Method for detecting gene of interest

WO2026205493A1PCT designated stage Publication Date: 2026-10-01THE UNIV OF TOKYO +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2026/012782
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-03-28
Filing Date
2026-03-27
Publication Date
2026-10-01

Smart Images

  • Figure JPOXMLDOC01-APPB-C000001
    Figure JPOXMLDOC01-APPB-C000001
  • Figure JPOXMLDOC01-APPB-C000002
    Figure JPOXMLDOC01-APPB-C000002
  • Figure JPOXMLDOC01-APPB-C000003
    Figure JPOXMLDOC01-APPB-C000003
Patent Text Reader

Abstract

The present invention addresses the problem of providing a method for detecting a gene of interest, with which it becomes possible to easily detect the presence or absence of a plurality of genes of interest. According to the present invention, a method for detecting a gene of interest is provided, the method comprising: (1) a step in which nucleic acid amplification is performed using a sample that may contain the gene of interest and a set of first primer sets and a set of second primer sets; (2) a step in which first colored particles to which the other of an affinity substance pair is bound and second colored particles to which a protein represented by SEQ ID NO: 37 is bound are added to an amplification product obtained in step (1), thereby coloring the amplification product; and (3) a step in which the amplification product that has been colored in step (2) is developed on a solid carrier and the first colored particles and the second colored particles are detected, thereby detecting the presence or absence of the gene of interest.
Need to check novelty before this filing date? Find Prior Art

Description

Method for detecting the target gene

[0001] This invention relates to a method for detecting a target gene. Furthermore, this invention relates to a combination of primer sets for detecting papillomavirus.

[0002] Nucleic acid chromatography is a known method for detecting target genes. In nucleic acid chromatography, a probe that binds to the target gene is immobilized on a chromatography support, and the colored product of the amplification of the target gene is spread. The target gene is then detected based on the presence or absence of coloration.

[0003] The present invention aims to provide a method for detecting target genes that can easily detect the presence or absence of multiple target genes. Furthermore, the present invention aims to provide a combination of primer sets for detecting papillomaviruses.

[0004] The present invention provides the following: <1> (1) A step of amplifying a target gene by performing nucleic acid amplification using a sample that may contain a target gene, a first set of primers comprising at least one set of primers, and a second set of primers comprising at least one set of primers, wherein the primers of the first set of primers are labeled with one of an affinity substance pair, and the primers of the second set of primers are labeled with a compound represented by the following formula (1); (In the formula, X1a, X1b, X2a, and X2b each independently represent O or NH, and Y 1 and Y 2 Each independently represents either C or S, and Z 1 and Z 2 Each of these independently represents O, S, or NH, and V 1 and V 2 Each is independently S or S + -O -A method for detecting a target gene, comprising: (2) adding a first colored particle to which the other of the affinity substance pair is bound, and a second colored particle to which the protein shown in Sequence ID No. 37 is bound, to the amplification product obtained in step (1) to color the amplification product; and (3) developing the colored amplification product obtained in step (2) on a solid support and detecting the presence or absence of the target gene by detecting the first colored particle and the second colored particle. <2> The method for detecting a target gene according to <1>, wherein one of the affinity substance pair is biotin and the other of the affinity substance pair is streptavidin. <3> The method for detecting a target gene according to <1>, wherein the target gene is a papillomavirus gene. <4> The method for detecting the target gene described in <3>, wherein the first set of primers is a set of primers for detecting HPV16, HPV39, HPV68, HPV51, HPV59, HPV53, HPV56, and HPV66, and the second set of primers is a set of primers for detecting HPV18, HPV31, HPV33, HPV52, HPV58, and HPV45.<5> The method for detecting the target gene described in <4>, wherein the primer set for detecting HPV16 is sequence number 15 and sequence number 16, the primer set for detecting HPV18 is sequence number 17 and sequence number 18, the primer set for detecting HPV31 is sequence number 19 and sequence number 20, the primer set for detecting HPV33, HPV52, and HPV58 is sequence number 21 and sequence number 22, the primer set for detecting HPV39 is sequence number 23 and sequence number 24, the primer set for detecting HPV68 is sequence number 23 and sequence number 25, the primer set for detecting HPV45 is sequence number 26 and sequence number 27, the primer set for detecting HPV51 is sequence number 28 and sequence number 29, the primer set for detecting HPV59 is sequence number 30 and sequence number 31, and the primer set for detecting HPV53, HPV56, and HPV66 is sequence number 32 and sequence number 33. <6> The method for detecting the target gene described in <5>, wherein the primer set of Sequence ID No. 34 and Sequence ID No. 35 is used as the primer set for internal control.<7> A primer set for detecting HPV16 represented by SEQ ID NO: 15 and SEQ ID NO: 16; a primer set for detecting HPV18 represented by SEQ ID NO: 17 and SEQ ID NO: 18; a primer set for detecting HPV31 represented by SEQ ID NO: 19 and SEQ ID NO: 20; a primer set for detecting HPV33, HPV52 and HPV58 represented by SEQ ID NO: 21 and SEQ ID NO: 22; a primer set for detecting HPV39 represented by SEQ ID NO: 23 and SEQ ID NO: 24; a primer set for detecting HPV68 represented by SEQ ID NO: 23 and SEQ ID NO: 25; a primer set for detecting HPV45 represented by SEQ ID NO: 26 and SEQ ID NO: 27; a primer set for detecting HPV51 represented by SEQ ID NO: 28 and SEQ ID NO: 29; a primer set for detecting HPV59 represented by SEQ ID NO: 30 and SEQ ID NO: 31; and a primer set for detecting HPV53, HPV56 and HPV66 represented by SEQ ID NO: 32 and SEQ ID NO: 33: A combination of primer sets for detecting papillomavirus, comprising at least one or more primer sets among the above. <8> The combination of primer sets for detecting papillomavirus according to <7>, wherein one primer included in a part of the primer sets is labeled with one of an affinity substance pair, the other primer is labeled with a tag, one primer included in the remaining part of the primer sets is labeled with the compound represented by formula (1) described in <1>, and the other primer is labeled with a tag.

[0005] According to the present invention, the presence or absence of a plurality of target genes can be easily detected. According to the present invention, in particular, the presence or absence of a papillomavirus genotype can be easily detected.

[0006] Figure 1 is a flowchart showing the acquisition of primers for multiplex PCR for HPV subgenotyping. Figure 2 shows the results of subgenotyping of high-risk HPV by combining the multiplex PCR method and two-color nucleic acid chromatography.

[0007] Hereinafter, the present invention will be described more specifically. The method for detecting a target gene of the present invention comprises the step of: (1) performing nucleic acid amplification using a sample that may contain the target gene, a first primer set group comprising at least one or more primer sets, and a second primer set group comprising at least one or more primer sets to amplify the target gene, wherein the primer of the first primer set is labeled with one member of an affinity substance pair, and the primer of the second primer set is labeled with a compound represented by the following formula (1); (wherein X1a, X1b, X2a and X2b each independently represent O or NH, Y 1 and Y 2 each independently represent C or S, Z 1 and Z 2 each independently represent O, S or NH, V 1 and V 2 each independently represent S or S + -O - , n1 and n2 each independently represent an integer of 0 or 1, m1 and m2 each independently represent an integer of 1 to 10, and L represents a linking group.) (2) adding first colored particles bound with the other member of the affinity substance pair and second colored particles bound with the protein represented by SEQ ID NO: 37 to the amplification product obtained in step (1) to stain the amplification product; and (3) developing the stained amplification product obtained in step (2) on a solid phase carrier, and detecting the first colored particles and the second colored particles to detect the presence or absence of the target gene.

[0008] The target gene is a gene comprising a target sequence to be detected. The origin of the target gene is not particularly limited, and examples thereof include various biological materials (tissues, organs, excreta, body fluids, etc. of an individual). As the sample that may contain the target gene, a biological material itself that may contain the target gene may be used, or a nucleic acid extraction sample obtained by removing part or all of components other than nucleic acids from the above biological material may be used.

[0009] The type of target gene is not particularly limited, and any gene can be detected. An example of a target gene is a papillomavirus gene. There are numerous genotypes of papillomavirus genes. In the present invention, the presence or absence of a genotype of a papillomavirus gene can be detected. For example, the presence or absence of HPV16, HPV39, HPV68, HPV51, HPV59, HPV53, HPV56, HPV66, or the presence or absence of HPV18, HPV31, HPV33, HPV52, HPV58, HPV45 can be detected.

