Method for producing human milk oligosaccharide
Patent Information
- Application Number
- PCT/JP2026/012331
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-03-27
- Filing Date
- 2026-03-26
- Publication Date
- 2026-10-01
Smart Images

Figure 00000028_0000 
Figure 00000029_0000 
Figure 00000030_0000
Abstract
Description
Method for producing human milk oligosaccharides
[0001] The present disclosure relates to a method for producing human milk oligosaccharides, modified non-mammary gland-derived mammalian cells, a composition containing modified mammalian cells, and the like.
[0002] Human Milk Oligosaccharide (HMO) is a functional oligosaccharide contained in human breast milk, and is known to have physiological functions such as formation and maintenance of intestinal flora in newborns, prevention of pathogenic bacterial infection, anti-inflammation, and development and maintenance of brain functions. In recent years, it has become clear that HMO is also effective for improving and maintaining the intestinal environment of adults. HMO has diverse structures, and more than 180 types of HMO have been known so far. Specific examples of HMO include 2'-fucosyllactose (2'-FL), 3-fucosyllactose (3-FL), lacto-N-neotetraose (LNnT), lacto-N-tetraose (LNT), and the like.
[0003] Japanese Unexamined Patent Publication No. 2024-105715
[0004] Huang YF, Aoki K, Akase S, et al. Global mapping of glycosylation pathways in human-derived cells. Dev Cell. 2021;56(8):1195-1209.e7. doi:10.1016 / j.devcel.2021.02.023
[0005] In recent years, research on the health functions of HMO has progressed, and its application to infant formula and functional foods is expected. However, since HMO is specifically present in human breast milk, it is difficult to directly obtain a large amount of naturally derived HMO.
[0006] Conventional research has focused on the production of HMOs by microbial fermentation. For example, Patent Document 1 discloses a method for producing HMOs using genetic engineering techniques with bacteria such as Escherichia coli. However, HMOs produced by microbial fermentation are limited to low-molecular-weight HMOs such as 2'-fucosyl lactose (2'-FL), 3-fucosyl lactose (3-FL), 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), and lacto-N-tetraose (LNT). The production of high-molecular-weight HMOs with complex structures is difficult using microbial fermentation and has not been reported to date. Furthermore, in mammals, HMOs are synthesized only in mammary epithelial cells and not in other tissues or cells. However, culturing mammary epithelial cells is difficult, and the synthesis of HMOs using non-mammary-derived mammalian cells has not been achieved.
[0007] The present inventors primarily aimed to provide a technology that enables HMO synthesis in non-mammary gland-derived mammalian cell lines.
[0008] The inventors have discovered that by improving the expression and / or activity of α-lactalbumin in non-mammary gland-derived mammalian cultured cells through gene modification or protein introduction, the cultured cells can synthesize and secrete human milk oligosaccharides (HMOs) into the culture medium. Further improvements have led to the completion of this disclosure.
[0009] This disclosure includes, for example, the following subjects: 1. A method for producing human milk oligosaccharides, comprising the step of culturing modified non-mammary gland mammalian cells in which the expression and / or activity of α-lactalbumin is enhanced by genetic modification or protein introduction. 2. The method according to 1, wherein the modified non-mammary gland mammalian cells are modified human cells. 3. The method according to 1 or 2, wherein the human milk oligosaccharide comprises at least one human milk oligosaccharide selected from the group consisting of 2'-fucosyl lactose, 3-fucosyl lactose, sialyl lacto-N-tetraose d, and disialyl lacto-N-tetraose. 4. The method according to any one of 1 to 3, wherein the modified non-mammary gland mammalian cells are kidney-derived cells. 5. The method according to any one of 1 to 4, wherein the modified non-mammary gland mammalian cells comprise an exogenous polynucleotide sequence including the coding sequence of the α-lactalbumin gene. 6. A method for producing the modified non-mammary gland mammalian cells, wherein the expression and / or activity of human milk oligosaccharide synthesis-related enzymes downstream of α-lactalbumin are altered by gene modification or protein introduction. Item 7. Modified non-mammary gland mammalian cells, wherein the expression and / or activity of α-lactalbumin are improved by gene modification or protein introduction. Item 8. The cells according to Item 7, wherein the modified non-mammary gland mammalian cells are modified human cells. Item 9. A cell-containing composition comprising the cells and culture medium according to Item 7 or 8. Item 10. The composition according to Item 9 for use in the production of human milk oligosaccharides. Item 11. The composition according to Item 9 or 10, further comprising lactose and / or human milk oligosaccharides. Item 12. The composition according to any one of Items 9 to 11, comprising dicialyl lacto-N-tetraose.
[0010] This disclosure provides a technology that enables HMO synthesis in cultured cells of non-mammary gland-derived mammals.
