Kit for discriminating multi-gene doping and cell doping using crispr-based nucleic acid detection system and uses thereof
Patent Information
- Application Number
- PCT/KR2025/004021
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-03-28
- Filing Date
- 2025-03-28
- Publication Date
- 2026-10-01
Smart Images

Figure KR2025004021_01102026_PF_FP_ABST
Abstract
Description
Kit for detecting multiple genes and cell doping using a CRISPR-based nucleic acid detection system and its uses
[0001] The present invention relates to a kit for determining multiple genes and cell doping using a CRISPR nucleic acid detection system and the use thereof.
[0002] The advancement of modern gene therapy and cell therapy technologies suggests the possibility that athletes may attempt new forms of doping. Consequently, the World Anti-Doping Agency (WADA) prohibits all activities aimed at enhancing athletic performance, including gene therapy and cell therapy technologies, by classifying them as gene and cell doping. Such gene doping is fundamentally based on the delivery of genes and cells from outside the body to enhance athletic ability, including specific proteins involved in improving endurance and muscle strength. In this process, proteins expressed from exogenous genes can not only share the same sequence as proteins expressed from endogenous genes but also become structurally identical proteins due to undergoing the same expression and secretion processes. Therefore, there is a problem in that current protein-level doping analysis methods, which rely on protein recombination characteristics or sequence differences, cannot detect such gene doping.
[0003] In response to this, WADA published guidelines on gene doping analysis methods using polymerase chain reaction (PCR) in 2021. The document recommends specifically amplifying exogenous genes, but with a sensitivity of no more than 10 copies. However, the document has a problem in that it does not describe 1) the types and sequences of potential doping genes, 2) the primer compositions for amplifying each target doping gene, 3) the processing methods for doping samples to amplify nucleic acids, and 4) the methods for amplifying and detecting nucleic acids.
[0004] In gene doping, all drugs used for protein and peptide doping can be potential candidates. Representative examples of such drugs currently tested by WADA include erythropoietin (EPO), human chorionic gonadotropin (hCG), human growth hormone (hGH), and insulin-like growth factor-1 (IGF-1); doping tests are conducted on all proteins associated with these isoforms. As the range of drugs that can be used for gene doping is so diverse, analytical methods for each should be established in every anti-doping laboratory; however, these individual methods remain in the research phase. Furthermore, conducting individual gene doping analyses for each sample entails difficulties in terms of time and manpower, thus necessitating integrated or multiplexed analytical methods.
[0005] Furthermore, there is the issue of how to utilize gene-doped samples for analysis. Gene doping utilizes blood samples containing genes and cells, and the process of extracting and purifying nucleic acids from these samples alone typically takes a significant amount of time, usually about two hours. Generally, extracting nucleic acids from blood involves steps of cell lysis, protein degradation, and subsequent fixation, washing, and purification of the eluted nucleic acids. Since each blood sample must be handled multiple times, the sample throughput is limited; moreover, if cross-contamination occurs during the lengthy pretreatment process, the system may be susceptible to false positives and false negatives when subsequent amplification is performed using methods such as PCR.
[0006] When using isothermal amplification methods such as RPA (Recombinase Polymerase Amplification) and LAMP (Loop-mediated Isothermal Amplification), a process of extracting and purifying high-purity genetic material from blood samples is required, and there is a high possibility of contamination of foreign genes serving as amplification templates or sample substitution during this process.
[0007] Therefore, there is a need to develop a method that minimizes blood processing and can be applied to gene doping.
[0008] To solve the above problem, the inventors developed a method for determining multiple gene or cell doping that does not require a pretreatment process using a CRISPR-based nucleic acid detection system, thereby completing the present invention.
[0009] Accordingly, the object of the present invention is to provide a composition for determining CRISPR-based multiple gene doping or cell doping.
[0010] Another objective of the present invention is to provide a CRISPR-based method for determining multiple gene doping or cell doping.
[0011] Another objective of the present invention is to provide an information providing system for determining CRISPR-based multiple gene doping or cell doping.
[0012] To achieve the above objectives, the present invention provides a CRISPR-based composition for determining multiple gene doping or cell doping.
[0013] To achieve another objective of the present invention, the present invention provides a CRISPR-based method for determining multiple gene doping or cell doping.
[0014] To achieve another objective of the present invention, the present invention provides an information providing system for determining CRISPR-based multiple gene doping or cell doping.
[0015]
[0016] The present invention will be described in detail below.
[0017] In one aspect of the present invention, the present invention relates to a composition for determining CRISPR-based gene doping or cell doping, wherein the composition comprises one or more primer sets for direct amplification of doping genes; and guide RNA and Cas protein specific to the doping gene to be detected.
[0018] "Gene and cell doping" is listed on the World Anti-Doping Agency's prohibited list and is designated as item M3. GENE AND CELL DOPING as a prohibited method as of 2025. This refers to the use of nucleic acids and nucleic acid derivatives capable of altering genomic sequences or gene expression in any way, as well as doping performed on genetically modified cells or normal cells for the purpose of enhancing potential athletic performance. Breaking down the sections, starting with "Gene Doping," this encompasses all genetic techniques, including the editing, suppression, and delivery of genes. Practical methods of such gene doping may include delivering genes via carriers such as viral vectors, plasmids, polymer particles, lipid particles, and hydrogels, as well as the use of CRISPR for gene editing and regulation, shRNA, miRNA for RNAi, and antisense oligonucleotides. Furthermore, "Cell Doping" can be carried out through the injection of normal cells, the individual's own cells, non-individual cells, cells cultured in vitro, or cells that have been genetically engineered in any manner. In particular, cell doping, which is gene doping through cell manipulation, can utilize various types of cells such as stem cells, immune cells, and hematopoietic stem cells, and the type of cell can be selected depending on the gene to be introduced or regulated.
