Microorganism into which artificial operon has been introduced, and method for producing tryptophan using same

Abstract

The present application relates to a recombinant microorganism of the genus Corynebacterium into which an artificial operon has been introduced, and a method for producing tryptophan using the microorganism.

Description

Microorganisms with introduced artificial operons and methods for producing tryptophan using the same

[0001] The present application relates to a recombinant Corynebacterium microorganism into which an artificial operon has been introduced, and a method for producing tryptophan using said microorganism.

[0002]

[0003] Tryptophan is one of the essential amino acids and has been widely used as a feed additive, a raw material for pharmaceuticals such as intravenous fluids, and a health food ingredient; currently, direct fermentation using microorganisms is primarily used for tryptophan production.

[0004] Microorganisms used for tryptophan production were initially mainly selected strains resistant to analogs through chemical or physical mutations, but with the rapid development of genetic recombination technology in the 1990s and the identification of regulatory mechanisms at the molecular level, recombinant strains using genetic engineering techniques are now mainly used.

[0005] For example, when producing L-tryptophan, target-specific approaches (US Patent 8945907 B2), such as increasing the expression of genes encoding enzymes involved in L-tryptophan biosynthesis or removing genes unnecessary for biosynthesis, are mainly used, but research is still needed to effectively increase the production capacity of L-tryptophan.

[0006]

[0007] The present application aims to provide a microorganism into which an artificial operon has been introduced and a method for producing tryptophan using the same.

[0008]

[0009] One aspect of the present application provides a polynucleotide comprising an aroD gene, an aroE gene, and an aroA gene sequentially operably linked to a single promoter.

[0010] Another aspect of the present application provides a tryptophan-producing microorganism of the genus Corynebacterium into which an operon comprising the polynucleotide of the present application has been introduced.

[0011] Another aspect of the present application provides a method for producing L-tryptophan, comprising the step of culturing a microorganism of the genus Corynebacterium of the present application in a medium.

[0012] Another aspect of the present application provides the use of the genus Corynebacterium microorganism of the present application for L-tryptophan production.

[0013]

[0014] When culturing a tryptophan-producing Corynebacterium microorganism into which an operon comprising a polynucleotide containing the aroD gene, aroE gene, and aroA gene of the present application has been introduced, L-tryptophan can be produced in a high yield compared to existing wild-type Corynebacterium microorganisms and microorganisms in which the aroD gene, aroE gene, and aroA gene are individually expressed through their respective promoters.

[0015]

[0016] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application may be applied to other descriptions and embodiments. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application should not be considered limited by the specific descriptions provided below. Additionally, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated by reference into this specification in their entirety to more clearly explain the level of the art to which this application pertains and the content of this application.

[0017]

[0018] One aspect of the present application provides a polynucleotide comprising an aroD gene, an aroE gene, and an aroA gene sequentially operably linked to a single promoter.

[0019]

[0020] In this application, the term "polynucleotide" refers to a polymer of nucleotides in which nucleotide monomers are linked together in a long chain by covalent bonds, as a DNA or RNA strand of a certain length or longer, and more specifically, a polynucleotide that acts as a single promoter and sequentially includes the aroD gene, the aroE gene, and the aroA gene.

[0021] In the present application, the aroD gene codes for 3-dehydroquinate dehydratase (DHQD), and said 3-dehydroquinate dehydratase is involved in the biosynthesis of phenylalanine, tyrosine, and tryptophan. Specifically, said 3-dehydroquinate dehydratase catalyzes the reaction of dehydrating 3-dehydroquinate to convert it into 3-dehydroshikimate in the shikimate pathway, which is a major biosynthetic pathway for the production of aromatic amino acids. The nucleotide sequence of said aroD gene can be obtained from known databases, such as, but not limited to, GenBank of NCBI.

[0022] In the present application, the aroE gene codes for shikimate dehydrogenase, which is involved in the biosynthesis of phenylalanine, tyrosine, and tryptophan. Specifically, the shikimate dehydrogenase catalyzes the conversion of 3-dehydroshikimate to shikimate in the shikimate pathway, which is a major biosynthetic pathway for the production of aromatic amino acids. The nucleotide sequence of the aroE gene can be obtained from known databases, such as, but not limited to, GenBank of NCBI.

[0023] In the present application, the aroA gene codes for 5-enolpyruvylshikimate-3-phosphate synthase (EPSP synthase), and said 5-enolpyruvylshikimate-3-phosphate synthase is involved in the biosynthesis of phenylalanine, tyrosine, and tryptophan. Specifically, said 5-enolpyruvylshikimate-3-phosphate synthase catalyzes the reaction of converting shikimate-3-phosphate and phosphoenolpyruvate into 5-enolpyruvylshikimate-3-phosphate in the shikimate pathway, which is a major biosynthetic pathway for the production of aromatic amino acids. The nucleotide sequence of the aroA gene mentioned above can be obtained from known databases, such as NCBI’s GenBank, but is not limited thereto.