[0010] The primer pairs constituting the primer set preferably satisfy the following conditions. The base length of the target nucleic acid obtained as an amplification product by the primer set is not particularly limited, and may be, for example, 80 bases or more and 300 bases or less, or 100 bases or more and 250 bases or less.

[0011] The length of each primer constituting the primer set is not particularly limited, and may be 15 bases or more and 50 bases or less, or 20 bases or more and 30 bases or less.

[0012] The melting temperature (Tm) of each primer in the primer set is not particularly limited, and may be, for example, 45°C or higher and 65°C or lower.

[0013] Either one of the primers of the primer set is labeled with one of a pair of affinity substances, or is labeled with a compound represented by formula (1). The other primer of the primer set is preferably labeled with a tag for capture on a nucleic acid chromatographic carrier. The tag preferably has 15 to 50 bases, more preferably 15 to 25 bases.

[0014] In the present invention, a first primer set group including at least one or more primer sets and a second primer set group including at least one or more primer sets are used. The primers of the first primer set are labeled with one of a pair of affinity substances, and the primers of the second primer set are labeled with the compound represented by formula (1).

[0015] Examples of affinity substance pairs include biotin and streptavidin, digoxigenin and anti-digoxigenin antibody, and FITC and anti-FITC antibody. The affinity substance pair may also be an oligonucleotide that is mutually hybridizable. A preferred affinity substance pair is biotin and streptavidin.

[0016] In one example of the present invention, the first set of primers is a set of primers for detecting HPV16, HPV39, HPV68, HPV51, HPV59, HPV53, HPV56, and HPV66, and the second set of primers is a set of primers for detecting HPV18, HPV31, HPV33, HPV52, HPV58, and HPV45.

[0017] In one example of the present invention, the primer set for detecting HPV16 is sequence number 15 and sequence number 16, the primer set for detecting HPV18 is sequence number 17 and sequence number 18, the primer set for detecting HPV31 is sequence number 19 and sequence number 20, the primer set for detecting HPV33, HPV52, and HPV58 is sequence number 21 and sequence number 22, the primer set for detecting HPV39 is sequence number 23 and sequence number 24, the primer set for detecting HPV68 is sequence number 23 and sequence number 25, the primer set for detecting HPV45 is sequence number 26 and sequence number 27, the primer set for detecting HPV51 is sequence number 28 and sequence number 29, the primer set for detecting HPV59 is sequence number 30 and sequence number 31, and the primer set for detecting HPV53, HPV56, and HPV66 is sequence number 32 and sequence number 33.

[0018] In this invention, in addition to the primer set for detecting HPV described above, the primer sets of Sequence ID No. 34 and Sequence ID No. 35 may be used as an internal control primer set.

[0019] In the present invention, the primers of the second primer set are labeled with the compound shown in formula (1) below. (In the formula, X1a, X1b, X2a, and X2b each independently represent O or NH, and Y 1 and Y 2 Each independently represents either C or S, and Z 1 and Z 2 Each of these independently represents O, S, or NH, and V 1 and V 2 Each is independently S or S + -O - (This indicates that n1 and n2 each independently represent integers of 0 or 1, m1 and m2 each independently represent integers from 1 to 10, and L represents a linking group.)

[0020] The compound represented by formula (1) is described in International Publication WO2015 / 125820. All contents of International Publication WO2015 / 125820 shall be incorporated into this specification.

[0021] The compound represented by formula (1) is preferably the compound represented by formula (2). (In the formula, X1a, X1b, X2a, and X2b each independently represent O or NH, and Y 1 and Y 2 Each independently represents either C or S, and Z 1 and Z 2 Each of these independently represents O, S, or NH, and V 1 and V 2 Each is independently S or S + -O - (This indicates that n1 and n2 each independently represent integers of 0 or 1, m1 and m2 each independently represent integers from 1 to 10, and L represents a linking group.)

[0022] In equations (1) and (2), the following structure: The portion indicated by is preferably, It is one of these, but is not limited to these.

[0023] m1 and m2 represent integers from 1 to 10, preferably integers from 2 to 10, more preferably integers from 2 to 8, and more preferably integers from 2 to 6.

[0024] L is preferably a linking group consisting of -CONH-, -NHCO-, -O-, an alkylene group having 1 to 10 carbon atoms, a phenylene group which may have a substituent, or a combination thereof. More preferably, L is -CONH-(CH 2 ) p -CONH-(CH 2 ) q -O-(CH 2 ) r - NHKCO - (CH 2 ) s -NH-CO-, -CONH-(CH 2 ) p -CONH-(CH 2 ) q - NHKCO - (CH 2 ) s -NH-CO-, -CONH-(CH 2 ) p -CONH- (phenylene group which may have substituents)-NHCO-(CH 2 ) s -NH-CO-, -CONH-CH(COOCH 3 )-(CH 2 ) p -NHCO- (phenylene group which may have substituents)-CONH-(CH 2 ) s -CH (COOCH) 3 )-NH-CO-, or-CONH-(CH 2 ) p -O-(CH 2 ) t -NHCO- (phenylene group which may have substituents)-CONH- (CH 2 ) s -O-(CH 2 ) u The formula is -NH-CO- (wherein p, q, r, s, t, and u each independently represent an integer from 1 to 10). More preferably, p, q, r, and s each independently represent an integer from 2 to 8, more preferably an integer from 2 to 6. More preferably, t and u each independently represent an integer from 1 to 4. Substituents on the phenylene group include -COOH and -CONH 2 , optionally substituted amide group, -CO-NH2 These are some examples, and they may also have a reactive group at their terminal end.

[0025] In one example of the present invention, the 5' ends of SEQ ID NOs: 15, 23, 28, 30, and 32 can be labeled with biotin, and SEQ ID NOs: 17, 19, 21, 26, and 34 can be labeled with a compound represented by formula (1) (for example, Psyche in the examples described below). In addition, SEQ ID NOs: 16, 18, 20, 22, 24, 25, 27, 29, 31, and 33 can be labeled with a tag (a tag for capture on a nucleic acid chromatograph support).

[0026] In step (1) of the present invention, nucleic acid amplification is performed using a sample that may contain the target gene and the first set of primers and the second set of primers described above.

[0027] The nucleic acid amplification method is not particularly limited, and any of the following methods may be used: PCR, LCR, SDA, LAMP, ICAN, RCA, RPA, etc. Preferably, the nucleic acid amplification method is PCR.

[0028] Amplification reactions can be carried out on samples potentially containing the target gene using the primer set described above, as well as DNA polymerase and various nucleotide triphosphates (dNTPs). Nucleic acid amplification reactions are generally carried out by repeating a cycle consisting of thermal denaturation, annealing, and extension reactions 15 to 100 times, for example, 20 to 50 times. This allows for the acquisition of the amplified product.

[0029] Those skilled in the art can set appropriate conditions for the thermal denaturation, annealing, and extension reactions. For example, thermal denaturation can be performed at 90°C to 99°C, annealing at approximately ±6°C of the primer's dissolution temperature, and the extension reaction at around 72°C, although this depends on the temperature characteristics of the DNA polymerase used.

[0030] In step (2) of the present invention, the amplification product obtained in step (1) is colored by adding a first colored particle to which the other of the affinity substance pair is bound, and a second colored particle to which the protein indicated by SEQ ID NO: 37 is bound.

[0031] SEQ ID NO: 37 (Cupid): Ala Glu Ala Gly Ile Thr Gly Thr Trp Ser Asp Gln Leu Gly Asp Thr Phe Ile Val Thr Ala Gly Ala Asp Gly Ala Leu Thr Gly Thr Tyr Glu Asn Ala Val Gly Gly Ala Glu Ser Arg Tyr Val Leu Thr Gly Arg Tyr Asp Ser Ala Pro Ala Thr Asp Gly Ser Gly Thr Ala Leu Gly Trp Thr Val Ala Trp Lys Asn Asn Ser Lys Asn Ala His Ser Ala Thr Thr Trp Ser Gly Gln Tyr Val Gly Gly Ala Asp Ala Lys Ile Asn Thr Gln Trp Leu Leu Thr Ser Gly Thr Thr Asn Ala Asn Ala Trp Lys Ser Thr Leu Val Gly His Asp Thr Phe Thr Lys Val Lys Pro Ser Ala Ala Ser

[0032] The protein represented by Sequence ID No. 37 is described as Sequence ID No. 4 in International Publication No. WO2015 / 125820. All contents of International Publication No. WO2015 / 125820 are incorporated into this specification.