[0011] Test 1-1: Shows the gene expression levels of B4GALT1 and LALBA when RNA-seq was performed using HEK293 cells. Test 1-1: Shows the results of GlycoMaple analysis of enzyme gene expression involved in HMO synthesis after lactose synthesis. Test 1-4: Shows the results of Western blotting to detect LALBA-3HA and GAPDH (control) in proteins extracted from HEK293 cells and LALBA-stable expressing HEK293 cells. Test 2-3: Shows the results of mass spectrometry to detect HMOs in samples recovered from HEK293 cells and samples recovered from LALBA-stable expressing HEK293 cells. Test 2-3: Shows the results of extracting the mass (m / z) of each HMO. Test 2-3: Shows the MS / MS results of each HMO. Experiment 3-3: The results of detecting HMOs by mass spectrometry in each sample recovered from HEK293 cells, LALBA-stable expressing HEK293 cells, LALBA-stable expressing B4GALT1-KO cells, and B3GNT2+LALBA-stable expressing HEK293 cells are shown. Experiment 3-3: (Left) For each HMO detected in each sample recovered from HEK293 cells, LALBA-stable expressing HEK293 cells, and LALBA-stable expressing B4GALT1-KO cells, the peak area of each MS was calculated, and the relative abundance is shown when the internal standard maltohexaose is set to 1. (Right) For each HMO detected in samples recovered from HEK293 cells, LALBA-stable-expressing HEK293 cells, B4GALT1-stable-expressing HEK293 cells, and B4GALT1+LALBA-stable-expressing HEK293 cells, the peak area of each MS was calculated, and the relative amount is shown when the internal standard maltohexaose is set to 1. Experiment 3-3: The relative abundances of each HMO (2'-FL, 3'-SL, LNTri-II, LNT / LNnT, LSTd / LSTa, LSTc, and DSLNT) detected in samples recovered from HEK293 cells, LALBA-stable-expressing HEK293 cells, B3GNT2+LALBA-stable-expressing HEK293 cells, and B3GALT5+B3GNT2+LALBA-stable-expressing HEK293 cells are shown. Maltohexaose was used as the internal standard for normalization.The relative intensity of each HMO species in LALBA-stable expressing HEK293 cells was set to 1, and the values for other cell lines were calculated based on this. Experiment 3-3: Continuation of Figure 6C. The relative amounts of HMOs in each cell are shown in the pie chart. Experiment 4-1: Results of detecting HMOs by mass spectrometry in samples recovered from HCT116 cells, LALBA-stable expressing HCT116 cells, CHO-K1 cells, and LALBA-stable expressing CHO-K1 cells are shown. Experiment 4-1: Results of comparing the peak areas of MS for HMOs estimated from mass are shown. An example of an embodiment of culturing HMOs using the technology of this disclosure is shown in a schematic diagram. In mammals, HMOs are synthesized only in mammary epithelial cells and not in other tissues or cells. In the technology of this disclosure, by introducing and expressing the α-lactalbumin gene (LALBA gene) in cells (e.g., HEK293 cells), HMOs can be synthesized in cells other than mammary epithelial cells that cannot normally synthesize HMOs. Furthermore, the structure of the synthesized HMO can be altered by modifying the genes of the cells. The full-length coding sequence of human wild-type LALBA (SEQ ID NO: 1) and the full-length coding sequence of B3GNT2 (SEQ ID NO: 2) are shown. The amino acid sequence of human wild-type α-lactalbumin protein (SEQ ID NO: 5) is shown. The full-length coding sequence of human wild-type B4GALT1 (SEQ ID NO: 6) and the full-length coding sequence of B3GALT5 (SEQ ID NO: 7) are shown.
[0012] The embodiments included in this disclosure will be described in more detail below. This disclosure preferably includes, but is not limited to, methods for producing human milk oligosaccharides, modified non-mammary gland-derived mammalian cells, and compositions containing modified non-mammary gland-derived mammalian cells, and so on. This disclosure includes everything disclosed herein and recognizable to those skilled in the art.
[0013] The method for producing human milk oligosaccharides as contained herein includes a step of culturing modified non-mammary gland mammalian cells in which the expression and / or activity of α-lactalbumin is enhanced by genetic modification or protein introduction. Hereinafter, the method for producing such cells as contained herein may be referred to as the "production method of the disclosure." The modified non-mammary gland mammalian cells may also be referred to as the "modified non-mammary gland mammalian cells of the disclosure."
[0014] I. Definitions, etc. In this disclosure, “polynucleotide” and “nucleic acid” are used interchangeably and refer to a polymer of two or more nucleotides of any length. The term “polynucleotide” also includes “polynucleotide derivatives.” That is, the term “polynucleotide” in this disclosure includes polynucleotides containing nucleotide derivatives; polynucleotides having unusual nucleotide bonding; and polynucleotides containing nucleotide derivatives and having unusual nucleotide bonding. Furthermore, in this disclosure, polynucleotides may be linear, branched, or cyclic.
[0015] Specific examples of polynucleotide derivatives include those that have undergone known chemical modifications. To prevent degradation by hydrolytic enzymes such as nucleases, the phosphate residues of each nucleotide can be replaced with chemically modified phosphate residues such as phosphorothioates (PS), methylphosphonates, or phosphorodithionates. The hydroxyl group at the 2' position of the sugar (ribose) may also be replaced with an -OR (where R represents, for example, CH3 (2'-O-Me), CH2CH2OCH3 (2'-O-MOE), CH2CH2NHC (NH)NH2, CH2CONHCH3, CH2CH2CN, etc.). Furthermore, the base portion (pyrimidine, purine) may be chemically modified, for example, by introducing a methyl group or cationic functional group at the 5th position of the pyrimidine base, or by substituting the carbonyl group at the 2nd position with a thiocarbonyl group. In addition, the phosphate or hydroxyl portion may be modified with, for example, biotin, amino groups, lower alkylamine groups, acetyl groups, etc., but is not limited to these. Furthermore, BNA (LNA), in which the conformation of the sugar portion of a nucleotide is fixed to the N-type by cross-linking the 2' oxygen and 4' carbon atoms of the sugar portion, can also be used.
[0016] Specific examples of nucleic acid bases that make up nucleotides include not only typical bases in DNA and RNA (adenine (A), thymine (T), uracil (U), guanine (G), cytosine (C), etc.), but also other bases, such as hypoxanthine (I) and modified bases. Modified bases include, for example, pseudouracil, 3-methyluracil, dihydrouracil, 5-alkylcytosine (e.g., 5-methylcytosine), 5-alkyluracil (e.g., 5-ethyluracil), 5-halouracil (5-bromouracil), 6-azapyrimidine, 6-alkylpyrimidine (6-methyluracil), 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, 1-methyladenine, 1-methylhypoxanthine Examples include santhine, 2,2-dimethylguanine, 3-methylcytosine, 2-methyladenine, 2-methylguanine, N6-methyladenine, 7-methylguanine, 5-methoxyaminomethyl-2-thiouracil, 5-methylaminomethyluracil, 5-methylcarbonylmethyluracil, 5-methyloxyuracil, 5-methyl-2-thiouracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid, 2-thiocytosine, purines, 2-aminopurines, isoguanine, indole, imidazole, xanthine, etc.
[0017] In this disclosure, "identity" of amino acid sequences refers to the degree of agreement between two or more comparable amino acid sequences. Therefore, the higher the agreement between two amino acid sequences, the higher their identity or similarity. The level of amino acid sequence identity can be determined, for example, using the sequence analysis tool FASTA and its default parameters. Alternatively, it can be determined using the algorithm BLAST. A program called BLASTX, based on the BLAST algorithm, has been developed. The specific methods for these analysis methods are publicly known and can be found on the National Center of Biotechnology Information (NCBI) website (http: / / www.ncbi.nlm.nih.gov / ). Furthermore, "identity" of nucleotide sequences is defined in accordance with the above.
[0018] An example of an amino acid sequence that does not have 100% sequence identity with a given amino acid sequence X is an amino acid sequence in which one or more amino acids are substituted, deleted, added, or inserted (preferably by substitution, more preferably by conservative substitution) into the amino acid sequence X. Here, "multiple" means, for example, 2 to 20, preferably 2 to 10, more preferably 2 to 5, and even more preferably 2 or 3. The upper or lower limit of the above range may be 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In this disclosure, substitution, deletion, addition, and insertion may be collectively referred to as "mutation".