[0019] The composition for determining gene or cell doping according to the present invention utilizes CRISPR gene editing and may include substances for amplifying, analyzing, and detecting a target gene subject to doping. Specifically, the composition of the present invention may include a primer for specifically amplifying the doping gene subject to determination, a gene amplification reagent, a Cas protein for CRISPR gene editing, a guide RNA, and a nucleic acid probe for detecting the target gene.
[0020] In the present invention, the doping gene subject to gene doping is erythropoietin (EPO), human growth hormone (hGH), insulin-like growth factor-1 (IGF-1), human chorionic gonadotropin (hCG), fibroblast growth factors (FGFs), hepatocyte growth factor (HGF), mechano growth factors (MGFs), platelet-derived growth factor (PDGF), thymosin-beta 4, vascular endothelial growth factor (VEGF), activin A-neutralizing antibodies, activin receptor IIB competitors, anti-activin receptor IIB antibodies, and myostatin-binding It may be at least two selected from the group consisting of proteins (myostatin-binding proteins), myostatin- or precursor-neutralizing antibodies, GH-releasing peptides (GHRPs), TGF-beta (transforming growth factor beta) signaling inhibitors, etc., and preferably erythropoietin (EPO), human growth hormone (hGH), or insulin-like growth factor (IGF-1).It may be insulin-like growth factor-1, but is not limited to that type.
[0021] Two types of pituitary-derived human growth hormone (hGH) are known: one with a molecular weight of about 22,000 (hereinafter referred to as 22K hGH) and one with a molecular weight of about 20,000 (hereinafter referred to as 20K hGH) (Endocrine Reviews, April 2012, 33(2):155-186).
[0022] IGF1A, IGF1B, and IGF1C are known isoforms of IGF1.
[0023] In the specification of the present invention, the term "primer" means a short nucleic acid sequence capable of forming base pairs with a complementary template and functioning as a starting point for template strand replication.
[0024] In the present invention, to produce a primer set optimized for "direct gene amplification," a primer set was produced by targeting the exon-exon junction of the doping gene and used for identifying the doping gene.
[0025] In one embodiment of the present invention, the primer set for amplifying the doping gene may include at least two primer sets selected from the group consisting of: a first primer set comprising a nucleotide sequence represented by SEQ ID NO. 1 and a nucleotide sequence represented by SEQ ID NO. 2; a second primer set comprising a nucleotide sequence represented by SEQ ID NO. 3 and a nucleotide sequence represented by SEQ ID NO. 4; and a third primer set comprising a nucleotide sequence represented by SEQ ID NO. 5 and a nucleotide sequence represented by SEQ ID NO. 6.
[0026] The above composition for detecting multiple gene doping may further include an excipient that stabilizes the primer set. The excipient may be a buffer, NEBuffer, NaCl, tris-HCl, MgCl2, albumin, salt, acid, or base, but is not limited thereto, and may include known substances for stabilizing the primer set.
[0027] In the present invention, the term "base sequence" means a sequence of nucleotides containing the corresponding base, and can be used with the same meaning as nucleotide sequence, nucleic acid sequence, or DNA sequence, and may include a sequence that has been modified according to a codon encoding a protein.
[0028] In addition, the composition of the present invention may include a reagent for gene amplification. For example, the reagent for amplification may include DNA / RNA polymerase, nucleotides (dNTPs, deoxyribonucleoside triphosphate), a buffer, an ion aid, and a fluorescence detection reagent.
[0029] The composition of the present invention is intended for analysis using a CRISPR-based nucleic acid detection system. In this specification, "CRISPR-based nucleic acid detection system" refers to a gene editing technology of a CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) / Cas protein system using a guide RNA (crRNA) that recognizes the DNA of a specific gene and a Cas nuclease.
[0030] The CRISPR / Cas system used in this invention is a type of immune system found in about 50% of bacteria and about 90% of archaea, which functions to prevent infection by selectively cutting foreign DNA and absorbing parts of it. Currently, CRISPR / Cas systems with different characteristics are being discovered in various species, and technologies utilizing them are also being developed.
[0031] In particular, the present invention is characterized by using a Cas protein having an activity (trans cleavage activity, collateral cleavage activity) that not only cleaves a sequence targeted by a guide RNA in the CRISPR-based nucleic acid detection system, but also randomly cleaves non-target single-stranded DNA that does not hybridize to the guide RNA after recognizing the target sequence.
[0032] Accordingly, the Cas protein included in the CRISPR-based nucleic acid detection system of the present invention has trans cleavage activity and, preferably, may include Cas12, Cas13, and Cas14. As an example, Cas12 belongs to class 2 type V and differs from Cas9 in that it creates a 5' overhang at the target site and cleaves DNA in a misaligned form. In addition, unlike the Cas9 protein, which requires tracrRNA for activity, Cas12 functions normally with only crRNA (i.e., there is no need for the process of combining crRNA and tracrRNA into a single sgRNA), and the cleavage site is characterized by being formed into a sticky end useful for genome editing.
[0033] In one embodiment, the Cas12 protein may be selected from the group consisting of Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, and Cas12j, and preferably may be Cas12a or Cas12b. For example, Cas12a may be LbCas12a, AsCas12a, EeCas12a, etc. However, it is not limited thereto, and any CRISPR effector protein that binds to crRNA, recognizes a double-stranded target nucleic acid, and has trans-cleavage activity may be used without limitation.
[0034] In the present invention, information on the gene and protein of the Cas12 protein can be obtained from GenBank of the NCBI (National Center for Biotechnology Information), but is not limited thereto.
[0035]
[0036] Accordingly, the composition of the present invention may include a Cas protein, guide RNA, and nucleic acid probe included in a CRISPR system, and additional stabilizers or excipients.