[0033] The colored particles contain a coloring substance. Preferably, the coloring substance is a substance that can produce a signal visible to the naked eye without requiring other components. This allows the detection process to be carried out quickly and easily. Examples of coloring substances include various pigments and dyes, various metals or alloys such as gold, silver, and copper, or organic compounds (or complex compounds) containing the above metals. The coloring substance may also be an inorganic compound (e.g., mica).

[0034] The colored particles may be latex particles, or colloids or sols containing gold colloid or sol, or silver colloid or sol.

[0035] The average particle size of colored particles such as latex particles is not particularly limited, but may be, for example, 20 nm to 20 μm, 40 nm to 10 μm, 0.1 μm to 10 μm, 0.1 μm to 5 μm, or 0.15 μm to 2 μm.

[0036] The colored particles are preferably made of an insoluble polymer material that can be suspended in an aqueous solution. Examples include polyethylene, polystyrene, styrene-styrene sulfonate copolymer, acrylic acid polymer, methacrylic acid polymer, acrylonitrile polymer, acrylonitrile-butadiene-styrene, polyvinyl acetate-acrylate, polyvinylpyrrolidone, or vinyl chloride-acrylate.

[0037] In step (3) of the present invention, the colored amplification product obtained in step (2) is spread on a solid support, and the presence or absence of the target gene is detected by detecting the first colored particles and the second colored particles.

[0038] Step (3) can be performed using a target gene detection device that includes a solid-phase support. The target gene detection device includes a solid-phase support that holds an oligonucleotide probe (an oligonucleotide probe that can hybridize with a tag labeled on the primer) for capturing the amplification product. The target gene detection device will be described later.

[0039] The developing solution is applied to the end of the solid support, and the oligonucleotide probes are immobilized parallel to each other in a line at a certain distance from this end, corresponding to each target nucleic acid. When detecting multiple target genes simultaneously, positional markers may be placed on the solid support to easily identify the probe region corresponding to each target gene. The presence of positional markers allows for easy detection of the presence or absence of target nucleic acids, even in visual detection.

[0040] The test solution containing the colored amplification product is applied to the solid support by immersing its ends in the test solution or through the sample port. The test solution applied to the solid support is then dispersed within the porous material by capillary action.

[0041] The test solution preferably contains a medium to facilitate the development of the amplification product in the solid support. Examples of the medium include, but are not limited to, water, an organic solvent, or a mixture of water and an organic solvent. Examples of organic solvents include C1-C4 alcohols, esters such as DMSO, DMF, methyl acetate, and ethyl acetate, and ketones such as acetone.

[0042] The medium may contain a buffering component. The pH of the medium is preferably between 6.0 and 8.0. As the buffering component, acetate buffer, citrate buffer, phosphate buffer, etc., can be used, and phosphate-buffered saline (PBS) may also be used. The amplification reaction solution may be used as is as the medium.

[0043] Amplified products containing tags are captured by oligonucleotide probes complementary to the tags as they are deployed on a solid support, resulting in color development by a coloring substance. This allows for the visual detection of target genes by observing the color development of lines immobilized with oligonucleotide probes complementary to the tags.

[0044] According to the present invention, a kit for detecting a target gene using the method for detecting the target gene of the present invention can be provided. The kit includes at least one of the following primer sets: a primer set for detecting HPV16, indicated by SEQ ID NOs. 15 and 16; a primer set for detecting HPV18, indicated by SEQ ID NOs. 17 and 18; a primer set for detecting HPV31, indicated by SEQ ID NOs. 19 and 20; a primer set for detecting HPV33, HPV52, and HPV58, indicated by SEQ ID NOs. 21 and 22; a primer set for detecting HPV39, indicated by SEQ ID NOs. 23 and 24; a primer set for detecting HPV68, indicated by SEQ ID NOs. 23 and 25; a primer set for detecting HPV45, indicated by SEQ ID NOs. 26 and 27; a primer set for detecting HPV51, indicated by SEQ ID NOs. 28 and 29; a primer set for detecting HPV59, indicated by SEQ ID NOs. 30 and 31; and a primer set for detecting HPV53, HPV56, and HPV66, indicated by SEQ ID NOs. 32 and 33. The primer set includes a portion of the above primer set in which one primer is labeled with one affinity substance pair and the other primer is labeled with a tag, and the remaining portion of the above primer set in which one primer is labeled with the compound shown in formula (1) and the other primer is labeled with a tag.

[0045] The kit may further include a device for detecting the target gene. The device for detecting the target gene includes a solid support that holds an oligonucleotide probe (an oligonucleotide probe that can hybridize with a tag labeled on the primer) for capturing the amplification product.

[0046] The solid phase support may be plastic or glass, and the material is not particularly limited. Examples of solid phase supports include so-called porous materials mainly composed of polymers such as polyethersulfone, nitrocellulose, nylon, and polyvinylidene fluoride. Cellulose-based materials such as filter paper can also be preferably used. The solid phase support may consist of a porous material (porous sheet) and a backing member that supports it. The backing member is preferably made of a water-impermeable material.

[0047] The shape of the solid phase support can be designed as appropriate and is not particularly limited, but for example, it is flat. The size of the solid phase support is not particularly limited, but for example, it has a flat surface area of ​​150 mm². 2 The following conditions apply: the aspect ratio is between 1.5 and 20, and the thickness is between 0.01 mm and 0.3 mm.

[0048] The length of the oligonucleotide probe is not particularly limited, but is preferably 15 to 50 bases, and more preferably 15 to 25 bases.

[0049] Oligonucleotide probes can be immobilized on a solid support by methods known to those skilled in the art. For example, the oligonucleotide probe and the solid support may be immobilized by covalent bonding, with a linker interposed as needed. The oligonucleotide probe may also be immobilized by electrostatic interaction between the oligonucleotide probe and the solid support. Alternatively, immobilization may be achieved by electrostatic interaction between the oligonucleotide probe and the solid support, and further covalent bonding may be induced by ultraviolet light or other means.

[0050] The device for detecting the target gene may include a covering member to maintain airtightness.

[0051] The kit may include other reagents as needed. These other reagents may include, for example, reagents for amplifying the target gene (DNA polymerase, dNTPs, etc.), and positive and negative control samples of the target gene (template nucleic acid).

[0052] The present invention will be specifically described by the following examples, but the present invention is not limited by these examples.

[0053] Synthesis example: Synthesis of Psyche-maleimido

[0054] N1,N1'-(5-((2-(6-(2,5-dioxo-2,5-dihydro-1H-pyrrole-1-yl)hexaneamide)ethoxy)ethyl)carbamoyl)-1.3-phenylene)bis(N7-(4-((3aS,4S,6aR)-2-iminohexahydro-1H-thieno[3,4-d]imidazole-4-yl)butyl)heptanediamide)trifluoroacetate (2)

[0055] To a solution of compound 1 (7.2 mg, 5.53 μmol) in 50 mM phosphate buffer (300 μL), N-Succinimidyl 6-Maleimidohexanoate (2.1 mg, 6.81 μmol) was added in DMF (300 μL) dissolved in it. The mixture was stirred at room temperature under an argon atmosphere for 40 minutes, azeotropic reaction was performed by adding ethanol, and the solvent was removed under reduced pressure. The resulting crude product was purified by reverse-phase HPLC (gradient: 0% for 5 min; 2-100% for 90 min, CH3CN in 0.1% CF3COOH aqueous solution, retention time: 41.5 min, YMC-Triart C18, flow rate = 3.5 ml / min) to obtain target compound 2 (5.2 mg, yield 68%).

