Antisense oligonucleotides

Abstract

The invention relates to single-stranded RNA editing antisense oligonucleotides (AONs) for binding to a target RNA molecule in a cell, for recruitment of an endogenous ADAR enzyme to deaminate at least one target adenosine in the target RNA molecule. The AON according to the invention comprises an orphan nucleotide that is directly opposite the target adenosine, and wherein the orphan nucleotide comprises a nucleobase that is a cytosine analog.

Description

P5652PC00ANTISENSE OLIGONUCLEOTIDESTECHNICAL FIELD

[0001] The present disclosure relates to the field of medicine. In particular, it relates to the field of RNA editing, whereby an RNA molecule, such as a transcript molecule, in a cell is targeted by a single stranded guide antisense oligonucleotide to specifically change a target nucleotide present in the target RNA molecule by recruitment of and using endogenous deaminating enzymes. More specifically, the disclosure relates to oligonucleotides that comprise chemically modified nucleotides to improve their ex vivo, in vivo and in vitro RNA editing effect.BACKGROUND

[0002] Antisense oligonucleotides (AONs) are short, synthetic nucleic acid molecules that are designed with a sequence to hybridize with complementary RNA or DNA targets, modulating their function for therapeutic or research applications. Oligonucleotides have been widely utilized in gene silencing, splicing modulation, and sequence-specific targeting in molecular biology and medicine. Their effectiveness largely depends on their stability, binding affinity, and specificity, which can be fine-tuned by modifying the sugar, phosphate, or nucleobase components of the nucleotides within the oligonucleotide.

[0003] Among these components, nucleobases such as adenine, cytosine, guanine, thymine, hypoxanthine, and uracil are critical for sequence recognition and hybridization fidelity. Various chemically modified nucleobases have been developed to improve AON performance. Modifications often focus on enhancing base pairing strength, reducing off-target effects, or improving resistance to enzymatic degradation. Synthetic nucleobases, including purine and pyrimidine analogs, have expanded the chemical diversity available for AON design, enabling the fine-tuning of hybridization properties and functional interactions. Substituents attached to purine and pyrimidine rings play a significant role in these modifications. Substitutions at key positions within the heterocyclic structures can alter hydrogen bonding patterns, improve hydrophobic interactions, or introduce steric effects that enhance target specificity. Common modifications include halogenation, methylation, and the addition of amine or hydroxyl groups, which can improve oligonucleotide stability and enhance binding affinity. These chemical alterations are instrumental in developing AONs with optimized therapeutic or experimental potential.

[0004] Recent advances in the field have introduced alternative nucleobases that extend beyond natural and conventional synthetic analogs. These analogs have been employed for specific applications, including those requiring enhanced hybridization properties and selective target engagement. One of the uses of synthetic AONs with modified bases is in a process generally referred to as ‘RNA editing’.P5652PC00

[0005] RNA editing is a natural process through which eukaryotic cells alter the sequence of their RNA molecules, often in a site-specific and precise way, thereby increasing the repertoire of genome encoded RNAs by several orders of magnitude. RNA editing enzymes have been described for eukaryotic species throughout the animal and plant kingdoms, and these processes play an important role in managing cellular homeostasis in metazoans from the simplest life forms (such as Caenorhabditis elegans) to humans. Examples of RNA editing are adenosine (A) to inosine (I) conversions and cytidine (C) to uridine (II) conversions, which occur through enzymes called Adenosine Deaminases acting on RNA (ADAR) and APOBEC / AID (cytidine deaminases that act on RNA), respectively.

[0006] ADAR is a multi-domain protein, comprising of a catalytic domain and two to three doublestranded RNA recognition domains, depending on the enzyme in question. Each recognition domain recognizes a specific double-stranded RNA (dsRNA) sequence and / or conformation. The catalytic domain does also play a role in recognizing and binding a part of the dsRNA helix, although the key function of the catalytic domain is to convert an adenosine into an inosine in a nearby, predefined, position in the target RNA, by deamination of the nucleobase. Inosine is read as guanosine by the translational machinery of the cell, meaning that, if an edited adenosine is in a coding region of an mRNA or pre-mRNA, it can recode the protein sequence. A-to-l conversions may also occur in 5’ non-coding sequences of a target mRNA, creating new translational start sites upstream of the original start site, which gives rise to N-terminally extended proteins, or in the 3’ untranslated region (UTR) or other non-coding parts of the transcript, which may affect the processing and / or stability of the RNA. In addition, A-to-l conversions may take place in splice elements in introns or exons in pre-mRNAs, thereby altering the pattern of splicing. As a result, exons may be included or skipped. The enzymes catalysing adenosine deamination are within an enzyme family of ADARs, which include human deaminases human ADAR1 and ADAR2, as well as ADAR3. However, for human ADAR3 no deaminase activity has been demonstrated to date.

[0007] The use of oligonucleotides to edit a target RNA, applying adenosine deaminase, has been described (e.g., Woolf et al. Proc Natl Acad Sci USA 1995, 92:8298-8302; Montiel- Gonzalez et al. Proc Natl Acad Sci USA 2013, 110(45): 18285-18290; Vogel et al. Angewandte Chemie Int 2014, Ed 53:267-271). A disadvantage of the method described by Montiel- Gonzalez et al. (2013) is the need for a fusion protein consisting of the boxB recognition domain of bacteriophage Lambda N-protein, fused to the adenosine deaminase domain of a truncated natural ADAR protein. It requires target cells to be either transduced with the fusion protein, which is a major hurdle, or that target cells are transfected with a nucleic acid construct encoding the engineered adenosine deaminase fusion protein for expression. The system described by Vogel et al. (2014) suffers from similar drawbacks, in that it is not clear how to apply the system without having to genetically modify the ADAR first and subsequently transfect or transform the cells harbouring the target RNA, to provide the cells with this genetically engineered protein.P5652PC00United States patent no. US 9,650,627 describes a similar system. The oligonucleotides of Woolf et al. (1995) that were 100% complementary to the target RNA sequences, suffered from severe lack of specificity: nearly all adenosines in the target RNA strand that were complementary to the AON were edited.

[0008] It is known that ADAR may act on any double stranded RNA. Through a process sometimes referred to as ‘promiscuous editing’, the enzyme will edit multiple adenosines in the double stranded complex. Hence, there was a need for methods and means that circumvent such promiscuous editing and only target specific adenosines in a target RNA molecule to become therapeutic applicable. Vogel et al. (2014) showed that such off-target editing can be suppressed by using 2’-O-methyl (2’-OMe) modified nucleosides in the oligonucleotide at positions opposite to adenosines that should not be edited and used a non-modified nucleoside directly opposite to the specifically targeted adenosine on the target RNA. However, the specific editing effect at the target nucleotide has not been shown to take place without the use of recombinant ADAR enzymes having covalent bonds with the AON. Several publications have now shown that the recruitment of endogenous ADAR (hence without the need for an exogenous and / or recombinant source) is feasible while maintaining a specificity in which a single adenosine within a target RNA molecule can be targeted and deaminated to an inosine. I nt. Patent Application Publication No. WO2016 / 097212 discloses AONs for the targeted editing of RNA, wherein the AONs are characterized by a sequence that is complementary to a target RNA sequence (therein referred to as the ‘targeting portion’) and by the presence of a stemloop I hairpin structure (therein referred to as the ‘recruitment portion’), which is preferably non- complementary to the target RNA. Such oligonucleotides are referred to as ‘self-looping AONs’. The recruitment portion acts in recruiting a natural ADAR enzyme present in the cell (endogenously present) to the dsRNA formed by hybridization of the target sequence with the targeting portion. Due to the recruitment portion, there is no need for conjugated entities or presence of modified recombinant ADAR enzymes. I nt. Patent Application Publication No. WO2016 / 097212 describes the recruitment portion as being a stem-loop structure mimicking either a natural substrate (e.g., the GluB receptor) or a Z-DNA structure known to be recognized by the double stranded RNA binding domains, or Z-DNA binding domains, of ADAR enzymes. A stem-loop structure can be an intermolecular stem-loop structure, formed by two separate nucleic acid strands, or an intramolecular stem loop structure, formed within a single nucleic acid strand. The stem-loop structure of the recruitment portion as described is an intramolecular stem-loop structure, formed within the AON itself, and are thought to attract (endogenous) ADAR. Similar stem-loop structure-comprising systems for RNA editing have since then been described in Int. Patent Application Publication Nos. WO2017 / 050306, W02020 / 001793, WO2017 / 010556, W02020 / 246560, WO2022 / 078995, and United States patent no. US11,390, 865.P5652PC00

[0009] Int. Patent Application Publication Nos. WO2017 / 220751 and WO2018 / 041973 describe a next generation type of AONs that do not comprise such a stem-loop structure but that are (almost fully) complementary to the targeted area, and that appeared still capable of attracting endogenous ADAR enzymes. In one embodiment, one or more mismatching nucleotides, wobbles, or bulges exist between the oligonucleotide and the target sequence. A sole mismatch may be at the site of the nucleoside opposite the target adenosine, but in other embodiments AONs (or “RNA editing oligonucleotides” - even though the deamination reaction is carried out by the ADAR enzyme - and often abbreviated to ‘EONs’) were described with multiple bulges and / or wobbles when attached to the target sequence area. It appeared possible to achieve in vitro, ex vivo and in vivo RNA editing with AONs lacking a stem-loop structure and with endogenous ADAR enzymes when the sequence of the AON was carefully selected such that it could attract / recruit ADAR.

[0010] The ‘orphan nucleoside’, which is defined as the nucleoside in the AON that is positioned directly opposite the target adenosine in the target RNA molecule, was a nucleotide with an unmodified cytosine nucleobase and that did not carry a 2’-OMe modification. It was found that the orphan nucleoside could potentially be a deoxyribonucleoside (DNA), wherein the remainder of the AON could still carry 2’-O-alkyl modifications at the sugar entity (such as 2’- OMe), and it was found that the nucleotides directly surrounding the orphan nucleoside could contain chemical modifications (such as DNA in comparison to RNA) that could further improve the RNA editing efficiency and / or provide an increased resistance against nucleases. Such effects could even be further improved by using sense oligonucleotides (SONs) that ‘protected’ the AONs against breakdown upon delivery to the cells (described in Int. Patent Application Publication No. W02018 / 134301 and United States patent no. US 11,274,300).

[0011] The use of chemical modifications and particular structures in oligonucleotides that could be used in ADAR-mediated editing of specific adenosines in a target RNA have been the subject of numerous disclosures in the field, such as Int. Patent Application Publication Nos. WO2019 / 111957, WO2019 / 158475, W02020 / 165077, W02020 / 201406, W02020 / 211780, WO2021 / 008447, WO2021 / 020550, WO2021 / 060527, WO2021 / 117729, WO2021 / 136408, WO2021 / 182474, WO2021 / 216853, WO2021 / 242778, WO2021 / 242870, WO2021 / 242889, W02022 / 007803, W02022 / 018207, WO2022 / 026928, and WO2022 / 124345. The use of specific sugar moieties has been disclosed in for instance Int. Patent Application Publication Nos. W02020 / 154342, W02020 / 154343, W02020 / 154344, WO2022 / 103839, and WO2022 / 103852, whereas the use of stereo-defined linker moieties (in general for oligonucleotides that for instance can be used for exon skipping, in gapmers, in siRNA, or specifically for RNA-editing oligonucleotides, related to a wide variety of target sequences) has been described in Int. Patent Application Publication Nos. WO2011 / 005761, WO2014 / 010250, W02014 / 012081, WO2015 / 107425, WO2017 / 015575 (HTT), WO2017 / 062862, WO2017 / 160741, WO2017 / 192664, WO2017 / 192679 (DMD), WO2017 / 198775,P5652PC00WO2017 / 210647, WO2018 / 067973, WO2018 / 098264, WO2018 / 223073 (APOC3), WO2018 / 237194, WO2019 / 032607 (C9orf72), WO2019 / 055951, WO2019 / 075357 (SMA / ALS), W02019 / 200185 (DM1), WO2019 / 217784 (DM1), WO2019 / 219581, W02020 / 118246 (DM1), W02020 / 160336 (HTT), WO2020 / 191252, W02020 / 196662, WO2020 / 219981 (USH2A), WO2020 / 219983 (RHO), WO2020 / 227691 (C9orf72), WO2021 / 071788 (C9orf72), WO2021 / 071858, WO2021 / 178237 (MAPT), WO2021 / 234459, WO2021 / 237223, WO2022 / 099159, WO2021 / 030778, WO2022 / 174053, and WO2023 / 278589. Next to these disclosures, an extensive number of publications relate to the targeting of specific RNA target molecules, or specific adenosines within such RNA target molecules, be it to repair a mutation that resulted in a premature stop codon, or other mutation causing disease. Examples of such disclosures in which adenosines are targeted within specified target RNA molecules are Int. Patent Application Publication Nos. W02020 / 157008 and WO2021 / 136404 (USH2A); WO2021 / 113270 (APP); WO2021 / 113390 (CMT1A); W02021 / 209010 (IDUA, for Hurler syndrome); WO2021 / 231673 and WO2021 / 242903 (LRRK2); WO2021 / 231675 (ASS1); WO2021 / 231679 (GJB2); WO2019 / 071274 and WO2021 / 231680 (MECP2, for RETT syndrome); WO2021 / 231685 and WO2021 / 231692 (OTOF, for autosomal recessive non- syndromic hearing loss); WO2021 / 231691 (XLRS); WO2021 / 231698 (argininosuccinate lyase deficiency); W02021 / 130313 and WO2021 / 231830 (ABCA4, for Stargardt disease); WO2023 / 152371 (PCSK9); and WO2021 / 243023 (SERPINA1; for Alpha-1 -Antitrypsin deficiency; see also WO2016 / 097212, WO2017 / 220751, and WO2018 / 041973).

[0012] Mutagenesis studies of human ADAR2 revealed that a single mutation at residue 488 from glutamate to glutamine (E488Q), gave an increase in the rate constant of deamination by 60- fold when compared to the wildtype enzyme (Kuttan and Bass. Proc Natl Acad Sci USA 2012, 109(48) :E3295-3304). During the deamination reaction, ADAR flips the edited base out of its RNA duplex, and into the enzyme active site (Matthews et al. Nat Struct Mol Biol 2016, 23(5):426-433). When ADAR2 edits adenosines the nucleotide in the double stranded complex and that is opposite the target adenosine is, as mentioned above, often referred to as the ‘orphan nucleotide’ or the ‘orphan cytidine’ (when it is a cytidine). The crystal structure of ADAR2 E488Q bound to double stranded RNA revealed that the glutamine side chain at position 488 can donate an H-bond to the N3 position of the orphan cytidine (see FIG. 1) which leads to the increased catalytic rate of the ADAR2 E488Q enzyme (Kuttan and Bass 2012). In the wildtype enzyme, wherein a glutamate (E) is present at position 488 instead of a glutamine (Q) the amide group of the glutamine is absent and is instead a carboxylic acid. To obtain the same contact of the orphan cytidine with the E488Q mutant would then, for the wildtype situation, require protonation for this contact to occur. To make use of endogenously expressed ADAR2, for instance to correct disease relevant mutations (and not mutant ADAR2 versions that may require over-expression and exogenous administration), it is essential to maximize the editing efficiency of the wild-type ADAR enzyme present in the cell. Instead of using enzyme mutants,P5652PC00it was found that AONs with modified orphan nucleotides could mimic the hydrogen-bonding patterns that was observed between the E488Q ADAR2 mutant and cytidine. By replacing the orphan nucleotide in the AON with a cytidine analog that could serve as H-bond donor at N3, it appeared possible to stabilize the same contact and provide an increase in catalytic rate. One of the analogs that appeared very effective is referred to by its chemical name 6-amino-5-nitro- 3-yl-2(1H)-pyridone, which is the name of the nucleobase within the orphan nucleotide. This nucleobase is often also referred to as ‘Benner’s base’, ‘Z base’, or when the nucleotide is a deoxynucleotide as ‘Zd’, wherein the ‘d’ refers to the DNA character of the nucleotide and the ‘Z’ to the base. I nt. Patent Application Publication No. WO2020 / 252376 describes the use of the Benner’s base opposite the target adenosine as a pH-independent proton donor to establish a hydrogen bond with the glutamate at position 488 of the ADAR2 enzyme. Without wishing to be bound by theory, it is envisioned that this results in a more stable H-bond between the AON and ADAR2 and therefore provides an increased deamination efficiency of the target adenosine.

[0013] Despite the achievements outlined above, it is known that not each target adenosine is deaminated with the same efficiency when using synthetic AONs in cells that recruit endogenous ADAR enzymes, which may be due to a variety of reasons such as availability of the target area in the target RNA comprising the target adenosine, abundancy of expression of the target RNA molecule, tissue- and cell-specific matters, etc. Hence, there remains a need for improved compounds that can utilise (endogenous) cellular pathways and enzymes that have deaminase activity, such as naturally expressed ADAR enzymes, to more specifically and more efficiently edit endogenous nucleic acids in mammalian cells, even in whole organisms, to alleviate disease.SUMMARY OF THE INVENTION

[0014] The present disclosure relates to an antisense oligonucleotide (AON) capable of forming a double stranded nucleic acid complex with a target transcript molecule in a cell, wherein the target transcript molecule is a pre-mRNA or mRNA transcript molecule, wherein the double stranded nucleic acid complex is capable of recruiting an endogenous Adenosine Deaminases Acting on RNA (ADAR) enzyme that is naturally present in the cell, for deamination of a target adenosine in the target transcript molecule, wherein the nucleotide in the AON that is directly opposite the target adenosine is the orphan nucleotide, wherein the nucleotide numbering in the AON is such that the orphan nucleotide is number 0 and nucleotides are further positively (+) incremented towards the 5’ end and negatively (-) incremented towards the 3’ end, and wherein the orphan nucleotide comprises a cytosine analog nucleobase according to formula (I):P5652PC00NR1R2» / vwor any of its tautomeric forms, wherein: R1 , R2, R4 and / or R5 is H; OH; SH; =0; NH2; a halogen; a linear or branched lower (C1-C10) alkyl; or a C1-C6 cycloalkyl, wherein the alkyl and / or cycloalkyl is optionally interrupted by one or more heteroatoms; and R3 is H; OH; SH; NH2; or a halogen. In a preferred embodiment R1, R2, R3, R4 and R5 are H. When R1, R2, R3, R4 and R5 are all H, the cytosine analog nucleobase is also referred to as 5-aza-5,6-dihydrocytosine, which is a nucleobase that is herein and elsewhere also referred to as the ’E base’. The nucleotide at the orphan position mismatches with the target adenosine in the target transcript. Additional mismatches, wobbles, or bulges may be present between the AON and the target sequence, beside the orphan nucleotide - target adenosine mismatch, but the remainder of the sequence within the AON (hence, at the 5’ side and the 3’ side of the orphan position) may be 100% complementary to the target sequence. Depending on the length of the AON and the region of the target sequence that comprises the target adenosine, the complementarity of the AON sequences and the target sequences (outside the orphan nucleotide - target adenosine position) may be approximately 80-100%.

[0015] The E base (formula (II)) and its tautomeric forms are depicted in FIG. 5 herein.

[0016] In a preferred embodiment, the orphan nucleotide is a deoxynucleotide or a 2’-F nucleotide. In some embodiments, the orphan nucleotide is a FANA nucleotide, a 2’-OMe modified nucleotide, or a 2’-MOE modified nucleotide. In a preferred embodiment, the nucleotide at position -1 in the AON is a deoxynucleotide. In a preferred embodiment, the nucleotide at position +1 in the AON is a deoxynucleotide. Deoxynucleotides are often referred to as ‘DNA’ or ‘DNA nucleotides’ because of the presence of an -H moiety at the 2’ position in the ribosyl sugar moiety. In a preferred embodiment, the orphan nucleotide comprises a 5-aza- 5,6-dihydrocytosine nucleobase, or any of its tautomeric forms, and is a deoxynucleotide. The orphan nucleotide may then also be referred to as a 5-aza-5,6-dihydrodeoxycytidine.

[0017] In one aspect, the disclosure relates to an AON, wherein the internucleoside linkage numbering in the AON is such that linkage number 0 is the linkage 5’ from the orphan nucleotide, and the linkage positions in the oligonucleotide are positively (+) incremented towards the 5’ end and negatively (-) incremented towards the 3’ end, and wherein the AON comprises one or more modifications in the linkage moiety, which is each independently selected from the group consisting of: phosphorothioate (PS), phosphonoacetate, phosphorodithioate,P5652PC00methylphosphonate (MP), sulfonylphosphoramidate, (1,3-dimethylimidazolidin-2-ylidene) phosphoramidate (PNdmi), and mesyl phosphoramidate (PNms). In a preferred embodiment, the linkage position -2 is a MP linkage or a PNms linkage. In another preferred embodiment, the linkage between the most terminal two nucleotides on the 5’ and / or 3’ terminus of the AON is a PNdmi linkage or a PNms linkage.

[0018] In one aspect, the disclosure relates to an AON, wherein the AON comprises one or more nucleotides comprising a mono- or di-substitution at the 2', 3' and / or 5' position of the ribose, each independently selected from the group consisting of: -OH; -F; substituted or unsubstituted, linear or branched lower (C1-C10) alkyl, alkenyl, alkynyl, alkaryl, allyl, or aralkyl, that may be interrupted by one or more heteroatoms; -O-, S-, or N-alkyl; -O-, S-, or N-alkenyl; -O-, S-, or N- alkynyl; -O-, S-, or N-allyl; -O-alkyl-O-alkyl; -methoxy; -aminopropoxy; -meth oxy ethoxy; - dimethylamino oxyethoxy; and -dimethylaminoethoxyethoxy.

[0019] In one aspect, the disclosure relates to an AON, wherein the AON comprises at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 nucleotides, and is at most 100 nucleotides long, preferably at most 60 nucleotides long.

[0020] The present disclosure also relates to a pharmaceutical composition comprising an AON as disclosed herein, and a pharmaceutically acceptable carrier or diluent.

[0021] The present disclosure also relates to an AON as disclosed herein, or a pharmaceutical composition as disclosed herein, for use in the treatment of a disorder that can be treated by a deamination of a target adenosine in a target nucleic acid molecule, preferably wherein the disorder is selected from the group consisting of: Hurler Syndrome, alpha-1 -antitrypsin (A1AT) deficiency, Parkinson’s disease, Alzheimer’s disease (AD), hypercholesterolemia, a cardiovascular disease (OVD), a liver disease, a cholestatic disease, obesity, galactosemia, type 2 diabetes mellitus (T2DM), a kidney disease, ALDH2 deficiency, Huntington’s disease (HD), Stargardt Disease, Usher syndrome, autosomal recessive non-syndromic hearing loss, a nervous system disorder, and cancer.