[0024] The aroD gene, aroE gene, and aroA gene of the present application may be of microbial origin, specifically may be of prokaryotic or eukaryotic microorganisms, and more specifically may be of microorganisms of the genus of Corynebacterium, but are not limited thereto.

[0025] In the present application, the aroD gene may have, include, or consist of the nucleotide sequence of SEQ ID NO. 26, or may essentially consist of said nucleotide sequence. In the present application, the aroE gene may have, include, or consist of the nucleotide sequence of SEQ ID NO. 27, or may essentially consist of said nucleotide sequence. In the present application, the aroA gene may have, include, or consist of the nucleotide sequence of SEQ ID NO. 28, or may essentially consist of said nucleotide sequence.

[0026] In the present application, the nucleotide sequence of the aroD gene may include a nucleotide sequence having at least 70%, 75%, 76%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with the nucleotide sequence of SEQ ID NO. 26. In the present application, the nucleotide sequence of the aroE gene may include a nucleotide sequence having at least 70%, 75%, 76%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with the nucleotide sequence of SEQ ID NO. 27. In the present application, the nucleotide sequence of the aroA gene may include a nucleotide sequence having at least 70%, 75%, 76%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with the nucleotide sequence of SEQ ID NO. 28. Furthermore, it is obvious that a gene having a nucleotide sequence in which some sequences are deleted, modified, substituted, conservatively substituted, or added is included within the scope of the present application, provided that the nucleotide sequence has such homology or identity and exhibits a function corresponding to that of a gene including the nucleotide sequences of SEQ ID NO. 26, SEQ ID NO. 27, and / or SEQ ID NO. 28. As an example, in the present application, the aroE gene and / or the aroA gene may include a start codon substituted with ATG.

[0027]

[0028] In this application, the terms 'homology' or 'identity' refer to the degree of similarity between two given nucleotide sequences and may be expressed as a percentage. The terms homology and identity may often be used interchangeably.

[0029] Sequence homology or identity of conserved polynucleotides is determined by standard arrangement algorithms, and a default gap penalty established by the program used may be utilized. Practically, homologous or identical sequences can generally be hybridized with the entire sequence or a part thereof under moderate or high stringent conditions. It is evident that hybridization also includes hybridization with polynucleotides containing common codons or codons that account for codon degeneracy.

[0030] Whether any two polynucleotide sequences have homology, similarity, or identity can be determined using a known computer algorithm, such as the "FASTA" program, using default parameters as in, for example, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, it can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] (Including Academic Press, San Diego, 1994, and [CARILLO ET AL](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST from the National Biotechnology Information Database Center or ClustalW.

[0031] The homology, similarity, or identity of polynucleotides can be determined by comparing sequence information using a GAP computer program, such as that described in, for example, Smith and Waterman, Adv. Appl. Math (1981) 2:482, or Needleman et al. (1970), J Mol Biol. 48:443. In summary, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides). The default parameters for the GAP program are (1) a unitary matrix (containing values ​​of 1 for identity and 0 for non-identity) and, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), or Gribskov et al. (1986) Nucl. Acids Res. 14: A weighted comparison matrix of 6745 (or an EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0032] Additionally, the polynucleotide of the present application may include, without limitation, probes that can be prepared from known gene sequences, for example, sequences that can be hybridized under stringent conditions with a sequence complementary to all or part of the polynucleotide sequence of the present application. The "stringent condition" means a condition that enables specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, conditions may be listed in which polynucleotides with high homology or identity are hybridized with each other, with homology or identity of 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more, and polynucleotides with lower homology or identity are not hybridized with each other, or conditions in which washing is performed once, specifically two to three times, at a salt concentration and temperature equivalent to the washing conditions of conventional southern hybridization, such as 60°C, 1 χSSC, 0.1% SDS, specifically 60°C, 0.1 χSSC, 0.1% SDS, more specifically 68°C, 0.1 χSSC, 0.1% SDS.

[0033] Hybridization requires that two nucleic acids have complementary sequences, even though a mismatch between bases may be possible depending on the degree of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, regarding DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Accordingly, the polynucleotides of this application may also include isolated nucleic acid fragments that are complementary to the entire sequence, as well as substantially similar nucleic acid sequences.

[0034] Specifically, a polynucleotide having homology or identity with the polynucleotide of the present application can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. Additionally, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and can be appropriately adjusted by a person skilled in the art according to the purpose.

[0035] The appropriate strictness for hybridizing the above polynucleotides depends on the length and degree of complementarity of the polynucleotides, and the variables are well known in the art (e.g., J. Sambrook et al., i.e.).

[0036]

[0037] In this application, the term “promoter” refers to an untranscribed nucleic acid sequence upstream of a coding region that includes a polymerase binding site and has transcription initiation activity into the mRNA of a promoter-downstream gene, i.e., a DNA region to which polymerase binds to initiate the transcription of the gene, and is located at the 5’ end of the mRNA transcription initiation site. The promoter of this application is operably linked to the aroD gene, the aroE gene, and the aroA gene.