[0056] 1H NMR (500 MHz, CD3OD) δ1.18-1.82 (m, 30H), 2.13 (t, 2H, J = 7.4 Hz), 2.20 (t, 4H, J = 7.4 Hz), 2.39 (t, 4H, J= 7.4 Hz), 2.80 (d, 2H, J =13.2 Hz), 2.97 (dd, 2H, J = 5.2 Hz, 13.2 Hz), 3.01-3.39 (m, 8H), 3.45 (t, 2H, J = 7.4 Hz), 3.48-3.70 (m, 10H), 4.50 (dd, 2H, J =4.6 Hz, 8.0 Hz), 4.70 (dd, 2H, J = 4.6 Hz, 8.0 Hz), 6.77(s, 1H), 7.71 (d, 2H, J = 1.7 Hz), 7.98-8.02 (m, 1H) LRMS (ESI): m / z 576.94 [M+2H] 2+ .

[0057] Preparation of Psyche Oligosaccharides Deprotection of Thiolated Nucleotides [Representative Example] The deprotection reaction of thiolated nucleotides (commissioned synthesis by Eurofins Genomics, Inc.) was carried out according to the attached instructions (Reference 2). Dry DNA oligosaccharides (15 nmol) were dissolved in 0.1 M DTT (dithiothreitol) aqueous solution (500 μL), left at room temperature for 30 minutes, and then diluted with purified water (500 μL). The resulting crude product was purified by silica gel column chromatography (2 M TEAA aqueous solution → 5% CH3CN / 0.1 M TEAA aqueous solution → purified water → 30% CH3CN aqueous solution) using a reversed-phase column (Waters, Sep-Pak Cartridge) to obtain a solution of thiolated nucleotides. After freeze-drying and removal of the solvent under reduced pressure, it was used for the conjugate reaction with Psyche. Other thiolated nucleotides were deprotected and purified in the same manner. Conjugate Addition Reaction of Thiolated Nucleotides and Psyche

[0058] [Synthesis Example 1]

[0059] DNA-Oligo 3 (SEQ ID NO: 21, 68.9 μg, 6.26 nmol) was dissolved in purified water (39 μL), and a 4 mM methanol solution of Compound 2 (15.5 μL, 61.8 nmol), a 1 M aqueous solution of NH4HCO3 (4.3 μL), and a 20 mM aqueous solution of TCEP (Tris(2-carboxyethyl)phosphine Hydrochloride) (3.1 μL, 61.8 nmol) were added. The mixture was incubated at 37°C for 2 hours. After returning to room temperature, a 4 mM methanol solution of Compound 2 (7.8 μL, 31.2 nmol) and a 20 mM aqueous solution of TCEP (1.6 μL, 32 nmol) were added. The mixture was allowed to stand at room temperature for 25.5 hours. The resulting reaction solution was then subjected to size exclusion chromatography (GE Healthcare: PD SpinTrap™ G-25) to remove unreacted Psyche and TCEP. Psyche conjugate 4 was eluted with purified water as a mixture with unreacted DNA oligonucleotides, and the solvent was removed under reduced pressure by freeze-drying. The resulting product 4 was diluted with purified water, and the nucleic acid concentration was measured using nanodrops (1282.6 ng / μL, 35 μL). Considering the proportion of the conjugates from the mass spectrometry results, the molar concentration of the conjugates was determined to be 55.4 μM (yield 31%). LRMS (ESI): m / z 2449.93 [M-5H] 5-

[0060] [Synthesis Example 2]

[0061] DNA-Oligo 5 (SEQ ID NO: 15, 120.2 μg, 10.5 nmol) was dissolved in purified water (65.4 μL), and a 4 mM methanol solution of Compound 2 (26 μL, 104 nmol), a 1 M aqueous solution of NH4HCO3 (7.4 μL), and a 20 mM aqueous solution of TCEP (5.2 μL, 104 nmol) were added. The mixture was incubated at 37°C for 2 hours. After returning to room temperature, it was allowed to stand for 1 hour. A 4 mM methanol solution of Compound 2 (13 μL, 52 nmol) and a 20 mM aqueous solution of TCEP (5.2 μL, 104 nmol) were added, and the mixture was allowed to stand at room temperature for 24 hours. The resulting reaction solution was then subjected to size exclusion chromatography (GE Healthcare: PD SpinTrap™ G-25) to remove unreacted Psyche and TCEP. Psyche conjugate 6 was eluted with purified water as a mixture with unreacted DNA oligonucleotides, and the solvent was removed under reduced pressure by freeze-drying. The resulting product 6 was diluted with purified water, and the nucleic acid concentration was measured using nanodrops (860.8 ng / μL, 50 μL solution). Based on the results of mass spectrometry, considering the proportion of the conjugate, the molar concentration of the conjugate was determined to be 35.9 μM (yield 17%). LRMS (ESI): m / z 2116.25 [M-6H] 6-

[0062] [Synthesis Example 3]

[0063] DNA-Oligo 7 (SEQ ID NO: 17, 104.4 μg, 10.3 nmol) was dissolved in purified water (63.5 μL), and a 4 mM methanol solution of Compound 2 (25.3 μL, 101 nmol), a 1 M aqueous solution of NH4HCO3 (7.1 μL), and a 20 mM aqueous solution of TCEP (5.1 μL, 101 nmol) were added. The mixture was incubated at 37°C for 2 hours. After returning to room temperature and standing for 2 hours, a 4 mM methanol solution of Compound 2 (12.6 μL, 50.4 nmol) and a 20 mM aqueous solution of TCEP (2.55 μL, 51 nmol) were added. After standing at room temperature for 23 hours, the resulting reaction solution was subjected to size exclusion chromatography (GE Healthcare: PD SpinTrap™ G-25) to remove unreacted Psyche and TCEP. Psyche conjugate 8 was eluted with purified water as a mixture with unreacted DNA oligonucleotides, and the solvent was removed under reduced pressure by freeze-drying. The resulting product 8 was diluted with purified water, and the nucleic acid concentration was measured using nanodrops (643.9 ng / μL, 40 μL solution). Based on the results of mass spectrometry, considering the proportion of the conjugate, the molar concentration of the conjugate was determined to be 29.9 μM (yield 12%). LRMS (ESI): m / z 2290.93 [M-5H] 5-

[0064] [Synthesis Example 4]

[0065] DNA-oligo-9 (SEQ ID NO: 19, 124.8 μg, 12.3 nmol) was dissolved in purified water (76.2 μL), and a 4 mM methanol solution of compound 2 (30.3 μL, 121 nmol), a 1 M aqueous solution of NH4HCO3 (8.5 μL), and a 20 mM aqueous solution of TCEP (6.1 μL, 121 nmol) were added. The mixture was incubated at 37°C for 2 hours. After returning to room temperature and standing for 1 hour and 45 minutes, a 4 mM methanol solution of compound 2 (6.1 μL, 24.4 nmol) and a 20 mM aqueous solution of TCEP (6.1 μL, 121 nmol) were added, and the mixture was left to stand at room temperature for 25 hours. A 20 mM aqueous solution of TCEP (3.0 μL, 120 nmol) was added, and the mixture was left to stand at room temperature for 24 hours. The resulting reaction solution was subjected to size exclusion chromatography (GE Healthcare: PD SpinTrap™ G-25) to remove unreacted Psyche and TCEP. Psyche conjugate 10 was eluted with purified water as a mixture with unreacted DNA-oligonucleotides, and the solvent was removed under reduced pressure by lyophilization. The resulting product 10 was diluted with purified water, and the nucleic acid concentration was measured using nanodrops (1202 ng / μL, 20 μL). Considering the proportion of the conjugates based on the mass spectrometry results, the molar concentration of the conjugates was determined to be 56 μM (yield 9%). LRMS (ESI): m / z 2293.75 [M-5H] 5-

[0066] [Synthesis Example 5]