[0019] A "conservative substitution" means that an amino acid residue is replaced by an amino acid residue that has a similar side chain. For example, substitutions between amino acid residues with basic side chains, such as lysine, arginine, and histidine, are considered conservative substitutions. Other examples of conservative substitutions include those between amino acid residues with acidic side chains, such as aspartic acid and glutamic acid; amino acid residues with non-charged polar side chains, such as glycine, asparagine, glutamine, serine, threonine, tyrosine, and cysteine; amino acid residues with non-polar side chains, such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan; amino acid residues with β-branched side chains, such as threonine, valine, and isoleucine; and amino acid residues with aromatic side chains, such as tyrosine, phenylalanine, tryptophan, and histidine.
[0020] In this disclosure, Fuc represents fucose, Gal represents galactose, Glc represents glucose, Neu5Ac represents N-acetylneuraminic acid, and GlcNAc represents N-acetylglucosamine. Furthermore, for example, α1-2 means that the sugars listed before and after it are linked by an α-1,2 bond.
[0021] In this disclosure, the structure of an oligosaccharide is represented, for example, as Galβ1-4Glc, in which case the hydroxyl group at position 1 of galactose and the hydroxyl group at position 4 of glucose are linked by a β-glucosidic bond. Furthermore, the branched structure is represented, for example, as Galβ1-3(Neu5Acα2-6)GlcNAcβ1-3Gal, in which case the hydroxyl group at position 1 of galactose and the hydroxyl group at position 3 of N-acetylglucosamine in GlcNAcβ1-3Gal are linked by a β-glycosidic bond, and the hydroxyl group at position 2 of N-acetylneuraminic acid and the hydroxyl group at position 6 of N-acetylglucosamine in GlcNAcβ1-3Gal are linked by an α-glycosidic bond.
[0022] II. Modified non-mammary gland mammalian cells. The α-lactalbumin protein is encoded by the LALBA gene. In this disclosure, unless otherwise specified, the term "α-lactalbumin" includes both the α-lactalbumin protein and the α-lactalbumin gene (i.e., the LALBA gene). The α-lactalbumin protein is known to promote the reaction that produces lactose from galactose and glucose by binding to galactosyltransferase and altering its substrate specificity.
[0023] The species from which α-lactalbumin is derived is not particularly limited, as long as it is a mammal. Examples of mammals include humans, chimpanzees, Japanese macaques, dogs, cats, brown bears, seals, cattle, goats, sheep, pigs, giraffes, horses, rhinoceroses, mice, rats, capybaras, rabbits, African elephants, blue whales, dolphins, kangaroos, koalas, platypuses, and echidnas. In the technology of this disclosure, it is particularly preferable that the α-lactalbumin is human α-lactalbumin.
[0024] The human α-lactalbumin gene (LALBA) is registered in the National Center for Biotechnology Information (NCBI) database with Gene ID: 3906. The full-length coding sequence (CDS) of the human α-lactalbumin gene (LALBA) is shown in Sequence ID No. 1. The amino acid sequence of the human α-lactalbumin protein is shown in Sequence ID No. 5.
[0025] In this disclosure, "modified non-mammalian cells in which the expression and / or activity of α-lactalbumin is enhanced by gene modification or protein introduction" refers to mammalian cells in which the expression level or activity of α-lactalbumin is enhanced by gene modification or protein introduction compared to control cells that have not undergone such gene modification or protein introduction. "Expression level of α-lactalbumin" includes both the expression level of the α-lactalbumin gene (i.e., the amount of transcripts) and the expression level of the α-lactalbumin protein (i.e., the amount of translation products).
[0026] The species from which the above cells originate is not particularly limited, as long as it is a mammal. Examples of mammals include humans, chimpanzees, Japanese macaques, dogs, cats, brown bears, seals, cattle, goats, sheep, pigs, giraffes, horses, rhinoceroses, mice, rats, hamsters, capybaras, rabbits, African elephants, blue whales, dolphins, kangaroos, koalas, platypuses, and echidnas. Although not particularly limited, it is especially preferable that the modified non-mammary gland-derived mammalian cells in the technology of this disclosure be modified human cells. In this disclosure, "human cells" means cells derived from humans.
[0027] Specific examples of genetic modification include gene transfection, gene cloning, and genome editing. A cell can be identified as a genetically modified cell by the presence of exogenous polynucleotide sequences within that cell. These exogenous polynucleotide sequences may be integrated into the genome or retained within the cell in a plasmid.
[0028] More specifically, gene modification operations to improve the expression level or activity of α-lactalbumin include, for example, introducing a plasmid containing the CDS of the α-lactalbumin gene into cells under the control of a strong promoter (e.g., CMV promoter) by lipofection or electroporation; synthesizing α-lactalbumin mRNA and introducing it into cells by lipofection or electroporation; expressing α-lactalbumin in cells using a viral vector (e.g., adenovirus vector); inserting the α-lactalbumin gene into the host cell genome using a retrovirus or lentivirus; inserting the α-lactalbumin gene into the host cell genome using a CRISPR-Cas9 system or TALEN (knock-in); and inserting the α-lactalbumin gene into the host cell genome using a transposon system.
[0029] When introducing a polynucleotide containing an exogenous α-lactalbumin gene into a cell, the α-lactalbumin gene may be a wild-type α-lactalbumin gene and may have mutations insofar as the protein translated from the gene can promote the reaction that produces lactose from galactose and glucose. More specifically, for example, a polynucleotide containing a base sequence having 70% or more identity with the full-length CDS of the human α-lactalbumin gene (SEQ ID NO: 1) may be introduced into the cell. The identity with respect to the base sequence shown in SEQ ID NO: 1 is preferably 80% or more, more preferably 90% or more, even more preferably 95% or more, and particularly preferably 99% or more. The identity with respect to the base sequence shown in SEQ ID NO: 1 may be 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% or more. When introducing an exogenous polynucleotide containing the α-lactalbumin gene into cells, it is most preferable to introduce a polynucleotide containing the base sequence consisting of Sequence ID No. 1 into the cells.
