, preferably at least 48 to 96 hours.

3. The method of any one of claims 1 or 2, wherein in step (b) the preadipocytes and / or adipose- derived stem cells (ASCs) are comprised in lipoaspirate.

4. A method for prolonging the life cycle of adipocytes by contacting lipoaspirate with a cell-free composition comprising adipogenic growth factors, wherein the cell-free composition comprising adipogenic growth factors is prepared by:I. subjecting cells to stress; andii. collecting factors produced by said cells when subjected to said stress, wherein said cells are in at least one first carrier and said collecting is effected by means of a second carrier, which is reversibly attached to and separated from said first carrier(s) by a device configured to allow the passage of said factors and prevent passage of said cells.

5. The method of any one of claims 1 to 4, further comprising producing a pharmaceutical or cosmetic composition comprising said adipocytes.

6. The method of any one of claims 1 to 5, wherein the adipogenic growth factors are at least one ofVEGF-A, PDGF-BB, bFGF, IGF-1 or ADIPOQ.

7. The method of any one of claims 1 to 6, wherein the subjecting to stress of step (a) is effected by exposing said cells to(i) hypoxia;(ii) mechanical stress; and / or(ill) electric stimulation.

8. The method of any one of claims 1 to 7, wherein said cells are autologous, allogeneic or xenogeneic(i) fibroblasts; bone-marrow derived stromal cells; skeletal, smooth or cardiac muscle cells;epithelial cells; adult stem cells; blood cells; or adipose tissue-derived stromal cells, preferably wherein said cells are blood cells or adipose tissue-derived stromal cells; (ii) myoblasts; osteocytes; osteoblasts; osteoclasts; chondrocytes; skeletal, smooth or cardiac muscle cells; dermal, tendon or cardiac fibroblasts; endothelial cells; or adult stem cells, or(ill) nerve cells; glial cells; skeletal, smooth or cardiac muscle cells; fibroblasts; osteocytes;osteoblasts; osteoclasts; chondrocytes; or adult stem cells including neural stem cells.

9. The method of any one of claims 1 to 5, wherein the device configured to allow the passage of said factors and prevent passage of said cells Is configured to contain at least one filter positioned between said first and second carrier which prevents any cells or parts of cells and pathogens present in (any of) said first carrier(s) from entering into said second carrier.

10. The method of any one of claims 1 to 9, wherein during preparation of the cell-free composition comprising adipogenic growth factors, steps I. and / or ii. are repeated two or more times.

11. The method of any one of claims 1 to 10, wherein the cells are mammalian, preferably wherein the cells are porcine, bovine, galline, primate or human cells, most preferably wherein the cells are human or porcine cells.

12. The method of any one of claims 1 to 3 or 5 to 11, wherein the preadipocytes and / or adipose- derived stem cells (ASCs) are additionally contacted with a growth medium and heparin, preferably the growth medium Is Dulbecco's modified Eagle's medium (DMEM) containing 3% fetal calf serum or a 1:1 mixture of DMEM and Ham's F 12 nutrient mix or alpha MEM or preadipocyte growth medium.

13. The method of claim 12, wherein the ratio of cell-free composition to growth medium is between 1:100 to 1:2, preferably between 1:10 and 1:2.5.

14. The method of any one of claims 1 to 3 or 5 to 13, wherein the preadipocytes and / or adipose- derived stem cells (ASCs) are mammalian, preferably wherein the preadipocytes and / or adipose-derived stem cells (ASCs) are human.

15. The method of any one of claims 1 to 3 or 5 to 13, wherein the preadipocytes and / or adipose- derived stem cells (ASCs) are autologous and obtained from the subject in need of medical or cosmetic lipotransfer.

16. The method of any one of claims 1 to 3 or 5 to 13, wherein the preadipocytes and / or adipose- derived stem cells (ASCs) are allogeneic or xenogeneic.

17. The method of any one of claims 1 to 16, wherein the adipocytes are administered to a subject into the body area(s) in need of cosmetic lipotransfer or lipofilling, wherein methods for treatment of the human or animal body by surgery or therapy are excluded.

18. Adipocytes obtained or obtainable by any one of claims 1 to 16.

19. The adipocytes of claim 18 for use in medical lipotransfer for the treatment of lipodystrophy, lipoatrophy, and soft tissue defects, preferably traumatic or post-inflammatory soft tissue defects, more preferably defects of subcutaneous tissue, or oncological soft tissue defects, preferably soft tissue defects after breast-conserving tumor resection of the female breast.

20. Use of the adipocytes of claim 18 for cosmetic lipotransfer, lipofilling or autologous fat transplantation in a human subject.

21. A composition comprising(a) a cell-free composition comprising adipogenic growth factors as defined in step (a) of claim 1; and(b) optionally preadipocytes and / or adipose-derived stem cells (ASCs); and(c) optionally erythropoietin (EPO)for use in the treatment of arthritis in a patient.

22. The composition for use of claim 21, wherein the arthritis is osteoarthritis, preferably trapeziometacarpal arthritis.

Images