[0037] The guide RNA included in the above CRISPR / Cas may be gRNA or crRNA, and the "crRNA (CRISPR RNA)" of the present invention is intended to locate a specific nucleotide sequence by having a target complementary sequence. In the present invention, the crRNA specifically recognizes the target doping gene to be detected and activates the Cas protein, and the activated CRISPR / Cas protein cleaves the target doping gene (double-stranded DNA). In one embodiment of the present invention, the crRNA may include at least two sequences selected from the group consisting of SEQ ID NOs 7 to 10.
[0038] By utilizing the trans-cleavage activity of the above-mentioned CRISPR effector protein, a labeling substance (e.g., fluorescent dye and quencher) linked as a single DNA strand around a Cas protein that reacts with a target nucleic acid can be added, thereby inducing the degradation of the single-stranded DNA and the emission of fluorescence. In the present invention, the single DNA strand is referred to as a 'nucleic acid probe,' which means a base sequence containing a single-stranded oligonucleotide sequence complementary to the target nucleic acid.
[0039] The above nucleic acid probes may have various forms. These nucleic acid probes are structurally distinguished according to their use and may include, for example, primer forms for amplifying specific nucleic acids, molecular beacons with a hairpin structure whose structure changes depending on whether they bind to a target, or nucleic acids in the form of linkers for inducing hydrogel formation.
[0040] In addition, the nucleotide sequence included in the single-stranded probe has a nucleotide sequence that is non-complementary to the target nucleic acid and the probe. The length of the nucleic acid probe may be 3 nt to 300 nt, 5 nt to 100 nt, 6 nt to 50 nt, or 8 nt to 20 nt.
[0041] In the present invention, the single-stranded nucleic acid probe comprises a labeling substance. The labeling substance is selected according to the application of the probe and is generally used to perform functions such as generating a fluorescent signal, quenching, biochemical binding, electrochemical signal conversion, immobilization, or inducing a chemical reaction. Labels used for fluorescence detection include FAM, HEX, ROX, Cy3, and Cy5, while quenchers such as BHQ1, BHQ2, BHQ3, and TAMRA are utilized for FRET-based structural change detection or detection of collateral cleavage activity in CRISPR-Cas systems. Labels for biochemical binding include biotin and digoxigenin (DIG), which are used for LFA, immobilization, and immunological detection through specific binding with streptavidin or anti-DIG antibodies, respectively. Methylene blue is typically used for electrochemical analysis, which converts the presence of nucleic acids into an electrical signal through redox reactions at the electrode. As a label for immobilization, an SH group (-SH) is used to stably bind nucleic acids to the surface of a gold electrode or gold nanoparticles. In addition, reactive groups such as azide and alkyne can be introduced for chemical gel formation or surface reactions. These labeling materials can be combined depending on the application of the probe and the analysis platform to be utilized in various diagnostic technologies.
[0042] In one embodiment, the single nucleic acid probe may be a FRET (fluorescence resonance energy transfer) type signal probe in which the energy of the fluorescent dye is transferred to a quencher (fluorescence suppressor) before cleaving to suppress the emission of a fluorescent signal, and after cleaving the probe, no fluorescence signal transfer occurs.
[0043] In one embodiment, when the single-stranded nucleic acid probe is added to the amplification reaction product, the Cas12 / crRNA binds to the target nucleic acid to form a Cas12 / crRNA / target nucleic acid triple complex, and the fluorescence of the fluorescent dye can be detected as the single-stranded DNA probe is cleaved by the complex. Therefore, if a sequence identical to the target nucleic acid is present in the amplification reaction product, a fluorescent signal is detected, and if a non-specific nucleic acid is present, a Cas12 / crRNA / target nucleic acid triple complex is not formed, and a fluorescent signal is not detected.
[0044]
[0045] In another aspect, the present invention relates to a CRISPR-based multiple gene doping detection method performed in the following steps.
[0046] 1) A step of directly amplifying using a primer set for two or more target doping genes to be detected in a biological sample isolated from an individual suspected of gene doping;
[0047] 2) a step of detecting the target doping gene using guide RNA and Cas protein specific to the two or more amplified target doping genes, and generating a fluorescent signal using a single-sequence nucleic acid probe; and
[0048] 3) After the step of generating the above fluorescent signal, a step of confirming whether two or more target doping genes are doped.
[0049] In the above method, the biological sample separated from the individual is a substance derived from the body that can be used to evaluate whether the subject has gene doped, and is not limited to any specific type, and may include, for example, blood, serum, plasma, urine, saliva, sweat, tears, cerebrospinal fluid (CSF), mucus, tissue samples (biopsy tissue), cell extracts, hair, nails, and feces.
[0050] The process of amplifying a doping gene to be detected using a primer set for the doping gene to be detected from a biological sample isolated from the above-mentioned individual is not limited to this method and can be performed according to known methods. In the present invention, the doping gene to be detected is directly amplified without pretreatment of the sample. The term "direct amplification (blood direct amplification)" refers to a method of directly amplifying nucleic acids present in a sample using primers without a pretreatment process of separating nucleic acids (DNA) within the sample to be detected (e.g., blood).
[0051] In addition, the amplification method of the above gene can be performed using a method selected from among standard polymerase chain reaction (Conventional PCR), real-time PCR using real-time signals (qPCR, quantitative PCR or real-time PCR), isothermal amplification (LAMP, loop-mediated isothermal amplification) and recombinase polymerase amplification (RPA) amplifying under isothermal conditions, multiplex PCR for simultaneous amplification of multiple targets, high resolution melting-polymerase chain reaction (HRM-PCR) based on dissociation curve analysis for amplifying single-stranded DNA, reverse transcription-polymerase chain reaction (RT-PCR) for amplifying RNA by converting it to DNA, and digital polymerase chain reaction (dPCR) for sensitively detecting specific gene mutations.