[0022] The present disclosure also relates to a method of treating a human subject suffering from Hurler Syndrome, A1AT deficiency, Parkinson’s disease, AD, hypercholesterolemia, a CVD, a liver disease, a cholestatic disease, obesity, galactosemia, T2DM, a kidney disease, ALDH2 deficiency, HD, Stargardt Disease, Usher syndrome, a nervous system disorder, or cancer, said method comprising the step of administering to said subject an AON as disclosed herein.

[0023] The present disclosure also relates to an in vitro, ex vivo, or in vivo method for the deamination of at least one target adenosine present in a target transcript molecule in a cell, the method comprising the steps of: i) providing the cell with an AON as disclosed herein; ii) allowing annealing of the AON to the target transcript molecule to form a double stranded nucleic acid complex capable of recruiting an endogenous ADAR enzyme that is naturally present in the cell; iii) allowing the ADAR enzyme to deaminate the target adenosine in theP5652PC00target transcript molecule; and iv) optionally identifying the presence of the deaminated adenosine in the target transcript molecule.

[0024] The present disclosure also relates to an in vitro, ex vivo, or in vivo method for the deamination of at least one target adenosine present in a target transcript molecule, the method comprising the steps of: i) providing an AON as disclosed herein; ii) allowing annealing of the AON to the target transcript molecule to form a double stranded nucleic acid complex; iii) allowing a mammalian ADAR enzyme to deaminate the target adenosine in the target transcript molecule; and iv) optionally identifying the presence of the deaminated adenosine in the target transcript molecule.

[0025] In one preferred aspect, the ADAR enzyme that is recruited is an endogenous enzyme (= naturally present in the cell wherein the deamination occurs), preferably an endogenous ADAR2 enzyme.BRIEF DESCRIPTION OF THE DRAWINGS

[0026] One or more embodiments of the invention will now be described, by way of example only, with reference to the accompanying drawings, in which:

[0027] FIG. 1 shows the structure of the ADAR2 E488Q mutant bound to dsRNA and the contact between the glutamine (GLN) at position 488 and the orphan cytidine (Orphan C).

[0028] FIG. 2 shows the cytosine analog 6-amino-5-nitro-3-yl-2(1H)-pyridone (also referred to herein as Benner’s base or Z base).

[0029] FIG. 3 shows three uridine analogs as further outlined herein: a deoxynucleotide comprising an iso-uracil (N3-uracil, or N3U) nucleobase (left; also referred to herein as isolld, or as Iso-lid); a nucleotide comprising a 2’-fluoro substitution and comprising an isouracil nucleobase (middle; also referred to herein as isollaf, or as FANA Iso-ll); and the isoll comprising a 2’-difluoro substitution and comprising an isouracil nucleobase (right; also referred to herein as isoll2f, or as Di-fluoro Iso-ll).

[0030] FIG. 4A and FIG. 4B show the editing percentages observed on the human ACTINB transcript (ACTB) in two transfection experiments (with two different AON concentrations) and a variety of AONs. FIG. 4A and FIG. 4B show the editing percentages after transfection of five AONs in primary human hepatocyte cells (PHHs) to target the human ACTB transcript and to bring about an A-to-l deamination, using 0.01 pM AON (FIG. 4A) and 0.1 pM AON (FIG. 4B).The AONs that were used were: (i) RM4000 (SEQ ID NO:1) that comprises a deoxycytidine at the orphan position (Cd); (ii) RM4266 (SEQ ID NO:2) that comprises a deoxynucleotide comprising a Benner’s base at the orphan position (Zd); (iii) RM4807 (SEQ ID NO:3) that comprises a deoxynucleotide comprising an isouracil nucleobase at the orphan position (Iso- lld); (iv) RM5253 (SEQ ID NO:4) that comprises a nucleotide comprising a 2’-fluoro substitution and an isouracil nucleobase at the orphan position (FANA Iso-ll); and (v) RM5254 (SEQ IDP5652PC00NO:5) that comprises a nucleotide comprising a 2’-difluoro substitution and an isouracil nucleobase at the orphan position (Di-fluoro Iso-ll). This experiment was duplicated using a different set of five AONs and in the same two concentrations, but with the same nucleotides at the orphan position as described above. FIG. 4C and FIG. 4D show the editing percentages after transfection of five other AONs. The AONs that were used were: (i) RM3254 (SEQ ID NO:6) that comprises a deoxycytidine at the orphan position (Cd); (ii) RM4264 (SEQ ID NO:7) that comprises a deoxynucleotide comprising a Benner’s base at the orphan position (Zd); (iii) RM4807 (SEQ ID NO:8) that comprises a deoxynucleotide comprising an isouracil nucleobase at the orphan position (Iso-lid); (iv) RM5257 (SEQ ID NO:9) that comprises a nucleotide comprising a 2’-fluoro substitution and an isouracil nucleobase at the orphan position (FANA Iso-ll); and (v) RM5258 (SEQ ID NQ:10) that comprises a nucleotide comprising a 2’-difluoro substitution and an isouracil nucleobase at the orphan position (Di-fluoro Iso-ll).

[0031] FIG. 5 shows the chemical structure of the 5-aza-5,6-dihydrocytosine (left), which is a nucleobase that is herein and elsewhere also referred to as the ’E base’, with towards the right, its keto-amino, keto-imino, enol-amino, and enol-imino tautomeric forms.

[0032] FIG. 6 shows the 5’ to 3’ sequences of the AONs that were used in the experiments and examples outlined herein, with their respective SEQ ID NO’s and RM numbers as indicated. The chemical modifications are as follows: Ae and Ge are 2’-MOE modified adenosine and guanosine, respectively; m5Ce is a 2’-MOE modified 5-methyl-cytidine; m5Ue is a 2’-MOE modified 5-methyl-uridine; Cm, Am, Um, and Gm are 2’-OMe modified cytidine, adenosine, uridine, and guanosine, respectively; Gf, Cf, Af, and Uf are 2’-F modified guanosine, cytidine, adenosine, and uridine, respectively; Zd (orphan nucleotide) is a deoxynucleotide (deoxycytidine analog) comprising a Benner’s base; Ed (orphan nucleotide) is a deoxynucleotide (deoxycytidine analog) comprising a 5-aza-5,6-dihydrocytosine; Ad and Cd are deoxyadenosine and deoxycytidine, respectively; 8Ud refers to a deoxynucleotide comprising an iso-uracil nucleobase; 8Uf refers to a nucleotide comprising a 2’-fluoro substitution and an iso-uracil nucleobase; 8U2f refers to a nucleotide comprising a 2’-difluoro substitution and an iso-uracil nucleobase; 2Pd refers to a deoxynucleotide carrying a 2-pyridone nucleobase; “I” refers to a PNdmi linkage; “A” refers to a MP linkage; “*” refers to a PS linkage; “e” refers to a phosphodiester (PO) linkage; “#” refers to a PNms linkage. L005 refers to a tri-antennary GalNAc moiety connected to the AON via a linker, according to Formula IX(b) as disclosed herein. Also shown is part of the human APP target transcript (SEQ ID NO:15) with the target adenosine underlined. Also shown is part of the human ACTIN B target transcript (SEQ ID NO: 16) with the target adenosine underlined. Also shown is part of the mouse Angptl3 target transcript (SEQ ID NO:25) with the target adenosine underlined.

[0033] FIG. 7 shows a dose response curve of two AONs (EONs) that were used in PHHs to target the human APP transcript to bring about an A-to-l deamination. The AONs that were used were RM3767 (SEQ ID NO:11) and RM3990 (SEQ ID NO:12), wherein RM3767 comprises aP5652PC00deoxynucleotide comprising a Benner’s base at the orphan position (Zd) and RM3990 comprises a deoxynucleotide comprising an E base at the orphan position. The cells were treated with the following AON concentrations: 0.001 pM, 0.01 pM, 0.1 pM, 1 pM, 10 pM, and 25 pM.

[0034] FIG. 8A and FIG. 8B show the editing percentages of two gymnotic uptake experiments conducted on two target sites in a transcript encoding a human protein. FIG. 8A shows the editing percentages of AONs targeting an adenosine in a first codon and FIG. 8B shows the editing percentages of AONs targeting an adenosine in a second codon. AON1 is directed at the adenosine in the first codon and comprises a Benner’s base at the orphan position. AON2 is identical to AON1, except that it comprises an E base instead of a Benner’s base at the orphan position. AON3 is identical to AON1 but comprises a 2’-OMe modified uridine at the orphan position. AON4 is a scrambled version of AON1. AON5 is directed at the adenosine in the second codon and comprises a Benner’s base at the orphan position. AON6 is identical to AON5, except that it comprises an E base instead of a Benner’s base at the orphan position. AON7 is identical to AON5 but comprises a 2’-OMe modified uridine at the orphan position. AON8 is a scrambled version of AON5. To highlight the low batch-to-batch variability, data is shown from two independent cell batches (referred to as cell batch A and cell batch B, respectively), provided by the first two bars.

[0035] FIG. 9 shows a nuclease stability assay with the following AONs that were designed to target the target adenosine in the human APP transcript: (i) RM3395 (SEQ ID NO: 13) that comprises a deoxynucleotide comprising a Benner’s base at the orphan position (Zd) and a methylphosphonate linkage (MeP) at linkage position -2; (ii) RM3989 (SEQ ID NO: 14) that comprises a deoxynucleotide comprising an E base at the orphan position (Ed) and a methylphosphonate linkage (MeP) at linkage position -2; (iii) RM3767 (SEQ ID NO:11) that comprises a deoxynucleotide comprising a Benner’s base at the orphan position (Zd) and a phosphorothioate linkage (PS) at linkage position -2; and (iv) RM3990 (SEQ ID NO:12) that comprises a deoxynucleotide comprising an E base at the orphan position (Ed) and a phosphorothioate linkage (PS) at linkage position -2. Stability (relative purity) was assessed at t=0 and t=24h.

[0036] FIG. 10 shows the editing percentages of an in vivo study using multiple oligonucleotides targeting the mouse Angptl3 transcript to bring about an A-to-l deamination. The target sequence of the Angptl3 transcript (SEQ ID NO:25) as well as the AON sequences (SEQ ID NO:26 to 30) and their chemical modifications are depicted in FIG.6. The AON sequences and chemistries are identical, except for the nucleotide at the orphan position. RM123180 (SEQ ID NO:26) comprises a deoxycytidine nucleobase (Cd) on the orphan position, RM 123874 (SEQ ID NO:27) comprises a deoxynucleotide with a Benner’s base (Zd) on the orphan position, RM 123181 (SEQ ID NO:28) comprises a deoxynucleotide with an iso-uracil (isolld) on theP5652PC00orphan position, RM 123182 (SEQ ID NO:29) comprises a deoxypyridin-2-one (referred to as 2Pd), and RM123183 (SEQ ID NO:30) comprises a deoxynucleotide with an E base (Ed).

[0037] FIG. 11A and FIG. 11B show the editing percentages of gymnotic uptake experiment of four AONs that were used in PHHs to target the human APP transcript to bring about an A-to-l deamination. The AONs that were used were RM3767 (SEQ ID NO:11), RM3990 (SEQ ID NO:12), RM129714 (SEQ ID NO:35) and RM129715 (SEQ ID NO:36), wherein RM3767 comprises a deoxynucleotide comprising a Benner’s base at the orphan position (Zd), RM3990 comprises a deoxynucleotide comprising an E base at the orphan position (Ed), RM129714 comprises a deoxynucleotide comprising a cytidine base at the orphan position (Cd) and RM129715 comprises a deoxynucleotide comprising an iso-uracil base at the orphan position (dlsoll). FIG. 11A shows the results of the treated cells with 2.5 pM AON concentration and FIG. 11B shows the results of the 5 pM AON concentrations.DETAILED DESCRIPTION

[0038] The present disclosure relates to the use of a nucleobase that has improved RNA editing capabilities when placed at the orphan position in an antisense oligonucleotide (AON) and when recruiting and utilizing endogenous (= naturally present) ADAR enzymes in a cell. As outlined above, the field of RNA editing initially used the naturally occurring orphan nucleotide, which is generally cytidine or uridine, in the early stages of studying RNA editing for therapeutic use. However, when a nucleotide carrying a cytosine nucleobase was used, thereby representing unmodified RNA, the guide oligonucleotide appeared more prone to nuclease-dependent degradation. Notably, protecting the orphan cytidine by introducing a 2’-OMe modification in the ribose sugar increased the stability of the guide oligonucleotide but lowered the efficiency of the ADAR enzyme significantly (Vogel et al. 2014). This was initially solved by using a deoxynucleotide at the orphan position in combination with a cytosine nucleobase. Then, RNA editing efficiency was further improved (for instance) by introducing deoxynucleotides at the 3’ and / or at the 5’ side of the orphan nucleotide. As outlined above also, RNA editing efficiency could be further boosted by mimicking the contact between an ADAR2 mutant enzyme (E488Q) with cytidine in the wildtype situation by applying a cytosine analog, generally referred to as the Benner’s base (Int. Patent Application Publication No. WQ2020 / 252376), see FIG. 1 and FIG.2. When used as a deoxynucleotide, the Benner’s base significantly increased RNA editing efficiency but also protected against nuclease-dependent degradation.

[0039] The present disclosure takes a next step in this development, by disclosing the use of a different type of cytosine analog at the orphan position, which surprisingly increased RNA editing efficiency in human cells (and thereby using endogenous ADAR enzymes) even more.

[0040] The present disclosure relates to an AON that is capable of forming a double stranded nucleic acid complex with a target transcript molecule in a cell, wherein the target transcript molecule is a pre-mRNA or mRNA transcript molecule, wherein the double stranded nucleicP5652PC00acid complex is capable of recruiting an endogenous ADAR enzyme that is naturally present in the cell, for deamination of a target adenosine in the target transcript molecule, wherein the orphan nucleotide comprises a cytosine analog nucleobase according to formula (I):NR1R2or any of its tautomeric forms, wherein: R1 , R2, R4 and / or R5 is H; OH; SH; =0; NH2; a halogen; a linear or branched lower (C1-C10) alkyl; or a C1-C6 cycloalkyl, wherein the alkyl and / or cycloalkyl is optionally interrupted by one or more heteroatoms; and R3 is H; OH; SH; NH2; or a halogen.

[0041] The field of nucleoside analogs has been instrumental in developing therapeutics targeting viral infections and epigenetic modifications. Among these, 5-aza-5,6-dihydrocytosine represents a structurally novel cytosine analog with distinct chemical and biological properties.5-aza-5,6-dihydrocytosine is represented by the structure of formula (II) wherein R1, R2, R3, R4, and R5 are all H moieties. The 5-aza-5,6-dihydrocytosine structure is provided in the left structure of FIG. 5, followed by four of its tautomeric forms.

[0042] Unlike as observed in conventional nucleosides, this nucleobase features a saturated 5,6 bond, altering its tautomeric equilibrium and base-pairing characteristics. This unique tautomeric flexibility allows it to adopt multiple conformations in solution. One of the most well- characterized applications of 5-aza-5,6-dihydrocytosine, particularly when used in a deoxyribonucleoside form (2’-deoxy-5-aza-5,6-dihydrocytidine), has been in the context of antivirals. Studies have shown that 5-aza-5,6-dihydrocytosine forms a mismatch with both adenine and guanine, a direct consequence of its ability to interconvert between distinct tautomeric states. Experimental data confirm that the 5-aza-5,6-dihydro nucleobase exists in a mixture of enol and keto tautomers, with the enol form being predominant under physiological conditions. The enol and keto tautomers of the 5-aza-5,6-dihydro nucleobase are displayed in FIG. 5. This property may explain its base-pairing promiscuity, which underlies its effects observed in other studies (Li D et al. Proc Natl Acad Sci USA 2014, 111(32):E3252-E3259).

[0043] Beyond its role in antivirals, 5-aza-5,6-dihydrocytosine has also demonstrated potential in epigenetic applications. DNA methylation, a key regulatory process in gene expression, is commonly dysregulated in malignancies. The structurally related nucleoside 2'-deoxy-5- azacytidine (decitabine) is widely used for DNA demethylation in cancer therapy by covalently trapping DNA methyltransferases (DNMTs; Matousova M et al. Epigenetics 2011, 6(6):769- 776). However, decitabine is associated with cytotoxicity and instability in aqueousP5652PC00environments. 2’-deoxy-5-aza-5,6-dihydrocytidine, in contrast, retains DNMT inhibitory activity while exhibiting greater hydrolytic stability due to the absence of a reactive C5-C6 double bond. Importantly, preclinical and clinical investigations have reported minimal cytotoxic effects of 2’- deoxy-5-aza-5,6-dihydrocytidine in mammalian systems. Furthermore, its stability profile allows for alternative modes of administration, including potential oral formulations, which would overcome the limitations of current hypomethylating agents requiring parenteral delivery (Matousova et al. 2011).

[0044] As already mentioned above, in the field of RNA editing there is a constant need for improving the pharmacokinetic properties of guide AONs that induce RNA editing through the formation of a double-stranded complex with the target RNA molecule (generally a pre-mRNA or mRNA transcript molecule) and the recruitment of an ADAR enzyme by the double-stranded complex. AONs are also sometimes referred to as ‘editing oligonucleotides’, or ‘EONs’, but it is not the oligonucleotide that does the editing, since the editing reaction (= the deamination) is enzymatically performed by the ADAR protein. These improvements are desired without negatively affecting editing efficiency of the target adenosine in the target RNA. The skilled person knows that a plethora of chemical modifications exists that may be applied in the generation of AONs, whose properties are not always compatible with the desire of achieving efficient RNA editing. For instance, in the search for better pharmacokinetic properties, it was found earlier that a 2’-O-methoxyethyl (or 2’-methoxyethoxy; or 2’-MOE) modification of the ribose of some, but not all, nucleotides appeared compatible with efficient ADAR engagement and editing (Int. Patent Application Publication No. WO2019 / 1548475). The same holds true for instance for2’-fluoro (2’-F) modifications and 2’,2’-difluoro (2’-diF) modifications.

[0045] FIG. 2 shows the structure of the cytosine nucleobase analog often referred to as the Benner’s base (Z). As previously envisioned and as disclosed in Int. Patent Application Publication No. WO2020 / 252376, the Benner’s base was found to be very effective in AONs for RNA editing when positioned on the orphan position, likely because of the hydrogen-bond donation at N3 with minimal perturbation to the shape of the nucleobase and pH independency. Surprisingly however, it is herein disclosed that when an AON comprising a Benner’s base in the orphan nucleotide (that is opposite the target adenosine) was compared to an AON comprising an E base instead of the Benner’s base, RNA editing was improved (increased RNA editing percentages). This was surprising because the E base carries a nitrogen on the 5 position and a hydrogen atom on the 5 and 6 positions of the pyrimidine base compared to what was previously envisioned a hydrogen bond donator at the N3 position (such as envisioned with the Benner’s base). Without wishing to be bound by theory, it is hypothesized that the E base can hold a hyperconjugation structure where the pi-orbital covalent bond between the N3 and C4 hybridizes between the N3, C4 and N5 and where the N5 hydrogen shifts between the nitrogen atoms at the N5 and N3 positions.P5652PC00

[0046] The presence of the cytosine analog in the orphan nucleotide of an AON as disclosed herein may be combined with modifications to the ribose 2’ group. The ribose 2’ groups in the AON can be independently selected from: 2’-H (i.e. DNA); 2’-OH (i.e. RNA); 2’-OMe; 2’-MOE; 2’-F; 2’-[N-methylacetamide] (2’-NMA); and 2’-4’-linked (i.e., a locked nucleic acid or LNA), or other 2’ substitutions or 2’,2’-disubstitutions. Different 2’ modifications are discussed in further detail in Int. Patent Application Publication Nos. WO2016 / 097212, WO2017 / 220751, WO2018 / 041973, and WO2018 / 134301. AONs as disclosed herein make use of specific nucleotide modifications at predefined spots to ensure stability as well as proper ADAR binding and activity. These changes may vary and may include modifications in the backbone of the AON, in the sugar moiety of the nucleotides as well as in the nucleobases or the phosphodiester linkages, as outlined in detail herein. They may also be variably distributed throughout the sequence of the AON. Specific modifications may be needed to support interactions of different amino acid residues within the RNA-binding domains of ADAR enzymes, as well as those in the deaminase domain. For example, PS linkages between nucleotides or 2’-OMe or 2’-MOE modifications may be tolerated in some parts of the AON, while in other parts they should be avoided so as not to disrupt crucial interactions of the enzyme with the phosphate and 2’-OH groups. Specific nucleotide modifications may also be necessary to enhance the editing activity on substrate RNAs where the target sequence is not optimal for ADAR editing. Previous work has established that certain sequence contexts are more amenable to editing. For example, a target sequence 5’-UAG-3’ (with the target A in the middle) contains the preferred nearest- neighbour nucleotides for ADAR2, whereas a 5’-CAA-3’ target sequence is disfavoured (Schneider et al. Nucleic Acids Res 2014, 42(10):e87). The structural analysis of ADAR2 deaminase domain hints at the possibility of enhancing editing by careful selection of the nucleotides that are opposite to the target trinucleotide. For example, the 5’-CAA-3’ target sequence, paired to a 3’-GCU-5’ sequence on the opposing strand (with the A-C mismatch formed in the middle), is disfavoured because the guanosine base sterically clashes with an amino acid side chain of ADAR2. The guanosine opposite the C in such circumstances is preferably replaced by an inosine (hence, at the -1 position within the AON), preferably this -1 position is then a deoxynucleotide comprising a hypoxanthine nucleobase (Id).