[0067] DNA-oligo-11 (SEQ ID NO: 26, 96.6 μg, 9.46 nmol) was dissolved in purified water (58.8 μL), and a 4 mM methanol solution of compound 2 (23.4 μL, 93.6 nmol), a 1 M aqueous solution of NH4HCO3 (6.5 μL), and a 20 mM aqueous solution of TCEP (4.7 μL, 94 nmol) were added. The mixture was incubated at 37°C for 2 hours. After returning to room temperature, a 4 mM methanol solution of compound 2 (11.7 μL, 46.8 nmol) and a 20 mM aqueous solution of TCEP (2.4 μL, 48 nmol) were added, and the mixture was allowed to stand at room temperature for 21.5 hours. The resulting reaction solution was subjected to size exclusion chromatography (GE Healthcare: PD SpinTrap™ G-25) to remove unreacted Psyche and TCEP. Psyche conjugate 12 was eluted with purified water as a mixture with unreacted DNA oligonucleotides, and the solvent was removed under reduced pressure by freeze-drying. The resulting product 12 was diluted with purified water, and the nucleic acid concentration was measured using nanodrops (953.8 ng / μL, 33.5 μL). Based on the results of mass spectrometry, considering the proportion of the conjugate, the molar concentration of the conjugate was determined to be 44.1 μM (yield 16%). LRMS (ESI): m / z 2302.71 [M-5H] 5-

[0068] [Example 6]

[0069] DNA-oligo-12 (SEQ ID NO: 34, 89.2 μg, 8.64 nmol) was dissolved in purified water (53.7 μL), and a 4 mM methanol solution of compound 2 (21.3 μL, 85.2 nmol), a 1 M aqueous solution of NH4HCO3 (6.0 μL), and a 20 mM aqueous solution of TCEP (4.3 μL, 86.0 nmol) were added. The mixture was incubated at 37°C for 2 hours. After returning to room temperature, a 4 mM methanol solution of compound 2 (10.7 μL, 42.8 nmol) and a 20 mM aqueous solution of TCEP (2.2 μL, 44 nmol) were added, and the mixture was allowed to stand at room temperature for 24 hours. The resulting reaction solution was subjected to size exclusion chromatography (GE Healthcare: PD SpinTrap™ G-25) to remove unreacted Psyche and TCEP. Psyche conjugate 13 was eluted with purified water as a mixture with unreacted DNA oligonucleotides, and the solvent was removed under reduced pressure by freeze-drying. The resulting product 13 was diluted with purified water, and the nucleic acid concentration was measured using nanodrops (805.7 ng / μL, 32 μL). Based on the results of mass spectrometry, considering the proportion of the conjugate, the molar concentration of the conjugate was determined to be 37 μM (yield 14%). LRMS (ESI): m / z 2321.50 [M-5H] 5-

[0070] References (Reference 1) Tatsumi, T.; Zhao, S.; Kasahara, A.; Aoki, M.; Nishijima, K.; Ukon, N.; Kodama, T.; Takahashi, K.; Sugiyama, A.; Washiyama, K.; Yamatsugu, K.; Kanai, M. Bioorg. Med. Chem. Lett. 2024, 108, 129803. (Reference 2) https: / / eurofinsgenomics.jp / media / 29261 / sh%E8%84%B1%E4%BF%9D%E8%AD%B7%E6%96%B9%E6%B3%95%E8%AA%AC%E6%98%8E%E6%9B%B8.pdf

[0071] Example 1: Coating of colored latex particles: Red latex particles (Polybead Carboxylate Dyed Microspheres, 0.30 μm, Red (2.5% Solid-Latex, Polyscience Co., Ltd.)) and blue latex particles (Blue Latex 5.1 w / w %, 0.3 μm (Fujikura Chemical Co., Ltd.)) were coated with Streptavidin or Cupid protein as follows.

[0072] The Cupid protein is the protein shown in Sequence ID No. 37, and is described as Sequence ID No. 4 in International Publication WO2015 / 125820.

[0073] To a latex particle suspension (5 mg particles / mL) diluted to 0.5% with reaction buffer (20 mM HEPES (pH 7.0)), 300 μL of condensing agent WSC (Dojin Chemical Laboratory, 1 mg / mL reaction buffer) was added per 1 mL, and the mixture was mixed at room temperature (~22°C) for 20 minutes.

[0074] 85.6 μg of Streptavidin (4 mg / mL (Tokyo Chemical)) was added per 1 mg of red latex particles, and 25.6 μg of Cupid protein (4 mg / mL) was added per 1 mg of blue latex particles. The mixture was then mixed at room temperature for 1 hour to bind each protein to the surface of the latex particles.

[0075] After the reaction, 1 / 100 volume of 10% Tween 20 surfactant was added to the solution, and the physically adsorbed proteins were released by sonication. The latex particles were then recovered as a precipitate by centrifugation at 20,000 xg for 20 minutes.

[0076] The latex particles obtained as precipitate were mixed with a blocking solution of 1% BSA in a volume more than twice the original reaction volume. After redispersion by sonication, the mixture was mixed at room temperature for 1 hour to block the precipitate. The latex particles were recovered as precipitate by centrifugation at 20,000 xg for 20 minutes and dispersed in storage buffer (20 mM HEPES (pH 7.0), 0.1% BSA) by sonication to obtain a 0.5% Streptavidin or Cupid-coated latex particle suspension.

[0077] Example 2: Fifteen genotypes of high-risk human papillomavirus (HPV) that cause cervical cancer are known. In this invention, by combining multiplex PCR and two-color nucleic acid chromatography, 14 high-risk HPV types, excluding HPV35, can be detected by dividing them into eight groups, enabling subgenotyping.

[0078] High-risk HPVs can be classified phylogenetically into groups A6, A7, A9, and other groups based on their genome sequences. HPVs belonging to group A6 are HPV53, HPV56, and HPV66. HPVs belonging to group A7 are HPV18, HPV39, HPV45, HPV59, and HPV68. HPVs belonging to group A9 are HPV16, HPV31, HPV33, HPV35, HPV52, and HPV58. There is also HPV51 in the "other" category.

[0079] Of these, we commissioned Eurofins Genomics Co., Ltd. to synthesize synthetic genes by incorporating approximately 400 base pairs of the E7 gene portion of each HPV (excluding HPV35) into pUC plasmids, and used them as DNA templates during PCR for each HPV genotype. The sequences of each synthesized gene are shown below.

[0080] <Sequence ID 1> Reference sequence derived from HPV16 E7 gene region GenBank accession number KU053830 AGATACACCTACATTGCATGAATATATGTTAGATTTGCAACCAGAGACAACTGATCTCTACTGTTATGAGCAATTAAATGACAGCTCAGAGGAGGAGGATGAAATAGATGGTCCAGCTGGACAAGCAGAACCGGACAGAGCCCATTACAATATTGTAACCTTTTGTTGCAAGTGTGACTCTACGCTTCGGTTGTGCGTACAAAGCACACACGTAGACATTCGTGTTTGGAAGACCTGTTAATGGGCACACTAGGAATTGTGTGTGCCCCATCTGTTCTCAGAAACCATAATCTACCATGGCTGATCCTGCAGGTACCAATGGGGAAGAGGGTACGGGATGTAATGGATGGTTTTATGTAGAGGCTGTAGTGGAAATTAAAACAGGGGATGCTATATCAGATG

[0081] <Sequence No. 2> Reference sequence derived from the HPV18 E7 gene region GenBank Accession number LC636309 AAGGCAACATTGCAAGACATTGTATTGCATTTAGAGCCCCAAAATGAAATTCCGGTTGACCTTCTATGTCACGAGCAATTAAGCGACTCAGAGGAAGAAAACGATGAAATAGATGGAGTTAATCATCAACATTTACCAGCCCGACGAGCTGAACCACAACGTCACACAATGTTGTGTATGTGTTGTAAGTGTGAAGCCAGAATTGAGCTAGTAGTAGAAAGCTCAGCAGACGACCTTCGAGCATTCCAGCAGCTGTTTCTGAACACCCTGTCCTTTGTGTGTCCGTGGTGTGCATCCCAGCAGTAAGCAACAATGGCTGATCCAGAAGGTACAGACGGGGAGGGCACGGGTTGTAACGGCTGGTTTTATGTACAAGCTATTGTAGACAATTAAACAGGAGATGTAATATCT

[0082] <Sequence ID 3> Reference sequence derived from the HPV31 E7 gene region GenBank Accession Number HQ537687 AGAAACACCTACATTGCAAGACTATGTGTTAGATTTGCAACCTGAGGCAACTGACCTCCACTGTTATGAGCAATTACCCGGCAGCTCAGATGAGGAGGATGTTATAGACAGTCCAGCTGGACAAGCAAAACCGGACACATCCAATTACAATATCGTTACCTTTTGTTGTCAGTGTGAGTCTACACTTCGTTTGTGTGTACAGAGCACACAAGTAGATATTCGCATATTGCAAGAGCTGTTAATGGGCTCATTTGGAATCGTGTGCCCCAACTGTTCTACTAGACTGTAACTACAATGGCTGATCCAGCAGGTACAGATGGGGAGGGGACGGGATGCAATGGTTGGTTTTATGTAGAAGCAGTAATTGACAGACAGACAGGGGACAACATTTCA