[0038] For example, the promoter may be the PlysCm1 promoter (US Patent Publication US 2023-0134555 A1), and any powerful promoter may be used without limitation.

[0039] Examples of known strong promoters include, but are not limited to, cj1 to cj7 promoters (US Patent No. 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13(sm3) promoter (US Patent No. 10584338 B2), O2 promoter (US Patent No. 10273491 B2), tkt promoter and yccA promoter, rmf promoter, serC promoter, etc.

[0040] In this application, the term "operably connected" means that a promoter sequence that initiates and mediates the transcription of the polynucleotide of this application is functionally connected to said polynucleotide sequence.

[0041]

[0042] In the present application, the aroD gene and the aroE gene may be connected to a first ribosome binding site (RBS), and the aroE gene and the aroA gene may be connected to a second ribosome binding site.

[0043] In this application, the term "ribosome binding site (RBS)" refers to a nucleic acid sequence located upstream of the initiation codon of mRNA, which is responsible for recruiting ribosomes during translation initiation to facilitate translation. The ribosome binding site of prokaryotes includes a Shine-Dalgarno (SD) sequence having the 5'-AGGAGG-3' sequence. Translation is initiated when the 3' end of 16S rRNA binds complementarily to the Shine-Dalgarno sequence, and the complementary sequence CCUCCU is referred to as the anti-Shine-Dalgarno (ASD) sequence.

[0044] In the present application, the aroD gene and the aroE gene are connected through a first ribosome binding site, and the aroE gene and the aroA gene are connected through a second ribosome binding site, so that the aroD gene, the aroE gene, and the aroA gene can be operated as a single operon to regulate expression.

[0045] For example, the first ribosome binding site of the present application may be the ribosome binding site of the qsuBC gene and the second ribosome binding site of the present application may be the ribosome binding site of the lysC / asd gene, but is not limited thereto.

[0046] For example, the ribosome binding site of the qsuBC gene of the present application may have, include, or be composed of the nucleotide sequence of SEQ ID NO. 29, or may be essentially composed of the said base sequence.

[0047] In addition, the ribosome binding site of the qsuBC gene of the present application may include a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more homology or identity with the nucleotide sequence of SEQ ID NO. 29. Furthermore, it is obvious that the ribosome binding site of the qsuBC gene having a nucleotide sequence having such homology or identity and exhibiting a function corresponding to the ribosome binding site of the qsuBC gene of the present application, wherein some sequences are deleted, modified, substituted, conservatively substituted, or added, is also included within the scope of the present application.

[0048] The ribosome binding site of the lysC / asd gene of the present application may have, include, be composed of, or essentially consist of the nucleotide sequence of SEQ ID NO. 30.

[0049] The ribosome binding site of the lysC / asd gene of the present application may include a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more homology or identity with the nucleotide sequence of SEQ ID NO. 30. Furthermore, it is obvious that the ribosome binding site of the lysC / asd gene having a nucleotide sequence having such homology or identity and exhibiting a function corresponding to the ribosome binding site of the lysC / asd gene of the present application, wherein some sequences are deleted, modified, substituted, conservatively substituted, or added, is also included within the scope of the present application.

[0050]

[0051] The polynucleotide of the present application may have, include, be composed of, or essentially consist of the nucleotide sequence of SEQ ID NO. 25.

[0052] In addition, the polynucleotide of the present application may include a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more homology or identity with the nucleotide sequence of SEQ ID NO. 25. Furthermore, it is obvious that a polynucleotide having a nucleotide sequence in which some sequences are deleted, modified, substituted, conservatively substituted, or added is included within the scope of the present application, provided that such a nucleotide sequence has such homology or identity and exhibits a function corresponding to that of the polynucleotide of the present application.

[0053]

[0054] Another aspect of the present application is to provide a vector comprising the polynucleotide of the present application.

[0055] The above vector may be an expression vector for expressing the above polynucleotide in a host cell, but is not limited thereto.

[0056] The vector of the present application may comprise a DNA product comprising a base sequence of a polynucleotide encoding said target polypeptide, which is operably linked to a suitable expression control region (or expression control sequence) to enable the expression of said target polypeptide within a suitable host. The expression control region may comprise a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence coding for a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After being transformed into a suitable host cell, the vector may replicate or function independently of the host genome and may be incorporated into the genome itself.

[0057]

[0058] The vectors used in this application are not particularly limited, and any vector known in the art may be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors may be used as plasmid vectors. Specifically, pDZ, pDC, pDC24, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors may be used.