[0030] Furthermore, when introducing a polynucleotide containing an exogenous α-lactalbumin gene into cells, the protein translated from the gene may be a wild-type α-lactalbumin protein, or it may have mutations insofar as it can promote the reaction that produces lactose from galactose and glucose. More specifically, for example, it may be a protein containing an amino acid sequence that has 70% or more identity with human α-lactoprotein (SEQ ID NO: 5). The identity with respect to the amino acid sequence shown in SEQ ID NO: 5 is preferably 80% or more, more preferably 90% or more, even more preferably 95% or more, and particularly preferably 99% or more. The identity with respect to the amino acid sequence shown in SEQ ID NO: 5 may be 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% or more. When introducing a polynucleotide containing an exogenous α-lactalbumin gene into cells, it is most preferable that the protein translated from the gene is a protein consisting of the amino acid sequence shown in SEQ ID NO: 5.
[0031] Furthermore, gene modification operations that activate the endogenous α-lactalbumin gene may be performed. Specifically, gene modification operations that activate endogenous genes include methods such as fusion of dCas9 (Cas9 that has lost its cleavage activity) with a transcription activator and binding to the promoter region of the endogenous α-lactalbumin gene to promote transcription (CRISPR activation, CRISPR a).
[0032] Specific methods for introducing proteins include, for example, introducing recombinant proteins into cells by encapsulating them in liposomes or lipid nanoparticles; introducing recombinant proteins into cells by encapsulating them in exosomes or extracellular vesicles; introducing recombinant proteins into cells using physical methods such as electroporation or microinjection; and introducing recombinant proteins fused with cell membrane-permeable peptides such as TAT (Trans-Activator of Transcription) peptides or arginine-rich peptides into cells.
[0033] The introduction of a protein into a cell can be determined, for example, by the presence of a protein in that cell that has an amino acid sequence not found in the wild-type protein. Examples of amino acid sequences not found in the wild-type protein include cell membrane permeable peptide sequences such as TAT (Trans-Activator of Transcription) peptides and arginine-rich peptides; tag sequences such as His tag, FLAG tag, Halo tag, MBP tag, HA tag, Myc tag, V5 tag, and PA tag; fluorescent protein sequences such as GFP, BFP, CFP, YFP, and RFP; luminescent protein sequences such as luciferase; secretory signal sequences such as Igκ signal sequences; and solubilization sequences. For example, if a protein with a structure fused with the wild-type protein and the aforementioned peptides is detected in a cell, it can be determined that the cell has been introduced with a protein.
[0034] While not particularly limited, the modified non-mammary gland-derived mammalian cells in the techniques of this disclosure are preferably genetically modified cells, and more preferably contain an exogenous polynucleotide sequence including the coding sequence of the α-lactalbumin gene.
[0035] In the techniques disclosed herein, the method for confirming the improved expression and / or activity of α-lactalbumin in modified non-mammary gland-derived mammalian cells is not particularly limited and can be confirmed by conventionally known methods or methods readily conceivable from conventionally known methods. Specific methods for evaluating gene expression levels include quantitative PCR (qPCR), digital droplet PCR (ddPCR), RNA sequencing (RNA-seq), and microarray analysis. Specific methods for evaluating protein expression levels include Western blotting, ELISA (enzyme-linked immunosorbent assay), and flow cytometry. Specific methods for evaluating activity include enzyme activity assays and substrate activity assays. These methods may be used individually or in combination of two or more.
[0036] While not particularly limited, in the modified non-mammary gland mammalian cells of this disclosure, in addition to the expression and / or activity of α-lactalbumin, the expression and / or activity of human milk oligosaccharide synthesis-related enzymes downstream of α-lactalbumin may be altered. Such alterations may be improvements or decreases. Specific examples of human milk oligosaccharide synthesis-related enzymes downstream of α-lactalbumin include, for example, B3GNT2, B4GALT1, B3GALT5, FUT2, ST3GAL3, ST6GAL1, GCNT2, and ST6GALNAC6. B3GNT2 is an enzyme that promotes the reaction to produce lacto-N-triose II from lactose, and human B3GNT2 is registered in NCBI with Gene ID: 10678. B4GALT1 is an enzyme that promotes the reaction to produce LNnT from lacto-N-triose II, and human B4GALT1 is registered in NCBI with Gene ID: 2683. B3GALT5 is an enzyme that promotes the reaction to produce LNT from lacto-N-triose II, and human B3GALT5 is registered in NCBI with Gene ID: 10317. FUT2 is an enzyme that promotes the reaction to produce 2'-FL from lactose, and human FUT2 is registered in NCBI with Gene ID: 2524. ST3GAL3 is an enzyme that promotes the reaction to produce 3'SL from lactose, and human ST3GAL3 is registered in NCBI with Gene ID: 6487. ST6GAL1 is an enzyme that promotes the reaction to produce 6'SL from lactose, and human ST6GAL1 is registered in NCBI with Gene ID: 6480. GCNT2 is an enzyme that promotes the reaction to produce LNnH etc. from LNnT, and human GCNT2 is registered in NCBI with Gene ID: 2651. ST6GALNAC6 is an enzyme that promotes the reaction that produces DSLNTs and other components from LSTA, and human ST6GALNAC6 is registered in NCBI under Gene ID: 30815.
[0037] Methods for improving the expression and / or activity of a gene and / or protein have already been described in the context of α-lactalbumin. Specifically, for example, the expression and / or activity of a gene and / or protein can be improved by introducing a plasmid containing the coding sequence (CDS) of the gene into cells via lipofection or electroporation, synthesizing the mRNA of the gene and introducing it into cells via lipofection or electroporation, expressing the gene in cells using a viral vector (e.g., adenovirus vector), inserting the gene into the host cell genome using a retrovirus or lentivirus, inserting the gene into the host cell genome using a CRISPR-Cas9 system or TALEN (knock-in), inserting the gene into the host cell genome using a transposon system, fusing dCas9 (Cas9 that has lost its cleavage activity) with a transcription activator and binding it to the endogenous promoter region of the gene to promote transcription (CRISPR activation, CRISPR a), or introducing a protein.
[0038] Specific methods for reducing the expression and / or activity of a gene and / or protein include RNA interference (RNAi) using siRNA (small interfering RNA), methods using antisense oligonucleotides and methods using miRNA (microRNA), methods for knocking out genes by genome editing using the CRISPR-Cas9 system, TALEN (Transcription Activator-Like Effector Nuclease), or ZFN (Zinc Finger Nuclease), and methods for suppressing gene expression by epigenetic regulation such as gene silencing using histone modification and DNA methylation.
