One-step assay technique for antibiotic-resistant strains

WO2026205715A1PCT designated stage Publication Date: 2026-10-01KOREA RES INST OF BIOSCIENCE & BIOTECHNOLOGY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2026/000391
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-06-27
Filing Date
2026-01-07
Publication Date
2026-10-01

Smart Images

  • Figure KR2026000391_01102026_PF_FP_ABST
    Figure KR2026000391_01102026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to an one-step assay technique for antibiotic-resistant strains. The assay technique according to the present invention is based on rolling circle amplification (RCA) technology that enables uniform amplification using circular DNA and serves as an efficient amplification platform using minimal enzymes and probes, and exhibits excellent sensitivity and performance in detecting genes in synthetic nucleic acids, cultured bacteria, and collected bacteria. In addition, the assay technique enables quick and sensitive detection of airborne antibiotic-resistant bacteria, and thus has potential as a next-generation detection platform.
Need to check novelty before this filing date? Find Prior Art

Description

One-step analysis technology for antibiotic-resistant strains

[0001] The present invention relates to a one-step analysis technology for antibiotic-resistant strains.

[0002] Antibiotic resistance has emerged as a critical global health challenge of the 21st century due to limitations in the development of new antibiotics and the accelerating spread of infectious diseases. It is estimated that approximately 1.14 million of the 4.71 million deaths caused by bacterial infections in 2021 were due to antibiotic resistance; among these, the mortality rate due to antibiotic resistance decreased in the population under 5 years of age but increased significantly in the population aged 5 and older. This indicates that mortality trends due to antibiotic resistance have varied considerably by age and region over the past 30 years. Various statistical projections highlight the serious risks of antibiotic resistance, predicting that the mortality rate due to antibiotic resistance in the population aged 70 and older will increase by up to 70% by 2050.

[0003] Recently, analysis reports addressing concerns regarding the transmission and spread of airborne bacteria have been published. Among them, methicillin-resistant Staphylococcus aureus (MRSA) has been reported to act as a causative agent for hospital-acquired pneumonia and ventilator-associated pneumonia when transmitted through the air due to various virulence factors. Furthermore, the transmission of vancomycin-resistant Enterococcus (VRE) is associated with a high incidence of severe sepsis and septic shock, with a mortality rate approaching 40%. Given these risks, there is an increasing demand for detection methods capable of rapidly identifying and responding to potential health threats. Therefore, on-site detection technology is necessary to prevent airborne transmission.

[0004] Conventional methods for detecting antibiotic-resistant bacteria have relied on antibiotic disk diffusion analysis and polymerase chain reaction (PCR). However, these methods have significant limitations due to their labor-intensive and time-consuming nature. Recently, various high-sensitivity field detection and monitoring methods have been developed to detect airborne bacteria. In particular, nucleic acid-based detection methods targeting specific bacterial genes are attracting attention. These methods are particularly promising due to their high stability and excellent sensitivity and accuracy. Reverse transcription loop-mediated isothermal amplification is rapidly emerging as a high-sensitivity isothermal nucleic acid amplification technology, demonstrating compatibility with reverse transcription PCR (RT-PCR). However, a drawback is that it requires the complex design and application of 4 to 6 primers, along with strict pH conditions and specific temperature ranges.

[0005] Furthermore, recombinant polymerase chain reaction (RPC) amplification is an alternative method capable of rapidly and efficiently amplifying specific target deoxyribonucleic acid (DNA) at room temperature. While this approach allows for rapid detection with high sensitivity, it carries a risk of false positives and may result in reduced accuracy depending on reaction conditions. Various application studies utilizing nucleic acid-based detection have been conducted to address the limitations associated with each isothermal amplification technique. Despite recent technological advancements, there are significant limitations to on-site detection due to the need for precise temperature control, complex procedures, and the use of multiple enzymes.

[0006] Accordingly, the inventors have completed the present invention by developing a Cas9 nickase-induced amplification reaction (CN-TAR) assay that can rapidly and sensitively detect antibiotic-resistant bacteria using a portable isothermal PCR device.

[0007] One object of the present invention is to comprise (i) a Cas9n protein (Cas9 nickase); (ii) a single-chain guide RNA (sgRNA) comprising a targeting sequence that specifically binds to a target nucleic acid; (iii) circular DNA having the structure of structural formula I below; and (iv) a fluorescent molecule that is captured in an amplification product and emits light;

[0008] [Structural Formula I]

[0009] 5'-XY-3'

[0010] The present invention provides a composition for detecting a target nucleic acid, wherein X is a sequence position complementary to a terminal portion of the target nucleic acid cleaved by an activated Cas9n protein, and Y is a position where a G-quadruplex structure is generated after amplification.

[0011] Another objective of the present invention is to provide a kit for detecting target nucleic acids comprising a detection composition according to the present invention.

[0012] Another object of the present invention comprises: a) reacting a sample with a Cas9n / sgRNA complex comprising a Cas9n protein (Cas9 nickase); and sgRNA (single chain guide) comprising a targeting sequence that specifically binds to a target nucleic acid; and b) treating the reaction product of step a) with circular DNA having the structural formula I below; and a fluorescent molecule; and

[0013] [Structural Formula I]

[0014] 5'-XY-3'

[0015] The present invention provides a method for detecting a target nucleic acid, wherein X is a sequence position complementary to a terminal portion of the target nucleic acid cleaved by an activated Cas9n protein, and Y is a position where a G-quadruplex structure is generated after amplification.

[0016] Another objective of the present invention is to provide a composition for detecting antibiotic-resistant bacteria comprising: a first agent comprising a Cas9n protein (Cas9 nickase); an sgRNA comprising a targeting sequence that specifically binds to the target DNA of antibiotic-resistant bacteria; and a second agent comprising a circular DNA that binds complementarily to the target DNA in the reaction product produced by the first agent.

[0017] Another objective of the present invention is to provide a kit for detecting antibiotic-resistant bacteria comprising a detection composition according to the present invention.

[0018] Another objective of the present invention is to provide a method for detecting antibiotic-resistant bacteria, comprising: a) reacting a sample with a Cas9n / sgRNA complex composed of a Cas9n protein (Cas9 nickase); and sgRNA having a targeting sequence that specifically binds to the target DNA of antibiotic-resistant bacteria; and b) treating the reaction product of step a) with circular DNA that binds complementarily to the target DNA of antibiotic-resistant bacteria; and a fluorescent molecule.

[0019] In the following, redundant details will be omitted to prevent clutter. In other words, the content of the invention is not limited solely to the following, and should be interpreted in accordance with the overall context of the invention.

[0020] Furthermore, the terms used in this invention are for illustrative purposes only and should not be interpreted as intended to be limiting. Singular expressions include plural expressions unless the context clearly indicates otherwise. In this invention, terms such as "comprising" or "having" are intended to specify the existence of the features, numbers, steps, actions, components, parts, or combinations thereof described in the specification, and should be understood as not precluding the existence or addition of one or more other features, numbers, steps, actions, components, parts, or combinations thereof.

[0021] Furthermore, unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as generally understood by those skilled in the art to which the embodiments pertain. Terms such as those defined in commonly used dictionaries should be interpreted as having a meaning consistent with their meaning in the context of the relevant technology, and should not be interpreted in an ideal or overly formal sense unless explicitly defined in this application.

