DOUBLE STRANDED RNAi AGENTS, COMPOSITIONS AND METHODS OF USE

WO2026202809A1PCT designated stage Publication Date: 2026-10-01NOVARTIS AG
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/IB2026/052976
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-03-28
Filing Date
2026-03-26
Publication Date
2026-10-01

Smart Images

  • Figure IMGF000009_0001
    Figure IMGF000009_0001
  • Figure IMGF000010_0001
    Figure IMGF000010_0001
  • Figure IMGF000010_0002
    Figure IMGF000010_0002
Patent Text Reader

Abstract

Disclosed are, inter alia, double stranded RNAi (dsRNAi) agents inhibiting expression of angiotensinogen (AGT), compositions including the same, and methods of treatment using the same.
Need to check novelty before this filing date? Find Prior Art

Description

PAT060035 -PCT-SEC01 DOUBLE STRANDED RNAi AGENTS, COMPOSITIONS AND METHODS OF USECROSS-REFERENCE TO RELATED APPLICATION AND INCORPORATION OF SEQUENCE LISTING

[0001] This application claims priority to U. S. Provisional Patent Appln. No.63 / 779,788 filed March 28, 2025, which is incorporated into this application by reference in its entirety. The sequence listing that is contained in the filed named “PAT060035-PCT- SEC01 ST26 SQL,” which is 1,977,762 bytes (measured in operating system MS- Windows) and was created on March 24, 2026, is filed herewith and incorporated herein by reference.BACKGROUND

[0002] Hypertension is the most common controlled disease in developed countries, affecting 20-50% of adults. It is a major risk factor for shortened life expectancy, chronic kidney disease, stroke, heart attack, heart failure, aneurysms, peripheral artery disease, heart damage, and other cardiovascular diseases. Hypertension contributes to 62% of strokes and 49% of heart disease cases.

[0003] Angiotensmogen (AGT), part of the renin-angiotensin system (RAS), is produced in the liver and converted by renin into angiotensin I, then by ACE into angiotensin II. Angiotensin II causes vasoconstriction, increasing blood pressure and stimulating aldosterone secretion. Aldosterone increases sodium and water reabsorption in the kidneys, further raising blood pressure. Overactivity of the RAS pathway leads to hypertension.

[0004] Despite several anti-hypertensive therapies available for treating hypertension, there is still an unmet need for treatments that have increased potency and / or durability of action.SUMMARY OF THE INVENTION

[0005] Provided herein are, inter alia, compounds that can inhibit expression of AGT in a subject, for example, e.g., in liver cells of a subject.

[0006] In an aspect, the disclosure provides a double stranded RNAi (dsRNAi) agent comprising:PAT060035-PCT-SEC01(i) a sense strand comprising a nucleotide sequence selected from SEQ ID NOs: 1 to 114;(ii) an antisense strand forming a duplex with the sense strand and comprising a nucleotide sequence selected from SEQ ID NOs: 115 to 228.

[0007] In some embodiments, one or more nucleotides in the sense strand and the antisense strand are modified nucleotides. In some embodiments, all nucleotides in the sense strand and the antisense strand are modified nucleotides.

[0008] In some embodiments, each of the modified nucleotides independently comprises one or more modifications selected from a 2’-deoxy modification, a 2’-O-alkyl modification, a 2'-halo modification, a threofuranosyl nucleotide (TNA) modification, a 2’- 5 ’-linkage modification, a conformationally restricting modification, an abasic modification, an inverted abasic 2 ’-deoxyribose modification, a 2’- ammo-modification, a 2’-O-allyl modification, 2’-C-alkyl modification, a 2’-O-alkoxyalkyl modification, a morpholino modification, a phosphoramidate modification, a non-natural nucleobase modification, a modification in a tetrahydropyran, a modification containing a 1,5- anhydrohexitol, a modification containing a cyclohexenyl, a modification containing a phospborothioate group, a modification containing a 5’-vinyl-phosphonate, a modification containing a 5 ’-phosphate, a modification to form a thermally destabilizing nucleotide, a glycol nucleic acid (GNA) modification, and a 2-O-(N-methylacetamide) modification.

[0009] In some embodiments, each of the modified nucleotides independently comprises one or more modifications selected from 2’-deoxy modification, 2'-O- alkoxyalkyl modification, 2'-O-alkyl modification, 2'-O-allyl modification, 2'-C-allyl modification, 2'-halo modification, modification containing anon-natural nucleobase, GNA modification, and TNA modification.

[0010] In some embodiments, the dsRNAi agent comprises a 3 ’-phospborothioate (PS) modification.

[0011] In some embodiments, each of the modified nucleotides independently comprises one or more modifications selected from 2’-deoxy modification, 2’-O-methyl (2’- OMe) modification, 2’-fluoro (2’-F) modification, 2’-O-methoxyethyl (2’-M0E) modification, the modification containing a non-natural nucleobase, TNA, GNA, 3’-phosphorothioate (PS) modification, and 5 ’-vinyl -phosphonate (5’-VP) modification.

[0012] In some embodiments, the sense strand comprises one or two 2’-MOE modifications positioned at the 1st and / or 2nd nucleotides from the 5’ end.PAT060035-PCT-SEC0100013 In some embodiments, the sense strand comprises one or two 2 / -MOE modifications positioned at the 1 st and / or 2nd nucleotides from the 3’ end.

[0014] In some embodiments, the antisense strand comprises a 5 ’-VP modification at the 1st nucleotide from the 5’ end.

[0015] In some embodiments, the antisense strand comprises a 5’-VP-2’-OMe modification at the 1 st position from the 5’ end.

[0016] In some embodiments, each of the sense strand and the antisense strand independently comprises two, three, four, five or six 2’-F modified nucleotides.

[0017] In some embodiments, the sense strand comprises one or two 3 ’-PS modifications at the 1st and / or 2nd nucleotides from the 5’ end.

[0018] In some embodiments, the sense strand comprises one or two 3 ’-PS modifications at the 1st and / or 2nd nucleotides from tire 3‘ end.

[0019] In some embodiments, the antisense strand comprises one or two 3 ’-PS modifications at the 1st and / or 2nd nucleotides from the 5’ end, and / or one or two 3 ’-PS modifications at tire 1st and / or 2nd nucleotides from the 3’ end.

[0020] In certain aspects, the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length.

[0021] In some embodiments, the sense strand comprises one to four 2’-M0E modifications positioned at the 1st, 2nd, 20th, and / or 21 st nucleotides from the 5’ end.

[0022] In some embodiments, the sense strand does not comprise a 2’-M0E modification at the 3rd to 19th positions from the 5’ end.

[0023] In some embodiments, the sense strand comprises two, three, or four 2’-F modifications positioned at the 7th, 9th, 10th, and / or 11th nucleotides from the 5’ end.

[0024] In some embodiments, the sense strand comprises one inverted abasic 2’- deoxyribose modifications positioned at the 1st nucleotide from the 5’ end.

[0025] In some embodiments, the sense strand comprises (i) 2’-F modifications positioned at the 7th, 9th, and 10th nucleotides from the 5’ end and (ii) an inverted abasic 2 ’-deoxyribose modification positioned at the 1st nucleotide from the 5’ end.

[0026] In some embodiments, the remaining nucleotides in the sense strand comprise 2’-OMe modifications.

[0027] In some embodiments, the antisense strand comprises a 5’-(E)-VP modification at the 1st nucleotide from the 5’ end.PAT060035-PCT-SEC0100028 In some embodiments, the antisense strand comprises a 5’-(E)-VP-2’-OMe modification at the 1st nucleotide from the 5’ end.

[0029] In some embodiments, the antisense strand comprises two, three, or four 2’-F modifications positioned at the 2nd, 6th, 14th, and / or 16th nucleotides from the 5’ end.

[0030] In some embodiments, the antisense strand comprises 2’-F modifications positioned at the 2nd, 6th, 14th, and 16th nucleotides from the 5’ end.

[0031] In some embodiments, the antisense strand comprises 2’-F modifications positioned at the 2nd, 6th, 14th, and 16th nucleotides from the 5’ end.

[0032] In some embodiments, the antisense strand comprises 2’-F modifications positioned at the 2nd, 6th, 14th, and 16th nucleotides from the 5’ end and 2’-deoxy modification positioned at the Sth nucleotide from the 5’ end.

[0033] In some embodiments, the antisense strand comprises 2’-F modifications positioned at the 2nd, 14th, and 16th nucleotides from the 5’ end and a 5’-(E)-VP-2’-OMe modification positioned at the 1st nucleotide from the 5’ end.

[0034] In some embodiments, the remaining nucleotides in the antisense strand comprise 2’-0Me modified modifications.

[0035] In some embodiments, the sense strand comprises one to four 3 ’-PS group at the 1st, 2nd, 20th, and / or 21st nucleotides from the 5’ end.

[0036] In some embodiments, the antisense strand comprises one to four 3 ’-PS group at the 2nd, 3rd, 22nd, and / or 23rd nucleotides from the 5’ end.

[0037] In some embodiments, at least one of the 3 ’-PS groups in each sense strand and antisense strand has a stereopure Rp configuration.

[0038] In some embodiments, at least one of the 3’-PS groups in each sense strand and antisense strand has a stereopure Sp configuration.

[0039] In certain aspects, the double stranded RNAi (dsRNAi) agent comprises:1) a sense strand comprising SEQ ID NO: 229, and an antisense strand comprising SEQ ID NO: 282;2) a sense strand comprising SEQ ID NO: 230, and an antisense strand comprising SEQ ID NO: 283;3) a sense strand comprising SEQ ID NO: 231, and an antisense strand comprising SEQ ID NO: 284;4) a sense strand comprising SEQ ID NO: 232, and an antisense strand comprising SEQ ID NO: 285;PAT060035 -PCT-SEC01) a sense strand comprising SEQ ID NO: 233, and an antisense strand comprising SEQ ID NO: 286;) a sense strand comprising SEQ ID NO: 235, and an antisense strand comprising SEQ ID NO: 288;) a sense strand comprising SEQ ID NO: 236, and an antisense strand comprising SEQ ID NO: 289;) a sense strand comprising SEQ ID NO: 237, and an antisense strand comprising SEQ ID NO: 290;) a sense strand comprising SEQ ID NO: 238, and an antisense strand comprising SEQ ID NO: 291;0) a sense strand comprising SEQ ID NO: 239, and an antisense strand comprising SEQ ID NO: 292;1 ) a sense strand comprising SEQ ID NO: 240, and an antisense strand comprising SEQ ID NO: 293;2) a sense strand comprising SEQ ID NO: 241, and an antisense strand comprising SEQ ID NO: 294;3) a sense strand comprising SEQ ID NO: 231, and an antisense strand comprising SEQ ID NO: 284;4) a sense strand comprising SEQ ID NO: 229, and an antisense strand comprising SEQ ID NO: 282;5) a sense strand comprising SEQ ID NO: 242, and an antisense strand comprising SEQ ID NO: 295;6) a sense strand comprising SEQ ID NO: 243, and an antisense strand comprising SEQ ID NO: 296;7) a sense strand comprising SEQ ID NO: 230, and an antisense strand comprising SEQ ID NO: 283;8) a sense strand comprising SEQ ID NO: 244, and an antisense strand comprising SEQ ID NO: 297;9) a sense strand comprising SEQ ID NO: 245, and an antisense strand comprising SEQ ID NO: 298;0) a sense strand comprising SEQ ID NO: 246, and an antisense strand comprising SEQ ID NO: 299;PAT060035 -PCT-SEC01) a sense strand comprising SEQ ID NO: 233, and an antisense strand comprising SEQ ID NO: 286;) a sense strand comprising SEQ ID NO: 247, and an antisense strand comprising SEQ ID NO: 286;) a sense strand comprising SEQ ID NO: 248, and an antisense strand comprising SEQ ID NO: 286;) a sense strand comprising SEQ ID NO: 249, and an antisense strand comprising SEQ ID NO: 286;) a sense strand comprising SEQ ID NO: 250, and an antisense strand comprising SEQ ID NO: 286;) a sense strand comprising SEQ ID NO: 251, and an antisense strand comprising SEQ ID NO: 286;) a sense strand comprising SEQ ID NO: 252, and an antisense strand comprising SEQ ID NO: 286;) a sense strand comprising SEQ ID NO: 253, and an antisense strand comprising SEQ ID NO: 286;) a sense strand comprising SEQ ID NO: 254, and an antisense strand comprising SEQ ID NO: 286;) a sense strand comprising SEQ ID NO: 255, and an antisense strand comprising SEQ ID NO: 300;) a sense strand comprising SEQ ID NO: 256, and an antisense strand comprising SEQ ID NO: 300;) a sense strand comprising SEQ ID NO: 257, and an antisense strand comprising SEQ ID NO: 300;) a sense strand comprising SEQ ID NO: 258, and an antisense strand comprising SEQ ID NO: 300;) a sense strand comprising SEQ ID NO: 259, and an antisense strand comprising SEQ ID NO: 300;) a sense strand comprising SEQ ID NO: 260, and an antisense strand comprising SEQ ID NO: 300;) a sense strand comprising SEQ ID NO: 261, and an antisense strand comprising SEQ ID NO: 300;PAT060035 -PCT-SEC01) a sense strand comprising SEQ ID NO: 262, and an antisense strand comprising SEQ ID NO: 300;) a sense strand comprising SEQ ID NO: 263, and an antisense strand comprising SEQ ID NO: 300;) a sense strand comprising SEQ ID NO: 264, and an antisense strand comprising SEQ ID NO: 286;) a sense strand comprising SEQ ID NO: 243, and an antisense strand comprising SEQ ID NO: 296;) a sense strand comprising SEQ ID NO: 265, and an antisense strand comprising SEQ ID NO: 301;) a sense strand comprising SEQ ID NO: 266, and an antisense strand comprising SEQ ID NO: 302;) a sense strand comprising SEQ ID NO: 267, and an antisense strand comprising SEQ ID NO: 303;) a sense strand comprising SEQ ID NO: 257, and an antisense strand comprising SEQ ID NO: 300;) a sense strand comprising SEQ ID NO: 268, and an antisense strand comprising SEQ ID NO: 300;) a sense strand comprising SEQ ID NO: 269, and an antisense strand comprising SEQ ID NO: 300;) a sense strand comprising SEQ ID NO: 268, and an antisense strand comprising SEQ ID NO: 304;) a sense strand comprising SEQ ID NO: 269, and an antisense strand comprising SEQ ID NO: 304;) a sense strand comprising SEQ ID NO: 262, and an antisense strand comprising SEQ ID NO: 300;) a sense strand comprising SEQ ID NO: 270, and an antisense strand comprising SEQ ID NO: 300;) a sense strand comprising SEQ ID NO: 271, and an antisense strand comprising SEQ ID NO: 300;) a sense strand comprising SEQ ID NO: 270, and an antisense strand comprising SEQ ID NO: 304;PAT060035 -PCT-SEC01) a sense strand comprising SEQ ID NO: 271, and an antisense strand comprising SEQ ID NO: 304;) a sense strand comprising SEQ ID NO: 272, and an antisense strand comprising SEQ ID NO: 296;) a sense strand comprising SEQ ID NO: 273, and an antisense strand comprising SEQ ID NO: 302;) a sense strand comprising SEQ ID NO: 274, and an antisense strand comprising SEQ ID NO: 302;) a sense strand comprising SEQ ID NO: 275, and an antisense strand comprising SEQ ID NO: 296;) a sense strand comprising SEQ ID NO: 267, and an antisense strand comprising SEQ ID NO: 302;) a sense strand comprising SEQ ID NO: 276, and an antisense strand comprising SEQ ID NO: 296;) a sense strand comprising SEQ ID NO: 243, and an antisense strand comprising SEQ ID NO: 301;) a sense strand comprising SEQ ID NO: 277, and an antisense strand comprising SEQ ID NO: 303;) a sense strand comprising SEQ ID NO: 276, and an antisense strand comprising SEQ ID NO: 301;) a sense strand comprising SEQ ID NO: 278, and an antisense strand comprising SEQ ID NO: 296;) a sense strand comprising SEQ ID NO: 279, and an antisense strand comprising SEQ ID NO: 300;) a sense strand comprising SEQ ID NO: 280, and an antisense strand comprising SEQ ID NO: 305;) a sense strand comprising SEQ ID NO: 272, and an antisense strand comprising SEQ ID NO: 301;) a sense strand comprising SEQ ID NO: 265, and an antisense strand comprising SEQ ID NO: 296;) a sense strand comprising SEQ ID NO: 266, and an antisense strand comprising SEQ ID NO: 303;PAT060035 -PCT-SEC0169) a sense strand comprising SEQ ID NO: 273, and an antisense strand comprising SEQ ID NO: 303;70) a sense strand comprising SEQ ID NO: 277, and an antisense strand comprising SEQ ID NO: 302; or71) a sense strand comprising SEQ ID NO: 281, and an antisense strand comprising SEQ ID NO: 302,

[0040] In some embodiments, the dsRNAi agent comprises a ligand.

[0041] In some embodiments, the ligand comprises a N-acetylgalactosamine (GalNAc) moiety.

[0042] In some embodiments, the ligand has a structure of:wherein:each L1is independently a linker which may be same or different in each occurrence;L2is a linker;n is an integer from 1 to 3; andis an attachment point to the sense strand or the antisense strand, or to a conjugate linker conjugated to the sense strand or the antisense strand.

[0043] In some embodiments, the ligand comprises the following structure ofPAT060035-PCT-SEC01wherein:each pl, p2, p3, ql, q2, rl, r2 and r3 is independently an integer from 0 to 12; each nl, n2, and n3 is independently an integer from 1 to 3; andis an attachment point to L2.[00044 j In some embodiments, the ligand has a structure of:NHAcwherein:each Lu, L12, L13, L14, and L15is an independently a linker;PAT060035 -PCT-SEC01L2is a linker:is an attachment point to the sense strand or the antisense strand, or to a conjugate linker conjugated to the sense strand or the antisense strand.[00045 j In some embodiments, the ligand has a structure of:HO OHHO OHwherein:each pl 1 and ql 1 is independently an integer from 0 to 12;each zl, z2, and z3 is independently an integer of 0 to 12; andis an attachment point to the sense strand or the antisense strand, or to a conjugate linker conjugated to the sense strand or the antisense strand.[00046 j In some embodiments, the ligand comprises the following structure:PAT060035-PCT-SEC01whereinis an attachment point to the sense strand or the antisense strand or to a conjugate linker conjugated to the sense strand or the antisense strand.PAT060035 -PCT-SEC01[00047 j In some embodiments, the ligand is conjugated to 3’ end of the sense strand to form the following structure:OHwherein W is -OH or -SH.

[0048] In some embodiments, the ligand is conjugated to 5’ end of the sense strand to form the following structure:PAT060035 -PCT-SEC01or a pharmaceutically acceptable salt thereof, wherein W is -OH or -SH.

[0049] In some embodiments, W is -OH,

[0050] In an aspect, a double stranded RNAi (dsRNAi) agent comprises:1) a sense strand consisting of SEQ ID NO: 233, and an antisense strand consisting of SEQ ID NO: 286;2) a sense strand consisting of SEQ ID NO: 243, and an antisense strand consisting of SEQ ID NO: 296;3) a sense strand consisting of SEQ ID NO: 247, and an antisense strand consisting of SEQ ID NO: 286;4) a sense strand consisting of SEQ ID NO: 256, and an antisense strand consisting of SEQ ID NO: 300;5) a sense strand consisting of SEQ ID NO: 257, and an antisense strand consisting of SEQ ID NO: 300;6) a sense strand consisting of SEQ ID NO: 258, and an antisense strand consisting of SEQ ID NO: 300;7) a sense strand consisting of SEQ ID NO: 260, and an antisense strand consisting of SEQ ID NO: 300;8) a sense strand consisting of SEQ ID NO: 261, and an antisense strand consisting of SEQ ID NO: 300;9) a sense strand consisting of SEQ ID NO: 262, and an antisense strand consisting of SEQ ID NO: 300;10) a sense strand consisting of SEQ ID NO: 263, and an antisense strand consisting of SEQ ID NO: 300;11) a sense strand consisting of SEQ ID NO: 265, and an antisense strand consisting of SEQ ID NO: 301;12) a sense strand consisting of SEQ ID NO: 267, and an antisense strand consisting of SEQ ID NO: 303;13) a sense strand consisting of SEQ ID NO: 270, and an antisense strand consisting of SEQ ID NO: 304;14) a sense strand consisting of SEQ ID NO: 271, and an antisense strand consisting of SEQ ID NO: 304;15) a sense strand consisting of SEQ ID NO: 272, and an antisense strand consisting of SEQ ID NO: 296;PAT060035 -PCT-SEC0116) a sense strand consisting of SEQ ID NO: 275, and an antisense strand consisting of SEQ ID NO: 296;17) a sense strand consisting of SEQ ID NO: 277, and an antisense strand consisting of SEQ ID NO: 303;18) a sense strand consisting of SEQ ID NO: 276, and an antisense strand consisting of SEQ ID NO: 301;19) a sense strand consisting of SEQ ID NO: 279, and an antisense strand consisting of SEQ ID NO: 300; or20) a sense strand consisting of SEQ ID NO: 266, and an antisense strand consisting of SEQ ID NO: 303;wherein the ligand (L96) is conjugated to the 3’ end of the sense strand to form the following schematic:OHor a pharmaceutically acceptable salt thereof, wherein W is -OH.

[0051] In some embodiments, the dsRNAi agent is in a pharmaceutically acceptable salt form,

[0052] In some embodiments, the pharmaceutically acceptable salt is a sodium salt.

[0053] In an aspect, the disclosure provides a pharmaceutical composition comprising the dsRNAi agent as described herein, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable earner.

[0054] In some embodiments, the composition is in an aqueous solution form.PAT060035 -PCT-SEC01

[0055] In an aspect, the disclosure provides a method of inhibiting AGT expression in a cell, the method comprising:(a) contacting the cell with the dsRNAi agent as described herein or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition as described herein; and(b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of a AGT gene, thereby inhibiting expression of the AGT gene in the cell.

[0056] In some embodiments, the disclosure provides a method of treating AGT- associated disease in a subject in need thereof, comprising administering to the subject the dsRNAi agent and a pharmaceutically acceptable salt thereof, or the pharmaceutical composition.

[0057] In some embodiments, the AGT-associated disease is selected from the group consisting of hypertension, borderline hypertension, primary hypertension, secondary hypertension, hypertensive emergency, hypertensive urgency, isolated systolic or diastolic hypertension, pregnancy-associated hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, labile hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vasculopathy, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiac myopathy, glomerulosclerosis, coarctation of tire aorta, aortic aneurism, ventricular fibrosis, Cushing’ s syndrome, and other glucocorticoid excess states including chronic steroid therapy, pheochromocytoma, reninoma, secondary aldosteronism and other mineralocorticoid excess states, sleep apnea, thyroid / parathyroid disease, heart failure, myocardial infarction, angina, stroke, diabetes mellitus, renal disease, renal failure, systemic sclerosis, intrauterine growth restriction (IUGR), and fetal growth restriction.

[0058] In some embodiments, the AGT-associated disease is selected from the group consisting of hypertension, pregnancy-associated hypertension, atherosclerosis, arteriosclerosis, and heart failure.

[0059] In some embodiments, the dsRNAi agent further comprises a ligand comprising the following structure:PAT060035-PCT-SEC01whereinis an attachment point to the sense strand or the antisense strand or to a conjugate linker conjugated to the sense strand or the antisense strand.[00060^ In some embodiments, the subject is a human.PAT060035 -PCT-SEC01

[0061] In some embodiments, the dsRNAi agent or the pharmaceutical composition is administered to the subject subcutaneously or intravenously.

[0062] In an aspect, the disclosure provides a kit comprising the dsRNAi agent as described herein, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition as described herein.

[0063] In some embodiments, the kit further comprises an applicator.

[0064] In some embodiments, the applicator is a syringe.

[0065] In some embodiments, the applicator is a pre-filled syringe.

[0066] Other aspects of the invention are disclosed infra.BRIEF DESCRIPTION OF DRAWINGS

[0067] Figure 1A. siRNA dosing regimen for AAV 8 -transgenic mice expressing human AGT (hAGT).

[0068] Figure IB. hAGT level in AAV8-transgenic mice treated with reference or select siRNAs up to 35 days post treatment according to the dosing regimen in FIG. LA.

[0069] Figure 2A. siRNA dosing regimen for HuAoGen transgenic mice expressing hAGT.

[0070] Figures 2B to Figure 21. hAGT levels in HuAoGen transgenic mice treated with reference or select siRNAs up to 91 days post treatment according to the dosing regimen in FIG. 2A.DETAILED DESCRIPTIONDefinitions

[0071] Unless defined otherwise, all technical terms, scientific terms, abbreviations, chemical structures, and chemical formulae used herein have the same meaning as is commonly understood by one of ordinary skill in the art. The chemical structures and formulae set forth herein are constructed according to the standard rules of chemical valency known in the chemical arts. All patents, applications, published applications, and other publications referenced herein are incorporated by reference in their entirety unless stated otherwise.

[0072] All patents, applications, published applications, and other publications referenced herein are incorporated by reference in their entirety unless stated otherwise. Unless otherwise indicated, conventional methods of mass spectroscopy, NMR, HPLC,PAT060035 -PCT-SEC01protein chemistry, biochemistry, recombinant DNA techniques, and pharmacology are employed.[00073 j Furthermore, use of the term “including” as well as other forms, such as “include”, “includes,” and “included,” is not limiting. As used in this specification, whether in a transitional phrase or in the body of the claim, the terms “comprise(s)” and “comprising” are to be interpreted as having an open-ended meaning. That is, the terms are to be interpreted synonymously with the phrases “having at least” or “including at least.” When used in the context of a process, the term “comprising” means that the process includes at least the recited steps, but may include additional steps. When used in the context of a compound, composition, or device, the term “comprising” means that the compound, composition, or device includes at least the recited features or components, but may also include additional features or components. As used herein, the term "a,” "an,” "the” and similar terms used in the context of the present invention (especially in the context of the claims) are to be construed to cover both the singular and plural unless otherwise indicated herein or clearly contradicted by the context.

[0074] Unless otherwise indicated, all numbers, values, and / or expressions referring to nucleotide lengths, inhibition, activities, dosages, contents, and formulations used herein are to be understood as modified in all instances by the term “about” as such numbers are inherently approximations that are reflective of, among other things, the various uncertainties of measurement encountered in obtaining such values. Further, unless specifically stated or obvious from context, as used herein, the term “about” is understood as within a range of normal tolerance in the art, for example within 2 standard deviations of the “mean. “About” may be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from the context, all numerical values provided herein are modified by the term “about.”

[0075] lire tenn “nucleic acid” means a compound containing at least two nucleotide monomers covalently linked together. Nucleic acids include polynucleotides and oligonucleotides, including double-stranded oligonucleotides and single-stranded oligonucleotides, and modified versions thereof.

[0076] The term “nucleotide” means a compound including a nucleoside and a phosphate group (or phosphodiester linkage) that are covalently attached at 5' position or 3' position of the pentofuranosyl sugar (e.g., ribose or deoxyribose). In certain aspects, the nucleotide is a ribonucleotide (RNA) having the ribose as the pentofuranosyl sugar. InPAT060035 -PCT-SEC01certain aspects, a nucleotide is a deoxyribonucleotide (DNA) having the deoxyribose (2'-deoxyribose) as the pentofuranosyl sugar. Unless otherwise specifically indicated, when referring a ‘'nucleotide” in a chain of nucleotides (e.g., oligonucleotides), e.g., X1 to X21 and X1' to X23', a nucleotide is meant by a nucleoside and a phosphate group (or phosphodiester linkage) that is covalently attached at 3' position of the pentofuranosyl sugar (e.g,, ribose or deoxyribose).[00G77] The term “nucleoside” means a monomer consisting of a nucleobase and a pentofuranosyl sugar (e.g., ribose or deoxyribose). A nucleoside including a ribose sugar HO, BaseIring has to a structure of OH OH or a pharmaceutically acceptable salt thereof,HO, Baseand a. nucleotide including a. deoxyribose sugar ring has a. structureof OH or a pharmaceutically acceptable salt, wherein in each structure, “Base” is a nucleobase.

[0078] The term “nucleobase” or “base,” as used herein, means the heterocyclic base moiety of a nucleoside or nucleotide. Non-limiting examples of nucleobases includes cytosine or a derivative thereof (e.g., cytosine analogue), guanine or a derivative thereof (e.g., guanine analogue), adenine or a derivative thereof (e.g., adenine analogue), thymine or a derivative thereof (e.g., thymine analogue), uracil or a derivative thereof (e.g,, uracil analogue), hypoxanthine or a derivative thereof (e.g., hypoxanthine analogue), xanthine or a derivative thereof (e.g., xanthine analogue), 7-methylguanine or a derivative thereof (e.g., 7-methylguanine analogue), deaza-adenine or a derivative thereof (e.g., deaza-adenine analogue), deaza-guanine or a derivative thereof (e.g., deaza-guanine), deaza-hypoxanthine or a derivative thereof, 5,6-dihydrouracil or a derivative thereof (e.g., 5,6-dihydrouracil analogue), 5-methylcytosine or a derivative thereof (e.g., 5 -methylcytosine analogue), or 5- hydroxymethylcytosine or a derivative thereof (e.g., 5-hydroxymethylcytosine analogue) moieties. In some embodiments, the nucleobase is adenine, guanine, hypoxanthine, xanthine, theobromine, caffeine, uric acid, or isoguanine, which may be optionally substituted or modified. In some embodiments, tire nucleobase isPAT060035-PCT-SEC01adenine guanine thymine uracilor methylateduracilI«AAcytidine 4-methyl 5-methylcytidine cytidinewhich may be optionally substituted or modified, wherein “‘ u ’’ denotes the point of attachment to a pentofuranosyl sugar ring (e.g., T position).

[0079] The term “phosphate,” or “phosphate group” as used herein a chemical speciesmade of one phosphorus atom and four oxygen atomso, or esters, salts, or acids thereof. In certain aspects, when the phosphate groups are positioned between adjacent nucleosides in RNA or DNA strand and form a “backbone” of the oligonucleotides, these terms “phosphate,” or “phosphate group” may be interchangeable used as “phosphate group,” “phosphate linkage,” “phosphodiester linkage,” or “linkage,” For example, the phosphate or phosphodiester linkage in the backbone of RNA or DNA may have thestructuresof or esters, salts (e.g., pharmaceutically acceptable salts), or acids £HO ^'y-P===Oo(e.g.,) thereof, wherein “ ” denotes the point of attachment to pentofuranosyl sugar rings (e.g., 5' and 3' positions) in adjacent nucleosides. In certainPAT060035-PCT-SEC01aspects, a variant of a phosphate or phosphodiester linkage, e.g., phosphorothioate (PS) linkage, can replace a phosphate group (or phosphodiester linkage) in the backbone and connect two adjacent nucleosides. In certain aspects, a variant of a phosphate or phosphodiester linkage, e.g., phosphorothioate (PS) linkage or vinyl phosphonate (VP) group, may be additionally attached at 3' end or 5' end of the oligonucleotides (e.g., RNA or DNA), e.g., 3'-OH or 5'-OH position of the terminal pentofuranosyl sugar (e.g., ribose or deoxyribose), so as to act as chemically or biologically functional group. In certain aspects, a variant of phosphate or phosphodiester linkage may also be referred as a phosphorus-derived internucleoside linkage that includes at least one phosphorus atom in the backbone.

[0080] Unless otherwise indicated herein, an unmodified RNA (or “ribonucleotide”) in a chain of nucleotides (e.g., mRNA, rRNA, or sense strand or antisense strand of siRNA) as disclosed refers to a structure ofor a pharmaceutically acceptable salt thereof. Likewise, an unmodified DNA (or “deoxyribonucleotides”) in a chain of nucleotides (e.g., genomic DNA or cDNA) as disclosed herein specifically refers to a structure ofO=P — OHor a pharmaceutically acceptable salt thereof. In each structure “Base” is a nucleobase and is an attachment point to the adjacent nucleotides.

[0081] Unless otherwise indicated herein, when an unmodified RNA is the first nucleotide from the 5' end of an RNA chain (e.g., mRNA, or sense strand or antisense strandPAT060035-PCT-SEC010=P — OHof siRNA), that nucleotide has a structureof or a pharmaceutically acceptable salt thereof. Likewise, when an unmodified DNA is the first nucleotide from the 5' end of a DNA chain (e.g., genomic DNA or cDNA), that nucleotide has a structure of, or a pharmaceutically acceptable salt thereof. In each structure “Base” is a nucleobase and » is an attachment point (5' oxygen) to the adjacent nucleotides. Alternatively but equivalently, for example, the first nucleotide from the 5' end of an RNA chain (e.g., mRNA, or sense strand or antisense strand of siRNA), that nucleotide has astructure of, or a pharmaceutically acceptable salt thereof and the first nucleotide from the 5' end of a DNA chain (e.g., genomic DNA or cDNA), that nucleotidehas a structure of, or a pharmaceutically acceptable salt thereof when is an attachment point (5' oxygen) to the adjacent nucleotides.

[0082] Unless otherwise indicated herein, when an unmodified RNA is the first nucleotide from the 3' end of an RNA chain (e.g., mRNA, or sense strand or antisense strandPAT060035-PCT-SEC01of siRNA), that nucleotide has a structureof OH, or a pharmaceutically acceptable salt. Likewise, when an unmodified DNA is the first nucleotide from the 3' end of a DNA chain (e.g., genomic DNA or cDNA), that nucleotide has a structure ofOH, or a pharmaceutically acceptable salt thereof. In certain embodiments, when an unmodified RNA is the first nucleotide from the 3' end of an RNA chain (e.g., mRNA, or sense strand or antisense strand of siRNA) that nucleotide does not include 3' end phosphate group or phosphodiester linkage, for example, which has beenremoved during hydrolysis or synthesis, has a structure of OH OH, or a pharmaceutically acceptable salt. Likewise, when an unmodified DNA is the first nucleotide from the 3' end of a DNA chain (e.g., genomic DNA or cDNA), that nucleotide does not include 3' end phosphate group, for example, which has been removed duringhydrolysis or synthesis, has a structureof OH, or a pharmaceutically acceptable salt thereof. In each structure “Base” is a nucleobase and is an attachment point (e.g., phosphorus of the phosphate linkage) to the adjacent nucleotides.

[0083] A code “A”, “G”, “C”, or “U” presented in a sequence list as disclosed herein stand for a RNA nucleotide that contains adenine, guanine, cytosine, or uracil as a base, respectively. A code “dA”, “dG”, “dC” or “dT” presented in a sequence list as disclosed herein stand for a DNA nucleotide that contains adenine, guanine, cytosine, and thymine as a base, respectively. In some embodiments, the code “T” may be present in a RNA sequence then it may refer to a nucleotide (e.g. modified nucleotide) that thymine as a base.PAT060035 -PCT-SEC01[00084 The term “oligonucleotide’’ means a shorter length nucleic acid, e.g. of less than 100 nucleotides in length, Oligonucleotides may be single -stranded or double-stranded. In some embodiments, an oligonucleotide may include naturally occurring ribonucleotides, naturally occurring deoxyribonucleotides, and / or nucleotides having one or more modifications to a naturally occurring terminus, sugar, nucleobase, and / or internucleoside linkage. Non-limiting examples of oligonucleotides include double-stranded oligonucleotides (e.g., dsRNA), single-stranded oligonucleotides (e.g., single stranded RNA or ssRNA), antisense oligonucleotides (“ASO”), small interfering RNA (siRNA), microRNA mimics, short hairpin RNAs (shRNA), single-strand small interfering RNA (ssRNAi), RNaseH oligonucleotides, anti-microRNA oligonucleotides, steric blocking oligonucleotides, exon-skipping oligonucleotides, CRISPR guide RNAs, and aptamers. In certain aspects, the oligonucleotide is a dsRNA and each strand has a length less than 100 nucleotides (“nt”), less than 90 nt, less than 80 nt, less than 70 nt, less than 60 nt, less than 50 nt, less than 40 nt, less than 35 nt, less than 30 nt, less than 28 nt, less than 26 nt, less than 25 nt, less than 24 nt, less than 23 nt, less than 22 nt, less than 21 nt, less than 20 nt, less than 19 nt, less than 18 nt, less than 17 nt, less than 16 nt, or 15 nt.

[0085] The terms “iRNA”, “RNAi agent,” “iRNA agent,”, “RNA interference agent” as used interchangeably herein, refer to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript (mRNA) via an RNA-induced silencing complex (RISC) pathway. An RNAi agent directs the sequence¬ specific degradation of mRNA through a process and thereafter inhibits expression of the gene encoded by the mRNA in a cell in vivo, e.g., in a subject (e.g., any vertebrate, mammal, or human).

[0086] The term “small interfering RNA” or “siRNA” means a double-stranded oligonucleotide (dsRNA) formed with two anti-parallel, and partially, substantially or fully complementary nucleic acid strands (e.g., a first strand and a second strand; or a “sense” strand and an “antisense” strand), which interferes with the expression of genes in a sequence-specific manner by facilitating mRNA degradation before translation through the RNA interference pathway. In some embodiments, depending on the context, the first strand can be a “guide” or antisense strand, and the second strand can be a “passenger” or sense strand. In some embodiments, depending on the context, the “first” strand can be a passenger or sense strand, and the “second” strand can be a guide or antisense. In certain aspects, an “RN Ai agent” or “siRN A agent,” as used herein, refers a double-stranded RNAPAT060035 -PCT-SEC01(dsRNA) with or without a ligand or other conjugate, and may be interchangeably used with a term “double stranded RNAi agent (dsRNAi agent),” or “dsRNA agent.” In certain aspect of the disclosure, the term “siRNA” can be used to describe a dsRNA with specific nucleotide sequences (unmodified or modified nucleotide sequences), without a ligand or other conjugate.