[0047] The oligonucleotides are herein abbreviated to “AONs”, but sometimes also referred to as ‘editing oligonucleotides’ (abbreviated to ‘EONs’), even though the RNA editing event itself, as already mentioned above, is performed by the deamination enzyme and the action of the oligonucleotide only triggers the RNA editing to take place. There is a constant need for improving the pharmacokinetic properties of the AONs without negatively affecting the efficiency in which the target adenosine is deaminated in the target RNA, and / or without negatively affecting the stability of the AON itself, which is constantly prone to breakdown because of nucleases present in a natural cell. Many chemical modifications are available for the generation of AONs (and many have been applied in the art). However, many of these properties are notP5652PC00always compatible with the desire of achieving efficient RNA editing. In the search for better pharmacokinetic properties, it was found earlier that a PS linkage at some, but not all, internucleoside linkages surprisingly appeared compatible with efficient ADAR engagement and editing (Int. Patent Application Publication No. WO2019 / 219581). Also, it was found earlier that phosphonoacetate linkage modifications and / or unlocked nucleic acid (UNA) ribose modifications of some, but not all, positions in the AON appeared compatible with efficient engagement of an enzyme with nucleotide deamination activity and with subsequent deamination (Int. Patent Application Publication No. W02020 / 165077). Whereas the properties of phosphonoacetate and UNA modifications were known as such, the compatibility thereof with engagement of enzymes with nucleotide deamination activity and with the deamination reaction was not known. Also, it was found earlier that MP linkage modifications of some, but not all, positions in the AON appeared compatible with efficient engagement of an enzyme with nucleotide deamination activity and with subsequent deamination (Int. Patent Application Publication No. WO2020 / 201406). Also, it was found earlier that PNms at some positions in the AON appeared compatible with efficient engagement of an enzyme with nucleotide deamination activity and with subsequent deamination (Int. Patent Application Publication No. W02024 / 200278).

[0048] The AON as disclosed herein can comprise internucleoside linkage modifications. In one aspect, the AON comprises one or more modifications in the linkage moiety, which is each independently selected from the group consisting of: PS, phosphonoacetate, phosphorodithioate, MP, sulfonylphosphoramidate, (1,3-dimethylimidazolidin-2-ylidene) phosphoramidate (PNdmi), and a linkage according to formula (III) below, more preferably mesyl phosphoramidate (PNms). In one aspect, as outlined above, the internucleoside linkage numbering in the AON is such that linkage number 0 is the linkage 5’ from the orphan nucleotide, and the linkage positions in the oligonucleotide are positively (+) incremented towards the 5’ end and negatively (-) incremented towards the 3’ end, and wherein linkage position -2 is an MP linkage, a PNdmi linkage, or a PNms linkage, preferably a PNms linkage. In one aspect, the linkage between the most terminal two nucleotides on the 5’ and / or 3’ terminus of the AON is a PNdmi linkage or a PNms linkage, and preferably both these linkages are PNms linkages.

[0049] In the AON of the present invention, the orphan nucleotide (the nucleotide directly opposite the target adenosine) generally comprises a ribose with a 2’-OH group but preferably comprises a deoxyribose with a 2’-H group.

[0050] RNA editing is often applied to correct G>A mutations that cause and / or is associated with a disease. Non-limiting examples of transcript molecules (as disclosed in the art) that are targeted using RNA editing for a variety of treatments are SERPINA1 (for the treatment of alphal -antitrypsin (A1AT) deficiency; see e.g., Int. Patent Application Publication Nos. WO2016 / 097212, WO2017 / 220751 , WO2018 / 041973, and WO2021 / 243023), IDUA (for the treatment of Hurler syndrome; see e.g., Int. Patent Application Publication Nos.P5652PC00WO2017 / 220751, WO2018 / 041973, and WO2021 / 209010), LRRK2 (for the treatment of Parkinson’s disease; see e.g., Int. Patent Application Publication Nos. WO2016 / 097212, WO2017 / 220751, WO2018 / 041973, WO2021 / 231673 and WO2021 / 242903), ABCA4 (for the treatment of Stargardt disease; see e.g., Int. Patent Application Publication Nos. W02021 / 130313 and WO2021 / 231830), USH2A (for the treatment of Usher syndrome; see e.g., Int. Patent Application Publication Nos. W02020 / 157008, WO2020 / 219981 and WO2021 / 136404), APP (see e.g., Int. Patent Application Publication No. WO2021 / 113270), CMT1A (see e.g., Int. Patent Application Publication No. WO2021 / 113390), ASS1 (see e.g., Int. Patent Application Publication No. WO2021 / 231675), GJB2 (see e.g., Int. Patent Application Publication No. WO2021 / 231679), MECP2 (for the treatment of Rett syndrome; see e.g., Int. Patent Application Publication Nos. WO2019 / 071274 and WO2021 / 231680), OTOF (for the treatment of autosomal recessive non-syndromic hearing loss; see e.g., Int. Patent Application Publication Nos. WO2021 / 231685 and WO2021 / 231692), XLRS (see e.g., Int. Patent Application Publication No. WO2021 / 231691), and PCSK9 (for the treatment of hypercholesterolemia; see e.g., Int. Patent Application Publication No. WO2023 / 152371). In all these cases, AONs can be applied using the teaching of the present disclosure. Hence, such AONs, comprising an orphan nucleotide comprising a nucleobase as disclosed herein, that can be used in the treatment of any disease associated with the listed target sequences are also within the present disclosure (see below).

[0051] Definitions

[0052] Whenever reference is made to an oligonucleotide, oligo, ON, ASO, oligonucleotide composition, antisense oligonucleotide, AON, (RNA) editing oligonucleotide, EON, and RNA (antisense) oligonucleotide, both oligoribonucleotides and deoxyoligoribonucleotides are meant unless the context dictates otherwise. Potentially the oligonucleotide may completely lack RNA and DNA nucleotides (as they appear in nature) and may consist completely of modified nucleotides. Whenever reference is made to an ‘oligoribonucleotide’ it may comprise the bases A, G, C, U, or I. Whenever reference is made to a ‘deoxyoligoribonucleotide’ it may comprise the bases A, G, C, T, or I. However, an AON as disclosed herein may comprise a mix of ribonucleotides and deoxyribonucleotides. When a deoxyribonucleotide is used, hence without a modification at the 2’ position of the sugar, the nucleotide is often abbreviated to dA (or Ad), dC (or Cd), dG (or Gd), dl (or Id), m5Ud (or T) in which the ‘d’ represents the deoxy nature of the nucleoside, while a ribonucleoside that is either normal RNA or modified at the 2’ position is often abbreviated without the ‘d’, and often abbreviated with their respective modifications and as explained herein.

[0053] The term ‘nucleoside’ refers to the nucleobase linked to the (deoxy) ribosyl sugar, without phosphate groups. A ‘nucleotide’ is composed of a nucleoside and one or more phosphate groups. The term ‘nucleotide’ thus refers to the respective nucleobase-(deoxy)ribosyl-P5652PC00phospholinker, as well as any chemical modifications of the ribose moiety or the phospho group. Thus, the term would include a nucleotide including a locked ribosyl moiety (comprising a 2’-4’ bridge, comprising a methylene group or any other group), an unlocked nucleic acid (UNA), a threose nucleic acid (TNA), a nucleotide including a linker comprising a phosphodiester (PO), phosphonoacetate, phosphotriester, PS, phosphoro(di)thioate, MP (or MeP), methyl thiophosphonate, phosphoramidate linkages, PNdmi, and a linkage according to the structure of formula (IV) as described herein. Sometimes the terms nucleobase, nucleoside and nucleotide are used interchangeably, unless the context clearly requires differently, for instance when a nucleoside is linked to a neighbouring nucleoside and the linkage between these nucleosides is modified. As stated herein, a nucleotide is a nucleoside plus one or more phosphate groups. The terms ‘ribonucleoside’ and ‘deoxyribonucleoside’, or ‘ribose’ and ‘deoxyribose’ are as used in the art.

[0054] Sometimes the terms adenine / adenosine, guanine / guanosine, cytosine / cytidine, uracil / uridine, thymine / 5-methyluridine (m5U), and hypoxanthine / inosine, are used interchangeably to refer to the corresponding nucleobase on the one hand, and the nucleoside or nucleotide on the other. The nucleobase thymine (T) is also known as 5-methyluracil (m5U) and is an uracil (U) derivative; thymine and 5-methyluracil can be interchanged throughout the document text. Likewise, the deoxyribonucleoside thymidine is also known as the deoxynucleotide version of 5-methyluridine and is therefore also a uridine derivative; thymidine and 5-methyluridine can be interchanged throughout the document text.

[0055] The term ‘cytosine analog’ refers to an analog version of the cytosine nucleobase. The nucleobase is sometimes in the art also referred to as the ‘nitrogenous base’.

[0056] Likewise, the term ‘cytidine analog’ refers to an analog of the ribonucleoside cytidine, whereas the term ‘deoxycytidine analog’ refers to an analog of the deoxyribonucleoside deoxycytidine.

[0057] When a referral is made to a cytidine analog, generally a referral is meant to the cytosine nucleobase, because the sugar moiety at the 2’ position may be 2’-OH, 2’-H, 2’-OMe, 2’-MOE, 2’-F, or any other modification as outlined herein. The Benner’s base or Z-base (6-amino-5- nitro-3-yl-2(1 H)-pyridone) is a cytosine analog, because the chemical structure is similar to (but different from) the cytosine nucleobase. However, the term ‘Benner’s base’ is often also used in the context of the (deoxy)ribonucleoside, in which a chemical substitution may or may not be present at the 2’ position of the sugar ring. The same holds true for the E base (5-aza-5,6- di hydrocytosine) that is also a cytosine analog, because the chemical structure is similar to (but different from) the cytosine nucleobase. Also here, the term ‘E base’ is often used in the context of the (deoxy)ribonucleoside, in which a chemical substitution may or may not be present at the 2’ position of the sugar ring. In general, when the term ‘5-aza-5,6-dihydrocytosine’ is used, the nucleobase structure on the left in FIG. 5 is meant, which nucleobase structure may be incorporated in a nucleotide comprising any (further) chemical modification in the sugar moietyP5652PC00and linkage as outlined herein. In general, when the term ‘5-aza-5,6-dihydrocytidine’ is used, a (deoxy)ribonucleotide is meant comprising the 5-aza-5,6-dihydrocytosine nucleobase. Sometimes, the term ‘2’-deoxy-5-aza-5,6-dihydrocytidine’ is used, which then solely relates to a deoxyribonucleotide comprising the 5-aza-5,6-dihydrocytosine nucleobase (Ed in FIG. 6).

[0058] AONs of the present disclosure comprise a nucleotide at the orphan position comprising a nucleobase that serves as an H-bond donor at the N5 site. In a preferred embodiment, the nucleobase is a cytosine analog that serves as an H-bond donor at the N5 site, more preferably wherein the nucleobase is 5-aza-5,6-dihydrocytosine. In another preferred embodiment, the orphan nucleotide is a deoxynucleotide. Combined this makes that in a preferred embodiment, the AON as disclosed herein comprises a 2’-deoxy-5-aza-5,6-dihydrocytidine at the orphan position.

[0059] Whenever reference is made to nucleotides in the oligonucleotide, such as cytosine, 5- methylcytosine, 5-hydroxymethylcytosine, 5-formylcytosine, 5-acetylcytosine, 5- hydroxycytosine, and p-D-glucosyl-5-hydroxymethylcytosine are included. Whenever reference is made to adenine, N6-methyladenine, 8-oxo-adenine, 2,6-diaminopurine and 7-methyladenine are included. Whenever reference is made to uracil, di hydrouracil, iso-uracil, N3-glycosylated uracil, pseudo-uracil, 5-methyluracil, N1 -methylpseudouracil, 4-thiouracil and 5- hydroxym ethyl uracil are included. Whenever reference is made to guanine, 1-methylguanine, 7-methylguanosine, N2,N2-dimethylguanosine, N2,N2,7-trimethylguanosine and N2,7- dimethylguanosine are included. Whenever reference is made to nucleosides or nucleotides, ribofuranose derivatives, such as 2’-deoxy, 2’-hydroxy, and 2’-O-substituted variants, such as 2’-OMe, are included, as well as other modifications, including 2’-4’ bridged variants. Whenever reference is made to oligonucleotides, one or more linkages may be a naturally occurring PO linkage, whereas the remaining linkages between two mononucleotides may be a modified linkage. Examples of such modified linkages are phosphonoacetate, phosphotriester, PS, phosphoro(di)thioate, MP, phosphoramidate linkages, phosphoryl guanidine, thiophosphoryl guanidine, sulfono phosphoramidate, PNdmi and the linkage structure according to formula (IV), further outlined in detail below.

[0060] The term ‘comprising’ encompasses ‘including’ as well as ‘consisting of’, e.g., a composition ‘comprising X’ may consist exclusively of X or may include something additional, e.g., X + Y. The term ‘about’ in relation to a numerical value x is optional and means, e.g., x+10%.

[0061] The word ‘substantially’ does not exclude ‘completely’, e.g., a composition which is ‘substantially free from Y’ may be completely free from Y. Where relevant, the word ‘substantially’ may be omitted from the definition of the invention.

[0062] The term ‘conducive to’ or ‘mediate’ can be used interchangeably with ‘capable of facilitating’. When used in the context of an AON that is conducive to ADAR editing (or can mediate ADAR editing), this means that the AON, after entry into the cell, interacts with theP5652PC00target RNA sequence, thereby forming a double stranded structure which is recognized by the ADAR enzyme, which can then deaminate the target adenosine into an inosine. Hence, the AON itself does not have the enzymatic function (the ADAR enzyme has), but it can trigger, induce, cause, organize, mediate, provide, give, produce, facilitate, result in RNA editing after binding to the target RNA molecule.

[0063] The term ‘mismatch’ is used herein to refer to opposing nucleotides in a double stranded RNA complex which do not form perfect base pairs according to the Watson-Crick base pairing rules. In the historical sense, mismatched nucleotides are G-A, C-A, ll-C, A-A, G-G, C-C, Il-Il pairs. In some embodiments AONs as disclosed herein comprise fewer than four mismatches with the target sequence, for example 0, 1 or 2 mismatches. ‘Wobble’ base pairs are G-ll, l-ll, l-A, and l-C base pairs. When a II is placed opposite the target A, there is no mismatch, and the AON may be 100% complementary. When a C is placed opposite the target A, there is at least 1 mismatch between the AON and the target sequence. A-basic nucleotides (nucleotides lacking a nucleobase) within the AON mismatch with their opposite nucleotide in the target sequence (because there can be no base ‘pair’). Although a G:G pairing would be considered a mismatch, that does not necessarily mean that the interaction is unstable, which means that the term ‘mismatch’ may be somewhat outdated based on the current disclosure where a Hoogsteen base-pairing may be seen as a mismatch based on the origin of the nucleotide but still be relatively stable. An isolated G:G pairing in duplex RNA can for instance be quite stable but still be defined as a mismatch. Analysis of natural targets of ADAR enzymes has indicated that these generally include mismatches between the two strands that form the RNA helix edited by ADAR1 or 2. It has been suggested that these mismatches enhance the specificity of the editing reaction (Stefl et al. 2006. Structure 14(2): 345-355; Tian et al. 2011. Nucleic Acids Res 39(13):5669-5681). Characterization of optimal patterns of paired / mismatched nucleotides between the AONs and the target RNA also appears important to the development of efficient ADAR-based AON therapy.

[0064] The term ‘complementary’ as used herein refers to the fact that the AON hybridizes under physiological conditions to a second nucleic acid strand. Examples are (i) when the AON as a first nucleic acid strand (= guide oligonucleotide) forms a heteroduplex RNA editing oligonucleotide complex with second complementary nucleic acid strand (in vitro), or (ii) when it forms a double stranded complex with the target RNA molecule. The term does not necessarily mean that each nucleotide in a nucleic acid strand has a perfect pairing with its opposite nucleotide in the opposite sequence. In other words, while an AON may be complementary to a target sequence, there may be mismatches, wobbles and / or bulges between the AON and the target sequence, while under physiological conditions that AON still hybridizes to the target sequence such that the cellular RNA editing enzymes can deaminate the target adenosine to an inosine. The term ‘substantially complementary’ therefore also means that despite the presence of the mismatches, wobbles, and / or bulges, the AON hasP5652PC00enough matching nucleotides with the target sequence that under physiological conditions the AON hybridizes to the target RNA molecule. As shown herein, an AON may be complementary, but may also comprise one or more mismatches, wobbles and / or bulges with the target sequence, if under physiological conditions the AON is able to hybridize to its target.

[0065] The term ‘orphan nucleotide’ relates to the nucleotide in the AON that is directly opposite the target adenosine, which is the adenosine that is deaminated by the deaminating enzyme. The orphan nucleotide as disclosed herein comprises a cytosine analog nucleobase, preferably wherein the cytosine analog nucleobase serves as an H-bond donor at the N5 site. It may be a chemically modified nucleotide, as further described in detail below.

[0066] A ‘nucleotide analog’ refers to an analog of a nucleic acid nucleotide. The nucleotide analog is an analog of adenosine, guanosine, cytidine, thymidine, uridine, inosine, deoxyadenosine, deoxyguanosine, deoxycytidine, deoxythymidine, deoxyuridine, or deoxyinosine.

[0067] The term ‘downstream’ in relation to a nucleic acid sequence means further along the sequence in the 3' direction; the term ‘upstream’ means the converse. Thus, in any sequence encoding a polypeptide, the start codon is upstream of the stop codon in the sense strand but is downstream of the stop codon in the antisense strand. The same holds true for the AONs as disclosed herein. Nucleotides that are upstream of the orphan nucleotide in the antisense oligonucleotide are located towards the 5’ terminus, and nucleotides that are downstream of the orphan nucleotide are located towards the 3’ terminus.

[0068] The nucleotide ‘numbering’ in an AON as disclosed herein is such that the orphan nucleotide is number 0 and the nucleotide 5’ from the orphan nucleotide is number +1. Counting is further positively (+) incremented towards the 5’ end and negatively (-) incremented towards the 3’ end, wherein the first nucleotide 3’ from the orphan nucleotide is number -1. The internucleoside linkage numbering in the AON is such that linkage number 0 is the linkage 5’ from the orphan nucleotide, and the linkage positions in the oligonucleotide are positively (+) incremented towards the 5’ end and negatively (-) incremented towards the 3’ end.

[0069] References to ‘hybridisation’ typically refer to specific hybridisation and exclude non-specific hybridisation. Specific hybridisation can occur under experimental conditions chosen, using techniques well known in the art, to ensure that most stable interactions between probe and target are where the probe and target have at least 70%, preferably at least 80%, more preferably at least 90% sequence identity.

[0070] The term ‘splice mutation’ relates to a mutation in a gene that encodes for a pre-m RNA, wherein the splicing machinery is dysfunctional in the sense that splicing of introns from exons is disturbed and due to the aberrant splicing, the subsequent translation is out of frame resulting in premature termination of the encoded protein. Often such shortened proteins degrade rapidly and do not have any functional activity.P5652PC00

[0071] Whenever a ‘naked’ form in relation to the AON as disclosed herein is referred to, it means that the AON is manufactured in a laboratory or manufacturing facility, through which it is generally chemically modified to prevent it from rapid degradation after it enters the mammalian body or a tissue, or cell, upon administration. The naked form of an AON is therefore different from a form in which the AON is encoded (and delivered) by a viral genome or within a plasmid vector. When such viral vectors or plasmid vectors are administered, the encoded AON is expressed from the viral vector genome or from the plasmid in the cell to which the viral vector or plasmid vector is delivered. Consequently, the AON is then not chemically modified and comprises solely naturally occurring RNA nucleotides.

[0072] The length of the AON as disclosed herein, and when delivered in a naked form is preferably 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 nucleotides in length.

[0073] The term ‘HEON’ refers to a heteroduplex double-stranded complex molecule wherein an AON as disclosed herein is hybridized to a partially or fully complementary, partially of fully overlapping sense oligonucleotide. Because the AON as disclosed herein often has specified chemical modifications that are different from the chemical modifications in the sense strand, the two strands form such a heteroduplex RNA editing oligonucleotide complex. The sense strand may be chemically modified almost in its entirety, similar or different to what is performed in the AON as disclosed herein, for example by providing nucleotides with a ribose sugar moiety carrying a 2’-OMe substitution, a 2’-F substitution, or a 2’-MOE substitution. It is to be understood that the sense strand present in the HEON is a different entity in comparison to the target RNA molecule in the cell. The sense strand in an HEON is preferably 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 nucleotides in length. The HEON is often generated in vitro and used as a delivery tool to protect the AON from degradation when administered to the cell. In other words, the HEON is preferably formed before the AON is administered to the cell.

[0074] The term ‘cytosine analog’ refers to any nucleobase that serves as an H-bond donor at N5 and / or N3 to interact with an ADAR enzyme, preferably ADAR2. Non-limiting examples of such cytosine analogs are pseudoisocytidine (piC), Benner’s base (Z), 5-hydroxyC-H+, 5- aminoC-H+ and 8-oxoA (syn) and 5-aza-5,6-dihydrocytosine, also referred to as the E base.

[0075] The term ‘nucleoside’ refers to the nucleobase linked to the (deoxy) ribosyl sugar, without phosphate groups. A ‘nucleotide’ is composed of a nucleoside and one or more phosphate groups. The term ‘nucleotide’ thus refers to the respective nucleobase-(deoxy)ribosyl- phospholinker, as well as any chemical modifications of the ribose moiety or the phospho group. Thus, the term ‘nucleotide’ includes a nucleotide with a locked ribosyl moiety (comprising a 2’- 4’ bridge, comprising a methylene group or any other group), an unlocked nucleic acid (UNA),P5652PC00a nucleotide including a linker comprising a phosphodiester, phosphonoacetate, phosphotriester, PS, phosphoro(di)thioate, MP, phosphoramidate linkers, and the like. Sometimes the terms adenine and adenosine, guanine and guanosine, cytosine and cytidine, uracil and uridine, thymine and 5-methyluridine / thymidine / uridine, and hypoxanthine and inosine, are used interchangeably to refer to the corresponding nucleobase on the one hand, and the nucleoside or nucleotide on the other. Sometimes the terms nucleobase, nucleoside and nucleotide are used interchangeably, unless the context clearly requires differently, for instance when a nucleoside is linked to a neighbouring nucleoside and the linkage between these nucleosides is modified. As stated above, a nucleotide is a nucleoside + one or more phosphate groups. The terms ‘ribonucleoside’ and ‘deoxyribonucleoside’, or ‘ribose’ and ‘deoxyribose’ are as used in the art.

[0076] The term ’hyperconjugation' refers to a stabilizing interaction in structural chemistry that arises from the delocalization of electrons in o-bonds (typically C-H or C-C) into adjacent empty or partially filled p-orbitals, TT-orbitals, or antibonding o* orbitals. This effect, sometimes referred to as no-bond resonance, enhances molecular stability by distributing electron density over a larger framework, reducing localized charge buildup. In alkenes, for instance, hyperconjugation occurs when the o-electrons of a p-C-H bond interact with the adjacent TT-system, leading to a more delocalized electronic structure that stabilizes the molecule. Similarly, in carbocations, hyperconjugation allows alkyl groups to donate electron density into the vacant p-orbital of the positively charged carbon, thereby lowering the overall energy of the species.