[0022] Antibiotic resistance is emerging as a significant issue in the 21st-century global healthcare sector due to limitations in the development of new antibiotics and the rapid spread of infectious diseases. In particular, methicillin-resistant Staphylococcus aureus (MRSA) and vancomycin-resistant enterococci (VRE) are reported to have high incidence and mortality rates as major causative pathogens of pneumonia and sepsis, respectively.

[0023] Accordingly, the inventors propose the Cas9 nickase-induced amplification reaction (CN-TAR) assay as a real-time on-site detection technique to prevent airborne transmission. The CN-TAR assay utilizes a single-step detection reaction based on rolling circle amplification, which involves clustering CRISPR Cas9 nickase to cleave the double-stranded DNA of a target gene. The present invention demonstrated the feasibility of on-site detection by integrating a portable isothermal polymerase chain reaction (PCR) device into the CN-TAR assay. Furthermore, the performance of the CN-TAR assay was evaluated using synthetic nucleic acids, cultured bacteria, and bacteria collected from the air.

[0024] Accordingly, the present invention, in one preferred embodiment, comprises (i) a Cas9n protein (Cas9 nickase); (ii) a single-chain guide RNA (sgRNA) comprising a targeting sequence that specifically binds to a target nucleic acid; (iii) circular DNA having the structure of structural formula I below; and (iv) a fluorescent molecule that is captured in the amplification product and emits light.

[0025] [Structural Formula I]

[0026] 5'-XY-3'

[0027] The present invention provides a composition for detecting a target nucleic acid, wherein X is a sequence position complementary to a terminal portion of the target nucleic acid cleaved by an activated Cas9n protein, and Y is a position where a G-quadruplex structure is generated after amplification.

[0028] Specifically, in the composition for detecting a target nucleic acid according to the present invention, a portion of the target nucleic acid binds to sgRNA, and when the end of the target nucleic acid is cleaved by the activated Cas9n protein, it binds to circular DNA on one side of the cleaved portion. Subsequently, a rolling circle amplification (RCA) reaction for the target nucleic acid is initiated by a nucleic acid polymerase. When the amplification product forms a G-quadruplex structure through the amplification reaction, a fluorescent molecule is captured and luminescence occurs, thereby enabling the detection of the target nucleic acid.

[0029] The term "Cas9n protein" as used in this invention refers to a modified form of the Cas9 protein, a core enzyme of the CRISPR-Cas9 system, which generates single-strand breaks in DNA rather than double-strand breaks. This is designed by introducing a mutation, such as D10A, into the RuvC domain; that is, one of the nuclease domains (RuvC or HNH) is mutated to prevent it from cutting DNA strands.

[0030] Information on the Cas9n protein gene and protein is available from GenBank of the National Center for Biotechnology Information (NCBI), but is not limited thereto.

[0031] The term "sgRNA" used in the present invention is a guide RNA connected as a single strand while maintaining the roles of crRNA and tracrRNA.

[0032] The specific binding of guide RNA (sgRNA) to a target gene may mean that a guide RNA with a sequence complementary to the target gene hybridizes with the single-stranded target sequence of the target gene to form a double-stranded molecule (hybrid).

[0033] The sequence of the guide RNA that is complementary to the target gene may hybridize with a portion of the target gene, and the complementary sequence may be a sequence that is 90% or more, specifically 95% or more, and more specifically 100% complementary to a portion of the target gene.

[0034] Guide RNA (sgRNA) may include a sequence complementary to the target nucleic acid, and may include a polynucleotide complementary to a sequence of 2 to 24 nucleotides (e.g., approximately 20 nt) (hereinafter referred to as 'nt') in the 5' or 3' direction of PAM in the target nucleic acid. The length of the guide RNA may be 10 nt to 100 nt, 10 nt to 90 nt, 10 nt to 80 nt, 10 nt to 70 nt, 10 nt to 60 nt, 10 nt to 50 nt, 15 nt to 50 nt, 20 nt to 50 nt, 25 nt to 50 nt, 30 nt to 50 nt, 35 nt to 50 nt, 40 nt to 50 nt, or 45 nt to 50 nt.

[0035] The term "circular DNA" used in the present invention refers to a rolling circle template (RCT) that acts as a padlock probe DNA, and is designed to be complementary to the tail generated when the Cas9n protein cleaves the double-stranded DNA produced by the binding of the target gene and sgRNA. That is, the circular DNA binds to the 3' region of the target gene (gDNA).

[0036] The rolling circle amplification (RCA) product utilizing circular DNA is designed to form a secondary G-quadruplex so that a fluorescent molecule can be incorporated into this structure. For example, the fluorescent molecule may be any one selected from the group consisting of thioflavin T, N-methyl mesoporphyrin IX, crystal violet, and BMVC (3,6-bis(1-methyl-4-vinylpyridinium)carbazole diiodide).

[0037] In a more preferred embodiment, the composition may further include dNTPs and nucleic acid polymerases for a rolling circle amplification (RCA) reaction.

[0038] The above dNTPs (deoxynucleotide triphosphates) include dATP, dTTP, dGTP, and dCTP, and play a role in extending the DNA sequence.

[0039] The above nucleic acid polymerase is an enzyme that plays a role in initiating the RCA reaction, and may be any one selected from the group consisting of Phi29 DNA polymerase, phage M2 DNA polymerase, phage Phi-PRD1 DNA polymerase, VENT.RTM DNA polymerase, Klenow fragment DNA polymerase I, T5 DNA polymerase, PRD1 DNA polymerase, T4 DNA polymerase holoenzyme, T7 native polymerase, and Bst polymerase, and preferably may be Phi29 DNA polymerase.

[0040] As used in this specification, the term "target gene sequence" refers to a nucleotide present in a target gene or nucleic acid, specifically a nucleotide sequence of a part of a target region within a target gene or nucleic acid, wherein the "target region" is a site within the target gene or nucleic acid that can be modified or cleaved by a guide nucleic acid-editor protein. That is, in the present invention, "target nucleic acid" refers to a nucleic acid sequence to be detected and is used interchangeably with "target nucleic acid" or "target sequence." For example, the target nucleic acid may be any one selected from the group consisting of DNA, miRNA, miRNA sponge, tough decoy miRNA, anti-miR, small RNA, siRNA, and shRNA.

[0041] For example, such targeted nucleic acid detection may preferably be for the detection of nucleic acids for pathogens. "Pathogen" refers to an organism that can cause disease by directly damaging host tissues or by producing toxins, such as bacteria, viruses, fungi, and other parasites.

[0042] Exemplary bacterial genera of pathogens include Staphylococcus, Streptococcus, Pseudomonas, Escherichia, Salmonella, Helicobacter, Neisseria, Campylobacter, Chlamydia, Clostridium, Vibrio, Treponema, Escherichia coli, Mycobacterium, Klebsiella, Actinomyces, Bacterioides, Bordetella, Borrelia, Brucella, and Corynebacterium. Diplococcus, Enterobacter, Fusobacterium, Leptospira, Listeria, Pasteurella, Proteus, Rickettsia, Shigella, Sphaerophorus, Acinetobacter, Aeromonas Burkholderia, Campylobacter, Corynebacterium, Enterococcus, Erwinia, Francisella, Haemophilus, Helicobacter, Legionella, Leptospira, Listeria, Mycoplasma, Neisseria, Veillonella, Vibrio, Coxiella, IMP (Imipenemase), NDM (New-Delhi metallo-beta-lactamase),It is VIM (Verona Integron-encoded Metallo-beta-lactamase), OXA-48 (Oxacillinase-48), or Yersinia.

