Novel probiotic culture having preventive and therapeutic activity against stress, depression, and hearing loss

Abstract

Disclosed is a novel Levilactobacillus brevis strain capable of regulating human microbiome growth, which is highly associated with depression, and having preventive and therapeutic efficacy against depression caused by medication and chronic stress. In addition, the present invention provides a pharmaceutical composition for treating or preventing depression, the pharmaceutical composition comprising the strain or a culture thereof. In addition, disclosed is a DX3004 lactic acid bacteria fermentation composition containing a gamma-aminobutyric acid as an active ingredient and having the effects of inhibiting stress-induced sudden hearing loss and improving cellular mechanical signal transduction of auditory receptor cells and / or the formation of sensory cilia structures of auditory receptor cells. In addition, the present invention provides a pharmaceutical composition for treating or preventing hearing loss, the pharmaceutical composition comprising a culture of the DX3004 lactic acid bacteria fermentation composition.

Description

Novel probiotic culture having preventive and therapeutic activity against stress, depression, and hearing loss

[0001] The present invention relates to a probiotic lactic acid bacteria strain. The present invention also relates to a pharmaceutical composition and a food composition for the prevention or treatment of depression comprising such strain. Furthermore, the present invention relates to a lactic acid bacteria strain that produces gamma-aminobutyric acid as a fermentation product, the fermentation product itself, and furthermore, a pharmaceutical composition and a food composition for the prevention or treatment of hearing loss comprising such fermentation product.

[0002] Probiotics refer to microorganisms that possess antimicrobial and enzymatic activity to help maintain the balance of intestinal microorganisms. Furthermore, probiotics are defined as live bacteria in the form of single or complex strains that are supplied to humans or animals in the form of dried cells or fermentation products to improve the intestinal flora. The characteristics required for probiotics include inhabiting the human gut, being non-pathogenic and non-toxic, and surviving during transit to the intestines. Recently, as various health benefits, including improved gut health, have been reported, probiotics are gaining attention as a major therapeutic substance capable of replacing existing compound-based treatments.

[0003] Inappropriate medication use and chronic stress not only cause disruptions to daily life, such as indigestion and sleep disorders, but can also lead to depression in severe cases. Since depression is accompanied by mental disorders like loss of motivation and suicidal impulses, as well as physical disorders such as immune and metabolic issues, medical alternatives for its prevention and treatment are urgently needed. To this end, many companies and universities worldwide are continuously researching and developing functional ingredients with efficacy in preventing and treating depression.

[0004] Many studies are also being conducted to identify microbiome strains residing in the human body that are highly associated with depression and to improve depression through this process. For example, according to a follow-up study conducted by Harvard University from 2013 to 2014 on a cohort of 204 participants, the amount of *Faecalibacterium prausnitzii* strains in the intestines of those who consistently consumed tangerines was significantly higher than in those who did not. Furthermore, an increase in *Faecalibacterium prausnitzii* strains showed a close correlation with an increase in neurotransmitters associated with depression improvement, such as dopamine and serotonin, in the gut. These results suggest that tangerine consumption may ultimately contribute to the improvement of depression by regulating the growth of gut microbiome strains.

[0005] Along with the gut, hundreds of microbiome species inhabit the oral cavity. According to a study by Wingfield et al. published in 2021, significant differences were observed in the distribution of oral microbiomes between 40 patients with depression (average age 21.8 years) and 43 healthy individuals (average age 20.4 years). The bacterial species showing the greatest difference in distribution was Haemophilus parainfluenzae, which was found to be significantly lower in the oral cavity of patients with depression compared to healthy individuals. According to a paper by Zhang et al. published in 2021, the amount of Haemophilus parainfluenzae was also found to be significantly lower in the intestines of 36 patients with depression (average age 36.8 years) compared to 45 healthy individuals (average age 39.2 years). These results suggest that increasing the growth of Haemophilus parainfluenzae, which has decreased in the oral cavity or intestines of patients with depression, may be helpful in the prevention and treatment of depression.