[0087] Tire term “antisense strand,” as used herein, refers an oligonucleotide (e.g., RNA) of an siRNA or a dsRNAi that is complementary (e.g., partially, substantially, or fully complementary) to the target mRNA and is incorporated into the RNA-induced silencing complex (RISC) to direct gene silencing in a sequence-specific manner through the RNA interference pathway. An antisense strand may also be referred to as the “guide strand.” In some embodiments, the antisense strand may have a length from 15-30 nt, 15-26 nt, 15-23 nt, 15-22 nt, 15-21 nt, 15-20 nt, 15-19 nt, 15-18 nt, 15-17 nt, 18-30 nt, 18-26 nt, 18-23 nt, 18-22 nt, 18-21 nt, 18-20 nt, 19-30 nt, 19-26 nt, 19-23 nt, 19-22 nt, 19-21 nt, 19-20 nt, 19 nt, 20-30 nt, 20-26 nt, 20-25 nt, 20-24 nt, 20-23 nt, 20-22 nt, 20-21 nt, 20 nt, 21-30 nt, 21- 26 nt, 21-25 nt, 21-24 nt, 21-23 nt, 21-22 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, 28 nt, 29 nt, 30 nt, 31 nt, 32 nt, 33 nt, 34 nt, 35 nt, or 36 nt.

[0088] The term “sense strand,” as used herein, refers an oligonucleotide that is complementary (e.g., partially, substantially, or fully complementary) to the antisense strand. The sense strand is typically degraded following incorporation of the antisense strand into RISC. The sense strand may also be referred to as the “passenger strand.” In some embodiments, the sense strand may have a length from 15-30 nt, 15-26 nt, 15-23 nt, 15-22 nt, 15-21 nt, 15-20 nt, 15-19 nt, 15-18 nt, 15-17 nt, 18-30 nt, 18-26 nt, 18-23 nt, 18-22 nt, 18-21 nt, 18-20 nt, 19-30 nt, 19-26 nt, 19-23 nt, 19-22 nt, 19-21 nt, 19-20 nt, 19 nt, 20-30 nt, 20-26 nt, 20-25 nt, 20-24 nt, 20-23 nt, 20-22 nt, 20-21 nt, 20 nt, 21-30 nt, 21-26 nt, 21- 25 nt, 21-24 nt, 21-23 nt, 21-22 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, 28 nt, 29 nt, 30 nt, 31 nt, 32 nt, 33 nt, 34 nt, 35 nt, or 36 nt.

[0089] The term “complementary” means that a nucleotide (e.g., RNA or DNA) or a sequence of nucleotides are capable of base pairing non-covalently via hydrogen bonding with another nucleotide or sequence of nucleotides. As described herein and commonly known in the art the complementary (matching) nucleotide of adenosine is thymidine or uridine and the complementary (matching) nucleotide of guanosine is cytidine. ThePAT060035 -PCT-SEC01complementarity of sequences may be partial, in which only some of the nucleic acids match according to base pairing, or complete, where all the nucleic acids match according to base pairing. For example, two sequences that are complementary to each other, may have a specified percentage of nucleotides that participate in nucleobase-pairing (i.e., about 50% complementarity, preferably 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or greater complementarity over a specified region). In some embodiments, two sequences are partially complementary when the percentage of nucleotides that participate in nucleobase-pairing is about 50%, about 55%, about 65%, about 70%, about 75%, or about 80%, or ranges from about 50% to about 80%. In some embodiments, two sequences are substantially complementary when the percentage of nucleotides that participate in nucleobase-pairing is about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 92%, about 93%, about 94%, or about 95%, or ranges from about 80% to about 95%.00090 Examples of complementary (e.g., partially, substantially, or fully complementary) sequences are sense and antisense sequences, wherein the sense sequence contains complementary (e.g., partially, substantially, or fully complementary) nucleotides to the antisense sequence and thus forms the complement of the antisense sequence. In certain aspects, a sense strand and an antisense strand of a double-stranded oligonucleotide (e.g., double stranded RNA) are substantially or fully complementary over their entire lengths. In some embodiments, a sense strand and an antisense strand of dsRNA are substantially or fully complementary over the entire length of the double -stranded region of the siRNA, and one or both termini of either strand comprises single -stranded nucleotides.

[0091] Another examples of complementary' (e.g., partially, substantially, or fully complementary) sequences are an antisense strand and its target mRNA sequence. In certain aspects, an antisense strand is substantially or fully complementary to its target mRNA. For example, the complementary (e.g., partially, substantially, or folly complementary) sequences may be between an antisense strand and a coding region of the target mRNA, or a non-coding sequence of the target mRNA. In certain aspects, an antisense strand is substantially, or fully complementary to its target mRNA to reduce or eliminate off-target profile for and to improve down-regulation of the target gene (e.g., gene of the target mRNA sequence).PAT060035 -PCT-SEC0100092 The terms “identical” or percent “identity,” in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., at least 60% identity, or at least 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or within a range defined by any of two of the preceding values, identity over a specified region when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site or the like). This definition also refers to, or may be applied to, the complement of a test sequence, The definition also includes sequences that have deletions and / or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps, insertions and the like. Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign (DNASTAR) software. Appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared can be determined by known methods.

[0093] As used herein, “target sequence” or “target gene” refer to a contiguous portion of the nucleotide sequence of an niRNA molecule formed during the transcription of a gene including mRNA that is a product of RN A processing of a primary' transcription product. The target portion of the sequence will be at least long enough to serve as a substrate tor RNAi-directed cleavage at or near that portion. For example, the target sequence will generally be from 9-36 nucleotides (“nt”) in length, e.g., 15-30 nt in length, including all sub-ranges therebetween. As non-limiting examples, the target sequence may have a length from 15-30 nt, 15-26 nt, 15-23 nt, 15-22 nt, 15-21 nt, 15-20 nt, 15-19 nt, 15-18 nt, 15-17 nt, 18-30 nt, 18-26 nt, 18-23 nt, 18-22 nt, 18-21 nt, 18-20 nt, 19-30 nt, 19-26 nt, 19-23 nt, 19- 2.2 nt, 19-21 nt, 19-2.0 nt, 19 nt, 20-30 nt, 20-26 nt, 20-25 nt, 20-24 nt, 20-23 nt, 20-22 nt, 20-21 nt, 20 nt, 21-30 nt, 21-26 nt, 21-25 nt, 21-24 nt, 21-23 nt, 21-22 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, 28 nt, 29 nt, 30 nt, 31 nt, 32 nt, 33 nt, 34 nt, 35 nt, or 36 nt.PAT060035 -PCT-SEC0100094 The term “ligand,” as used herein, refers to a compound or moiety that can impose characteristics to provide additional properties, e.g., affinity or cell delivery efficiency, to an RNAi (e.g., dsRNAi) as described herein. The ligand may be coupled or conjugated directly to the RNAi (e.g., sense strand or antisense strand of dsRNA), or indirectly to the RNAi agent (e.g., sense strand or antisense strand of dsRNA) via an intervening linker (“linker”). When a ligand is conjugated or coupled indirectly to the RNAi (e.g., dsRNA) via a linker, the ligand may be formed of a core moiety (e.g., targeting moiety) that has specific function to provide affinity or efficacy and the linker that provides merely an optimal distance, e.g., between the core moiety and the RNAi agent (dsRNA), In certain aspects, the term “ligand” embraces the ligand in combination with the linker. Examples of ligands or targeting moieties thereof may include, but not be limited to, one or more selected from a synthetic or natural compound, a peptide, an antibody, a carbohydrate (e.g., sugar moiety), or an additional nucleic acid.

[0095] The term “modified nucleotide” means a nucleotide having one or more modifications relative to a naturally occurring nucleotide, e.g., RNA. The modified nucleotide may be selected over an unmodified form because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for other oligonucleotides or nucleic acid targets, increased stability in the presence of nucleases, and / or reduced immune stimulation. In certain aspects, the modification may be present in at least one of (i) an internucleoside linkage (“linkage”), (ii) a nucleobase, and (iii) a sugar moiety of the nucleotide. In certain aspects, the modification is present in the internucleoside linkage, e.g., by chemically modifying a phosphate (or phosphodiester) linkage or replacing a phosphate (or phosphodiester) linkage with other linking groups. In certain aspects, the modification is present in a sugar moiety, i.e., ribose ring, by substituting hydroxyl group on 2' position of the ribose ring with other chemical group or by replacing a ring structure / ° with other heterocycloalkyl or cycloalkyl, glycol group having a structure of bicyclic or bridged ring on the ribose such as locked nucleic acid (LNA) having a structure 7of N, or the like. In certain aspects, the modification is present in a nucleobasePAT060035 -PCT-SEC01(e.g., A, G, C, T, or U) by chemical modification in a nucleobase by replacing the nucleobase with other moiety, for example, by replacing one naturally occurring nucleobase with another naturally occurring nucleobase. In certain aspects, a modified nucleotide may contain a modification in a sugar moiety and an unmodified phosphate (or phosphodiester) linkage. In certain aspects, a modified nucleotide may have a modification in a sugar moiety but with an unmodified nucleobase. In certain aspects, a modified nucleotide may have a modification in a sugar moiety and a nucleobase. In certain aspects, a modified nucleotide may have a modification in a sugar moiety and a phosphate (or phosphodie ster) linkage. In certain aspects, a modified nucleotide may have a modification in a sugar moiety, a phosphate (or phosphodiester) linkage and a nucleobase. In certain aspects, a modified nucleotide may have an unmodified sugar moiety and an unmodified phosphate (or phosphodiester) linkage. In certain aspects, a modified nucleotide may have an unmodified sugar moiety and an unmodified nucleobase. In certain aspects, a modified nucleotide may have an unmodified sugar moiety and a modified nucleobase. In certain aspects, a modified nucleotide may have an unmodified sugar moiety and a modified phosphate (or phosphodiester) linkage. In certain aspects, a modified nucleotide may have a modified sugar moiety, a modified phosphate (or phosphodiester) linkage and a modified nucleobase.

[0096] The term ‘"modified phosphate group,” or “modified phosphodiester linkage” as used herein refers to a chemical group in place of a phosphate group (or phosphodiester linkage) in a nucleotide as being attached to the 3' end (e.g., 3' carbon) of the pentofuranosyl group.

[0097] The terms “identical” or percent “identity,” in tire context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., at least 60% identity, or at least 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or within a range defined by any of two of the preceding values, identity over a specified region when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site or the like). This definition also refers to, or may be applied to, the complement of a test sequence, The definition also includes sequences thatPAT060035 -PCT-SEC01have deletions and / or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps, insertions and the like. Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign (DNASTAR) software. Appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared can be determined by¬ known methods.[00098 j Throughout the disclosure, nucleotide positions or coordinates are relative to the beginning (5' end) of the reference transcript.