[0043] The target nucleic acid detection technology according to the present invention detects nucleic acids present in pathogens with high sensitivity and accuracy, and thereby can provide specific information regarding whether a target pathogen is infected, the presence of the pathogen, etc.

[0044] In another preferred embodiment, the present invention provides a kit for detecting target nucleic acids comprising a detection composition as described above.

[0045] The above-described kit may additionally include a user guide describing the optimal conditions for performing the reaction. The guide is a printed document explaining the use of the kit, for example, the method for preparing the buffer solution, the presented sequence of colorimetric detections, etc. The guide includes instruction booklets in the form of pamphlets or leaflets, labels attached to the kit, and descriptions on the surface of the package containing the kit. Additionally, the guide includes information disclosed or provided through electronic media, such as the Internet.

[0046] In another preferred embodiment, the present invention comprises: a) reacting a sample with a Cas9n / sgRNA complex comprising a Cas9n protein (Cas9 nickase); and sgRNA (single chain guide) comprising a targeting sequence that specifically binds to a target nucleic acid; and b) treating the reaction product of step a) with circular DNA having the structural formula I below; and a fluorescent molecule; and

[0047] [Structural Formula I]

[0048] 5'-XY-3'

[0049] The present invention provides a method for detecting a target nucleic acid, wherein X is a sequence position complementary to a terminal portion of the target nucleic acid cleaved by an activated Cas9n protein, and Y is a position where a G-quadruplex structure is generated after amplification.

[0050] In the method for detecting antibiotic-resistant bacteria according to the present invention, the sample may be a sample obtained from an individual that is infected with or suspected of being infected with antibiotic-resistant bacteria. The individual may be a mammal, for example, a human, mouse, rat, cattle, horses, pigs, dogs, sheep, ferrets, hamsters, monkeys, apes, goats, or cats.

[0051] In the present invention, the term "sample (biological sample)" refers to any sample containing a target gene of antibiotic-resistant bacteria. The biological sample may be any tissue or body fluid obtained from a subject containing a target gene of antibiotic-resistant bacteria.

[0052] The biological samples described above include, but are not limited to, the subject's sputum, blood, serum, plasma, blood cells (e.g., leukocytes), tissue, biopsy sample, smear sample, wash sample, swab sample, cell-containing body fluid, liquid nucleic acid, urine, peritoneal fluid and pleural fluid, cerebrospinal fluid, feces, leaky fluid, or cells derived therefrom. The biological samples may also include tissue sections taken for histological purposes, i.e., frozen or fixed sections, or microscopic cells or extracellular portions thereof. The biological samples may be obtained in a manner that does not cause harm to the subject.

[0053] In the present invention, the term "detection" includes quantitative and / or qualitative analysis, including the detection of presence or absence, and the detection of the amount (level) present.

[0054] In addition, the present invention provides, in another preferred embodiment, a composition for detecting antibiotic-resistant bacteria comprising a first agent comprising a Cas9n protein (Cas9 nickase); an sgRNA comprising a targeting sequence that specifically binds to the target DNA of antibiotic-resistant bacteria; and a second agent comprising a circular DNA that binds complementarily to the target DNA in the reaction product produced by the first agent.

[0055] In a more preferred embodiment, the antibiotic-resistant bacteria are Staphylococcus aureus-resistant bacteria (MRSA) or vancomycin-resistant bacteria (VRE).

[0056] As used herein, the term “target gene sequence” refers to a nucleotide present in a target gene or nucleic acid, specifically a nucleotide sequence of a part of a target region within a target gene or nucleic acid, wherein the “target region” is a site within a target gene or nucleic acid that can be modified or cleaved by a guide nucleic acid-editor protein. Preferably, the target gene may be mecA in the case of MRSA or vancomycin-resistant bacteria (VRE).

[0057] The term "Cas9n protein" as used in this invention refers to a modified form of the Cas9 protein, a core enzyme of the CRISPR-Cas9 system, which generates single-strand breaks in DNA rather than double-strand breaks. This is designed by introducing a mutation, such as D10A, into the RuvC domain; that is, one of the nuclease domains (RuvC or HNH) is mutated to prevent it from cutting DNA strands.

[0058] Information on the Cas9n protein gene and protein is available from GenBank of the National Center for Biotechnology Information (NCBI), but is not limited thereto.

[0059] The term "sgRNA" used in the present invention is a guide RNA connected as a single strand while maintaining the roles of crRNA and tracrRNA.

[0060] The specific binding of guide RNA (sgRNA) to a target gene may mean that a guide RNA with a sequence complementary to the target gene hybridizes with the single-stranded target sequence of the target gene to form a double-stranded molecule (hybrid).

[0061] The sequence of the guide RNA that is complementary to the target gene may hybridize with a portion of the target gene, and the complementary sequence may be a sequence that is 90% or more, specifically 95% or more, and more specifically 100% complementary to a portion of the target gene.

[0062] Guide RNA (sgRNA) may include a sequence complementary to the target nucleic acid, and may include a polynucleotide complementary to a sequence of 2 to 24 nucleotides (e.g., approximately 20 nt) (hereinafter referred to as 'nt') in the 5' or 3' direction of PAM in the target nucleic acid. The length of the guide RNA may be 10 nt to 100 nt, 10 nt to 90 nt, 10 nt to 80 nt, 10 nt to 70 nt, 10 nt to 60 nt, 10 nt to 50 nt, 15 nt to 50 nt, 20 nt to 50 nt, 25 nt to 50 nt, 30 nt to 50 nt, 35 nt to 50 nt, 40 nt to 50 nt, or 45 nt to 50 nt.

[0063] In a more preferred embodiment, the sgRNA comprises one or more nucleic acid sequences selected from the group consisting of SEQ ID NOs 5, 7, 9, 11, 13 and 15.

[0064] In the present invention, the term "specific binding" may be used interchangeably with hybridization.

[0065] The term "circular DNA" used in the present invention refers to a rolling circle template (RCT) that acts as a padlock probe DNA, and is designed to be complementary to the tail generated when the Cas9n protein cleaves the double-stranded DNA produced by the binding of the target gene and sgRNA. That is, the circular DNA binds to the 3' region of the target gene (gDNA).

[0066] In a preferred embodiment, the above-mentioned circular DNA has the structure of the following structural formula I.

[0067] [Structural Formula I]

[0068] 5'-XY-3'

[0069] The above X is a sequence position complementary to a terminal portion of the target nucleic acid cleaved by the activated Cas9n protein, and

[0070] The above Y is the location where a G-quadruplex structure is generated after amplification.

[0071] The rolling circle amplification (RCA) product utilizing circular DNA is designed to form a secondary G-quadruplex so that fluorescent molecules can be incorporated into this structure.

[0072] At this time, the preferred concentration of circular DNA can be applied as 0.25 to 300 pmol, more preferably 0.62 to 250 pmol, and most preferably 125 to 250 pmol. This is because identifiable fluorescence intensity can be confirmed at the corresponding concentration.

[0073] In a more preferred embodiment, the circular DNA comprises one or more nucleic acid sequences selected from the group consisting of SEQ ID NOs 6, 8, 10, 12, 14 and 16.