[0077] Embodiments

[0078] The present disclosure relates to an AON capable of forming a double stranded nucleic acid complex with a target transcript molecule in a cell, wherein the target transcript molecule is a pre-mRNA or mRNA transcript molecule, wherein the double stranded nucleic acid complex is capable of recruiting an endogenous ADAR enzyme that is naturally present in the cell, for deamination of a target adenosine in the target transcript molecule, wherein the nucleotide in the AON that is directly opposite the target adenosine is the orphan nucleotide, wherein the nucleotide numbering in the AON is such that the orphan nucleotide is number 0 and nucleotides are further positively (+) incremented towards the 5’ end and negatively (-) incremented towards the 3’ end, and wherein the orphan nucleotide comprises a cytosine analog nucleobase according to formula (I):P5652PC00NR1R2or any of its tautomeric forms, wherein: R1 , R2, R4 and / or R5 is H; OH; SH; =0; NH2; a halogen; a linear or branched lower (C1-C10) alkyl; or a C1-C6 cycloalkyl, wherein the alkyl and / or cycloalkyl is optionally interrupted by one or more heteroatoms; and R3 is H; OH; SH; NH2; or a halogen. In a preferred embodiment, R1, R2, R3, R4 and R5 are H. When R1, R2, R3, R4 and R5 are all H, the cytosine analog nucleobase is also referred to as 5-aza-5,6-dihydrocytosine, which is a nucleobase that is herein and elsewhere also referred to as the ’E base’ or ‘E nucleobase’. The E base and its tautomeric forms are depicted in FIG. 5 herein. A nucleotide comprising 5-aza-5,6-dihydrocytosine is often referred to as a 5-aza-5,6-dihydrocytidine, either when it is a ribonucleoside or a deoxyribonucleoside. When the nucleoside is a deoxyribonucleoside, the nucleoside can also be referred to as a 5-aza-5,6- di hydrodeoxycytidine. In a preferred embodiment, the orphan nucleotide is a deoxynucleotide.

[0079] In a preferred embodiment, the present disclosure relates to an AON capable of forming a double stranded nucleic acid complex with a target transcript molecule in a cell, wherein the target transcript molecule is a pre-mRNA or mRNA transcript molecule, wherein the double stranded nucleic acid complex is capable of recruiting an endogenous ADAR enzyme that is naturally present in the cell, for deamination of a target adenosine in the target transcript molecule, wherein the nucleotide in the AON that is directly opposite the target adenosine is the orphan nucleotide, wherein the orphan nucleotide mismatches with the target adenosine, wherein the sequence in the AON outside the orphan position is approximately 80% to 100%, preferably approximately 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 100% complementary to the target transcript molecule ( / .e., except for the orphan nucleotide - target adenosine mismatch), wherein the nucleotide numbering in the AON is such that the orphan nucleotide is number 0 and nucleotides are further positively (+) incremented towards the 5’ end and negatively (-) incremented towards the 3’ end, and wherein the orphan nucleotide comprises a cytosine analog nucleobase according to formula (II):or any of its tautomeric forms.P5652PC00

[0080] In a preferred embodiment, the orphan nucleotide is a deoxynucleotide or a 2’-F nucleotide.

[0081] In some aspects, the orphan nucleotide is: a FANA nucleotide; a 2’-OMe modified nucleotide; or a 2’-MOE modified nucleotide. In a preferred embodiment, the nucleotide at position -1 in the AON is a deoxynucleotide or a FANA nucleotide. In a preferred embodiment, the nucleotide at position +1 in the AON is a deoxynucleotide or a FANA nucleotide. Deoxynucleotides are often referred to as ‘DNA’ or ‘DNA nucleotides’ because of the presence of an -H moiety at the 2’ position in the ribosyl sugar moiety. In nature ADAR deaminates adenosines to inosines when complexed with double stranded RNA, such as pre-mRNA or mRNA. However, in certain preferred embodiments the AON comprises one or more deoxynucleotides, which are often referred to as ‘DNA’, and which DNA moiety can therefore be seen as a modification of RNA in this context. In a preferred embodiment, the orphan nucleotide comprises a 5-aza-5,6-dihydrocytosine nucleobase, or any of its tautomeric forms, and wherein the orphan nucleotide is a deoxynucleotide. The orphan nucleotide may then also be referred to as a 5-aza-5,6-dihydrodeoxycytidine.

[0082] In one aspect, the internucleoside linkage numbering in the AON is such that linkage number 0 is the linkage 5’ from the orphan nucleotide, and the linkage positions in the oligonucleotide are positively (+) incremented towards the 5’ end and negatively (-) incremented towards the 3’ end, and wherein the AON comprises one or more modifications in the linkage moiety, which is each independently selected from the group consisting of: phosphorothioate (PS), phosphonoacetate, phosphorodithioate, methylphosphonate (MP, or MeP), sulfonylphosphoramidate, (1,3-dimethylimidazolidin-2-ylidene) phosphoramidate (PNdmi), and mesyl phosphoramidate (PNms). In a preferred embodiment, linkage position -2 is a MP linkage or a PNms linkage. In another preferred embodiment, the linkage between the most terminal two nucleotides on the 5’ and / or 3’ terminus of the AON is a PNdmi linkage or a PNms linkage.

[0083] In one aspect, the AON comprises one or more nucleotides comprising a mono- or disubstitution at the 2', 3' and / or 5' position of the ribose, each independently selected from the group consisting of: -OH; -F; substituted or unsubstituted, linear or branched lower (C1-C10) alkyl, alkenyl, alkynyl, alkaryl, allyl, or aralkyl, that may be interrupted by one or more heteroatoms; -O-, S-, or N-alkyl; -O-, S-, or N-alkenyl; -O-, S-, or N-alkynyl; -O-, S-, or N-allyl; - O-alkyl-O-alkyl; -methoxy; -aminopropoxy; -methoxyethoxy; -dimethylamino oxyethoxy; and - dimethylaminoethoxyethoxy.

[0084] In one aspect, the AON comprises at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 nucleotides, and is at most 100 nucleotides long, preferably at most 60 nucleotides long.

[0085] The present disclosure also relates to a pharmaceutical composition comprising an AON as disclosed herein, and a pharmaceutically acceptable carrier or diluent. Such pharmaceutically acceptable carriers or diluents are well known to the person skilled in the art.P5652PC00

[0086] In one aspect, the present disclosure relates to an AON as disclosed herein, or a pharmaceutical composition as disclosed herein, for use in the treatment of a disorder that can be treated by a deamination of a target adenosine in a target nucleic acid molecule, preferably wherein the disorder is selected from the group consisting of: Hurler Syndrome {e.g., to repair a c.1205G>A premature termination codon mutation in the human IDUA transcript), alpha-1- antitrypsin (A1AT) deficiency {e.g., to repair a c.1096G>A mutation in the human SERPINA1 transcript), Parkinson’s disease e.g., to repair a c.6055G>A mutation in the human LRRK2 transcript), Alzheimer’s disease (AD), hypercholesterolemia {e.g., to target the C.455A site in the human PCSK9 transcript to generate a loss of function in the encoded protein), a cardiovascular disease (CVD) {e.g., to target the C.1055A site in the human B4GALT1 transcript to generate a loss of function of the B4GALT1 protein, to target the C.187A site in the human ANGPTL3 transcript to generate a loss of function of the ANGPTL3 protein, or to target the C.823A site in the human ALG12 transcript to generate a loss of function of the ALG12 protein), a liver disease or a cholestatic disease {e.g., to target the C.203A site in the human SLC10A1 transcript to generate a Q68R loss of function of the encoded NTCP protein, or to target the C.442A site in the human PNPLA3 transcript to repair the I148M protein variant to a wild type version), obesity {e.g., to target the C.949A site in the human MC4R transcript to generate a gain of function variant of the MC4R protein), galactosemia {e.g., to target the C.557A site in the human GALK1 transcript to generate a loss of function of the GALK1 protein), ALDH2 deficiency (e.g., to repair the c.1510G>A mutation in the human ALDH2 transcript), Huntington’s disease (HD) {e.g., to target the C.1715A or the C.1757A site in the human HTT transcript to generate a loss of function of the encoded HTT protein), Stargardt Disease {e.g., to repair the c.5882G>A mutation in the human ABCA4 transcript), Usher syndrome {e.g., to repair the c.11864G>A mutation in the human USH2A transcript), a nervous system disorder, and cancer.

[0087] In one aspect, the present disclosure relates to a method of treating a human subject suffering from Hurler Syndrome {e.g., to repair a c.1205G>A premature termination codon mutation in the human IDUA transcript), alpha-1-antitrypsin (A1AT) deficiency {e.g., to repair a c.1096G>A mutation in the human SERPINA1 transcript), Parkinson’s disease {e.g., to repair a c.6055G>A mutation in the human LRRK2 transcript), Alzheimer’s disease (AD), hypercholesterolemia {e.g., to target the C.455A site in the human PCSK9 transcript to generate a loss of function in the encoded protein), a cardiovascular disease (CVD) {e.g., to target the C.1055A site in the human B4GALT1 transcript to generate a loss of function of the B4GALT1 protein, to target the C.187A site in the human ANGPTL3 transcript to generate a loss of function of the ANGPTL3 protein, or to target the C.823A site in the human ALG12 transcript to generate a loss of function of the ALG12 protein), a liver disease or a cholestatic disease {e.g., to target the C.203A site in the human SLC10A1 transcript to generate a Q68R loss of function of the encoded NTCP protein, or to target the C.442A site in the human PNPLA3 transcript to repair the I148M protein variant to a wild type version), obesity {e.g., to target the C.949A site in theP5652PC00human MC4R transcript to generate a gain of function variant of the MC4R protein), galactosemia {e.g., to target the C.557A site in the human GALK1 transcript to generate a loss of function of the GALK1 protein), ALDH2 deficiency (e.g., to repair the c.1510G>A mutation in the human ALDH2 transcript), Huntington’s disease (HD) {e.g., to target the C.1715A or the C.1757A site in the human HTT transcript to generate a loss of function of the encoded HTT protein), Stargardt Disease e.g., to repair the c.5882G>A mutation in the human ABCA4 transcript), Usher syndrome {e.g., to repair the c.11864G>A mutation in the human USH2A transcript), a nervous system disorder, or cancer, said method comprising the step of administering to said subject an AON as disclosed herein.

[0088] In one aspect, the present disclosure relates to a method for the deamination of at least one target adenosine present in a target transcript molecule in a cell, the method comprising the steps of: (i) providing the cell with an AON as disclosed herein; (ii) allowing annealing of the AON to the target transcript molecule to form a double stranded nucleic acid complex capable of recruiting an endogenous ADAR enzyme that is naturally present in the cell; (iii) allowing the ADAR enzyme to deaminate the target adenosine in the target transcript molecule; and (iv) optionally identifying the presence of the deaminated adenosine in the target transcript molecule.

[0089] The present disclosure also relates to a method for the deamination of at least one target adenosine present in a target transcript molecule, the method comprising the steps of: i) providing an AON as disclosed herein; ii) allowing annealing of the AON to the target transcript molecule to form a double stranded nucleic acid complex; iii) allowing a mammalian ADAR enzyme to deaminate the target adenosine in the target transcript molecule; and iv) optionally identifying the presence of the deaminated adenosine in the target transcript molecule.

[0090] As outlined herein, an AON as disclosed herein makes use of specific nucleotide modifications at predefined spots to ensure stability as well as proper ADAR binding and activity. These changes may vary and may include modifications in the backbone of the AON, in the sugar moiety of the nucleotides as well as in the nucleobases or the phosphodiester linkages, as outlined in detail herein. They may also be variably distributed throughout the sequence of the AON. Specific modifications may be needed to support interactions of different amino acid residues within the RNA-binding domains of ADAR enzymes, as well as those in the deaminase domain. For example, PS linkages between nucleotides or2’-OMe or2’-MOE modifications may be tolerated in some parts of the AON, while in other parts they should be avoided so as not to disrupt crucial interactions of the enzyme with the phosphate and 2’-OH groups. Specific nucleotide modifications may also be necessary to enhance the editing activity on substrate RNAs where the target sequence is not optimal for ADAR editing. Previous work has established that certain sequence contexts are more amenable to editing. For example, a target sequence 5’-UAG-3’ (with the target A in the middle) contains the preferred nearest-neighbour nucleotides for ADAR2, whereas a 5’-CAA-3’ target sequence is disfavoured (Schneider et al.P5652PC00Nucleic Acids Res 2014, 42(10):e87). The structural analysis of ADAR2 deaminase domain hints at the possibility of enhancing editing by careful selection of the nucleotides that are opposite to the target trinucleotide. For example, the 5’-CAA-3’ target sequence, paired to a 3’- GCll-5’ sequence on the opposing strand (with the A-C mismatch formed in the middle), is disfavoured because the guanosine base sterically clashes with an amino acid side chain of ADAR2. The guanosine opposite the C in such circumstances is preferably replaced by an inosine (hence, at the -1 position within the AON), preferably a deoxynucleotide carrying a hypoxanthine nucleobase (Id).

[0091] The double stranded AON / target RNA molecule complex interacts through Watson-Crick base-pairing. The skilled person is able, based on the teaching available in the art, to determine the level of capability to achieve RNA editing and compare this to an AON lacking specific sugar- and / or linkage modifications specified positions.

[0092] The length of the AON may vary depending on the structures that are present (hairpin- structured AONs are generally longer, but when no hairpin structure is present, the AON may be relatively ‘short’, preferably comprising 15 to 25 nucleotides). The AON of the present invention does not necessarily carry a recruiting portion (a stem-loop structure) to attract ADAR, but it is not excluded. In any case, the cytosine analogs as outlined herein may be applied in a variety of different RNA editing AONs. Also, preferably, the AON is shorter than 100 nucleotides, more preferably shorter than 60 nucleotides.

[0093] The mammalian enzyme with nucleotide deaminase activity that is engaged through the use of the AON as disclosed herein is preferably an adenosine deaminase enzyme, more preferably ADAR2, even more preferably an endogenous ADAR2 enzyme that is naturally present in the cell, and is capable of altering the target nucleotide in the target RNA molecule, which target nucleotide is then preferably an adenosine that is deaminated to an inosine.

[0094] In another embodiment, the present disclosure relates to a method of treating a subject, preferably a human subject in need thereof, wherein the subject suffers from a genetic disorder caused by a mutation involving the appearance of an adenosine (for instance in a premature termination codon), and in which deamination of the target adenosine to an inosine would alleviate, prevent, or ameliorate the disease, comprising the steps of administering to the subject an AON or pharmaceutical composition as disclosed herein, allowing the formation of a double stranded nucleic acid complex of the AON with its specific complementary target nucleic acid in a cell in the subject; allowing the engagement of an endogenous present ADAR enzyme; and allowing the enzyme to deaminate the target adenosine in the target nucleic target molecule to an inosine, thereby alleviating, preventing or ameliorating the genetic disease. The genetic diseases that may be treated according to this method are preferably but not limited to the genetic diseases listed herein (see above).

[0095] Int. Patent Application Publication No. W02020 / 157008 discloses AONs for RNA editing for the treatment of Usher syndrome, wherein the target RNA molecule is a human USH2A pre-P5652PC00mRNA and / or mRNA molecule. In a preferred embodiment therein, the target adenosine is part of a premature stop codon caused by the c.11864G>A mutation in exon 61 of the USH2A gene. The present disclosure therefore also relates to an AON for the deamination of a target adenosine in the human USH2A pre-mRNA and / or mRNA in a cell, wherein the double stranded nucleic acid complex that is formed between the AON and the target RNA molecule is capable of recruiting an endogenous ADAR enzyme that is naturally present in the cell, wherein the nucleotide in the AON that is directly opposite the target adenosine is the orphan nucleotide, wherein the orphan nucleotide comprises a cytosine analog nucleobase according to formula (I) or any of its tautomeric forms, wherein: R1, R2, R4 and / or R5 is H; OH; SH; =0; NH2; a halogen; a linear or branched lower (C1-C10) alkyl; or a C1-C6 cycloalkyl, wherein the alkyl and / or cycloalkyl is optionally interrupted by one or more heteroatoms; and R3 is H; OH; SH; NH2; or a halogen. In a preferred embodiment, R1, R2, R3, R4 and R5 are H. In a preferred embodiment of the present disclosure the target adenosine that is targeted by an AON as disclosed herein, is part of a premature stop codon caused by the c.11864G>A mutation in exon 61 of the human USH2A pre-mRNA and / or mRNA.

[0096] Int. Patent Application Publication No. W02021 / 130313 discloses AONs for RNA editing for the treatment of Stargardt disease, wherein the target RNA molecule is a human ABCA4 pre-mRNA and / or mRNA molecule. In a preferred embodiment therein, the target adenosine is any one of the G>A mutations as provided in Table 1 in Int. Patent Application Publication No. W02021 / 130313, preferably the adenosine represented by the c.5882G>A mutation in exon 42 of the human ABCA4 gene. The present disclosure therefore also relates to an AON for the deamination of a target adenosine in the human ABCA4 pre-mRNA and / or mRNA in a cell, wherein the double stranded nucleic acid complex that is formed between the AON and the target RNA molecule is capable of recruiting an endogenous ADAR enzyme that is naturally present in the cell, wherein the nucleotide in the AON that is directly opposite the target adenosine is the orphan nucleotide, wherein the orphan nucleotide comprises a cytosine analog nucleobase according to formula (I) or any of its tautomeric forms, wherein: R1, R2, R4 and / or R5 is H; OH; SH; =0; NH2; a halogen; a linear or branched lower (C1-C10) alkyl; or a C1-C6 cycloalkyl, wherein the alkyl and / or cycloalkyl is optionally interrupted by one or more heteroatoms; and R3 is H; OH; SH; NH2; ora halogen. In a preferred embodiment, R1, R2, R3, R4 and R5 are H. In a preferred embodiment of the present disclosure the target adenosine that is targeted by an AON as disclosed herein, is the c.5882G>A mutation in the human ABCA4 pre-mRNA and / or mRNA.

[0097] Int. Patent Application Publication No. WO2023 / 152371 discloses AONs for RNA editing for the treatment of hypercholesterolemia, wherein the target RNA molecule is a human PCSK9 pre-mRNA and / or mRNA molecule to decrease or prevent the ability of the encoded PCSK9 proprotein from being processed by auto-cleavage of a proteolytic cleavage site. In a preferred embodiment therein, the target adenosine is the second nucleotide of the codon coding forP5652PC00glutamine at position 152 in the PCSK9 proprotein. The present disclosure therefore also relates to an AON for the deamination of a target adenosine in the human PCSK9 pre-mRNA and / or mRNA in a cell, wherein the double stranded nucleic acid complex that is formed between the AON and the target RNA molecule is capable of recruiting an endogenous ADAR enzyme that is naturally present in the cell, wherein the nucleotide in the AON that is directly opposite the target adenosine is the orphan nucleotide, wherein the orphan nucleotide comprises a cytosine analog nucleobase according to formula (I) or any of its tautomeric forms, wherein: R1 , R2, R4 and / or R5 is H; OH; SH; =0; NH2; a halogen; a linear or branched lower (C1-C10) alkyl; or a C1-C6 cycloalkyl, wherein the alkyl and / or cycloalkyl is optionally interrupted by one or more heteroatoms; and R3 is H; OH; SH; NH2; ora halogen. In a preferred embodiment, R1, R2, R3, R4 and R5 are H. In a preferred embodiment of the present disclosure the target adenosine that is targeted by an AON as disclosed herein, is the second nucleotide of the codon coding for glutamine at position 152 in the PCSK9 proprotein.

[0098] Int. Patent Application Publication No. WO2024 / 121373 discloses AONs for RNA editing for the treatment of cardiovascular disease, wherein the target RNA molecule is a human B4GALT1 pre-mRNA and / or mRNA molecule. In a preferred embodiment therein, the target adenosine is at a position in the B4GALT1 transcript where a guanosine would encode a B4GALT1 protein variant that has a reduced enzymatic turnover rate. In a further preferred embodiment therein, the target adenosine is at position C.1055A in the human B4GALT1 transcript, and wherein the deamination results in a change from asparagine (N; Asn) to serine (S; Ser) at position 352 in the human wildtype B4GALT1 amino acid sequence. The present disclosure therefore also relates to an AON for the deamination of a target adenosine in the human B4GALT1 pre-mRNA and / or mRNA in a cell, wherein the double stranded nucleic acid complex that is formed between the AON and the target RNA molecule is capable of recruiting an endogenous ADAR enzyme that is naturally present in the cell, wherein the nucleotide in the AON that is directly opposite the target adenosine is the orphan nucleotide, wherein the orphan nucleotide comprises a cytosine analog nucleobase according to formula (I) or any of its tautomeric forms, wherein: R1, R2, R4 and / or R5 is H; OH; SH; =0; NH2; a halogen; a linear or branched lower (C1 -C10) alkyl; or a C1 -06 cycloalkyl, wherein the alkyl and / or cycloalkyl is optionally interrupted by one or more heteroatoms; and R3 is H; OH; SH; NH2; or a halogen. In a preferred embodiment, R1, R2, R3, R4 and R5 are H. In a preferred embodiment of the present disclosure the target adenosine that is targeted by an AON as disclosed herein, is at a position in the B4GALT1 transcript where a guanosine would encode a B4GALT1 protein variant that has a reduced enzymatic turnover rate. In an even more preferred embodiment of the present disclosure the target adenosine that is targeted by an AON as disclosed herein, is at position C.1055A in the human B4GALT1 transcript, and wherein the deamination results in a change from asparagine to serine at position 352 in the human wildtype B4GALT1 amino acid sequence.P5652PC00

[0099] Int. Patent Application Publication No. WO2024 / 115635 discloses AONs for RNA editing for the treatment of aldehyde dehydrogenase 2 deficiency, wherein the target RNA molecule is a human ALDH2 pre-mRNA and / or mRNA molecule. In a preferred embodiment therein, the target adenosine is the c.1510G>A mutation in the ALDH2 transcript. The present disclosure therefore also relates to an AON for the deamination of a target adenosine in the human ALDH2 pre-mRNA and / or mRNA in a cell, wherein the double stranded nucleic acid complex that is formed between the AON and the target RNA molecule is capable of recruiting an endogenous ADAR enzyme that is naturally present in the cell, wherein the nucleotide in the AON that is directly opposite the target adenosine is the orphan nucleotide, wherein the orphan nucleotide comprises a cytosine analog nucleobase according to formula (I) or any of its tautomeric forms, wherein: R1, R2, R4 and / or R5 is H; OH; SH; =0; NH2; a halogen; a linear or branched lower (C1-C10) alkyl; or a C1-C6 cycloalkyl, wherein the alkyl and / or cycloalkyl is optionally interrupted by one or more heteroatoms; and R3 is H; OH; SH; NH2; or a halogen. In a preferred embodiment, R1, R2, R3, R4 and R5 are H. In a preferred embodiment of the present disclosure the target adenosine is the c.1510G>A mutation in the human ALDH2 transcript.