[0099] The term “overhang” or “nucleotide overhang” herein refers to at least one unpaired nucleotide that protrudes from the end of at least one of the two strands of the duplex structure of an RNAi agent. In some embodiments, when a 3'-end of one strand extends beyond the 5 '-end of the other strand, or vice versa, this forms a nucleotide overhang, e.g., the unpaired nucleotide(s) form the overhang.[000100] “Blunt” or “blunt end” means that there are no unpaired nucleotides at that end of the double stranded RNAi agent, i.e., no nucleotide overhang. A “blunt ended” RNAi agent is a dsRNA that is double-stranded over its entire length, i.e., no nucleotide overhang at either end of the molecule.[000101] A “mismatch” is defined herein as a difference between the base sequence (e.g., A instead of G) or length when two sequences are maximally aligned and compared. In certain aspects, the term “mismatch” means a nucleobase of a first oligonucleotide (e.g., a first strand) that is not capable of pairing with a nucleobase at a corresponding position of a second oligonucleotide (e.g., a second strand).[000102] The term “non-end” herein refers to a position between the 3' end and the 5' end of the sense or antisense strand.[000103] The term “A GT” includes human AGT, the amino acid and complete coding sequence of which may be found in, for example, GenBank: NM_001384479.1 (SEQ ID NO: 393)1 gaagaagctg ccgttgttct gggtactaca gcagaagggt atgcggaagc gagcacccca61 gtctgagatg gctoatgccg gtgtgagcct gagggccaco atcctctgcc tcctggcctgPAT060035-PCT-SEC01121 ggctggcctg gctgcaggtg accgggtgta catacacccc ttccacctcg tcatccacaa181 tgagagtaac tgtgagcagc tggcaaaggc caatgccggg aagccoaaag accccacct t241 catacctgct ccaattcagg ccaagacatc ccctgtggat gaaaaggccc t a c agqa c c a301 gctggtgcta gtcgctgaaa aacttgacac cgaagaoaag ttgagggccg caatggtcgg361 gafcgatggcc aacttcttgg gcttccgtat atatggcatg cacagtgagc tatggggcgt421 ggtccatggg gccaccgtcc tctccccaac ggctgtcttt gg cac cc t g cctctctcta481 tctgggagcc ttggaccaca aagctgaaag gctacaggca atcctgggtg ttccttggaa541 ggacaagaac tgcacctccc ggctggatgc gcaaaaggtc ct.gtctgccc tgcaggctgt601 acagggcctg atagtggacc agggcagggc tgatagccag gcoaagctgo tgctgtccac661 ggtggtgggc gtgttcacag cccaaggcct gcacctgaag cagacgtttg tgcagggcct721 ggctctctat acccctgtgg tcctcccacg ctctctggac ttcacagaac tggatgttgc781 tgctgagaag attgacaggt tcatgcaggc tgtgacagga tggaagactg gctgctccct841 gatgggagac agtgtggaca gcaccctggc tttcaacacc tacgtzcaact tccaagggaa901 gatgaagggc ttctccctgc tggccgagcc ccaggagttc tgggtggaca acagcacctc961 agtgtctgtt cccatgctct ctggcatggg caccttcxiag cactggagtg acatccagga1021 caacttctcg gtgacfccaag tgcacttcac tgagagcgcc fcgcatgcfcgc tgatccagcc1081 tcactatgcc tctgacctgg acaaggtgga gggtctcact ttccagcaaa actccctcaa1141 ctggafcgaag aaactatctc accggacaat. ccacctgacc atgcccaaac tggtgctgca1201 aggatcttat gacctgcagg acctgctcgc ccaggctgag ctgcccgcca ttctgcacac1261 cgagatgaac ctgcaaaaat tgagcaatga ccgcatcagg gtgggggagg tgctgaacagPAT060035 -PCT-SEC011321 catttttttt gagcttgaag cggatgagag agagcccaca gagtctaccc aacagcttaa1381 oaagcctgag gtcttggagg tgaccctgaa ccgcccattc ctgtttgctg tgtatgatca1441 aagcgccact gccctgcact tcctgggccg cgtggccaac ccgctgagca cagcatgagg1501 ccagggcccc agaacaoagt gcctggcaag gcctctgccc ctggcctttg aggcaaaggc1561 cagcagcaga taacaacccc ggacaaatca gcgatgtgtc acccccagtc tcccaccttt1621 tcttctaatg agtcgacttt gagctggaaa gcagccgttt ctccttggtc taagtgtgct1681 gcatggagtg agcagtagaa gcctgcagcg gcaaaaatgc acctcccagt ttgctgggtt1741 tattttagag aatgggggfcg gggaggcaag aaccagtgtt tagcgcggga ct actgttcc1801 aaaaagaatt ccaaccgacc agcttgtttg tgaaacaaaa aagtgttccc ttttcaagtt1861 gagaacaaaa attgggtttt aaaattaaag tatacatttt tgcattgcct tcggtttgta1921 tttagtgtct tgaatgtaag aacatgacct ccgtgtagtg tctgtaatac c 11 ag 11111981 tccacagatg cttgtgattt ttgaacaata cgtgaaagat gcaagcacct gaatttctgt2041 ttgaatgcgg aaccatagct ggttatttct cccttgtgtt agtaataaac gt cttgccac2 ±01 aataagcctc caaaaa[000104] In certain aspects, AGT may include a fragment, variant, or mutant of the protein that may have the same or similar amino acid sequences (e.g., having about 80%, 85%, 90%, 95%, or 99% or greater of similarity or identity of amino acid sequences) with any one of the above listed AGT gene (mRNA) or protein sequences. In certain aspects, AGT ay include a fragment, variant, or mutant of the protein having the same or in similar in vivo or in vitro enzymatic (e.g., reductase) activity, for example, having about 80%, 85%, 90%, 95%, or 99% or the native protein activity.[000105] The term ‘‘Compound’1as used herein refers to a double stranded RNA (e.g., AGT dsRNA or dsRNAi agent) that is conjugated with a ligand or a delivery moiety, while a term “compound” denotation may refer to a substance, molecule or chemical entity’ thatPAT060035 -PCT-SEC01can be chemically defined and / or identifiable. In the present disclosure. Compounds are numbered in examples, e.g., “Ml” or “NVS1.”[000106] As defined herein, the term “inhibition”, “inhibit”, “inhibiting” and the like mean negatively affecting (e.g. decreasing) activity, expression or function relative to the activity-, expression or function in the absence of an inhibitor. In certain aspects, inhibition can mean negatively affecting (e.g. decreasing) the concentration or levels of a biomolecule, such as a protein or mRNA, relative to the concentration or level of the biomolecule in the absence of an inhibitor. In certain aspects, inhibition includes, partially or totally, blocking stimulation, decreasing, preventing, or delaying activation; inactivating, desensitizing, or down-regulating signal transduction or enzymatic activity; or decreasing the amount of a biomolecule target (e.g., protein target or mRNA target). In certain aspects, inhibition refers to a reduction in the expression of a particular biomolecule target, such as a protein target (e.g., AGT protein) or an mRNA target (e.g., AGT mRNA). In certain aspects, inhibition refers to a reduction of amount of a target biomolecule (e.g., AGT protein or mRNA) resulting from a down-regulating protein expression (e.g. directly inhibiting translation or transcription). In certain aspects, inhibition refers to a reduction of activity of a target biomolecule (e.g., AGT protein or mRNA) from an indirect interaction (e.g., inhibiting or regulating other transcriptional or translational factors).[000107] lire term “inhibitor” also refers to a compound, composition, or substance capable of detectably negatively affecting (e.g. decreasing) activity, expression or function of a given protein or gene. For example, an inhibitor may decrease activity, expression or function by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater in comparison to a control in the absence of the inhibitor. Inhibitors include, for example, synthetic or biological molecules, such as oligonucleotides. In some embodiments, the inhibitors include RNAi agent, e.g., siRNA agent, dsRNAi agent, or dsRNA agent.[000108] As used herein, the “level or degree of inhibiting or decreasing expression” of a given gene refers to the at least partial suppression of the expression of a target gene (e.g., AGT), as manifested by a reduction of the amount of the target gene mRNA (e.g., AGT mRNA) or protein (e.g., AGT) encoded by the target gene, which may be isolated from or detected m a group of cells (“a first, cell”) in which a target, gene is transcribed and which has or have been treated such that the expression of a target gene is inhibited, as compared to group of cells substantially identical to the first cell but without treated (“control cells” or “a second cell”).PAT060035 -PCT-SEC01000109] In some embodiments, the level or expression of the target gene (e.g., AGT) can be measured by evaluation of mRNA (e.g., via Northern blots or PCR). The effect of an RNAi agent on the target gene (e.g., AGT) expression can be determined by measuring the gene transcription rates (e.g., via Northern blots; or reverse transcriptase polymerase chain reaction or real-time polymerase chain reaction). In some embodiments, the degree of inhibition can be calculated as the following equation:(mRNA in control cells) - (mRNA in treated cells) *0 / (mRNA in control cells)[000110] Alternatively, the degree of inhibition may be given in terms of a reduction of a parameter that is functionally linked to target gene (e.g., AGT) expression, e.g., the amount of protein encoded by a target gene (e.g., AGT), alteration in expression of the protein whose expression is dependent on the target gene (e.g., AGT), alteration in an activity of the enzyme (e.g., AGT) encoded by the target gene (e.g., AGT). In some embodiments, the level or expression of the protein (e.g., AGT) from the target gene can be evaluated by measuring the expressed protein amount (e.g.. Western blots). In some embodiments, the level or expression of the protein from the target gene can be measured by the enzymatic assay (e.g., kinetic assay) of the protein.[000111 ] As used herein, the term “down-regulate” or “down -regulating” refers to any decrease (e.g., statistically significant) in abioiogical activity and / or expression of the target protein (e.g., AGT), including full blocking of the activity (i.e., complete inhibition) and / or expression. For example, “down-regulation” can refer to a decrease of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% in target protein (e.g., AGT) level, activity and / or expression.[000112] As used herein, the terms “salt” or “salts” refers to an acid addition or base addition salt of a compound of the present invention. “Salts” include in particular “pharmaceutical acceptable salts”. The term “pharmaceutically acceptable salts” refers to salts that retain the biological effectiveness and properties of the compounds of this invention and, which typically are not biologically or otherwise undesirable. In many cases, the compounds of the present invention are capable of forming acid and / or base salts by virtue of the presence of amino and / or carboxyl groups or groups similar thereto. When both a basic group and an acid group are present in the same molecule, the compounds of the present invention may also form internal salts, e.g., zwitterionic molecules. In certain aspects, pharmaceutically acceptable acid addition salts can be formed with inorganic acidsPAT060035 -PCT-SEC01and organic acids. Examples of the inorganic acids from which salts can be derived include, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like. Examples of the organic acids from which salts can be derived include, for example, acetic acid, propionic acid, glycolic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, toluene sulfonic acid, sulfosalicylic acid, and the like. In certain aspects, the pharmaceutically acceptable base addition salts can be formed with inorganic and organic bases. Examples of the inorganic bases from which salts can be derived include, for example, ammonium salts and metals from columns I to XII of the periodic table, such as sodium, potassium, ammonium, calcium, magnesium, iron, silver, zinc, and copper; particularly suitable salts include ammonium, potassium, sodium, calcium and magnesium salts. Examples of the organic bases from which salts can be derived include, for example, primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, basic ion exchange resins, and the like, such as organic amines include isopropylamine, benzathine, cholmate, diethanolamine, diethylamine, lysine, meglumine, piperazine and tromethamine,[000113] In certain aspects, the term “pharmaceutically acceptable salt” as used herein may include the salts forms in acetate, ascorbate, adipate, aspartate, benzoate, besylate, bromide / hydrobromide, bicarbonate / carbonate, bisulfate / sulfate, camphorsulfonate, caprate, chloride / hydrochloride, chlortheophyllonate, citrate, ethandisulfonate, fumarate, gluceptate, gluconate, glucuronate, glutamate, glutarate, glycolate, hippurate, hydroiodide / iodide, isethionate, lactate, lactobionate, laurylsulfate, malate, maleate, malonate, mandelate, mesylate, methylsulphate, mucate, naphthoate, napsylate, nicotinate, nitrate, octadecanoate, oleate, oxalate, palmitate, pamoate, phosphate / hydrogen phosphate / dihydrogen phosphate, polygalacturonate, propionate, sebacate, stearate, succinate, sulfosalicylate, sulfate, tartrate, tosylate trifenatate, trifluoroacetate or xinafoate.[000114] As used herein, the term "pharmaceutically acceptable earner" refers to a substance useful in the preparation or use of a pharmaceutical composition and includes, for example, suitable diluents, solvents, dispersion media, surfactants, antioxidants, preservatives, isotonic agents, buffering agents, emulsifiers, absorption delaying agents, salts, drug stabilizers, binders, excipients, disintegration agents, lubricants, wetting agents, sweetening agents, flavoring agents, dyes, and combinations thereof, as would be known toPAT060035 -PCT-SEC01those skilled in the art (see, for example, Remington The Science and Practice of Pharmacy, 22nd Ed. Pharmaceutical Press, 2013, pp. 1049-1070).[000115] As used herein, the term "‘treat,” “treating,” or “treatment” of any disease or disorder refers to alleviating or ameliorating the disease or disorder (i.e., slowing or arresting the development of the disease or at least one of the clinical symptoms thereof); or alleviating or ameliorating at least one physical parameter or biomarker associated with the disease or disorder, including those which may not be discernible to the patient. In some embodiments, treating does not include preventing.[000116] As used herein, the term “prevent”, “preventing" or “prevention” of any disease or disorder refers to the prophylactic treatment of the disease or disorder; or delaying the onset or progression of the disease or disorder.[000117] lire term “therapy,” as used herein refers to an application of one or more specific procedures used for the amelioration of at least one indicator or a disease or condition. In certain aspects, the specific procedure is the administration of one or more pharmaceutical or therapeutic agents.[000118] The term “associated” or “associated with” in the context of a substance or substance activity or function associated with a disease (e.g. a protein associated disease, or AGT associated disease) means that the disease is caused by (in whole or in part), or a symptom of the disease is caused by (in whole or in part) the substance or substance activity or function (e.g., AGT activity or function). Thus, as used herein, what is described as “being associated” with a disease, if a causative agent, could be a target for treatment of the disease.[000119] As used herein, the term “administering” means oral administration, administration as a suppository, topical contact, intravenous, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal or subcutaneous administration, or the implantation of a slow-release device, e.g., a mini-osmotic pump, to a subject. Administration is by any route, including parenteral and transmucosal (e.g,, buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal) compatible with the preparation. Parenteral administration includes, e.g., intravenous, intramuscular, intra-arteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial. Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, etc.PAT060035 -PCT-SEC01000120] The terms "subject" and “patient” as used herein are used interchangeably, lire term subject includes a human or non-human animal, preferably a vertebrate, and more preferably a mammal. In certain aspects, the subject is a human. In certain aspects, the subject is a human patient.[000121] As used herein, a subject is “in need of’ a treatment if such subject would benefit biologically, medically or in quality of life from such treatment.[0001221 The term "a therapeutically effective amount" of a compound (e.g., siRNA) as disclosed herein refers to an amount of the compound that will elicit the biological or medical response of a subject, for example, reduction or inhibition of an enzyme or a protein activity, or ameliorate symptoms, alleviate conditions, slow or delay disease progression, or prevent a disease, etc. In certain aspects, the term “a therapeutically effective amount” refers to tire amount of tire compound (e.g., siRNA) of the disclosure that, when administered to a subject, is effective to (1) at least partially alleviate, prevent and / or ameliorate a condition, or a disorder or a disease (i) mediated by the target gene (e.g., AGT), or (ii) associated with its activity, or (iii) characterized by activity (normal or abnormal) of the protein encoded by the target gene (e.g., AGT); or (2) reduce or inhibit the activity of the protein encoded by the target gene (e.g., AGT); or (3) reduce or inhibit the expression of the target gene (e.g., AGT). In certain aspects, the term “a therapeutically effective amount” refers to the amount of the compound that, when administered to a cell, or a tissue, or a non-cellular biological material, or a medium, is effective to at least partially reducing or inhibiting the activity of the protein encoded by the target gene (e.g., AGT); or at least partially reducing or inhibiting the expression of the protein (e.g., AGT) encoded by the target gene. The meaning of the term “a therapeutically effective amount” as illustrated in the above embodiment, for the target gene expression also applies by the same means to any other relevant proteins / peptides / enzymes (e.g., AGT or other proteins relevant to cholesterol uptake).[000123] For any compound described herein, the therapeutically effective amount can be initially determined from cell culture assays. Target concentrations will be those concentrations of active compound(s) that are capable of achieving the methods described herein, as measured using the methods described herein or known in the art. Therapeutically effective amounts for use in humans can also be determined from animal models. For example, a. dose for humans can be formulated to achieve a concentration that has been found to be effective in animals. The dosage in humans can be adjusted by monitoring compounds effectiveness and adjusting the dosage upwards or downwards, as describedPAT060035 -PCT-SEC01above. An example of an “therapeutically effective amount” is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease. For example, for the given parameter (e.g., biomarker), a therapeutically effective amount will show an increase or decrease of at least about 5%, about 10%, about 15%, about 2.0%, about 25%, about 40%, about 50%, about 60%, about 75%, about 80%, about 90%, or about 95%. Therapeutic efficacy can also be expressed as “-fold” increase or decrease. For example, a therapeutically effective amount can have at least a 1.2 -fold, 1.5-fold, 2-fold, 5-fold, or more effect over a control.[000124] The term “control” or “control experiment” is used in accordance with its plain ordinary meaning and refers to an experiment in which the subjects or reagents of the experiment are treated as in a parallel experiment except for omission of a procedure, reagent, or variable of the experiment. Typically, a control is used as a standard of comparison in evaluating experimental effects. In some embodiments, a control is the measurement of the expression of a protein or mRNA (e.g., AGT) in the absence of RNAi agents as described herein.[000125] Unless defined otherwise, the chemical structures and formulae set forth herein are constructed according to the standard rales of chemical valency known in the chemical arts.[000126] The term “alkyl,” by itself or as part of another substituent, means, unless otherwise stated, a straight (i.e., unbranched) or branched carbon chain (or carbon), or combination thereof, which is fully saturated (i.e., molecule by only single bonds) and include mono-, di- and multivalent radicals. As used herein, the alkyl is an uncyclized chain. The alkyl may include a designated number of carbons (e.g., Ci-Cio means one to ten carbons). Examples of alkyl include, but are not limited to, groups such as C1-30 alkyl, C1-25 alkyl, C1-20 alkyl, C1-15 alkyl, C1-12 alkyl, C1-10 alkyl, Ci-8 alkyl, Ci-6 alkyl, Ci-4 alkyl, or Ci-3 alkyl. For example, C1-6 alkyl include, but are not limited to, methyl, ethyl, n-propyl, 1- methylethyl (iso-propyl), n-butyl, n-pentyl and 1,1 -dimethylethyl (t-butyl), and their isomers.[000127] A term “alkylene,” by itself or as part of another substituent, means, unless otherwise stated, a divalent radical derived from an alkyl, as exemplified, but not limited by, -CH2CH2CH2CH2-.[000128]. As used herein, the term "alkenyl," by itself or as part of another substituent, means, unless otherwise stated, a straight (i.e., unbranched) or branched carbon chain (orPAT060035-PCT-SEC01carbon), or combination thereof, which is mono- or polyunsaturated (i.e., molecule including at least one double bond) and include mono-, di- and multivalent radicals. As used herein, the alkenyl is an uncyclized chain. Like the alkyl, the alkenyl may include a designated number of carbons (e.g., Ci-Ciomeans one to ten carbons). Examples of alkenyl include, but are not limited to, groups such as C1-30 alkenyl, C1-25 alkenyl, Ci-20 alkenyl, Ci-15 alkenyl, Ci-12 alkenyl, Ci-ioalkenyl, C1-8 alkenyl, C1-6 lkenyl, CM alkenyl, or C 1-3 alkenyl. For example, C2-6 alkenyl include, but are not limited to, ethenyl (vinyl), prop-l-enyl, but- 1-enyl, pent-l-enyl, pent-4-enyl and penta- 1,4-dienyl, and their isomers. A term “alkenylene,” by itself or as part of another substituent, means, unless otherwise stated, a divalent radical derived from an alkenyl, as exemplified, but not limited by, - CH-CHCH2CH2-.[000129] As used herein, the term " alkynyl,” by itself or as part of another substituent, means, unless otherwise stated, a straight (i.e., unbranched) or branched carbon chain (or carbon), or combination thereof, which is mono- or polyunsaturated (i.e., molecule including at least one triple bond) and include mono-, di- and multivalent radicals. As used herein, the alkynyl is an uncyclized chain. Like the alkyl, the alkynyl may include a designated number of carbons (e.g., C1-C10 means one to ten carbons). Examples of alkynyl include, but are not limited to, groups such as C1-30 alkynyl, C 1-25 alkynyl, C1-20 alkynyl, Ci-15 alkynyl, C1-12 alkynyl, Ci-io alkynyl, Ci-s alkynyl, C1-6 alkynyl, C1-4 alkynyl, or Ci-3 alkynyl. For example, C2-6 alkynyl include, but are not limited to, alkynyl, and their isomers. A term “alkynyl,” by itself or as part of another substituent, means, unless otherwise stated, a divalent radical derived from an alkenyl, as exemplified, but not limited by, -CCH2CH2-.[000130] As used herein, the term “alkoxy” refers to a radical of the formula -ORawhere Rais an alkyl (e.g., C1-30 alkyl, C1-25 alkyl, C1-20 alkyl, C1-15 alkyl, C1-12 alkyl, C1-10 alkyl, Ci- a alkyl, C1-6 alkyl, CM alkyl, or C1-3 alkyl) radical as generally defined above. For example. Ci -6 alkoxy include, but are not limited to, methoxy, ethoxy, propoxy, isopropoxy, butoxy, isobutoxy, pentoxy, and hexoxy.[000131] As used herein, the term " alkoxyalkyl " refers to a radical of the formula -Ra-O-Rbwhere each Raand R.bis independently an alkyl (e.g.. Ci -30 alkyl, Ci-25 alkyl, Ci-2oalkyl, Ci-15 alkyl, Ci-12 alkyl, C1-10 alkyl, Ci-s alkyl, C1-6 alkyl. C alkyl, or C1-3 alkyl) radical as defined above and oxygen atom may be bonded to any carbon atom in either alkyl radical. For example, Ci-ealkoxy Ci-6alkyl include, but are not limited to, methoxy-methyl, methoxy-ethyl, ethoxy -ethyl, 1 -ethoxy-propyl and 2-methoxy-butyl.PAT060035 -PCT-SEC01(000132] As used herein, the term “alkylcarbonyl” refers to a radical of the formula -C(=O)-Ra where Rais an alkyl (e.g., C1-30 alkyl, C1-25 alkyl, Ci-20 alkyl, Ci- 15 alkyl, Ci-12 alkyl, Ci-ioalkyl, Ci-s alkyl, C1-6 alkyl, Ci-4 alkyl, or C1-3 alkyl) radical as defined above.[000133] As used herein, the term "alkyl-carbonyl alkyl” refers to a radical of the formula, e.g., -Ra-C(=O)-Rbwhere each Raand Rbis independently an alkyl (e.g., Ci-30 alkyl, C1-25 alkyl, C1-20 alkyl, C1-15 alkyl, Ci-i2 alkyl, C1-10 alkyl, Ci-s alkyl, Ci-6 alkyl, C 1-4 alkyl, or Ci-3 alkyl) radical as defined above. The carbon atom of the carbonyl group may be bonded to any carbon atom in either alkyl radical.[000134] As used herein, the term "alkylaminocarbonyl" refers to a radical of the formula -C(=O)-NH-Rawhere Rais an alkyl (e.g., C1-30 alkyl, C1-25 alkyl, Ci-20 alkyl, C1-15 alkyl, Ci- 12 alkyl, C1-10alkyl, Ci-s alkyl, Ci-6 alkyl, C1-4 alkyl, or Ci-3 alkyl) as defined above.[000135] As used herein, the term "alkoxy carbonyl” refers to a radical of the formula - C(=O)-O-Rawhere Rais an alkyl (e.g., C1-30 alkyl, Ci-25 alkyl, C1-20 alkyl, Ci-i5 alkyl, C1-12 alkyl, Ci-10 alkyl, Ci-s alkyl, C1-6 alkyl, C1-4 alkyl, or C1-3 alkyl) radical as defined above.[000136] As used herein, the term “alkoxycarbonyl alkyl” refers to a radical of the formula -Ra-C(=O)-O-Rbwhere each Raand Rbis independently an alkyl (e.g., C1-30 alkyl, Ci -25 alkyl, C1-20 alkyl, C1-15 alkyl, Ci-i2 alkyl, Ci-io alkyl, Ci-s alkyl, C 1-6 alkyl, C 1-4 alkyl, or Ci -3 alkyl) radical as defined above.[000137] As used herein, the term "haloalkyl” refers to an alkyl (e.g., C1-30 alkyl, Ci-25 alkyl, C1-20 alkyl, C1-15 alkyl, Ci-i2 alkyl, C1-10 alkyl, Ci-s alkyl, Ci-6 alkyl, C 1-4 alkyl, or Ci-3 alkyl) radical, as defined above, substituted by one or more halo radicals, as defined above. Examples of halogenCi -ealkyl include, but are not limited to, trifluoromethyl, di fluoromethyl, fluoromethyl, trichloromethyl, 2,2,2-trifluoroethyl, 1,3 -dibromopropan -2-yl, 3-bromo-2-fluoropropyl and l,4,4-trifluorobutan-2-yl.[000138]. As used herein, the term "hydroxyalkyl” refers to an alkyl (e.g., C1-30 alkyl, Ci-25 alkyl, C1-20alkyl, C1-15alkyl, C1-12 alkyl. C1-10alkyl, Ci-s alkyl, C1-6 alkyl, C1-4 alkyl, or Ci-3 alkyl) radical as defined above, wherein one of the hydrogen atoms of the alkyl radical is replaced by OH. Examples of hydroxyC 1-6 alkyl include, but are not limited to, hydroxy¬ methyl, 2-hydroxy-ethyl, 2 -hydroxy-propyl, 3 -hydroxy -propyl and 5 -hydroxy-pentyl.[000139] As used herein, the term “aminoalkyl” refers to an alkyl (e.g., C1-30 alkyl, Ci-25 alkyl, C1-20 alkyl, Ci-15 alkyl, C1-12 alkyl, Ci-ioalkyl, Ci-s alkyl, C 1-6 alkyl, C1-4 alkyl, or Ci-3 alkyl) radical as defined above, wherein one of the hydrogen atoms of the Ci-ealkyl group is replaced by a primary amino group. Examples of amino Ci-ealkyl include, but are notPAT060035 -PCT-SEC01limited to, amino-methyl, 2-amino-ethyl, 2-amino-propyl, 3 -amino-propyl, 3 -amino-pentyl and 5-amino-pentyl.[000140] As used herein, the term “alkylamino” refers to a radical of the formula -NH-Rawhere Rais an alkyl (e.g., Ci-io alkyl, C1-25alkyl, C1-20 alkyl, C1-15 alkyl, Ci-12 alkyl, C1-10 alkyl, Ci-8 alkyl, Ci-e alkyl, C 1-4 alkyl, or Cm alkyl) radical as defined above.[000141] The term “heteroalkyl,” by itself or in combination with another term, means, unless otherwise stated, a stable straight or branched chain, or combination thereof, which is fully saturated (i.e., molecule by only single bonds) and include mono-, di- and multivalent radicals, including at least one carbon atom and at least one heteroatom (e.g., O, N, S, Si, or P), and wherein the nitrogen and sulfur atoms may optionally be oxidized, and the nitrogen heteroatom may optionally be quaternized. The heteroatom(s) (e.g., O, N, S, Si, or P) may be placed at any interior position of the heteroalkyl group or at the position at which the alkyl group is attached to the remainder of the molecule. Heteroalkyl is an uncyclized chain. The heteroalkyl may include a designated number of carbons and heteroatoms (e.g., “2 to 10 membered heteroalkyl” means two to 10 atoms including carbons and heteroatoms).[000142] Similarly, the term ‘heteroalkylene,” by itself or as part of another substituent, means, unless otherwise stated, a divalent radical derived from heteroalkyl, as exemplified, but not limited by, -CH2-CH2-S-CH2-CH2- and -CH2-S-CH2-CH2-NH-CH2-. For heteroalkylene groups, heteroatoms can also occupy either or both of the chain termini (e.g., alkyleneoxy, alkylenedioxy, alkyleneamino, alkylenediamino, and the like).[000143] As used herein, the term "heteroalkenyl," by itself or as part of another substituent, means, unless otherwise stated, a straight (i.e., unbranched) or branched carbon chain (or carbon), or combination thereof, which is mono- or polyunsaturated (i.e., molecule including at least one double bond between carbon and carbon) and include mono-, di- and multivalent radicals. As used herein, the alkenyl is an uncyclized chain. Like the alkenyl, the heteroalkenyl may include a designated number of carbons and heteroatoms (e.g., “2 to 10 membered heteroalkenyl” means two to 10 atoms including carbons and heteroatoms).[000144] As used herein, the term " heteroalkynyl," by itself or as part of another substituent, means, unless otherwise stated, a straight (i.e., unbranched) or branched carbon chain (or carbon), or combination thereof, which is mono- or polyunsaturated (i.e., molecule including at least one triple bond between carbon and carbon) and include mono-, di- and multivalent radicals. As used herein, the alkynyl is an uncyclized chain. The heteroalkynylPAT060035 -PCT-SEC01may include a designated number of carbons and heteroatoms (e.g., “2 to 10 membered heteroalkynyl” means two to 10 atoms including carbons and heteroatoms).[000145] For alkylene and heteroalkylene linking groups, no orientation of the linking group is implied by the direction in which the formula of the linking group is written. For example, the formula -C(O)2R′- represents both -C(O)2R'- and -R'C(O)2~.[000146] A “cycloalkylene” and a “heterocycloalkylene,” alone or as part of another substituent, means a divalent radical derived from a cycloalkyl and heterocycloalkyl, respectively. The terms “cycloalkyl” and “heterocycloalkyl,” by themselves or in combination with other terms, mean, unless otherwise stated, cyclic versions of “alkyl” and “heteroalkyl,” respectively. Cycloalkyl and heterocycloalkyl are not aromatic. Additionally, for heterocycloalkyl, a heteroatom can occupy the position at which the heterocycle is attached to the remainder of the molecule. Examples of cycloalkyl include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, 1 -cyclohexenyl, 3- cyclohexenyl, cycloheptyl, and the like. Examples of heterocycloalkyl include, but are not limited to, l-(l,2,5,6“tetrahydropyridyl), 1-piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-morpholinyl, 3-morpholinyl, tetrahydrofuran-2-yl, tetrahydrofuran-3-yl, tetrahydrothien-2- yl, tetrahydrothien-3-yl, 1 -piperazinyl, 2 -piperazinyl, and the like. A “cycloalkylene” and a “heterocycloalkylene,” alone or as part of another substituent, means a divalent radical derived from a cycloalkyl and heterocycloalkyl, respectively.[000147] Tire term “aryl” means, unless otherwise stated, a polyunsaturated, aromatic, hydrocarbon substituent, which can be a single ring or multiple rings (preferably from 1 to 3 rings) that are fused together (i.e., a fused ring aryl) or linked covalently. A fused ring aryl refers to multiple rings fused together wherein at least one of the fused rings is an aryl ring. The term “heteroaryl” refers to aryl groups (or rings) that contain at least one heteroatom such as N, O, or S, wherein the nitrogen and sulfur atoms are optionally oxidized, and the nitrogen atom(s) are optionally quaternized. Thus, the term “heteroaryl” includes fused ring heteroaryl groups (i.e., multiple rings fused together wherein at least one of the fused rings is a heteroaromatic ring). A 5,6-fused ring heteroarylene refers to two rings fused together, wherein one ring has 5 members and the other ring has 6 members, and wherein at least one ring is a heteroaryl ring. Likewise, a 6,6-fused ring heteroarylene refers to two rings fused together, w'herein one ring has 6 members and the other ring has 6 members, and w'herein at least one ring is a heteroaryl ring. And a 6,5 -fused ring heteroarylene refers to two rings fused together, wherein one ring has 6 members and the other ring has 5 members, andPAT060035-PCT-SEC01wherein at least one ring is a heteroaryl ring. A heteroaryl group can be attached to the remainder of the molecule through a carbon or heteroatom. Non-limiting examples of aryl and heteroaryl groups include phenyl, naphthyl, pyrrolyl, pyrazolyl, pyridazinyl, triazinyl, pyrimidinyl, imidazolyl, pyrazinyl, purinyl, oxazolyl, isoxazolyl, thiazolyl, furyl, thienyl, pyridyl, pyrimidyl, benzothiazolyl, benzooxazoyl benzimidazolyl, benzofuran, isobenzofuranyl, indolyl, isoindolyl, benzothiophenyl, isoquinolyl, quinoxalinyl, quinolyl, 1-naphthyl, 2-naphthyl, 4-biphenyi, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 3-pyrazolyl, 2- imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl, 2-phenyl-4-oxazolyl, 5-oxazolyl, 3 -isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2- furyl, 3-furyl, 2 -thienyl, 3-thienyl, 2 -pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidyl, 4-pyrimidyl, 5-benzothiazolyl, purinyl, 2-benzimidazolyl, 5 -indolyl, 1 -isoquinolyl, 5 -isoquinolyl, 2- quinoxalinyl, 5-quinoxalinyl, 3-quinolyl, and 6-quinolyl. Substituents for each of the above noted aryl and heteroaryl ring systems are selected from the group of acceptable substituents described below. An “arylene” and a “heteroarylene,” alone or as part of another substituent, mean a divalent radical derived from an aryl and heteroaryl, respectively.[000148] The terms “halo” or “halogen,” by themselves or as part of another substituent, mean, unless otherwise stated, a fluorine, chlorine, bromine, or iodine atom. Additionally, terms such as “haloalkyl” are meant to include monohaloalkyl and poly haloalkyl. For example, the term “halo(Ci-C4)alkyl” includes, but is not limited to, fluoromethyl, difluoromethyl, trifluoromethyl, 2,2,2-trifluoroethyl, 4-chlorobutyl, 3 -bromopropyl, and the like.[000149] The symbol” denotes the point of attachment of a chemical moiety to the remainder of a molecule or chemical formula.[000150] The term “oxo,” as used herein, means an oxygen that is double-bonded to a carbon atom.[000151] Each of the above terms (e.g., “alkyl,” “heteroalkyl,” “cycloalkyl,” “heterocycloalkyl,” “and,” and “heteroaryl”) includes both substituted and unsubstituted forms of die indicated radical. Substituents for the alkyl and heteroalkyl radicals (including those groups often referred to as alkylene, alkenyl, heteroalkylene, heteroalkenyl, alkynyl, cycloalkyl, heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl) can be one or more of a variety of groups selected from, but not limited to, — OR', =0, =NR', ==N — OR', — NR'R", SR’. -halogen, SiR'R’’R’". OC(O)R', --C(O)R', --CO2R', --CONR'R", -- OC(O)NR'R", --NR" C(O)R', --NR'--C(0)NR" R’", --NR" C(O)2R', --NR--PAT060035 -PCT-SEC01C(NR'R" R")=NR"", XR C(X ICWAR'”. --S(O)R', S(O) R'_ --S(O)2N R", -- NRSOzR; — NRrNR" R'", ONR'R", — NR’C(O)NR" NR"'R"", — CN, — NO2, — NR'SChR", XR'( (O)R". --NR'C (()) OR”. XR’OR". in a number ranging from zero to (2m’+l), where m' is the total number of carbon atoms in such radical. R, R', R", R"’, and R"" each preferably independently refer to hydrogen, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl (e.g., aryl substituted with 1-3 halogens), substituted or unsubstituted heteroaryl, substituted or unsubstituted alkyl, alkoxy, or thioalkoxy groups, or arylalkyl groups. When a compound described herein includes more than one R group, for example, each of the R groups is independently selected as are each R', R", R”', and R"" group when more than one of these groups is present. When R' and R” are attached to the same nitrogen atom, they can be combined with the nitrogen atom to form a 4-, 5-, 6-, or 7-membered ring. For example, — NR'R" includes, but is not limited to, 1-pyrrolidinyl and 4-morpholinyl. From the above discussion of substituents, one of skill in the art will understand that the tenn “alkyl” is meant to include groups including carbon atoms bound to groups other than hydrogen groups, such as haloalkyl (e.g., -CF3 and - CH2CF3) and acyl (e.g., -C(O)CH3, — C(O)CF3, — C(O)CH2OCH3, and the like).[000152] Certain compounds provided herein possess asymmetric carbon atoms (optical or chiral centers) or double bonds; the enantiomers, racemates, diastereomers, tautomers, geometric isomers, stereoisomeric forms that may be defined, in terms of absolute stereochemistry, as (R)- or (S)- or, as (D)- or (L)- for amino acids, and individual isomers are encompassed within the scope of the present disclosure. The compounds of provided herein do not include those that are known in art to be too unstable to synthesize and / or isolate. Compounds provided herein include those in racemic and optically pure forms. Optically active (R)- and (S)-, or (D)- and (L)-isomers may be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques. When the compounds described herein contain olefinic bonds (vinyl group) and unless specified otherwise, it is intended that the compounds include both (E) and (Z) geometric isomers.[000153] As used herein, the tenn “’isomers” refers to compounds having the same number and kind of atoms, and hence the same molecular weight, but differing in respect to the structural arrangement or configuration of the atoms.PAT060035 -PCT-SEC01RNAi Agents[000154] In an aspect, the disclosure provides an RNAi agent including a double stranded RNA (dsRNA). In an aspect, also provided is a dsRNA interference (dsRNAi) agent that includes a dsRNA consisting of (i) a sense strand and (ii) an antisense strand, and a ligand attached to at least one of the sense strand and the antisense strand.[000155] A dsRNA is a complex of ribonucleic acid (RNA) molecules formed in a duplex structure. In certain aspects, the dsRNA may be a small interfering RNA (siRNA) that has 10 to 30, or particularly 15-25 nucleotides in each RNA molecule, respectively, “passenger strand” and “guide strand”, and can be incorporated into an RNA-induced silencing complex (RISC). The siRNA is dissociated or unwounded in the RISC, and the passenger strand is degraded while the guide strand remains in the RISC pathway. The guide strand can subsequently bind to an mRNA molecule that includes a complementary sequence to the guide strand and induce or initiate cleavage or degradation of the mRNA molecule. In certain aspects, the mRNA encodes a target gene (e.g., mRNA transcript of a target gene) such that expression of the target gene is suppressed or inhibited through a post- transcriptional gene-silencing (“RNA silencing”). A guide RNA molecule has a complementary sequence to a target mRNA sequence and has anti-parallel orientation to the target gene, so it is interchangeably referred to as an antisense strand. A passenger RNA molecule forming a duplex with the guide RNA and having a complementary sequence to the guide strand (antisense strand) has the same orientation with the target mRNA sequence, so it is interchangeably referred to as a sense strand.AGT siRNA (double stranded RNA)[000156] In an aspect, the disclosure provides a dsRNA interference (dsRNAi) agent that is capable of interacting or recruiting a target mRNA sequence, e.g., AGT mRNA sequence, in the RISC thereby cleaving the target mRNA. The dsRNAi agent can silence AGT gene, e.g., by inhibiting, downregulating, or suppressing the expression of AGT gene. Gene-silencing (e.g., inhibiting, downregulating, or suppressing of the gene) may be assessed by a decrease in an absolute or relative level of one or more variables that are associated with AGT expression compared with a control level. The control level may be any type obtained from, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or untreated or treated subject with inactive agents (e.g., PBS buffer). In some embodiments, the level of silencing the AGT gene may be demonstrated by a reduction of the amount of aPAT060035 -PCT-SEC01total AGT mRNA in a cell. In some embodiments, the level of silencing the AGT may be demonstrated by a reduction of the amount of a total AGT protein in a cell.[000157] In some embodiments, expression of the AGT gene (e.g., human AGT) is inhibited by at least about 10%, about 15%, about 20%, about 25%, about 30 %, about 40%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% based on the expression level of the AGT gene in untreated cell or subject. In some embodiments, expression of the AGT gene (e.g., human AGT) is inhibited by at least about 20% based on the expression le vel of the AGT gene in untreated cell or subject. In some embodiments, expression of the AGT gene (e.g., human AGT) is inhibited by at least about 30% based on the expression level of the AGT gene in untreated cell or subject. In some embodiments, expression of the AGT gene (e.g., human AGT) is inhibited by at least about 40% based on the expression level of the AGT gene in untreated cell or subject. In some embodiments, expression of the AGT gene (e.g., human AGT) is inhibited by at least about 50% based on the expression level of the AGT gene in untreated cell or subject. In some embodiments, expression of the AGT gene (e.g., human AGT) is inhibited by at least about 60% based on the expression level of the AGT gene in untreated cell or subject. In some embodiments, expression of the AGT gene (e.g., human AGT) is inhibited by at least about 70% based on the expression level of the AGT gene in untreated cell or subject.[000158] In some embodiments, inhibition of the expression of the AGT gene may be manifested by a reduction of the amount of mRNA expressed in a first cell or a first group of cells obtained from a subject that has been treated, e.g., by contacting the cell or by administering the dsRNAi agent as described herein, as compared to a second cell or a second group of cells obtained from a subject that has not been treated but is identical to the first cell or the first group of cells. For example, the level of gene-silencing (e.g., inhibiting, downregulating, or suppressing of the gene) of the AGT (e.g., human AGT) may be presented as a percentage of remaining mRNA in the treated cells (first cell or group of cells) compared to the mRNA amount in the control (untreated) cells, as shown in the following equation:(mRNA in control cells) - (mRNA in treated cells)- - « 100 %(mRNA in control cells)[000159] In some embodiments, the level of gene-silencing (e.g., inhibiting, downregulating, or suppressing of the gene) of the AGT (e.g., human AGT) may be assessedPAT060035 -PCT-SEC01by measuring a parameter or biomarker, e.g., human AGT protein level, in a biological sample (e.g., a blood, serum or liver tissue obtained from a subject), which may be treated or untreated. Conventional analytical methods as known in the art such as electrophoresis (e.g., SDS or capillary electrophoresis), chromatography (e.g., high performance liquid chromatography (HPLC)), spectroscopy, western blotting, enzyme- linked immunosorbent assays (ELIS As), immunofluorescent assays, electrochemiluminescence assays, and the like can be used without limitation, but examples are not limited thereto. In some embodiments, reduced level of gene-silencing (e.g., inhibiting, downregulating, or suppressing of the gene) of the AGT (e.g., human AGT) may be observed or assessed by in a liver (tissue) biopsy of the treated subject.[000160] In certain aspects, the dsRNAi agent is a free acid. In certain aspects, the dsRNAi agent is in a salt form (e.g., a pharmaceutically acceptable salt form). It will be understood that references to dsRNAi agent are meant to also include the pharmaceutically acceptable salts of the dsRNAi agent. If the dsRNAi agent has, for example, at least one basic center, they can fonn acid addition salts. Corresponding acid addition salts can also be formed having, if desired, an additionally present basic center. Active substances having an acid group, e.g., COOH, can form salts with bases. The dsRNAi agent or pharmaceutically acceptable salts thereof may also be used in form of a hydrate or include other solvents used for crystallization. In some embodiments, the RNAi agent is a sodium salt. In some embodiments, the dsRNAi agent is in a salt form (e.g., a pharmaceutically acceptable salt form), where the salt is sodium (Na+), ammonium (NH4+), calcium (Ca2+), iron (Fe2+or Fe3”), magnesium (Mg2+), potassium (K+), pyridinium (C5H5NH+), quaternary ammonium (NR4+, R being an alkyl group or an aryl group as described herein), or copper (Cu2+).