[0052] Additionally, regarding the amplified target gene sequence, the method includes the step of detecting the target doping gene by cutting it using a CRISPR system, and labeling it by expressing a fluorescent signal through a fluorescent agent or quencher bound to the single-sequence nucleic acid probe as the cutting of the non-specific single-sequence nucleic acid probe occurs simultaneously.
[0053] The operating principle of the above CRISPR system is as follows. The Cas protein and guide RNA form a complex and move along the DNA of the target gene, confirming that the crRNA and the DNA sequence of the target gene match in the T-rich PAM sequence. When the crRNA and DNA sequences match, cis-cleavage activity occurs in the double-stranded DNA of the target gene, and simultaneously, trans-cleavage activity is exhibited on the non-target single-sequence DNA. The above single-sequence DNA is a nucleic acid probe molecule to which a fluorescent protein, etc., is bound, and this trans-cleavage activity can induce a target sequence-dependent fluorescent reaction.
[0054] In addition, the method of the present invention may further include a method for identifying two or more target doping genes detected according to the labeled fluorescent protein. The method for identifying the target doping genes may be performed according to methods known in the art, for example, by electrophoresis, but is not particularly limited to the method.
[0055] The CRISPR-based multiplexed gene and cell doping assay method according to the present invention is also referred to as "HiMDA (High-throughput multiplexed gene and cell doping assay)." In one embodiment, the HiMDA method of the present invention performs a multiplexed blood direct amplification process on a large amount of blood samples without a blood pretreatment process using a 96-well plate, and immediately performs a CRISPR / Cas reaction on the amplified products in a 96-well plate without special treatment. Then, for samples that are positive for the Cas reaction, the amplified gene and the size of the cut fragment are confirmed by electrophoresis to identify the type of doping gene.
[0056] In another aspect, the present invention relates to a CRISPR-based multiple cell doping detection method for detecting genetically engineered cells from a biological sample isolated from an individual suspected of cell doping, comprising the steps of: amplifying and analyzing one or more target doping genes to be detected from a cell contained in a biological sample isolated from the individual suspected of cell doping; or analyzing an expression product expressed from said cell.
[0057] The above method for detecting cell doping is intended to detect transgenic cells that have been genetically modified externally and administered to an individual, and this can be performed by directly analyzing the gene sequence of the administered foreign cells, analyzing the immune response by the cells, or analyzing the activity of the administered cells, such as protein expression or cell differentiation.
[0058] In particular, in one embodiment of the present invention, the cell doping may be performed according to gene analysis or expression product analysis of the administered foreign cell, and the gene analysis of the foreign cell may be performed by the analysis using CRISPR (HiMDA) reviewed above. In addition, the expression product analysis involves analyzing products such as mRNA or proteins expressed from the foreign cell, and known analysis methods may be utilized.
[0059] In another aspect, the present invention relates to a CRISPR-based information providing system for multiple gene doping or cell identification comprising the following.
[0060] i) a gene amplification unit comprising a biological sample isolated from an individual suspected of gene doping and two or more sets of primers specific to one or more target doping genes to be detected;
[0061] ii) a gene amplification confirmation unit that confirms gene amplification using a nucleic acid probe comprising a guide RNA specific to one or more amplified target doping genes obtained from the gene amplification unit; a Cas protein; and a labeling substance; and
[0062] iii) A multiple gene doping verification unit that verifies the type of amplified gene appearing in the gene amplification verification unit above.
[0063] The present invention relates to a composition for determining multiple gene doping or cell doping and a method for determining gene doping or cell doping using the same. By utilizing the above composition and method, simultaneous analysis of target multiple doping genes is possible. Furthermore, by directly amplifying target gene fragments without the genome extraction and pretreatment steps within the sample (e.g., blood) that are involved in general gene amplification processes, it is easy to process large volumes of samples. In addition, in the case of cell doping, there is an advantage that doping determination is possible not only through gene analysis but also through the analysis of cell expression products.
[0064] In addition, the multiple gene doping detection method according to the present invention is characterized by very high sensitivity, capable of detecting up to 2.5 copies of cell-derived genes and up to a single-cell level of cell nucleic acids.
[0065] Figure 1 shows a schematic diagram of the process of HiMDA (high-throughput multiplexed gene and cell doping analysis) for the detection of doping genes according to the present invention.
[0066] Figure 2 shows a photograph (A) of a 96-well in which multiple blood direct amplification of the present invention was performed, and the electrophoresis results confirming each amplified doping gene.
[0067] Figure 3 is a diagram illustrating the molecular binding form of Cas12a of the present invention and the gene scissors principle of Cas12a.
[0068] FIG. 4 is a schematic diagram showing the cDNA form (A) and sequence of the target gene to be doped according to the present invention, and the crRNA binding site (B), etc.
[0069] Figure 5 shows the fluorescence response of Cas12a to a target, showing the relationship between reaction time and reporter concentration (A) and the Cas12a reaction results according to the concentration of the doping gene (B).
[0070] Figure 6 shows the results of confirming the target specificity of the exogenous gene to be doped for in vitro gene doping and the crRNA to it through fluorescence (A) and the change in fluorescence intensity according to concentration (B).
[0071] Figure 7 shows the results of verifying a cell model containing four types of doping genes and fluorescent protein expression (A), the results of SDS-PAGE analysis of the genes included in the cell model (B), and the results of immunological analysis of the expression product (protein) (C), respectively.
[0072] Figure 8 shows the results of HiMDA (high-throughput multiplexed gene and cell doping analysis) in in vitro gene doping, including fluorescent signals for all target genes (A), analysis results of gene fragments resulting from multiplexed direct blood amplification (B), and analysis results of fragments cut using cis-cleavage of Cas12a (C).
[0073] Figure 9 shows the results of measuring the shape (A), size (B), particle stability (C), and zeta potential (D) of a nano-inducer particle (PEI-EPO, polyethylenimine-erythropoietin) for the intracellular introduction of the exogenous doping gene EPO.