[0059] For example, the polynucleotide of the present application may be inserted into a chromosome through a vector for intracellular chromosome insertion. The insertion of said polynucleotide into the chromosome may be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker may be additionally included to confirm whether the chromosome insertion has occurred. The selection marker is intended to select cells transformed with the vector, that is, to confirm whether the target nucleic acid molecule has been inserted, and markers conferring selectable phenotypes such as drug resistance, nutritional requirements, resistance to cytotoxic agents, or expression of surface polypeptides may be used. Since only cells expressing the selection marker survive or exhibit other phenotypes in an environment treated with a selective agent, the transformed cells can be selected.

[0060] In this application, the term "transformation" means introducing a vector containing a target polynucleotide into a host cell or microorganism so that the polypeptide encoded by said polynucleotide can be expressed within the host cell. The transformed polynucleotide may include all of the following, regardless of whether it is inserted into or outside the chromosomes of the host cell, as long as it can be expressed within the host cell. The polynucleotide may be introduced in any form that allows it to be introduced into and expressed within the host cell. For example, said polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic structure containing all the elements necessary for self-expression. The expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal operably linked to said polynucleotide. The expression cassette may be in the form of a self-replicating expression vector. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.

[0061]

[0062] Another aspect of the present application provides a tryptophan-producing microorganism of the genus Corynebacterium into which an operon comprising the polynucleotide of the present application has been introduced.

[0063]

[0064] In this application, the term "operon" refers to a functional unit of DNA comprising a single expression-regulating sequence, specifically a group of genes whose expression is regulated by a single promoter. The mRNA transcribed by the operon may be polycistronic mRNA in which a single mRNA molecule codes for one or more proteins, or monocistronic mRNA in which a single mRNA molecule codes for one protein.

[0065] For the purposes of this application, the operon comprising the polynucleotide of this application may be an operon comprising the aroD gene, the aroE gene, and the aorA gene involved in the tryptophan synthesis pathway, and the polynucleotide and the operon may be used interchangeably.

[0066]

[0067] In this application, the term “microorganism (or strain)” includes both wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification, and may be microorganisms in which specific mechanisms are weakened or strengthened due to causes such as the insertion of external genes or the enhancement or inactivation of the activity of endogenous genes, and may be microorganisms that include genetic modification for the production of a desired polypeptide, protein, or product.

[0068] In this application, the term "tryptophan" may be used interchangeably with "L-tryptophan" and refers to an essential amino acid that many animals, including humans, cannot synthesize and must obtain through food.

[0069] The microorganism of the present application may be a microorganism that naturally possesses the ability to produce L-tryptophan, or a microorganism that lacks the ability to produce L-tryptophan but has been endowed with the ability to produce L-tryptophan. For example, it may be a microorganism in which the ability to produce L-tryptophan is increased by introducing an operon comprising a polynucleotide containing aroD gene, aroE gene, and aroA gene sequentially operably linked to a single promoter, but is not limited thereto.

[0070] The microorganism of the present application may be a microorganism with increased L-tryptophan production capacity compared to a parent strain or a wild-type strain of the genus Corynebacterium in which the aroD gene, the aroE gene, and the aroA gene are individually expressed through respective promoters. The microorganism may have enhanced L-tryptophan production capacity by introducing an operon comprising a polynucleotide containing the aroD gene, the aroE gene, and the aroA gene sequentially operably linked to a single promoter.

[0071] For example, the non-modified microorganism that serves as a control strain for comparing whether the L-tryptophan production capacity is increased may be the Corynebacterium glutamicum (C. glutamicum) KCCM12670P strain, and may be the KCCM12670PΔBBD29_01410::PlysCm1-aroD_PlysCm1-aroE(g>a)_PlysCm1-aroA(t>a) strain in which the aroD gene, the aroE gene, and the aroA gene are individually expressed through their respective promoters, but is not limited thereto.

[0072] As another example, the recombinant microorganism with increased production capacity may be increased by about 3% or more compared to the L-tryptophan production capacity of the parent strain before mutation, the non-mutated microorganism, or the microorganism in which the aroD gene, the aroE gene, and the aroA gene are individually expressed through their respective promoters, specifically by about 3% or more, about 4% or more, about 5% or more, about 6% or more, about 7% or more, about 9% or more, or about 11% or more (there is no special limitation on the upper limit value, for example, it may be about 200% or less, about 150% or less, about 100% or less, or about 50% or less), but is not limited thereto as long as it has a positive increase amount compared to the production capacity of the parent strain before mutation, the non-mutated microorganism, or the microorganism in which the aroD gene, the aroE gene, and the aroA gene are individually expressed through their respective promoters. In another example, the recombinant microorganism with increased L-tryptophan production capacity has an L-tryptophan production capacity of about 1.01 times or more, about 1.05 times or more, about 1.10 times or more, about 1.15 times or more, about 1.20 times or more, about 1.25 times or more, about 1.30 times or more, about 1.325 times or more, about 1.35 times or more, about 1.375 times or more, about 1.40 times or more, about 1.425 times or more, about 1.45 times or more, about 1.46 times or more, or about 1.47 times or more (the upper limit is not specifically restricted and may be, for example, about 10 times or less, about 5 times or less, about 3 times or less, or about 2 times or less). It may be increased, but is not limited to this.