[000161] In an aspect, the disclosure provides a dsRNA having sequences (e.g., antisense strand sequence) that can recognize a specific region of a AGT mRNA (e.g., human AGT mRNA) and lead cleavage of the AGT mRNA and silencing of the gene. The dsRNA includes a sense strand and an antisense strand and each strand may range from 12 to 30 nucleotides in length. In some embodiments, each strand may have 15 to 30 nucleotides in length. In some embodiments, each strand may have 15 to 25 nucleotides in length. In some embodiments, the antisense strand may have 15 to 25 nucleotides in length. In some embodiments, the sense strand may have 15 to 25 nucleotides in length. In some embodiments, the antisense strand may have 15 to 23 nucleotides m length. In somePAT060035 -PCT-SEC01embodiments, the sense strand may have 15 to 23 nucleotides in length. In some embodiments, the antisense strand may have 18 to 25 nucleotides in length. In some embodiments, the sense strand may have 18 to 25 nucleotides in length.[000162] In some embodiments, the sense strand may have 19 to 23 nucleotides in length. In some embodiments, the sense strand may have 21 to 2.3 nucleotides in length. In some embodiments, the sense strand may have 19 nucleotides in length. In some embodiments, the sense strand may have 20 nucleotides in length. In some embodiments, the sense strand may have 21 nucleotides in length. In some embodiments, the sense strand may have 22 nucleotides in length. In some embodiments, the sense strand may have 23 nucleotides in length.[000163] In some embodiments, the antisense strand may have 19 to 25 nucleotides in length. In some embodiments, the antisense strand may have 19 to 23 nucleotides in length. In some embodiments, the antisense strand may have 21 to 23 nucleotides in length. In some embodiments, the antisense strand may have 23 to 25 nucleotides in length. In some embodiments, the antisense strand may have 19 nucleotides m length. In some embodiments, the antisense strand may havenucleotides in length. In some embodiments, the antisense strand may havenucleotides m length. In some embodiments. the antisense strand may havenucleotides in length. In some embodiments. the antisense strand may havenucleotides in length. In some embodiments, the antisense strand may have 24 nucleotides in length.some embodiments, the antisense strand may have 25 nucleotides in length.[000164] In some embodiments, the sense strand is 21 to 23 nucleotides in length and the antisense strand is 23 to 25 nucleotides in length. In some embodiments, the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length. In some embodiments, the sense strand is 22 nucleotides in length and the antisense strand is 24 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides in length and the antisense strand is 25 nucleotides in length.[000165] In an aspect, a dsRNA as described herein forms a double-stranded (or “duplex”) region made between a sense strand and an antisense strand and having 10 to 25 nucleotide pairs in length. The double stranded or duplex region are loaded into the RISC and subsequent specific degradation of the sense strand occurs during the RISC pathway. In some embodiments, the double stranded region has 10 nucleotide base pairs in length. In some embodiments, the double stranded region has 11 nucleotide base pairs in length. InPAT060035 -PCT-SEC01some embodiments, the double stranded region has 12 nucleotide base pairs in length. In some embodiments, the double stranded region has 13 nucleotide base pairs in length. In some embodiments, the double stranded region has 14 nucleotide base pairs in length. In some embodiments, the double stranded region has 15 nucleotide base pairs in length. In some embodiments, the double stranded region has 16 nucleotide base pairs in length. In some embodiments, the double stranded region has 17 nucleotide base pairs in length. In some embodiments, the double stranded region has 18 nucleotide base pairs in length. In some embodiments, the double stranded region has 19 nucleotide base pairs in length. In some embodiments, the double stranded region has 20 nucleotide base pairs in length. In some embodiments, the double stranded region has 21 nucleotide base pairs in length. In some embodiments, the double stranded region has 22 nucleotide base pairs in length. In some embodiments, the double stranded region has 23 nucleotide base pairs in length.[000166] In an aspect, a dsRNA as described herein may include at least one single¬ stranded nucleotide overhang, for example, for increasing in vivo effectiveness of the dsRNA and having substantially improved inhibition of the target genes. In certain aspects, the dsRNA may contain one or more extra nucleotides constituting overhang regions that locate other than the double stranded region at the 3'-end, 5'-end, or both ends of either strand or both strands (sense and antisense strands). In some embodiments, the overhang region may exist at the 3 '-end, 5 '-end, or both ends of the sense strand. In some embodiments, the overhang region may exist at the 3 '-end, 5 '-end, or both ends of the antisense strand. In some embodiments, the antisense strand may have a greater length than a length in the sense strand. In some embodiments, the antisense strand may have a shorter length than a length in the sense strand.[000167] In some embodiments, the dsRNA may contain one or more extra nucleotides constituting overhang regions at the 3 '-end, 5 '-end, or both ends of the antisense strand. In some embodiments, the overhang region in the antisense strand may consist of 1-6 nucleotides in length, for example, 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, or 6 nucleotides in length. In some embodiments, the dsRNA may contain one or more extra nucleotides constituting overhang regions at the 3 '-end, 5 '-end, or both ends of the sense strand. In some embodiments, the overhang region may consist of 1 to 6 nucleotides in length, for example, 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, or 6 nucleotides in length.PAT060035 -PCT-SEC01000168] In some embodiments, the antisense strand may include one-nucleotide overhang at the 5’ end. In some embodiments, the antisense strand may include one- nucleotide overhang at the 3' end. In some embodiments, the antisense strand may include two-nucleotides overhang. In some embodiments, the antisense contains two-nucleotides overhang at the 5' end. In some embodiments, the antisense contains two-nucleotides overhang at the 3’ end. In some embodiments, the antisense contains one-nucleotide overhang at the 5' end and one-nucleotide overhang at the 3' end. In some embodiments, the antisense strand may include three-nucleotide overhang. In some embodiments, the antisense contains three-nucleotides overhang at the 5' end. In some embodiments, the antisense contains three-nucleotides overhang at the 3' end. In some embodiments, the antisense contains two-nucleotides overhang at the 5' end and one-nucleotide overhang at the 3' end. In some embodiments, the antisense contains two nucleotides overhang at the 3’ end and one-nucleotide overhang at the 5' end.[000169 In certain aspects, a dsRNA as described herein may include at least one blunt end, e.g., for increasing in vivo stability with resistance to degradation in physiological surroundings. In some embodiments, the dsRNA may have a blunt end at the 3'-end, 5'- end, or both ends of the duplex. In some embodiments, the dsRNA includes one overhang (e.g., at 3' end of antisense strand) and one blunt end (e.g., at 5' end of antisense strand). In some embodiments, the dsRNA includes a blunt end at the 5 '-end of the sense strand (and at 3' end of the antisense strand) and contain overhang nucleotide(s) at the other end. In some embodiments, the dsRNA may have a blunt end at the 3 '-end of the sense strand (and at 5’ end of the antisense strand) and contain overhang nucleotide(s) at the other end.[000170] In certain aspects, the target AGT mRNA sequence may range from 12 to 30 nucleotides, from 15 to 30 nucleotides, from 18 to 30 nucleotides, from 18 to 25 nucleotides, from 18 to 23 nucleotides. In certain aspects, the target AGT mRNA sequence may range from 19 to 25 nucleotides, from 19 to 23 nucleotides, or from 19 to 21 nucleotides. In some embodiments, the target AGT mRNA sequence may have 15 nucleotides in length. In some embodiments, the target AGT mRNA sequence may have 16 nucleotides in length. In some embodiments, the target AGT mRNA sequence may have 17 nucleotides in length. In some embodiments, the target AGT mRNA sequence may have 18 nucleotides in length. In some embodiments, the target AGT mRNA sequence may have 19 nucleotides in length. In some embodiments, the target AGT mRNA sequence may have 20 nucleotides in length. In some embodiments, the target AGT mRNA sequence may have 21 nucleotides in length. In somePAT060035-PCT-SEC01embodiments, the target AGT mRNA sequence may have 22 nucleotides in length. In some embodiments, the target AGT mRNA sequence may have 23 nucleotides in length.[000171] In certain aspects, exemplary dsRNA sequences including sense strands and antisense strands targeting human AGT mRNA of SEQ ID NO: 391 GenBank: NM_001384479.1 are in Table 1.PAT060035-PCT-SEC01Table 1: Examples of unmodified nucleotide sequences of AGT siRNAAGT Sense Sequence SEQ Antisense Sequence SEQ siRNA ID ID NO: i 1 NO: Al ACCTGAAGCAGCCGTTTGTGT 1 i ACACAAACGGCTGCTTCAGGTGC i 115 A2 CTTTCCAGCAAAACTCCCTCT 2 i AGAGGGAG T 111 GCTGGAAAGTG | 116 A3 GCTGTGTATGATCAAAGCGCT 3 i AGCGCTTTGATCATACACAGCAA | 117 A4 TCTCTATACCCCTGTGGTCCT 4 i AGGACCAC AGGGGTA TAGAGAGC 118 A5 TGCTGCTGATCCAGCCTCACT 5 i AGTGAGGCTGGATCAGCAGCAGG 119 A6 TACAGGCAATCCTGGGTGTTT 6 i AAACACCCAGGATTGCCTGTAGC | 120 A7 ACTTTCCAGCAAAACTCCCTT 7 | AAGGGAGTTTTGCTGGAAAGTGA | 121 A8 GGCTTTCAACACCTACGTCCT 8 i AGGACG TAGGT 'GTTGAAAGCCAG 1 122 A9 CTGTGTATGATCAAAGCGCCT 9 i AGGCGCTTTGATCATACACAGCA i 123 A10 CCAGCAAAACTCCCTCAACTT 10 i AAGTTGAGGGAGTTTT GCTGGAA 1 124 All GATAACAACCCCGGACAAATT 11 i AATTTGTCCGGGGTTGTTATCTG 1 125 A12 CAG AGTCTACCC A AC A GCTTT 12 i AAAGCTGTTGGGTAGACTCTGTG i 126 A13 CACCCTGGCTTTCAACACCTT 13 i AAGGTGTTGAAAGCCAGGGTGCT 1 127 A14 CTACCCAACAGCTTAACAAGT 14 i ACTTGTTAAGCTGTTGGGTAGAC 1 128 A15 ACAGCA 1 " ITT 1 " 1 "1TGAGCTTT 15 i AAAGCTCAAAAAAAATGCTGTTC i 129 A16 CAGCAT’T’TTTTTTGAGCTTGT 16 i ACAAGCTCAAAAAAAATGCTGTT | 130 A17 TGTGTATGATC AAAG CGCCAT 17 i ATGGCGCTTTGATCATACACAGC 1 131 A18 TGACCCTGAACCGCCCATTCT 18 i AGAATGGGCGGTTCAGGGTCACC i 132 A19 AAAATTGAGCAATGACCGCAT 19 i ATGCGGTCATTGCTCAATTTTTG! 133 A20 TTGGGTTTTAAAATTAAAGTT 20 | AACTTTAA' IT 1"1 AAAACCCAATT 1 134 A21 ACAGAGTCTACCCAACAGCTT 21 i AAGCTGTTGGGTAGACTCTGTGG 135 A22 GTGGACAACAGCACCTCAGTT 22 i AACTGAGGTGCTGTTGTCCACCC | 136 A23 CCACAGAGTCTACCCAACAGT 23 i ACTGTTGGGTAGACTCTGTGGGC 137 A24 TAATGAGTCGACTTTGAGCTT 24 i AAGCTCAAAGTCGACTCATTAGA 138 A25 AACAGCTTAACAAGCCTGAGT 25 i ACTCAGGCTTGTTAAGCTGTTGG | 139 A26 GACAAATCAGCGATGTGTCAT 26 i ATGACACATCGCTGATTTGTCCG 1 140 A27 CTTTTCTTCTAATGAGTCGAT 27 i ATCGACTCATTAGAAGAAAAGGT 1 141 A28 AGCCCACAG AGTCTACCC A AT 28 i ATTGGGTAGACTCTGTGGGCTCT i 142 A29 TTCCAGCAAAACTCCCTCAAT 29 i ATTGAGGGAGTTTTGCTGGAAAG 1 143 A30 TTCTAATGAGTCGACTTTGAT 30 i ATCAAAGTCGACTCATTAGAAGA 1 144 A31 CAAAAATTGAGCAATGACCGT 31 i ACGGTCATTGCTCAAi T T H GC \ 1 145 A32 TTTCTTCTAATGAGTCGACTT 32 i AAGTCGACTCATTAGAAGAAAAG 1 146 A33 GCCATTCTGCACACCGAGCTT 33 i AAGCTCGGTGTGCAGAATGGCGG 147 A34 GTCATCCACAATGAGAGTACT 34 i AGTACTCTCATTGTGGATGACGA 148 A35 CATGCAGGCTGTGACAGGATT 35 i AATCCTGTCACAGCCTGCATGAA | 149 A 36 AAATTGGGTTTTAAAATTAAT 36 i ATTAArTTTAAAACCCAArTTTT 1 150 A37 ACCCCGGACAAATCAGCGATT 37 i AATCGCTGATTTGTCCGGGGTTG 151 A38 CCTCAACTGGATGAAGAAACT 38 i AGTTTCTTCATCCAGTTGAGGGA i 152 A39 TGAGCTTGAAGCGGATGAGAT 39 i ATCTCATCCGCTTCAAGCTCAAA 153 A40 TTCTTCTAATGAGTCGACTTT 40 i AAAGTCGACTCATTAGAAGAAAA 154 A41 AGATAACAACCCCGGACAAAT 41 i ATTTGTC JCGGGGTTGTTA TCTGC i 155 A42 CTTCTAATGAGTCGACTTTGT 42 i ACAAAGTCGACTCATTAGAAGAA 1 156 A43 ATGAGTCGACTTTGAGCTGGT 43 i ACCAGCTCAAAGTCGACTCATTA 1 157 A44 TCCG1TTTCAAGTTGAGAACT 44 i AGTTCTCAACTTG AAAAGGGAAC i 158 A45 CTCTCTGGACTTCACAGAACT 45 i AGTTCTGTGAAGTCCAGAGAGCG 1 159A46 TCACTTTCCAGCAAAACTCCT 46 i AGGAGTTTTGCTGGAAAGTGAGA | 160PAT060035-PCT-SEC01A GT Sense Sequence SEQ Antisense Sequence SEQ siRNA ID ID NO: NO: A47 TAAGTGTGCTGCATGGAGTGT 47 ACACTCCATGCAGCACACTTAGA 161 A48 TGCACCTGAAGCAGCCGTTTT 48 A A A ACGGCTGCTTC A GGTGC AGG 162 A49 GTATATATGGCATGCACAGTT 49 AACTGTGCATGCCATATATACGG 163 A5O GCTGAGCTGCCCGCCATTCTT 50 AAGAATGGCGGGCAGCTCAGCCT 164 A51 CCCAAAGACCCCACCTTCATT 53 AATGAAGGTGGGGTCTTTGGGCT 165 A52 TCAAGTTGAGAACAAAAA1TT 52 AAATTFTTG1TCTCAACTTGAAA 166 A53 CCCACGCTCTCTGGACTTCAT 53 ATGAAGTCCAGAGAGCGTGGGAG 167 A54 G A C A AGGTGG AGGGTCTCACT 54 AGTGAGACCCTCCACCTTGTCCA 168 A55 GTGACCCTGAACCGCCCATTT 55 AAATGGGCGGTTCAGGGTCACCT 169 A 56 TAACAACCCCGGACAAATCAT 56 ATGATTTGTCCGGGGTTGTTATC 170 A57 AACCCCGGACAAATCAGCGAT 57 ATCGCTGA1TTGTCCGGGGTTGT 171 A58 GCCCTTCACTGAGAGCGCCTT 58 AAGGCGCTCTCAGTGAAGGGCAC 172 A59 CAGCAAAACTCCCTCAACTGT 59 ACAGTTGAGGGAG 1 1 TTGC 1 GGA 173 A60 GCCGTTTCTCCTTGGTCTAAT 60 ATTAGACCAAGGAGAAACGGCTG 174 A61 TTCATACCTGCTCCAATTCAT 61 ATGAATTGGAGCAGGTATGAAGG 175 A62 ACGGCTGTCTTTGGCACCCTT 62 AAGGGTGCCAAAGACAGCCGTTG 176 A63 AAACAAAAAAGTGTTCCCTTT 63 AAAGGGAACACTTTTTTGTTTCA 177 A64 AGAGTCTACCCAACAGCTTAT 64 ATAAGCTGTTGGGTAGACTCTGT 178 A65 CAAAACTCCCTCAACTGGATT 65 AATCCAGTTGAGGGAG1TTTGCT 179 A66 GGACAAATCAGCGATGTGTCT 66 AGACACATCGCTGATTTGTCCGG 180 A67 AGTCGACTTTGAGCTGGAAAT 67 ATTTCCAGCTCAAAGTCGACTCA 181 A68 CCCCGGACAAATCAGCGATGT 68 ACATCGCTGATTTGTCCGGGGTT 182 A69 CTG A A CCGCCC ATTCCTGTTT 69 AAACAGGAATGGGCGGTTCAGGG 183 A70 AGCCGTTTCTCCTTGGTCTAT 70 ATAGACCAAGGAGAAACGGCTGC 184 A71 TGACTCAAGTGCCCTTCACTT 71 AAGTGAAGGGCACTTGAGTCACC 185 A72 CAGCAGATAACAACCCCGGAT 72 ATCCGGGGTTGTTATCTGCTGCT 186 A73 GCTAGTCGCTGCAAAACTTGT 73 AC AAGlTl11 GCAGCGACT AGC AC 187 A74 CTGGCTCTCTATACCCCTGTT 74 AACAGGGGTATAGAGAGCCAGGC 188 A75 GGACTACTGTTCCAAAAAGAT 75 ATCT 1 1 ITGGAACAGTAGTCCCG 189 A76 AACAAAAAAGTGTTCCCTTTT 76 AAAAGGGAACACTTFT1TGTTFC 190 A77 CCGGACAAATCAGCGATGTGT 77 ACACATCGCTGATTTGTCCGGGG 191 A78 GTGTTTAGCGCGGGACTACTT 78 AAGTAGTCCCGCGCTAAACACTG 192 A79 CCCGGACAAATCAGCGATGTT 79 AACATCGCTGATTTGTCCGGGGT 193 A80 GCTGCAAAACTTGACACCGAT 80 ATCGGTGTCAAGTTTTGCAGCGA 194 A81 TAGTCGCTGCAAAACTTGACT 81 AGTCAAGTT1TGCAGCGACTAGC 195 A82 ACTTTCCAGCAAAACTCCCTA 82 TAGGGAGTTTTGCTGGAAAGTGA 196 A83 TTCCAGCA AA A CTCCCTCA AA 83 TTTGAGGGAG11111TGCTGG A AAG 197 A84 GTCATCCACAATGAGAGTACA 84 TGTACTCTCATTGTGGATGACGA 198 A 85 CAGAGTCTACCCAACAGCTTA 85 TAAGCTGTTGGGTAG A CTCTGTG 199 A86 CAGCATT'l'ITTT'lGAGCTTGA 86 TCAAGCTCAAAAAAAATGCTGTT 200 A87 TTGGGTTTTAAAATTAAAGTA 87 TACTTTAATTTTAAAACCCAATT 201 A 88 CCC A A AGACCCC A CCTTCATA 88 TATGAAGGTGGGGTCTTTGGGCT 202 A89 TCAAGTTGAGAACAAAAATTA 89 TAATTTTTGTTCTCAACTTGAAA 203 A90 CTTTTCTTCTAATGAGTCGAA 90 TTCGACTCATTAGAAGAAAAGGT 204 A91 GACAAATCAGCGATGTGTC A A 91 TTGACACATCGCTGATTTGTCCG 205 A92 ACAGCATTTTTTTTGAGCTTA 92 TAAGCTCAAAAAAAATGCTGTTC 206 A93 TTCCGTATATATGGCATGCAA 93 TTGCATGCCATATATACGGAAGC 207A 94 GCCGTTTCTCCTTGGTCTAAA 94 TTTAGACCAAGGAGAAACGGCTG 208PAT060035-PCT-SEC01A GT Sense Sequence SEQ Antisense Sequence SEQ siRNA ID ID NO: NO: A95 TTCATACCTGCTCCAATTCAA 95 TTGAATTGGAGCAGGTATGAAGG 209 A96 AAATTGGGTTTTAAAATTAAA 96 TTTAATTTTA A AACCCAA1 " 1TTT 210 A97 CCCACGCTCTCTGGACTTCAA 97 TTGAAGTCCAGAGAGCGTGGGAG 211 A98 TAATGAGTCGACTTTGAGCTA 98 TAGCTCAAAGTCGACTCATTAGA 212 A99 AGAGTCTACCCAACAGCTTAA 99 TTAAGCTGTTGGGTAGACTCTGT 213 A100 TTCTAATGAGTCGACTTTGAA 100 TTCAAAGTCGACTCATTAGAAGA 214 A 101 CTTCTAATGAGTCGACTTTGA 101 TCAAAGTCGACTCATTAGAAGAA 215 A 102 GGACTACTGTTCCAAAAAGAA 102 TTCf r 1TTGGAACAGTAGTCCCG 216 A103 AGCCGTFTCTCCTTGGTCTAA 103 TTAGACCAAGGAGAAACGGCTGC 217 A 104 ACCCCGGACAAATCAGCGATA 104 TATCGCTGATTTGTCCGGGGTTG 218 A 105 GATAACAACCCCGGACAAATA 105 TATTTGTCCGGGGTTGTTATCTG 219 A106 GGACAAATCAGCGATGTGTCA 106 TGACACATCGCTGATTTGTCCGG 220 A 107 AGCCCACAGAGTCTACCCAAA 107 TTTGGGTAGACTCTGTGGGCTCT 221 A 108 TAGTCGCTGCAAAACTTGACA 108 TGTCAAGTTITGCAGCGACTAGC 222 A109 TACAGGCAATCCTGGGTGTTA 109 TAACACCCAGGATTGCCTGTAGC 223 AliO GCTGCAAAACTTGACACCGAA 110 TTCGGTGTCAAGT 1 1 TGC AGCGA 224 Alli AGCTGGAAAGCAGCCGTTTCT 111 AGAAACGGCTGCTTTCCAGCTCA 225 Al 12. ACCTCCCAGTTTGCTGGGTTT 112 AAACCCAGCAAACTGGGAGGTGC 226 Al 13 CCCGGACAAATCAGCGATGTA 113 TACATCGCTGAT1TGTCCGGGGT 227Al 14 CTGGTGCTAGTCGCTGCAAAA 114 TTTTGCAGCGACTAGCACCAGCT 228[000172] In Table 1, each code (leter, e.g., A, G, C, and U) represents a single ribonucleotide in the dsRNA. In some embodiments, the sequence list may be inclusive of any possible modifications, for example, a modification in a nucleobase, a ribose sugar ring, and / or a phosphate group (i.e., phosphodiester internucleoside linkage). In some embodiments, the last nucleotide from the 5' end (or the first nucleotide from 3' end) in each strand (sense strand and antisense strand) may have not include a phosphate group as being hydrolyzed or processed, e.g., during the synthesis of the oligonucleotides, but may contain 3'-terminal -OH group. In some embodiments, a phosphate group in the last nucleotide from the 5' end (or the first nucleotide from 3’ end) in the sense strand may be added as a functional group for conjugation with a ligand.[000173] In some embodiments, the dsRNA includes a sense strand having 10 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 10 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 11 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In somePAT060035-PCT-SEC01embodiments, the dsRNA includes an antisense strand having 11 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 12 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 12 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 13 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 13 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 14 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 14 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 16 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 16 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 17 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 17 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 18 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includesPAT060035 -PCT-SEC01an antisense strand having 18 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 19 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 19 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 20 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 20 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 21 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 21 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228.[000174 ] In some embodiments, the dsRNA includes a sense strand having 10 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 10 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 11 contiguous nucleotides differing by no more than 2. nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114, In some embodiments, the dsRNA includes an antisense strand having 11 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 12 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 12 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 13 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand havingPAT060035-PCT-SEC0113 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 14 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 14 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 15 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114, In some embodiments, the dsRNA includes an antisense strand having 15 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 16 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: I to 114. In some embodiments, the dsRNA includes an antisense strand having 16 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 17 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 17 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 18 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114, In some embodiments, the dsRNA includes an antisense strand having 18 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 19 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 19 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 20 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 20 contiguous nucleotidesPAT060035 -PCT-SEC01differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 21 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 21 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228.[000175 In some embodiments, the dsRNA includes a sense strand having 10 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 10 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 11 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 11 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 12 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 12 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 13 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 13 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 14 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 14 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 15 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 15 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequencePAT060035-PCT-SEC01selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 16 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 16 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 17 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 17 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 18 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 18 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 19 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 19 contiguous nucleotides differing by no more than I nucleotide from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 20 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 20 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes a sense strand having 21 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 1 to 114. In some embodiments, the dsRNA includes an antisense strand having 21 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes an antisense strand having 22 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes an antisense strand having 23 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from SEQ ID NOs: 115 to 228.PAT060035 -PCT-SEC01000176] In some embodiments, the dsRNA includes (i) a sense strand having 15 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 15 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes (i) a sense strand having 16 contiguous nucleotides differing by no more than one, two or three from the nucleotide sequence selected from SEQ ID NOs: 1 to 114 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 16 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes (i) a sense strand having 17 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 17 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes (i) a sense strand having 18 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 18 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes (i) a sense strand having 19 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 19 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes (i) a sense strand having 20 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 1 to 114 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 20 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228. In some embodiments, the dsRNA includes (i) a sense strand having 21 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs:PAT060035 -PCT-SEC011 to 114 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 21 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from SEQ ID NOs: 115 to 228.[000177] In certain aspects, the sequences of the single strands (i.e., sense strand and antisense strand) of the dsRNA can be selected by selecting a target region and a length in the AGT mRNA. In certain aspects, a dsRNA as described herein may target a nucleotide region selected from regions of 1-2101 of a human AGT mRNA sequence that has at least about 85% (e.g., about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or 100%) identity to SEQ ID NO: 391 GenBank: NM_001384479.1. In an aspect, the sense strand of the dsRNA has one mismatch with a 21 contiguous nucleotide of SEQ ID NO: 391 at position 1, 2, 3, 4. 5, 6, 7. 8, 9, 10 11. 12, 13. 14, 15. 16, 17, 18, 19, 20, or 21 from the 5’ end of SEQ ID NO: 391. In an aspect, the mismatch is located at a nucleotide position of SEQ ID NO: 391 selected from the group consisting of: 244, 1062, 1085. 1255, 1267, 1337. 1338, 1350, 1373, 1378, 1379, 1589, 1595, 1596. and 1889. In an aspect, the mismatch is located at position 1338 or 1596 of SEQ ID NO: 391.Modification Pattern[000178] In an aspect, the disclosure provides a set of modification patterns determined or arranged by modified nucleotides in dsRNAs described herein. Aside from or in addition to the nucleobase sequences, various arrangements of modified nucleotides and the modification patterns thereof can be introduced, for example, to increase stability in a biological or physiological surrounding, to facilitate or promote cleavage by the RNA- induced silencing complex, and / or to mitigate or reduce off-targeting risk (e.g., to AGT off- targeting risk).[000179] In an aspect, the disclosure provides a dsRNA that is partially (e.g., greater than about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, or 45% of the total nucleotides), substantially (e.g., greater than about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the total nucleotides), or entirely made of modified nucleotides, which can provide improved resistance to chemical and / or nuclease digestion and increased in vivo stability thereby imposing a longer in vivo half-life. Further, increasing the in vivo half-life of the dsRNA results in enhanced bioavailability and enhanced effectiveness in inhibiting expression or activity of a target gene (e.g., human AGT). For example, the stability of dsRNA in blood or serum may be determined, e.g., by its susceptibility to degradation byPAT060035 -PCT-SEC01the cellular enzymes, which may be dependent on the characteristics (e.g,, sequences, modification, modification pattern, or other chemical moieties) of each strand (i.e., sense strand or antisense strand) of the dsRNA. In certain aspects, the efficiency of dsRNA as a therapeutic agent may be improved by increasing the in vivo stability (e.g., in blood or serum) of the dsRNA while maintaining the ability of the dsRNA to mediate RNA interference in vivo.Modified Nucleotides[000180] The modified nucleotides as used herein contain one or more modifications, for example, the modified nucleotides contain at least one chemical modification or replacement in an internucleoside linkage (“linkage”), a nucleobase, and / or a sugar moiety of the nucleotide. Non-limiting examples include a 2'-modification on a ribose sugar ring (e.g., 2'-deoxy, 2'-O-alkyl, 2'-halo, 2'-O-alkoxyalkyl, 2'-O-amino alkyl, etc.), 3'-modification (e.g,, substitution) in backbone phosphate group (or phosphodiester linkage), or 4'-modification on a ribose sugar ring (e.g., 4'-thio RNA). Also, other non-limiting examples of modifications may include one or more modifications selected from a deoxy modification, a 2'-O-alkyl modification, a 2'-halo modification, a 2'-5'-linkage modification, a conformationally restricting modification, an abasic modification, a 2'-amino-modification, a 2'-O-allyl modification, 2'-C-alkyl modification, a 2'-O-alkoxyalkyl modification, a morpholino modification, a modification containing a phosphoramidate group, a non-natural nucleobase modification, a modification in a tetrahydropyran, a threofuranosyl nucleotide (TNA) modification, a modification containing a 1,5- anhydrohexitol, a modification containing a cyclohexyl, a modification containing a cyclohexenyl, a modification containing a phosphorothioate group, a modification containing a methylphosphonate group, a modification containing an alkylphosphate, a modification containing a phosphonate, a modification containing an alkylphosphonate, a modification to form a thermally destabilizing nucleotide, a glycol nucleic acid (GNA) modification, and a 2-O-(N-methylacetamide) modification. For example, a modified nucleotide may include a single modification, or two or more modifications at the positions at which the chemical modification groups do not hinder or intervene each other.[000181] In some embodiments, each of the modified nucleotides is independently selected from TNA, GNA, LNA, 2'-O-alkoxyalkyl modified nucleotide, 2'-O-alkyl modified nucleotide, 2'-O-allyl modified nucleotide, 2'-C -allyl modified nucleotide, 2'-halo modified nucleotide, and 2'-deoxy modified nucleotide (DNA). In some embodiments, eachPAT060035-PCT-SEC01of the modified nucleotides contain independently selected from TNA modification, GNA modification, LNA modification, 2'-O-alkoxyalkyl modification, 2'-O-alkyl modification, 2'-O-allyl modification, 2'-C-allyl modification, 2'-halo modification, and 2 '-deoxy modification (DNA). The term alkyl, alkoxyl, allyl, amino, and halo can be interpreted as described above. In some embodiments, the modified nucleotides include at least one TNAs. In some embodiments, the modified nucleotides include at least one GNAs. In some embodiments, the modified nucleotides include at least one LNAs. In some embodiments, the modified nucleotides include at least one 2'-O-alkoxyalkyl modified nucleotides. In some embodiments, the modified nucleotides include at least one 2'-O-alkyl modified nucleotides. In some embodiments, the modified nucleotides include at least one 2'-O-allyl modified nucleotides. In some embodiments, the modified nucleotides include at least one 2'-C-allyl modified nucleotides. In some embodiments, the modified nucleotides include at least one 2'-halo (e.g., -F) modified nucleotides. In some embodiments, the modified nucleotides include at least one 2'-deoxy modified nucleotides (DNA).[000182] In some embodiments, the modified nucleotide may be a bicyclic (or bridged) nucleic acid (“BNA”) having a covalent linkage between the 2' and 4' carbons on a ribose sugar. In some embodiments, the modified nucleotide is a locked RNA (“L. NA”) having covalent linkage of a bicyclic sugar modification is a 4′-CH₂-O-2′ linkage (methylene oxy),’ ^^-O^^^Base£ oI OHalso known as “LN A having a structure of e.g.,, or a pharmaceutically acceptable salt thereof, wherein is an attachment point to the adjacent nucleotides.000183] In some embodiments, a ribose ring may be replaced with a glycol moiety linked •^O BaseOto phosphate and the GNA includes a moiety of, or a pharmaceuticallyI OHacceptable salt thereof. In some embodiments, the GNA may have a structureof or a pharmaceutically acceptable salt thereof. In some embodiments, the phosphodiesterPAT060035 -PCT-SEC01linkage in the GNA may be modified, e.g., with phosphorothioate group and modified GNAI SHmay have the structureof. or a pharmaceutically acceptable salt thereof. The GNA may further include one or more substituents replacing hydrogen(s) and such modified GNA may be encompassed by the definition of GN A herein.[000184] In some embodiments, a ribose pentofuranosyl ring may be replaced with a threofuranosyl ring linked to the phosphate and a threofuranosyl nucleotide (TNA) mayinclude a moiety off, or a pharmaceutically acceptable salt thereof. In someembodiments, the TN A may have a structureof or a pharmaceutically acceptable salt thereof. In some embodiments, the phosphodiester linkage in the TNA may be modified, e.g., with phosphorothioate group and modified TNA may include a structure. or a pharmaceutically acceptable salt thereof. The INA may further include one or more substituents at 1', 3’ and / or 4' positions and such modified TN A may be encompassed by the definition of TNA herein.[000185] In certain aspects, the modified nucleotide may include a heterocyclic group (e.g., 5 to 6 membered heterocycloalkyl ring) in place of a ribose ring. In some embodiments, the ribose ring may be replaced with a morpholinyl ring, e.g., to form an morpholino oligonucleotide. In some embodiments, the ribose ring may be replaced with an arabinose ring.[000186] In certain aspects, the modified nucleotides contain one or more modification groups at 2' position on the ribose ring by replacing 2'-OH. In some embodiments, thePAT060035-PCT-SEC01modification group may include one or more selected from hydrogen (i.e. deoxy), halogen (e.g., -F), substituted or unsubstituted alkyl (e.g,, C1-C12 alkyl), substituted or unsubstituted heteroalkyl (e.g., -O-(Ci-Ci2 alkyl), -N-(Ci-Ci2 alkyl), -C(0)NH-(Ci-Ci2 alkyl), -NHC(O)- (C1-C12 alkyl), and -C(O)-(Ci-Ci2 alkyl)). In some embodiments, the modification group may be hydrogen, -F, -O-alkyl (e.g., C1-C4 alkyl), or -O-alkoxyalkyl (e.g., -O-(Ci-C4 a]kylene)-(Ci-C4 alkoxyl)). Any of the alkyl, heteroalkyl, alkylene in the disclosure are optionally substituted with one or more of hydroxyl (-OH), C1-C.3 alkyl (e.g., methyl, or ethyl), amine (e.g., monoamine or diamine), alkoxyl (e.g., -O-CH3 (OMe) or -O-CH2CH3 (OEt)), halogen (e.g., -F) or the like.[000187] In certain aspects, the modified nucleotides may include one or more of 2'-deoxy modification, 2'-O-alkyl modification, 2'-O-subsituted alkyl modification, 2 '-O-alkoxyalkyl modification, and 2'-O-aminoalkyl modification. In some embodiments, tire modified nucleotides may include one or more of 2'-deoxy modification, 2'-0-alkyl modification, 2'-O-subsituted alkyl modification, 2'-O-alkoxyalkyl modification, and 2'-O-aminoalkyl modification. In some embodiments, the modified nucleotides include at least one GNAs. In some embodiments, the modified nucleotides include at least one 2'-O-alkoxyalkyl modifications. In some embodiments, the modified nucleotides include at least one 2'-O- alkyl modifications. In some embodiments, the modified nucleotides include at least one 2'-O-allyl modifications. In some embodiments, the modified nucleotides include at least one 2'-C-allyl modifications. In some embodiments, the modified nucleotides include at least one 2'-halo (e.g., -F) modifications. In some embodiments, the modified nucleotides include at least one 2'-deoxy modifications (DNA). In some embodiments, the modified nucleotides do not include 2'-deoxy modifications (DNA).[000188] In certain aspects, the modified nucleotides may include one or more of 2'-deoxy nucleotide (DNA), 2'-O-methyl (2'-OMe) modification, 2'-flouro (2'-F) modification, 2'-O- methoxyethyl (2'-0-M0E or “2'-MOE”) modification, 2'-O-aminopropyl (2'-O-AP) modification, 2'-O-dimethy1aminoethyl (2'-O-DMAOE) modification, 2'-O- dimethylaminopropyl (2'-O-DMAP) modification, 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE) modification, and 2 '-O-N -methylacetamido (2'-0-NMA) modification. In some embodiments, the modified nucleotides may include at least one 2'-deoxy modification (DNA). In some embodiments, the modified nucleotides may include at least one 2'-O-methyl (2'-OMe) modification. In some embodiments, the modified nucleotides may include at least one 2'-flouro (2'-F) modification. In some embodiments, the modifiedPAT060035 -PCT-SEC01nucleotides may include at least one 2'-O-methoxyethyl (2'-0-M0E or “2 -MOE”) modification. In some embodiments, the modified nucleotides may include at least one ~ O-aminopropyl (2'-O-AP) modification. In some embodiments, the modified nucleotides may include at least one 2'-O-dimethylaminoethyl (2'-O-DMAOE) modification. In some embodiments, the modified nucleotides may include at least one 2'-O-dimethylaminopropyl (2'-0-DMAP) modification. In some embodiments, the modified nucleotides may include at least one 2'-O-dimethylaminoethyIoxyethyl (2'-0-DMAE0E) modification. In some embodiments, the modified nucleotides may include at least one 2'-O-N-methylacetamido (2'-0-NMA) modification.[000189] In some embodiments, each modified nucleotide containing a modification on a sugar ring may optionally contain a phosphorothioate group at 5' or 3' linkage. In some embodiments, each modified nucleotide containing a modification on a 2' sugar ring may optionally contain a modification such as an abasic modification (absence of a nucleobase) or methylated nucleobase modification at nucleobase (e.g., thymine (T) or 5-methyl cytosine (5mC)).[000190] In certain aspects, the dsRNA is partially (e.g., greater than about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, or 45% of the total nucleotides), substantially (e.g., greater than about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the total nucleotides), or entirely made of modified nucleotides containing the modification on 2’ sugar ring. In some embodiments, the dsRNA is partially (e.g., greater than about 1 %, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, or 45% of the total nucleotides) made of modified nucleotides containing the modification on 2' sugar ring. In some embodiments, the dsRNA is substantially (e.g., greater than about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the total nucleotides) made of modified nucleotides containing the modification on 2' sugar ring. In some embodiments, the dsRNA includes greater than about 80% of modified nucleotides containing the modification on 2' sugar ring based on the total nucleotides. In some embodiments, the dsRNA includes greater than about 85% of modified nucleotides containing the modification on 2' sugar ring based on the total nucleotides. In some embodiments, the dsRNA includes greater than about 90% of modified nucleotides containing the modification on 2' sugar ring based on the total nucleotides. In some embodiments, the dsRNA includes greater than about 95% of modified nucleotides containing the modification on 2' sugar ring based on the total nucleotides. In somePAT060035 -PCT-SEC01embodiments, the dsRNA is entirely made of modified nucleotides containing the modification on 2’ sugar ring.[000191] In certain aspects, the modified nucleotide may include a modification in a phosphate or phosphodiester linkage, in other words, an internucleoside linkage modification (e.g., phosphorothioate, phosphorodithioate, methylphosphonate, methylene phosphonate, or vinyl phosphonate (VP) linkage). In some embodiments, the linkage modification may include phosphorothioate (PS) having a structure of *, which may be an Rp isomer or an Sp isomer. In some embodiments, the linkage modification may °XSHO=P"oinclude phosphorothioate (PS) having a structure of*, which may be a stereopure Rp isomer. In some embodiments, the linkage modification may include phosphorothioate ^SH°=P'o(PS) having a structure of *, which may be a stereopure Sp isomer.[000192] For example, the modified nucleotide including 3 '-PS modification can berepresented ass, or a pharmaceutically acceptable salt thereof, wherein R represents H, OH or a substituent (e.g,, -F, -CHs, -OMe, or MOE) and is an attachment point to the adjacent nucleotides. In some embodiments, the 3'-PS group may be a stereopure Sp isomer. In some embodiments, the 3'-PS group may be a stereopure Rp isomer.[000193] In certain aspects, the dsRNAi agent may be entirely made of modified nucleotides having one or more internucleoside linkage modification and / or modifications in the sugar moieties of the nucleotides.[000194] In certain aspects, the first nucleotide from the 5' end of each strand (e.g., sense strand and antisense strand) may include an additional phosphate group or a variant thereofPAT060035 -PCT-SEC01(e.g., phosphorothioate, phosphorodithioate, methylphosphonate, methylene phosphonate, or vinyl phosphonate (VP)) attached or linked to the 5′ terminal group of the first nucleotide.[000195] In some embodiments, the first nucleotide from the 5' end of each strand (e.g., sense strand and antisense strand) includes a 5 '-vinyl phosphonate (5'-VP) group that is achemical moiety having the structure ofor a pharmaceutically acceptable salt thereof, wherein represents the point of attachment to the 5' carbon of the pentofuranosyl sugar of a nucleotide. In some embodiments, the first nucleotide from the 5' end of each strand (e.g., sense strand and antisense strand) may include (E)-vinyl phosphonate (VP)having a structure ofor a pharmaceutically acceptable salt thereof, whereinrepresents the point of attachment to the 4' carbon of the pentofuranosyl sugar. In some embodiments, the first nucleotide from the 5' end of each strand (e.g., sense strand andantisense strand) may include (Z)-vinyl phosphonate having a structure ofa pharmaceutically acceptable salt thereof, wherein represents the point of attachment to the 4′ carbon of the pentofuranosyl sugar.[000196] In some embodiments, the first nucleotide from the 5' end of each strand (e.g., sense strand and antisense strand) includes an inverted abasic deoxynucleotide that contains OHa chemical moiety having the structureof, or a pharmaceutically acceptable salt thereof, wherein » represents the point of attachment to the 5 '-end, via phosphodiester linkage, of the pentofuranosyl sugar of a nucleotide. In some embodiments, the first nucleotide from tire 3' end of each strand (e.g., sense strand and antisense strand) includes an inverted abasic deoxynucleotide that contains a chemical moiety having the structure ofOH, or a pharmaceutically acceptable salt thereof, wherein « represents the point of attachment to the 3 '-end, via phosphodiester linkage, of the pentofuranosyl sugar of aPAT060035 -PCT-SEC01nucleotide. Unless otherwise indicated, the inverted abasic deoxynucleotide is considered as a chemical moiety conjugated to a nucleotide, and is not counted as an independent nucleotide or position in each strand.[000197] In certain aspects, one or more of tire modified nucleotides contain a 2' modification (e.g,, 2'-0Me, 2'-F, 2'-M0E, 2'-deoxy, etc.) and an internucleoside linkage modification (e.g., phosphorothioate or (E)-vinyl phosphonate). In some embodiments, one or more of the modified nucleotides contain 2'-0Me modification and phosphorothioate group. In some embodiments, one or more of the modified nucleotides contain 2'-0Me modification and (E)-vmyl phosphonate group. In some embodiments, one or more of the modified nucleotides contain 2'-F modification and phosphorothioate group. In some embodiments, one or more of tire modified nucleotides contain 2'-F and (E)-vinyl phosphonate group. In some embodiments, one or more of tire modified nucleotides contain 2'-M0E modification and phosphorothioate group. In some embodiments, one or more of the modified nucleotides contain 2'-M0E modification and (E)-vinyl phosphonate group. In some embodiments, one or more of the modified nucleotides contain 2'-deoxy modification and phosphorothioate group. In some embodiments, one or more of the modified nucleotides contain 2'-0Me modification and (E)-vinyl phosphonate group. In some embodiments, one or more of the modified nucleotides are GNA containing (E)-vinyl phosphonate group. In some embodiments, one or more of the modified nucleotides are GNA containing a phosphorothioate group. In some embodiments, one or more of the modified nucleotides are TNA containing (E)-vinyl phosphonate group. In some embodiments, one or more of tire modified nucleotides are TNA containing a phosphorothioate group,[000198] In certain aspects, the modified nucleotides contain one or more modifications on a modified nucleobase. In some embodiments, one or more of the modified nucleotides may include thymine (“T”) nucleobase (“ribothymidine” or “5-methyluridine”) in the ribonucleotide (e.g., including 2'-OH). In some embodiments, one or more of the modified nucleotides may include methylcytosine nucleobase (e.g., 5 -methylcytidine or N4- methylcytidine). In certain aspects, one or more of the modified nucleotides may contain no nucleobase or be abasic.PAT060035 -PCT-SEC01Sense Strand (SS)[000199] In certain aspects, a sense strand of the dsRNA as described herein are substantially (e.g., greater than about 80%, 85%, 90%, or 95% of the total nucleotides) made of modified nucleotides. In another certain aspect, the sense strand is entirely made of modified nucleotides.[000200] In certain aspects, a sense strand of the dsRNA as described herein includes two or more 2'-M0E modifications. In some embodiments, the sense strand includes two, four, six or eight 2'-M0E modifications. In some embodiments, the sense strand includes two 2'-M0E modifications. In some embodiments, the sense strand includes four 2'-M0E modifications. In some embodiments, the sense strand includes six 2'-M0E modifications. In some embodiments, the sense strand includes eight 2'-M0E modifications.[000201] In some embodiments, the 2'-M0E modified nucleotides in the sense strand asdescribed herein include a structure of or a pharmaceutically acceptable salt thereof, wherein71is an attachment point to a linkage (e.g., phosphate or phosphorothioate group) or the adjacent nucleotides and “Base” is a nucleobase. [000202] In some embodiments, the 2 -MOE modified nucleotides in the sense strand asdescribed herein include a structureof pharmaceutically acceptable salt thereof, wherein71is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides and “Base” is a nucleobase. In some embodiments, the 2′-MOE modified nucleotides in the sense strand as describedPAT060035-PCT-SEC01herein include a structureof or a pharmaceutically acceptable salt thereof.