[0039] The modified non-mammary gland-derived mammalian cell of the present disclosure may be an immortalized cell, a primary cultured cell, or a finitely proliferating cell. There is also no particular limitation on the tissue from which the modified non-mammary gland-derived mammalian cell of the present disclosure is derived, and the cell may be derived from at least one tissue selected from the group consisting of, for example, renal tissue, hepatic tissue, pulmonary tissue, colonic tissue, rectal tissue, gastric tissue, skin tissue, hematopoietic tissue, nerve tissue, brain tissue, bone tissue, muscle tissue, pancreatic tissue, prostate tissue, uterine tissue, ovarian tissue, fetal tissue, and umbilical cord tissue.
[0040] Specific examples of human cells include HEK293 (Human Embryonic Kidney 293) cells, HK-2 cells, HeLa cells, HCT116 cells, A549 cells, MCF-7 cells, HepG2 cells, Caco-2 cells, HT-29 cells, U-87 MG cells, WI-38 cells, MRC-5 cells, BJ cells, HUVEC (Human Umbilical Vein Endothelial Cells), Jurkat cells, K562 cells, THP-1 cells, HL-60 cells, SH-SY5Y cells, SK-N-SH cells, U251 cells, HaCaT cells, A431 cells, Huh7 cells, IMR-90 cells, and HT-1080 cells.
[0041] Although not particularly limited, the modified non-mammary gland-derived mammalian cell of the present disclosure is preferably a kidney-derived cell (a cell derived from renal tissue), more preferably a human kidney-derived cell, and even more preferably a HEK293 cell. In addition, although not particularly limited, it is preferable that the modified non-mammary gland-derived mammalian cell of the present disclosure is not derived from mammary epithelial cells.
[0042] In the technology of the present disclosure, methods for culturing cells, such as medium, culture vessel, culture conditions, culture period, and passage method, are not particularly limited, and conventionally known methods or methods easily conceivable from conventionally known methods can be employed.
[0043] The culture medium can be, for example, a conventionally known basal medium or a modified conventionally known basal medium. Examples of known basal media include minimal essential medium (MEM), Dulbecco's modified MEM medium (DMEM), Ham's F12 medium, DMEM / F12 medium, IMDM medium, EMEM medium, etc. Optional components that can be added to the culture medium include, for example, fetal bovine serum (FBS), bovine serum albumin (BSA), transferrin, insulin, ethanolamine, fatty acids, collagen precursors, trace elements, 2-mercaptoethanol, thiolglycerol, sugars, lipids, amino acids, vitamins such as ascorbic acid, growth factors such as EGF, antibiotics such as penicillin and streptomycin, antioxidants, buffers, inorganic salts, etc. Optional components that can be added to the culture medium can be used individually or in combination of two or more.
[0044] In the techniques of this disclosure, the components contained in the culture medium and their content are not particularly limited as long as the cells can grow. In the techniques of this disclosure, the culture medium preferably contains sugars, more preferably contains at least one sugar selected from the group consisting of glucose, galactose, N-acetylglucosamine, fucose, and N-acetylneuraminic acid, even more preferably contains glucose and / or galactose, and particularly preferably contains glucose and galactose. Although not particularly limited, in the techniques of this disclosure, the culture medium preferably does not contain serum. Furthermore, the culture medium may be used with the same composition throughout the culture period, or it may be replaced with a culture medium of a different composition at any time.
[0045] The conditions for culturing cells are not particularly limited as long as the cells proliferate. Suitable culture temperatures include, for example, 20°C to 45°C, preferably 30°C to 40°C, more preferably 35°C to 40°C, and particularly preferably 37°C. Suitable culture times include, for example, 12 hours to 240 hours, preferably 48 hours to 120 hours, more preferably 60 hours to 96 hours, even more preferably 70 hours to 90 hours, and particularly preferably 84 hours. The CO2 concentration is also not particularly limited and may be, for example, around 5%.
[0046] Subculture may be performed appropriately according to the state of the cells. For example, subculture may be performed when the cells grow and the cell confluency reaches about 80% or more. In addition, the medium may be replaced appropriately according to the state of the cells. The medium after medium replacement may have the same composition as the medium before medium replacement, or may have a different composition.
[0047] III. Human Milk Oligosaccharides In the present disclosure, "Human Milk Oligosaccharide (HMO)" means an oligosaccharide of three or more monosaccharides containing a lactose structure that is naturally contained in human breast milk. Specific human milk oligosaccharides include, for example, 2'-fucosyllactose (2'-FL), 3-fucosyllactose (3-FL), 3'-sialyllactose (3'-SL), 6'-sialyllactose (6'-SL), lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), lacto-N-hexaose (LNH), lacto-N-neohexaose (LNnH), lacto-N-octaose (LNO), disialyl lacto-N-tetraose (DSLNT), sialyl lacto-N-tetraose (LST) a, LST b, LST c, and LST d, etc.
[0048] Although not particularly limited, in the technology of the present disclosure, the human milk oligosaccharide preferably contains at least one selected from the group consisting of 2'-fucosyllactose, 3-fucosyllactose, sialyl lacto-N-tetraose d, and disialyl lacto-N-tetraose, and more preferably contains disialyl lacto-N-tetraose.
[0049] Furthermore, 2'-fucosyllactose (2'-FL) consists of the structure represented by Fucα1-2Galβ1-4Glc. 3-fucosyllactose (3-FL) consists of the structure represented by Fucα1-3Galβ1-4Glc. Siaryllactose-N-tetraose d (LST d) consists of the structure represented by Neu5Acα2-3Galβ1-4GlcNAcβ1-3Galβ1-4Glc. Disialyllacto-N-tetraose (DSLNT) consists of the structure represented by Neu5Acα2-3Galβ1-3(Neu5Acα2-6)GlcNAcβ1-3Galβ1-4Glc.
[0050] As mentioned above, conventional microbial fermentation methods produce only low-molecular-weight HMOs such as 2'-FL, 3-FL, 3'-SL, 6'-SL, and LNT. The production of high-molecular-weight HMOs with complex structures is difficult with microbial fermentation methods and has not been reported to date. On the other hand, the technology of this disclosure makes it possible to synthesize DSLNTs and other HMOs with even higher molecular weights and more complex structures. In other words, the technology of this disclosure makes it possible to produce high-molecular-weight and complex HMOs that were difficult to synthesize with conventional microbial fermentation methods.
[0051] Human milk oligosaccharides obtained by the technology disclosed herein can exert functions in vivo such as improving the intestinal environment, regulating the intestinal flora, protecting against infection, anti-inflammatory effects, and immunomodulation. Therefore, human milk oligosaccharides obtained by the technology disclosed herein can be applied, for example, to infant nutritional supplements such as powdered milk, health foods, supplements, pharmaceuticals, pet food, animal supplements, etc.