[0073] In this application, the term "non-mutated microorganism" does not exclude strains containing mutations that may naturally occur in microorganisms, and may refer to wild-type strains or natural-type strains themselves, or strains prior to genetic mutations caused by natural or artificial factors.

[0074] In this application, the term "non-mutated microorganism" may be used interchangeably with "pre-mutation strain," "pre-mutation microorganism," "non-mutated strain," "non-mutated strain," "non-mutated microorganism," or "reference microorganism."

[0075] The microorganism of the present application may be a microorganism (e.g., a recombinant microorganism) into which an operon comprising a polynucleotide having an aroD gene, an aroE gene, and an aroA gene sequentially operably linked to a single promoter has been introduced.

[0076]

[0077] As another example of the present application, the microorganisms of the present application include Corynebacterium glutamicum, Corynebacterium stationis, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes, and Corynebacterium It may be Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris, or Corynebacterium flavescens, and specifically may be Corynebacterium glutamicum, but is not limited thereto.

[0078]

[0079] Another aspect of the present application provides a method for producing L-tryptophan, comprising the step of culturing a microorganism of the genus Corynebacterium of the present application in a medium.

[0080]

[0081] The L-tryptophan production method of the present application may include the step of culturing a microorganism of the genus Corynebacterium that produces L-tryptophan in a medium, into which an operon comprising a polynucleotide having aroD gene, aroE gene, and aroA gene sequentially operably linked to a single promoter has been introduced.

[0082] In this application, the term "culture" means growing the microorganism of this application under appropriately controlled environmental conditions. The culture process of this application may be carried out according to suitable media and culture conditions known in the art. Such a culture process can be easily adjusted and used by those skilled in the art depending on the microorganism selected. Specifically, the culture may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0083] In this application, the term "medium" refers to a substance mixed with nutrients as the main component required to culture the microorganism of this application, and supplies nutrients and growth factors, including water, which is indispensable for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganism of this application may be any medium used for culturing ordinary microorganisms without special limitations; however, the microorganism of this application may be cultured under aerobic conditions while controlling the temperature, pH, etc., in a conventional medium containing a suitable carbon source, nitrogen source, phosphorus, inorganic compounds, amino acids, and / or vitamins.

[0084] Specifically, culture media for microorganisms of the genus Corynebacterium can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981)].

[0085] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvate, lactic acid, citric acid, etc.; and amino acids such as glutamic acid, methionine, lysine, etc. Additionally, natural organic nutrient sources such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane residue, and corn steeping liquid may be used. Specifically, carbohydrates such as glucose and sterilized pre-treated molasses (i.e., molasses converted into reducing sugars) may be used, and other carbon sources in appropriate amounts may be used in various ways without limitation. These carbon sources may be used individually or in combination of two or more types, but are not limited thereto.

[0086] The above nitrogen sources may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; and organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc., peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquid, casein hydrolysate, fish or its decomposition products, defatted soybean cake or its decomposition products, etc. These nitrogen sources may be used alone or in combination of two or more types, but are not limited thereto.

[0087] The above ingredients may include monopotassium phosphate, dipotassium phosphate, or corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc., and may also include amino acids, vitamins, and / or suitable precursors. These components or precursors may be added to the culture medium in a batch or continuous manner. However, they are not limited thereto.

[0088] In addition, during the cultivation of the microorganism of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc., may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during cultivation, an antifoaming agent such as fatty acid polyglycol ester may be used to suppress the formation of bubbles. Furthermore, to maintain an aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection to maintain an anaerobic and microaerobic state, but is not limited thereto.

[0089] In the culture of the present application, the culture temperature may be maintained at 20 to 45°C, specifically 25 to 40°C, and culture may be carried out for about 10 to 160 hours, but is not limited thereto.

[0090] L-tryptophan produced by the culture of the present application may be secreted into the culture medium or remain within the cell.

[0091]

[0092] The method for producing L-tryptophan of the present application may additionally include, for example, the step of preparing a microorganism of the present application, the step of preparing a medium for culturing said microorganism, or a combination thereof (in any order), prior to the culturing step.

[0093] The method for producing L-tryptophan according to the present application may further include a step of recovering L-tryptophan from a culture medium (a medium in which culture is performed) or from a cultured microorganism of the genus Corynebacterium. The recovery step may be additionally included after the culture step.

[0094] The above recovery may involve collecting the desired amino acid using a suitable method known in the art according to the culture method of the microorganism of the present application, such as a batch, continuous, or fed-batch culture method. For example, various chromatographs such as centrifugation, filtration, treatment with a crystallizing protein precipitating agent (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC, or a combination thereof may be used, and the desired amino acid may be recovered from the culture medium or microorganism using a suitable method known in the art.