[000203] In some embodiments, the 2'-M0E modified nucleotides include a structure of, or a pharmaceutically acceptable salt thereof, wherein1is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments, the 2'-M0E modified nucleotides include aacceptable salt thereof. In some embodiments, the 2'-M0E modified nucleotides include a, or a pharmaceutically acceptable salt thereof.PAT060035-PCT-SEC01[000204] In some embodiments, the 2'-MOE modified nucleotides include a nucleotidepharmaceutically acceptable salt thereof, whereinis an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments, the 2'- MOE modified nucleotides include a nucleotide having a structure of, or a pharmaceutically acceptable salt thereof. In some embodiments, the 2'-M0E modified nucleotides include a nucleotide having a structure of, or a pharmaceutically acceptable salt thereof. In some embodiments, the 2'-M0E modified nucleotides include a nucleotidePAT060035-PCT-SEC01having a structureof, or a pharmaceutically acceptable salt thereof.[000205] In some embodiments, the 2'-M0E modified nucleotides in the sense strand as oOHdescribed herein include a nucleotide having a structureof, or a pharmaceutically acceptable salt thereof wherein is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments, the 2′-MOE modified nucleotides in the sense strand as described herein include a nucleotide having a structure of, or a pharmaceutically acceptable salt thereof.PAT060035 -PCT-SEC01[000206] In some embodiments, the 2′-MOE modified nucleotides include a nucleotidepharmaceutically acceptable salt thereof, wherein1is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments, the 2'- MOE modified nucleotides include a nucleotide having a structure of, or a pharmaceutically acceptable salt thereof.[000207] In certain aspects, at least one of the 2 -MOE modified nucleotides in the sensestrand as described herein has a structureof, or a pharmaceutically acceptable salt thereof, wherein71is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. InPAT060035-PCT-SEC01some embodiments, at least one of the 2'-M0E modified nucleotides in the sense strand asdescribed herein has a structureof or a pharmaceutically acceptable salt thereof.[000208] In some embodiments, the first nucleotide from the 5' end of the sense strandacceptable salt thereof. In some embodiments, the first nucleotide from the 5' end of thesense strand includes a structure of, or a pharmaceutically acceptable salt thereof.[000209] In some embodiments, the first nucleotide from the 3' end of the sense strand o oincludes a structure of OH, OH. or a pharmaceuticallyPAT060035-PCT-SEC01acceptable salt thereof. In some embodiments, the first nucleotide from the 3' end of theor a pharmaceutically acceptable salt thereof, whereinis an attachment point to a ligand. In some embodiments, the first nucleotide from the 3 ' end of the sense strandincludes a structureof, or a pharmaceutically acceptable salt thereof[000210] In certain aspects, at least one of the 2'-M0E modified nucleotides in the sensestrand as described herein has a structure ofPAT060035-PCT-SEC01, or a pharmaceutically acceptable salt thereof, wherein71is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments, at least one of the 2'-M0E modified nucleotides in the sense strand as described herein has a structure of, or a pharmaceutically acceptable salt thereof.[000211] In some embodiments, the first nucleotide from the 5' end of the sense strandincludes a structure of or a pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide from the 5' end of thesense strand includes a structure of acceptable salt thereof.PAT060035-PCT-SEC01000212] In some embodiments, the first nucleotide from the 3’ end of the sense strandor a pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide fromthereof, wherein1is an attachment point to a ligand. In some embodiments, the first nucleotide from the 3' end of the sense strand includes a structure of, or a pharmaceutically acceptable salt thereof.PAT060035-PCT-SEC01[000213] In certain aspects, at least one of the 2 -MOE modified nucleotides in the sensestrand as described herein has a structureofor a pharmaceutically acceptable salt thereof, wherein1is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments, at least one of the 2'-M0E modified nucleotides in the sense strand as described herein has a structure ofor a pharmaceutically acceptable salt thereof.[000214] In some embodiments, the first nucleotide from the 5' end of the sense strandpharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide fromPAT060035-PCT-SEC01the 5' end of the sense strand includes a structure of pharmaceutically acceptable salt thereof.[000215] In some embodiments, the first nucleotide from the 3' end of the sense strandhas a structure of OH OH, or a pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide fromthe 3' end of the sense strand has a structure ofPAT060035-PCT-SEC01salt thereof, wherein1is an attachment point to a ligand. In some embodiments, the firstnucleotide from the 3' end of the sense strand has a structureof or a pharmaceutically acceptable salt thereof.[000216] In certain aspects, at least one of the 2′-MOE modified nucleotides in the sensestrand as described herein has a structureofacceptable salt thereof, wherein71is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments, at least one of the 2 ’-MOE modified nucleotides in the sense strand as described herein has a structure ofoor a pharmaceutically acceptable salt thereofPAT060035-PCT-SEC01[000217] In some embodiments, the first nucleotide from the 5’ end of the sense strandincludes a structureof pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide fromthe 5' end of the sense strand includes a structure of pharmaceutically acceptable salt thereof.[000218] In some embodiments, the first nucleotide from the 3' end of the sense strandhas a structureof OH pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide from the 3' end of the sense strand has a structure ofPAT060035-PCT-SEC01acceptable salt thereof, whereinis an attachment point to a ligand. In some embodiments, the first nucleotide from the 3' end of the sense strand has a structure ofor a pharmaceutically acceptable salt thereof.[000219] In certain aspects, the 2′-MOE modified nucleotides locate at both 5′ and 3′ ends of a sense strand so as to form a structural confinement (“2'-M0E clamp”) at the sense strand termini. In some embodiments, the 2'-M0E clamps may be symmetric and having the same number of 2'-M0E modified nucleotides at both 5' and 3' ends of the sense strand. For example, the sense strand includes one 2'-M0E modified nucleotide at 5' end and one 2'-M0E modified nucleotide at 3' end; two 2'-M0E modified nucleotides at 5’ end and two 2'-M0E modified nucleotides at 3' end: or three 2'-M0E modified nucleotides at 5' end and three 2'-M0E modified nucleotides at 3' end. In somePAT060035-PCT-SEC01embodiments, the 2′-MOE clamps may be asymmetric and having different numbers of 2'- MOE nucleotides at 5' and 3' ends of the sense strand. For example, the sense strand includes one 2'-M0E modified nucleotide at 5' end only; one 2'-M0E modified nucleotide at 3' end only; two 2'-M0E modified nucleotides at 5' end only; two 2'-M0E modified nucleotides at 3' end only; one 2'-M0E modified nucleotide at 5' end and two 2'-M0E modified nucleotides at 3' end; or two 2'-M0E modified nucleotides at 5’ end and one 2'- MOE modified nucleotide at 3' end.000220] In certain aspects, the sense strand includes one 2'-M0E modified nucleotide at 5' end and one 2 / -MOE modified nucleotide at 3' end. In some embodiments, the sense strand includes only one 2'-M0E modified nucleotide at 5' end and only one 2'-M0E modified nucleotide at 3' end. In some embodiments, the sense strand includes only one 2'-M0E modified nucleotide at 5’ end. In some embodiments, the sense strand includes only one 2'-M0E modified nucleotide at. 3’ end.[000221] In certain aspects, the sense strand includes at least two contiguous 2′-MOE modified nucleotides at 5′ end and at least two 2′-MOE modified nucleotides at 3′ end. In some embodiments, the sense strand includes only two 2′-MOE modified nucleotides at 5′ end and only two 2′-MOE modified nucleotides at 3′ end. In some embodiments, the sense strand includes only two 2′-MOE modified nucleotides at 5′ end. In some embodiments, the sense strand includes only two 2′-MOE modified nucleotides at 3′ end.[000222] In certain aspects, the sense strand is 21 nucleotides in length. In some embodiments, the sense strand includes one, two, three, or four 2'-MOE modified nucleotides positioned at the 1st, 2nd, 20th, and / or 21 st nucleotides from the 5' end of the sense strand. In some embodiments, the sense strand includes two 2'-M0E modified nucleotides positioned at the 1st, 2nd, 20th, or 21st nucleotides from the 5' end of the sense strand. In some embodiments, the sense strand includes three 2'-M0E modified nucleotides positioned at the 1st, 2nd, 20th, or 21st nucleotides from the 5' end of tire sense strand. In some embodiments, the sense strand includes 2'-M0E modified nucleotides positioned at the 1 st, 2nd, 20th, and 21st nucleotides from the 5' end of the sense strand. In some embodiments, the sense strand does not include a 2'-M0E modified nucleotide at the 3rd to 19th nucleotides from 5’ end of the sense strands.[000223] Alternatively, in certain aspects, a sense strand of the dsRNA as described herein includes two or more TNAs. In some embodiments, the sense strand includes two, four, six or eight TNAs. In some embodiments, the sense strand includes two TNAs. InPAT060035 -PCT-SEC01some embodiments, the sense strand includes four TNAs. In some embodiments, the sense strand includes six TNAs. In some embodiments, the sense strand includes eight TNAs.[000224] In certain aspects, the sense strand includes at least two contiguous TNAs at 5' end and at least two TNAs at 3' end. In some embodiments, the sense strand includes only two TNAs at 5' end and only two TNAs at 3’ end. In some embodiments, the sense strand includes only two TNAs at 5' end. In some embodiments, the sense strand includes only two TNAs at 3' end.[000225] In some embodiments, the TNAs in the sense strand as described herein^t-O-^^ / BaseOinclude a structure of, or a pharmaceutically acceptable salt thereof, whereinis an attachment point to a linkage (e.g., phosphate or phosphorothioate group) or the adjacent nucleotides and ‘" Base” is a nucleobase.[000226] In some embodiments, the TNAs in the sense strand as described hereininclude a structure of or a pharmaceutically acceptable salt thereof, wherein71is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides and "‘Base” is a nucleobase. In some embodiments, the TNAs in the dsRN A as described herein include a structure ofBaseOO=p— SHor a pharmaceutically acceptable salt thereof.PAT060035-PCT-SEC01[000227] In some embodiments, the TNAs include a structureof, or a pharmaceutically acceptable salt thereof. wherein71is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacentnucleotides. In some embodiments, the TNAs include a structureof or a pharmaceutically acceptable salt thereof.[000228] In some embodiments, the TNAs include a nucleotide having a structure ofor a pharmaceutically acceptable salt thereof, wherein1is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments, the TNAs include aPAT060035-PCT-SEC01nucleotide having a structure of salt thereof.[000229] In some embodiments, the TNAs in the dsRNA as described herein include aor a pharmaceutically acceptable salt thereof, wherein71is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments, the TNAs in the dsRNA as described herein include a nucleotidehaving a structure of, or a pharmaceutically acceptable salt thereof.PAT060035 -PCT-SEC01[000230] In some embodiments, the TNAs include a nucleotide having a structure ofpharmaceutically acceptable salt thereof, wherein1is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments, the TNAsinclude a nucleotide having a structure of or a pharmaceutically acceptable salt thereof.[000231] In certain aspects, at least one of the TNAs in the sense strand as describedherein has a structureof or a pharmaceutically acceptable salt thereof, wherein1is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. In some embodiments, at least one of the TNAs in the sense strand as described herein has a structure of, or a pharmaceutically acceptable salt thereof.PAT060035-PCT-SEC01000232] In some embodiments, the first nucleotide from the 5’ end of the sense strandincludes a structure of, or a pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide from the 5' end of thesense strand includes a structureof, or a pharmaceutically acceptable salt thereof.[000233] In some embodiments, the first nucleotide from the 3' end of the sense strandOH or a pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide from the 3' end of thesense strand includes a structure ofPAT060035-PCT-SEC01a pharmaceutically acceptable salt thereof and71is an attachment point to a ligand. In some embodiments, the first nucleotide from the 3' end of the sense strand includes a, or a pharmaceutically acceptable salt thereof.[000234] In certain aspects, at least one of the TNAs in the sense strand as described, or a pharmaceutically acceptable salt thereof, whereinsis an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. InPAT060035 -PCT-SEC01some embodiments, at least one of the TNAs in the sense strand as described herein has astructureof or a pharmaceutically acceptable salt thereof.[000235] In some embodiments, the first nucleotide from the 5' end of the sense strandincludes a structure of or a pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide from the 5' end of thesense strand includes a structureof or a pharmaceutically acceptable salt thereof.[000236] In some embodiments, the first nucleotide from the 3' end of the sense strandincludes a structure of [image] OH, [image] OH, or a pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide fromthe 3' end of the sense strand includes a structureofPAT060035-PCT-SEC01o O=p^OH IOIOO=p- SH, or a pharmaceutically acceptable salt thereof and1is an attachment point to a ligand. In some embodiments, the first nucleotide from the 3' end ofthe sense strand includes a structureof OH or a pharmaceutically acceptable salt thereof.[000237] In certain aspects, at least one of the TN As in the sense strand as describedherein has a structure ofO=p— SH *1, or a pharmaceutically acceptable salt thereof, wherein71is an attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides. InPAT060035 -PCT-SEC01some embodiments, at least one of the TNAs in the sense strand as described herein has a '2oO=P-SHstructure of i, or a pharmaceutically acceptable salt thereof.[000238] In some embodiments, the first nucleotide from the 5' end of the sense strand '2 '2NoO=p— SHincludes a structure of, or a pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide from the 5' end of theNsense strand includes a structureof, or a pharmaceutically acceptable salt thereof.[000239] In some embodiments, the first nucleotide from the 3' end of the sense strandNo O o=p— OH o=p— SHIincludes a structure of OH, or a pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide from NH2the 3' end of the sense strand includes a structure ofPAT060035-PCT-SEC01thereof and1is an attachment point to a ligand, In some embodiments, the first nucleotide from the 3' end of the sense strand includes a structure of, or a pharmaceutically acceptable salt thereof.[000240] In certain aspects, at least one of the TNAs in the sense strand as describedherein has a structure of, or a pharmaceutically acceptable salt thereof, whereinan attachment point to a terminal group (e.g., H, OH, or salt) or the adjacent nucleotides.PAT060035-PCT-SEC01In some embodiments, at least one of the TNAs in the sense strand as described herein has oY O / NN NH2OO=p— SHa structure of, or a pharmaceutically acceptable salt thereof.[000241] In some embodiments, the first nucleotide from the 5' end of the sense strandincludes a structure of pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide fromthe 5' end of the sense strand includes a structure of pharmaceutically acceptable salt thereof.[000242] In some embodiments, the first nucleotide from the 3' end of the sense strando o=p— SH Iincludes a structure of OH, or a pharmaceutically acceptable salt thereof In some embodiments, the first nucleotide fromthe 3' end of the sense strand includes a structure ofPAT060035-PCT-SEC01or a pharmaceutically acceptable salt thereof andis an attachment point to a ligand. In some embodiments, the first nucleotide from the 3' end of the sense strand includes a structure ofor a pharmaceutically acceptable salt thereof.[000243] In certain aspects, the TNAs locate at both 5' and 3' ends of a sense strand so as to form a structural confinement (“TNA clamp”) at the sense strand termini. In some embodiments, tire TNA ciamps may be symmetric and having the same number of TNAs at. both 5' and 3' ends of the sense strand. For example, the sense strand includes one TNA at 5' end and one TNA at 3' end; two TNAs at 5' end and two TNAs at 3' end; or three TNAs at 5' end and three TNAs at 3' end. In some embodiments, the TNA clamps may be asymmetric and having different numbers of TNAs at 5' and 3' ends of the sense strand. For example, the sense strand includes one TNA at 5' end only; one TNA at 3’ end only; two TNAs at 5' end only; two TNAs at 3' end only; one TNA at 5' end and two TNAs at 3' end; or two TNAs at 5' end and one TNA at 3' end.[000244] In certain aspects, the sense strand includes one TNA at 5' end and one TNA at 3' end. In some embodiments, the sense strand includes only one TNA at 5' end and onlyPAT060035 -PCT-SEC01one INA at 3' end. In some embodiments, the sense strand includes only one TNA at 5' end. In some embodiments, the sense strand includes only one TNA at 3' end.[000245] In certain aspects, the sense strand includes at least two contiguous TNAs at 5' end and at least two TNAs at 3' end. In some embodiments, the sense strand includes only two TNAs at 5' end and only two TNAs at 3' end. In some embodiments, the sense strand includes only two TNAs at 5' end. In some embodiments, the sense strand includes only two TNAs at 3' end.[000246] In certain aspects, the sense strand is 21 nucleotides in length. In some embodiments, the sense strand includes one, two, three, or four TNAs positioned at the 1 st, 2nd, 20th, and / or 21 st nucleotides from the 5' end of the sense strand. In some embodiments, the sense strand includes two TNAs positioned at the 1st, 2nd, 20th, or 21st nucleotides from the 5' end of the sense strand. In some embodiments, the sense strand includes three TNAs positioned at the 1st, 2nd, 20th, or 21st nucleotides from the 5' end of the sense strand. In some embodiments, the sense strand includes TNAs positioned at the 1st, 2nd, 20th, and 21st nucleotides from the 5' end of tire sense strand. In some embodiments, the sense strand does not include a TNA at the 3rd to 19th nucleotides from 5' end of the sense strands.[000247] In certain aspects, the sense strand of the dsRNA as described herein includes two or more 2’-F modifications. In some embodiments, the sense strand of the dsRNA includes two, three, tour, five, six, seven, or eight 2'-F modified nucleotides. In some embodiments, the sense strand includes two 2'-F modified nucleotides. In some embodiments, the sense strand includes three 2’-F modified nucleotides. In some embodiments, the sense strand includes four 2'-F modified nucleotides. In some embodiments, the sense strand includes five 2'-F modified nucleotides. In some embodiments, the sense strand includes six 2'-F modified nucleotides. In some embodiments, the sense strand includes seven 2'-F modified nucleotides. In some embodiments, the sense strand includes eight 2'-F modified nucleotides. In some embodiments, two contiguous 2'-F modified nucleotides locate in the sense strand. In some embodiments, three contiguous 2'-F modified nucleotides locate in the sense strand. In some embodiments, four contiguous 2'-F modified nucleotides locate in the sense strand.[000248] In certain aspects, the sense strand is 21 nucleotides in length. In some embodiments, 2'-F modified nucleotides locate at 5th, 7th, 8th, and / or 9th positions fromPAT060035 -PCT-SEC01the 5' end of the sense strand. In some embodiments, 2'-F modified nucleotides locate at 6th, 8th, 9th, and / or 10th positions from the 5' end of the sense strand. In some embodiments, 2'-F modified nucleotides locate at 7th, 9th, 1 Oth, and / or 11th positions from the 5’ end of the sense strand. In some embodiments, 2'-F modified nucleotides locate at 8th, 10th, 11th, and / or 12th positions from the 5' end of the sense strand. In some embodiments, 2'-F modified nucleotides locate at 9th, 11th, 12th, and / or 13th positions from the 5' end of the sense strand.[000249] In certain aspects, a sense strand of the dsRNA as described herein includes one, two, three, or four 2'-deoxy modifications (DNA). In some embodiments, the sense strand of the dsRNA includes one 2'-deoxy modified nucleotide. In some embodiments, the sense strand includes two 2 '-deoxy modified nucleotides. In some embodiments, the sense strand includes three 2'-deoxy modified nucleotides. In some embodiments, the sense strand includes four 2'-deoxy modified nucleotides.[000250] In certain aspects, a sense strand of the dsRNA as described herein includes one, two, three, or four deoxythymidines (dT). In some embodiments, the sense strand of the dsRNA includes one deoxythymidine (dT). In some embodiments, the sense strand includes two deoxythymidines. In some embodiments, the sense strand includes three deoxythymidines (dT). In some embodiments, the sense strand includes four deoxythymidines.[000251] In some embodiments, the sense strand is 21 nucleotides in length. In some embodiments, one or more 2'-deoxy modified nucleotides locate at 5th, 7th, 8th, and / or 9th positions from the 5' end of tire sense strand. In some embodiments, one or more 2'-deoxy modified nucleotides locate at 6th, 8th, 9th, and / or 10th positions from the 5' end of the sense strand. In some embodiments, one or more 2'-deoxy modified nucleotides locate at 7th, 9th, 10th, and / or 11th positions from the 5' end of the sense strand. In some embodiments, one or more 2'-deoxy modified nucleotides locate at 8th, 10th, 11th, and / or 12th positions from the 5' end of the sense strand. In some embodiments, one or more 2'- deoxy modified nucleotides locate at 9th, 11th, 12th, and / or 13th positions from the 5’ end of die sense strand.[000252] In some embodiments, the sense strand is 21 nucleotides in length and one 2'- deoxy modified nucleotide locates at 7th position from the 5' end of the sense strand. In some embodiments, the sense strand is 21 nucleotides in length and one 2'-deoxy modified nucleotide locates at 8th position from the 5' end of the sense strand. In somePAT060035 -PCT-SEC01embodiments, the sense strand is 21 nucleotides in length and one 2'-deoxy modified nucleotide locates at 9th position from the 5' end of the sense strand. In some embodiments, the sense strand is 21 nucleotides in length and one 2'-deoxy modified nucleotide locates at 10th position from the 5' end of the sense strand. In some embodiments, the sense strand is 21 nucleotides in length and one 2'-deoxy modified nucleotide locates at 11th position from the 5' end of the sense strand. In some embodiments, the sense strand is 21 nucleotides in length and one 2'-deoxy modified nucleotide locates at 12th position from the 5' end of the sense strand. In some embodiments, the sense strand is 21 nucleotides in length and one 2'-deoxy modified nucleotide locates at 13th position from the 5' end of the sense strand. In some embodiments, the sense strand is 21 nucleotides in length and one 2'-deoxy modified nucleotide locates at 14th position from the 5' end of the sense strand.[000253] In some embodiments, the sense strand is 21 nucleotides in length and one deoxythymidine (dT) locates at 7th position from the 5' end of the sense strand. In some embodiments, the sense strand is 21 nucleotides in length and one deoxythymidine (dT) locates at 8th position from the 5' end of the sense strand. In some embodiments, the sense strand is 21 nucleotides in length and one deoxythymidine (dT) locates at 9th position from the 5' end of the sense strand. In some embodiments, the sense strand is 21 nucleotides in length and one deoxythymidine (dT) locates at 10th position from the 5' end of the sense strand. In some embodiments, the sense strand is 21 nucleotides in length and one deoxythymidine (dT) locates at 11th position from the 5' end of the sense strand. In some embodiments, the sense strand is 21 nucleotides in length and one deoxythymidine (dT) locates at 12th position from the 5' end of the sense strand. In some embodiments, the sense strand is 21 nucleotides in length and one deoxythymidine (dT) locates at 13th position from the 5' end of the sense strand. In some embodiments, the sense strand is 21 nucleotides in length and one deoxythymidine (dT) locates at 14th position from the 5' end of the sense strand.(000254] In some embodiments, when the sense strand is 21 nucleotides in length, 2’-F modified nucleotides locate at 5th, 7th, and 8th from the 5' end of the sense strand and one deoxythymidine (dT) locates at 9th position from the 5' end of the sense strand. In some embodiments, when the sense strand is 21 nucleotides in length, 2'-F modified nucleotides locate at 6th, 8th, and 9th from the 5' end of the sense strand and one deoxythymidine (dT)PAT060035 -PCT-SEC01locates at 10th position from the 5 ' end of the sense strand. In some embodiments, when the sense strand is 21 nucleotides in length, 2'-F modified nucleotides locate at 7th, 9th, and 10th from the 5' end of the sense strand and one deoxy thymidine (dT) locates at 11th position from the 5' end of the sense strand. In some embodiments, when the sense strand is 21 nucleotides in length, 2'-F modified nucleotides locate at 8th, 10th, and 11th from the 5' end of the sense strand and one deoxythymidine (dT) locates at 12th position from the 5' end of the sense strand. In some embodiments, when the sense strand is 21 nucleotides in length, 2'-F modified nucleotides locate at 9th, 11th, and 12th from the 5' end of the sense strand and one deoxythymidine (dT) locates at 13th position from the 5' end of the sense strand.[000255] In some embodiments, the sense strand includes 2'-0Me modified nucleotides in the remaining positions in the sense strand.[000256] In certain aspects, the sense strand includes one to six phosphorothioate (PS) linkages between nucleosides. In some embodiments, the sense strand includes one, two, three, or four phosphorothioate (PS) linkages between nucleosides.[000257] In certain aspects, the sense strand is 21 nucleotides in length. In some embodiments, the sense strand includes two 3'-PS modified nucleotides at the 1st, 2nd, 19th and / or 20th positions from 5' end of the sense strand. In some embodiments, the sense strand includes three 3'-PS modified nucleotides at the 1st, 2nd, 19th and / or 20th positions from 5' end of the sense strand. In some embodiments, the sense strand includes 3 '-PS modified nucleotides at the 1st, 2nd, 19th and 20th positions from 5' end of the sense strand.[000258] In certain aspects, the sense strand is 21 nucleotides in length. In some embodiments, the sense strand includes 3'-PS modified nucleotides at the 1 st and 2nd positions from 5' end of the sense strand. In some embodiments, the sense strand includes a 3 ’-PS modified nucleotide at the 19th and 20th position from 5' end of the sense strand. In some embodiments, the sense strand includes 3'-PS modified nucleotides at the 1st and 20th positions from 5' end of the sense strand. In some embodiments, the sense strand includes 3'-PS modified nucleotides at the 1st, 2nd, 19th and 20th positions from 5' end of the sense strand.[000259] In certain aspects, the sense strand includes two to eight phosphorothioate (PS) groups or linkages between nucleosides. In certain aspects, the sense strand is 21 nucleotides in length. In some embodiments, the sense strand includes two 3 ’-PS modifiedPAT060035 -PCT-SEC01nucleotides positioned at the 1st, 2nd, 3rd, 4th, 17th, 18th, 19th and / or 20th nucleotides from 5' end of the sense strand. In some embodiments, the sense strand includes four 3'-PS modified nucleotides positioned at the 1st, 2nd, 3rd, 4th, 17th, 18th, 19th and / or 20th nucleotides from 5’ end of the sense strand. In some embodiments, the sense strand includes six 3'-PS modified nucleotides positioned at the 1st, 2nd, 3rd, 4th, 17th, 18th, 19 th and / or 20th nucleotides from 5' end of the sense strand. In some embodiments, the sense strand includes 3'-PS modified nucleotides positioned at the 1st, 2nd, 3rd, 4th, 17th, 18th, 19th and 20th nucleotides from 5' end of the sense strand.[000260] In certain aspects, the sense strand is 21 nucleotides in length. In some embodiments, at least one of the 3'-PS groups at the 1st, 2nd, 3rd, 4th, 17th, 18th, 19th and / or 20th nucleotides from 5' end of the sense strand is a stereopure Rp isomer. In some embodiments, at least one of the 3’-PS groups at the 1st, 2nd, 19th and / or 20th nucleotides from 5' end of the sense strand is a stereopure Rp isomer. In some embodiments, at least one of the 3'-PS groups at the 1st and / or 20th nucleotides from 5' end of the sense strand is a stereopure Rp isomer. In some embodiments, the 3'-PS group at the 1st nucleotide from 5' end of the sense strand is a stereopure Rp isomer. In some embodiments, the 3'-PS group at the 2nd nucleotide from 5' end of the sense strand is a. stereopure Rp isomer. In some embodiments, the 3 '-PS group at the 19th nucleotide from 5' end of the sense strand is a stereopure Rp isomer. In some embodiments, the 3 ’-PS group at the 20th nucleotide from 5' end of the sense strand is a stereopure Rp isomer. In some embodiments, the 3'-PS groups at the 1st and 20th nucleotides from 5' end of the sense strand are stereopure Rp isomers. In some embodiments, tire 3 ’-PS groups attire 1st, 2nd, 19thand 20th nucleotides from 5’ end of the sense strand are stereopure Rp isomers.[000261 ] In certain aspects, the sense strand is 21 nucleotides in length. In some embodiments, at least one of the 3'-PS groups at the 1st, 2nd, 3rd, 4th, 17th, 18th, 19th and / or 20th nucleotides from 5' end of the sense strand is a stereopure Sp isomer. In some embodiments, at least one of the 3'-PS groups at the 1st, 2nd, 19th and / or 20th nucleotides from 5’ end of the sense strand is a stereopure Sp isomer. In some embodiments, at least one of the 3'-PS groups at the 1st and / or 20th nucleotides from 5' end of the sense strand is a stereopure Sp isomer. In some embodiments, the 3'-PS group at the 1st nucleotide from 5’ end of the sense strand is a stereopure Sp isomer. In some embodiments, the 3'-PS group at the 2nd nucleotide from 5' end of the sense strand is a stereopure Sp isomer. In some embodiments, the 3'-PS group at the 19th nucleotide from 5' end of the sense strandPAT060035 -PCT-SEC01is a stereopure Sp isomer. In some embodiments, the 3'-PS group at the 20nd nucleotide from 5' end of the sense strand is a stereopure Sp isomer. In some embodiments, the 3'-PS groups at the 1st and 20th nucleotides from 5' end of the sense strand are stereopure Sp isomers. In some embodiments, the 3'-PS groups at the 1st, 2nd, 19th, and 20th nucleotides from 5' end of the sense strand are stereopure Sp isomers,[000262] In certain aspects, a sense strand of the dsRNA as described herein includes one or more of TNAs, one or more of 2'-F modified nucleotides, one or more of 2'-deoxy modified nucleotides, and one or more of 2’-OMe modified nucleotides. In certain aspects, a sense strand of the dsRNA as described herein consists of one or more of TNA s, one or more of 2'-F modified nucleotides, one or more of 2'-deoxy modified nucleotides, and one or more of 2'-OMe modified nucleotides.[000263] In certain aspects, a sense strand of the dsRNA as described herein may have a Formula (I),“X]2“X13" X14-X15-X16“Xr7“X]8“X]9" X20-X21-^'(1) wherein:each Xi, X2, X20, and X21 is independently a 2'-M0E modified nucleotide;each X3 to X19 is independently selected from a 2 '-deoxy modified nucleotide, 2'-MOE modified nucleotide, 2'-F modified nucleotide, and 2'-0Me modified nucleotide.[000264] In some embodiments, the first nucleotide from the 5' end of the sense strand (Xi) is a 2'-M0E modified nucleotide with a nucleobase T. In some embodiments, the first nucleotide from the 5' end of the sense strand (Xi) is a 2'-M0E modified nucleotide with a nucleobase methylated cytosine (e.g., 5 -methyl cytosine or N4-methyl cytosine). In some embodiments, the second nucleotide from the 5' end of the sense strand (X2) is a 2'-M0E modified nucleotide with a nucleobase A, T, G or methylated cytosine (e.g., 5- methylcytosine or N4~methylcytosine). In some embodiments, the second nucleotide from the 5' end of the sense strand (X2) is a 2'-MOE modified nucleotide with a nucleobase T. In some embodiments, the second nucleotide from the 5' end of the sense strand (X2) is a 2'- MOE modified nucleotide with a nucleobase G. In some embodiments, the second nucleotide from the 5' end of the sense strand (X2) is a 2'-M0E modified nucleotide with a nucleobase A. In some embodiments, the second nucleotide from the 5' end of the sense strand (X2) is a 2'-M0E modified nucleotide with a nucleobase methylated cytosine (e.g., 5 -methylcytosine or N4-methylcytosme).PAT060035-PCT-SEC01000265] In some embodiments, the first nucleotide from the 3’ end of the sense strand (X21) is a 2 -MOE modified nucleotide with a nucleobase A or T. In some embodiments, the first nucleotide from the 3' end of the sense strand (X21) is a 2'-MOE modified nucleotide with a nucleobase A. In some embodiments, the first nucleotide from the 3' end of the sense strand (X21) is a 2'-M0E modified nucleotide with a nucleobase T. In some embodiments, the second nucleotide from the 3' end of the sense strand (X20) is a 2'-M0E modified nucleotide with a nucleobase A. In some embodiments, the second nucleotide from the 3' end of the sense strand (X20) is a 2 / -M0E modified nucleotide with a nucleobase G. In some embodiments, the second nucleotide from the 3' end of the sense strand (X20) is a 2'-M0E modified nucleotide with a nucleobase T, In some embodiments, the second nucleotide from the 3' end of the sense strand (X20) is a 2'-MOE modified nucleotide with a nucleobase methylated cytosine (e.g., 5 -methylcytosine or N4-methylcytosine).[000266] In certain aspects, in Formula (I), X3 to X19 do not include a 2'-M0E modified nucleotide. In certain aspects, X3 to X19 do not include a TNA. In some embodiments, each X3 to Xj9 is selected from deoxyribonucleotide, 2'-F modified nucleotides and 2'-0Me modified nucleotides. In some embodiments, at least one of X3 to X19 is not a deoxy ribonucleoti de.[000267] In some embodiments, each Xr, Xf+2, and Xf+3 is 2'-F modified nucleotide and Xn-4 is 2’-deoxy modified nucleotide when f is an integer from 3 to 17. In some embodiments, f is 5. In some embodiments, f is 6. In some embodiments, f is 7. In some embodiments, f is 8. In some embodiments, f is 9. In some embodiments, X5, X7, and X8 are 2'-F modified nucleotides, and X9 is 2'-deoxy modified nucleotide (e.g., dT). In some embodiments, X6, X8, and X9 are 2'-F modified nucleotides and X10 is 2'-deoxy modified nucleotide (e.g., dT). In some embodiments, X7, X9, and Xio are 2'-F modified nucleotides, and Xi 1 is 2’ -deoxy modified nucleotide (e.g., dT). In some embodiments, X8, X10, and X11 are 2'-F modified nucleotides, and X12 is 2'-deoxy modified nucleotide (e.g., dT). In some embodiments, X9, X11, and X12 are 2'-F modified nucleotides, and X13 is 2'-deoxy modified nucleotide (e.g., dT).[000268] In some embodiments, the sense strand includes 2'-OMe modified nucleotides in the remaining positions in the sense strand.[000269] In some embodiments, at least two nucleotides from Xi, X2, X19, and X20 contain a 3'-PS group, respectively. In some embodiments, two nucleotides from Xi, X2, X19, and X20 contain a 3'-PS group, respectively. In some embodiments, three nucleotidesPAT060035 -PCT-SEC01from Xi, Xz, Xi9, arid X20 contain a 3’-PS group, respectively. In some embodiments, each Xi, X2, Xis, and X20 contains a 3'-PS group. In some embodiments, each Xi and X2 contains a 3'- PS group.[000270] In some embodiments, at least four from Xi, X2, X3, X4, X17, Xis, X19, and / or X20 contain 3'-PS groups. In some embodiments, four from Xi, X2, X3, X4, X17, Xis, X19, and / or X20 contain a 3'-PS group, respectively. In some embodiments, six from Xi, X2, X3, X4, Xi?, Xis, X19, and / or X20 contain a 3'-PS group, respectively. In some embodiments, Xi, X2, X3, X4, Xi7, Xis, X19, and X20 contain a 3'-PS group, respectively.[000271] In some embodiments, in X3 to Xis, two to six nucleotides contain 3'-PS groups. In some embodiments, in X3 to Xis, two nucleotides contain a 3'-PS group, respectively, respectively. In some embodiments, in X3 to Xis, three nucleotides contain a 3 ’-PS group, respectively. In some embodiments, in X3 to Xis, four nucleotides contain a 3'-PS group, respectively. In some embodiments, in X3 to Xis, five nucleotides contain a 3 '-PS group, respectively. In some embodiments, in X3 to X18, six nucleotides contain a 3'-PS group, respectively.[000272] In certain aspects, the sense strand includes 2'-M0E modified nucleotides positioned at the 1st, 2nd, 20th, and 21st nucleotides from the 5' end of the sense strand.[000273] In some embodiments, the sense strand having 21 nucleotides in length includes:(i) 2'-M0E modifications at the 1st, 2nd, 20th and / or 21st nucleotides from the 5' end of the sense strand; and(ii) 3'-PS modifications at the 1st, 2nd, 19th, and / or 20th nucleotides from 5' end of the sense strand.[000274] In some embodiments, the sense strand having 21 nucleotides in length includes:(i) 2'-M0E modifications at the 1st, 2nd, 20th and / or 21st nucleotides from the 5' end of the sense strand; 2'-F modifications at 7th, 9th, and 10th nucleotides from the 5' end of the sense strand; 2'-deoxy modification at 11th nucleotide; and 2'-OMe modifications in the remaining nucleotides.[000275] In some embodiments, the sense strand having 21 nucleotides in length includes:(i) 2'-MOE modifications at the 1st, 2nd, 20th and / or 21 st nucleotides from the 5' end of the sense strand; 2'-F modifications at 7th, 9th, and 10th nucleotidesPAT060035 -PCT-SEC01from the 5' end of the sense strand; and 2'-deoxy modification at 11th nucleotide; and(ii) 3'-PS modifications at the 1st and 2nd nucleotides from 5' end of the sense strand.[000276] In some embodiments, the sense strand having 21 nucleotides in length includes:(i) 2 / -M0E modifications at the 1st, 2nd, 20th and / or 21st nucleotides from the 5' end of the sense strand; 2 / -F modifications at 7th, 9th, and 10th nucleotides from the 5’ end of the sense strand; and 2'-deoxy modification at 11th nucleotide; and(ii) 3'-PS modifications at the 1st, 2nd, 19th, and 20th nucleotides from 5' end of the sense strand.[000277] In some embodiments, the sense strand having 21 nucleotides in length includes:(i) 2 / -M0E modifications at the 1st, 2nd, 20th and / or 21st nucleotides from the 5’ end of the sense strand; 2'-F modifications at 7th, 9, and 10th nucleotides from the 5' end of the sense strand; 2'-deoxy modification at 11th nucleotide; and 2'- OMe modifications in the remaining nucleotides; and(n) 3 '-PS modifications at tire 1st and 2nd nucleotides from 5' end of the sense strand.[000278] In some embodiments, the sense strand having 21 nucleotides in length includes:(i) 2'-M0E modifications at the 1st, 2nd, 20th and / or 21 st nucleotides from the 5' end of the sense strand; 2'-F modifications at 7th, 9, and 10th nucleo tides from the 5' end of the sense strand; 2'-deoxy modification at 11th nucleotide; and 2'- OMe modifications in the remaining nucleotides; and(ii) 3'-PS modifications at the 1st, 2nd, 19th, and 20th nucleotides from 5' end of the sense strand.[000279] In some embodiments, the sense strand having 21 nucleotides in length includes:(i) 2'-M0E modifications at the 1st, 2nd, 20th and 21st nucleotides from the 5' end of the sense strand; 2'-F modifications at 7th, 9, and 10th nucleotides from thePAT060035 -PCT-SEC015' end of the sense strand; 2'-deoxy modification at 11th nucleotide; and 2'- OMe modifications m the remaining nucleotides; and(ii) 3'-PS modifications at the 1st and 2nd nucleotides from 5' end of the sense strand.[000280] In some embodiments, the sense strand having 21 nucleotides in length includes:(i) 2'-M0E modifications at the 1st, 2nd, 20th and 21st nucleotides from the 5' end of the sense strand; 2'-F modifications at 7th, 9, and 1 Oth nucleotides from the 5’ end of the sense strand; 2'-deoxy modification at 11th nucleotide; and 2'- OMe modifications in the remaining nucleotides; and(ii) 3'-PS modifications at the 1st, 2nd, 19th, and 20th nucleotides from 5' end of the sense strand.[000281] In certain aspects, a sense s trand of the dsRNA as described herein may have a Formula (I'),5'-Xl-X2-X3-X4-X5-X6-X7-X8-X9-Xl0-Xll-X12-X13-X14-X15-Xl6-X17-X18-X19-X20-X2l-3'(I )wherein:each Xi, X2, X20, and X?.] is independently a TNA; andeach X3 to X19 is independently selected from 2'-deoxy modified nucleotide, 2'-M0E modified nucleotide, 2'-F modified nucleotide, and 2'-OMe modified nucleotide.[000282 In certain aspects, in Formula (I'), X3 to 19 do not include a 2'-M0E modified nucleotide. In some embodiments, each X3 to X19 is selected from deoxy ribonucleotide, 2'- F modified nucleotides and 2'-OMe modified nucleotides. In some embodiments, at least one of X3 to X19 is not a deoxyribonucleotide.[000283] In some embodiments, each Xr, Xf+2, and Xf+3 is 2'-F modified nucleotide and Xf+4 is 2’-deoxy modified nucleotide when f is an integer from 3 to 17. In some embodiments, f is 5. In some embodiments, f is 6. In some embodiments, f is 7. In some embodiments, f is 8. In some embodiments, f is 9. In some embodiments, Xs, X7, and Xs are 2'-F modified nucleotides, and X9 is 2'-deoxy modified nucleotide (e.g., dT). In some embodiments, X6, X8, and X9 are 2'-F modified nucleotides and X10 is 2'-deoxy modified nucleotide (e.g., dT). In some embodiments, X7, X9, and Xio are 2'-F modified nucleotides, and Xi 1 is 2’ -deoxy modified nucleotide (e.g., dT). In some embodiments, X8, X10, and X11 are 2'-F modified nucleotides, and X12 is 2'-deoxy modified nucleotide (e.g., dT). In somePAT060035 -PCT-SEC01embodiments, X9, X11, and X12 are 2'-F modified nucleotides, and X13 is 2'-deoxy modified nucleotide (e.g., dT).[000284] In some embodiments, the sense strand includes 2'-OMe modified nucleotides in the remaining positions in the sense strand.[000285] In some embodiments, at least two nucleotides from Xi, X2, X19, and X20 contain a 3'-PS group, respectively. In some embodiments, two from Xi, X2, X19, and X20 contains 3'-PS group. In some embodiments, three nucleotides from Xi, X2, X19, and X20 contain a 3'-PS group, respectively. In some embodiments, each Xi, X2, Xi9, and X20 contains a 3'-PS group. In some embodiments, each Xi and X2 contains a 3'-PS group.[000286] In some embodiments, at least four from X1, X2, X3, X4, X17, X18, X19, and / or X20 contain 3'-PS groups. In some embodiments, four from X1, X2, X3, X4, X17, X18, X19, and / or X20 contain a 3'-PS group, respectively. In some embodiments, six from X1, X2, X3, X4, X17, X18, X19, and / or X20 contain a 3'-PS group, respectively. In some embodiments, X1, X2, X3, X4, X17, X18, X19, and X20 contain a 3'-PS group, respectively.[000287] In some embodiments, in X3 to Xis, two to six nucleotides contain 3'-PS groups. In some embodiments, in X3 to Xis, two nucleotides contain a 3'-PS group, respectively. In some embodiments, in X3 to Xis, three nucleotides contain a. 3'-PS group, respectively. In some embodiments, in X3 to Xis, four nucleotides contain a 3'-PS group, respectively. In some embodiments, in X3 to Xis, five nucleotides contain a 3'-PS group, respectively. In some embodiments, in X3 to Xis, six nucleotides contain a 3'-PS group, respectively.[000288] In certain aspects, the sense strand includes TNAs positioned at the 1st, 2nd, 2.0th, and 21st nucleotides from the 5' end of the sense strand.