[0074] In the most preferred embodiment, the composition comprises sgRNA of SEQ ID NO. 9 and circular DNA of SEQ ID NO. 10 for detecting Staphylococcus aureus resistant strain (MRSA), and sgRNA of SEQ ID NO. 13 and circular DNA of SEQ ID NO. 14 for detecting vancomycin resistant strain (VRE).

[0075] According to one embodiment of the present invention, by combining the sgRNA of the above sequence and circular DNA, it was possible to specifically detect Staphylococcus aureus resistant bacteria (MRSA) and vancomycin resistant bacteria (VRE) with high sensitivity without detecting non-specific fluorescent signals.

[0076] In a more preferred embodiment, the second formulation further comprises a DNA polymerase; a fluorescent molecule; and dNTPs.

[0077] Fluorescent dyes that intercouple into a G-quadruplex structure can be applied at a concentration preferably of 1 to 200 μM, more preferably of 10 to 100 μM, and most preferably of 50 μM. This is because the highest fluorescence intensity was observed at the corresponding concentration.

[0078] In addition, DNA polymerase important for the amplification reaction may preferably be applied in an amount of 1 to 30 units, more preferably 1.25 to 10 units, and most preferably 5 to 10 units, and the concentration of dNTPs may preferably be applied in an amount of 10 to 500 μM, and more preferably 50 to 400 μM. This is because the highest fluorescence intensity was observed at the corresponding concentrations.

[0079] According to another feature of the present invention, the incubation step may be performed at 25 to 40°C for 5 to 10 minutes, but is not limited thereto, and as a preferred example, may be performed at 30°C.

[0080] In a more preferred embodiment, the DNA polymerase is an enzyme that initiates the RCA reaction and may be any one selected from the group consisting of Phi29 DNA polymerase, phage M2 DNA polymerase, phage Phi-PRD1 DNA polymerase, VENT.RTM DNA polymerase, Klenow fragment DNA polymerase I, T5 DNA polymerase, PRD1 DNA polymerase, T4 DNA polymerase holoenzyme, T7 native polymerase, and Bst polymerase, and preferably may be Phi29 DNA polymerase. Phi29 DNA polymerase performs two important roles as an exonuclease and a polymerase.

[0081] During the reaction, tails of different lengths that are not complementary to the circular DNA may protrude from the 5' and 3' ends of the target DNA sequence. Thanks to the 3' → 5' exonuclease activity of Phi29 DNA polymerase, the 3' end tail can be gradually digested until the remaining portion is converted into an RCA primer and extended along the circular template through the polymerase activity of Phi29 DNA polymerase. Then, RCA can proceed smoothly. At this point, Phi29 DNA polymerase is typically used in the RCA reaction, but its exonuclease activity is rarely utilized.

[0082] The term "fluorescence molecule" used in the present invention may refer to a type of light emission generated for a short period of time by electromagnetic excitation. More specifically, fluorescence may refer to a phenomenon generated when a specific substance absorbs light energy at a short wavelength and then emits light energy at a longer wavelength, and the time length between absorption and emission is typically relatively short, for example, within the range of about 10⁻⁹ to 10⁻⁸ seconds.

[0083] In a more preferred embodiment, the fluorescent molecule may be any one selected from the group consisting of thioflavin T, N-methyl mesoporphyrin IX, crystal violet and BMVC (3,6-bis(1-methyl-4-vinylpyridinium)carbazole diiodide), and most preferably thioflavin T.

[0084] Thioflavin T (ThT) is a highly sensitive G-quadruplex fluorescent probe that exhibits excellent specificity for DNA of different structures, including single-stranded and double-stranded DNA. Thioflavin T is a fluorescent molecule with an absorption wavelength of 470 nm and an emission wavelength of 522 nm, and when incorporated into a G-quadruplex, it emits light, enabling fluorescence analysis of target genes.

[0085] N-methyl mesoporphyrin IX (8,13-diethyl-3,7,12,17,23-pentamethyl-21H,23H-porphine-2,18-dipropanoic acid) is a fluorescent molecule with an absorption wavelength of 399 nm and an emission wavelength of 610 nm, and can be used as a turn-on biosensor for a target DNA sequence when it forms a complex with a G-quadruplex-forming sequence fused to a DNA sequence complementary to the target sequence.

[0086] Crystal violet is a fluorescent molecule with an absorption wavelength of 550 nm and an emission wavelength of 695 nm, and can be used as a selective probe for G-quadruplex structures.

[0087] BMVC (3,6-bis(1-methyl-4-vinylpyridinium)carbazole diiodide) is a G-quadruplex target phosphor with an absorption wavelength of 480 nm and an emission wavelength of 520 nm.

[0088] As the reaction according to the present invention proceeds, increasingly more G-quadruplexes accumulate, which can be easily detected by the fluorescent molecule described above.

[0089] Specifically, when sgRNA specifically binds to target DNA, Cas9 nickase generates a single-strand cleavage, and as circular DNA binds to the 3' region of the cleaved target gene, a circular RCA template is formed. The tail protruding from the 3' end of the target DNA sequence is degraded by the 3' → 5' exonuclease activity of Phi29 DNA polymerase, even if it folds into a double-strand structure. The degraded DNA fragment can then initiate an RCA reaction. The RCA product, designed to fold into a G-quadruplex structure, accumulates exponentially when a nicking endonuclease recognition site is reasonably introduced into the RCA template where appropriate, and can be easily detected by the aforementioned fluorescent molecule (e.g., thioflavin T (ThT), etc.).

[0090] Meanwhile, as another preferred embodiment, the present invention provides a kit for detecting antibiotic-resistant bacteria comprising a detection composition as described above.

[0091] The above-described kit may additionally include a user guide describing the optimal conditions for performing the reaction. The guide is a printed document explaining the use of the kit, for example, the method for preparing the buffer solution, the presented sequence of colorimetric detections, etc. The guide includes instruction booklets in the form of pamphlets or leaflets, labels attached to the kit, and descriptions on the surface of the package containing the kit. Additionally, the guide includes information disclosed or provided through electronic media, such as the Internet.

[0092] Meanwhile, in another preferred embodiment, the present invention provides a method for detecting antibiotic-resistant bacteria comprising: a) reacting a sample with a Cas9n / sgRNA complex composed of a Cas9n protein (Cas9 nickase); and sgRNA having a targeting sequence that specifically binds to the target DNA of antibiotic-resistant bacteria; and b) treating the reaction product of step a) with circular DNA that binds complementarily to the target DNA of antibiotic-resistant bacteria; and a fluorescent molecule.

[0093] In the method for detecting antibiotic-resistant bacteria according to the present invention, the sample may be a sample obtained from an individual that is infected with or suspected of being infected with antibiotic-resistant bacteria. The individual may be a mammal, for example, a human, mouse, rat, cattle, horses, pigs, dogs, sheep, ferrets, hamsters, monkeys, apes, goats, or cats.

[0094] In the present invention, the term "sample (biological sample)" refers to any sample containing a target gene of antibiotic-resistant bacteria. The biological sample may be any tissue or body fluid obtained from a subject containing a target gene of antibiotic-resistant bacteria.

[0095] The biological sample comprises, but is not limited to, the subject's sputum, blood, serum, plasma, blood cells (e.g., leukocytes), tissue, biopsy sample, smear sample, wash sample, swab sample, cell-containing body fluid, liquid nucleic acid, urine, peritoneal fluid and pleural fluid, cerebrospinal fluid, feces, leaky fluid, or cells derived therefrom. The biological sample may also comprise tissue sections taken for histological purposes, i.e., frozen or fixed sections, or microscopic cells or extracellular portions thereof. The biological sample may be obtained in a manner that does not cause harm to the subject.