[0095] In addition, the method for producing L-tryptophan according to the present application may additionally include a purification step. The purification may be performed using a suitable method known in the art. In one example, where the method for producing L-tryptophan according to the present application includes both a recovery step and a purification step, the recovery step and the purification step may be performed continuously or discontinuously regardless of the order, or simultaneously or integrated into a single step, but are not limited thereto.

[0096] In the method of the present application, the polynucleotide, operon, microorganism, and L-tryptophan, etc., are as described in the other embodiments above.

[0097]

[0098] Another aspect of the present application provides the use of the genus Corynebacterium microorganism of the present application for L-tryptophan production.

[0099] In the use of the present application, the microorganisms, etc. are as described in the other embodiments above.

[0100]

[0101] The present application will be explained in more detail below through examples. However, the following examples are merely preferred embodiments for illustrating the present application and are not intended to limit the scope of the rights of the present application. Meanwhile, technical matters not described in this specification can be fully understood and easily implemented by a person skilled in the art who is proficient in the technical field of the present application or a similar technical field.

[0102]

[0103] Example 1: Construction of a recombinant vector for introducing an operon containing the aroD gene, the aroE gene, and the aroA gene

[0104]

[0105] A vector was constructed as follows to regulate the expression of the aroD, aroE, and aroA genes, which are transcribed individually within the wild-type strain, by operating them as a single operon.

[0106] First, to insert an artificial operon into the chromosome of Corynebacterium glutamicum, BBD29_01410, known as the gene encoding a transposon in Corynebacterium glutamicum, was used as the insertion site. Specifically, to construct a BBD29_01410 deletion and target gene insertion vector, PCR was performed using the gDNA of wild-type Corynebacterium glutamicum ATCC13869 as a template and primer pairs SEQ ID NO. 1 and SEQ ID NO. 2; and SEQ ID NO. 3 and SEQ ID NO. 4. PfuUltra™ high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and the PCR conditions were denaturation at 95°C for 30 seconds; denaturation at 55°C for 30 seconds; and polymerization at 72°C for 1 minute; and these denaturation, annealing, and polymerization reactions were repeated a total of 28 times. As a result, DNA fragments of approximately 600 bp were obtained from each.

[0107] Next, PCR was performed in the same manner as above using the primer pair of SEQ ID NOs. 5 and 6 with the gDNA of wild-type Corynebacterium glutamicum ATCC 13869 as a template, and the ribosome binding site (RBS) fragment of the aroD gene and the qsuBC gene linked thereto (SEQ ID NO. 29) was obtained. In addition, PCR was performed in the same manner as above using the primer pair of SEQ ID NOs. 7 and 8 with the gDNA of wild-type Corynebacterium glutamicum ATCC 13869 as a template, and the RBS fragment of the aroE gene with the start codon substituted from GTG to ATG and the lysC / asd gene linked thereto (SEQ ID NO. 30) was obtained. In addition, PCR was performed in the same manner as above using the primer pair of SEQ ID NOs. 9 and 10 with the gDNA of wild-type Corynebacterium glutamicum ATCC 13869 as a template, and an aroA gene fragment was obtained in which the start codon was substituted from TTG to ATG.

[0108] Overlapping PCR was performed in the same manner as above using the primer pair of SEQ ID NO. 5 and SEQ ID NO. 10 with the mixture of the three fragments obtained above as a template, and a gene fragment of 'aroDE(1g>a)A(1t>a)' was obtained in which the aroD gene and the aroE gene are linked through the RBS of the qsuBC gene and the aroE gene and the aroA gene are linked through the RBS of the lysC / asd gene.

[0109] Next, in order to use the PlysCm1 promoter (Sequence No. 11, US Patent Publication US 2023-0134555 A1), known as a strong promoter, PCR was performed in the same manner as above using the primer pair of Sequence No. 12 and Sequence No. 13 with the PlysCm1 promoter as a template, and the PlysCm1 promoter fragment was obtained.

[0110] After treating the pDC24 vector (sequence number 14, KR 10-2024-0167588 A) with the restriction enzyme SmaI, the amplified BBD29_01410 left homologous cancer fragment, PlysCm1 promoter fragment, 'aroDE(1g>a)A(1t>a)' gene fragment, and BBD29_01410 right homologous cancer fragment were cloned using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix). Cloning was performed by mixing the Gibson assembly reagents with each gene fragment in calculated moles and storing at 50°C for 1 hour.

[0111] Through this, a recombinant plasmid was obtained and named 'pDC24ΔBBD29_01410:: PlysCm1_aroDE(1g>a)A(1t>a)'.

[0112]

[0113] Example 2: Preparation of a control group recombinant vector

[0114]

[0115] As a control group, vectors were constructed as follows to regulate the aroD, aroE, and aroA genes with their respective promoters.