[000289] In some embodiments, the sense strand having 21 nucleotides in length includes:(i) TNAs at the 1st, 2nd, 20th and / or 21st nucleotides from the 5’ end of the sense strand; and(ii) 3'-PS modifications at the 1st 2nd, 19th, and / or 20th nucleotides from 5' end of the sense strand.[000290] In some embodiments, the sense strand having 2.1 nucleotides in length includes:(i) TNAs at the 1st, 2nd, 20th and / or 21st nucleotides from the 5' end of the sense strand; 2'-F modifications at 7th, 9th, and 10th nucleotides from the 5 ' end ofPAT060035 -PCT-SEC01the sense strand; 2'-deoxy modification at 11th nucleotide; and 2'-0Me modifications in the remaining nucleotides.[000291] In some embodiments, the sense strand having 21 nucleotides in length includes:(i) TNAs at the 1st, 2nd, 20th and / or 21 st nucleotides from the 5' end of the sense strand; 2'-F modifications at 7th, 9th, and 1 Oth nucleotides from the 5' end of the sense strand; and 2 '-deoxy modification at 11th nucleotide; and (ii) 3'-PS modifications at the 1st and 2nd nucleotides from 5' end of the sense strand.[000292] In some embodiments, the sense strand having 21 nucleotides in length includes:(i) TNAs at the 1st, 2nd, 20th and / or 21st nucleotides from the 5’ end of the sense strand; 2'-F modifications at 7th, 9th, and 1 Oth nucleotides from the 5' end of the sense strand; and 2 '-deoxy modification at 11th nucleotide; and (ii) 3'-PS modifications at the 1st, 2nd, 19th, and 20th nucleotides from 5’ end of the sense strand.[000293] In some embodiments, the sense strand having 21 nucleotides in length includes:(i) TNAs at the 1st, 2nd, 20th and / or 21st nucleotides from the 5’ end of the sense strand; 2'-F modifications at 7th, 9th, and 1 Oth nucleotides from the 5' end of the sense strand; 2'-deoxy modification at 11th nucleotide; and 2'-OMe modifications in the remaining nucleotides; and(ii) 3'-PS modifications at the 1st and 2nd nucleotides from 5' end of the sense strand.J000294] In some embodiments, the sense strand having 21 nucleotides in length includes:(i) TNAs at the 1st, 2nd, 20th and / or 21 st nucleotides from the 5' end of the sense strand; 2'-F modifications at 7th, 9th, and 1 Oth nucleotides from the 5' end of the sense strand; 2'-deoxy modification at 11th nucleotide; and 2'-OMe modifications in the remaining nucleotides; and(ii) 3'-PS modifications at the 1st, 2nd, 19th, and 20th nucleotides from 5' end of the sense strand.PAT060035 -PCT-SEC01000295] In some embodiments, the sense strand having 21 nucleotides in length includes:(i) TN As at the 1st, 2nd, 20th and 21st nucleotides from the 5' end of the sense strand: 2'-F modifications at 7th, 9th, and 10th nucleotides from the 5 ' end of the sense strand; 2'-deoxy modification at 11th nucleotide; and 2'-OMe modification in the remaining nucleotides; and(ii) 3'-PS modifications at the 1st and 2nd nucleotides from 5' end of the sense strand.[000296] In some embodiments, the sense strand having 2.1 nucleotides in length includes:(i) TN As at the 1st, 2nd, 20th and 21st nucleotides from the 5' end of the sense strand; 2'-F modifications at 7th, 9th, and 10th nucleotides from the 5 ' end of the sense strand; 2'-deoxy modification at 11th nucleotide; and 2'-OMe modifications in the remaining nucleotides; and(ii) 3'-PS modifications at the 1st, 2nd, 19th, and 20th nucleotides from 5’ end of the sense strand.[000297] Exemplary modification patterns of sense strands are shown in Table 2.21 -riser SS i 2 ’-MOE TN A 2'F modified?. ’-deoxy?.’-OMe 3 '-PS linkage modification | modified 1 position nucleotide modified modifiedpatern No. | nucleoside | position nucleotide nucleotide1 position 1 position position7, 9, 10, 11 1, 2, 3, 4, 5, 1, 2.6, 8, 12, 13,14, 15, 16,17, 18, 19,20, 217, 9, 10, 11 3, 4, 5, 6, 8, 1, 212, 13, 14,15, 16, 17.18, 19SS3 | 1, 2, 20, 21 I 7, 9, 10 11 3, 4, 5, 6, 8, 1.212, 13, 14,15, 16, 17,18, 19SS4 i 1, 2, 20, 21 1 7, 9, 10, 11 3, 4, 5, 6, 8, 1, 2, 19. 2.012, 13, 14,15, 16, 17,18, 19SS5 | 1, 2, 20, 21 7, 9, 10 11 3, 4, 5, 6, 8, 1, 2, 19, 2012, 13, 14,15, 16, 17,18, 19PAT060035 -PCT-SEC01SS6 | 1, 2, 20, 21 7, 9, 10, 11 3, 4, 5, 6, 8, 1, 212, 13, 14,15, 16, 17,18, 197, 9, 10 11 3, 4, 5, 6, 8, 1, 2,12, 13, 14,15, 16, 17,18, 19SS8 | 1, 2, 20, 21 7, 9, 10, 11 3, 4, 5, 6, 8, 1, 2, 19, 2012, 13, 14,15, 16, 17,18, 19SS9 | 1, 2, 20, 21 7, 9, 10 11 3, 4, 5, 6, 8, 1, 2, 19, 2012, 13, 14,15, 16, 17,18, 19[000298] In some embodiments, the sense strand having 21 nucleotides in length has the modification pattern of SSI. In some embodiments, the sense strand having 21 nucleotides in length has the modification pattern of SS2. In some embodiments, the sense strand having 21 nucleotides in length has the modification pattern of SS3. In some embodiments, the sense strand having 21 nucleotides in length has the modification pattern of SS4. In some embodiments, the sense strand having 21 nucleotides in length has the modification pattern of SS5. In some embodiments, the sense strand having 21 nucleotides in length has the modification pattern of SS6. In some embodiments, the sense strand having 21 nucleotides in length has the modification pattern of SS7. In some embodiments, the sense strand having 21 nucleotides in length has the modification pattern of SS8. In some embodiments, the sense strand having 21 nucleotides in length has the modification pattern of SS9.Antisense Strand (AS)[000299] In certain aspects, an antisense strand of the dsRNA as described herein are substantially (e.g., greater than about 80%, 85%, 90%, or 95% of the total nucleotides) made of modified nucleotides. In another certain aspect, the antisense strand is entirely made of modified nucleotides.[000300] In certain aspects, the first nucleotide from the 5’ end of the antisense strand may contain an additional phosphate group or a variant thereof (e.g., phosphorothioate, phosphorodithioate, methylphosphonate, methylene phosphonate, or vinyl phosphonate (VP)) attached or linked to tire 5’ terminal group of the first nucleotide) attached or linked to the 5’ terminal group of the first nucleotide.PAT060035 -PCT-SEC01(000301] In certain aspects, the antisense strand includes 5 '-vinyl phosphonate (5’-VP) group at the first nucleotide from the 5' end in the antisense strand. The “5 -VP” is achemical moiety having the structure ofor a pharmaceutically acceptable salt thereof, where the wavy line represent the point of attachment to the 5' carbon of the pentofuranosyl sugar of a nucleotide.[000302] In some embodiments, the first nucleotide from the 5' end in the antisensestrand includes (E)-vinyl phosphonate (VP) having a structure ofor a pharmaceutically acceptable salt thereof, wherein the wavy line presents the point of attachment to the 4' carbon of the pentofuranosyl sugar of a nucleotide. In some embodiments, tire first nucleotide from the 5' end in the antisense strand includes (Z)-vinylphosphonate having a structure of, or a pharmaceutically acceptable salt thereof, wherein the wavy line presents the point of attachment to the 4' carbon of the pentofuranosyl sugar of a nucleotide.[000303] In some embodiments, the first nucleotide from the 5' end of the antisenss, ora pharmaceutically acceptable salt thereof. In some embodiments, the first nucleotide fromthe 5' end of the antisense strand has a structureof pharmaceutically acceptable salt thereof In some embodiments, the first nucleotide fromPAT060035-PCT-SEC01the 5' end of the antisense strand has a structure ofor a pharmaceutically acceptable salt thereof In some embodiments, die first nucleotide from the 5' end of the antisense strand has a structure ofor a pharmaceutically acceptable salt thereof.[000304] In some embodiments, the first nucleotide from the 5′ end of the antisensestrand has a structure of pharmaceutically acceptable salt thereof, whereinis an attachment point to the adjacent nucleotides. In some embodiments, the first nucleotide from the 5' end of the antisensePAT060035-PCT-SEC01strand has a structureof or a pharmaceutically acceptable salt. thereof. In some embodiments, the first nucleotide from the 5' end of the antisense strandpharmaceutically acceptable salt thereof, wherein1is an attachment point to the adjacent nucleotides. In some embodiments, the first nucleotide from the 5' end of the antisensestrand has a structureof or a pharmaceutically acceptable salt thereof.[000305] In certain aspects, the antisense strand of the dsRNA as described herein includes two or more 2′-F modifications. In some embodiments, the antisense strand of the dsRNA includes two, three, four, five, six, seven, or eight 2'-F modified nucleotides. In some embodiments, the antisense strand includes two 2'-F modified nucleotides. In some embodiments, the antisense strand includes three 2'-F modified nucleotides. In some embodiments, the antisense strand includes four 2'-F modified nucleotides. In some embodiments, the antisense strand includes five 2'-F modified nucleotides. In some embodiments, the antisense strand includes six 2'-F modified nucleotides. In some embodiments, the antisense strand includes seven 2'-F modified nucleotides. In somePAT060035-PCT-SEC01embodiments, the antisense strand includes eight 2'-F modified nucleotides. In some embodiments, two contiguous 2'-F modified nucleotides locate in the antisense strand. In some embodiments, three contiguous 2'-F modified nucleotides locate in the antisense strand. In some embodiments, four contiguous 2′-F modified nucleotides locate in the antisense strand.[000306] In certain aspects, the antisense strand is 23 nucleotides in length. In some embodiments, the antisense includes comprises two, three, or four 2'-F modifications positioned at the 2nd, 6th, 14th, and / or 16th nucleotide from 5' end of the antisense strand. In some embodiments, the antisense includes two 2'-F modifications positioned at the 2nd, 6th, 14th, and / or 16th nucleotide from 5' end of the antisense strand. In some embodiments, the antisense includes three 2'-F modifications positioned at the 2nd, 6th, 14th, and / or 16th nucleotide from 5' end of the antisense strand. In some embodiments, the antisense includes 2′-F modifications positioned at the 2nd, 6th, 14th, and 16th nucleotide from 5′ end of the antisense strand.[000307] In certain aspects, an antisense strand of the dsRNA as described herein does not include a 2′-MOE modification. Alternatively, in certain aspects, the antisense strand includes one to four 2′-MOE modified nucleotides. In some embodiments, the antisense strand includes one 2′-MOE modified nucleotide. In some embodiments, the antisense strand includes two 2′-MOE modified nucleotides. In some embodiments, the antisense strand includes three 2′-MOE modified nucleotides. In some embodiments, the antisense strand includes four 2′-MOE modified nucleotides.[000308] In certain aspects, the antisense strand includes at least one GNA. In some embodiments, the antisense strand includes only one GNA.[000309] In certain aspects, the antisense strand is 23 nucleotides in length. In some embodiments, the antisense strand includes only one GNA at the 4th nucleotide from 5′ end of the antisense strand. In some embodiments, the antisense strand includes only one GNA at the 5th nucleotide from 5’ end of the antisense strand. In some embodiments, the antisense strand includes only one GNA at the 6th nucleotide from 5' end of the antisense strand. In some embodiments, the antisense strand includes only one GNA at the 7th nucleotide from 5’ end of the antisense strand.[000310] In certain aspects, the antisense strand includes at least one TNA. In some embodiments, the antisense strand includes only one TNA.PAT060035-PCT-SEC01[000311] In certain aspects, the antisense strand is 23 nucleotides in length. In some embodiments, the antisense strand includes only one TNA at the 3rd nucleotide from 5' end of the antisense strand. In some embodiments, the antisense strand includes only one TNA at the 4th nucleotide from 5' end of the antisense strand. In some embodiments, the antisense strand includes only one TNA at the 5th nucleotide from 5' end of the antisense strand. In some embodiments, the antisense strand includes only one TNA at the 6th nucleotide from 5′ end of the antisense strand. In some embodiments, the antisense strand includes only one TNA at the 7th nucleotide from 5′ end of the antisense strand. In some embodiments, the antisense strand includes only one TNA at the 8th nucleotide from 5' end of the antisense strand.[000312] In certain aspects, the antisense strand includes at least one 2'-deoxy modified nucleotide (e.g., dT, dA, dG, or dC). In some embodiments, the antisense strand includes only one 2'-deoxy modified nucleotide (e.g., dT, dA, dG, or dC).[000313] In certain aspects, the antisense strand is 23 nucleotides in length. In some embodiments, the antisense strand includes only one 2'-deoxy modified nucleotide (e.g., dT, dA, dG, or dC) at the 3rd nucleotide from 5’ end of the antisense strand. In some embodiments, the antisense strand includes only one 2'-deoxy modified nucleotide (e.g., dT, dA, dG, or dC) at the 4th nucleotide from 5' end of the antisense strand. In some embodiments, the antisense strand includes only one 2'-deoxy modified nucleotide (e.g., dT, dA, dG, or dC) at the 5th nucleotide from 5' end of the antisense strand. In some embodiments, the antisense strand includes only one 2 ’-deoxy modified nucleotide (e.g., dT, dA, dG, or dC) at the 6th nucleotide from 5' end of the antisense strand. In some embodiments, the antisense strand includes only one 2 ’-deoxy modified nucleotide (e.g., dT, dA, dG, or dC) at the 7th nucleotide from 5' end of the antisense strand. In some embodiments, the antisense strand includes only one 2 ’-deoxy modified nucleotide (e.g., dT, dA, dG, or dC) at the 8th nucleotide from 5' end of the antisense strand.[000314] In certain aspects, the antisense strand includes two, three, or four phosphorothioate (PS) linkages between nucleosides. In certain aspects, the antisense strand is 23 nucleotides in length. In some embodiments, the antisense strand includes two 3'-PS modifications positioned at the 1st, 2nd, 21 st, and / or 22nd nucleotides from 5' end of the antisense strand. In some embodiments, the antisense strand includes three 3'- PS modifications positioned at the 1st, 2nd, 21st, and / or 22nd nucleotides from 5' end ofPAT060035 -PCT-SEC01the antisense strand. In some embodiments, the antisense strand includes 3′-PS modifications positioned at the 1st, 2nd, 21st, and 22nd nucleotides from 5′ end of the antisense strand.[000315] In certain aspects, the antisense strand includes two to eight phosphorothioate (PS) linkages between nucleosides.[000316] In certain aspects, the antisense strand is 23 nucleotides in length. In some embodiments, the antisense strand includes two 3'-PS modified nucleotides positioned at the 1st, 2nd, 3rd, 4th, 19th, 20th, 21st, and / or 22nd nucleotides from 5' end of the antisense strand. In some embodiments, the antisense strand includes four 3'-PS modified nucleotides positioned at the 1st, 2nd, 3rd, 4th, 19th, 20th, 21st, and / or 22nd nucleotides from 5' end of the antisense strand. In some embodiments, the antisense strand includes six 3 ’-PS modified nucleotides positioned at the 1st, 2nd, 3rd, 4th, 19th, 20th, 21st, and / or 22nd nucleotides from 5' end of the antisense strand. In some embodiments, the antisense strand includes 3'-PS modified nucleotides positioned at the 1st, 2nd, 3rd, 4th, 19th, 20th, 21st, and 22nd nucleotides from 5' end of the antisense strand.[000317] In certain aspects, the antisense strand is 23 nucleotides in length. In some embodiments, at least one of the PS groups at the 1 st, 2nd, 3rd, 4th, 19th, 20th, 21st, and / or 22nd nucleotides from 5' end of the antisense strand is a stereopure Rp isomer. In some embodiments, at least one of the PS groups at the 1st, 2nd, 21st, and / or 22nd nucleotides from 5' end of the antisense strand is a stereopure Rp isomer. In some embodiments, at least one of the PS groups at the 1st and / or 22nd nucleotides from 5' end of the antisense strand is a stereopure Rp isomer. In some embodiments, the PS group at the 1st nucleotide from 5' end of the antisense strand is a stereopure Rp isomer. In some embodiments, the PS group at the 22nd nucleotide from 5' end of the antisense strand is a stereopure Rp isomer. In some embodiments, the PS groups at the 1st and 22nd nucleotides from 5’ end of the antisense strand are stereopure Rp isomers.[000318] In certain aspects, the antisense strand is 23 nucleotides in length. In some embodiments, at least one of the PS groups at the 1st, 2nd, 3rd, 4th, 19th, 20th, 21 st, and / or 22nd nucleotides from 5' end of the antisense strand is a stereopure Sp isomer. In some embodiments, at least one of the PS groups at the 1st, 2nd, 21 st, and / or 22nd nucleotides from 5' end of the antisense strand is a stereopure Sp isomer. In some embodiments, at least one of the PS groups at the 1st and / or 22nd nucleotides from 5' end of the antisense strand is a stereopure Sp isomer. In some embodiments, the PS group atPAT060035 -PCT-SEC01the 1st nucleotide from 5' end of the antisense strand is a stereopure Sp isomer. In some embodiments, the PS group at the 22nd nucleotide from 5' end of the antisense strand is a stereopure Sp isomer. In some embodiments, the PS groups at the 1st and 22nd nucleotides from 5’ end of the antisense strand are stereopure Sp isomers.[000319] In certain aspects, the antisense strand is 23 nucleotides in length. In some embodiments, at least one of the PS groups at the 1st, 2nd, 3rd, 4th, 19th, 20th, 21 st, and / or 22nd nucleotides from 5' end of the antisense strand is stereopure Sp isomer [000320] In certain aspects, an antisense strand of dsRNA may have a Formula (II):5'-Xr-X2-X3'-X4'-X5'-X6'-X7’-X8'-X9'-X10'-Xll'-X12-Xi3-X14'-X15'-Xi6-X17-X18'-X19- X20-X2i-X22'-X23- -3'(II)wherein:each Xr to X23’ is independently selected from a 2 '-deoxy modified nucleotide, 2'-F modified nucleotide, 2'-0Me modified nucleotide, 2'-M0E modified nucleotide, TNA, and GNA; andX1′ further includes a 5′-(E)-vinyl phosphonate group.[000321] In certain aspects, X1′ to X23′ do not include a 2′-MOE modified nucleotide. In some embodiments, each X1′ to X23′ is independently selected from 2′-F modified nucleotides and 2′-OMe modified nucleotides.[000322] Alternatively, in certain aspects, Xr to X23' include one to four 2'-M0E modified nucleotides. In some embodiments, one of X1′, X9′, X10′, and X23′ may be 2′-MOE modified nucleotide. In some embodiments, two of X1′, X9′, X10′, and X23′ may be 2′-MOE modified nucleotides. In some embodiments, three of X1′, X9′, X10′, and X23′ may be 2′-MOE modified nucleotides. In some embodiments, X1′, X9′, X10′, and X23′ may be 2′-MOE modified nucleotide.[000323] In some embodiments, X2′ is a 2′-F modified nucleotide. In some embodiments, X6′ is a 2′-F modified nucleotide. In some embodiments, X14′ is a 2′-F modified nucleotide. In some embodiments, X16′ is a 2′-F modified nucleotide. In some embodiments, two of X2′, X6′, X14′ and X16′ are 2′-F modified nucleotides. In some embodiments, three of X2′, X6′, X14′ and X16′ are 2′-F modified nucleotides. In some embodiments, each X2′, X6′, X14′ and X16′ is a 2′-F modified nucleotide.[000324] In some embodiments, X1′ to X23′ may include at least one GNA. In some embodiments, X1′ to X23′ may include only one GNA. In some embodiments, X3′ is aPAT060035-PCT-SEC01GNA. In some embodiments, X41is a GNA. In some embodiments, X5' is a GNA. In some embodiments, Xe’ is a GNA. In some embodiments, X?' is a GNA,[000325] In some embodiments, Xr to X231may include at least one TNA. In some embodiments, Xi - to X23’ may include only one TNA, In some embodiments, X3' is a TNA. In some embodiments, X4' is a TNA. In some embodiments, Xr is a TNA. In some embodiments, Xeris a TNA. In some embodiments, X?' is a TNA.[000326] In some embodiments, Xr to X23' may include at least one 2'-deoxy modified nucleotide (e.g., dT, dA, dG, or dC). In some embodiments, Xr to X23' may include only one 2'-deoxy modified nucleotide (e.g., dT, dA, dG, or dC). In some embodiments, X3' is a 2’-deoxy modified nucleotide (e.g., dT, dA, dG, or dC). In some embodiments, Xr is a 2 '-deoxy modified nucleotide (e.g., dT, dA, dG, or dC). In some embodiments, Xs- is a 2"~ deoxy modified nucleotide (e.g., dT, dA, dG, or dC). In some embodiments, Xe1is a 2'- deoxy modified nucleotide (e.g., dT, dA, dG, or dC). In some embodiments, X / ;is a 2'- deoxy modified nucleotide (e.g,, dT, dA, dG, or dC). In some embodiments, Xi'to X23' may include only dT. In some embodiments, X3' is dT. In some embodiments, X ' is dT. In some embodiments, X5- is dT. In some embodiments, Xe' is dT. In some embodiments, X7- is dT.[000327] In some embodiments, the antisense strand includes 2'-OMe modified nucleotides in the remaining positions in the antisense strand.[000328] In some embodiments, at least two from Xr, Xr, X21', and X221contain 3'-PS groups. In some embodiments, two from Xr, X22 X21’, and X22' contain a 3’-PS group, respectively. In some embodiments, three from Xr, r, X21', and X22' contain a 3'-PS group. In some embodiments, each Xr, Xr, X21', and X22 / contains a 3'-PS group.[000329] In some embodiments, at least four from Xr, X?r, X32 X4', X19', X20', X21', and X22' contain 3'-PS groups. In some embodiments, four from Xr, X2’, X3', Xr, Xiy, X20', X21', and X22' contain a 3'-PS group, respectively. In some embodiments, six from Xr, Xr, X31, X4', Xi9', X201, X21’, and X22' contain a 3'-PS group, respectively. In some embodiments, Xr, r, Xr, X4', X19', X201, X21-, and X221contain a 3 ’-PS group, respectively.[000330] In some embodiments, in X3' to X20', two to six nucleotides contain 3'-PS groups. In some embodiments, in Xy to X20', two nucleotides contain a 3'-PS group, respectively. In some embodiments, m X3' to X20', three nucleotides contain a 3'-PS group,PAT060035 -PCT-SEC01respectively. In some embodiments, in Xy to X20', four nucleotides contain a 3'-PS group, respectively. In some embodiments, in Xs’ to X20; five nucleotides contain a 3 -PS group, respectively. In some embodiments, in Xy to X20', six nucleotides contain a 3'-PS group, respectively.[000331] In certain aspects, the antisense strand includes 5'-(E)-VP modified nucleotide at the first nucleotide from 5' end of the antisense strand. In some embodiments, the antisense strand includes a 5'-(E)-VP-2'-OMe modified nucleotide at the first nucleotide from 5’ end of the antisense strand.[000332] In some embodiments, the antisense strand having 23 nucleotides in length includes:(i) a 5'-(E)-VP-2'-OMe modification at the first nucleotide from 5' end of the antisense strand; and(ii) 3'-PS modifications at the 1st, 2nd, 21st, and / or 22nd nucleotides from 5' end of the antisense strand.[000333 In some embodiments, the antisense strand having 23 nucleotides in length includes:(i) a 5'-(E)-VP-2'-OMe modification at the first nucleotide from 5' end of the antisense strand;(ii) 2'-F modifications at 2nd, 6th, 14th, and / or 16th nucleotides from the 5' end of the antisense strand; and 2'-0Me modifications in the remaining nucleotides; and(iii) 3'-PS modifications at the 1st, 2nd, 21st, and / or 22nd nucleotides from 5’ end of the antisense strand.[000334] In some embodiments, the antisense strand having 23 nucleotides in length includes:(i) a 5'-(E)-VP-2’-OMe modification at the first nucleotide from 5' end of the antisense strand;(ii) 2'-F modifications at 2nd, 6th, 14th, and / or 16th nucleotides from the 5' end of the antisense strand; GNA at 5th nucleotide from the 5' end of the antisense strand; and 2'-0Me modifications in the remaining nucleotides; and (iii) 3'-PS modifications at the 1st, 2nd, 21 st, and / or 22nd nucleotides from 5' end of the antisense strand.PAT060035 -PCT-SEC01[000335] In some embodiments, the antisense strand having 23 nucleotides in length includes:(i) a 5'-(E)-VP-2'-OMe modification at the first nucleotide from 5' end of the antisense strand;(H) 2'-F modifications at 2nd, 14th, and / or 16th nucleotides from the 5’ end of the antisense strand; GNA at 6th nucleotide from the 5' end of the antisense strand; and 2'-OMe modifications in the remaining nucleotides; and(iii) 3'-PS modifications at the 1st, 2nd, 21st, and / or 22nd nucleotides from 5’ end of the antisense strand.[000336] In some embodiments, the antisense strand having 23 nucleotides in length includes:(i) a 5'-(E)-VP-2’-OMe modification at the first nucleotide from 5' end of the antisense strand;(ii) 2'-F modifications at 2nd, 6th, 14th, and / or 16th nucleotides from the 5' end of the antisense strand; GNA at 7th nucleotide from the 5’ end of the antisense strand; and 2'-0Me modifications in the remaining nucleotides; and (iii) 3'-PS modifications at the 1st, 2nd, 21 st, and / or 22nd nucleotides from 5' end of the antisense strand.[000337] In some embodiments, the antisense strand having 23 nucleotides in length includes:(i) a 5'-(E)-VP-2'-OMe modification at the first nucleotide from 5' end of the antisense strand;(ii) 2'-F modifications at 2nd, 6th, 14th, and / or 16th nucleotides from the 5' end of the antisense strand; TNA at 3rd nucleotide from the 5' end of the antisense strand; and 2'-0Me modifications in the remaining nucleotides; and (in) 3'-PS modifications at the 1st, 2nd, 21st, and / or 22ndnucleotides from 5' end of the antisense strand.[000338] In some embodiments, the antisense strand having 23 nucleotides in length includes:(i) a 5'-(E)-VP-2'-OMe modification at the first nucleotide from 5' end of the antisense strand;PAT060035-PCT-SEC01(ii) 2'-F modifications at 2nd, 6th, 14th, and / or 16th nucleotides from the 5’ end of the antisense strand; TNA at 5th nucleotide from the 5’ end of the antisense strand; and 2'-0Me modifications in the remaining nucleotides; and (iii) 3 '-PS modifications at the 1st, 2nd, 21st, and / or 22nd nucleotides from 5' end of the antisense strand.[000339] In some embodiments, the antisense strand having 23 nucleotides in length includes:(i) a 5'-(E)-VP-2'-OMe modification at the first nucleotide from 5' end of the antisense strand;(ii) 2'-F modifications at 2nd, 14th, and / or 16th nucleotides from the 5' end of the antisense strand; TNA at 6thnucleotide from the 5' end of the antisense strand; and 2’-0Me modifications in the remaining nucleotides; and(iii) 3'-PS modifications at the 1st, 2nd, 21st, and / or 22nd nucleotides from 5' end of the antisense strand.[000340] In some embodiments, the antisense strand having 23 nucleotides in length includes:(i) a 5'-(E)-VP-2'-OMe modification at the first nucleotide from 5' end of the antisense strand;(ii) 2'-F modifications at 2nd, 6th, 14th, and / or 16th nucleotides from the 5' end of the antisense strand; TNA at 7th nucleotide from the 5' end of the antisense strand; and 2'-0Me modifications in the remaining nucleotides; and (iii) 3'-PS modifications at the 1st, 2nd, 21st, and / or 22nd nucleotides from 5' end of the antisense strand.[000341] In some embodiments, the antisense strand having 23 nucleotides in length includes:(i) a 5'-(E)-VP-2’-OMe modification at the first nucleotide from 5' end of the antisense strand;(ii) 2'-F modifications at 2nd, 6th, 14th, and / or 16th nucleotides from the 5' end of the antisense strand; a 2 '-deoxy modification at 5th nucleotide from the 5' end of the antisense strand; and 2'-0Me modifications in the remaining nucleotides; and(iii) 3'-PS modifications at the 1st, 2nd, 21 st, and / or 22nd nucleotides from 5' end of tire antisense strand.PAT060035 -PCT-SEC01[000342] In some embodiments, the antisense strand having 23 nucleotides in length includes:(i) a 5'-(E)-VP-2'-OMe modification at the first nucleotide from 5' end of the antisense strand;(H) 2'-F modifications at 2nd, 14th, and / or 16th nucleotides from the 5’ end of the antisense strand; a 2'-deoxy modification at 6thnucleotide from the 5' end of the antisense strand; and 2'-OMe modifications in the remaining nucleotides; and(iii) 3'-PS modifications at the 1st, 2nd, 21st, and / or 22nd nucleotides from 5' end of the antisense strand.[000343] In some embodiments, the antisense strand having 23 nucleotides in length includes:( a 5'-(E)-VP-2'-OMe modification at the first nucleotide from 5’ end of the antisense strand;(ii) 2 / -F modifications at 2nd, 6th, 14th, and / or 16th nucleotides from the 5’ end of the antisense strand; a 2'-deoxy modification at 7th nucleotide from the 5' end of the antisense strand; and 2'-0Me modifications in the remaining nucleotides; and(iii) 3'-PS modifications at the 1st, 2nd, 21st, and / or 22nd nucleotides from 5' end of the antisense strand.[000344] In some embodiments, the antisense strand having 23 nucleotides in length includes:(i) a 5'-(E)-VP-2'-OMe modification at the first nucleotide from 5' end of the antisense strand;(ii) 2'-F modifications at 2nd, 6th, 14th, and / or 16th nucleotides from the 5' end of the antisense strand; GNA at 3rd and 5th nucleotides from the 5' end of the antisense strand; and 2'-0Me modifications in the remaining nucleotides; and (iii) 3'-PS modifications at the 1st, 2nd, 21st, and / or 22nd nucleotides from 5' end of the antisense strand.[000345] In some embodiments, the antisense strand having 23 nucleotides in length includes:(i) a 5'-(E)-VP-2'-OMe modification at the first nucleotide from 5' end of the antisense strand;PAT060035 -PCT-SEC01(ii) 2'-F modifications at 2nd, 14th, and / or 16th nucleotides from the 5' end of the antisense strand; GNA at 3rd and 6th nucleotides from the 5' end of the antisense strand; and 2'-OMe modifications in the remaining nucleotides; and (iii) 3'-PS modifications at the 1st, 2nd, 21st, and / or 22nd nucleotides from 5' end of the antisense strand.[000346] In some embodiments, the antisense strand having 23 nucleotides in length includes:(i) a 5'-(E)-VP-2'-OMe modification at the first nucleotide from 5' end of the antisense strand;(ii) 2'-F modifications at 2nd, 6th, 14th, and / or 16th nucleotides from the 5' end of the antisense strand; GNA at 3rd and 7th nucleotides from the 5' end of the antisense strand; and 2'-OMe modifications in the remaining nucleotides; and (iii) 3'-PS modifications at the 1st, 2nd, 21st, and / or 22nd nucleotides from 5' end of the antisense strand.[000347] In some embodiments, the antisense strand having 23 nucleotides in length includes:(i) a 5'-(E)-VP-2'-OMe modification at the first nucleotide from 5' end of the antisense strand;(ii) 2'-F modifications at 2nd, 6th, 14th, and / or 16th nucleotides from the 5' end of the antisense strand; TNA at 3rd and 5th nucleotides from the 5' end of the antisense strand; and 2'-0Me modifications in the remaining nucleotides; and (iii) 3'-PS modifications at the 1st, 2nd, 21st, and / or 22nd nucleotides from 5' end of the antisense strand.[000348] In some embodiments, the antisense strand having 23 nucleotides in length includes:(i) a 5'-(E)-VP-2’-OMe modification at the first nucleotide from 5' end of the antisense strand;(ii) 2'-F modifications at 2nd, 14 th, and / or 16th nucleotides from the 5' end of the antisense strand; TNA at 3rd and 6th nucleotides from the 5' end of the antisense strand; and 2'-OMe modifications in the remaining nucleotides; and (iii) 3'-PS modifications at the 1st, 2nd, 21st, and / or 22nd nucleotides from 5' end of the antisense strand.PAT060035 -PCT-SEC01[000349] In some embodiments, the antisense strand having 23 nucleotides in length includes:(i) a 5'-(E)-VP-2'-OMe modification at the first nucleotide from 5' end of the antisense strand;(ii) 2'-F modifications at 2nd, 6th, 14th, and / or 16th nucleotides from the 5' end of the antisense strand; TNA at 3rd and 7th nucleotides from the 5' end of the antisense strand; and 2'-0Me modifications in the remaining nucleotides; and (iii) 3'-PS modifications at the 1st, 2nd, 21st, and / or 22nd nucleotides from 5’ end of the antisense strand.[000350] In some embodiments, the antisense strand having 23 nucleotides in length includes:(i) a 5'-(E)-VP-2’-OMe modification at the first nucleotide from 5' end of the antisense strand;(ii) 2'-F modifications at 2nd, 6th, 14th, and / or 16th nucleotides from the 5' end of the antisense strand; a 2'-deoxy modification at 3rd and 5th nucleotides from the 5' end of the antisense strand; and 2'-0Me modifications in the remaining nucleotides; and(iii) 3'-PS modifications at the 1st, 2nd, 21 st, and / or 22nd nucleotides from 5' end of the antisense strand.[000351] In some embodiments, the antisense strand having 23 nucleotides in length includes:(i) a 5'-(E)-VP-2'-OMe modification at the first nucleotide from 5' end of the antisense strand;(ii) 2'-F modifications at 2nd, 14th, and / or 16th nucleotides from the 5' end of the antisense strand; a 2 '-deoxy modification at 3rd and 6th nucleotide from the 5' end of the antisense strand; and 2’-0Me modifications in the remaining nucleotides; and(iii) 3'-PS modifications at the 1st, 2nd, 21st, and / or 22nd nucleotides from 5' end of the antisense strand.[000352] In some embodiments, the antisense strand having 23 nucleotides in length includes:(i) a 5'-(E)-VP-2'-OMe modification at the first nucleotide from 5' end of the antisense strand;PAT060035-PCT-SEC01(ii) 2'-F modifications at 2nd, 6th, 14th, and / or 16th nucleotides from the 5’ end of the antisense strand; a 2'-deoxy modification at 3rd and 7th nucleotides from the 5' end of the antisense strand; and 2'-OMe modifications in the remaining nucleotides: and(iii) 3'-PS modifications at the 1st, 2nd, 21st, and / or 22nd nucleotides from 5' end of the antisense strand.[000353] Exemplary modification patterns of antisense strands are shown in Table 3.Table 323-mer AS modification pattern | 5'-VP modified nucleotide position | 2'-F modified nucleotide | GNA position | TNA position | 2'-deoxy modified nucleotide position | 2'-OMe modified nucleotide position | 3'-PS linkageAS1 2, 6, 14, 16 1, 3, 4, 5, 7, 8, 1, 2, 21, 229, 10, 11, 12,13, 15, 17, 18,19, 20, 21.22,23AS2 1 2, 6, 14, 16 1, 3, 4, 5, 7, 8, 1, 2, 21, 229, 10, 11, 12,13, 15, 17, 18,19, 20, 21, 22,23AS3 1 2, 6, 14. 16 5 1, 3, 4, 7, 8, 9, 1, 2, 21, 2210, 11, 12, 13,15, 17, 18, 19, 20, 21, 22, 23AS4 1 2, 14, 16 6 1, 3. 4, 5, 7, 8, 1, 2, 21, 229, 10, 11, 12,13, 15, 17. 18, 19, 20, 21, 22,23AS5 1 2, 6. 14, 16 7 1, 3, 4, 5, 8, 9, 1. 2, 21, 2210, 11, 12, 13,15, 17, 18, 19,20, 21, 22. 23AS6 1 2, 6, 14. 16 3 1, 4, 5, 7, 8, 9, 1, 2, 21, 2210, 11, 12, 13,15, 17, 18, 19, 20, 21, 22, 23AS7 1 2, 6, 14, 16 5 1, 3, 4, 7, 8, 9, 1, 2, 21, 2210, 11, 12, 13,15, 17, 18, 19,20, 21, 22, 23AS8 1 2, 14. 16 6 1, 3, 4, 5, 7, 8, 1, 2, 21, 229, 10, 11, 12,13, 15, 17. 18, 19, 20, 21, 22,23AS9 1 2, 6. 14, 16 7 1, 3, 4, 5, 8, 9, 1. 2, 21, 2210, 11, 12, 13,PAT060035-PCT-SEC0123-mer AS 1 5'-VP 2’-F modified GNA TN'A 2 '-deoxy 2’-OMe 3'-PS modification 1 modified nucleotide position i position modified modified linkage pattern | nucleotide nucleotide nucleotide1 position position position15, 17, 18, 19,20, 21, 22, 23AS10 1 2, 6, 14, 16 5 1, 3, 4, 7, 8, 9, 1, 2, 21, 2210, 11, 12, 13,15, 17, 18, 19, 20, 21, 22, 23AS11 1 2, 14, 16 6 1, 3, 4, 5, 7, 8, 1, 2, 21, 229, 10, 11, 12,13, 15, 17, 18,19, 20. 21, 22,23AS12 1 2, 6, 14, 16 7 1, 3, 4, 5, 8, 9, 1, 2, 21, 2210, 11, 12, 13,15, 17, 18, 19,20, 21, 22, 23AS13 1 2, 6, 14, 16 3, 5 1, 4, 7, 8, 9, 1, 2, 21, 2210, 11, 12, 13,15, 17, 18, 19, 20, 21, 22, 23AS14 1 2, 14, 16 3, 6 1, 4, 5, 7, 8, 9, 1, 2, 21, 22 10, 11, 12, 13,15, 17, 18, 19, 20, 21, 22. 23AS15 1 2, 6, 14, 16 3, 7 1, 4, 5, 8, 9, 1, 2, 21, 2210, 11, 12, 13,15, 17, 18, 19,20. 21. 22. 23AS16 1 2, 6, 14. 16 3, 5 1, 4, 7, 8, 9, 1, 2, 21, 2210, 11, 12, 13,15, 17, 18, 19, 20, 21, 22, 23AS17 1 2, 14, 16 3, 6 1, 4, 5, 7, 8, 9, 1, 2, 21, 2210, 11, 12, 13,15, 17, 18, 19,20, 21, 22, 23AS18 1 2, 6, 14, 16 3, 7 1, 4, 5, 8, 9, 1, 2, 21, 2210, 11, 12, 13,15, 17, 18. 19, 20, 21, 22, 23AS19 1 2, 6, 14, 16 3, 5 1, 4, 7, 8, 9, 1, 2, 21, 2210, 11, 12, 13,15, 17, 18, 19,20, 21, 22, 23AS20 1 2, 14, 16 3, 6 1, 4, 5, 7, 8, 9, 1, 2, 21, 2210, 11, 12, 13,15, 17, 18, 19, 20, 21, 22. 23AS21 1 2, 6, 14, 16 3, 7 1, 4, 5, 8, 9, 1, 2, 21, 22 10, 11, 12, 13,15, 17, 18, 19,20, 21, 22, 23PAT060035-PCT-SEC01[000354] In some embodiments, the antisense strand having 23 nucleotides in length has the modification pattern of AS1. In some embodiments, the antisense strand having 23 nucleotides in length has the modification patern of AS2. In some embodiments, the antisense strand having 23 nucleotides m length has tire modification pattern of AS3. In some embodiments, the antisense strand having 23 nucleotides in length has the modification patern of AS4. In some embodiments, the antisense strand having 23 nucleotides in length has the modification pattern of AS5. In some embodiments, the antisense strand having 23 nucleotides in length has the modification pattern of AS6. In some embodiments, the antisense strand having 23 nucleotides in length has the modification pattern of AS7. In some embodiments, the antisense strand having 23 nucleotides in length has the modification pattern of AS8. In some embodiments, the antisense strand having 23 nucleotides in length has the modification pattern of AS9. In some embodiments, the antisense strand having 23 nucleotides in length has the modification patern of AS 10. In some embodiments, the antisense strand having 23 nucleotides in length has the modification pattern of AS 11. In some embodiments, the antisense strand having 23 nucleotides in length has the modification patern of AS 12, In some embodiments, the antisense strand having 23 nucleotides in length has the modification pattern of AS 13. In some embodiments, the antisense strand having 23 nucleotides in length has the modification pattern of AS 14. In some embodiments, the antisense strand having 23 nucleotides in length has the modification pattern of AS15. In some embodiments, the antisense strand having 23 nucleotides in length has the modification pattern of AS16. In some embodiments, the antisense strand having 23 nucleotides in length has the modification patern of AS17. In some embodiments, the antisense strand having 23 nucleotides in length has the modification pattern of AS 18. In some embodiments, the antisense strand having 23 nucleotides in length has the modification patern of AS 19. In some embodiments, the antisense strand having 23 nucleotides in length has the modification pattern of AS20. In some embodiments, the antisense strand having 23 nucleotides in length has the modification pattern of AS21.dsRNA modification pattern[000355] In an aspect, the dsRNA as described herein includes a sense strand of Formula (I) as described herein and an antisense strand of Formula (II) as described herein. The sense strand and the antisense strand form a duplex.PAT060035-PCT-SEC01[000356] In some embodiments, the dsRNA includes:(i) a sense strand Formula (I) including 2'-MOE modifications at Xi, X2, X20 and X21;and(ii) an antisense strand Formula (II) including a 5'-(E)-VP-2'-OMe modification at Xr.[000357] In some embodiments, the dsRNA includes:(i) a sense strand Formula (I) including:(a) 2'~MOE modifications at Xi, X2, X20 and X21; and(b) 3'-PS modifications at Xi and X2,and(ii) an antisense strand Formula (II) including:(a) a 5'-(E)-VP-2'-OMe modification at X1′; and(b) 3'-PS modifications at X1', X2', X21', and X22'.] 000358 ] In some embodiments, the dsRNA includes:(i) a sense strand Formula (I) including:(a) 2'-MOE modifications at Xi, X2, X20 and X21; and(b) 3'-PS modifications at Xi, X2, X19, andXzo,and(ii) an antisense strand Formula (II) including:(a) a 5'-(E)-VP-2'-OMe modification at X1′; and(b) 3'-PS modifications at Xr, Xz*, Xzr, and X22’.[000359] In some embodiments, the dsRNA includes:(i) a sense strand Formula (I) including:(a) 2'-MOE modifications at Xi, Xz, X20 and X21;(b) 3'-PS modifications at X1, X2, X19, and / or X20; and(c) one selected from:(cl) 2'-F modifications at X7, X9, X10 and Xu; and 2'-OMe modifications in the remaining nucleotides in the sense strand, and (c2) 2'-F modifications at X7, X9, and X10; 2'-deoxy modification at Xn; and 2'-OMe modifications in the remaining nucleotides in the sense strand,andPAT060035-PCT-SEC01(ii) an antisense strand Formula (II) including:(a) a 5'-(E)-VP-2'-OMe modification at X1′;(b) 3'-PS modifications at Xr, Xr, X21', and X22'; and(c) one selected from:(cl) 2'-F modifications at Xr, Xe’, X14' and Xi6-; and 2'-0Me modifications in the remaining nucleotides in the antisense strand, (c2) 2'-F modifications at X2', X6', X14' and X16'; TNA at X3'; and 2'-OMe modifications in the remaining nucleotides in the antisense strand, (c3) 2'-F modifications at X2', Xe', X14' and Xi6’; TNA, GN A or 2'-deoxy modification at Xst and 2'-0Me modifications in the remaining nucleotides in the antisense strand,(c4) 2'-F modifications at X2', X14' and X16'; TNA, GNA or 2'-deoxy modification at X6'; and 2'-OMe modifications in the remaining nucleotides in the antisense strand, and(c5) 2 -F modifications at Xr, Xe-, X14’ and Xj 6'; TNA, GN A or 2'-deoxy modification atX?-; and 2'-0Me modifications in the remaining nucleotides in the antisense strand.[000360] In some embodiments, the dsRNA includes:(i) a sense strand of Formula (I') including TNAs at X1, X2, X20 and X21; and(ii) an antisense strand of Formula (II) including a 5'-(E)-VP-2'-OMe modification at Xr.[000361] In some embodiments, the dsRNA includes:(i) a sense strand of Formula (I') including:(a) TNAs at Xi, X2, X20 and X21; and(b) 3'-PS modifications at Xi and X2,and(ii) an antisense strand of Formula (II) including:(a) a 5'-(E)-VP-2'-OMe modification at X1′; and(b) 3'-PS modifications at Xr, X, X21', and X22’.[000362] In some embodiments, the dsRNA includes:(i) a sense strand of Formula (I') including:(a) TNAs at Xi, X2, X20 and X21; andPAT060035-PCT-SEC01(b) 3′-PS modifications at X1, X2, X19, and X20,and(ii) an antisense strand of Formula (II) including:(a) a 5'-(E)-VP-2'-OMe modification at X1′; and(b) 3'-PS modifications at Xv, X2', X21’, and X22'.[000363] In some embodiments, the dsRNA includes:(i) a sense strand of Formula (I') including:(a) TNAs at X1, X2, X20and X21;(b) 3'-PS modifications at X1, X2, X19, and / or X20; and(c) one selected from:(cl) 2′-F modifications at X7, X9, X10and X11; and 2′-OMe modifications in the remaining nucleotides in the sense strand, and (c2) 2′-F modifications at X7, X9, and X10; 2′-deoxy modification at X11; and 2′-OMe modifications in the remaining nucleotides in the sense strand,and(ii) an antisense strand of Formula (II) including:(a) a 5'-(E)-VP-2'-OMe modification at X1′;(b) 3'-PS modifications at X1′, X2′, X21′, and X22′; and(c) one selected from:(cl) 2′-F modifications at X2′, X6′, X14′ and X16′; and 2′-OMe modifications in the remaining nucleotides in the antisense strand, (c2) 2'-F modifications at X2′, X6′, X14′ and X16′; TNA at X3′; and 2′-OMe modifications in the remaining nucleotides in the antisense strand, (c3) 2'-F modifications at X2′, X6′, X14′ and X16′; TNA, GNA or 2′-deoxy modification at X5′; and 2′-OMe modifications in the remaining nucleotides in the antisense strand,(c4) 2'-F modifications at X2′, X14′ and X16′; TNA, GNA or 2′-deoxy modification at X6′; and 2′-OMe modifications in the remaining nucleotides in the antisense strand, and(c5) 2'-F modifications at X2′, X6′, X14′ and X16′; TNA, GNA or 2′-deoxy modification at X7′; and 2′-OMe modifications in the remaining nucleotides in the antisense strand.PAT060035 -PCT-SEC01[000364] In certain aspects, the dsRNA as described herein includes a sense strand having 21 nucleotides in length and an antisense strand having 23 nucleotides.[000365] In certain aspects, the dsRNA as described herein includes a sense strand having 21 nucleotides in length and including 2'-M0E modifications at the 1st, 2nd, 20th and 21st nucleotides from the 5' end of the sense strand.[000366] In certain aspects, the dsRNA as described herein includes antisense strand having 23 nucleotides in length and including a 5'-(E)-VP-2'-OMe modification at the 1st position from 5' end of the antisense strand.[000367] In some embodiments, the dsRNA includes:(i) a sense strand having 21 nucleotides in length and including:(a) 2'-M0E modifications at the 1st, 2nd, 20th and 21st nucleotides from the 5' end of the sense strand, and(b) 3'-PS modifications at the 1st and 2nd nucleotides from 5' end of the sense strand,and(ii) an antisense strand having 23 nucleotides in length and including:(a) a 5'-(E)-VP-2'-OMe modification at the 1st position from 5' end of the antisense strand, and(b) 3'-PS modifications at the 1st, 2nd, 21st, and 22nd nucleotides from 5' end of the antisense strand.