[0052] IV. Compositions of the Disclosure The Disclosure also includes cell-containing compositions comprising modified non-mammary gland-derived mammalian cells and culture media as described herein. Such compositions may be referred to as “Compositions of the Disclosure.” The information provided for the manufacturing methods of the Disclosure and the information provided for modified non-mammary gland-derived mammalian cells as described herein may be incorporated into the Compositions of the Disclosure as appropriate. The information provided for the Compositions of the Disclosure may be incorporated into the manufacturing methods of the Disclosure and the modified non-mammary gland-derived mammalian cells as appropriate.
[0053] While not particularly limited, the compositions of the present disclosure preferably further contain lactose and / or human milk oligosaccharides, and more preferably contain dicialyl lacto-N-tetraose. Since the compositions of the present disclosure contain modified non-mammary gland mammalian cells of the present disclosure in which the expression or activity of α-lactalbumin is enhanced by genetic modification or protein introduction, human milk oligosaccharides can be synthesized in the compositions of the present disclosure by the function of α-lactalbumin.
[0054] As described in the examples below, the modified non-mammary gland mammalian cells of this disclosure have the ability to produce human milk oligosaccharides. Therefore, the compositions of this disclosure containing the modified non-mammary gland mammalian cells of this disclosure can be used for the production of human milk oligosaccharides.
[0055] In this specification, the term “comprising” includes not only “containing” but also “essentially consisting of” and “consisting of.” Furthermore, this disclosure encompasses all combinations of the constituent elements described herein.
[0056] Furthermore, the various characteristics (properties, numerical values, structure, function, etc.) described for each embodiment of this disclosure described above may be combined in any way to identify the subject matter covered by this disclosure. In other words, this disclosure covers all subject matter consisting of any combination of the combinable characteristics described herein.
[0057] The embodiments of this disclosure will be described in more detail below with examples, but the embodiments of this disclosure are not limited to the examples below.
[0058] Test Example 1. Stable Expression of LALBA in HEK293 Cells <1-1. Expression of B4GALT1 and LALBA in Cultured Cell Lines> HMOs are known to be synthesized in mammary epithelial cells, but there have been no cases of detection in mammalian cultured cell lines. Lactose, which forms the structural basis of HMOs, has a structure in which galactose is bound to glucose by a β-1,4 linkage. B4GALT1, a β-1,4-galactosyltransferase, normally transfers galactose using N-acetylglucosamine as a substrate, but when α-lactalbumin is bound to B4GALT1, it becomes able to recognize glucose as a substrate.
[0059] The inventors performed RNA-seq using HEK293 cells to obtain gene expression information from cultured cell lines. As a result, B4GALT1 was expressed in HEK293 cells, while LALBA was not expressed at all (Figure 1A). Next, the inventors analyzed the expression of enzyme genes involved in HMO synthesis after lactose synthesis using GlycoMaple. GlycoMaple is a tool that visualizes the expression information of glycan-related genes on the metabolic pathway of glycans. As a result of the analysis using GlycoMaple, it was confirmed that various enzyme genes involved in HMO synthesis after lactose synthesis were expressed in various cells, including HEK293 cells (Figure 1B). Therefore, the inventors decided to attempt HMO synthesis by expressing LALBA in cultured cells that do not normally express LALBA.
[0060] <1-2. Construction of LALBA Expression Plasmid> A cDNA fragment containing the full-length human wild-type LALBA coding sequence (SEQ ID NO: 1) was obtained using an artificial DNA synthesis service. Using the obtained synthetic LALBA cDNA fragment as a template, DNA was amplified by PCR using LALBA-EcoRI-F primer (AAAAGCTGCGGAATTCGCCACCATGAGGTTCTTTG, SEQ ID NO: 3) and LALBA-MluI-R primer (GGTATCCGCCACGCGTCAACTTCTCACAAAGCCACTGTTCC, SEQ ID NO: 4). The obtained PCR product was introduced into the EcoRI-MluI site of the pME-Hyg-3HA plasmid using infusion cloning (Takara) to obtain the LALBA expression plasmid pME-Hyg-LALBA-3HA.
[0061] <1-3. Introduction of pME-Hyg-LALBA-3HA into HEK293> The circular plasmid pME-Hyg-LALBA-3HA (2 μg) was cleaved with the restriction enzyme FspI (NEB) to form a linear plasmid. After restriction enzyme treatment, ethanol precipitation was performed, and the resulting precipitate was resuspended in 10 μL of TE (10 mM Tris-HCl (pH 7.5), 1 mM EDTA).
[0062] HEK293 cells were placed in 0.4 x 10⁶ wells of Dulbecco's Modified Eagle Medium (DMEM) / 10% Fetal Bovine Serum (FBS) in a 12-well plate. 6 Cells were seeded and cultured for 5 hours. Transfection with linearized pME-Hyg-LALBA-3HA was then performed using Lipofectamine 3000 Transfection Reagent (Thermo Fisher Scientific). After 1 day, the cells were transferred to a 6-well plate. After another day, the medium was changed to DMEM / 10% FBS medium containing 400 μg / mL Hygromycin, and the cells were selected for more than 3 weeks to obtain LALBA-stable expressing HEK293 cells.
[0063] <1-4. Detection of LALBA-3HA> HEK293 cells and LALBA-stable expressing HEK293 cells were seeded in 6-well plates and cultured in DMEM / 10% FBS medium for 1 day. After washing the medium with PBS, the cells were detached with Trypsin / EDTA, and approximately 1 x 10⁶ cells were detected. 6 Cells were collected. After washing the cells with PBS, 100 μL of cell lysate (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1% Triton-X100, 1 mM EDTA, protease inhibitor) was added to the cell pellet to suspend the cells, and the mixture was left on ice for 30 minutes. After solubilization, the cells were centrifuged at 10,000 xg at 4°C for 10 minutes, and the supernatant was used as the cell solution. 6 x SDS sample buffer (0.3 M Tris-HCl (pH 6.8), 12% Sodium Dodecyl Sulfate (SDS), 60 mM Dithiothreitol, 30% Glycerol, 0.2 mg / mL Bromophenol Blue) was added to the cell solution, and the mixture was treated at 95°C for 5 minutes to obtain the sample solution.