[0116] First, PCR was performed in the same manner as above using the gDNA of wild-type Corynebacterium glutamicum ATCC 13869 as a template and primer pairs of SEQ ID NOs 5 and 15; SEQ ID NOs 16 and 17; and SEQ ID NOs 18 and 10, and the aroD gene, the aroE gene with the start codon substituted from GTG to ATG, and the aroA gene fragment with the start codon substituted from TTG to ATG were obtained.

[0117] Next, PCR was performed in the same manner as above using primer pairs of SEQ ID NO. 12 and SEQ ID NO. 13; SEQ ID NO. 19 and SEQ ID NO. 20; and SEQ ID NO. 21 and SEQ ID NO. 22 with the PlysCm1 promoter as a template, and PlysCm1 promoter fragments were obtained respectively.

[0118] Overlapping PCR was performed in the same manner as above using the primer pair of SEQ ID NO. 12 and SEQ ID NO. 10 with the above-mentioned mixture of six fragments as a template, and the gene fragments 'PlysCm1_aroD-PlysCm1_aroE(1g>a)-PlysCm1_aroA(1t>a)' in which the aroD gene, the aroE gene, and the aroA gene were each linked to the PlysCm1 promoter in sequence were obtained.

[0119] After treating the pDC24 vector with the restriction enzyme SmaI, a recombinant plasmid was obtained by cloning the amplified BBD29_01410 left homologous cancer fragment, the 'PlysCm1_aroD-PlysCm1_aroE(1g>a)-PlysCm1_aroA(1t>a)' gene fragment, and the BBD29_01410 right homologous cancer fragment using the Gibson assembly method, and was named 'pDC24ΔBBD29_01410:: PlysCm1_aroD-PlysCm1_aroE(1g>a)-PlysCm1_aroA(1t>a)'. Gibson cloning was performed in the same manner as above. The primers used to prepare the recombinant vector are listed in Table 1 below.

[0120]

[0121] 서열번호명칭서열 (5'→3')1primer 1CGAGCTCGGTACCCCGGACGTTTACGCT2primer 2GCTCCCTAAGGAGCAAACCGGAAGGGCC3primer 3AGATGGTTGGCTAGAAACAGGAAGAGCC4primer 4TCTAGAGGATCCCCCCGCATGTGGTGGC5primer 5TCGAAAGGTGCACACATATGCCTGGAAAAATTCT6primer 6GTGATGTGAGAACCCATTATTTTTGGGCTTTCT7primer 7AGAAAGCCCAAAAATAATGGGTTCTCACATCAC8primer 8GTAAAACTACTCCTTTAAAACTTTAGTGTTCTTCTGAGATGCC9primer 9GTTTTAAAGGAGTAGTTTTACAATGGCTGCGCTCGCATCAA10primer 10AGGGGCTCTTCCTGTTTCTAGCCAACCATCTCCT12primer 11GGCCCTTCCGGTTTGCTCCTTAGGGAGC13primer 12AGAATTTTTCCAGGCATATGTGTGCACCTTTCGA15primer 13GCTCCCTAAGGAGCCTACTTTTGGAGATTTGC16primer 14GATCGAAAGGTGCACACATATGGGTTCTCACATCAC17primer 15GCTCCCTAAGGAGCTTAGTGTTCTTCTGAGATG18primer 16TCGAAAGGTGCACACATATGGCTGCGCTCGCATCAA19primer 17AAATCTCCAAAAGTAGGCTCCTTAGGGAGCCA20primer 18TGATGTGAGAACCCATATGTGTGCACCTTTCGAT21primer 19CATCTCAGAAGAACACTAAGCTCCTTAGGGAGCCAT22primer 20TTGATGCGAGCGCAGCCATATGTGTGCACCTTTCGA

[0122]

[0123] 실시예 3: 트립토판 생산 균주 제작

[0124]

[0125] The vectors 'pDC24ΔBBD29_01410:: PlysCm1_aroDE(1g>a)A(1t>a)' and 'pDC24ΔBBD29_01410:: PlysCm1_aroD-PlysCm1_aroE(1g>a)-PlysCm1_aroA(1t>a)' produced in Examples 1 and 2 above were each transformed into the tryptophan-producing strain KCCM12670P (US Patent Publication US 2023-0134555 A1) by the electro-pulse method (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and then the transformed strain was obtained through a second crossover process. PCR was performed in the same manner as in Example 1 using primers of SEQ ID NO. 23 and SEQ ID NO. 24, and the corresponding genetic modification was confirmed through genome sequencing. The strains obtained in this way were named KCCM12670PΔBBD29_01410:: PlysCm1_aroDE(1g>a)A(1t>a) and KCCM12670PΔBBD29_01410::PlysCm1_aroD-PlysCm1_aroE(1g>a)-PlysCm1_aroA(1t>a), respectively. The primers used are listed in Table 2 below.