[000368] In some embodiments, the dsRNA includes:(i) a sense strand having 21 nucleotides in length and including:(a) 2'-M0E modifications at the 1st, 2nd, 20th and 21st nucleotides from the 5' end of the sense strand, and(b) 3'-PS modifications at the 1st, 2nd, 19th, and 20th nucleotides from 5' end of the sense strand,and(ii) an antisense strand having 23 nucleotides in length and including:(a) a 5'-(E)-VP-2'-OMe modification at the 1stposition from 5' end of the antisense strand, and(b) 3'-PS modifications at the 1st, 2nd, 21st, and 22ndnucleotides from 5' end of the antisense strand.[000369] In some embodiments, the dsRNA includes:PAT060035-PCT-SEC01(i) a sense strand having 21 nucleotides in length and including:(a) 2′-MOE modifications at the 1st, 2nd, 20th and 21st nucleotides from the 5′ end of the sense strand,(b) 3'-PS modifications at the 1st, 2nd, 19th, and / or 20th nucleotides from 5' end of the sense strand, and(c) one selected from:(cl) 2'-F modifications at 7th, 9th, 10th, and 11th nucleotides: and 2'-OMe modifications in the remaining nucleotides in the sense strand, and (c2) 2'-F modifications at 7th, 9th, and 10th nucleotides; 2'-deoxy modification at 11th nucleotide; and 2'-OMe modifications in the remaining nucleotides in the sense strand,and(ii) an antisense strand having 23 nucleotides in length and including:(a) a 5'-(E)-VP-2'-OMe modification at the 1stposition from 5' end of the antisense strand.(b) 3'-PS modifications at the 1st, 2nd, 21st, and 22nd nucleotides from 5' end of the antisense strand, and(c) one selected from:(cl) 2’-F modifications at the 2nd, 6th, 14th, and 16th nucleotides from 5' end; and 2'-OMe modifications in the remaining nucleotides in the antisense strand,(c2) 2'-F modifications at the 2nd, 6th, 14th, and 16th nucleotides from 5 ' end; TNA at the 3rd nucleotide from 5’ end; and 2'-OMe modifications in the remaining nucleotides in the antisense strand,(c3) 2'-F modifications at the 2nd, 6th, 14th, and 16th nucleotides from 5' end; TNA, GNA or 2’-deoxy modification at the 5th nucleotide from 5' end; and 2'-OMe modifications in the remaining nucleotides in the antisense strand,(c4) 2'-F modifications at the 2nd, 14th, and 16th nucleotides from 5' end;TNA, GNA or 2'-deoxy modification at the 6th nucleotide from 5’ end; and 2'-OMe modifications in the remaining nucleotides in the antisense strand, andPAT060035-PCT-SEC01(c5) 2'-F modifications at the 2nd, 6th, 14th, and 16th nucleotides from 5 ' end; TNA, GNA or 2′-deoxy modification at the 7th nucleotide from 5′ end; and 2′-OMe modifications in the remaining nucleotides in the antisense strand.[000370] In some embodiments, the dsRNA includes:(i) a sense strand having 21 nucleotides in length and including:(a) TN As at the 1st, 2nd, 20th and 21st nucleotides from the 5' end, and (b) 3'-PS modifications at the 1st and 2nd nucleotides from the 5' end, and(ii) an antisense strand having 23 nucleotides in length and including:(a) a 5'-(E)-VP-2'-OMe modification at the 1st position from the 5' end, and (b) 3'-PS modifications at the 1st, 2nd, 21st, and 22nd nucleotides from the 5' end.[000371] In some embodiments, the dsRNA includes:(i) a sense strand having 21 nucleotides in length and including:(a) TN As at the 1st, 2nd, 20th and 21st nucleotides from the 5' end, and (b) 3'-PS modifications at the 1st, 2nd, 19th, and 20th nucleotides from the 5' end,and(ii) an antisense strand having 23 nucleotides in length and including:(a) a 5'-(E)-VP-2'-OMe modification at the 1stposition from the 5' end, and (b) 3'-PS modifications at the 1st, 2nd, 21st, and 22nd nucleotides from the 5' end.[000372] In some embodiments, the dsRNA includes:(i) a sense strand having 21 nucleotides in length and including:(a) TNAs at the 1st, 2nd, 20th and 21st nucleotides from tire 5' end, (b) 3'-PS modifications at the 1st, 2nd, 19th, and / or 20th nucleotides from the 5' end, and(c) one selected from:(cl) 2'-F modifications at the 7th, 9th, 10th, and 11th nucleotides from the 5' end; and 2'-OMe modifications in the remaining nucleotides in the sense strand, andPAT060035-PCT-SEC01(c2) 2'-F modifications at the 7th, 9th, and 10th nucleotides from the 5' end:2'-deoxy modification at the 11th nucleotide from the 5' end; and 2'- OMe modifications in the remaining nucleotides in the sense strand, and(ii) an antisense strand having 23 nucleotides in length and including:(a) a 5'-(E)-VP-2'-OMe modification at the 1stposition from the 5' end, (b) 3'-PS modifications at the 1st, 2nd, 21st, and 22nd nucleotides from the 5 ' end, and(c) one selected from:(cl) 2'-F modifications at the 2nd, 6th, 14th, and 16th nucleotides from the 5' end; and 2'-OMe modifications in the remaining nucleotides in the antisense strand,(c2) 2'-F modifications at the 2nd, 6th, 14th, and 16th nucleotides from the 5' end; TNA at the 3rd nucleotide from the 5' end; and 2'-OMe modifications in the remaining nucleotides in the antisense strand, (c3) 2'-F modifications at the 2nd, 6th, 14th, and 16th nucleotides from the 5’ end; TNA, GNA or 2'-deoxy modification at the 5th nucleotide from the 5' end; and 2'-OMe modifications in the remaining nucleotides in the antisense strand,(c4) 2'-F modifications at the 2nd, 14th, and 16th nucleotides from the 5' end; TNA, GNA or 2'-deoxy modification at the 6th nucleotide from the 5' end; and 2'-OMe modifications in the remaining nucleotides in the antisense strand, and(c5) 2'-F modifications at the 2nd, 6th, 14th, and 16th nucleotides from the 5' end; TNA, GNA or 2'-deoxy modification at the 7th nucleotide from the 5' end; and 2'-OMe modifications in the remaining nucleotides in the antisense strand.[000373] Exemplary dsRNAs (siRNA) with modified nucleotides, including sense strands and antisense strands targeting the above indicated AGT mRNA, are shown in Table 4.PAT060035-PCT-SEC01Table 4: Examples of modified nucleotide sequence of AGT siRNAsiRNA Pos. Sense Strand SEQ Antisense Strand SEQ ID ID NO NON1 1379 C004p001 A004p001 G004pA004pG004pU004p 229 A004p001A002p001A004pG004pC002pU004pG002pU 282C004pU004pA007pC007pC007pC004pA004pA 004pU004pG004pG004pG002pU004pA007pG004pA0 004pC004pA004pG004pC004pU004pU004pU0 04pC004pU004pC004pU004pG004p001 U004p001 GOO 04 4N2 1889 A004p001A004p001A004pU004pU004pG004p 230 A004p001U002p001LT004pA004pA002pU004pTJ002p 283G004pG004pU007pTJ007pU007pU004pA004pA U004pTJ004pA004pA004pA002pA004pC007pC004pC 004pA004pA004pU004pU004pA004p A004p U 0 004pA 004pA004pU004pU004pU 004p001 U004p001 U 0 04 04N3 1378 A004p001 C004p001 A004pG004p A004pG004p 231 A004p001 A002p001 G004pC004pU002pG004pU002pU 284LT004pC004plT007pA007pC007pC004pC004pA 004pG004pG004pG004plT002pA004pG007pA004pC00 004pA004pC004pA004pG004pC004pU004pU0 4pU004pC004pU004pG004pU004p001 G004p001 G004 04N4 1337 A004p001C004p001A004pG004pC004pA004p 232 A004p001A002p001A004pG004pC002pU004pC002pA 285U004pU004pU007pU007pU007pU004pU004pU 004pA004pA004pA004pA002pA004pA007pA004pU0 004pG004pA004pG004pC004pU004pU004pU0 04pG004pC004pU004pG004pU004p00! U004p001 COO 04 4N5 1338 C004p001 A004p001 G004pC004pA004pU004p 233 A004p001C002p001A004pA004pG002pC004pU002pC 286U004pU004pU007pU007pU007pU004pU004pG 004pA004pA004pA004pA002pA004pA007pA004pA0 004pA004pG004pC004pU004pTJ004pG004pU0 04pU004pG004pC004pU004pG004p001U004p001U00 04 4N6 190 G004p00 HJ004p001 C004pA004pU004pC004p 234 U004p001 G007p00 lTJ004pA004pC004pUl 016pC004p 287C007pA004pC007pA007pA007pU004pG004pA LT004pC004pA004pU004pU004pG004pTJ007pG004pG 004pG004pA004pG004pU004pA004pC004pA0 007p A004pU004pG004pA004pC004p001 G004p001 A0 04 04N7 244 C004p001 C004p001 C004pA004p A004p A004p 235 A004p001 A002p001 U004pG004pA002pA004pG002p 288G004pA004pC007pC007pC007pC004pA004pC G004plT004pG004pG004pG002pG004pU007pC004pU 004pC004plJ004pU004pC004pA004pU004pU0 004pU004pU004pG004pG004pG004p001C004p001U0 04 04N8 1589 G004p001 A004p001 U004pA 004p A004pC004p 236 A004p001A002p001U004pU004pU002pG004plJ002pC 289A004pA004pC007pC007pC007pC004pG004pG 004pC004pG004pG004pG002pG004pU007pU004pG004pU004pU004pA004pU004pC004p00 lU004p001 G004PAT060035-PCT-SEC01siRNA Pos. Sense Strand SEQ Antisense Strand SEQ ID ID NO NO004pA004pC004pA004pA004pA004pU004pU004N9 1062 G004p001 C004p001 C004pC004pU004pU004pC 237 A004p001 A002p001 G004pG004pC002pG004pC002pU 290004pA004pC007pU007pG007pA004pG004pA0 004pC004pU004pC004pA002pG004pU007pG004pA00 04pG004pC004pG004pC004pC004pU004pU00 4pA004pG004pG004pG004pC004p001A004p001C004 4N10 1255 G004p001 C004p00! U004pG004p A004pG004p 238 A004p001 A002p00 I G004pA004pA002pU004pG002p 291C004pU004pG007pC007pC007pC004pG004pC G004pC004pG004pG004pG002pC004pA007pG004pC 004pC004pA004pU004pU004pC004pU004pIJ0 004pIJ 004pC004pA004pG004pC004p001 C004p001U0 04 04Nil 1267 G004p001 C004p001 C004pA004pU004pLI004p 239 A004p001A002p001G004pC004pIJ002pC004pG002pG 292C004pU004pG007pC007pA007pC004pA004pC 004pU004pG004pU004pG002pC004pA007pG004pA00 004pC004pG004pA004pG004pC004pU004pU0 4pA004pU004pG004pG004pC004p001 G004p001 G004 04N12 1350 U004p001G004p001A004pG004pC004pU004p 240 A004p001U002p001C004pU004pC002pA004pU002pC 293U004pG004pA007pA007pG007pC004pG004pG 004pC004pG004pC004plJ002pU004pC007pA004pA00 004pA004pU004pG004pA004pG004pA004pU0 4pGOO4pCOO4pUOO4pCOO4pAOO4pOO 1 A004p001 A004 04N13 1373 A004p001 G004p001 C004pC004pC004p A004pC 241 A004p001U002p001U004pG004pG002pG004plJ002p 294004pA004pG007pA007pG007pU004pC004pU0 A004pG004pA004pC004pU002pC004pU007pG094pU 04pA004pC004pC004pC004pA004pA004pU00 004pG004pG004pG004pC004pU004p001C004p001U0 4 04NI4 1378 A004p001C004p001A004pG004pA004pG004p 231 A004p001 A002p001 G004pC004pU002pG004pU002pU 284U004pC004pU007pA007pC007pC004pC004pA 004pG004pG004pG004pU002pA004pG007pA004pC00 004pA004pC004pA004pG004pC004pLI004pU0 4pIJ004pC004pIJ004pG004pLT004p001G004p001G004 04N15 1379 C004p001 A004p001 G004pA004pG004pU004p 229 A004p001A002p001A004pG004pC002pU004pG002pU 282C004pU004pA007pC007pC007pC004pA004pA 004pU004pG004pG004pG002pU004pA007pG004pA0 004pC004pA004pG004pC004pU004pU004plT0 04pC004pU004pC004pU004pG004p001 U 004p001 GOO 04 4N16 1595 A004p001A004p001C004pC004pC004pC004pG 242 A004p001IJ002p001C004pG004pC002pU004pG002pA 295004pG004pA007pC007pA007pA004pA004pU0 004pU004pU004pU004pG002pU004pC007pC004pG004pGOO4pGOO4pGOO4pUOO4pUOO4pOO 1 G004p001U004PAT060035-PCT-SEC01siRNA Pos. Sense Strand SEQ Antisense Strand SEQ ID ID NO NO04pC004pA004pG004pC004pG004pA004pU004N17 1596 A004p001 C004p001 C004pC004pC004pG004pG 243 A004p001A002p001U004pC004pG002pC004pU002pG 296004pA004pC007pA007pA007pA004pU004pC0 004pA004pU004pU004plJ002pG004pU007pC004pC00 04pA004pG004pC004pG004pA004pU004pU00 4pG004pG004pG004pG004pU004p001U004p001G004 4N18 1889 A004p001A004p001 A004pU004pU004pG004p 230 A004p001U002p001U004pA004pA002pU004pU002p 283G004pG004pU007pU007pU007pU004pA004pA U004pU004pA004pA004pA002pA004pC007pC004pC 004pA004pA004pU004pU004pA004pA004pU0 004pA004pA004pLI004pU004pU004p001U004p001U0 04 04N19 1889 A004p001A004p001A004pU004pU004pG004p 244 U004p001 Li007p001U004pA004pA004pLI007pU004p 297G007pG004pU007pU007pU007pU004pA004pA L;004pU004pA004pA004pA004pA004pC007pC004pC 004pA004pA004pU004pU004pA004pA004pA0 007pA004pA004pU004plI004pU004p001U004p001U0 04 04N20 1892 11004 pOO 1 U 004p001 G004pG004pG004pU 004p 245 U004p001A007p001C004pU004pU004pU007pA004pA 298U007pU004pU007pA007pA007pA004pA004pU 004plJ004pU004pU004pU004pA004pA007pA004pA0 004pU004pA004pA004pA004pG004pU004pA0 07pC004pC004pC004p A004p A004p001 U004p001 U00 04 4N21 1853 A004p001 A004p001 A004pC004pA004pA 004p 246 A004p001A002p001 A004pG004pG002pG004pA 1016p 299A004pA004pA007pA007pG007pU004pG004pU A004pC004pA004pC004pU002pU004pU007pU004pU 004pU004pC004pC004pC004pU004pU004pU0 004pU004pG004pU004pU004pU004p001 C004p001 AO 04 04N22 1338 C004p001 A004p001 G004pC004pA004pU004p 233 A004p001 C002p001 A004pA004pG002pC004pU002pC 286U004pU004pU007pU007pU007pU004pU004pG 004pA004pA004pA004pA002pA004pA007pA004pA0 004pA004pG004pC004pLI004pU004pG004pU0 04pU004pG004pC004pU004pG004p001U004p001U00 04 4N23 1338 C042p001 A042p001 G004pC004pA004pU004p 247 A004p001 C002p001 A004pA004pG002pC004pU002pC 286U004pU004pU007pU007pU007pU004pU004pG 004pA004pA004pA004pA002pA004pA007pA004pA0 004pA004pG004pC004pU004plI004pG042pU0 04pU004pG004pC004pU004pG004p001 U004p001 U 00 42 4N24 1338 X2171 pC042p001 A042p001 G004pC004pA004p 248 A004p001 C002p001 A004pA004pG002pC004plI002pC 286U004pU004pU004pU007pU007pU007pU004pU 004pA004pA004pA004pA002pA004pA007pA004pA0PAT060035-PCT-SEC01siRNA Pos. Sense Strand SEQ Antisense Strand SEQ ID ID NO NO004pG004pA004pG004pC004plJ004pU004pG0 04pU004pG004pC004pU004pG004p001U004p001U00 42pU042 4N25 1338 C042p001 A042p001 G004pC004pA004pU004p 249 A004p001 C002p001 A004pA004pG002pC004plJ002pC 286U004pU004pU007pU007pU007pU004pU004pG 004pA004pA004pA004pA002pA004pA007pA004pA0 004pA004pG004pC004pU004pU004pG004pU0 04pU004pG004pC004pU004pG004p001U004p001U00 04 4N26 1338 X2171 pC042p001 A042p001 G004pC004pA004p 250 A004p001C002p001A004pA004pG002pC004pU002pC 286TJ004pU004pU004pU007pU007pU007pU004pU 004pA004pA004pA004pA002pA004pA007pA004pA0 004pG004pA004pG004pC004pTJ004pU004pG0 04pU004pG004pC004pU004pG004p001U004p001U00 04pU004 4N27 1338 X217 lpC004p001 A004p001 G004pC004pA004p 251 A004p001C002p001A004pA004pG002pC004pTJ002pC 286TJ004pU004pU004pU007pU007pU007pU004pU 004pA004pA004pA004pA002pA004pA007pA004pA0 004pG004pA004pG004pC004pU004pU004pG0 04pU004pG004pC004plT004pG004p001 U 004p001 U00 04pU004 4N28 1338 C005p001 AOOSpOO 1 G004pC004pA004pU004p 252 A004p001 C002p001 A004pA004pG002pC004pU002pC 286U004pU004pU007plJ007pU007pU004pU004pG 004pA004pA004pA004pA002pA004pA007pA004pA0 004pA004pG004pC004pU004pU004pG005pU0 04pU004pG004pC004plJ004pG004p001U004p001U00 05 4N29 1338 X2171pC005p001A005p001G004pC004pA004p 253 A004p001C002p001A004pA004pG002pC004pU002pC 286U004pU004pU004pU007pU007pU007pU004pU 004pA004pA004pA004pA002pA004pA007pA004pA0 004pG004pA004pG004pC004pU004pU004pG0 04pU004pG004pC004pU004pG004p001U004p001U00 05pU005 4N30 1338 C005p001A005p001G004pC004pA004pU004p 254 A004p001 C002p001 A004pA004pG002pC004pU002pC 286U004pU004pU007pU007pU007pU004pU004pG 004pA004pA004pA004pA002pA004pA007pA004pA0 004pA004pG004pC004pLI004pU004pG004pU0 04pU004pG004pC004pU004pG004p001U004p001U00 04 4N31 1338 COOSpOO 1 A005p001 G004pC004pA004pU004p 255 A004p001 C007p001 A004pA004pG004pC007pU004pC 300U007pU004pU007pU007pU007pU004pU004pG 004pA004pA004pA004pA004pA004pA007pA004pA0 004pA004pG004pC004pU004plT004pG004pU0 07pU004pG004pC004pU004pG004p001 U004p001 U 00 04 4N32 1338 C004p001 A004p001 G004pC004pA004pU004p 256 A004p001 C007p001 A004pA004pG004pC007plI004pC 300U007pU004pU007pU007pU007pU004pU004pG 004pA004pA004pA004pA004pA004pA007pA004pA0PAT060035-PCT-SEC01siRNA Pos. Sense Strand SEQ Antisense Strand SEQ ID ID NO NO004pA004pG004pC004pU004pU004pG004pU0 07pU004pG004pC004pU004pG004p001U004p001U00 04 4N33 1338 C042p001 A042p001 G004pC004pA004pU004p 257 A004p001 C007p001 A004pA004pG004pC007plJ004pC 300U007pU004pU007pU007pU007pU004pU004pG 004pA004pA004pA004pA004pA004pA007pA004pA0 004pA004pG004pC004pU004pU004pG042pU0 07pU004pG004pC004pU004pG004p001U004p001U00 42 4N34 1338 X2171 pC042p001 A042p001 G004pC004pA004p 258 A004p001C007p001A004pA004pG004pC007pU004pC 300TJ004pU007pU004pU007pU007pU007pU004pU 004pA004pA004pA004pA004pA004pA007pA004pA0 004pG004pA004pG004pC004pTJ004pU004pG0 07pU004pG004pC004pU004pG004p001U004p001U00 42pU042 4N35 1338 C042p001 A042p001 G004pC004pA004pU004p 259 A004p001C007p001A004pA004pG004pC007pTJ004pC 300TJ007pU004pU007pU007pU007pU004pU004pG 004pA004pA004pA004pA004pA004pA007pA004pA0 004pA004pG004pC004pU004pU004pG004pU0 07pU004pG004pC004plT004pG004p001 U 004p001 U00 04 4N36 1338 X217 lpC042p001 A042p001 G004pC004pA004p 260 A004p001C007p001A004pA004pG004pC007pU004pC 300U004pU007pU004plJ007pU007pU007pU004pU 004pA004pA004pA004pA004pA004pA007pA004pA0 004pG004pA004pG004pC004pU004pU004pG0 07pU004pG004pC004pU004pG004p001U004p001U00 04pU004 4N37 1338 X217 lpC004p001 A004p001 G004pC004p A004p 261 A004p001C007p001A004pA004pG004pC007pU004pC 300U004pU007pU004pU007pU007pU007pU004pU 004pA004pA004pA004pA004pA004pA007pA004pA0 004pG004pA004pG004pC004pU004pU004pG0 07pU004pG004pC004pU004pG004p001U004p001U00 04pU004 4N38 1338 C005p001A005p001G004pC004pA004pU004p 262 A004p001C007p001A004pA004pG004pC007pU004pC 300U007pU004pU007pU007pU007pU004pU004pG 004pA004pA004pA004pA004pA004pA007pA004pA0 004pA004pG004pC004pLI004pU004pG005pU0 07pU004pG004pC004pU004pG004p001U004p001U00 05 4N39 1338 X217 lpC005p001 A005p001 G004pC004pA004p 263 A004p001 C007p001 A004pA004pG004pC007pU004pC 300U004pU007pU004pU007pU007pU007pU004pU 004pA004pA004pA004pA004pA004pA007pA004pA0 004pG004pA004pG004pC004plT004pU004pG0 07pU004pG004pC004pU004pG004p001 U004p001 U 00 05pU005 4N40 1338 X2171 pC005p001 AOOSpOO 1 G004pC004pA004p 264 A004p001 C002p001 A004pA004pG002pC004plT002pC 286U004pU004pU004pU007pU007pU007pU004pU 004pA004pA004pA004pA002pA004pA007pA004pA0PAT060035-PCT-SEC01siRNA Pos. Sense Strand SEQ Antisense Strand SEQ ID ID NO NO004pG004pA004pG004pC004plJ004pU004pG0 04pU004pG004pC004pU004pG004p001U004p001U00 04pU004 4N41 1596 A004p001 C004p001 C004pC004pC004pG004pG 243 A004p001A002p001U004pC004pG002pC004pU002pG 296004pA004pC007pA007pA007pA004pU004pC0 004pA004pU004pU004plJ002pG004pU007pC004pC00 04pA004pG004pC004pG004pA004pU004pU00 4pG004pG004pG004pG004pU004p001 U004p001 G004 4N42 1596 A042p001C042p001C004pC004pC004pG004pG 265 X033A1027p001A002p001U004pC004pG002pC004pU 301004pA004pC007pA007pA007pA004pU004pC0 002pG004pA004pU004pU004pU002pG004pU007pC00 04pA004pG004pC004pG004pA004pLI042pU04 4pC004pG004pG004pG004pG004pU004p001U004p00 2 1G004N43 1596 A004p001C004p001C004pC004pC004pG004pG 266 U004p001A007p001U004pC004pG004pC007pTJ004pG 302007pA004pC007pA007pA007pA004pU004pC0 004pA004pU004pU004pTJ004pG004pLT007pC004pC00 04pA004pG004pC004pG004pA004pU004pA00 7pG004pG004pG004pG004pU 004p001 U004p001 G004 4N44 1596 A042p001C042p001C004pC004pC004pG004pG 267 X033U1027p001A007p001 U004pC004pG004pC007pU 303007pA004pC007pA007pA007pA004pU004pC0 004pG004pA004pU004pU004pU004pG004plJ007pC00 04pA004pG004pC004pG004pA004p001U042p0 4pC007pG004pG004pG004pG004pU004p001U004p00 01A042 1G004N45 1338 C042p001A042p001G004pC004pA004pU004p 257 A004p001C007p001A004pA004pG004pC007pU004pC 300U007pU004pU007pU007pU007pU004pU004pG 004pA004pA004pA004pA004pA004pA007pA004pA0 004pA004pG004pC004pU004pU004pG042pU0 07pU004pG004pC004pU004pG004p001U004p001U00 42 4N46 1338 C042p001 A042p001 G004pC004pA004pU004p 268 A004p001C007p001A004pA004pG004pC007pU004pC 300U007pU004pU007pU007pU007pU004pU004pG 004pA004pA004pA004pA004pA004pA007pA004pA0 004pA004pG004pC004pLI004pU004p001 G042p 07pU004pG004pC004pU004pG004p001U004p001U00 001U042 4N47 1338 X217 lpC042p001 A042p001 G004pC004pA004p 269 A004p001 C007p001 A004pA004pG004pC007pU004pC 300U004pU007pU004pU007pU007pU007pU004pU 004pA004pA004pA004pA004pA004pA007pA004pA0 004pG004pA004pG004pC004plT004pU004p001 07pU004pG004pC004pU004pG004p001 U004p001 U 00 G042p001U042 4N48 1338 C042p001 A042p001 G004pC004pA004pU004p 268 X033A1027p001C007p001A004pA004pG004pC007pU 304U007pU004pU007pU007pU007pU004pU004pG 004pC004pA004pA004pA004pA004pA004pA007pA00PAT060035-PCT-SEC01siRNA Pos. Sense Strand SEQ Antisense Strand SEQ ID ID NO NO004pA004pG004pC004pU004pU004p001G042p 4pA007pU004pG004pC004pU004pG004p001U004p00 001U042 1U004N49 1338 X2171pC042p001A042p001G004pC004pA004p 269 X033A1027p001C007p001A004pA004pG004pC007pU 304U004pU007pU004pU007pU007pU007pU004pU 004pC004pA004pA004pA004pA004pA004pA007pA00 004pG004pA004pG004pC004pU004pU004p001 4pA007pU004pG004pC004pU004pG004p001U004p00 G042p001U042 1U004N50 190 G004p001 U004p001 C004pA004pU004pC004p 234 U004p001 G007p001U004pA004pC004pU1016pC004p 287C007pA004pC007pA007pA007pU004pG004pA U004pC004pA004pU004pU004pG004pU007pG004pG 004pG004pA004pG004pU004pA004pC004pA0 007pA004pU004pG004pA004pC004p001G004p001A0 04 04N51 1338 C005p001A005p001G004pC004pA004pU004p 262 A004p001C007p001A004pA004pG004pC007pU004pC 300U007pU004pU007pU007pU007pU004pU004pG 004pA004pA004pA004pA004pA004pA007pA004pA0 004pA004pG004pC004pU004pU004pG005pU0 07pU004pG004pC004plT004pG004p001 U 004p001 U00 05 4N52 1338 C005p001 A005p001 G004pC004pA004pU004p 270 A004p001C007p001A004pA004pG004pC007pU004pC 300U007pU004pU007plJ007pU007pU004pU004pG 004pA004pA004pA004pA004pA004pA007pA004pA0 004pA004pG004pC004pU004pU004p001 G005p 07pU004pG004pC004pU004pG004p001U004p001U00 001U005 4N53 1338 X2171pC005p001A005p001G004pC004pA004p 271 A004p001C007p001A004pA004pG004pC007pU004pC 300U004pU007pU004pU007pU007pU007pU004pU 004pA004pA004pA004pA004pA004pA007pA004pA0 004pG004pA004pG004pC004pU004pU004p001 07pU004pG004pC004pU004pG004p001U004p001U00 G005p001U005 4N54 1338 C005p001A005p001G004pC004pA004p0004p 270 X033A1027p001C007p001A004pA004pG004pC007pU 304U007pU004pU007pU007pU007pU004pU004pG 004pC004pA004pA004pA004pA004pA004pA007pA00 004pA004pG004pC004pLT004pU004p001G005p 4pA007pU004pG004pC004pU004pG004p00IU004p00 001U005 1U004N55 1338 X217 lpC005p001 A005p001 G004pC004pA004p 271 X033A1027p001C007p001A004pA004pG004pC007pU 304 lT004pU007pU004pU007pU007pU007pU004pU 004pC004pA004pA004pA004pA004pA004pA007pA00 004pG004pA004pG004pC004plT004pU004p001 4pA007pU004pG004pC004pU004pG004p001U004p00 G005p001U005 1U004N56 1596 A004p001 C004p001 C004pC004pC004pG004pG 272 A004p001 A002p001U004pC004pG002pC004plI002pG 296004pA004pC007pA007pA007pA004pU004pC0 004pA004pU004pU004pU002pG004pU007pC004pC004pG004pG004pG004pG004pU004p001 U004p001 G004PAT060035-PCT-SEC01siRNA Pos. Sense Strand SEQ Antisense Strand SEQ ID ID NO NO04pA004pG004pC004pG004pA004p001U004p001U004N57 1596 A004p001 C004p001 C004pC004pC004pG004pG 273 U004p001 A007p00 lU004pC004pG004pC007plJ004pG 302007pA004pC007pA007pA007pA004pU004pC0 004pA004pU004pU004plJ004pG004pU007pC004pC00 04pA004pG004pC004pG004pA004p001U004p0 7pG004pG004pG004pG004pU004p001 U004p001 G004 01A004N58 1596 A005p001C005p001C004pC004pC004pG004pG 274 U004p001A007p001U004pC004pG004pC007pU004pG 302007pA004pC007pA007pA007pA004pU004pC0 004pA004pU004pU004pTJ004pG004pLT007pC004pC00 04pA004pG004pC004pG004pA004pLI005pA00 7pG004pG004pG004pG004pU004p001U004p001G004 5N59 1596 A005p001C005p001C004pC004pC004pG004pG 275 A004p001A002p001U004pC004pG002pC004pTJ002pG 296004pA004pC007pA007pA007pA004pU004pC0 004pA004pU004pU004pU002pG004pU007pC004pC00 04pA004pG004pC004pG004pA004pU005pU00 4pG004pG004pG004pG004pU004p001U004p001G004 5N60 1596 A042p001C042p001C004pC004pC004pG004pG 267 U004p001A007p001U004pC004pG004pC007pU004pG 302007pA004pC007pA007pA007pA004pU004pC0 004pA004pU004pU004pU004pG004pU007pC004pC00 04pA004pG004pC004pG004pA004p001U042p0 7pG004pG004pG004pG004pU004p001U004p001G004 01A042N61 1596 A042p001 C042p001 C004pC004pC004pG004pG 276 A004p001 A002p001 U004pC004pG002pC004pU002pG 296004pA004pC007pA007pA007pA004pU004pC0 004pA004pU004pU004pU002pG004pU007pC004pC00 04pA004pG004pC004pG004pA004p001U042p0 4pG004pG004pG004pG004pU004p001U004p001G004 01TJ042N62 1596 A004p001 C004p001 C004pC004pC004pG004pG 243 X033A1027p001A002p001U004pC004pG002pC004pU 301004pA004pC007pA007pA007pA004pU004pC0 002pG004pA004pU004pU004pU002pG004pU007pC00 04pA004pG004pC004pG004pA004pU004pTJ00 4pC004pG004pG004pG004pG004pU004p00ITJ004p00 4 1G004N63 1596 A042p001 C042p001 C004pC004pC004pG004pG 277 X033U1027p001A007p001U004pC004pG004pC007pU 303007pA004pC007pA007pA007pA004pU004pC0 004pG004pA004pU004plT004pU004pG004pU007pC00 04pA004pG004pC004pG004pA004pU042pA04 4pC007pG004pG004pG004pG004plT004p001U004p00 2 1G004N64 1596 A042p001 C042p001 C004pC004pC004pG004pG 276 X033 A 1027p001 A002p001 U004pC004pG002pC004pU 301004pA004pC007pA007pA007pA004pU004pC0 002pG004pA004pU004pU004pU002pG004pU007pC00PAT060035-PCT-SEC01siRNA Pos. Sense Strand SEQ Antisense Strand SEQ ID ID NO NO04pA004pG004pC004pG004pA004p001U042p0 4pC004pG004pG004pG004pG004pU004p001U004p00 1U042 1G004N65 1596 A004p001 C004p001 C004pC004pC004pG004pG 278 A004p001A002p001U004pC004pG002pC004pU002pG 296004pA004pC007pU007pA007pA004pU004pC0 004pA004pU004pU004pU002pG004pU007pC004pC00 04pA004pG004pC004pG004pA004pU004pU00 4pG004pG004pG004pG004pU004p001U004p001G004 4N66 1338 X2171pC005p001A005p001G004pC004pA004p 279 A004p001C007p001A004pA004pG004pC007pU004pC 300U004pU007pU004pU007pU007pU007pU004pU 004pA004pA004pA004pA004pA004pA007pA004pA0 004pG004pA004pG004pC004pU004pU004pG0 07pU004pG004pC004pU004pG004p001U004p001U00 04pU004 4N67 1085 U004p001 G004p001 C004pU004pG004pC004p 280 A004p001G002p001U004pG004pA002pG004pG002pC 305U004pG004pA007pU007pC007pC004pA004pG 004pU004pG004pG004pA002pU004pC007pA004pG00 004pC004pC004pU004pC004pA004pC004pU00 4pC004pA004pG004pC004pA004p001G004p001G004 4N193 1596 A004p001C004p001C004pC004pC004pG004pG 272 X033A1027p001A002p001 U004pC004pG002pC004pU 301004pA004pC007pA007pA007pA004pU004pC0 002pG004pA004pU004pU004pU002pG004plJ007pC00 04pA004pG004pC004pG004pA004p001U004p0 4pC004pG004pG004pG004pG004pU004p001U004p00 01U004 1G004N194 1596 A042p001 C042p001 C004pC004pC004pG004pG 265 A004p001 A002p001 U004pC004pG002pC004pU002pG 296004pA004pC007pA007pA007pA004pU004pC0 004pA004pU004pU004pU002pG004pU007pC004pC00 04pA004pG004pC004pG004pA004pU042pU04 4pG004pG004pG004pG004pU004p001U004p001G004 2N195 1596 A004p001 C004p001 C004pC004pC004pG004pG 266 X033U1027p001A007p001U004pC004pG004pC007pU 303007pA004pC007pA007pA007pA004pU004pC0 004pG004pA004pU004pU004pU004pG004pU007pC00 04pA004pG004pC004pG004pA004pU004pA00 4pC007pG004pG004pG004pG004pU004p00ITJ004p00 4 1G004N196 1596 A004p001 C004p001 C004pC004pC004pG004pG 273 X033U1027p001A007p001U004pC004pG004pC007pU 303007pA004pC007pA007pA007pA004pU004pC0 004pG004pA004pU004pU004pU004pG004pU007pC00 04pA004pG004pC004pG004pA004p001U004p0 4pC007pG004pG004pG004pG004pU004p001U004p00 1A004 1G004N197 1596 A042p001 C042p001 C004pC004pC004pG004pG 277 U004p001A007p001U004pC004pG004pC007pLI004pG 302007pA004pC007pA007pA007pA004pU004pC0 004pA004pU004pU004plJ004pG004pU007pC004pC007pG004pG004pG004pG004pU004p001 U004p001 G004PAT060035-PCT-SEC01siRNA Pos. Sense Strand SEQ Antisense Strand SEQ ID ID NO NO04pA004pG004pC004pG004pA004pU042pA042N198 1596 A004p001 C004p001 C004pC004pC004pG004pG 281 U004p001 A007p00 lU004pC004pG004pC007plJ004pG 302007pA004pC007pU007pA007pA004pU004pC0 004pA004pU004pU004pU004pG004pU007pC004pC00 04pA004pG004pC004pG004pA004pU004pA00 7pG004pG004pG004pG004pU004p001U004p001G0044PAT060035-PCT-SEC01[000374] Table A below shows codes in the nucleotide sequences in Table 5 and the following Tables in the disclosure.p: phosphodiester linkagepOOl: phosphorothioate (PS) linkageSS: sense strand AS: antisense strandX2I71: inverted abasic 2 ’-deoxyriboseA002: 2'-deoxy adenosine (dA) G002: 2'-deoxy guanosine (dG)A004: adenosine / 2'-OMe G004: guanosine / 2'-0MeA005: adenosine / 2'-M0E G005: guanosine / 2'-M0EA007: adenosine / 2'-F G007: guanosine / 2'-FA042: adenosine TNA G042: guanosine TNAA1016: adenosine GNA G1016: guanosine GNAX033A1027: Adenosine / 5'-(E)-VP-2'-OMe X033G1027: guanosine / 5'-(E)-VP-2'-OMe C002: 2'-deoxy cytidine (dC) T002: 2'-deoxy thymidine (dT)C004: cytidine / 2'-0Me U002: 2.'-deoxy-5-methyluridineC005: 5-methyl-cytidine / 2'-MOE U004: uridine / 2'-OMeC007: cytidine / 2'-F U005: ribothymidine (5-methyluridine) / 2'-MOE C042: cytidine TNA U007: uridine / 2'-FC1016: cytosine GNA U042: uridine TNAX033C1027: cytidine / 5'-(E)-VP-2'-OMe U1016: uridine GNAX033U1027: uridine / 5'-(E)-VP-2'-OMe [000375] The sequences and sequence lists including modified nucleosides (e.g., RNA, RNA modified at a 2'-OH sugar moiety, or RNA modified at a nucleobase) in the disclosure (e.g,, Tables 5-9) are indicated with codes defined in Table A unless otherwise indicated. Each code consists of a letter representing a type of the nucleobase, e.g., “A”, “G”, “C”,“U,” or “T” and a numeric code representing a type of modification on a sugar ring.[000376] For example, if a nucleoside is coded as “U005”, it is meant by a RNA nucleoside including a 2'-M0E ribose sugar moiety and a thymine (or methylated uracil) as “U” indicates a methylated uracil nucleobase and “005” indicates a 2'-M0E substituent at 2'-OH position on the ribose sugar ring.[000377] In particular example, if a nucleoside is coded as “C005”, it is meant by a RNA nucleoside including a 5-methylated cytosine and a 2'-M0E sugar moiety as “C” indicates a type of specific nucleobase that can exist in combination with a 2’-M0E sugar moiety and “005” indicates a 2'-M0E substituent at 2'-OH position on the ribose sugar ring.[000378] In another example, if a nucleoside is coded as “A042”, it is meant by a RNA nucleoside including an adenine and a threofuranosyl sugar ring as “A” indicates a type of adenine and “042” indicates a threofuranosyl ring replacing the ribose sugar ring.PAT060035-PCT-SEC01[000379] In some embodiments, the dsRNA includes a sense strand having 10 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 10 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of Table 4. In some embodiments, the dsRNA includes a sense strand having 11 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 11 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRN A includes a sense strand having 12 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 12 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 13 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 13 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 14 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 14 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected Table 4. In some embodiments, the dsRNA includes a sense strand having 16 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 16 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 17 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRN A includes an antisense strand having 17 contiguous nucleotides differingPAT060035-PCT-SEC01by no more than 3 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 18 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 18 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 19 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 19 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 20 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 20 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 21 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 21 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence selected from Table 4.[000380] In some embodiments, the dsRNA includes a sense strand having 10 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from Table 4, In some embodiments, the dsRNA includes an antisense strand having 10 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 11 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from Table 4, In some embodiments, the dsRNA includes an antisense strand having 11 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 12 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 12 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 13 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected fromPAT060035-PCT-SEC01Table 4, In some embodiments, the dsRNA includes an antisense strand having 13 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 14 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 14 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 15 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 15 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 16 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 16 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 17 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 17 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 18 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 18 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 19 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 19 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 20 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 20 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 21 contiguousPAT060035-PCT-SEC01nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 21 contiguous nucleotides differing by no more than 2 nucleotides from the nucleotide sequence selected from Table 4.[000381] In some embodiments, the dsRNA includes a sense strand having 10 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 10 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 11 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 11 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 12 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 12 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 13 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 13 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 14 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 14 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 15 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 15 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 16 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 16 contiguousPAT060035-PCT-SEC01nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 17 contiguous nucleotides differing by no more than I nucleotide from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 17 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 18 contiguous nucleotides differing by no more than I nucleotide from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 18 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 19 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes an antisense strand having 19 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 20 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from Table 4, In some embodiments, the dsRNA includes an antisense strand having 20 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes a sense strand having 21 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from Table 4, In some embodiments, the dsRNA includes an antisense strand having 21 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from Table 4, In some embodiments, the dsRNA includes an antisense strand having 22 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from Table 4, In some embodiments, the dsRNA includes an antisense strand having 23 contiguous nucleotides differing by no more than 1 nucleotide from the nucleotide sequence selected from Table 4.[000382] In some embodiments, the dsRNA includes (i) a sense strand having 15 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from Table 4 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 15 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRN A includes (i) a sensePAT060035-PCT-SEC01strand having 16 contiguous nucleotides differing by no more than one, two or three from the nucleotide sequence selected from Table 4 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 16 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes (i) a sense strand having 17 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from Table 4 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 17 contiguous nucleotides differing by no more than one, tw'O or three nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes (i) a sense strand having 18 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from Table 4 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 18 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes (i) a sense strand having 19 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from Table 4 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 19 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from Table 4. In some embodiments, the dsRNA includes (i) a sense strand having 20 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from Table 4 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 20 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from Table 4, In some embodiments, the dsRNA includes (i) a sense strand having 21 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from Table 4 and (ii) an antisense strand forming a duplex with the sense strand of (i) and having 21 contiguous nucleotides differing by no more than one, two or three nucleotides from the nucleotide sequence selected from Table 4.[000383] In certain aspects, when a sense strand or an antisense strand of a dsRNA in above paragraphs is differing by a certain number of nucleotides (e.g., one, two or three nucleotides) from a specific sequence (e.g., SEQ ID NOs: 229-305), it is meant by that the sense strand or the antisense strand includes one, two or three nucleotides, having different nucleobases and / or different modifications compared to the nucleobases and / or the modifications of the nucleotides atPAT060035-PCT-SEC01the corresponding positions of the specific sequence (e.g., SEQ ID NOs: 229-305). In some embodiments, when a sense strand or an antisense strand is differing by a certain number of nucleotides (e.g., one, two or three nucleotides) from a specific sequence (e.g., SEQ ID NOs: 229- 305), the sense strand or the antisense strand includes one, two, or three nucleotides, having different nucleobases compared to the nucleobases of the nucleotides at the corresponding positions of the specific sequence (e.g., SEQ ID NOs: 229-305). In some embodiments, when a sense strand or an antisense strand is differing by a certain number of nucleotides (e.g., one, two or three nucleotides) from a specific sequence (e.g., SEQ ID NOs: 229-305), the sense strand or the antisense strand includes one, two, or three nucleotides, having different modifications compared to the modifications of the nucleotides at the corresponding positions of the specific sequence (e.g., SEQ ID NOs: 229-305). In some embodiments, when a sense strand or an antisense strand is differing by a certain number of nucleotides (e.g., one, two or three nucleotides) from a specific sequence (e.g., SEQ ID NOs: 229-305), the sense strand or the antisense strand includes one, two, or three nucleotides having different nucleobases and different modifications compared to the nucleobases and the modifications of the nucleotides at the corresponding positions of the specific sequence (e.g., SEQ ID NOs: 229-305).[0003S4] In certain aspects, when a sense strand or an antisense strand of a dsRNA in above paragraphs is differing by a certain number of nucleotides (e.g., one, two or three nucleotides) from a specific sequence (e.g,, SEQ ID NOs: 229-305), it is meant by that the sense strand or the antisense strand includes one, two or three nucleotides, having different nucleobases, different modifications, and / or different phosphate linkages (e.g., phosphorothioate (PS)), compared to the nucleobases, the modifications, and / or the phosphate linkages of the nucleotides at the corresponding positions of the specific sequence (e.g., SEQ ID NOs: 229-305). In some embodiments, when a sense strand or an antisense strand is differing by a certain number of nucleotides (e.g., one, two or three nucleotides) from a specific sequence (e.g., SEQ ID NOs: 229- 305), the sense strand or the antisense strand includes one, two, or three nucleotides, having different phosphate linkages compared to the phosphate linkages of the nucleotides at the corresponding positions of the specific sequence (e.g., SEQ ID NOs: 229-305). In some embodiments, when a sense strand or an antisense strand is differing by a certain number of nucleotides (e.g., one, two or three nucleotides) from a specific sequence (e.g., SEQ ID NOs: 229- 305), the sense strand or the antisense strand includes one, two, or three nucleotides, havingPAT060035-PCT-SEC01different nucleobases and different phosphate linkages compared to the nucleobases and the phosphate linkages of the nucleotides at the corresponding positions of the specific sequence (e.g., SEQ ID NOs: 229-305). In some embodiments, when a sense strand or an antisense strand is differing by a certain number of nucleotides (e.g., one, two or three nucleotides) from a specific sequence (e.g., SEQ ID NOs: 229-305), the sense strand or the antisense strand includes one, two, or three nucleotides, having different modifications and different phosphate linkages compared to the modifications and the phosphate linkages of the nucleotides at the corresponding positions of the specific sequence (e.g., SEQ ID NOs: 229-305). In some embodiments, when a sense strand or an antisense strand is differing by a certain number of nucleotides (e.g., one, two or three nucleotides) from a specific sequence (e.g., SEQ ID NOs: 229-305), the sense strand or the antisense strand includes one, two, or three nucleotides having different nucleobases, different modifications, and different phosphate linkages compared to the nucleobases, the modifications, and the phosphate linkages of the nucleotides at the corresponding positions of the specific sequence (e.g., SEQ ID NOs: 229-305).[000385] In some embodiments, the dsRNA includes a sense strand consisting of SEQ ID NO: 233, and an antisense strand consisting of SEQ ID NO: 286.[000386] In some embodiments, the dsRNA includes a sense strand consisting of SEQ ID NO: 243, and an antisense strand consisting of SEQ ID NO: 296.[000387] In some embodiments, the dsRNA includes a sense strand consisting of SEQ ID NO: 247, and an antisense strand consisting of SEQ ID NO: 286.[000388] In some embodiments, the dsRNA includes a sense strand consisting of SEQ ID NO: 256, and an antisense strand consisting of SEQ ID NO: 300.[000389] In some embodiments, the dsRNA includes a sense strand consisting of SEQ ID NO: 257, and an antisense strand consisting of SEQ ID NO: 300.[000390] In some embodiments, the dsRNA includes a sense strand consisting of SEQ ID NO: 258, and an antisense strand consisting of SEQ ID NO: 300.[000391] In some embodiments, the dsRNA includes a sense strand consisting of SEQ ID NO: 260, and an antisense strand consisting of SEQ ID NO: 300.[000392] In some embodiments, the dsRNA includes a sense strand consisting of SEQ ID NO: 261, and an antisense strand consisting of SEQ ID NO: 300.PAT060035-PCT-SEC01[000393] In some embodiments, the dsRNA includes a sense strand consisting of SEQ ID NO: 262, and an antisense strand consisting of SEQ ID NO: 300.[000394] In some embodiments, the dsRNA includes a sense strand consisting of SEQ ID NO: 263, and an antisense strand consisting of SEQ ID NO: 300.[000395] In some embodiments, the dsRNA includes a sense strand consisting of SEQ ID NO: 265, and an antisense strand consisting of SEQ ID NO: 301.[000396] In some embodiments, the dsRNA includes a sense strand consisting of SEQ ID NO: 267, and an antisense strand consisting of SEQ ID NO: 303.[000397] In some embodiments, the dsRNA includes a sense strand consisting of SEQ ID NO: 270, and an antisense strand consisting of SEQ ID NO: 304.[000398] In some embodiments, the dsRNA includes a sense strand consisting of SEQ ID NO: 271, and an antisense strand consisting of SEQ ID NO: 304.[000399] In some embodiments, the dsRNA includes a sense strand consisting of SEQ ID NO: 272, and an antisense strand consisting of SEQ ID NO: 296.[000400] In some embodiments, the dsRNA includes a sense strand consisting of SEQ ID NO: 275, and an antisense strand consisting of SEQ ID NO: 296.[000401] In some embodiments, the dsRNA includes a sense strand consisting of SEQ ID NO: 277, and an antisense strand consisting of SEQ ID NO: 303.[000402] In some embodiments, the dsRNA includes a sense strand consisting of SEQ ID NO: 276, and an antisense strand consisting of SEQ ID NO: 301.[000403] In some embodiments, the dsRNA includes a sense strand consisting of SEQ ID NO: 279, and an antisense strand consisting of SEQ ID NO: 300.[000404] In some embodiments, the dsRNA includes a sense strand consisting of SEQ ID NO: 266, and an antisense strand consisting of SEQ ID NO: 303.Ligands[000405] In an aspect, a ligand including the various chemical and biological moieties, such as a small molecule compound, a peptide, an antibody, a carbohydrate, or an additional nucleic acid with or without a linker, can be coupled or conjugated to a dsRNA as described herein. In certain aspects, the ligand may directly (e.g., covalently) conjugated to at. least one strand of the dsRNA.[000406] In certain aspects, the ligand may be conjugated via a linker thereof (e.g., covalent linker) to a sense strand. In some embodiments, the ligand may be conjugated via a linker (e.g.,PAT060035-PCT-SEC01covalent linker, or phosphate or phosphorothioate group) to one or more nucleotides in the sense strand. In some embodiments, the ligand may be conj ugated via a linker (e.g., covalent linker, or phosphate or phosphorothioate group) to 5' end of the sense strand. In some embodiments, the ligand may be conjugated via a linker (e.g., covalent linker, or phosphate or phosphorothioate group) to 3' end of the sense strand.[000407] In certain aspects, the ligand may be conjugated via a linker (e.g., covalent linker) to an antisense strand. In some embodiments, the ligand may be conjugated via a linker (e.g., covalent linker, or phosphate or phosphorothioate group) to one or more nucleotides of an antisense strand. In some embodiments, the ligand may be conjugated via a linker (e.g., covalent linker, or phosphate or phosphorothioate group) to 5’ end of an antisense strand. In some embodiments, the ligand may be conjugated via a linker (e.g., covalent linker, or phosphate or phosphorothioate group) to 3' end of an antisense strand.[000408] In certain aspects, the linker may be a cleavable chemical moiety which is suffici...