[0096] In the present invention, the term "detection" includes quantitative and / or qualitative analysis, including the detection of presence or absence, and the detection of the amount (level) present.

[0097] The detection method according to the present invention consists of two steps: cutting a target gene using a CRISPR system, and initiating amplification by binding circular DNA to the cut target site. By integrating these two steps into a single step, the method according to the present invention enabled the development of a high-sensitivity, low-complexity detection platform. Furthermore, by applying the method according to the present invention to a portable isothermal PCR device, target genes can be detected on-site without spatial constraints.

[0098] In one embodiment of the present invention, the method according to the present invention was evaluated using synthetic DNA, cultured bacteria, and bacteria collected from the air, and the LODs for MRSA and VRE were confirmed to be 1.40 copies / µl and 1.13 copies / µl, respectively. In addition, as a result of analyzing various airborne bacteria, it was confirmed that the method according to the present invention showed detection performance similar to reverse transcription-PCR, and that it can selectively detect target bacterial genes with high specificity.

[0099] The analytical technology according to the present invention is based on Rolling Circle Amplification (RCA) technology, which enables uniform amplification using circular DNA and serves as an efficient amplification platform using minimal enzymes and probes, and exhibits excellent sensitivity and performance in detecting genes in synthetic nucleic acids, cultured bacteria, and collected bacteria. In addition, this analytical method can rapidly and sensitively detect airborne antibiotic-resistant bacteria, thus having potential as a next-generation detection platform.

[0100] Figure 1 is a schematic diagram of the Cas9 nickase-induced amplification reaction (CN-TAR) assay for the detection of airborne antibiotic-resistant bacteria ((a): conceptual diagram of the CN-TAR assay detection process of antibiotic-resistant bacteria collected using an electrostatic air sampler, (b): overall workflow of the CN-TAR assay).

[0101] Figure 2 shows the evaluation results of the CRISPR-based CN-TAR assay at various temperatures (real-time fluorescence intensity of the CN-TAR assay at various reaction temperatures: (a) 30℃, (b) 37℃, (c) 40℃).

[0102] Figure 3 shows the optimization results of reaction components for CRISPR-based CN-TAR analysis ((a): circular DNA, (b): thioflavin T, (c): phi29 DNA polymerase, and (d): dNTP concentration optimization).

[0103] Figure 4 shows the results of CN-TAR analysis for methicillin-resistant Staphylococcus aureus (MRSA) ((a), (d), (g): design of sgRNA probe sequences targeting the mecA gene of methicillin-resistant Staphylococcus aureus (MRSA), (b), (e), (h): real-time fluorescence intensity obtained using the designed probe in CN-TAR analysis for the mecA gene, (c), (f), (i): endpoint fluorescence).

[0104] Figure 5 shows the results of CN-TAR analysis for vancomycin-resistant enterococci (VRE) ((a), (d), (g): design of sgRNA probe sequences targeting the vanA gene of vancomycin-resistant enterococci (VRE), (b), (e), (h): real-time fluorescence intensity obtained using the designed probe in CN-TAR analysis for the vanA gene, (c), (f), (i): endpoint fluorescence).

[0105] Figure 6 shows the results of evaluating the sensitivity of the CRISPR-based CN-TAR assay (real-time fluorescence intensity for (a) MRSA and (b) VRE targeting various concentrations of synthetic DNA, and (c) endpoint fluorescence over reaction time for MRSA and (d) VRE).

[0106] Figure 7 shows the results of reverse transcription polymerase chain reaction (RT-PCR) analysis of cultured bacteria (RT-PCR analysis was performed using primers targeting the (a) mecA gene of MRSA and primers targeting the (b) vanA gene of VRE).

[0107] Figure 8 shows the results of confirming real-time fluorescence intensity of CRISPR-based CN-TAR analysis using genomic DNA (gDNA) extracted from bacteria ((a): MRSA, (b): VRE, (c): nontarget control of MRSA, (d): nontarget control of VRE).

[0108] Figure 9 shows the endpoint fluorescence and standard curves of a CRISPR-based CN-TAR assay using genomic DNA (gDNA) extracted from bacteria (((a): MRSA, (b): VRE, (c): nontarget control of MRSA, (d): endpoint fluorescence of a CN-TAR assay targeting nontarget control of VRE, (e) standard curves for various concentrations of MRSA and (f) VRE).

[0109] Figure 10 shows the results of evaluating the specificity of CRISPR-based CN-TAR analysis using gDNA extracted from bacteria ((a): results of cross-validation to confirm bacterial specificity targeting the mecA gene of MRSA and (b): the vanA gene of VRE).

[0110] Figure 11 shows the results of RT-PCR analysis of airborne captured samples ((a): analysis of captured samples using primers targeting the mecA gene, (b) analysis of captured samples using primers targeting the vanA gene).

[0111] Figure 12 shows the results of evaluating the performance of a CRISPR-based CN-TAR assay on air-captured samples ((a, c) real-time fluorescence intensity and endpoint fluorescence for detecting the mecA gene in MRSA and (b, d) the vanA gene in VRE).

[0112] The present invention will be described in more detail below through examples. These examples are intended solely to illustrate the present invention, and it will be obvious to those skilled in the art that the scope of the present invention is not to be interpreted as being limited by these examples.

[0113] Experimental method

[0114] 1. Ingredients

[0115] All oligonucleotides purchased from Bioneer Co. (Daejeon, Korea) were purified by high-performance liquid chromatography and dissolved in ultrapure distilled water. sgRNA and Cas9 nickase (840A) were purchased from Integrated DNA Technologies (Coralville, IA, USA). CircLigase II ssDNA Ligase (100 U / µL) was purchased from Biosearch Technologies. Phi29 DNA polymerase (10 units / µL) and 10× phi29 DNA polymerase buffer were purchased from New England Biolabs Co. (Ipswich, MA, USA). dNTPs were purchased from TakaRa Bio. Inc. (Shiga, Japan), Thioflavin T from Sigma-Aldrich (St. Louis, MO, USA), and Ultrapure distilled water from Invitrogen Co. (MA, USA). The QuantiTect SYBR Green PCR Kit was purchased from Qiagen Co. (Hilden, Germany). 0.1 ml 8-strip PCR Tubes (with optically-clear flat caps) were purchased from Novas Bio Co. (CA, USA).

[0116] 2. Circularization of the Padlock Probe

[0117] Linear padlock probes (10 μmol / L) were reacted with CircLigase II single-stranded DNA (ssDNA) ligase in a reaction buffer containing 10× CircLigase II ssDNA ligase buffer, 2.5 mmol / L MnCl2, 1 mol / L betaine, and ssDNA ligase (5 unit / μl) at 60°C for 16 hours. Subsequently, circularization was inactivated at 80°C for 10 minutes. The non-circularized padlock probes were degraded with exonuclease (10 units / μl) at 37°C for 60 minutes. Afterward, exonuclease I was inactivated at 80°C for 20 minutes. The resulting circular DNA was used without further purification.