[0074] Figure 10 confirms the effect of EPO gene delivery in a mouse model transduced with an EPO nano-inducer, showing a fluorescent signal (A), electrophoresis results for gene analysis (B), and analysis results of a cleavage fragment using cis-cleavage of Cas12a (C).
[0075] Figure 11 shows a fluorescence microscope image (A) of an EPO-secreting biofactory T cell (EPO-EL4, erythropoietin-EL4) produced for the exogenous doping gene EPO, the result of mRNA analysis to confirm EPO gene expression (B), the result of confirming EPO protein expression to confirm EPO gene expression (C), and the result of quantitatively measuring the expression levels of the mRNA and EPO protein (D and E), respectively.
[0076] Figure 12 shows the fluorescence intensity of the EPO gene in a mouse model injected with EPO-EL4 cells (A), the results of electrophoresis to confirm the presence and size of the gene (B), and the results of analysis of the cleavage fragment using cis-cleavage of Cas12a (C).
[0077] Hereinafter, embodiments are described in detail to specifically explain the present specification. However, the embodiments according to the present specification may be modified in various different forms, and the scope of the present specification is not to be interpreted as being limited to the embodiments described below. The embodiments of the present specification are provided to more completely explain the present specification to those with average knowledge in the art.
[0078]
[0079] Example 1. Design of primer set and crRNA for direct blood amplification of four target doping genes
[0080] 1-1. Primer Preparation
[0081] Four sets of primers capable of blood direct amplification for four target doping genes (22K-GH, 20K-GH, EPO, IGF1) to be detected from blood were designed from the GenBank database.
[0082] First, primers were obtained from the NCBI Primer Blast for the target reference sequences of the 22K-GH (GenBank NM_000515.5), 20K-GH (GenBank NM_022559.4), EPO (GenBank NM_000799.4), and IGF1 (GenBank NM_000618.5) genes, respectively. The PCR primer sets were designed according to the following parameter settings. First, primer positioning was used to ensure that the crRNA binding region was included in the resulting amplicon. Second, the primers included the exon-exon junction. Third, a specificity database of the human genome was selected, and specificity strictness was set to include at least two mismatches within the last 5 bps of the 3' end, with a total of five mismatches for unintended targets. Other parameters were set to their default values. The PCR primer set synthesized as described above was tested by direct PCR using blood, and primers showing high selectivity and target amplification were finally selected through agarose gel electrophoresis, and the selected primer sequences are shown in Table 1 below.
[0083] Target Primer Position Tm (°C) Size (bp) Sequence (5'→3') Sequence Number GH (20K & 22K) Forward Exon 259.2368 (22K), 323 (20K) AGGCTTTTTGACAACGCTATGC1 Reverse Exon 5 / Exon 465.4 TCTTCCAGCCTCCCCATCA2EPO Forward Exon 1 / Exon 263.6514 ATGGGGGTGCACGAATGTC3 Reverse Exon 2562.3514 AGACTCGGAAGAGTTTGCGG4IGF1 Forward Exon 1 / Exon 359.5290 TGTGATTTCTTGAAGGTGAAGATGC5 Reverse Exon 461.1290 TTGAGGGGTGCGCAATACAT6
[0084] The multiple reaction conditions and composition for direct blood amplification are as follows:
[0085] 1) Composition: For one reaction, 25 μL of KOD One PCR master mix, 10 μL of primer mix (primers of sequence numbers 1-6 in Table 1 at 500 nM each, 0.075 v / v% Triton X-100), and 10 μL of water were added to dispense a final volume of 45 μL into a 96-well plate.
[0086] Afterwards, 5 μL of the sample containing whole blood was dispensed to make a final volume of 50 μL.
[0087] 2) Thermal cycling: After heating at 97°C for 3 minutes, 50 thermal cycles were performed, consisting of denaturation at 98°C for 10 seconds, primer attachment at 63°C for 8 seconds, and polymerization at 68°C for 1 second. Afterward, the 96-well plate was centrifuged at 3,200 × g for 5 minutes to obtain the supernatant.
[0088]
[0089] 1-2. crRNA production
[0090] In addition, crRNAs were designed using the target gene sequence of 1-1 above. At this time, 5'TTTV was used as the PAM, and crRNAs for each target gene were designed such that the crRNA sequence following the PAM included the exon-exon junction of the target exogenous gene, and the target sequence was synthesized as a 5'-scaffold for AsCpf1 (5'-UAAUUUCUACUCUUGUAGAU-3'). The constructed crRNA sequences are indicated by sequence numbers 7 to 10 in Table 2 below, respectively.
[0091] Target sequence (5'→3') Sequence number 22K-GHAAGAAGCCUAUAUCCCAAAG720K-GHACCCCCAGACCUCCCUCUGU8EPOAGCACAGCCCGUCGUGAUAU9IGF1UUUCAACAAGCCCACAGGGU10
[0092] The multiple reaction conditions and composition of the above crRNA sequence and Cas12a are as follows:
[0093] - Composition: For each reaction, 1.5 pmol of crRNA corresponding to sequence numbers 7-10 in Table 2 and 10 pmol of fluorescent probe (5'-FAM-TTATTCCCCC-BHQ1-3'), respectively, were prepared in 100 μL of reaction buffer (50 mM Tris-HCl, 140 mM NaCl, 10 mM MgCl2, pH 7.4) and dispensed into a 96-well plate.
[0094] -Cas12a reaction: 1 μL of the supernatant of the blood direct amplification reaction product of Example 1-1 was added and incubated at 37°C for 30 minutes, after which fluorescence values were measured and recorded at an excitation wavelength of 485 nm and an emission wavelength of 535 nm.