Claims

PAT060035-PCT-SEC01CLAIMS WHAT IS CLAIMED:

1. A double stranded RNAi (dsRNAi) agent comprising:a. a sense strand comprising a nucleotide sequence selected from SEQ ID NOs: 1-114; b. an antisense strand forming a duplex with the sense strand and comprising a nucleotide sequence selected from SEQ ID NOs: 115-228.

2. The dsRNAi agent of claim 1, wherein one or more nucleotides in the sense strand and the antisense strand are modified nucleotides, wherein each of the modified nucleotides independently comprises one or more modifications selected from a 2 '-deoxy modification, a 2’- O-alkyl modification, a 2'-halo modification, a threofuranosyl nucleotide (TNA) modification, a 2 ’-5 ’-linkage modification, a conformationally restricting modification, an abasic modification, an inverted abasic 2 ’-deoxyribose modification, a 2’- amino-m edification, a 2’-O-allyl modification, 2’-C-alkyl modification, a 2’-O-alkoxyalkyl modification, a morpholino modification, a phosphoramidate modification, a non-natural nucleobase modification, a modification in a tetrahydropyran, a modification containing a 1,5-anhydrohexitol, a modification containing a cyclohexenyl, a modification containing a phosphorothioate group, a modification containing a 5’-vinyl-phospbonate, a modification containing a 5 '-phosphate, a modification to form a thermally destabilizing nucleotide, a glycol nucleic acid (GNA) modification, a 2-O-(N- methylacetamide) modification, 2 ’-deoxy modification, 2'-O-alk oxyalkyl modification, 2'-O- alkyl modification, 2'-O-allyl modification, 2'-C-allyl modification, 2'-halo modification, modification containing a non-natural nucleobase, 3 ’-phosphorothioate (PS) modification, 2’-O- methyl (2’-0Me) modification, 2 ’-fluoro (2’-F) modification, 2’-O-methoxyethyl (2’-M0E) modification, the modification containing a non-natural nucleobase, and 5’-vinyl-phosphonate (5 ’-VP) modification.

3. The dsRNAi agent of claim 1 or 2, wherein the sense strand comprises:a. one or two 2’-M0E modifications positioned at the 1st and / or 2nd nucleotides from the 5’ end; and / orb. one or two 2’-M0E modifications positioned at the 1st and / or 2nd nucleotides from the 3 ’ end;c. one or two 3 ’-PS modifications at the 1st and / or 2nd nucleotides from the 5’ end; d. one or two 3’-PS modifications at the 1st and / or 2nd nucleotides from the 3’ end; e. one to four 2 ’-MOE modifications positioned at the 1st, 2nd, 20th, and / or 21st nucleotides from the 5 ’ end;PAT060035-PCT-SEC01f. two, three, or four 2’-F modifications positioned at the 7th, 9th, 1 Oth, and / or 11th nucleotides from the 5’ end; and / org, one to four 3’-PS group at the 1st, 2nd, 20th, and / or 21st nucleotides from the 5’ end.

4. The dsRNAi agent of any one of claims 1 to 3, wherein the antisense strand comprises:a. a 5 ’-VP modification at the 1st nucleotide from the 5 ’ end;b. a 5’-VP-2’-OMe modification at the 1st position from the 5’ end;c. one or two 3 ’-PS modifications at the 1st and / or 2nd nucleotides from the 5’ end; d. one or two 3’-PS modifications at the 1st and / or 2nd nucleotides from the 3’ end; e. a 5’-(E)-VP modification at the 1st nucleotide from the 5’ end;f. a 5’-(E)-VP-2’-OMe modification at the 1st nucleotide from the 5’ end;g. two, three, or four 2’-F modifications positioned at the 2nd, 6th, 14th, and / or 16th nucleotides from the 5’ end;h. 2’-F modifications positioned at the 2nd, 6th, 14th, and 16th nucleotides from the 5’ end; i. 2’-F modifications positioned at the 2nd, 14th, and 16th nucleotides from the 5’ end and a 5’-(E)-VP-2’-OMe modification positioned at the 1st nucleotide from the 5’ end; j. 2’-OMe modifications; and / ork. one to four 3 '-PS group at the 2nd, 3rd, 22nd, and / or 23rd nucleotides from the 5’ end.

5. The dsRNAi agent of any one of claims 1 to 4, wherein each of the sense strand and the antisense strand independently comprises two, three, four, five or six 2’-F modified nucleotides.

6. A double stranded RNAi (dsRNAi) agent comprising:1) a sense strand comprising SEQ ID NO: 229, and an antisense strand comprising SEQ ID NO: 282;2) a sense strand comprising SEQ ID NO: 230, and an antisense strand comprising SEQ ID NO: 283;3) a sense strand comprising SEQ ID NO: 231, and an antisense strand comprising SEQ ID NO: 284;4) a sense strand comprising SEQ ID NO: 232, and an antisense strand comprising SEQ ID NO: 285;5) a sense strand comprising SEQ ID NO: 233, and an antisense strand comprising SEQ ID NO: 2.86;6) a sense strand comprising SEQ ID NO: 235, and an antisense strand comprising SEQ ID NO: 288;7) a sense strand comprising SEQ ID NO: 236, and an antisense strand comprising SEQ ID NO: 289;PAT060035-PCT-SEC018) a sense strand comprising SEQ ID NO: 237, and an antisense strand comprising SEQ ID NO: 290;9) a sense strand comprising SEQ ID NO: 238, and an antisense strand comprising SEQ ID NO: 291;10) a sense strand comprising SEQ ID NO: 239, and an antisense strand comprising SEQ ID NO: 292;11) a sense strand comprising SEQ ID NO: 240, and an antisense strand comprising SEQ ID NO: 293;12) a sense strand comprising SEQ ID NO: 241, and an antisense strand comprising SEQ ID NO: 294;13) a sense strand comprising SEQ ID NO: 231, and an antisense strand comprising SEQ ID NO: 284;14) a sense strand comprising SEQ ID NO: 229, and an antisense strand comprising SEQ ID NO: 282;15) a sense strand comprising SEQ ID NO: 242, and an antisense strand comprising SEQ ID NO: 295;16) a sense strand comprising SEQ ID NO: 243, and an antisense strand comprising SEQ ID NO: 296; or17) a sense strand comprising SEQ ID NO: 230, and an antisense strand comprising SEQ ID NO: 283.

7. A double stranded RNAi (dsRNAi) agent comprising:1) a sense strand comprising SEQ ID NO: 244, and an antisense strand comprising SEQ ID NO: 297;2) a sense strand comprising SEQ ID NO: 245, and an antisense strand comprising SEQ ID NO: 298;3) a sense strand comprising SEQ ID NO: 246, and an antisense strand comprising SEQ ID NO: 299;4) a sense strand comprising SEQ ID NO: 233, and an antisense strand comprising SEQ ID NO: 286;5) a sense strand comprising SEQ ID NO: 247, and an antisense strand comprising SEQ ID NO: 286;6) a sense strand comprising SEQ ID NO: 248, and an antisense strand comprising SEQ ID NO: 286;PAT060035-PCT-SEC017) a sense strand comprising SEQ ID NO: 249, and an antisense strand comprising SEQ ID NO: 286;8) a sense strand comprising SEQ ID NO: 250, and an antisense strand comprising SEQ ID NO: 286;9) a sense strand comprising SEQ ID NO: 251, and an antisense strand comprising SEQ ID NO: 286;10) a sense strand comprising SEQ ID NO: 252, and an antisense strand comprising SEQ ID NO: 286;11) a sense strand comprising SEQ ID NO: 253, and an antisense strand comprising SEQ ID NO: 286;12) a sense strand comprising SEQ ID NO: 254, and an antisense strand comprising SEQ ID NO: 286;13) a sense strand comprising SEQ ID NO: 255, and an antisense strand comprising SEQ ID NO: 300;14) a sense strand comprising SEQ ID NO: 256, and an antisense strand comprising SEQ ID NO: 300;15) a sense strand comprising SEQ ID NO: 257, and an antisense strand comprising SEQ ID NO: 300;16) a sense strand comprising SEQ ID NO: 258, and an antisense strand comprising SEQ ID NO: 300;17) a sense strand comprising SEQ ID NO: 259, and an antisense strand comprising SEQ ID NO: 300; or18) a sense strand comprising SEQ ID NO: 260, and an antisense strand comprising SEQ ID NO: 300.19) a sense strand comprising SEQ ID NO: 261, and an antisense strand comprising SEQ ID NO: 300;20) a sense strand comprising SEQ ID NO: 262, and an antisense strand comprising SEQ ID NO: 300;21) a sense strand comprising SEQ ID NO: 263, and an antisense strand comprising SEQ ID NO: 300;22) a sense strand comprising SEQ ID NO: 264, and an antisense strand comprising SEQ ID NO: 286;23) a sense strand comprising SEQ ID NO: 243, and an antisense strand comprising SEQ ID NO: 296;PAT060035-PCT-SEC0124) a sense strand comprising SEQ ID NO: 265, and an antisense strand comprising SEQ ID NO: 301;25) a sense strand comprising SEQ ID NO: 266, and an antisense strand comprising SEQ ID NO: 302;26) a sense strand comprising SEQ ID NO: 267, and an antisense strand comprising SEQ ID NO: 303;27) a sense strand comprising SEQ ID NO: 257, and an antisense strand comprising SEQ ID NO: 300;28) a sense strand comprising SEQ ID NO: 268, and an antisense strand comprising SEQ ID NO: 300;29) a sense strand comprising SEQ ID NO: 269, and an antisense strand comprising SEQ ID NO: 300;30) a sense strand comprising SEQ ID NO: 268, and an antisense strand comprising SEQ ID NO: 304;31) a sense strand comprising SEQ ID NO: 269, and an antisense strand comprising SEQ ID NO: 304;32) a sense strand comprising SEQ ID NO: 262, and an antisense strand comprising SEQ ID NO: 300;33) a sense strand comprising SEQ ID NO: 270, and an antisense strand comprising SEQ ID NO: 300;34) a sense strand comprising SEQ ID NO: 271, and an antisense strand comprising SEQ ID NO: 300;35) a sense strand comprising SEQ ID NO: 270, and an antisense strand comprising SEQ ID NO: 304; or36) a sense strand comprising SEQ ID NO: 271, and an antisense strand comprising SEQ ID NO: 304.37) a sense strand comprising SEQ ID NO: 272, and an antisense strand comprising SEQ ID NO: 296;38) a sense strand comprising SEQ ID NO: 273, and an antisense strand comprising SEQ ID NO: 302;39) a sense strand comprising SEQ ID NO: 274, and an antisense strand comprising SEQ ID NO: 302;40) a sense strand comprising SEQ ID NO: 275, and an antisense strand comprising SEQ ID NO: 296;PAT060035-PCT-SEC0141) a sense strand comprising SEQ ID NO: 267, and an antisense strand comprising SEQ ID NO: 302;42) a sense strand comprising SEQ ID NO: 276, and an antisense strand comprising SEQ ID NO: 296;43) a sense strand comprising SEQ ID NO: 243, and an antisense strand comprising SEQ ID NO: 301;44) a sense strand comprising SEQ ID NO: 277, and an antisense strand comprising SEQ ID NO: 303;45) a sense strand comprising SEQ ID NO: 276, and an antisense strand comprising SEQ ID NO: 301;46) a sense strand comprising SEQ ID NO: 278, and an antisense strand comprising SEQ ID NO: 296;47) a sense strand comprising SEQ ID NO: 279, and an antisense strand comprising SEQ ID NO: 300;48) a sense strand comprising SEQ ID NO: 280, and an antisense strand comprising SEQ ID NO: 305;49) a sense strand comprising SEQ ID NO: 272, and an antisense strand comprising SEQ ID NO: 301;50) a sense strand comprising SEQ ID NO: 265, and an antisense strand comprising SEQ ID NO: 296;51) a sense strand comprising SEQ ID NO: 266, and an antisense strand comprising SEQ ID NO: 303;52) a sense strand comprising SEQ ID NO: 273, and an antisense strand comprising SEQ ID NO: 303;53) a sense strand comprising SEQ ID NO: 277, and an antisense strand comprising SEQ ID NO: 302; or54) a sense strand comprising SEQ ID NO: 281, and an antisense strand comprising SEQ ID NO: 302.

8. A double stranded RNAi (dsRNAi) agent comprising:1) a sense strand comprising SEQ ID NO: 310, and an antisense strand comprising SEQ ID NO: 371;2) a sense strand comprising SEQ ID NO: 322, and an antisense strand comprising SEQ ID NO: 381;PAT060035-PCT-SEC013) a sense strand comprising SEQ ID NO: 328, and an antisense strand comprising SEQ ID NO: 371;4) a sense strand comprising SEQ ID NO: 337, and an antisense strand comprising SEQ ID NO: 385;5) a sense strand comprising SEQ ID NO: 338, and an antisense strand comprising SEQ ID NO: 385;6) a sense strand comprising SEQ ID NO: 339, and an antisense strand comprising SEQ ID NO: 385;7) a sense strand comprising SEQ ID NO: 341, and an antisense strand comprising SEQ ID NO: 385;8) a sense strand comprising SEQ ID NO: 342, and an antisense strand comprising SEQ ID NO: 385;9) a sense strand comprising SEQ ID NO: 343, and an antisense strand comprising SEQ ID NO: 385;10) a sense strand comprising SEQ ID NO: 344, and an antisense strand comprising SEQ ID NO: 385;11) a sense strand comprising SEQ ID NO: 347, and an antisense strand comprising SEQ ID NO: 386;12) a sense strand comprising SEQ ID NO: 349, and an antisense strand comprising SEQ ID NO: 388;13) a sense strand comprising SEQ ID NO: 355, and an antisense strand comprising SEQ ID NO: 304;14) a sense strand comprising SEQ ID NO: 356, and an antisense strand comprising SEQ ID NO: 304;15) a sense strand comprising SEQ ID NO: 357, and an antisense strand comprising SEQ ID NO: 381;16) a sense strand comprising SEQ ID NO: 360, and an antisense strand comprising SEQ ID NO: 381;17) a sense strand comprising SEQ ID NO: 362, and an antisense strand comprising SEQ ID NO: 388; or18) a sense strand comprising SEQ ID NO: 361, and an antisense strand comprising SEQ ID NO: 386.19) a sense strand comprising SEQ ID NO: 364, and an antisense strand comprising SEQ ID NO: 385;PAT060035-PCT-SEC0120) a sense strand comprising SEQ ID NO: 348, and an antisense strand comprising SEQ ID NO: 388; or21) a sense strand comprising SEQ ID NO: 392, and an antisense strand comprising SEQ ID NO: 304.

9. The dsRNAi agent of any one of claims 1 through 8, further comprising a ligand, wherein the ligand comprises a N-acetylgalactosamine (GalNAc) moiety comprising the following structureHO OHHO OHc. wherein:d. each pl 1 and ql 1 is independently an integer from 0 to 12;e. each zl, z2, and z3 is independently an integer of 0 to 12; andf is an attachment point to the sense strand or the antisense strand, or to a conjugate linker conjugated to the sense strand or the antisense strand.PAT060035-PCT-SEC0110. 'The dsRNAi agent of claim 9, wherein the ligand comprises the following structure:, orPAT060035-PCT-SEC01d. whereine.is an attachment point to the sense strand or the antisense strand or to a conjugate linker conjugated to the sense strand or the antisense strand.

11. The dsRNAi agent of claim 10, wherein the ligand is conjugated to 3’ end of the sense strand to form the following structure:OH-OH or -SH.PAT060035-PCT-SEC0112. The dsRNAi agent of claim 10, wherein the ligand is conjugated to 5’ end of the sense strand to form the following structure:OHb. or a pharmaceutically acceptable salt thereof, wherein W is -OH or -SH.

13. A double stranded RNAi (dsRNAi) agent comprising:1) a sense strand consisting of SEQ ID NO: 233, and an antisense strand consisting of SEQ ID NO: 286;2) a sense strand consisting of SEQ ID NO: 243, and an antisense strand consisting of SEQ ID NO: 296;3) a sense strand consisting of SEQ ID NO: 247, and an antisense strand consisting of SEQ ID NO: 286;4) a sense strand consisting of SEQ ID NO: 256, and an antisense strand consisting of SEQ ID NO: 300;5) a sense strand consisting of SEQ ID NO: 257, and an antisense strand consisting of SEQ ID NO: 300;6) a sense strand consisting of SEQ ID NO: 258, and an antisense strand consisting of SEQ ID NO: 300;7) a sense strand consisting of SEQ ID NO: 260, and an antisense strand consisting of SEQ ID NO: 300;8) a sense strand consisting of SEQ ID NO: 261, and an antisense strand consisting of SEQ ID NO: 300;PAT060035-PCT-SEC019) a sense strand consisting of SEQ ID NO: 262, and an antisense strand consisting of SEQ ID NO: 300;10) a sense strand consisting of SEQ ID NO: 263, and an antisense strand consisting of SEQ ID NO: 300;11) a sense strand consisting of SEQ ID NO: 265, and an antisense strand consisting of SEQ ID NO: 301;12) a sense strand consisting of SEQ ID NO: 267, and an antisense strand consisting of SEQ ID NO: 303;13) a sense strand consisting of SEQ ID NO: 270, and an antisense strand consisting of SEQ ID NO: 304;14) a sense strand consisting of SEQ ID NO: 271, and an antisense strand consisting of SEQ ID NO: 304;15) a sense strand consisting of SEQ ID NO: 272, and an antisense strand consisting of SEQ ID NO: 296;16) a sense strand consisting of SEQ ID NO: 275, and an antisense strand consisting of SEQ ID NO: 296;17) a sense strand consisting of SEQ ID NO: 277, and an antisense strand consisting of SEQ ID NO: 303;18) a sense strand consisting of SEQ ID NO: 276, and an antisense strand consisting of SEQ ID NO: 301;19) a sense strand consisting of SEQ ID NO: 279, and an antisense strand consisting of SEQ ID NO: 300; or20) a sense strand consisting of SEQ ID NO: 266, and an antisense strand consisting of SEQ ID NO: 303;wherein the ligand (L96) is conjugated to the 3’ end of the sense strand to form the following schematic:PAT060035-PCT-SEC01or a pharmaceutically acceptable salt thereof, wherein W is -OH.

14. A pharmaceutical composition comprising the dsRNAi agent of any one of claims 1 to 13Error! Reference source not found, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

15. A method of inhibiting angiotensinogen (AGT) expression in a cell, the method comprising: a. contacting the cell with the dsRNAi agent of any one of claims 1 to 13 or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 14; andb. maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of an AGT gene, thereby inhibiting expression of the AGT gene in the cell.

16. A method of treating AGT-associated disease in a subject in need thereof, comprising administering to the subject the dsRNAi agent of any one of claims 1 to 13 and the pharmaceutical composition of claim 14.

17. The method of claim 16, wherein the AGT-associated disease is selected from the group consisting of hypertension, borderline hypertension, primary hypertension, secondary hypertension, hypertensive emergency, hypertensive urgency, isolated systolic or diastolic hypertension, pregnancy-associated hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension.PAT060035-PCT-SEC01systemic venous hypertension, systolic hypertension, labile hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vasculopathy, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiac myopathy, glomerulosclerosis, coarctation of the aorta, aortic aneurism, ventricular fibrosis, Cushing’ s syndrome, and other glucocorticoid excess states including chronic steroid therapy, pheochromocytoma, reninoma, secondary aldosteronism and other mineralocorticoid excess states, sleep apnea, thyroid / parathyroid disease, heart failure, myocardial infarction, angina, stroke, diabetes mellitus, renal disease, renal failure, systemic sclerosis, intrauterine growth restriction (IUGR), and fetal growth restriction.

18. The method of any one of claims 15 to 17, wherein the dsRNAi agent further comprises a ligand comprising the following structure:PAT060035-PCT-SEC01e. > is an attachment point to the sense strand or the antisense strand or to a conjugate linker conjugated to the sense strand or the antisense strand.

19. The method of any one of claims 16 to 18, wherein the dsRNAi agent or the pharmaceutical composition is administered to the subject subcutaneously or intravenously.

20. A kit comprising the dsRNAi agent of any one of claims 1 to 13 or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 14.