[0100] Int. Patent Application Publication No. WO2024 / 175550 discloses AONs for RNA editing for the treatment of atherosclerotic OVD, wherein the target RNA molecule is a human ANGPTL3 pre-mRNA and / or mRNA molecule. In a preferred embodiment therein, the target adenosine is present in a codon encoding an amino acid involved in the lipase inhibition functionality of the ANGPTL3 protein, and wherein the deamination of the target adenosine into an inosine results in an ANGPTL3 protein that is impaired in its lipase inhibitory function. Preferably, the target adenosine is the first nucleotide in the codon encoding lysine at position 63 in the human ANGPTL3 protein. The present disclosure therefore also relates to an AON for the deamination of a target adenosine in the human ANGPTL3 pre-mRNA and / or mRNA in a cell, wherein the double stranded nucleic acid complex that is formed between the AON and the target RNA molecule is capable of recruiting an endogenous ADAR enzyme that is naturally present in the cell, wherein the nucleotide in the AON that is directly opposite the target adenosine is the orphan nucleotide, wherein the orphan nucleotide comprises a cytosine analog nucleobase according to formula (I) or any of its tautomeric forms, wherein: R1, R2, R4 and / or R5 is H; OH; SH; =0; NH2; a halogen; a linear or branched lower (C1-C10) alkyl; or a C1-C6 cycloalkyl, wherein the alkyl and / or cycloalkyl is optionally interrupted by one or more heteroatoms; and R3 is H; OH; SH; NH2; ora halogen. In a preferred embodiment, R1, R2, R3, R4 and R5 are H. In a preferred embodiment of the present disclosure the target adenosine is present in a codon encoding an amino acid involved in the lipase inhibition functionality of the ANGPTL3 protein, and wherein the deamination of the target adenosine into an inosine results in an ANGPTL3 protein that is impaired in its lipase inhibitory function. Even more preferably, the target adenosine is the first nucleotide in the codon encoding lysine at position 63 in the human ANGPTL3 protein.P5652PC00

[0101] Int. Patent Application Publication No. W02024 / 200472 discloses AONs for RNA editing for the treatment of a disease caused by bile accumulation in the liver, such as cholestasis, primary sclerosing cholangitis (PSC), biliary atresia (BA), and liver cirrhosis, wherein the target RNA molecule is the human SLC10A1 transcript encoding the Na+ / Taurocholate Cotransporting Polypeptide (NTCP). In a preferred embodiment therein, the target adenosine is selected from the group consisting of: i) the adenosine in the CAG codon coding for glutamine (Q) at position 68 of the NTCP protein, and wherein the deamination of the adenosine changes the amino acid to an arginine (R); ii) the first adenosine in the CAA codon coding for glutamine (Q) at position 261 of the NTCP protein, and wherein the deamination of the adenosine changes the amino acid to an arginine (R); iii) the adenosine in the GAG codon coding for glutamic acid (E) at position 257 of the NTCP protein, and wherein the deamination of the adenosine changes the amino acid to glycine (G); and iv) the first adenosine in the AAG codon coding for lysine (K) at position 314 of the NTCP protein, and wherein the deamination of the adenosine changes the amino acid to glutamic acid (E), wherein the deamination of the target adenosine results in an NTCP protein that is impaired in its function to transport bile acids from portal circulation into the cell. The present disclosure therefore also relates to an AON for the deamination of a target adenosine in the human SLC10A1 pre-mRNA and / or mRNA in a cell, wherein the double stranded nucleic acid complex that is formed between the AON and the target RNA molecule is capable of recruiting an endogenous ADAR enzyme that is naturally present in the cell, wherein the nucleotide in the AON that is directly opposite the target adenosine is the orphan nucleotide, wherein the orphan nucleotide comprises a cytosine analog nucleobase according to formula (I) or any of its tautomeric forms, wherein: R1, R2, R4 and / or R5 is H; OH; SH; =0; NH2; a halogen; a linear or branched lower (C1-C10) alkyl; or a C1-C6 cycloalkyl, wherein the alkyl and / or cycloalkyl is optionally interrupted by one or more heteroatoms; and R3 is H; OH; SH; NH2; or a halogen. In a preferred embodiment, R1, R2, R3, R4 and R5 are H. In a preferred embodiment of the present disclosure the target adenosine is selected from the group consisting of: i) the adenosine in the CAG codon coding for glutamine (Q) at position 68 of the NTCP protein, and wherein the deamination of the adenosine changes the amino acid to an arginine (R); ii) the first adenosine in the CAA codon coding for glutamine (Q) at position 261 of the NTCP protein, and wherein the deamination of the adenosine changes the amino acid to an arginine (R); iii) the adenosine in the GAG codon coding for glutamic acid (E) at position 257 of the NTCP protein, and wherein the deamination of the adenosine changes the amino acid to glycine (G); and iv) the first adenosine in the AAG codon coding for lysine (K) at position 314 of the NTCP protein, and wherein the deamination of the adenosine changes the amino acid to glutamic acid (E).

[0102] Int. Patent Application Publication No. WO2025 / 051946 discloses AONs for RNA editing for the treatment of a metabolic disorder such as obesity, and diseases that may follow obesity, such as type II diabetes and coronary artery disease, wherein the target RNA molecule is theP5652PC00human MC4R transcript encoding the MC4R protein. In a preferred embodiment therein, the target adenosine is the adenosine in the AUC codon coding for an isoleucine (I) residue at position 317 of the MC4R protein, and wherein the deamination of the adenosine results in an inosine that translates the codon to a valine (V) residue at position 317, and wherein the deamination of the target adenosine results in an MC4R protein that has a gain-of-function in comparison to the wildtype MC4R protein. The present disclosure therefore also relates to an AON for the deamination of a target adenosine in the human MC4R pre-mRNA and / or mRNA in a cell, wherein the double stranded nucleic acid complex that is formed between the AON and the target RNA molecule is capable of recruiting an endogenous ADAR enzyme that is naturally present in the cell, wherein the nucleotide in the AON that is directly opposite the target adenosine is the orphan nucleotide, wherein the orphan nucleotide comprises a cytosine analog nucleobase according to formula (I) or any of its tautomeric forms, wherein: R1, R2, R4 and / or R5 is H; OH; SH; =0; NH2; a halogen; a linear or branched lower (C1-C10) alkyl; or a C1-C6 cycloalkyl, wherein the alkyl and / or cycloalkyl is optionally interrupted by one or more heteroatoms; and R3 is H; OH; SH; NH2; ora halogen. In a preferred embodiment, R1, R2, R3, R4 and R5 are H. In a preferred embodiment of the present disclosure the target adenosine is the adenosine in the AUC codon coding for an isoleucine (I) residue at position 317 of the MC4R protein, and wherein the deamination of the adenosine results in an inosine that translates the codon to a valine (V) residue at position 317.

[0103] Int. Patent Application Publication No. WO2025 / 104239 discloses AONs for RNA editing for the treatment of classic galactosemia, wherein the target RNA molecule is a human GALK1 pre-mRNA and / or mRNA molecule. In a preferred embodiment therein, the target adenosine is the adenosine in the GAC codon coding for an aspartic acid (D) residue at position 186 of the GALK1 protein, and wherein the deamination of the adenosine results in an inosine that translates the codon to a glycine (G) residue at position 186, and wherein the deamination of the target adenosine results in a GALK1 protein that has a diminished, lowered, or absent ability to phosphorylate galactose. The present disclosure therefore also relates to an AON for the deamination of a target adenosine in the human GALK1 pre-mRNA and / or mRNA in a cell, wherein the double stranded nucleic acid complex that is formed between the AON and the target RNA molecule is capable of recruiting an endogenous ADAR enzyme that is naturally present in the cell, wherein the nucleotide in the AON that is directly opposite the target adenosine is the orphan nucleotide, wherein the orphan nucleotide comprises a cytosine analog nucleobase according to formula (I) or any of its tautomeric forms, wherein: R1, R2, R4 and / or R5 is H; OH; SH; =0; NH2; a halogen; a linear or branched lower (C1-C10) alkyl; or a C1-C6 cycloalkyl, wherein the alkyl and / or cycloalkyl is optionally interrupted by one or more heteroatoms; and R3 is H; OH; SH; NH2; ora halogen. In a preferred embodiment, R1, R2, R3, R4 and R5 are H. In a preferred embodiment of the present disclosure the target adenosine is the adenosine in the GAC codon coding for an aspartic acid (D) residue at position 186 of theP5652PC00GALK1 protein, and wherein the deamination of the adenosine results in an inosine that translates the codon to a glycine (G) residue at position 186.

[0104] Int. Patent Application Publication No. WO2025 / 132708 discloses AONs for RNA editing for the treatment of Huntington’s disease, wherein the target RNA molecule is a human HTT pre-mRNA and / or mRNA molecule that encodes the Huntingtin (HTT) protein. In preferred embodiments therein, the target adenosine is in the GAU codon coding for aspartic acid at position 572 that is part of a caspase-1 proteolytic cleavage site in the HTT protein, or wherein the target adenosine is in the GAC codon coding for aspartic acid at position 586 that is part of a caspase-6 proteolytic cleavage site in the HTT protein. The present disclosure therefore also relates to an AON for the deamination of a target adenosine in the human HTT pre-mRNA and / or mRNA in a cell, wherein the double stranded nucleic acid complex that is formed between the AON and the target RNA molecule is capable of recruiting an endogenous ADAR enzyme that is naturally present in the cell, wherein the nucleotide in the AON that is directly opposite the target adenosine is the orphan nucleotide, wherein the orphan nucleotide comprises a cytosine analog nucleobase according to formula (I) or any of its tautomeric forms, wherein: R1, R2, R4 and / or R5 is H; OH; SH; =0; NH2; a halogen; a linear or branched lower (C1-C10) alkyl; or a C1-C6 cycloalkyl, wherein the alkyl and / or cycloalkyl is optionally interrupted by one or more heteroatoms; and R3 is H; OH; SH; NH2; or a halogen. In a preferred embodiment, R1, R2, R3, R4 and R5 are H. In a preferred embodiment of the present disclosure the target adenosine is in the GAU codon coding for aspartic acid at position 572 that is part of a caspase-1 proteolytic cleavage site in the HTT protein. In yet another preferred embodiment of the present disclosure the target adenosine is in the GAC codon coding for aspartic acid at position 586 that is part of a caspase-6 proteolytic cleavage site in the HTT protein.

[0105] Chemical modifications

[0106] Various chemistries and modifications are known in the field of oligonucleotides that can be readily used in accordance with the invention. All chemical modifications listed herein that may be used in the AON as disclosed herein may also be used for a sense strand that is complementary to the AON, when the AON and the complementary strand form a HEON complex, such as described in Int. Patent Application Publication No. W02024 / 084048, except that the opposite sense strand does not have an orphan nucleotide. Hence, the modification related to the orphan nucleotide relate only to the AON as disclosed herein, but all other modifications relate to the AON as disclosed herein and any (protecting) sense oligonucleotide that may be used together with the AON in a pharmaceutical product. This includes the use of hydrophobic moieties (such as tocopherol and cholesterol) and cell-specific ligands (such as GalNAc moieties), that have also been described herein, and in detail in Int. Patent Application Publication No. W02024 / 084048, which may either be bound to the AON or its opposite strand, or both. Preferred GalNAc moieties that can be used in the context of the AONs as disclosedP5652PC00herein are disclosed herein and exemplified in Int. Patent Application Publication No. WO2022 / 271806.

[0107] The skilled person knows that an oligonucleotide, such as an AON as outlined herein, generally consists of repeating monomers. Such a monomer is most often a nucleotide or a chemically modified nucleotide. The most common naturally occurring nucleotides in RNA are adenosine monophosphate (A), cytidine monophosphate (C), guanosine monophosphate (G), and uridine monophosphate (II). These consist of a pentose sugar, a ribose, a 5’-linked phosphate group which is linked via a phosphate ester, and a T-linked base. The sugar connects the base and the phosphate and is therefore often referred to as the “scaffold” of the nucleotide. A modification in the pentose sugar is therefore often referred to as a ‘scaffold modification’. The original pentose sugar may be replaced in its entirety by another moiety that similarly connects the base and the phosphate. It is therefore understood that while a pentose sugar is often a scaffold, a scaffold is not necessarily a pentose sugar. Examples of scaffold modifications that may be applied in the monomers of the AON as disclosed herein are disclosed in Int. Patent Application Publication Nos. W02020 / 154342, W02020 / 154343, and W02020 / 154344.

[0108] A nucleoside in the AON as disclosed herein may be a natural nucleoside (deoxyribonucleoside or ribonucleoside) or a non-natural nucleoside. It is noted that for RNA editing, in which double-stranded RNA is generally the substrate for enzymes with deamination activity (such as ADARs), ribonucleosides are considered ‘natural’, while deoxyribonucleosides may then be, for the sake of argument, considered as non-natural, or modified, simply because DNA is not present in the RNA-RNA double stranded (natural) substrate configurations. The skilled person appreciates that when the nucleotide has a natural ribose moiety, it may still be non-naturally modified in the base and / or the linkage.

[0109] It is recognized in the art that common limiting factors in oligonucleotide-based therapies are the oligonucleotide’s ability to be taken up by the cell (when delivered per se, or ‘naked’ without applying a delivery vehicle such as a viral vector or plasmid), the biodistribution and the resistance to nuclease-mediated breakdown. The skilled person is aware, and it has been described in detail in the art, that a variety of chemical modifications can assist in overcoming such limitations. Examples of such now commonly used chemical modifications are the 2’-OMe, 2’-F and 2’-MOE modifications of the sugar and the use of PS linkages between nucleosides, as described herein.

[0110] Scaffold modifications (ribose)

[0111] The ribose 2’ groups in all nucleotides of the AON as disclosed herein, except for the ribose sugar moiety of the orphan nucleotide that has certain limitations in respect of compatibility with RNA editing, can be independently selected from 2’-H (i.e., DNA), 2’-OH (i.e., RNA), 2’-OMe, 2’-MOE, 2’-F, or 2’-4’-linked (for instance a locked nucleic acid (LNA)), or otherP5652PC00ribosyl T-substitutions, 2’ substitutions, 3’ substitutions, 4’ substitutions or 5’ substitutions. The orphan nucleotide may carry a 2’-F, a 2’,2’-difluoro (diF), or2’-ara-F (FANA) substitution or may be DNA. Int. Patent Application Publication No. W02024 / 013360 discloses the modification of the 2’ position of the ribose sugar moiety of the orphan nucleotide by a 2’,2’-disubstituted substitution such as diF, which is also applicable to what is disclosed here. The 2’-4’ linkage can be selected from many linkers known in the art, such as a methylene linker, amide linker, or constrained ethyl linker (cEt).

[0112] An AON as disclosed herein may comprise one or more nucleotides carrying a 2’-MOE ribose modification. Also, an AON as disclosed herein may comprise one or more nucleotides not carrying a 2’-MOE ribose modification, or wherein the 2’-MOE ribose modifications are at positions that do not prevent the enzyme with adenosine deaminase activity from deaminating the target adenosine. An AON as disclosed herein may comprise a 2’-OMe ribose modification at a position that does not comprise a 2’-MOE ribose modification. An AON as disclosed herein may comprise deoxynucleotides at positions that do not comprise a 2’-MOE or a 2’-OMe ribose modification, or other 2’ ribose substitution. An AON as disclosed herein may comprise one or more nucleotides comprising a 2’ substitution comprising a 2’-MOE, 2’-OMe, 2’-OH, 2’-deoxy, TNA, 2’-fluoro (2’-F), 2’,2’-difluoro (diF) modification, 2’-fluoro-2’-C-methyl modification, or a 2’- 4’-linkage ( / .e., a bridged nucleic acid such as a locked nucleic acid (LNA or examples mentioned in e.g., Int. Patent Application Publication No. WO2018 / 007475)). Other nucleic acid monomers that may be used in an AON as disclosed herein are arabinonucleic acids and 2’- deoxy-2’-fluoroarabinonucleic acid (FANA), for instance for improved affinity purposes. The 2’- 4’ linkage can be selected from linkers known in the art, such as a methylene linker or constrained ethyl linker. A wide variety of 2’ modifications that may present in an AON as disclosed herein are known in the art, including but not limited to the modifications outlined in detail in Int. Patent Application Publication Nos. WO2016 / 097212, WO2017 / 220751, WO2018 / 041973, WO2018 / 134301, WO2019 / 219581 , WO2019 / 158475, and WO2022 / 099159. In all cases, the modifications should be compatible with RNA editing such that the AON fulfils its role as an oligonucleotide that can form a double stranded complex with the target RNA molecule and by generating this double-stranded nucleic acid complex, recruit a deaminating enzyme, which can subsequently deaminate the target adenosine. Where a monomer in an AON as disclosed herein comprises an unlocked nucleic acid (UNA) ribose modification, that monomer can have a 2’ position comprising the same modifications discussed above, such as a 2’-MOE, a 2’-OMe, a 2’-OH, a 2’-deoxy, a 2’-F, a 2’,2’-diF, a 2’-fluoro-2’-C- methyl, an arabinonucleic acid, a FANA, or a 2’-4’-linkage (i.e., a bridged nucleic acids such as an LNA). In an aspect, the AON as disclosed herein comprises at least one nucleotide comprising a threose nucleic acid (TNA) ribose modification. In one aspect, the AON as disclosed herein comprises at least one nucleotide with a sugar moiety that comprises a 2’- fluoro (2’-F) modification.P5652PC00

[0113] A scaffold modification indicates the presence of a modified version of the ribosyl moiety as naturally occurring in RNA (i.e., the pentose moiety), such as bicyclic sugars, tetrahydropyrans, hexoses, morpholinos, 2’-modified sugars, 4’-modified sugar, 5’-modified sugars and 4’-substituted sugars. Examples of suitable modifications include, but are not limited to 2’-O-modified RNA monomers, such as 2’-O-alkyl or 2’-O-(substituted)alkyl such as 2’-OMe, 2’-O-(2-cyanoethyl), 2’-MOE, 2’-O-(2-thiomethyl)ethyl, 2’-O-butyryl, 2’-O-propargyl, 2’-O-allyl, 2’-O-(2-aminopropyl), 2’-O-(2-(dimethylamino)propyl), 2’-O-(2-amino)ethyl, 2’-O-(2- (dimethylamino)ethyl); 2’-deoxy (DNA); 2’-O-(haloalkyl)methyl such as 2’-O-(2- chloroethoxy)methyl (MCEM), 2’-O-(2,2-dichloroethoxy)methyl (DCEM); 2’-O-alkoxycarbonyl such as 2’-O-[2-(methoxycarbonyl)ethyl] (MOCE), 2’-O-[2-N-methylcarbamoyl)ethyl] (MCE), 2’- O-[2-(N,N-dimethylcarbamoyl)ethyl] (DCME); 2’-halo e.g. 2’-F, FANA; 2'-O-[2-(methylamino)-2- oxoethyl] (NMA); a bicyclic or bridged nucleic acid (BNA) scaffold modification such as a conformationally restricted nucleotide (CRN) monomer, a locked nucleic acid (LNA) monomer, a xylo-LNA monomer, an a-LNA monomer, an a-l-LNA monomer, a p-d-LNA monomer, a 2’- amino-LNA monomer, a 2’-(alkylamino)-LNA monomer, a 2’-(acylamino)-LNA monomer, a 2’- N-substituted 2’-amino-LNA monomer, a 2’-thio-LNA monomer, a (2’-O,4’-C) constrained ethyl (cEt) BNA monomer, a (2’-O,4’-C) constrained methoxyethyl (cMOE) BNA monomer, a 2’, 4’- BNANC(NH) monomer, a 2’,4’-BNANC(NMe) monomer, a 2’,4’-BNANC(NBn) monomer, an ethylene-bridged nucleic acid (ENA) monomer, a carba-LNA (cLNA) monomer, a 3,4-dihydro- 2H-pyran nucleic acid (DpNA) monomer, a 2’-C-bridged bicyclic nucleotide (CBBN) monomer, an oxo-CBBN monomer, a heterocyclic-bridged BNA monomer (such as triazolyl or tetrazolyl- linked), an amido-bridged BNA monomer (such as AmNA), an urea-bridged BNA monomer, a sulfonamide-bridged BNA monomer, a bicyclic carbocyclic nucleotide monomer, a TriNA monomer, an a-l-TriNA monomer, a bicyclo DNA (bcDNA) monomer, an F-bcDNA monomer, a tricyclo DNA (tcDNA) monomer, an F-tcDNA monomer, an alpha anomeric bicyclo DNA (abcDNA) monomer, an oxetane nucleotide monomer, a locked PMO monomer derived from 2’-amino LNA, a guanidine-bridged nucleic acid (GuNA) monomer, a spirocyclopropylene- bridged nucleic acid (scpBNA) monomer, and derivatives thereof; cyclohexenyl nucleic acid (CeNA) monomer, altriol nucleic acid (ANA) monomer, hexitol nucleic acid (HNA) monomer, fluorinated HNA (F-HNA) monomer, pyranosyl-RNA (p-RNA) monomer, 3’-deoxypyranosyl DNA (p-DNA), unlocked nucleic acid UNA); an inverted version of any of the monomers above. All these modifications are known to the person skilled in the art.