[0095] Experimental Example 1. CRISPR / Cas12-based multiple gene doping detection method
[0096] A CRISPR / Cas12-based multiplex gene doping detection method according to the present invention is schematically illustrated in FIG. 1. Specifically, for four target doping genes (22K-GH, 20K-GH, EPO, IGF1) to be detected in 5 μL of whole blood, multiplex blood direct amplification was performed in a 96-well plate using the primer set and reaction composition of Example 1 and reaction conditions, and the supernatant was obtained by centrifugation. After reacting the supernatant of multiplex blood direct amplification with Cas12a and a fluorescent reporter, a crRNA specific to the four target doping genes was reacted with the above-mentioned Cas12a and a fluorescent reporter, and a fluorescent reaction was confirmed (Screening step). At this time, blood samples exhibiting a fluorescent reaction were identified as samples containing the target doping genes, and to identify the type of gene, the size of the amplified gene and the fragments cut by Cas12a were confirmed (Confirm step). The process and results of the above blood direct amplification are illustrated in FIG. 2.
[0097] To utilize the fluorescence mechanism of the Cas12a (AsCpf1) protein, the Cas12a protein was first induced and expressed, and then purified. As confirmed in Fig. 3B, a clear band was observed at 153.9 kDa in the SDS-PAGE results of the purified Cas12a. When the Cas12a protein, crDNA, and target gene bind, they have a crystal structure as shown in Fig. 3A. That is, it was confirmed that 20 nts of target dsDNA complementary to 20 nts of crRNA specifically bound (Fig. 3C).
[0098] As illustrated in Fig. 3C, the Cas12a gene scissors move along the DNA while in a complex state with Cas12a and crRNA, confirming the DNA sequence match between the crRNA and the T-rich PAM sequence. When the DNA sequence matches the crRNA, cis-cleavage activity occurs to cleave the double-stranded DNA of the target gene, and simultaneously, trans-cleavage activity is exhibited on the non-target single-sequence DNA. By utilizing this trans-cleavage activity, a target sequence-dependent fluorescent response can be induced using a fluorescent reporter with a signaling substance attached to the ssDNA.
[0099] Four target doping genes (22K-GH, 20K-GH, EPO, IGF1) were analyzed using the above method. Figure 4A shows the cDNA-type gene structure of the above target doping genes and the attachment site of the primer of the present invention, and Figure 4B shows their sequence and the cis-cleavage site by Cas12a in more detail. As such, cDNA-based exogenous doping genes are characterized by a unique exon-exon junction, whereas endogenous genes contain both exons and introns, so an exon-exon junction does not exist. Therefore, in the present invention, primers targeting the exon-exon junction were designed for the detection of the above exogenous doping genes.
[0100] To evaluate the activity of crRNA using the above Cas12a, the generation of a fluorescent signal in a target-dependent manner was tested through single-stranded DNA (nucleic acid probe)-fluorescent reporter cleavage. As a result, as shown in Figure 5A, a clear target-dependent fluorescent signal was observed, and based on this, the reaction time of Cas12a and the concentration of the reporter were determined. As a result of the basic experiment to determine the reaction time and reporter concentration, a reaction time of 30 minutes was set using 10 pmol of reporter.
[0101] Meanwhile, the Cas12a reaction results for four non-amplified target genes at different concentrations could be confirmed as shown in Fig. 5B. Fig. 5B shows the Cas12a reaction results for four non-amplified target genes at different concentrations, confirming that they have a sensitivity of tens of pM. In other words, it can be seen that doping genes can be detected from trace amounts of blood samples only when amplification is involved.
[0102] As a result of confirming the target specificity of the crRNA and exogenous doping gene under the conditions set above and designed by fluorescence reaction, it was confirmed that a fluorescence reaction occurred only when the target of the crRNA and the target gene matched in all cases, as shown in Figure 6A. In other words, the distinction between endogenous and exogenous doping genes is clear, and since a clear target-dependent fluorescence signal was observed in the experimental results, it was found that Cas12a has cleavage activity and crRNA has high target specificity.
[0103] In addition, Figure 6B shows the results of performing multiplex Cas12a after multiplex direct blood amplification for each of the four doping genes. It was confirmed that all target doping genes could be amplified and detected by fluorescent reaction up to 2.5 copies. Furthermore, it was confirmed that the fluorescence intensity detected by each gene increased in a dose-dependent manner.
[0104] As described above, it was confirmed that the presence of multiple foreign doping genes in the blood can be analyzed quickly and conveniently within 90 minutes using the HiMDA of the present invention. In addition, the type of foreign doping gene can be identified through a simple electrophoresis process in addition to a fluorescence reaction using the HiMDA of the present invention.
[0105] Furthermore, since the present invention uses the blood itself as a template for amplifying target gene fragments, there is no possibility of sample contamination or alteration. In addition, the present invention has confirmed that all major isoforms of the target doping gene can be amplified and detected (e.g., GH (22K-GH, 20K-GH), IGF1 (IGF1A, IGF1B, IGF1C)).
[0106] To explain GH isotypes (22K, 20K) as an example, the same primers are used, but the crRNA is distinguished, allowing for the detection of isotypes and identification of their types.
[0107] In the case of IGF1, any of the three isoforms (IGF1A, B, C) can be detected using the same primer and crRNA.
[0108]
[0109] Experimental Example 2. Gene doping analysis using an in vitro model
[0110] 2-1. Construction and Validation of In vitro Cell Models for Gene Doping
[0111] To simulate a gene doping situation in which foreign genes are inserted into cells, a gene doping model was constructed using HEK-293-F cells, and HiMDA was performed on them in vitro. To create the HEK-293-F gene doping cell model, four types of exogenous doping genes (22K-GH, 20K-GH, EPO, and IGF1) were cloned into the pcDNA3.1 plasmid. The plasmids containing the exogenous doping genes were delivered to HEK-293-F cells using PEI (polyethylene imine) and cultured for 3 days at 37°C under 8% CO2 conditions. Subsequently, the cells and cell culture were recovered by centrifugation at 500 × g for 5 minutes. After performing such transient expression for 3 days, the cells were harvested.