[0083] <Sequence No. 4> Reference sequence derived from the HPV33 E7 gene region GenBank Accession number PPH33CG ACACAAGCCAACGTTAAAGGAATATGTTTTAGATTTATATCCTGAACCAACTGACCTATACTGCTATGAGCAATTAAGTGACAGCTCAGATGAGGATGAAGGCTTGGACCGGCCAGATGGACAAGCACAACCAGCCACAGCTGATTACTACATTGTAACCTGTTGTCACACACTTGTAACACCACAGTTCGTTTATGTGTCAACAGTACAGCAAGTGACCTACGAACCATACAGCAACTACTTATGGGCACAGTGAATATTGTGTGCCCTACCTGTGCACAACAATAAACATCATCTACAATGGCCGATCCTGAAGGTACAAATGGGGCTGGGATGGGGTGTACTGGTTGGTTTGAGGTAGAAGCAGTCATAGAGAGAAGAACAGGAGATAATATTTCAGAAGAT

[0084] <Sequence No. 5> Reference sequence derived from the HPV39 E7 gene region GenBank Accession number LR862071 CACCTTGCAGGAAATTGTATTAGATTTATGTCCTTACAATGAAATACAGCCGGTTGACCTTGTATGTCACGAGCAATTAGGAGAGTCAGAGGATGAAATAGATGAACCCGACCATGCAGTTAATCACCAACATCAACTACTAGCCAGACGGGATGAACCACAGCGTCACACAATAGTGTTCGTGTTGTAAGTGTAACACACACTGCAGCTGGTAGTAGAAGCCTCACGGGATACTCTGCGACAACTACAGCAGCTGTTTATGGACTCACTAGGATTTGTGTGTCCGTGGTGTGCAACTGCAAACCAGTAACCTGCTATGGCCAATCGTGAAGGTACAGACGGGGATGGGTCGGGATGTAACGGATGGTTTCTAGTACAGGCAATAGTAGATAAACAAACAGGCGACACAGT

[0085] <Sequence No. 6> Reference sequence derived from the HPV45 E7 gene region GenBank Accession number EF202167 ACACTGCAAGAAATTGTATTGCATTTGGAACCTCAGAATGAATTAGATCCTGTTGACCTGTTGTGTTACGAGCAATTAAGCGAGTCAGAGGAGGAAAACGATGAAGCAGATGGCGTTAGTCATGCACAACTACCAGCCCGACGAGCCGAACCACAGCGTCACAAAATTTTGTGTGTATGTTGTAAGTGTGACGGCAGAATTGAGCTTACAGTAGAGAGCTCGGCAGATGACCTTAGAACACTACAGCAGCTGTTTTTGAGCACCTTGTCCTTTGTGTGTCCGTGGTGTGCAACTAACCAATAATCTACAATGGCGGATCCAGAAGGTACCGACGGGGAGGGAACGGGGTGTAATGGCTGGTTTTTTGTAGAAACAATTGTAGAGAATTAAACAGGGGATGTAATATCA

[0086] <Sequence ID 7> Reference sequence derived from the HPV51 E7 gene region GenBank Accession number LR862072 TAATGTACCACAATTAAAAGATGTAGTATTGCATTTAACACCACAGACTGAAATTGACTTGCAATGCTACGAGCAATTTGACAGCTCAGAGGAGGAGGATGAAGTAGATAATATGCGTGACCAGCTACCAGAAAGACGGGCTGGACAGGCTACGTGTTACAGAATTGAAGCTCCGTGTTGCAGGTGTTCAAGTGTAGTACAACTGGCAGTGGAAAGCAGTGGAGACACCCTTCGCGTTGTACAGCAGATGTTAATGGGCGAACTAAGCCTGGTTTGCCCGTGTTGTGCGAACAACTAGCAACGGCGATGGACTGAAGGTACAGAGGATGAGGAGGCGGGGTGTAATGGGTGGTTTTTTGTTGAAGCAATAGTAGAAATTAAAACAGGAGATAATGTTTC

[0087] <Sequence No. 8> Reference sequence derived from the E7 gene region of HVP52 GenBank accession number LC373207 AGACAAAGCAACTATAAAAGATTATATATTAGATCTGCAACCTGAAACAACTGACCTACACTGCTATGAGCAATTAGGTGACAGCTCAGATGAGGAGGATACAGATGGTGTGGACCGGCCAGATGGACAAGCAGAACAAGCCACAAGCAATTACTACATTGTGACATATTGTCACAGTTGTGATAGCACATTACGGCTATGCATTCATAGCACTGCGACGGACCTTCGTACTCTACAGCAGATGCTGTTGGGCACATTACAAGTTGTGTGCCCCGGCTGTGCACGGCTATAAACAACCCTGCAATGGAGGACCCTGAAGGTACAGAGGGCGAAAGGGAGGGATGTACAGGCTGGTTTGAAGTAGAGGCAATAATAGAAAAACAAACAGGAGATAACATTTCAGAG

[0088] <Sequence No. 9> Reference sequence derived from the HPV53 E7 gene region GenBank accession number EF546481 TAACGTACCAACACTTCCACAATATATTATAGAACTTATACCACAAACTGAGATTGACCTGCAATGCCATGAGCAATTGAACAGCTCAGAGGATGAGGATGAGGATGAAGTAGACCATTTGCAGGAGCAGCCACAGCAAGCTAGACGGGACGAACAACATCCTTGTTACCTAATTGAAACACAGTGTTGTAGGTGTGAGTCGTTGGTGCAGTTGGCTGTTCAGAGTCCAACAAAAGAGCTGCGTATGTTACAACAAATGCTTATGGGCACAGTGGAGCTTGTGTGCCCCCTCTGCGCAACAAGGCGATAACTGCAATGGCGTCACCTGAAGGTACAGAGGATGAGGGGGGATGTCGGGGATGGTTTCACGTGGAGGCAATAGTAAATTAACGTACAGG

[0089] <Sequence No. 10> Reference sequence derived from the HPV56 E7 gene region GenBank Accession number LR862083 TAAAGTACCAACGCTGCAAGACGTTATATTAGAACTAACACCTCAAACAGAAATTGACCTACAGTGCAATGAGCAATTGGACAGCTCAGAGGATGAGGATGAGGATGAGGATGAAGTAGACCATTTGCAGGAGCGGCCACAGCAAGCTAGACAAGCTAAACAACATACGTGTTACCTAATACACGTACCTTGTTGTGAGTGTGTAAGTTTGTGGTGCAGTTGGACATTCACAGTACCAAAGAGGACCTGCGTGTTGTACAACAGCTGCTTATGGGTGCGTTAACAGTAACGTGCCCACTCTGCGCATCAAGTAACTAACTGCAATGGCGTCACCTGAAGGTACAGATGGGGAGGGGAAGGGATGTTGTGGATGGTTTGAAGTAGAGGCAATTGTAGAAATTAAAACA

[0090] <Sequence ID 11> Reference sequence derived from the HPV58 E7 gene region GenBank accession number LC373210 AAACAACCCAACGCTAAGAGAATATATTTTAGATTTACATCCTGAACCAACTGACCTATTCTGCTATGAGCAATTATGTGACAGCTCAGACGAGGATGAAATAGGCTTGGACAGGCCAGATGGACAAGCACAACCGGCCACAGCTAATTACTACATTGTAACGTGTTGTTACACTTGTGACACCACGGTTCGTTTGTGTATCAACAGTACAACAACCGACGTACGAACCCTACAGCAGCTGCTTATGGGCACATGTACCATTGTGTGCCCTAGCTGTGCACAGCAATAAACACCATCTGCAATGGATGACCCTGAAGGTACAAACGGGGTAGGGGCGGGCTGTACTGGCTGGTTTGAGGTAGAAGCAGTAATAGAACGAAGAACAGGAGATAATATTTCAGAT