[0114] Base modifications

[0115] A base, sometimes called a nucleobase, is generally adenine, cytosine, guanine, thymine, hypoxanthine, or uracil, or a derivative thereof. A nucleobase is defined as a moiety that can bond to another nucleobase through H-bonds, polarized bonds (such as through CF moieties) or aromatic electronic interactions. Cytosine, thymine, and uracil are pyrimidine bases, and areP5652PC00generally linked to the scaffold through their 1 -nitrogen. Adenine and guanine are purine bases and are generally linked to the scaffold through their 9-nitrogen. The terms ‘adenine’, ‘guanine’, ‘cytosine’, ‘thymine’, ‘uracil’ and ‘hypoxanthine’ as used herein refer to the nucleobases as such. The terms ‘adenosine’, ‘guanosine’, ‘cytidine’, ‘thymidine’, ‘uridine’ and ‘inosine’ refer to the nucleobases linked to the (deoxy)ribosyl sugar. The nucleobases, besides what has been outlined for the orphan nucleotide herein, in an AON as disclosed herein can be adenine, cytosine, guanine, thymine, hypoxanthine, or uracil or any other moiety able to interact with another nucleobase through H-bonds, polarized bonds (such as CF) or aromatic electronic interactions. The nucleobases at any position in the AON as disclosed herein, outside the orphan nucleotide, can be a modified form of adenine, cytosine, guanine, thymine, or uracil, such as hypoxanthine (the nucleobase in inosine), pseudouracil, pseudocytosine, isouracil, N3- glycosylated uracil, 1 -methylpseudouracil, orotic acid, agmatidine, lysidine, 2-thiouracil, 2- thiothymine, 5-substituted pyrimidine (e.g., 5-halouracil, 5-halomethyluracil, 5- trifluoromethyluracil, 5-propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5- hydroxym ethyl uracil, 5-formyluracil, 5-aminomethylcytosine, 5-formylcytosine), 5- hydroxymethylcytosine, 7-deazaguanine, 7-deazaadenine, 7-deaza-2,6-diaminopurine, 8-aza- 7-deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, 8-oxo-adenine, 3- deazapurine (such as a 3-deaza-adenosine), pseudoisocytosine, N4-ethylcytosine, N2- cyclopentylguanine, N2-cyclopentyl-2-aminopurine, N2-propyl-2-aminopurine, 2,6- diaminopurine, 2-aminopurine, G-clamp and its derivatives, Super A, Super T, Super G, aminomodified nucleobases or derivatives thereof; and degenerate or universal bases, like 2,6- difluorotoluene, or absent like abasic sites (e.g. 1 -deoxyribose, 1,2-dideoxyribose, 1-deoxy-2- O-methylribose, azaribose). Modified bases comprise synthetic and natural bases such as inosine, xanthine, hypoxanthine and other -aza, deaza, -hydroxy, -halo, -thio, thiol, -alkyl, - alkenyl, -alkynyl, thioalkyl derivatives of pyrimidine and purine bases that are or will be known in the art. Purine nucleobases and / or pyrimidine nucleobases may be modified to alter their properties, for example by amination or deamination of the heterocyclic rings. The exact chemistry and formats may vary from oligonucleotide construct to oligonucleotide construct and from application to application, and may be worked out in accordance with the wishes and preferences of those of skill in the art.

[0116] Linkage modifications

[0117] A nucleoside is generally connected to neighbouring nucleosides through condensation of its 5’-phosphate moiety to the 3’-hydroxyl moiety of the neighbouring nucleotide monomer. Similarly, its 3’-hydroxyl moiety is generally connected to the 5’-phosphate of a neighbouring nucleotide monomer. This forms phosphodiester bonds. The phosphodiesters and the scaffold form an alternating copolymer. The bases are grafted on this copolymer, namely to the scaffold moieties. Because of this characteristic, the alternating copolymer formed by linked scaffolds ofP5652PC00an oligonucleotide is often called the ‘backbone’ of the oligonucleotide. Because phosphodiester bonds connect neighbouring monomers together, they are often referred to as ‘backbone linkages’. It is understood that when a phosphate group is modified so that it is instead an analogous moiety such as a phosphorothioate, such a moiety is still referred to as the backbone linkage of the monomer. This is referred to as a ‘backbone linkage modification’. In general terms, the backbone of an oligonucleotide comprises alternating scaffolds and backbone linkages.

[0118] As outlined in detail herein, naked AONs as disclosed herein comprise at least one, preferably multiple linkage modifications. It is generally preferred that the AON as disclosed herein comprises linkage modifications at most, and potentially all positions if the AON can mediate RNA editing through the deamination enzyme when the AON is bound to the target RNA nucleic acid molecule. A linkage modification can be, but is not limited to, a modified version of the PO present in RNA, such as PS, chirally pure PS, (R)-PS, (S)-PS, MP (or MeP), chirally pure MP, (R)-MP, (S)-MP, phosphoryl guanidine (such as PNdmi), chirally pure phosphoryl guanidine, (R)-phosphoryl guanidine, (S)-phosphoryl guanidine, sulfonyl phosphoramidate, chirally pure sulfonyl phosphoramidate, (R)-sulfonyl phosphoramidate, (S)- sulfonyl phosphoramidate, phosphorodithioate (PS2), phosphonacetate (PACE), phosphonoacetamide (PACA), thiophosphonoacetate, thiophosphonoacetamide, methyl phosphorohioate, methyl thiophosphonate, PS prodrug, alkylated PS, H-phosphonate, ethyl phosphate, ethyl PS, boranophosphate, borano PS, metyl boranophosphate, methyl borano PS, methyl boranophosphonate, methyl boranophosphothioate, phosphate, phosphotriester, aminoalkylphosphotriester, and their derivatives. Another modification includes phosphoramidite, phosphoramidate, N3’->P5’ phosphoramidate, phosphorodiamidate, phosphorothiodiamidate, sulfamate, diethylenesulfoxide, amide, sulfonate, siloxane, sulfide, sulfone, formacetyl, alkenyl, methylenehydrazino, sulfonamide, triazole, oxalyl, carbamate, methyleneimino (MMI), and thioacetamide nucleic acid (TANA); and their derivatives. Various salts, mixed salts, deprotonated, protonated, tautomeric, and free acid forms are also included, as well as 3’->3’ and 2’->5’ linkages. An AON as disclosed herein may also comprise one or more linkage modifications according to the structure of formulas (III), (IV), (V), or (VI).

[0119] Disclosed herein is also an AON that is able to mediate adenosine deamination by recruitment of a deaminating enzyme in a cell after the AON has formed a double-stranded complex with a region of a target RNA nucleic acid molecule in a cell, wherein the region comprises a target adenosine, wherein the deaminating enzyme can deaminate the target adenosine into an inosine, and wherein the AON comprises a moiety at one and / or both termini with a structure according to formula (III):P5652PC00Y O I H> II>X^=P - N - S - RO Ox / WV' (Hl)wherein: X = 0 or S;Y = 0- or S-; andR = an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a C1-C6 alkoxy, a substituted C1-C6 alkoxy, a C1-C20 alkyl, a substituted C1-C20 alkyl, a C1-C6 alkenyl, a C1-C6 substituted alkenyl, a C1-C6 alkynyl, a substituted C1-C6 alkynyl, or a conjugate group. In a preferred embodiment, X = O and R = methyl. A preferred internucleoside linkage modification that is used in the AON as disclosed herein has the structure of formula (IV):v / VW'o o> I H> II>O^=P - N - S - CH3O Ovjxrvv' (|V)which is also referred to as a PNms linkage. PNms linkages and their application in oligonucleotides and as replacement of PS linkages has been described (Chelobanov BP et al. Russ J Bioorganic Chem. 2017. 43(6):664-668; DOI: 10.1134 / S1068162017060024; Klabenkova K et al. Molecules. 2021. 26(17):5420; Miroshnichenko SK et al. Proc Natl Acad Sci USA. 2019. 116(4): 1229- 1234), and for instance in oligonucleotides that may provide splice switching (Hammond SM et al. Nucleic Acid Ther. 31(3):190-200).

[0120] In a preferred aspect, the AON as disclosed herein comprises an internucleoside linkage of the structure of formula (IV), wherein X = O and R = CH3, which linkage is generally referred to herein as a PNms linkage. In other preferred aspects, R equals one of the following structures (a), (b), (c), (d), (e), (f), (g), (h), or (i):P5652PC00

[0121] The one or more PN linkages as depicted in formula (IV), present in an AON as disclosed herein, can be independently of each other of RP or SP chirality, or stereo random.

[0122] The one or more PN linkages as depicted in formula (IV), in an AON as disclosed herein, can be in tautomeric and / or pH-dependent (de)protonated form, including but not limited to the structures (A), (B), (C), (D), and (E):(A)o oX^=P - N^=S - R(B)P5652PC00O OHX^=P I - N^=S I - Ro I o III (D)o oHX - P I^=N - S II - Ro I o III (E)wherein X and R are as indicated above for formula (III).

[0123] An AON as disclosed herein may comprise a substitution of one of the non-bridging oxygens in the PO linkage. This modification slightly destabilizes base pairing but adds significant resistance to nuclease degradation. A preferred nucleotide analogue or equivalent comprises PS, phosphonoacetate, phosphorodithioate, phosphotriester, aminoalkylphosphotriester, H-phosphonate, methyl and other alkyl phosphonate including 3'- alkylene phosphonate, 5'-alkylene phosphonate and chiral phosphonate, phosphinate, phosphoramidate including 3'-amino phosphoramidate and aminoalkylphosphoramidate, thionophosphoramidate, thionoalkylphosphonate, thionoalkylphosphotriester, selenophosphate or boranophosphate. Particularly preferred are internucleoside linkages that are modified to contain a PS. Particularly preferred are internucleoside linkages that are modified to contain a PNms. Particularly preferred are internucleoside linkages that are modified to contain a PNdmi. The regular internucleoside linkages between the nucleotides may be altered by mono- or di- thioation of the PO bonds to yield PS esters or phosphorodithioate esters, respectively. Other modifications of the internucleoside linkages are possible, including amidation and peptide linkers. The skilled person can determine what target RNA nucleic acid molecule the AON comprises a certain linkage modification at each linkage position of the AON as disclosed herein to generate the most effective and stable oligonucleotide compound.

[0124] Many of the non-naturally occurring modifications of the linkage, such as PS, are chiral. This means that there are Rp and Sp configurations, known to the person skilled in the art. In one embodiment, the chirality of the PS linkages is controlled, which means that each of the linkages is either in the Rp or in the Sp configuration, whichever is preferred. The choice of an Rp or Sp configuration at a specified linkage position may depend on the target sequence and the efficiency of binding and induction of causing RNA editing of the target adenosine. However,P5652PC00if such is not specifically desired, a composition may comprise AONs as active compounds with both Rp and Sp configurations at a certain specified linkage position. Mixtures of such AONs are also feasible, wherein certain positions preferably have either one of the configurations, while for other positions such does not matter. In one aspect, the AON as disclosed herein comprises one or more (chirally pure or chirally mixed) PS linkages. In one aspect, the AON as disclosed herein comprises one of more (chirally pure or chirally mixed) phosphoramidate (PN) linkages. In one aspect, the AON as disclosed herein comprises one or more (chirally pure or chirally mixed) PNms linkages. In one aspect, a PNdmi or PNms linkage connects the terminal two nucleotides on either end of the AON. AONs as disclosed herein may also comprise linkage modifications at all positions that are not chirally controlled. The AON as disclosed herein may also comprise one or more naturally occurring internucleoside linkages. The choice and number of modified linkages may depend on the specific target, the sequence, the length, and the stability of the AON observed in a particular cell type of interest, which can be assessed by methods known to the person skilled in the art. In one aspect, at least one, at least two, at least three, or at least four internucleoside linkages between the 5’ and / or the 3’ terminal two, three, four, or five nucleosides respectively of the AON as disclosed herein are modified internucleoside linkages. In one aspect, the AON as disclosed herein comprises at least one MP internucleoside linkage according to the structure of formula (V):o=!_5. 1''' (V)

[0125] As was noted in the art, when a single orphan nucleotide is present in an AON, a preferred position for an MP linkage in an AON is linkage position -2, thereby connecting the nucleoside at position -1 with the nucleoside at position -2. Int. Patent Application Publication No. W02024 / 200278 describes that PNms at this position renders the AON more stable than when a MP linkage is present. Hence, in a preferred embodiment, this -2 position, in an AON as disclosed herein, comprises a linkage modification according to the structure of formula (III), more preferably a linkage modification according to the structure of formula (IV), such as a PNms linkage, instead of an MP linkage. Int. Patent Application Publication No. W02020 / 201406 discloses the use of MP linkage modifications at certain positions surrounding the orphan nucleotide. Although the presence of MP linkages is compatible with RNA editing by human ADAR enzymes, introducing MP linkages during the manufacturing of oligonucleotides is also challenging in view of additional manufacturing (purification) steps in the coupling and decoupling process. In one aspect, the AON does not comprise an MP linkage, and the MP linkage is replaced by a PNms linkage.P5652PC00

[0126] In one aspect, the AON as disclosed herein comprises at least one PNdmi linkage, preferably linking the most terminal two nucleosides at the 5’ and / or 3’ end of the AON. A PNdmi linkage that can be used in an AON as disclosed herein has the structure of formula (VI), or a derivative thereof:PNdmilinkage(V)

[0127] Other internucleoside linkages that may be used in the AONs as disclosed herein are those that are disclosed in I nt. Patent Application Publication No. WO2023 / 278589. In one aspect, the AON as disclosed herein comprises at least one phosphonoacetate and / or at least one phosphonoacetamide internucleoside linkage.

[0128] Conjugate chemistries

[0129] In one aspect, the AON as disclosed herein, or the sense strand to which it may be annealed before entering a target cell (in an HEON as disclosed herein), is bound to a hydrophobic moiety, such as palmityl or an analog thereof, cholesterol or analog thereof, or tocopherol or analog thereof. It is preferably bound to the 5’ terminus. In case a hydrophobic moiety is bound to the 5’ terminus as well as to the 3’ terminus, such hydrophobic moieties may the same or different. The hydrophobic moiety bound to the oligonucleotide may be bound directly or indirectly mediated by another substance. When the hydrophobic moiety is bound directly, it is sufficient if the moiety is bound via a covalent bond, an ionic bond, a hydrogen bond, or the like. When the hydrophobic moiety is bound indirectly, it may be bound via a linking group (a linker). The linker may be a cleavable or an uncleavable linker. A cleavable linker refers to a linker that can be cleaved under physiological conditions, for example, in a cell or an animal body {e.g., a human body). A cleavable linker is selectively cleaved by an endogenous enzyme such as a nuclease, or by physiological circumstances specific to parts of the body or cell, such as pH or reducing environment (such as glutathione concentrations). Examples of a cleavable linker comprise, but is not limited to, an amide, an ester, one or both esters of a phosphodiester, a phosphoester, a carbamate, and a disulfide bond, as well as a natural DNA linker. Cleavable linkers also include self-immolative linkers. An uncleavable linker refers to a linker that is not cleaved under physiological conditions, or very slowly compared to a cleavable linker, for example, in a PS linkage, modified or unmodified deoxyribonucleosides linked by a PS linkage, a spacer connected through a PS bond and a linker consisting of modified or unmodifiedP5652PC00ribonucleosides. There is no restriction on the chain length, when a linker is a nucleic acid such as DNA, or an oligonucleotide. However, it may be usually from 2 to 20 bases in length, from 3 to 10 bases in length, or from 4 to 6 bases in length. There is no restriction on the length or composition of a spacer that is connects the ligand and the oligonucleotide, and may include for example ethylene glycol, triethylene glycol (TEG), HEG, alkyl chains, propyl, 6-aminohexyl, or dodecyl. One or more other types of molecules may be bound to the AON through one or more linkers, including peptides, sugars, vitamins, polymers, aptamers, (fragments of) antibodies, small molecules, and the like.

[0130] In one embodiment, the AON as disclosed herein comprises a delivery moiety. Preferably, for delivery to liver cells, such as hepatocytes, and in the context of the present invention when HOC cells are to be targeted to treat the HOC, the delivery moiety is an / V-Acetylgalactosamine (GalNAc) moiety. Preferred GalNAc moieties are tri-antennary GalNAc moieties as shown in formula VII, VIII, IX, X and XIII (below). Preferred mono-antennary GalNAc moieties are as shown in formula XI and XII (below).

[0131] Formula VII, includes connection point E (see Int. Patent Application Publication No. WO2022 / 271806):

[0132] Formula VIII, includes a linker and a connection point F which conjugates to the AON (see WO2014 / 179620):

[0133] Formula IX(a) and IX(b) include a linker and a connection point F which conjugates to the AON (see W02009 / 073809):P5652PC00Formula IX(a);Formula IX(b)

[0134] Formula X:

[0135] Formula XI:P5652PC00

[0136] Formula XII (see WO2011 / 104169), wherein the squiggly line indicates a connection, optionally via linker and / or a spacer, to the AON:

[0137] When the GalNAc moiety of formula VI is applied, the GalNAc moiety is preferably conjugated to the AON at its 3’ terminus, via connection point E of formula VII, optionally via a linker and / or a spacer.

[0138] Formula XIII:.(XIII)

[0139] When the GalNAc moiety of formula VIII is applied, the GalNAc moiety is preferably conjugated to the AON at its 5’ terminus, via connection point F of formula VIII, optionally via a linker and / or a spacer.P5652PC00

[0140] General

[0141] In addition to the specific preferred chemical modifications at certain positions in compounds as disclosed herein, AONs as disclosed herein may comprise one or more (additional) modifications to the nucleobase, scaffold and / or backbone linkage, which may or may not be present in the same monomer, for instance at the 3’ and / or 5’ position. In one aspect, the AON as disclosed herein comprises at least one internucleoside linkage according to the structure of formula (III), and / or the AON further comprises at least one nucleotide with a sugar moiety that comprises a 2’-OMe modification, and / or the AON comprises at least one nucleotide with a sugar moiety that comprises a 2’-MOE modification, and / or the AON comprises at least one nucleotide with a sugar moiety that comprises a 2’-F modification, and / or the AON comprises an orphan nucleotide that carries a 2’-H in the sugar moiety and is therefore referred to as a DNA nucleotide, even though additional modifications may exist in its base and / or linkage to its neighbouring nucleosides. In one aspect, the orphan nucleotide carries a 2’-F in the sugar moiety. In one aspect, the orphan nucleotide carries a diF substitution in the sugar moiety. In one aspect, the orphan nucleotide carries a 2’-F and a 2’-C-methyl in the sugar moiety. In one aspect, the orphan nucleotide comprises a 2’-F in the arabinose configuration (FANA) in the sugar moiety.

[0142] Other chemical modifications of the AON as disclosed herein include the substitution of one or more than one of any of the hydrogen atoms with deuterium or tritium, examples of which can be found in e.g., Int. Patent Application Nos. WO2014 / 022566 or WO2015 / 011694. Again, in all cases, the modifications should be compatible with editing such that the AON fulfils its role as an oligonucleotide that can, after binding to its target sequence, recruit an adenosine deaminase enzyme because of the double-stranded nucleic acid entity that arises. In all aspects of the disclosure, the enzyme with adenosine deaminase activity is preferably ADAR1 , ADAR2, or ADAT.

[0143] AONs as disclosed herein preferably do not include a 5’-terminal O6-benzylguanosine or a 5’-terminal amino modification and preferably are not covalently linked to a SNAP-tag domain (an engineered O6-alkylguanosine-DNA-alkyl transferase). An AON as disclosed herein preferably does not comprise a boxB RNA hairpin sequence. In one aspect, an AON as disclosed herein comprises 0, 1, 2 or 3 wobble base pairs with the target sequence, and / or 0, 1, 2, 3, 4, 5, 6, 7, or 8 mismatching base pairs with the target RNA sequence. Preferably, the target adenosine in the target sequence forms a mismatch base pair with the orphan nucleotide.

[0144] The AON as disclosed herein, in contrast to what has been described for siRNA, or gapmers and their relation towards RNase breakdown and the use of such gapmers in doublestranded complexes (see for instance European Patent Application Publication No. EP 3954395 A1), does not comprise a stretch of more than four DNA nucleotides which would make a target sequence (or a sense nucleic acid strand) a target for RNase-mediated breakdown. It is notP5652PC00desired that the target transcript molecule is degraded through the binding of the AON to the transcript molecule. In one embodiment, the AON does not comprise more than four consecutive DNA nucleotides anywhere within its sequence. In an embodiment, the AON is composed of as much (chemically) modified nucleotides as possible to enhance the resistance towards RNase-mediated breakdown, while at the same time being as efficient as possible in producing an RNA editing effect. This means that the orphan nucleotide and several other nucleotides within the AON may be DNA, but also that there is no stretch of more than four consecutive DNA nucleotides within the AON. Hence, the AON as disclosed herein is not a gapmer. A gapmer reduces the expression of a target transcript but does not produce RNA editing of a specified adenosine within the target transcript. A gapmer is in principle a singlestranded nucleic acid consisting of a central region (DNA gap) and wing regions positioned directly at the 5’ end (5’ wing region) and the 3’ end (3’ wing region) thereof. In contrast, the AON as disclosed herein may be any oligonucleotide that produces an RNA editing effect in which a target adenosine in a target RNA molecule is deaminated to an inosine and accordingly is resistant to RNase-mediated breakdown as much as possible to yield this effect and to allow the mRNA transcript being translated into a protein.

[0145] The AONs as disclosed herein may also be administered in the context of aids that will increase the entry of the AON into the target cell and / or its endosomal escape as soon as it is in the cell. Moieties that can be applied for such applications are for example a set of chemical compounds (generally purified from nature) referred to as saponins or triterpene glycosides, as outlined infra. A saponin that can be used in the methods as disclosed herein is AG1856, disclosed in Int. Patent Application Publication No. WO2021 / 122998 and further described for use with RNA editing producing oligonucleotides in Int. Patent Application Publication No. WO2024 / 153801.

[0146] The invention concerns the modification of target RNA sequences in eukaryotic, preferably metazoan, more preferably mammalian, most preferably human cells. The invention can be used with cells from any organ e.g. skin, lung, heart, kidney, liver, pancreas, gut, muscle, gland, eye, brain, blood and the like. The invention is particularly suitable for modifying sequences in cells, tissues or organs implicated in a diseased state of a (human) subject. The cell can be located in vitro, ex vivo or in vivo. One advantage of the invention is that it can be used with cells in situ in a living organism, but it can also be used with cells in culture. In some embodiments cells are treated ex vivo and are then introduced into a living organism (e.g. re-introduced into an organism from whom they were originally derived). The invention can also be used to edit target RNA sequences in cells within a so-called organoid. Organoids can be thought of as three-dimensional in vitro-derived tissues but are driven using specific conditions to generate individual, isolated tissues (Lancaster & Knoblich, Science 2014, 345(6194):1247125). In a therapeutic setting they are useful because they can be derived in vitro from a patient’s cells, and the organoids can then be re-introduced to the patient asP5652PC00autologous material which is less likely to be rejected than a normal transplant. The cell to be treated will generally have a genetic mutation. The mutation may be heterozygous or homozygous. The invention will typically be used to modify point mutations, such as N to A mutations, wherein N may be G, C, II (on the DNA level T), preferably G to A mutations, or N to C mutations, wherein N may be A, G, II (on the DNA level T), preferably II to C mutations.