[0118] 3. Extraction of total gDNA from bacteria

[0119] MRSA [NCCP S115] and MSSA [NCCP S122] were provided by the National Center for Type Cultures (NCCP). VRE [American Type Culture Collection (ATCC), 700221] and VSE [Korean Collection for Type Cultures (KCTC), 13225] were obtained from ATCC and KCTC. MRSA and MSSA were cultured in Luria-Bertani broth (Condalab, Madrid, Spain) in a shaking incubator at 37°C overnight, and VRE and VSE were cultured in brain heart infusion broth (BD, NJ, USA) in a shaking incubator at 37°C overnight.

[0120] The density of each bacterial strain was evaluated by measuring optical density at 600 nm (Optizen pop, Daejeon, Korea) until it reached ~1.0 through culture. Cultured cells were centrifuged at 15,000 × g for 20 minutes, and total gDNA was extracted from the spin-down pellet using the AccuPrep genomic DNA extraction kit (Bionner, Daejeon, Korea). The quality and quantity of the extracted gDNA were verified using a Nanodrop™ One C instrument (Thermo Fisher Scientific).

[0121] 4. Collection of airborne bacteria

[0122] The air sampling process began by injecting 25 mL of PBS (phosphate-buffered saline) into the sampler using an internal peristaltic pump (MADE LAB, Gyeonggi-do, Korea). Then, a fan was used to draw airborne bacteria into the sampler, where they were directly collected into the liquid via electrostatic precipitation. Once sampling was complete, the collected liquid sample was returned to a recovery vessel using the internal peristaltic pump. Subsequently, 50 mL of bacteria at a concentration of 1 × 10⁵ CFU / mL were dispersed in the chamber for 20 minutes, and the collected sample was liquefied in 20 mL of PBS. The sample was centrifuged at 15,000 RPM for 10 minutes to remove the supernatant. The resulting pellet was eluted in 50 µL of buffer, and gDNA extraction was performed using the AccuPrep Genomic DNA Extraction Kit (Bioneer, Daejeon, Korea). The extracted gDNA was subsequently analyzed using CN-TAR analysis and RT-PCR.

[0123] 5. RT-PCR

[0124] gDNA extracted from bacteria was amplified and verified using the QuantiTect SYBR Green PCR kit according to the manufacturer's protocol. RT-PCR was performed with a total volume of 50 µl under the following sequential conditions: RT-PCR was performed for a total of 45 cycles, consisting of an initial activation step at 95°C for 15 minutes, followed by denaturation at 94°C for 15 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds as one cycle. The fluorescence intensity of the amplified product was CFX96 TM Analysis was performed using a Real-Time PCR system (Bio-Rad). The primer sequences for performing RT-PCR are shown in Table 1 below.

[0125] 5' → 3'SEQ ID NO:mecA forwardTTAGATTGGGATCATAGCGTCATTAT1mecA reverseAATTCCACATTGTTTCGGTCTAAAA2vanA forwardGCA ATT TGT ATG GAC AAA TCG TTG3vanA reverseGCC TAT CAT CTT TAT TAA TA4

[0126] 6. Statistical Analysis

[0127] All experiments were performed in triplicate (n = 3), and data were expressed as mean ± standard deviation. All analyses were performed using the OriginPro software program (OriginLab, Northampton, MA, USA).

[0128] LOD was calculated as 3 σ / m, where σ is the standard deviation of the blank and m is the slope of the linear model fitted to the data.

[0129] Example 1. CN-TAR analysis (Cas9 nickase-triggered amplification reaction assay)

[0130] Since antibiotic-resistant bacteria such as MRSA and VRE can cause serious complications in immunocompromised patients, on-site detection and monitoring of airborne bacteria are essential preventive measures.

[0131] Accordingly, MRSA and VRE antibiotic-resistant bacteria, which have high infectivity and potential for transmission, were selected as target bacteria, and the CN-TAR (Cas9 nickase-triggered amplification reaction) assay was used to detect them. Specifically, as shown in Figure 1, the goal was to rapidly detect antibiotic target genes using a CRISPR (clustered regularly interspaced short palindromic repeats) Cas9 nickase-based rolling circle amplification method (a).

[0132] The sequences used in the system are shown in Table 2 below. The probes used for CN-TAR analysis were analyzed using the software program NUPACK, and probes with high binding affinity were selected and applied.

[0133] 5' → 3'Modification SEQ ID number mecAmecA sgRNA-1TAT ATT TCT AAA AGC GAT AA-5mecA padlock -1CCC TAA CCC TAA CCC TAA CCC TTA CCC TAA CCC TA A CCC TAA CCC TTA TCG CTT TTA5'- Phosphate6vanAvanA sgRNA-1TCA AAG CTC AGC AAT TTG TA-11vanA padlock-1CCC TAA CCC TAA CCC TAA CCC TTA CCC TAA CCC TA A CCC TAA CCC TAC AAA TTG CTG5'- Phosphate12

[0134] The CN-TAR reaction consisted of two main steps: ribonucleoprotein (RNP) synthesis and amplification. For RNP synthesis, the reaction mixture contained sgRNA (0.5 µl), Cas9 nickase (0.5 µl), 10× NEB buffer (0.5 µl), and 1× PBS. The total amplification reaction mixture consisted of circular DNA (2.5 µl), RNP (5 µl), Phi29 DNA polymerase (1 µl), 10× Phi29 DNA polymerase buffer (2 µl), dNTPs (2 µl), target samples at various concentrations (synthesized nucleic acid, cultured bacteria, collected bacteria), thioflavin T (50 µM), and nuclease-free water. This solution was reacted for 120 minutes at 30°C using a portable isothermal PCR machine, isoQuark (Revosketch, Daejeon, Korea).

[0135] As shown in Figure 1, CRISPR Cas9 nickase modifies the 3' region of double-stranded genomic DNA (gDNA) into a single-stranded form. Circular DNA for RCA binds to the single-stranded 3' region of gDNA. At this stage, the circular DNA is designed to contain a complementary sequence specific to each antibiotic resistance gene.

[0136] In particular, the amplification product is designed to form a secondary G-quadruplex so that the fluorescent molecule thioflavin T can be incorporated into this structure. Thioflavin T is a fluorescent molecule with an absorption wavelength of 470 nm and an emission wavelength of 522 nm, and when incorporated into the G-quadruplex, it emits light, enabling fluorescence analysis of the target gene (b).

[0137] Example 2. Optimization of CN-TAR Analysis

[0138] CN-TAR analysis utilizes CRISPR Cas9 nickase to interact with target genes and trigger an isothermal amplification reaction. Therefore, the gene editing enzyme and sgRNA (single-guide ribonucleic acid) depend heavily on the binding site of the target gene. Accordingly, key experimental variables were optimized to maximize the efficiency of the analysis.

[0139] Since CN-TAR analysis is performed as a single-step process, optimization of the reaction temperature was essential. Therefore, the reaction temperature was optimized first. As shown in Figure 2, based on the results of analyzing fluorescence intensity at 30°C, 37°C, and 40°C using the CN-TAR analysis method, the optimal reaction temperature for CN-TAR analysis was determined to be 30°C.

[0140] Subsequently, concentration optimization was performed on the major reaction components of the CN-TAR analysis, such as circular DNA, thioflavin T, Phi29 DNA polymerase, and dNTPs (deoxynucleotide triphosphates).