[0006] Gamma-aminobutyric acid (GABA) is a non-protein amino acid found in the nervous system and blood of humans, with most of it present in the bone marrow of the brain, performing physiological functions such as increasing the amount of the neurotransmitter acetylcholine. GABA is produced by the irreversible decarboxylation of glutamate by glutamate decarboxylase (GAD), and GAD and GABA are widely found in organisms ranging from microorganisms to higher organisms.

[0007] In addition to its role as a neurotransmitter, GABA possesses a wide range of physiological functions, including promoting brain function, stabilizing the mind, lowering blood pressure, acting as a diuretic, improving liver function, preventing obesity, promoting alcohol metabolism, and deodorizing. Although GABA is naturally present in fruits, rice, green tea, and cabbage, its content is low, making it difficult to expect significant physiological activity or efficacy from the amounts consumed through natural foods. GABA can be synthesized using chemical or biochemical methods. Biochemical methods are more advantageous than chemical methods due to their simpler reactions and higher enzymatic efficiency. Consequently, various biochemical methods have been studied.

[0008] According to a 2025 World Health Organization report, approximately 340 million people, or about 5% of the global population, currently suffer from hearing loss, and this number is projected to increase to 700 million by 2050, representing about 10% of the world's population. Aging, underlying diseases, noise exposure, and ototoxic drugs are identified as major causes of hearing loss, and once hearing is lost, it is difficult to restore it to its original state. On the other hand, in the case of sudden hearing loss, hearing can be restored to its original state if adequately supported by timely diagnosis and treatment. Sudden hearing loss is characterized by a rapid decline in hearing, typically within three days, accompanied by symptoms such as tinnitus (ringing in the ears) or a sensation of fullness in the ear. Although the exact cause of sudden hearing loss has not yet been precisely identified, it has been revealed that excessive physical and mental stress or blood circulation problems can be contributing factors, and steroid medications or blood circulation enhancers are used as treatment methods. As such, while it is important to treat sudden hearing loss immediately upon onset, it is also crucial to prevent it in advance, as it significantly reduces the quality of life from the moment of onset. However, research on substances effective in preventing and improving sudden hearing loss is currently very limited.

[0009] According to research results published in 2025 by Yoshihisa Koyama's research team at the Department of Neuropsychiatry, Osaka University, Japan, repeated exposure of experimental mice to cold stress induced sudden hearing loss, and the levels of corticortisone and C-reactive protein, stress-inflammation-related factors in the mice's serum, significantly increased. While these findings are significant in that they established an experimental animal model for studying sudden hearing loss and developed pathological indicators related to the condition, they still failed to propose solutions for the prevention and improvement of sudden hearing loss.

[0010] The inventors developed a method for producing a fermentation product containing a high concentration of gamma-aminobutyric acid by fermentation using the Reviractobacillus brevis DX3004 strain and the fermentation composition thereof, and completed the present invention by discovering that the fermentation composition has efficacy in preventing and improving sudden hearing loss.

[0011] One technical objective of the present invention is to provide a novel lactic acid bacterium for probiotics that can secrete gamma-aminobutyric acid (GABA), has growth-regulating efficacy for human microbiome strains highly associated with depression, and has superior efficacy in restoring physiological and behavioral disorders caused by depression compared to GABA treatment alone.

[0012] Another technical objective of the present invention is to provide a method for producing a fermentation product that produces GABA from glutamic acid source using the Reviractobacillus brevis DX3004 strain, and the fermentation composition thereof. Furthermore, a technical objective of the present invention is to provide the aforementioned fermentation composition for medicinal use in preventing and treating hearing loss.

[0013] To achieve the aforementioned technical problem, one aspect of the present invention provides the Levilactobacillus brevis DX3004 strain (deposit number: KCTC 16236BP).