[0091] <Sequence No. 12> Reference sequence derived from the HPV59 E7 gene region GenBank Accession number LR862080 ACACTTTGTGACATTGTTTTAGATTTGGAACCACACAATTTTGAGGAAGTTGACCTTGTGTGCTACGAGCAATTACCTGACTCCGACTCCGAGAATGAAAAAGATGAACCAGATGGAGTTAATCATCCTTTGCTACTAGCTAGACGAGCTGAACCACAGCGTCACAACATTGTGTGTGTGTGTTGTAAGTGTAATAATCAACTTCAGCTAGTAGTAGAAACCTCGCAAGACGGATTGCGAGCCTTACAGCAGCTGTTTATGGACGCACTATCCTTTGTGTGTCCTTTGTGTGCAGCAAACCAGTAACCTGCGATGGCCGATTCGGAAGGTACAGATGGGGAAGGGACGGGGTGCAATGGATGGTTTTTTGTGCAGGCAATAGTAGATAATTAAACAGGTGACAAAATTTCA

[0092] <Sequence No. 13> Reference sequence derived from HPV66 E7 gene region GenBank Accession number HPU31794 TAAAGTACCAACGTTGCAAGAGGTTATATTAGAACTTGCACCGCAAACGGAAATTGACCTACAATGCAATGAGCAATTGGACAGCTCAGAGGATGAGGATGAGGATGAAATAGACCATTTGCTGGAGCGGCCACAGCAAGCTAGACAAGCTGAACAACATAAGTGTTACCTAATTCACGTACCTTGTTGTAAGTGTGAGTTGGTGGTGCAGTTGGACATTCAGAGTACCAAAGAGGAGCTACGTGTGGTACAACAGCTGCTTATGGGTGCGTTAACAGTAACGTGCCCACTCTGCGCATCATCTAAATAACTGCAATGGCATCACCTGAAGGTACAGATGGGGAGGGGATGGGATGTTGTGGATGGGATGTTGTGGATGGTTTCAGGTAGAAGCAATTGTAGAAAGAAAAACGGG

[0093] <Sequence No. 14> Reference sequence derived from HPV68 E7 gene region GenBank Accession number KC470283 CACCGTGCAGGAAATTGTGTTAGAGTTATGTCCATGCAATGAAATAGAGCCGGTTGACCTTGTATGTCACGAGCAATTAGGAGATTCAGACGATGAAATAGATGAACCCGACCATGCAGTTAATCACCACCAACATCAACTACTAGCCAGACGGGACGAACAACAGCGTCACAGAATTCAGTGTATGTGTTGTAAGTGTAACACAACCCACTGCAACTAGTAGTAGAAGCGTCGCGGGAGAACCTGCGGAAGCTACAACTGCTGTTTATGGACTCACTAAATTTTGTGTGTCCGTGGTGTGCAACGGAAACCCAGTAATCTGCAATGGCCAATTGTGAAGGTACAGATGGGGACGGGACGGGGTGTAACGGATGGTTTTTTGTACAAGCAATAGTAGATAAACAAACAGGTGACACA

[0094] Example 3: Acquisition of primers for identifying and detecting HPV genotypes by multiplex PCR The acquisition of primers for multiplex PCR to detect 14 types of HPV genotypes by nucleic acid chromatography was carried out according to the flowchart shown in Figure 1. Trial and error was repeated based on the quality of the results at each stage of the flow. Through diligent trial and error, primers shown in SEQ ID NOs. 15 to 33 were obtained. Based on the characteristics of the E7 gene sequence, HPV 16, 18, 31, 45, 39, 68, 51, and 59 were individually identified from the 14 types of HPV genotypes, and a primer set was obtained that identified HPV 33, 52, and 58 as one group, and HPV 53, 56, and 66 as one group.

[0095] <SEQ ID NO: 15> Sequence of forward primer for HPV16 GCAACCAGAGACAACTGATCTCTACTATTATGAGCAA <SEQ ID NO: 16> Sequence of reverse primer for HPV16 GCTTTGTACGCACAACCGAAGCGTAGAGTCACACTTG <SEQ ID NO: 17> Sequence of forward primer for HPV18 GAAATTCCGGTTGACCTTCTATGTCACGAGCAA <SEQ ID NO: 18> Sequence of reverse primer for HPV18 ATGCTCGAAGGTCGTCTGCTGAGCTTTCTACTAC <SEQ ID NO: 19> Sequence of forward primer for HPV31 CCTGAGGCAACTGACCTCCACTGTTATGAGCAA <SEQ ID NO: 20> Sequence of reverse primer for HPV31 GTCCGGTTTTGCCTGTCCAGCTGGACTGTCTATAA

[0096] <SEQ ID NO: 21> Sequence of forward primer for HPV33, 52, and 58: CATCCTGAACCAACTGACCTACACTGCTATGAGCAA <SEQ ID NO: 22> Sequence of reverse primer for HPV33, 52, and 58: GCTGTGGCTTGTTCTGCTTGTCCATCTGGCCAGTCCA <SEQ ID NO: 23> Sequence of forward primer for HPV39 and 68: GCCGGTTGACCTTGTATGTCACGAGCAATTAGGAG <SEQ ID NO: 24> Sequence of reverse primer for HPV39: GTAGTTGTCGCAGAGTATCCCGTGAGGCTTCTAC <SEQ ID NO: 25> Sequence of reverse primer for HPV68: GTAGCTTCCGCAGGTTCTCCCGCGACGCTTCTAC

[0097] <SEQ ID NO: 26> Sequence of forward primer for HPV45 TTAGATCCTGTTGACCTGTTGTGTTACGAGCAA <SEQ ID NO: 27> Sequence of reverse primer for HPV45 GTGTTCTAAGGTCATCTGCCGAGCTCTCTACTGTA <SEQ ID NO: 28> Sequence of forward primer for HPV51 CACAGACTGAAATTGACTTGCAATGCTACGAGCAA <SEQ ID NO: 29> Sequence of reverse primer for HPV51 GCCTGTCCAGCCCGTCTTTCTGGTAGCTGGTCAC <SEQ ID NO: 30> Sequence of forward primer for HPV59 GGAAGTTGACCTTGTGTGCTACGAGCAATTACCTG

[0098] <SEQ ID NO: 31> Sequence of reverse primer for HPV59 GCGTCCATAAACAGCTGCTGTAAGGCTCGCAATC <SEQ ID NO: 32> Sequence of forward primer for HPV53, 56, and 66 CAATTGRACAGCTCAGAGGATGAGGATGAGGATGA <SEQ ID NO: 33> Sequence of reverse primer for HPV53, 56, and 66 GCTTGTCTAGCTTGCTGTGGCCGCTCCWGCAAATG <SEQ ID NO: 34> Sequence of forward primer for internal control CCCTTACCAATGTATCCATACCTAGTGCACTATC <SEQ ID NO: 35> Sequence of reverse primer for internal control GGCCTAGCCACCCAGCCTATCTAGGTCTAGTTC

[0099] <Sequence ID 36> Sequence of internal control template DNA GGATCCTATGAAACCCTTACCAATGTATCCATACCTAGTGCACTATCTAGCTGGTGTAGCTCGCTTTGGCTAATGTCCTTGCTGTAAACTGGTTGCCAATTTCTATTACAAGTATCACTAGAACTAGACCTAGATAGGCTGGATGGCTAGGCCTATGAAAGTAAGCTT

[0100] Example 4: Labeling and Tags for Primers for HPV Genotype Detection by Nucleic Acid Chromatography The nucleic acid chromatography stick C-PAS(F6) was obtained from TBA Corporation. The C-PAS(F6) has a line of single-stranded DNA oligos complementary to tag F1 printed at the F1 line position. PCR products tagged with F1 are trapped at the F1 line position, allowing for detection. The detection color is determined by the color of the colored latex particles bound to the PCR product. For example, if biotin is bound to the PCR product, red latex particles coated with streptavidin will bind, resulting in red detection. Similarly, a line of single-stranded DNA oligos complementary to tag F2 is printed at the F2 line position. Single-stranded DNA oligos are printed in a line up to the F5 line position, and an internal control line is printed at the F8 line position, skipping the F6 and F7 lines. Based on the characteristics of the prints from lines F1 to F5, HPV genotype detection was performed by individually identifying HPV16, 18, 31, 45, and 51, grouping HPV33, 52, and 58 into one group, HPV53, 56, and 66 into another group, and HPV39, 59, and 68 into yet another group, and identifying them by line position and color coding. The methods for labeling the forward primers with biotin and Psyche, and tagging the reverse primers are shown in Tables 1 and 2. Note that the tag sequence information has not been made public by TBA Corporation.