[0141] As shown in Figure 3, the concentration of circular DNA was optimized at 0.25, 0.62, 125, and 250 pmol, and higher fluorescence intensity was observed at higher concentrations (a). Thioflavin T, a fluorescent dye that intercouples in a G-quadruplex structure, was tested at concentrations of 10, 20, 50, and 100 μM, and the highest fluorescence intensity was observed at 50 μM (b).

[0142] In addition, the concentrations of Phi29 DNA polymerase and dNTPs, which are important for the amplification reaction, were optimized at 1.25, 2.5, 5, and 10 units and 50, 100, 200, and 400 μM, respectively (c and d). As a result, it was found that the fluorescence intensity increased as the concentration of these components increased.

[0143] As a result of optimization, 250 pmol of circular DNA, 50 μM of thioflavin T, 10 units of Phi29 DNA polymerase, and 400 μM of dNTPs were applied to the CN-TAR assay.

[0144] Finally, to increase the amplification efficiency of CN-TAR analysis, which is mainly affected by the cleavage site of the target gene, we intended to select a target region with high cleavage efficiency.

[0145] As shown in Figures 4 and 5, three target regions were selected within the mecA gene of MRSA and the vanA gene of VRE, and probes were designed. When designing the probes, target regions were selected based on the absence of a fluorescent signal in the non-target control (NTC). In addition, regions where sgRNA sequences did not overlap within the mecA gene of MRSA and the vanA gene of VRE were identified and analyzed using CRISPRscan (https: / www.crisprscan.org / sequence / ), and based on these results, probes were designed as shown in Table 3 below.

[0146] 5' → 3'Modification서열번호mecAmecA sgRNA-1TAT ATT TCT AAA AGC GAT AA-5mecA padlock-1CCC TAA CCC TAA CCC TAA CCC TTA CCC TAA CCC TA A CCC TAA CCC TTA TCG TTA5'TTA Phosphate6me sgRNA-2ACA AGA TAT GAA GTG GTA AA-7mecA padlock-2CCC TAA CCC TAA CCC TAA CCC TTA CCC TAA CCC TA A CCC TAA CCC TTT ACC ACT TCA5'- Phosphate8mecA ACC CTA ACC CTA ACC CTT ACC CTA ACC CTA ACC CTA ACC CAA TTC GAG5'- Phosphate10vanAvanA sgRNA-1TCA AAG CTC AGC AAT TTG TA-11vanA padlock-1CCC TAA CCC TAA CCC TAA CCC TTA CCC TAA CCC TAA CTA ACC TAA CTT CTG5'- Phosphate12vanA sgRNA-2GGG TTA TTA ATA AAG ATG AT-13vanA padlock-2TTT ATT CCC TAA CCC TAA CCC TAA CCC TTA CCC TA A CCC TAA CCC TAA CCC ATC ATC5'- Phosphate14vanAT sgRNA-3 GGA TGA TGA CGA AT-15vanA padlock-3CCC TAA CCC TAA CCC TAA CCC TTA CCC TAA CCC TA A CCC TAA CCC ATT CAA TTG CGT5'- Phosphate16

[0147] As a result of the experiment, as shown in Figure 4, the fluorescence signal in the first target region of MRSA was found to be increased compared to NTC (b, c; mecA sgRNA-3 and mecA padlock-3). However, in the second (e, f; mecA sgRNA-1 and mecA padlock-1) and third (h, i; mecA sgRNA-2 and mecA padlock-2) target regions, non-specific fluorescence signals were observed in NTC as well. Similarly, in the case of VRE, as shown in Figure 5, the fluorescence signal in the first target region was increased compared to NTC (b, c; vanA sgRNA-2 and vanA padlock-2), but in the second (e, f; vanA sgRNA-1 and vanA padlock-1) and third (h, i; vanA sgRNA-3 and vanA padlock-3) target regions, non-specific fluorescence signals were observed in NTC.

[0148] Based on these results, we selected the first target regions for MRSA and VRE and applied the designed probe to evaluate the performance of CN-TAR analysis below. In addition, we intended to evaluate the bacterial detection performance using the optimized experimental variables identified in this experiment.

[0149] Example 3. Performance evaluation of CN-TAR analysis

[0150] We aimed to evaluate the performance of an optimized CN-TAR assay using synthetic nucleic acids and cultured bacteria. Synthetic DNA was designed and applied based on the full sequences of the mecA and vanA genes, and cultured bacteria were quantified using the copy / µL count to estimate the number of target gene molecules per cell.

[0151] The CN-TAR assay is a single-step reaction method that combines gene editing enzymes, circular DNA, and various enzymes with target nucleic acids. This assay measured real-time fluorescence signals while carrying out the reaction at 30°C for 2 hours using a portable isothermal PCR device. In particular, endpoint fluorescence values ​​were visualized as bar graphs at 30-minute intervals to allow for a clearer comparison of changes in fluorescence signals over time.

[0152] This approach aids in the evaluation of reaction kinetics and quantitative analysis, while also enabling more reliable testing of experimental reproducibility. A portable isothermal PCR device that measures fluorescence signals can analyze specific fluorescence wavelengths (λex = 470 nm, λem = 522 nm) and display real-time fluorescence signals, offering the advantage of being a measurement tool for on-site detection.

[0153] As shown in Figure 6, CN-TAR analysis was performed using synthetic nucleic acids of the mecA and vanA genes at various concentrations ranging from 5 pM to 1,000 pM. As a result, it was observed that the real-time fluorescence signals for both the mecA(a) and vanA(b) genes increased in a concentration-dependent manner compared to NTC. Additionally, a linear increase in mecA(c) and vanA(d) was further confirmed in the endpoint fluorescence analysis at the end of the reaction.

[0154] Then, the performance of the CN-TAR analysis was evaluated using cultured bacteria. To this end, gDNA extracted from cultured bacteria was prepared and applied to the analysis. First, as shown in Figure 7, the presence of the mecA gene (a) and the vanA gene (b) in the extracted gDNA was confirmed through RT-PCR analysis.

[0155] Based on these results, the extracted gDNA was 10~10 10It was diluted to a concentration of copies / µl and applied to CN-TAR analysis. As shown in Figure 8, the real-time fluorescence signal increased with concentration (a, b), and a distinct difference was observed compared to NTC (c, d).

[0156] In addition, as shown in Fig. 9, the possibility of quantitative detection was confirmed through endpoint fluorescence analysis (ad). The standard curve equations were derived as follows: MRSA: y = 45.4x - 220.04, VRE: y = 31.88x + 93.09. The limit of detection (LOD) obtained from this analysis was determined to be 1.40 copies / µl for MRSA and 1.13 copies / µl for VRE (e, f).

[0157] In addition, high linear correlation (R 2 > 0.9) demonstrated the excellent quantitative reliability of the CN-TAR analysis. To evaluate the specificity of the CN-TAR analysis, cross-analysis was performed using four bacterial strains, including target and non-target organisms (MRSA, MSSA, VRE, VSE). The gDNA of each strain was adjusted to a concentration of 10 copies / µl for analysis.

[0158] As shown in Figure 10, it was confirmed that the probe used in the CN-TAR analysis effectively prevented non-specific amplification of non-target bacteria, thereby exhibiting high specificity.