[0112] The results of verifying the cell model constructed above can be seen in Figures 7A and 7B. A GFP fluorescent protein was linked to each inserted doping gene, and its expression was confirmed using a fluorescence microscope and fluorescence cytometry (FCM) (Figure 7A). At this time, distinct GFP positivity was observed in the transfected group at 48 and 72 hours after transfection compared to the untransfected control group. In addition, the results of analyzing the amount of GFP protein expressed from the cells by SDS-PAGE (Figure 7B) and enzyme-linked immunosorbent assay (ELISA) (Figure 7C) also confirmed that each target protein was expressed and secreted in all transfected cells.
[0113] 2-2. HiMDA Results Using an In vitro Cell Model
[0114] The above-described doping cell model was injected into the blood, and gene doping analysis was performed using multiplex blood direct amplification and multiplex CRISPR / Cas12a reactions. As confirmed in Figure 8A, target-specific fluorescence responses were found to be correlated with the number of transfected cells, allowing for the rapid identification of the presence of multiple gene doping targets. Specifically, compared to the control group (NC1: blank, NC2: untransfected HEK-293-F cells), the doping cell model exhibited dose-dependent fluorescence responses ranging from a minimum of 500 cells to a single cell.
[0115]
[0116] In addition, multiplex blood direct amplification was performed on the HEK-293-F in vitro model at different cell concentrations and electrophoresis was performed to analyze the gene fragment patterns of each delivery gene. As shown in Figure 8B, gene fragments of the target size were identified for each delivery gene, but it has the disadvantage of being difficult to isolate specific genes that exhibit fluorescent signals.
[0117] Therefore, after performing multiplex blood direct amplification on the HEK-293-F in vitro model at different cell concentrations, each target was cut using a multiplex CRISPR / Cas12a reaction, followed by electrophoresis. As shown in Fig. 8C, a single DNA fragment, which was not clearly distinguishable in Fig. 8B, was divided into an uncut fragment and two new fragments cut by Cas12a, demonstrating that the distinction by target gene became clear.
[0118]
[0119] Experimental Example 3. Gene doping analysis using an in vivo model
[0120] 3-1. Construction of an In vivo Mouse Model for Gene Doping
[0121] To develop a mouse model for gene doping, a characterized nano-inducer delivering the EPO gene (PEI+EPO nano-inducer: 80 μg PEI and 20 μg pEPO) was injected into the tail vein of a mouse using the same approach as used in Experimental Example 2 above. The EPO gene delivery nano-inducer is morphologically similar to that shown in Fig. 9A, in which PEI and the EPO gene are combined to form spherical nanoparticles. The size (Fig. 9B), stability (Fig. 9C), and zeta potential (Fig. 9D) of the nanoparticles represent the characteristics of the nano-inducer.
[0122] For the above mouse model, an untreated control group and a vehicle control group injected with 80 μg of PEI were established; the second injection was performed 12 hours after the first injection, and the third injection was performed 24 hours after the second injection. All mice were sacrificed 84 hours after the first injection, and whole blood samples were collected.
[0123] 3-2. HiMDA Results Using an In vivo Animal Model
[0124] Gene doping analysis was performed using multiplex direct blood amplification and multiplex CRISPR / Cas12a reactions with the in vivo model of 3-1 above, and the results are shown in Fig. 10A. Consequently, fluorescence was detected only in mice treated with an EPO nano-inducer (PEI+EPO), confirming that gene introduction was successfully achieved in the animal model. These results are also confirmed by the gene size analysis results by electrophoresis (Fig. 10B) and the gene fragment pattern analysis results of each delivered gene (Fig. 10C), demonstrating that it is possible to explore gene doping in vivo as well as gene doping in in vitro models.
[0125]
[0126] Experimental Example 4. Cell doping analysis using an in vivo model
[0127] 4-1. Preparation of In vitro Cell Models for Cell Doping
[0128] In addition, a cell model for cell doping was established as follows. 5 × 10⁶ EL4 cells (T cells) purchased from ATCC (cat. TIB-39) 5 Inoculate into a T-25 flask at cell density, centrifuge at 300 × g for 5 minutes at room temperature, then 1 × 10 6 The cells were transferred to a microcentrifuge tube. The cells were sterilized in PBS (Ca 2+ and Mg 2+After washing with (excluding), the EL4 cell pellet was suspended in Resuspension Buffer R (cat. MPK1096B, Invitrogen™) and transferred using a pipette to obtain a single-cell suspension. After transferring 1,000 ng / μl pEPO to a microcentrifuge tube, the Neon™ pipette containing the sample was inserted into a Neon™ tube containing 3 ml Electrolytic Buffer E (Cat. no. MPK1096B, Invitrogen™). Electroporation was performed using a Neon™ device (Cat. no. 17800225, Invitrogen™) with a combination of 1,550 volts, 10 ms, and 3 pulses. After electroporation, transfected EL4 cells were transferred to well plates containing antibiotic-free medium and cultured at 37°C and 5% CO2. Seven days after electroporation, all cells were transferred to a new well plate and selected by adding Geneticin (0.5 mg / ml) to the medium for one week. Fourteen days after electroporation, a higher concentration of Geneticin (1 mg / ml) was administered for another week.