[0147] Without wishing to be bound by theory, the RNA editing through hADAR2 is thought to take place on primary transcripts in the nucleus, during transcription or splicing, or in the cytoplasm, in which mature mRNA, miRNA or ncRNA can be edited.

[0148] Many genetic diseases are caused by G to A mutations, and these are preferred target diseases because adenosine deamination at the mutated target adenosine will reverse the mutation to a codon giving rise to a functional, full length and / or wild type protein, especially when it concerns PTCs. Preferred examples of genetic diseases that can be prevented and / or treated with oligonucleotides according to the invention are any disease where the modification of one or more adenosines in a target RNA will bring about a (potentially) beneficial change.

[0149] It should be clear, that targeted editing according to the invention can be applied to any adenosine, whether it is a mutated or a wild-type nucleotide in a given sequence. For example, editing may be used to create RNA sequences with different properties. Such properties may be coding properties (creating proteins with different sequences or length, leading to altered protein properties or functions), or binding properties (causing inhibition or over-expression of the RNA itself or a target or binding partner; entire expression pathways may be altered by recoding miRNAs or their cognate sequences on target RNAs). Protein function or localization may be changed at will, by functional domains or recognition motifs, including but not limited to signal sequences, targeting or localization signals, recognition sites for proteolytic cleavage or co- or post-translational modification, catalytic sites of enzymes, binding sites for binding partners, signals for degradation or activation and so on. These and other forms of RNA and protein “engineering”, whether to prevent, delay or treat disease or for any other purpose, in medicine or biotechnology, as diagnostic, prophylactic, therapeutic, research tool or otherwise, are encompassed by the present invention.

[0150] The amount of AON to be administered, the dosage and the dosing regimen can vary from cell type to cell type, the disease to be treated, the target population, the mode of administration {e.g., systemic versus local), the severity of disease and the acceptable level of side activity, but these can and should be assessed by trial and error during in vitro research, in pre-clinical and clinical trials. The trials are particularly straightforward when the modified sequence leads to an easily detected phenotypic change. It is possible that higher doses of AON could compete for binding to an ADAR within a cell, thereby depleting the amount of the entity, which is free to take part in RNA editing, but routine dosing trials will reveal any such effects for a given AON and a given target.P5652PC00

[0151] One suitable trial technique involves delivering the AON to cell lines, or a test organism and then taking biopsy samples at various time points thereafter. The sequence of the target RNA can be assessed in the biopsy sample and the proportion of cells having the modification can easily be followed. After this trial has been performed once then the knowledge can be retained, and future delivery can be performed without needing to take biopsy samples. A method of the invention can thus include a step of identifying the presence of the desired change in the cell’s target RNA sequence, thereby verifying that the target RNA sequence has been modified. This step will typically involve sequencing of the relevant part of the target RNA, or a cDNA copy thereof (or a cDNA copy of a splicing product thereof, in case the target RNA is a pre-mRNA), as discussed above, and the sequence change can thus be easily verified. Alternatively, the change may be assessed on the level of the protein (length, glycosylation, function or the like), or by some functional read-out, such as a(n) (inducible) current, when the protein encoded by the target RNA sequence is an ion channel, for example.

[0152] After RNA editing has occurred in a cell, the modified RNA can become diluted over time, for example due to cell division, limited half-life of the edited RNAs, etc. Thus, in practical therapeutic terms a method of the invention may involve repeated delivery of an AON until enough target RNAs have been modified to provide a tangible benefit to the patient and / or to maintain the benefits over time.

[0153] AONs of the invention are particularly suitable for therapeutic use, and so the invention provides a pharmaceutical composition comprising an AON of the invention and a pharmaceutically acceptable carrier. In some embodiments of the invention the pharmaceutically acceptable carrier can simply be a saline solution. This can usefully be isotonic or hypotonic, particularly for pulmonary delivery. The invention also provides a delivery device (e.g. syringe, inhaler, nebuliser) which includes a pharmaceutical composition of the invention.

[0154] The invention also provides an AON of the invention for use in a method for making a change in a target RNA sequence in a mammalian, preferably a human cell, as described herein. Similarly, the invention provides the use of an AON of the invention in the manufacture of a medicament for making a change in a target RNA sequence in a mammalian, preferably a human cell, as described herein.

[0155] The invention also relates to a method for the deamination of at least one specific target adenosine present in a target RNA sequence in a cell, the method comprising the steps of: providing the cell with an AON according to the invention; allowing uptake by the cell of the AON; allowing annealing of the AON to the target RNA molecule; allowing a mammalian ADAR enzyme comprising a natural dsRNA binding domain as found in the wild type enzyme to deaminate the target adenosine in the target RNA molecule to an inosine; and optionally identifying the presence of the inosine in the RNA sequence.P5652PC00

[0156] In a preferred aspect, depending on the ultimate deamination effect of A to I conversion, the identification step comprises: sequencing the target RNA; assessing the presence of a functional, elongated, full length and / or wild type protein; assessing whether splicing of the pre- mRNA was altered by the deamination; or using a functional read-out, wherein the target RNA after the deamination encodes a functional, full length, elongated and / or wild type protein. Because the deamination of the adenosine to an inosine may result in a protein that is no longer suffering from the mutated A at the target position, the identification of the deamination into inosine may also be a functional read-out, for instance an assessment on whether a functional protein is present, or even the assessment that a disease that is caused by the presence of the adenosine is (partly) reversed. The functional assessment for each of the diseases mentioned herein will generally be according to methods known to the skilled person. A very suitable manner to identify the presence of an inosine after deamination of the target adenosine is of course RT-PCR and sequencing, using methods that are well-known to the person skilled in the art.

[0157] The AON according to the invention is suitably administrated in aqueous solution, e.g. saline, or in suspension, optionally comprising additives, excipients and other ingredients, compatible with pharmaceutical use, at concentrations ranging from 1 ng / ml to 1 g / ml, preferably from 10 ng / ml to 500 mg / ml, more preferably from 100 ng / ml to 100 mg / ml. Dosage may suitably range from between about 1 pg / kg to about 100 mg / kg, preferably from about 10 pg / kg to about 10 mg / kg, more preferably from about 100 pg / kg to about 1 mg / kg. Administration may be by inhalation (e.g. through nebulization), intranasally, orally, by injection or infusion, intravenously, subcutaneously, intra-dermally, intra-cranially, intravitreally, intramuscularly, intra-tracheally, intra-peritoneally, intra-rectally, and the like. Administration may be in solid form, in the form of a powder, a pill, a gel, an eye-drop, or in any other form compatible with pharmaceutical use in humans.EXAMPLES

[0158] Example 1. RNA editing of a target adenosine in human ACTIN B transcripts using AONs with different nucleobases in the orphan nucleotide.

[0159] Initially, it was investigated how AONs comprising a Benner’s base would behave in RNA editing efficiency in relation to identical AONs that comprises either: a) a cytosine nucleobase at the orphan position, or b) an isouracil nucleobase at the orphan position. The Benner’s base (Z) is depicted in FIG.2. Initially 5 AONs were designed based on the human ACTIN B transcript (provided in FIG. 6; SEQ ID NO:16, with the target adenosine underlined):i) RM4000 (SEQ ID NO:1) that comprises a deoxycytidine at the orphan position (Cd);P5652PC00ii) RM4266 (SEQ ID NO:2) that comprises a deoxynucleotide comprising a Benner’s base at the orphan position (Zd);iii) RM4805 (SEQ ID NO:3) that comprises a deoxynucleotide comprising an isouracil nucleobase at the orphan position (Iso-lid);iv) RM5253 (SEQ ID NO:4) that comprises a nucleotide comprising a 2’-fluoro substitution and an isouracil nucleobase at the orphan position (FANA Iso-ll); andv) RM5254 (SEQ ID NO:5) that comprises a nucleotide comprising a 2’-difluoro substitution and an isouracil nucleobase at the orphan position (Di-fluoro Iso- U).

[0160] The structures of the isolld, isollaf, and isoll2f orphan nucleotides are provided in FIG.3. The sequences and chemical modifications of each of these five AONs are provided in FIG.6.

[0161] For this, primary human hepatocytes (PHHs; Liverpool mixed gender human hepatocytes- 10 donor pool, cryo-plateable) carrying the wildtype ACTB target transcript were obtained from BioIVT. Cells were stored at -150 °C and thawed and plated on day 0. Approximately 50,000 cells / well were plated of a 96-well plate with INVITROGRO CP medium (BioIVT) + 2.2% Torpedo antibiotic mix (BioIVT) and incubated at 37 °C+ 5% CO2 for 24 hrs. Then, medium was removed, and the cells were treated with two concentrations AONs: 0.01 pM and 0.1 pM, in INVITROGRO HI medium (BioIVT). Non-treated cells were taken as a Negative control. The cells were incubated for 3 days (~72 hrs), then lysed and stored at -20 °C. RNA was extracted from the cell lysates using the MaxwellORSC SimplyRNA Tissue semi-automated system (Promega) according to the manufacturer’s instructions. RNA concentrations were measured using the NanoDrop Eight (Thermo Scientific). cDNA was prepared using the Maxima reverse transcriptase kit (Thermo Scientific) according to the manufacturer’s instructions, with a combination of random hexamer (Thermo Scientific) and oligo-dT primers (Thermo Scientific). The cDNA was diluted 160-fold and 1.2 pL of this dilution was used as template for a digital droplet PCR (ddPCR) with a total input of 0.125 ng cDNA per sample. The dPCR assay for absolute quantification of nucleic acid target sequences was performed using Qiagen’s QIAcuityOI Digital PCR system. 1.2 pl of diluted cDNA obtained from the RT-cDNA synthesis reaction was used in a total mixture of 12 pl of reaction mix, including the QI Acuity Probe PCR Kit (Qiagen), a Taqman SNP genotype assay with the forward and reverse primers provided in Table 1, combined with the gene-specific probes, also as provided in Table 1, and nuclease- free water (Ambion). A total volume of 12 pl dPCR mix including cDNA was loaded in the wells of a QIAcuity Nanoplate 8.5k 96-well (Qiagen). The template for the run was set up in the QuantStudio Absolute Q Digital PCR Software where details about the run were added along with the PCR program that is commonly as follows: 2 min at 95 °C; 40 x 15 sec at 95 °C and 30 sec at 64 °C.P5652PC00

[0162] The QiaquityOI digital PCR system then measured the fluorescence in each well and calculated the total copies of wild-type and edited transcripts present per pL of sample. The amount of wild-type and edited copies per ng of RNA input were then calculated using excel and further used to calculate the editing percentage which was scored as follows: score = SUM(G) / (SUM(A+G) * 100.

[0163] Table 1. Primers and probes with their respective sequences for quantitative PCR assays. The SEQ ID NO of each primer or probe is given between brackets following the respective sequence in the middle column. The + indicates a Locked Nucleic Acid (LNA) on the 3’ side of the symbol.Name Sequence 5'-3' Item human ActB FW primer AGTCCTCTCCCAAGTCCACA (SEQ ID NO:17) Primer human ActB REV primer GGCACGAAGGCTCATCATTC (SEQ ID NO:18) Primer ActB probe target G FAM FAM-AGGTGA+T+G+GCATTGCTTTCGT-IABkFQ (SEQ ID NO:19) ProbeActB probe target A HEX HEX-AG+GTGA+T+A+GCATTGCTTTCGTGT-IABkFQ (SEQ ID NQ:20) Probe

[0164] The editing percentages obtained with the AONs in this first experiment are provided in FIG. 4A (displaying the results with 0.01 pM AON) and FIG. 4B (displaying the results with 0.1 pM AON). This shows that with an increased concentration of AON, higher editing percentages were obtained. Moreover, it is shown that whereas the AONs with the Iso-lid orphan nucleotide (RM4805) and the FANA-lso-U orphan nucleotide (RM5253) outperformed the AON with the Di-fluoro Iso-ll orphan nucleotide (RM5254) as well as the AON comprising the deoxycytidine orphan nucleotide (RM4000). However, notably, the AON comprising the deoxynucleotide comprising the Benner’s base at the orphan nucleotide (RM4266) provided a marked increase in editing percentage in comparison to the other four AONs, confirming what has been shown earlier (see Int. Patent Application No. WO2020 / 252376 and elsewhere) and providing further support for the beneficial properties of the Benner’s base in RNA editing using endogenous ADAR enzymes in human cells.

[0165] This experiment was performed in an identical manner, but then using another set of five AONs, also targeting the same target adenosine in human ACTB transcripts in PHHs as outlined above. The next five AONs were:(i) RM3254 (SEQ ID NO:6) that comprises a deoxycytidine at the orphan position (Cd);(ii) RM4264 (SEQ ID NO:7) that comprises a deoxynucleotide comprising a Benner’s base at the orphan position (Zd);(iii) RM4807 (SEQ ID NO:8) that comprises a deoxynucleotide comprising an isouracil nucleobase at the orphan position (Iso-lid);(iv) RM5257 (SEQ ID NO:9) that comprises a nucleotide comprising a 2’-fluoro substitution and an iso-uracil nucleobase at the orphan position (FANA Iso-ll); andP5652PC00(v) RM5258 (SEQ ID NO: 10) that comprises a nucleotide comprising a 2’-difluoro substitution and an iso-uracil nucleobase at the orphan position (Di-fluoro Iso-ll)

[0166] The sequences and chemical modifications of each of these five AONs are provided in FIG. 6.

[0167] The experiment with these five AONs was identical to the first experiment described in detail above. A ddPCR assay was also performed in an identical manner with the same primers and probes as provided above. The editing percentages obtained with the AONs in this second experiment are provided in FIG. 4C (displaying the results with 0.01 pM AON) and FIG. 4D (displaying the results with 0.1 pM AON). In general a similar pattern in editing efficiency was observed, with the AON comprising the Benner’s base at the orphan nucleotide providing a significant increase in RNA editing in comparison to the AONs comprising the Cd, Iso-lid, FANA Iso-ll and Di-fluoro Iso-ll orphan nucleotides, once again conforming the superiority of the Benner’s base in RNA editing when present at the orphan position.

[0168] Example 2. RNA editing of human APP target transcripts using AONs comprising Zd and Ed orphan nucleotides in a dose response assay.

[0169] As shown in the first example above, AONs comprising an orphan deoxynucleotide comprising a Benner’s base outperform the ‘original’ deoxycytidine orphan nucleotide, as well as three variants of the orphan nucleotide with an iso-uracil (N3-uracil, or N3U) nucleobase. To compare how the Benner’s base would hold up against another cytosine analog, RNA editing was investigated using an AON comprising a deoxynucleotide comprising a Benner’s base at the orphan position and an AON comprising a deoxynucleotide comprising a 5-aza-5,6- di hydrocytosine at the orphan position. Whereas the target transcript in the previous example was human ACTB, the subsequent experiment was performed by targeting a target adenosine in the human Amyloid-beta Precursor Protein (APP) transcript. The target sequence and the target adenosine in the human APP transcript is provided in SEQ ID NO:15 (FIG. 6). Again, a screen was performed on primary human hepatocytes (PHH’s) using two AONs that were identical in sequence and chemical modifications except for the orphan position. The AONs that were used were RM3767 (SEQ ID NO:11) and RM3990 (SEQ ID NO:12), wherein RM3767 comprises a deoxynucleotide comprising a Benner’s base at the orphan position (Zd) and RM3990 comprises a deoxynucleotide comprising an E base at the orphan position (Ed), see also FIG. 6.

[0170] PHHs (a Liverpool mixed gender human hepatocytes- 10 donor pool, cryo-plateable) carrying the wildtype human APP target transcript were obtained from Biol VT. Cells were stored at -150 °C and thawed and plated on day 0. Approximately 50,000 cells / well were plated wells of a 96-well plate with INVITROGRO CP medium (BiolVT) + 2.2% Torpedo antibiotic mix (BiolVT) and incubated at 37 °C+ 5% CO2 for 24 hrs. Then, medium was removed, and the cells were treated with a range of concentrations of RM3767 and RM3990 to generate a dose-P5652PC00response curve: 0.001 pM, 0.01 pM, 0.1 pM, 1 pM, 10 pM, and 25 pM, in INVITROGRO HI medium (BiolVT). Non-treated cells were taken as a negative control. The cells were incubated for 3 days (~72 hrs), lysed and stored at -20 °C. RNA was extracted from the cell lysates using the MaxwellORSC SimplyRNA Tissue semi-automated system (Promega) according to the manufacturer’s instructions. RNA concentrations were measured using the NanoDrop Eight (Thermo Scientific). The cDNA was prepared using the Maxima reverse transcriptase kit (Thermo Scientific) according to the manufacturer’s instructions, with a combination of random hexamer (Thermo Scientific) and oligo-dT primers (Thermo Scientific). The cDNA was diluted 8.6-fold and 1.2 pL of this dilution was used as template for a digital droplet PCR (ddPCR) with a total input of 3.5 ng cDNA per sample. The dPCR assay for absolute quantification of nucleic acid target sequences was performed using Qiagen’s QIAcuityOI Digital PCR system. 1.2 pl of diluted cDNA obtained from the RT-cDNA synthesis reaction was used in a total mixture of 12 pl of reaction mix, including the QIAcuity Probe PCR Kit (Qiagen), a Taqman SNP genotype assay with the forward and reverse primers provided in Table 2, combined with the genespecific probes, also as provided in Table 2, and nuclease-free water (Ambion). A total volume of 12 pl ddPCR mix including cDNA was loaded in the wells of a QIAcuity Nanoplate 8.5k 96- well (Qiagen). The template for the run was set up in the QuantStudio Absolute Q Digital PCR Software where details about the run were added along with the PCR program that is commonly as follows: 2 min at 95 °C; 40 x 15 sec at 95 °C and 30 sec at 64 °C. The editing percentage was calculated as indicated above.

[0171] Table 2. Primers and probes with their respective sequences for quantitative PCR assays. The SEQ ID NO of each primer or probe is given between brackets following the respective sequence in the middle column. The + indicates a Locked Nucleic Acid (LNA) on the 3’ side of the symbol.Name Sequence 5'-3' Item 1205 hAPP Exl7 ddPCR Fw CATTGGACTCATGGTGG (SEQ ID NO:21) Primer 1206 hAPP Exl7 ddPCR Rev CAGCATCACCAAGGTG (SEQ ID NO:22) Primer / 56-FAM / TGTTGTCAT+G+GCGACAGT / 3IABkFQ / 1209 hAPP Exl7 ddPCR Mut FAM_3(SEQ ID NO:23) Probe / 5HEX / TGTT+GTCAT+A+G+CGACAGT / 3IABkFQ / 1207 hAPP Exl7 ddPCR WT HEX(SEQ ID NO:24) Probe

[0172] The result of this experiment is visualized in a dose response curve displayed in FIG. 7.As can be clearly observed, the AON comprising the Ed nucleotide at the orphan position (RM3990) outperformed the AON with the Zd nucleotide at the orphan position (RM3767). This was a very unexpected result because it was initially considered that the Benner’s base was better suited in serving as an H-bond donor at the N3 site than the E base. The E-base, in its 5-aza-5,6-dihydrocytosine state, would be considered as serving as an H-donor at the N5 site, which appears counter-intuitive in respect of the crystal structure of human ADAR2.P5652PC00Nevertheless, from this experiment it unexpectedly appeared that the E base, when present in a deoxynucleotide at the orphan position could outperform the Benner’s base.

[0173] Example 3. Editing of two adenosines in a human transcript using AONs with Z or E nucleobases.

[0174] To further study the difference in editing efficiency of AONs carrying a deoxynucleotide comprising a Z base or an E base at the orphan position, it was investigated whether the editing was also influenced in a similar fashion as shown in Example 2, in another target RNA molecule. For this, a different human transcript was chosen. Two target adenosines within that transcript were selected for RNA editing. To test the difference between AONs comprising a Z base and an E base at the orphan position, two sets of AONs were manufactured for targeting the first target adenosine and second adenosine, independently. In each of the two experiments, four different AONs were used in a gymnotic exposure using human cells derived from pluripotent stem cells, with 6.0x105 cells per treatment.

[0175] AON1 is directed at the first adenosine and comprises a deoxyribonucleoside comprising a Benner’s base at the orphan position (Zd). AON2 is identical to AON 1, except that it comprises a deoxyribonucleoside comprising an E base at the orphan position (Ed). AON3 is identical to AON1 but comprises a 2’-OMe modified nucleotide comprising an uracil nucleobase at the orphan position (Um), which should suppress RNA editing and which AON serves as an on- target negative control of AON1. AON4 is a scrambled version of AON1 and serves as a negative control. AON5 is directed at the second adenosine and comprises a deoxyribonucleoside comprising a Benner’s base at the orphan position (Zd). AON6 is identical to AON5, except that it comprises a deoxyribonucleoside comprising an E base at the orphan position (Ed). AON7 is identical to AON5 but comprises a 2’-OMe modified nucleotide comprising an uracil nucleobase at the orphan position (Um), which should suppress RNA editing and which AON serves as an on-target negative control of AON5. AON8 is a scrambled version of AON5 and serves as a negative control.

[0176] After plating of the cells, 5 pM AON was administered to the culture medium and kept on the cells for 48 hrs, after which the AON was slowly washed out through a replacement of 50% of the culture medium with fresh medium every 2 days. RNA was isolated using miRVana RNA isolation kit (Thermo Fisher), the manufacturer protocol was followed with a few adaptations to remove the AONs from the RNA samples. After disruption of the cells, the supplied miRNA homogenate additive was added at 1 / 10 of the total volume. After phenokchloroform (same volume) extraction the upper aqueous phase was heated for 1 min at 60 °C. 100% ethanol was added to the aqueous phase at 1 / 3 of the total volume. The samples were added to the supplied filter columns, after centrifugation, the flow through was discarded. The filters containing the mRNA were washed according to the protocol and eluted using 30 pl 95 °C nuclease-free water. The purified RNA was subsequently treated with TURBO DNase (Thermo Fisher) according toP5652PC00the supplied protocol. RNA concentrations were measured using the Nanodrop and 500 ng RNA was used for cDNA synthesis. cDNA synthesis was performed using the Maxima reverse transcriptase kit (Thermo Fisher) according to the manufacturer’s instructions, with a combination of random hexamer and oligo-dT primers. Then, cDNA was subjected to RT-PCR using the Amplitaq Gold 360 DNA Polymerase 100011 kit (Applied Biosystems) according to the manufacturer’s instructions to amplify the target region.