[0159] Example 4. Performance evaluation of CN-TAR analysis for airborne bacteria

[0160] Finally, we aimed to evaluate the performance of the CN-TAR assay for detecting airborne bacteria. Collected samples were obtained by installing a chamber in the laboratory and using a high-flow electrostatic air sampler. To minimize external variables, the chamber environment was stabilized by dispersing bacteria at a concentration of 105 CFU / mL in 50 mL for 20 minutes. The types of samples in the chamber included MRSA, methicillin-susceptible Staphylococcus aureus (MSSA), VRE, vancomycin-susceptible enterococci (VSE), MSSA + MRSA, VSE + VRE, and MSSA + MRSA + VSE + VRE, and were collected accordingly.

[0161] After gene extraction from bacteria collected using an electrostatic air sampler, the presence of mecA and vanA was confirmed by applying CN-TAR analysis. First, the presence of mecA and vanA genes in each collected bacterial group was confirmed through RT-PCR analysis. As shown in Figure 11, the mecA gene was detected in groups containing MRSA, such as MRSA, MSSA, MRSA + MSSA, and MRSA + MSSA + VSE + VRE (a). Similarly, the vanA gene was identified in groups containing VRE, including VRE, VSE, VRE + VSE, and VRE + VSE + MSSA + MRSA (b).

[0162] Based on these results, CN-TAR analysis was applied to the collected bacteria, and as shown in Fig. 12, it was confirmed that the mecA gene was detected in the MRSA-containing group (a) and the vanA gene was detected in the VRE-containing group (b). In addition, quantitative detection was possible through endpoint fluorescence values ​​(c, d).

[0163] These results demonstrate that the CN-TAR assay shows performance similar to RT-PCR in the analysis of collected airborne bacteria, proving its potential as a field-distributable tool for detecting airborne bacteria.

Claims

1. (i) Cas9n protein (Cas9 nickase); (ii) sgRNA (single chain guide RNA) containing a targeting sequence that specifically binds to a target nucleic acid; (iii) circular DNA having the structure of structural formula I below; and (iv) a fluorescent molecule that is captured in the amplification product and emits light; comprising, [Structural Formula I] 5'-XY-3' The above X is a sequence position complementary to a terminal portion of the target nucleic acid cleaved by the activated Cas9n protein, and The above Y is a composition for detecting target nucleic acids, wherein the above Y is a location where a G-quadruplex structure is generated after amplification.

2. A composition for detecting target nucleic acids according to claim 1, wherein the fluorescent molecule is any one selected from the group consisting of thioflavin T, N-methyl mesoporphyrin IX, crystal violet, and BMVC (3,6-bis(1-methyl-4-vinylpyridinium)carbazole diiodide).

3. A composition for detecting a target nucleic acid according to claim 1, further comprising dNTPs and nucleic acid polymerase for a rolling circle amplification (RCA) reaction.

4. A composition for detecting a target nucleic acid according to claim 3, wherein the nucleic acid polymerase is any one selected from the group consisting of Phi29 DNA polymerase, phage M2 DNA polymerase, phage Phi-PRD1 DNA polymerase, VENT.RTM DNA polymerase, Klenow fragment DNA polymerase I, T5 DNA polymerase, PRD1 DNA polymerase, T4 DNA polymerase holoenzyme, T7 native polymerase, and Bst polymerase.

5. A composition for detecting a target nucleic acid according to claim 1, wherein the target nucleic acid is any one selected from the group consisting of DNA, miRNA, miRNA sponge, tough decoy miRNA, anti-miR, small RNA, siRNA, and shRNA.

6. A kit for detecting target nucleic acids comprising a detection composition according to any one of claims 1 to 5. 7.a) a step of reacting a sample with a Cas9n / sgRNA complex comprising a Cas9n protein (Cas9 nickase); and an sgRNA (single chain guide) containing a targeting sequence that specifically binds to a target nucleic acid; and b) a step of treating the reaction product of step a) with circular DNA having the structural formula I below; and a fluorescent molecule; comprising, [Structural Formula I] 5'-XY-3' The above X is a sequence position complementary to a terminal portion of the target nucleic acid cleaved by the activated Cas9n protein, and A target nucleic acid detection method in which the above Y is a location where a G-quadruplex structure is generated after amplification.

8. A first formulation comprising: a Cas9n protein (Cas9 nickase); and sgRNA comprising a targeting sequence that specifically binds to the target DNA of antibiotic-resistant bacteria; and A composition for detecting antibiotic-resistant bacteria comprising a second agent comprising circular DNA that binds complementarily to target DNA on the reaction product generated by the first agent.

9. In paragraph 8, the above-mentioned circular DNA has the structure of the following structural formula I, [Structural Formula I] 5'-XY-3' The above X is a sequence position complementary to a terminal portion of the target nucleic acid cleaved by the activated Cas9n protein, and The above Y is a composition for detecting antibiotic-resistant bacteria, wherein the above Y is a location where a G-quadruplex structure is formed after amplification.

10. A composition for detecting antibiotic-resistant bacteria according to claim 8, wherein the antibiotic-resistant bacteria are Staphylococcus aureus-resistant bacteria (MRSA) or vancomycin-resistant bacteria (VRE).

11. A composition for detecting antibiotic-resistant bacteria according to claim 8, wherein the sgRNA comprises one or more nucleic acid sequences selected from the group consisting of SEQ ID NOs 5, 7, 9, 11, 13 and 15.

12. A composition for detecting antibiotic-resistant bacteria according to claim 8, wherein the circular DNA comprises one or more nucleic acid sequences selected from the group consisting of SEQ ID NOs 6, 8, 10, 12, 14 and 16.

13. A composition for detecting antibiotic-resistant bacteria according to claim 9, wherein the composition comprises sgRNA of SEQ ID NO. 9 and circular DNA of SEQ ID NO. 10 for detecting Staphylococcus aureus-resistant bacteria (MRSA).

14. A composition for detecting antibiotic-resistant bacteria according to claim 9, wherein the composition comprises sgRNA of SEQ ID NO. 13 and circular DNA of SEQ ID NO. 14 for detecting vancomycin-resistant bacteria (VRE).

15. A composition for detecting antibiotic-resistant bacteria according to claim 8, wherein the second preparation further comprises a DNA polymerase; a fluorescent molecule; and dNTPs.

16. A composition for detecting antibiotic-resistant bacteria according to claim 15, wherein the DNA polymerase is any one selected from the group consisting of Phi29 DNA polymerase, phage M2 DNA polymerase, phage Phi-PRD1 DNA polymerase, VENT.RTM DNA polymerase, Klenow fragment DNA polymerase I, T5 DNA polymerase, PRD1 DNA polymerase, T4 DNA polymerase holoenzyme, T7 native polymerase, and Bst polymerase.

17. A composition for detecting antibiotic-resistant bacteria according to claim 15, wherein the fluorescent molecule is any one selected from the group consisting of thioflavin T, N-methyl mesoporphyrin IX, crystal violet, and BMVC (3,6-bis(1-methyl-4-vinylpyridinium)carbazole diiodide).

18. A kit for detecting antibiotic-resistant bacteria comprising a detection composition according to any one of claims 8 to 17. 19.a) a step of reacting a sample with a Cas9n / sgRNA complex comprising a Cas9n protein (Cas9 nickase); and sgRNA containing a targeting sequence that specifically binds to the target DNA of antibiotic-resistant bacteria; and b) a circular DNA that binds complementarily to the target DNA of antibiotic-resistant bacteria; and a fluorescent molecule; and a step of treating the reaction product of step a) with the reaction product; comprising a method for detecting antibiotic-resistant bacteria.