[0064] Sample solutions were applied to Polyacrylamide Gel (PAG), and proteins were separated by electrophoresis (SDS-PAGE). After SDS-PAGE, the proteins were transferred to a Polyvinylidene difluoride (PVDF) membrane. LALBA-3HA and control GAPDH were detected by Western blotting using anti-HA antibody (HA-7, Merck) and anti-GAPDH antibody (5A12, Fujifilm Wako) as primary antibodies, and Horseradish peroxidase (HRP)-conjugated anti-mouse IgG antibody (Cell Signaling Technology) as a secondary antibody.
[0065] Figure 2 shows the results of detecting LALBA-3HA by Western blotting. While the endogenous protein GAPDH was detected to similar levels in both HEK293 cells and LALBA-stable-expressing HEK293 cells, the anti-HA antibody-positive band was detected only in LALBA-stable-expressing HEK293 cells (Figure 2). These results confirm that LALBA-3HA is expressed in LALBA-stable-expressing HEK293 cells.
[0066] Test Example 2. HMO Production by Cultured Cells <2-1. Recovery of Culture Supernatant of LALBA-Stable-Expressing HEK293 Cells> HEK293 cells (control) and LALBA-stable-expressing HEK293 cells were placed in 6-well plates in 0.8 x 10⁶ wells. 6 Cells were seeded and cultured for 1 day in DMEM / 10% FBS medium. The following day, the DMEM / 10% FBS medium was removed, washed with warmed PBS, and replaced with 2 mL of warmed Opti-MEM (Thermo Fisher Scientific). After culturing for 3.5 days in a 37°C CO2 incubator, 2 mL of Opti-MEM medium was collected and centrifuged at 4°C and 800 xg for 3 minutes to collect the culture supernatant.
[0067] <2-2. Preparation and Labeling of HMO> 100 μL of 1.52 M acetate buffer (pH 3.4) was added to the collected culture supernatant (2 mL) to adjust the pH to approximately 5.6. 40 μL of glucose oxidase (5,000 units / mL, Fujifilm Wako) was added and the mixture was reacted at 37°C for at least 16 hours to decompose the glucose in the culture supernatant. The entire culture supernatant was then vacuum-dried.
[0068] After drying, the sample was dissolved in 20 μL of pure water, and HMO capture and purification were performed according to the procedure using the BlotGlyco Glycan Purification and Labeling Kit (Sumitomo Bakelite Co., Ltd.).
[0069] After purification of the HMO, it was labeled with procainamide (ProA). Specifically, 9.5 mg of procainamide and 11.2 mg of 2-picoline borane were dissolved in 175 μL of methyl sulfoxide (DMSO) / 75 μL of acetic acid, and then diluted with 200 μL of distilled water to prepare the labeling solution. 45 μL of the labeling solution was added to BlotGlyco polymer beads, and the tube was placed in a 65°C heat block and reacted for 2 hours. The reaction tube was placed in a new microcentrifuge tube and centrifuged (3,000 xg, 1 minute) to collect the solution containing the labeled HMO in the microcentrifuge tube. 855 μL of acetonitrile was added to the collected solution (approximately 45 μL) and mixed, and excess labeling reagent was removed using the BlotGlyco cleanup column. 50 μL of distilled water was added, and the solution was centrifuged (3,000 xg, 1 minute) to collect the procainamide-labeled HMO.
[0070] <2-3. Detection of HMOs using a Mass Spectrometer> 10 μL of the procainamide-labeled sample was vacuum-dried and redissolved in 25 μL of pure water and 75 μL of acetonitrile. HMOs were detected by mass spectrometry using a liquid chromatography (LC) coupled mass spectrometer (SYNAPT XS, Waters) under the following conditions.
[0071] Column: XBridge Glycan BEH Amide Column, 130 Å, 2.5 μm, 2.1 mm x 150 mm, 1K - 150K, 1 / pk Mobile phase A: Acetonitrile, Mobile phase B: 50 mM ammonium formate (pH 4.4) Mobile phase ratio: 0 min: A / B = 75 / 25, 40 min: A / B = 60 / 40, 42.5 min: A / B = 20 / 80, 47.5 min: A / B = 20 / 80, 50 min: A / B = 75 / 25, 55 min: A / B = 75 / 25 Measurement time: 55 min, Flow rate: 0.2 mL / min, Column temperature: 60℃
[0072] Mass spectrometry results were compared between samples recovered from HEK293 cells and samples recovered from LALBA-stable expressing HEK293 cells. The results showed that the samples recovered from LALBA-stable expressing HEK293 cells contained peaks not observed in the samples recovered from HEK293 cells (Figure 3). Structural analysis of these peaks based on mass (m / z), MS / MS results, and glycohydrolase treatment confirmed them to be 3'-sialyllactose (3'-SL), 2'-fucosyllactose (2'-FL), Lacto-sialyl-tetraose d (LST d), and discialyl-lacto-N-tetraose (DSLNT) (Figures 4 and 5).
[0073] Test Example 3. To modify the structure of HMOs produced by HMO-modified cells, B4GALT1 was knocked out (KO) and B3GNT2 was highly expressed.
[0074] <3-1. Construction of LALBA-stable-expressing B4GALT1 knockout cells> LALBA-stable-expressing B4GALT1 knockout cells were constructed by stably expressing pME-Hyg-LALBA-3HA in HEK293-derived B4GALT1-KO cells (Non-Patent Literature 1), similar to the method used in Experimental Examples 1-3.
[0075] <3-2. Construction of B4GALT1 high-expression cells, B3GNT2 high-expression cells, and B3GNT2+B3GALT5 high-expression cells> A cDNA fragment containing the full-length coding sequence of B4GALT1 (SEQ ID NO: 6) was amplified by PCR and introduced into the BamHI-EcoRI site of the pcDNA-BSD-mycHis6 plasmid to obtain pcDNA6-BSD-B4GALT1-mycHis6. pcDNA6-BSD-B4GALT1-mycHis6 (2 μg) was cleaved with the restriction enzyme FspI (NEB) to form a linear plasmid, which was then transfected into HEK293 cells and LALBA stable-expressing HEK293 cells. Cells were selected in DMEM / 10% FBS medium containing 10 μg / mL Blasticidin for more than two weeks to obtain B4GALT1 stable-expressing HEK293 cells and B4GALT1+LALBA stable-expressing HEK293 cells. A cDNA fragment containing the full-length coding sequence of B3GNT2 (SEQ ID NO: 2) was amplified by PCR and introduced into the EcoRI-XhoI site of the pcDNA-BSD-mycHis6 plasmid to obtain pcDNA6-BSD-B3GNT2-mycHis6. 2 μg of pcDNA6-BSD-B3GNT2-mycHis6 was cleaved with the restriction enzyme FspI (NEB) to form a linear plasmid, which was then transfected into LALBA-stable expressing HEK293 cells. The cells were selected in DMEM / 10% FBS medium containing 10 μg / mL Blasticidin for more than two weeks to obtain B3GNT2+LALBA-stable expressing HEK293 cells.