[0177] Then, PCR products were analysed by Sanger sequencing to detect A-l editing. Each ddPCR sample contained 1x ddPCR supermix for probes (no dllTP) (from Biorad) and 0.9 pM primer, and template cDNA in a total volume of 21 pL. Droplets were made from the PCR mixes using the QX200 droplet generator (Biorad). Next, the droplet PCR was performed in a T100 thermal cycler (Biorad) with a heated lid of 105 °C and a ramp temperature of 2 °C per sec. The polymerase was heat activated at 95 °C for 10 min. Each cycle the denaturation was performed at 95 °C for 30 sec and the annealing / extension was performed at 59 °C for 60 sec. This was repeated for 40 cycles in total. The enzymes were deactivated at 98 °C for 10 min and the reaction was held at 8 °C. Fluorescent signal from the droplets was measured by the QX200 droplet reader (Biorad). Determining the number of fluorescent positive droplets and subsequent absolute quantification was performed with QuantaSoft software (Bio-Rad). As an additional quality control samples were removed which significantly deviated from the rest in terms of absolute copy numbers. This was determined by calculating the average number of total transcript (A + G transcripts) copies for each condition, samples were removed if they had a five-fold lower or higher number of transcript copies compared to the average.

[0178] FIG. 8A shows the editing percentages after gymnotic uptake of the AONs targeting the first adenosine using AON1-4 and FIG. 8B shows the editing percentages after gymnotic uptake of the AONs targeting the second adenosine using AON5-8. The results showed that there was a very low batch-to- batch variability in the different assays: the first two bars in both figures represent the results obtained with the same AON for each site, but in different cell batches (cell batch A and B, respectively). The AON comprising an E base at the orphan position for targeting the first adenosine (AON2) and that was only tested in cell batch B outperformed the AON comprising a Z base at the orphan position (AON1) by 1.2-fold (-61.5% editing vs -50% editing). Similarly, the AON comprising an E base at the orphan position for targeting the second adenosine (AON6) and that was also only tested in cell batch B outperformed the AON comprising a Z base at the orphan position (AON5) by 1.2-fold as well (-36% editing vs -29% editing). AON3 and AON7 were identical to AON1 and AON5, respectively, except that the orphan nucleotide was a 2’-OMe modified uridine nucleotide (Um), which should suppress efficient editing. Very low editing yields were indeed observed after using these AONs. AON4 and AON8 were scrambled versions of AON 1 and AON5, respectively, and served as negative controls. Non-treated samples (NT) also served as negative controls. Table 3 shows the editing percentages numbers averaged in the bar diagrams of FIG. 8.P5652PC00

[0179] Table 3. Editing percentages in iPSC-derived human cells after treatment with 5 pM AON targeting two different adenosines in a human transcript molecule. Treatments were in triplicate. NA indicates a sample from which no results were retrieved. NT are non-treated samples.AON1 cell batch A AON1 cell batch B AON2 AON3 AON4 NT N=1 50.39 51.25 59.27 9.34 0.12 0.21 N=2 51.60 50.54 63.95 0.00 0.00 0.25 N=3 49.03 NA 61.37 0.00 0.49 0.27 Averag50.34 50.90 61.53 3.11 0.21 0.24 eAON5 cell batch A AON5 cell batch B AON6 AON7 AON8 NT N=1 31.60 30.10 35.78 0.63 0.06 0.11 N=2 27.90 26.76 36.77 0.16 0.17 0.00 N=3 27.78 31.36 35.64 0.00 0.16 0.19 Averag29.10 29.41 36.06 0.26 0.13 0.10e

[0180] These results clearly show that incorporation of the E base as a nucleobase in the nucleotide at the orphan position, which is directly opposite the target adenosine, seriously improves the RNA editing efficiency of a target adenosine in the target human transcript, in comparison to AONs that carry a Z base at this position.

[0181] Together, the results show that, for three target adenosines in different codons in different human transcripts, incorporation of the E base as a nucleobase in the nucleotide at the orphan position which is directly opposite the target adenosine improves the RNA editing efficiency of the target adenosine, in comparison to the Z base at this position, and strengthens the unexpected finding outlined in Example 2. This provides a further improved tool to achieve higher editing percentages and more efficient tools in the setup of RNA editing using chemically modified oligonucleotides in a wide variety of therapeutic applications.

[0182] Example 4. Stability study of AONs comprising a Z or E nucleobase at the orphan position, in combination with different linkages at linkage position -2.

[0183] It was studied whether using an E base at the orphan position instead of the Z base would influence the stability of the AON. For this, a nuclease stability study was designed with the goal of assessing the difference in chemical stability between AONs that would only differ at that specific aspect. Furthermore, it was also investigated how a methylphosphonate linkage at linkage position -2 would influence stability in this context and how that would compare to an AON that comprises a phosphorothioate linkage at linkage position -2. For this the following AONs were studied:P5652PC00(i) RM3395 (SEQ ID NO: 13) comprises a deoxynucleotide comprising a Benner’s base at the orphan position (Zd) and a methylphosphonate linkage (MeP) at linkage position -2;(ii) RM3989 (SEQ ID NO:14) comprises a deoxynucleotide comprising an E base at the orphan position (Ed) and a methylphosphonate linkage (MeP) at linkage position -2;(iii) RM3767 (SEQ ID NO: 11) comprises a deoxynucleotide comprising a Benner’s base at the orphan position (Zd) and a phosphorothioate linkage (PS) at linkage position -2; and(iv) RM3990 (SEQ ID NO:12) comprises a deoxynucleotide comprising an E base at the orphan position (Ed) and a phosphorothioate linkage (PS) at linkage position - 2.The sequences and chemical modifications of each of these AONs are provided in FIG. 6.

[0184] The AONs were diluted to 10 pM in water, in a total volume of 34 pL. To this 16 pL of Nuclease mix was added and this was incubated for 24 hrs at 37 °C and 300 rpm. This nuclease mix comprised SVPD, BAL-31, RNaseA, and DNasel. After the incubation, 50 pL of 8 M Guanidine HCL buffer was added to both control and samples. This was heated to 95 °C for 1 min. The stability (purity) was measured using HPLC-UV. HPLC analysis was performed using Ion-Pair Reversed Phase (IPRP) LIPLC combined with UV detection and mass spectrometry (MS) analysis. IPRP is based on the electrostatic interaction between an oligonucleotide and an ion pairing reagent that is added to the mobile phase, such as tri- or tetra-alkylamine salts, and the hydrophobic interactions between the ion pairing reagent and the non-polar stationary phase. For this method, triethylamine (TEA) and hexafluoro-isopropanol (HFIP) was used as ion-pairing reagent and methanol as organic modifier. UV detection was used at a wavelength of 260 nanometers and MS detection for the identification.

[0185] The results of the stability assay using these four different AONs are shown in FIG. 9.Surprisingly, it was found that an AON with an E base at the orphan position in combination with an MP linkage at linkage position -2 remained stable for at least 24 hrs. It was concluded that incorporation of the E base at the orphan position in combination with a DNA character of the nucleotide and in combination with either an MP or PS linkage at linkage position -2 is not detrimental in respect of AON stability, similar to what is observed with an AON with the exact same content, except for the Benner’s base (Z) at the orphan position in contrast to the E base at that position. It is held that concomitantly this high stability aspect contributes to the efficiency and longer lasting RNA editing effects, in vitro, ex vivo, and in vivo.

[0186] Example 5. RNA editing of Angptl3 target transcripts in mice using AONs comprising a variety of nucleobases at the orphan position.P5652PC00

[0187] In a follow up study, the editing efficiency of the E base was tested in an in vivo study in mice by using multiple oligonucleotides to target the adenosine in the mouse Angptl3 transcript that is the equivalent of the target adenosine in the human ANGPTL3 transcript, which is the first nucleotide in the codon encoding lysine at position 63 in the human ANGPTL3 protein (see Int. Patent Application Publication No. WO2024 / 175550), and bring about A-to-l deamination. The target sequence of the mouse ANGPTL3 transcript (SEQ ID NO:25) as well as the five designed AON sequences (SEQ ID NO:26 to 30) are depicted in FIG. 6. The sequences of the AONs are identical, except for the nucleotide on the orphan position:(i) RM123180 (SEQ ID NO:26) comprises a deoxycytidine at the orphan position (Cd);(ii) RM123874 (SEQ ID NO:27) comprises a deoxynucleotide comprising a Benner’s base at the orphan position (Zd);(iii) RM123181 (SEQ ID NO:28) comprises a deoxynucleotide comprising an iso-uracil nucleobase at the orphan position (Iso-lid);(iv) RM123182 (SEQ ID NO:29) comprises a deoxynucleotide comprising a pyridine- 2-one at the orphan position (shown as “(2)” in FIG. 6); and(v) RM123183 (SEQ ID NQ:30) comprises a deoxynucleotide comprising an E base on the orphan position (Ed).

[0188] In this study, a total of 20 female wildtype C57B1 / 6J mice received three subcutaneous (SC) injections at day 0, 2, and 4 with AONs at a dose of 10 mg / kg (equimolar dosing of 1 pmol / kg) designed to target the equivalent adenosine in the mouse ANGPTL3 in comparison to the target adenosine in the human ANGPTL3 gene referred to in Int. Patent Application Publication No. WQ2024 / 175550. Mice were sacrificed on day 7 to collect blood-plasma and tissue samples. Snap-frozen liver tissue samples were thawed and disrupted in 1 mL TG / Homogenization Solution (Promega) using the Bead mill24 (Fischer Scientific). Samples were incubated for 1 min on ice and centrifuged for 1 min at 14000g. 200 pL tissue homogenate was transferred to a 1.5 mL tube and 200 pL lysis Buffer was added. This was then transferred to a Maxwell RSC Cartridge. The Maxwell RSC simplyRNA Tissue kit and Maxwell RCS 48 were used to isolate RNA following the manufacturer’s protocol.

[0189] cDNA synthesis was performed using the Maxima Reverse Transcriptase kit (Thermo Scientific) following the manufacturer’s protocol. To avoid cDNA synthesis interference due to secondary structures, 500 ng of RNA was first incubated with dNTP mix, random hexamers and oligoDt (Thermo Scientific) at 65°C for 5 min, then slowly cooled to 4°C. Subsequently, reverse transcriptase buffer and enzyme were added, followed by the incubation of the samples of 10 min at 25°C, 50°C for 30 min and 85°C for 5 min.

[0190] The dPCR assay for absolute quantification of nucleic acid target sequences was performed using Qiagen’s QIAcuityOI Digital PCR system. 1.2 pl of diluted cDNA obtained from the RT-cDNA synthesis reaction was used in a total mixture of 12 pl of reaction mix, includingP5652PC00the QIAcuity Probe PCR Kit (Qiagen), a Taqman SNP genotype assay with the forward and reverse primers provided in Table 4, combined with the gene-specific probes, also as provided in Table 4, and nuclease-free water. A total volume of 12 pl ddPCR mix including cDNA was loaded in the wells of a QIAcuity Nanoplate 8.5k 96-well (Qiagen). The template for the run was set up in the QuantStudio Absolute Q Digital PCR Software where details about the run were added along with the PCR program that is commonly as follows: 2 min at 95°C, 40x 15 sec at 95°C, and 30 sec at 60°C. The editing percentage was calculated as indicated above.

[0191] Table 4. Primers and probes with their respective sequences for quantitative PCR assays. The SEQ ID NO of each primer or probe is given between brackets following the respective sequence in the middle column. The + indicates a Locked Nucleic Acid (LNA) on the 3’ side of the symbol.Name Sequence 5'-3' Item mANGPTL3_exl_FW 1 1 1 IAGCGAATGGCCTCCTG (SEQ ID NO:31) Primer mANGPTL3_exl_RV CATTGGTTCGAAGTGATAGGTC (SEQ ID NO:32) Primer / 56-FAM / l 1 1 1 G 1 CCA+T+A+AGACTAAGGGACA / 3BHQ_1 / mANGPTL3_exl_edit_FAM(SEQ ID NO:33) Probe / 5HEX / I 1 1 1 G 1 CCA+T+G+AGACTAAGGGA / 3BHQ_1 / (SEQmANGPTL3_exl_ori_HEXID NO:34) Probe

[0192] The results of the in vivo study are shown in FIG. 10. The Cd (RM123180), isolld (RM123181), and the 2’-deoxypyridin-2-one (RM123182) nucleobases performed relatively similar, with editing percentages around 5%. The Zd nucleobase (RM 123784) showed editing percentages of approximately 18%. Quite strikingly, the AON with the Ed nucleobase (RM 123183) outperformed the other four AONs with an approximate editing level of 26%, which is not only a 1.5 increase over the AON with the Zd base, but that also shows the superior benefit of using this nucleobase at the orphan position in AONs that can be used to provide RNA editing.

[0193] Example 6. RNA editing of human APP target transcripts using AONs comprising a variety of nucleobases at the orphan position.

[0194] As discussed in the examples above, the E base outperforms the Z base at multiple concentrations as shown in FIG. 7. As a follow-up experiment, the same target transcript and AONs were used as described in Example 2. The target sequence and the target adenosine in the human APP transcript are provided in SEQ ID NO: 15 (FIG. 6), and the primers and probes are identical to the ones described in Table 2. Similarly, a screen was performed on primary human hepatocytes (PHH’s) using four AONs: RM3767 (SEQ ID NO:11), RM3990 (SEQ ID NO:12), RM129714 (SEQ ID NO:35), and RM129715 (SEQ ID NO:36). Their nucleotide sequences and chemical modifications are identical except for the orphan position. RM129714 comprises a deoxynucleotide comprising a cytidine base at the orphan position (Cd) andP5652PC00RM 129715 comprises a deoxynucleotide comprising an isouracil base at the orphan position (isolld).

[0195] Primary human hepatocytes (PHHs) carrying the wild type APP editing region were obtained from BiolVT (X008001-P). Cells were retrieved from -150 °C storage on dry ice and thawed in a 37 °C water bath by shaking gently for 1-2 min. Contents were then transferred to pre-warmed CP medium (BiolVT) and cells counted manually using a Fuchs-Rosenthal counting chamber (Thermo Fisher) and microscope. The cells were diluted in pre-warmed CP medium to a concentration of 500,000 cells / mL and 50,000 cells were seeded per well in a collagen I coated 96-well plates (Corning / VWR) and incubated for 4 h to allow attachment to the bottom of the wells. Medium was then refreshed with pre-warmed CP with 1% Torpedo antibiotics mix (BiolVT) and cells incubated for 24 h. Medium was then replaced with HI medium (BiolVT) with 1% Torpedo antibiotics mix (BiolVT) and 2.5 or 5 pM of EON. Non-treated PHH cells were taken as a negative control. The cells were then incubated for 72 h, medium was remover, cells washed with cold PBS (Gibco) and lysed with MagMax MirVana lysis buffer and stored at -20 °C degrees until RNA isolation. RNA was extracted from the cell lysates using the MagMax™ mirVana™ Total RNA isolation kit (Thermo Scientific) according to the manufacturer’s instructions. RNA concentrations were measured using the Nanodrop One Spectrophotometer.

[0196] The cDNA was diluted 10x and 1.2 pL of this dilution, was used as template for a digital PCR (dPCR) with a total input of 3.5 ng cDNA per sample. The dPCR assay for absolute quantification of nucleic acid target sequences was performed using Qiagen’s QIAcuityOI Digital PCR system. 1.2 pl of diluted cDNA obtained from the RT-cDNA synthesis reaction was used in a total mixture of 12 pl of reaction mix, including the QIAcuity Probe PCR Kit (Qiagen), a Taqman SNP genotype assay with the forward and reverse primers, as shows in Table 2, combined with the gene-specific probes and Nuclease free water (Ambion). A total volume of 12 pl dPCR mix including cDNA was filled in the wells of a QIAcuity Nanoplate 8.5k 96-well (Qiagen). The template for the run was set up in the QuantStudio Absolute Q Digital PCR Software where details about the run were added along with the PCR program that was as follows: 2 min at 95 °C; 40 x 15 sec at 95 °C and 60 sec at 53.8 °C. The editing percentage was calculated as indicated above.

[0197] The results of this experiment are visualized in FIG. 11A (2.5 pM) and FIG. 11B (5 pM). As can be clearly observed, the AON comprising the Ed nucleotide at the orphan position (RM3990) outperformed the AONs with the Cd, Isolld and the Zd nucleotide at the orphan position at both concentrations. This data shows the reproducibility of the experiment shown in Example 2 and indicates the superiority of having an E-base at the orphan position in an AON that can mediate RNA editing after hybridizing to a target sequence in which the target adenosine that is to be deaminated is located directly opposite the nucleotide in the AON that carries the E-base, and wherein the double stranded complex between the AON and the targetP5652PC00transcript molecule to which it is hybridized is capable of recruiting endogenously present ADAR enzymes to deaminate the target adenosine in the target sequence.

Claims

1. P5652PC00CLAIMS1. An antisense oligonucleotide (AON) capable of forming a double stranded nucleic acid complex with a target transcript molecule in a cell, wherein the target transcript molecule is a pre-mRNA or mRNA transcript molecule, wherein the double stranded nucleic acid complex is capable of recruiting an endogenous Adenosine Deaminases Acting on RNA (ADAR) enzyme that is naturally present in the cell, for deamination of a target adenosine in the target transcript molecule, wherein the nucleotide in the AON that is directly opposite the target adenosine is the orphan nucleotide, wherein the nucleotide numbering in the AON is such that the orphan nucleotide is number 0 and nucleotides are further positively (+) incremented towards the 5’ end and negatively (-) incremented towards the 3’ end, and wherein the orphan nucleotide comprises a cytosine analog nucleobase according to formula (I):NR1R2or any of its tautomeric forms, wherein:R1, R2, R4and / or R5is H; OH; SH; =0; NH2; a halogen; a linear or branched lower (C C10) alkyl; or a C C6cycloalkyl, wherein the alkyl and / or cycloalkyl is optionally interrupted by one or more heteroatoms; andR3is H; OH; SH; NH2; or a halogen.

2. The AON according to claim 1 , wherein R1, R2, R3, R4and R5are H.

3. The AON according to claims 1 or 2, wherein the orphan nucleotide is a deoxynucleotide, or a 2’-F nucleotide.

4. The AON according to any one of claims 1 to 3, wherein the nucleotide at position -1 in the AON is a deoxynucleotide.

5. The AON according to any one of claims 1 to 4, wherein the nucleotide at position +1 in the AON is a deoxynucleotide.65P5652PC006. The AON according to any one of claims 1 to 5, wherein the internucleoside linkage numbering in the AON is such that linkage number 0 is the linkage 5’ from the orphan nucleotide, and the linkage positions in the oligonucleotide are positively (+) incremented towards the 5’ end and negatively (-) incremented towards the 3’ end, and wherein the AON comprises one or more modifications in the linkage moiety, which is each independently selected from the group consisting of: phosphorothioate (PS), phosphonoacetate, phosphorodithioate, methylphosphonate (MP), sulfonylphosphoramidate, (1,3-dimethylimidazolidin-2-ylidene) phosphoramidate (PNdmi), and mesyl phosphoramidate (PNms).

7. The AON according to claim 6, wherein linkage position -2 is a MP linkage or a PNms linkage.

8. The AON according to claim 6 or 7, wherein the linkage between the most terminal two nucleotides on the 5’ and / or 3’ terminus of the AON is a PNdmi linkage or a PNms linkage.

9. The AON according to any one of claims 1 to 8, wherein the AON comprises one or more nucleotides comprising a mono- ordi-substitution at the 2', 3' and / or 5' position of the ribose, each independently selected from the group consisting of: -OH; -F; substituted or unsubstituted, linear or branched lower (CrC10) alkyl, alkenyl, alkynyl, alkaryl, allyl, or aralkyl, that may be interrupted by one or more heteroatoms; -O-, S-, or N-alkyl; -O-, S-, or N-alkenyl; -O-, S-, or N-alkynyl; -O-, S-, or N-allyl; -O-alkyl-O-alkyl; -methoxy; -aminopropoxy; -methoxyethoxy; -dimethylamino oxyethoxy; and -dimethylaminoethoxyethoxy.

10. The AON according to any one of claims 1 to 9, wherein the AON comprises at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 nucleotides, and is at most 100 nucleotides long, preferably at most 60 nucleotides long.

11. A pharmaceutical composition comprising an AON according to any one of claims 1 to 10, and a pharmaceutically acceptable carrier or diluent.

12. An AON according to any of claims 1 to 10, or a pharmaceutical composition according to claim 11, for use in the treatment of a disorder that can be treated by a deamination of a target adenosine in a target nucleic acid molecule, preferably wherein the disorder is selected from the group consisting of: Hurler Syndrome, alpha-1 -antitrypsin (A1AT) deficiency, Parkinson’s disease, Alzheimer’s disease (AD), hypercholesterolemia, a cardiovascular disease (CVD), a liver disease, a cholestatic disease, obesity, galactosemia, type 2 diabetes mellitus (T2DM), a kidney disease, ALDH2 deficiency, Huntington’s disease (HD), Stargardt Disease, Usher syndrome, autosomal recessive non-syndromic hearing loss, a nervous system disorder, and cancer.66P5652PC0013. A method of treating a human subject suffering from Hurler Syndrome, A1AT deficiency, Parkinson’s disease, AD, hypercholesterolemia, a CVD, a liver disease, a cholestatic disease, obesity, galactosemia, T2DM, a kidney disease, ALDH2 deficiency, HD, Stargardt Disease, Usher syndrome, a nervous system disorder, or cancer, said method comprising the step of administering to said subject an AON according to any one of claims 1 to 10.

14. A method for the deamination of at least one target adenosine present in a target transcript molecule in a cell, the method comprising the steps of:(i) providing the cell with an AON according to any one of claims 1 to 10;(ii) allowing annealing of the AON to the target transcript molecule to form a double stranded nucleic acid complex capable of recruiting an endogenous ADAR enzyme that is naturally present in the cell;(iii) allowing the ADAR enzyme to deaminate the target adenosine in the target transcript molecule; and(iv) optionally identifying the presence of the deaminated adenosine in the target transcript molecule.

15. A method for the deamination of at least one target adenosine present in a target transcript molecule, the method comprising the steps of:i. providing an AON according to any one of claims 1 to 10;ii. allowing annealing of the AON to the target transcript molecule to form a double stranded nucleic acid complex;iii. allowing a mammalian ADAR enzyme to deaminate the target adenosine in the target transcript molecule; andiv. optionally identifying the presence of the deaminated adenosine in the target transcript molecule.67

Images