[0101] Table of biotin and psyche labeling for forward primers (Table 1)

[0102] Table for assigning tags to reverse primers (Table 2)

[0103] Example 5: Primer preparation and DNA template for internal control. The 5' end biotin-labeled primers shown in Table 1 were synthesized by Eurofins Genomics, Inc., and the 5' end Psyche-labeled primers were chemically synthesized by Eurofins Genomics, Inc. using thiol-oligoDNA. The tag-primers in Table 2 were synthesized by TBA Corporation. The internal control primers used in this experiment are shown as SEQ ID NOs. 34 and 35, and the sequence of the double-stranded DNA template for internal control is shown as SEQ ID NO. 36. The primer of SEQ ID NO. 34 was Psyche-labeled (Table 1), and the tag F8 was added to the primer of SEQ ID NO. 35 (Table 2), so that the amplification of the internal control in PCR could be detected as a line in red at the F8 line position.

[0104] Example 6: Multiplex PCR and Nucleic Acid Chromatography GoTaq G2 Hot Start Colorless Master Mix (Promega) was obtained and mixed with 1x Master Mix (200 μM each dNTPs, 2 mM MgCl2) and 500 nM primers shown in Tables 1 and 2. DNA templates were added to this mixture to a reaction volume of 10 μL, and the reaction was carried out in a 0.2 mL PCR tube (Nippon Genetics). 100 copies of each HPV template and 10 ng of human genomic DNA template were dispensed into PCR tubes. 50 copies of double-stranded DNA were used as an internal control template and added to all test tubes.

[0105] Multiplex PCR reactions were performed using an ABI 2720 thermal cycler. After initial thermal denaturation at 95°C for 2 minutes, a cycle of 98°C for 2 seconds and 68°C for 20 seconds was repeated 40 times. For nucleic acid chromatography, 10 μL of chromatographic developing solvent (TBA Co., Ltd., Sendai) was added to 10 μL of the reaction mixture after PCR. 1 μL each of 0.5% Streptavidin-coated red latex particles and Cupid-coated blue latex particles were added and mixed. The bottom of a chromatographic stick C-PAS (F6) (TBA Co., Ltd., Sendai) was then immersed in the mixture and developed for 15 minutes.

[0106] The nucleic acid chromatography results are shown in Figure 2. The internal control detection line F8 is detected in blue on all sticks. When HPV DNA is used as the template, it is detected on the numbered sticks for each genotype at the line positions shown in Table 2, with lines colored by biotin (red) or psyche (blue) as shown in Table 1. For example, HPV16 is detected in red at the F1 line position. NC is the negative control, and the template DNA is only the internal control DNA; no lines appear at positions F1 to F5. DN uses human genomic DNA as the template; the HPV primers shown in Tables 1 and 2 do not cross over, and no lines appear at positions F1 to F5.

[0107] Example 7: In Example 7, HPV39, 59, and 68 were detected as a single group depending on how the F2 tag was attached at the F2 line position. However, as shown in Tables 1 and 2, HPV39 was detected using the biotin-forward tag for HPV39 (SEQ ID NO: 23) / F2-reverse tag for HPV3968 (SEQ ID NO: 24), HPV59 was detected using the biotin-forward tag for HPV59 (SEQ ID NO: 30) / F6-reverse tag for HPV59 (SEQ ID NO: 31) by changing the tag from F2 to F6, and HPV68 was detected using the biotin-forward tag for HPV3968 (SEQ ID NO: 24) / F7-reverse tag for HPV68 (SEQ ID NO: 25) by changing the tag from F2 to F7. By using C-PAS (F8) with detection oligoDNA printed on F6 and F7, individual detection at the F2, F6, and F7 line positions becomes possible, indicated by red lines. In this case, as described in Example 3, HPV16, 18, 31, 45, 39, 68, 51, and 59 are individually identified, and HPV33, 52, and 58 are identified and detected as one group, and HPV53, 56, and 66 are identified and detected as one group.

Claims

1. (1) A step of performing nucleic acid amplification using a sample that may contain a target gene, a first primer set group including at least one or more primer sets, and a second primer set group including at least one or more primer sets to amplify the target gene, wherein the primers of the first primer set are labeled with one of an affinity substance pair, and the primers of the second primer set are labeled with a compound represented by the following formula (1); (wherein X1a, X1b, X2a and X2b each independently represent O or NH, Y 1 and Y 2 each independently represent C or S, Z 1 and Z 2 each independently represent O, S or NH, V 1 and V 2 each independently represent S or S + -O - , n1 and n2 each independently represent an integer of 0 or 1, m1 and m2 each independently represent an integer of 1 to 10, and L represents a linking group.) (2) A step of adding first colored particles bound with the other of the affinity substance pair and second colored particles bound with a protein represented by SEQ ID NO: 37 to the amplification product obtained in step (1) to color the amplification product; and (3) A step of developing the colored amplification product obtained in step (2) on a solid support and detecting the first colored particles and the second colored particles to detect the presence or absence of the target gene. A method for detecting a target gene, comprising:

2. The method for detecting a target gene according to claim 1, wherein one of the affinity substance pairs is biotin and the other of the affinity substance pairs is streptavidin.

3. The method for detecting a target gene according to claim 1, wherein the target gene is a papillomavirus gene.

4. The method for detecting a target gene according to claim 3, wherein the first set of primers is a set of primers for detecting HPV16, HPV39, HPV68, HPV51, HPV59, HPV53, HPV56, and HPV66, and the second set of primers is a set of primers for detecting HPV18, HPV31, HPV33, HPV52, HPV58, and HPV45.

5. A method for detecting a target gene according to claim 4, wherein the primer set for detecting HPV16 is sequence number 15 and sequence number 16, the primer set for detecting HPV18 is sequence number 17 and sequence number 18, the primer set for detecting HPV31 is sequence number 19 and sequence number 20, the primer set for detecting HPV33, HPV52, and HPV58 is sequence number 21 and sequence number 22, the primer set for detecting HPV39 is sequence number 23 and sequence number 24, the primer set for detecting HPV68 is sequence number 23 and sequence number 25, the primer set for detecting HPV45 is sequence number 26 and sequence number 27, the primer set for detecting HPV51 is sequence number 28 and sequence number 29, the primer set for detecting HPV59 is sequence number 30 and sequence number 31, and the primer set for detecting HPV53, HPV56, and HPV66 is sequence number 32 and sequence number 33.

6. The method for detecting a target gene according to claim 5, wherein the primer set of SEQ ID NO: 34 and SEQ ID NO: 35 is used as an internal control primer set.

7. A combination of primer sets for detecting papillomavirus, comprising at least one of the following primer sets: a primer set for detecting HPV16, as shown in SEQ ID NOs. 15 and 16; a primer set for detecting HPV18, as shown in SEQ ID NOs. 17 and 18; a primer set for detecting HPV31, as shown in SEQ ID NOs. 19 and 20; a primer set for detecting HPV33, HPV52, and HPV58, as shown in SEQ ID NOs. 21 and 22; a primer set for detecting HPV39, as shown in SEQ ID NOs. 23 and 24; a primer set for detecting HPV68, as shown in SEQ ID NOs. 23 and 25; a primer set for detecting HPV45, as shown in SEQ ID NOs. 26 and 27; a primer set for detecting HPV51, as shown in SEQ ID NOs. 28 and 29; a primer set for detecting HPV59, as shown in SEQ ID NOs. 30 and 31; and a primer set for detecting HPV53, HPV56, and HPV66, as shown in SEQ ID NOs. 32 and 33.

8. A combination of primer sets for detecting papillomavirus according to claim 7, wherein one primer in part of the primer set is labeled with one affinity substance of a pair, and the other primer is labeled with a tag, and one primer in the remaining part of the primer set is labeled with the compound represented by formula (1) in claim 1, and the other primer is labeled with a tag.