[0076] A cDNA fragment containing the full-length coding sequence of B3GALT5 (SEQ ID NO: 7) was amplified by PCR and introduced into the EcoRI-MluI site of the pME-puro-3FLAG plasmid to obtain pME-puro-B3GALT5-3FLAG. 2 μg of pME-puro-B3GALT5-3FLAG was cleaved with the restriction enzyme FspI (NEB) to form a linear plasmid, which was then transfected into B3GNT2+LALBA stable-expressing HEK293 cells. The cells were selected in DMEM / 10% FBS medium containing 1 μg / mL Puromycin for more than two weeks to obtain B3GALT5+B3GNT2+LALBA stable-expressing HEK293 cells.
[0077] <3-3. Detection of HMO in LALBA-stable expressing B4GALT1-KO cells, B3GNT2-expressing cells, and B3GALT5+B3GNT2-expressing cells> 0.8 x 10⁶ cells in a 6-well plate. 6 HEK293 cells, LALBA-stable expressing HEK293 cells, LALBA-stable expressing B4GALT1-KO cells, and B3GNT2+LALBA-stable expressing HEK293 cells were seeded and cultured for 1 day in DMEM / 10% FBS medium. The following day, the DMEM / 10% FBS medium was removed, washed with warmed PBS, and replaced with 2 mL of warmed Opti-MEM. After culturing for 4 days in a 37°C CO2 incubator, 2 mL of Opti-MEM medium was collected, centrifuged at 4°C and 800 xg for 3 minutes, and the supernatant was collected. The collected HMO was purified as in Test Examples 2-2 and 2-3, labeled with procainamide (ProA), and detected by mass spectrometry (Figure 6A).
[0078] Compared to HEK293 cells that stably express LALBA, LALBA-stably expressing B4GALT1-KO cells showed a decrease in all HMO species (Figure 6B left). On the other hand, HEK293 cells that overexpressed both B4GALT1 and LALBA showed increases of approximately 2.0, 1.4, 3.1, and 8.8 times, respectively, for 2'-FL, 3'-SL, LSTd / a, and LSTc, and total HMO production also increased by approximately 1.5 times (Figure 6B right). Furthermore, when B4GALT1 was overexpressed in HEK293 cells lacking LALBA, although the total HMO production was lower compared to LALBA-expressing cells, 3'-SL production was detected compared to unmodified HEK293 cells, indicating that B4GALT1 overexpression alone can partially support HMO production.
[0079] Next, to clarify the effects of overexpression of specific glycosyltransferase genes on HMO synthesis, we attempted to modify HMO-producing cells. In B3GNT2+LALBA stable expression HEK293 cells, no changes were observed in the levels of 2'-FL and 3'-SL, but the levels of LNTri-II, LNT / LNnT, LSTd / LSTa, LSTc, and DSLNT increased (Figure 6C and D). In particular, the levels of LSTd / LSTa and DSLNT increased by approximately 1.8 times and 2 times, respectively. Furthermore, in B3GALT5+B3GNT2+LALBA stable expression HEK293 cells, DSLNT was detected at levels approximately 7.9 times and 3.7 times higher, respectively, compared to LALBA stable expression HEK293 cells and B3GNT2+LALBA stable expression HEK293 cells (Figure 6C and D). These results demonstrate that by expressing glycosyltransferases in combination, it is possible to reconstruct the HMO biosynthesis pathway in mammalian cells and selectively produce structurally and functionally diverse HMOs.
[0080] Test Example 4. HMO Production in Cultured Cells Other Than HEK293 <4-1. Construction of LALBA-Stable Expression Cells and HMO Production> Similar to Test Examples 1-3, HCT116 cells and Chinese hamster ovary-derived (CHO-K1) cells were transfected with pME-Hyg-LALBA-3HA and selected with 400 μg / mL of hydroxycin to obtain LALBA-stable expression cells. Using these cells, HMO was recovered from the culture medium in the same manner as in Test Example 2 and analyzed using a mass spectrometer.
[0081] Similar to LALBA-stable expressing HEK293 cells, HMO was detected in the culture supernatant of LALBA-stable expressing HCT116 cells and LALBA-stable expressing CHO-K1 cells (Figures 7A and B). This indicates that the technology disclosed herein can be applied not only to HEK293 cells but also to other non-mammary gland-derived mammalian cell lines.
Claims
1. A method for producing human milk oligosaccharides, comprising the step of culturing modified non-mammary gland-derived mammalian cells in which the expression and / or activity of α-lactalbumin is improved by genetic modification or protein introduction.
2. The method for producing a modified non-mammary gland-derived mammalian cell, wherein the modified non-mammary gland-derived mammalian cell is a modified human cell, according to claim 1.
3. The method for producing human milk oligosaccharide according to claim 1 or 2, wherein the human milk oligosaccharide comprises at least one human milk oligosaccharide selected from the group consisting of 2'-fucosyl lactose, 3-fucosyl lactose, sialyl lacto-N-tetraose d, and disialyl lacto-N-tetraose.
4. The method for producing a modified non-mammary gland-derived mammalian cell, wherein the modified non-mammary gland-derived mammalian cell is a kidney-derived cell.
5. The method for producing the modified non-mammary gland-derived mammalian cells, wherein the modified non-mammary gland-derived mammalian cells contain an exogenous polynucleotide sequence including the coding sequence of the α-lactalbumin gene.
6. The method for producing human milk oligosaccharide synthesis-related enzymes downstream of α-lactalbumin in the modified non-mammary gland-derived mammalian cells, wherein the expression and / or activity of these enzymes is altered by gene modification or protein introduction.
7. Modified non-mammary gland mammalian cells in which the expression and / or activity of α-lactalbumin is enhanced by genetic modification or protein introduction.
8. The cell according to claim 7, wherein the modified non-mammary gland derived mammalian cell is a modified human cell.
9. A cell-containing composition comprising the cells and culture medium described in claim 7 or 8.
10. The composition according to claim 9 for use in the production of human milk oligosaccharides.
11. The composition according to claim 9, further comprising lactose and / or human milk oligosaccharides.
12. The composition according to claim 9, comprising disialyllacto-N-tetraose.