[0126]

[0127] Sequence No. Name Sequence (5'→3')23primer 21GGTTCGAAAATGCAGTGG24primer 22AAAACTGATTGGCCTGAAGA

[0128]

[0129] Example 4: Evaluation of Tryptophan Production Capacity

[0130]

[0131] To confirm the L-tryptophan production capacity of the strain prepared in Example 3 above, it was evaluated by culturing in the following manner. Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium and cultured with shaking at 200 rpm for 20 hours at 30 ℃. Then, 1 ml of seed culture was inoculated into a 250 ml corner-baffle flask containing 25 ml of production medium and cultured with shaking at 200 rpm for 24 hours at 30 ℃. After the culture was completed, the production of L-tryptophan was measured by HPLC, and the analysis results are shown in Table 3 below.

[0132]

[0133] <Seed medium (pH 7.0)>

[0134] Glucose 20g, Peptone 10g, Yeast extract 5g, Urea 1.5g, KH2PO44g, K2HPO48g, MgSO47H2O 0.5g, Biotin 100µg, Thiamine HCl 1000µg, Calcium-Pantothenic Acid 2000µg, Nicotinamide 2000µg (based on 1 liter of distilled water)

[0135]

[0136] Production Medium (pH 7.0)

[0137] Glucose 30g, (NH4)2SO4 15g, MgSO4 7H2O 1.2g, KH2PO4 1g, Yeast extract 5g, Biotin 900µg, Thiamine hydrochloride 4500µg, Calcium pantothenic acid 4500µg, CaCO3 30g (based on 1 liter of distilled water)

[0138]

[0139] Strain Name L-Tryptophan Concentration (g / L)KCCM12670P1.8KCCM12670PΔBBD29_01410::PlysCm1_aroDE(1g>a)A(1t>a)2.8KCCM12670PΔBBD29_01410::PlysCm1_aroD-PlysCm1_aroE(1g>a)-PlysCm1_aroA(1t>a)2.2

[0140]

[0141] As a result, as shown in Table 3 above, it was confirmed that tryptophan production capacity increased in the KCCM12670PΔBBD29_01410::PlysCm1_aroDE(1g>a)A(1t>a) and KCCM12670PΔBBD29_01410::PlysCm1_aroD-PlysCm1_aroE(1g>a)-PlysCm1_aroA(1t>a) strains, in which the aroD, aroE, and aroA genes, which are the tryptophan biosynthetic pathways, were enhanced compared to the parent strain KCCM12670P. In addition, it was confirmed that tryptophan production capacity increased in the KCCM12670PΔBBD29_01410::PlysCm1_aroDE(1g>a)A(1t>a) strain, in which the aroD, aroE, and aroA genes are regulated by a single operon, compared to the KCCM12670PΔBBD29_01410::PlysCm1_aroD-PlysCm1_aroE(1g>a)-PlysCm1_aroA(1t>a) strain, in which the aroD, aroE, and aroA genes are expressed individually through their respective promoters.

[0142] Through this, it was confirmed that regulating the aroD, aroE, and aroA genes as a single operon, rather than transcribing them individually, allows for the balanced coordination of gene expression levels and the exertion of synergistic effects, thereby enabling more efficient production of L-tryptophan.

[0143]

[0144] From the foregoing description, those skilled in the art to which this application pertains will understand that this application may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of this application should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.

Claims

1. A polynucleotide comprising aroD gene, aroE gene, and aroA gene sequentially operably linked to a single promoter.

2. A polynucleotide according to claim 1, wherein the aroD gene and the aroE gene are connected to a first ribosome binding site (RBS), and the aroE gene and the aroA gene are connected to a second ribosome binding site.

3. The polynucleotide according to claim 1, wherein the aroD gene, the aroE gene, and the aroA gene each consist of nucleotide sequences having 90% or more sequence identity with SEQ ID NO. 26, SEQ ID NO. 27, and SEQ ID NO.

28.

4. A polynucleotide according to paragraph 2, wherein the first ribosome binding site is the ribosome binding site of the qsuBC gene and the second ribosome binding site is the ribosome binding site of the lysC / asd gene.

5. A polynucleotide according to claim 4, wherein the ribosome binding site of the qsuBC gene and the ribosome binding site of the lysC / asd gene each consist of a nucleotide sequence having at least 90% sequence identity with SEQ ID NO. 29 and SEQ ID NO.

30.

6. The polynucleotide of claim 1, wherein the polynucleotide is composed of a nucleotide sequence having 90% or more sequence identity with SEQ ID NO.

25.

7. A tryptophan-producing microorganism of the genus Corynebacterium into which an operon comprising the polynucleotide of any one of claims 1 to 6 has been introduced.

8. In paragraph 7, the microorganism is Corynebacterium glutamicum.

9. A method for producing L-tryptophan comprising the step of culturing the microorganism of claim 7 in a culture medium.

10. A method for producing L-tryptophan according to claim 9, further comprising the step of recovering L-tryptophan from the cultured microorganism or medium.

11. Use of a tryptophan-producing microorganism of the genus Corynebacterium, into which an operon comprising a polynucleotide of any one of claims 1 to 6 has been introduced for the production of L-tryptophan.