[0129] Electron micrographs of EPO-EL4 prepared according to the above method are shown in Fig. 11A. By confirming the fluorescent signal from EPO linked to fluorescent protein (GFP), it can be seen that the EPO gene was successfully inserted. Furthermore, Western blot results for the analysis of mRNA and expressed protein (EPO) of the secreted EPO protein in the EPO-EL4 cells also confirmed that transduction was successfully achieved. (Figs. 11B to E)
[0130] 4-2. In vivo HiMDA results for cell doping
[0131] In addition, for the development of cell doping mimicking an in vivo mouse model, 5 × 10⁶ transfected as in 4-1 above 6Cans of EPO-EL4 cells were injected into mice via the tail vein. As controls, a non-administered group and 5 × 10⁶ per mouse were administered. 6 A T cell administration group was formed by injecting dogs with EL4 cells. The second injection was administered 12 hours after the first injection, and the third injection was administered 24 hours after the second injection. All mice were sacrificed 84 hours after the first injection, and whole blood samples were collected.
[0132] Multiple blood direct amplification and multiple CRISPR / Cas12 were performed on whole blood collected from the above mouse model. As a result, as shown in Figure 12, a high fluorescence signal was detected in mice injected with EPO-EL4 labeled EPO-secreting cells, and this was also confirmed in mice injected with EPO-secreting cells through gene analysis and gene fragment pattern analysis.
[0133] The present invention has been described above with reference to its preferred embodiments. Those skilled in the art will understand that the present invention may be embodied in modified forms without departing from the essential characteristics of the invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the invention is defined by the claims, not by the foregoing description, and all variations within the scope of the claims should be interpreted as being included in the invention.
Claims
1. 1 or more sets of primers for direct doping gene amplification; and A CRISPR-based composition for determining gene doping comprising guide RNA and Cas protein specific to the above-mentioned doping gene 2. In Paragraph 1, The above composition further comprises a nucleic acid probe containing a labeling substance for labeling a doping gene.
3. In Paragraph 2, A composition comprising a nucleic acid sequence having a length of 3 to 300 nt, wherein the above nucleic acid probe is in the form of any one of a primer for amplifying a specific nucleic acid, a molecular beacon with a hairpin structure whose structure changes depending on whether it binds to a target, or a linker for inducing hydrogel formation.
4. In Paragraph 2, A composition comprising one or more labels selected from the group comprising: a fluorescent label including FAM, HEX, ROX, Cy3 or Cy5; a quencher including BHQ1, BHQ2, BHQ3 or TAMRA; a biochemical label including biotin or digoxigenin (DIG); methylene blue for electrochemical analysis; and an SH group for immobilization analysis.
5. In Paragraph 1, The above-mentioned doping genes are erythropoietin (EPO), human growth hormone (hGH), insulin-like growth factor-1 (IGF-1), human chorionic gonadotropin (hCG), fibroblast growth factors (FGFs), hepatocyte growth factor (HGF), mechano growth factors (MGFs), platelet-derived growth factor (PDGF), thymosin beta 4, vascular endothelial growth factor (VEGF), activin A-neutralizing antibodies, activin receptor IIB competitors, anti-activin receptor IIB antibodies, and myostatin-binding proteins. A composition selected from the group consisting of myostatin- or precursor-neutralizing antibodies, GH-releasing peptides (GHRPs), and TGF-beta, transforming growth factor beta signaling inhibitors.
6. In Paragraph 1, A composition in which the above Cas protein is selected from the group comprising Cas12, Cas13, and Cas14 having trans-cleavage activity.
7. In Paragraph 1, A composition in which the above guide RNA is crRNA or gRNA.
8. In Paragraph 1, A composition wherein the primer sequence is selected from a first primer set comprising a nucleotide sequence represented by SEQ ID NO. 1 and a nucleotide sequence represented by SEQ ID NO. 2; a second primer set comprising a nucleotide sequence represented by SEQ ID NO. 3 and a nucleotide sequence represented by SEQ ID NO. 4; and a third primer set comprising a nucleotide sequence represented by SEQ ID NO. 5 and a nucleotide sequence represented by SEQ ID NO.
6.
9. In Paragraph 1, A composition in which the guide RNA is a crRNA selected from the group consisting of SEQ ID NOs 7 to 10.
10. A CRISPR-based multiplex gene doping detection method using the composition of claim 1, 1) A step of directly amplifying using a primer set for one or more target doping genes to be detected in a biological sample isolated from an individual suspected of gene doping; 2) a step of detecting the target doping gene using guide RNA and Cas protein specific to the two or more amplified target doping genes, and generating a fluorescent signal using a single-sequence nucleic acid probe; and 3) A method comprising, after the step of generating the above fluorescent signal, a step of confirming whether two or more target doping genes are doped.
11. In Paragraph 10, A method in which the biological sample is selected from the group comprising blood, serum, plasma, urine, saliva, sweat, tears, cerebrospinal fluid (CSF), mucus, tissue sample (biopsy tissue), cell extract, hair, nails, and feces.
12. A CRISPR-based information providing system for multiple gene doping or cell identification including the following. i) a gene amplification unit comprising a biological sample isolated from an individual suspected of gene doping and a set of primers specific to one or more target doping genes to be detected; ii) a gene amplification confirmation unit that confirms gene amplification through fluorescence development using a nucleic acid probe comprising a guide RNA specific to two or more amplified target doping genes obtained from the gene amplification unit; a Cas protein; and a labeling substance; and iii) A multiple gene doping verification unit that verifies the type of amplified gene appearing in the gene amplification verification unit above.
13. A CRISPR-based multi-cell doping detection method using the composition of claim 1, A method comprising the steps of: amplifying and analyzing one or more target doping genes to be detected from cells contained in a biological sample separated from an individual suspected of cell doping; or analyzing an expression product expressed from said cells.
14. In Paragraph 13, The step of amplifying and analyzing one or more target doping genes above 1) A step of directly amplifying using a primer set for one or more of the target doping genes to be detected; 2) A method comprising the step of detecting the target doping gene using guide RNA and Cas protein specific to the two or more amplified target doping genes, and generating a fluorescent signal using a single-sequence nucleic acid probe.
15. In Paragraph 13, A method in which the expression product expressed from the above cell comprises mRNA or protein.