[0014] In another aspect of the present invention, a pharmaceutical composition for the prevention or treatment of depression is provided, comprising as active ingredients one or more selected from the Reviractobacillus brevis DX3004 strain (deposit number: KCTC 16236BP), lysate of the strain, dead cells of the strain, culture of the strain, concentrate of the culture of the strain, extract of the culture of the strain, dried culture of the strain, and supernatant of a cell-free culture of the strain.

[0015] In one embodiment of the present invention, the aforementioned DX3004 strain, the lysate of the strain, the dead cells of the strain, the culture of the strain, the concentrate of the culture of the strain, the extract of the culture of the strain, the dried culture of the strain, or the supernatant of the cell-free culture of the strain are effective against depression induced by a dopamine receptor antagonist drug.

[0016] In another embodiment of the present invention, the aforementioned DX3004 strain, the lysate of the strain, the dead cells of the strain, the culture of the strain, the concentrate of the culture of the strain, the extract of the culture of the strain, the dried culture of the strain, or the supernatant of the cell-free culture of the strain are effective against depression induced by chronic stress.

[0017] In another embodiment of the present invention, the aforementioned DX3004 strain, the lysate of the strain, the dead cells of the strain, the culture of the strain, the concentrate of the culture of the strain, the extract of the culture of the strain, the dried culture of the strain, or the supernatant of the cell-free culture of the strain promotes gene expression of dopamine receptors and / or serotonin receptors in a host.

[0018] In another embodiment of the present invention, the aforementioned DX3004 strain, the lysate of the strain, the dead cells of the strain, the culture of the strain, the concentrate of the culture of the strain, the extract of the culture of the strain, the dried culture of the strain, or the supernatant of the cell-free culture of the strain promotes the growth of Haemophilus parainfluenzae.

[0019] In another aspect of the present invention, a food composition is provided comprising one or more selected from the Reviractobacillus brevis DX3004 strain (deposit number: KCTC 16236BP), lysate of the strain, dead cell of the strain, culture of the strain, concentrate of the culture of the strain, extract of the culture of the strain, dried culture of the strain, and supernatant of a cell-free culture of the strain.

[0020] In another aspect of the present invention, a feed composition is provided comprising one or more selected from the Reviractobacillus brevis DX3004 strain (deposit number: KCTC 16236BP), lysate of the strain, dead cell body of the strain, culture of the strain, concentrate of the culture of the strain, extract of the culture of the strain, dried culture of the strain, and supernatant of a cell-free culture of the strain.

[0021] In one aspect of the present invention, a fermented composition containing gamma-aminobutyric acid is provided, wherein the product obtained by fermenting a culture of the strain Reviractobacillus brevis DX3004, deposited under accession number KCTC 16236BP, by contacting it with a liquid glutamic acid source is dried and powdered. In one embodiment of the fermented composition of the present invention, the gamma-aminobutyric acid content of the fermented composition accounts for 30% to 70% by weight of the total weight of the fermented composition. In one specific embodiment of the fermented composition of the present invention, the glutamic acid source is sodium monoglutamate.

[0022] In another aspect of the present invention, a method for producing a fermentation product containing gamma-aminobutyric acid is provided, comprising the step of culturing the Reviractobacillus brevis DX3004 strain deposited under accession number KCTC 16236BP and contacting it with a liquid glutamic acid source. In one embodiment of the method for producing a fermentation product according to the present invention, the aforementioned step of culturing and contacting it with a liquid glutamic acid source is

[0023] (a) A pre-culture step of culturing the Reviractobacillus brevis DX3004 strain in a medium containing a carbon source and a nitrogen source,

[0024] (b) a main culture step in which the entire culture of the pre-culture step or the Reviractobacillus brevis DX3004 strain that has completed the pre-culture step is inoculated into a medium containing a carbon source and a nitrogen source, which is larger in scale than the medium of the pre-culture step, and the Reviractobacillus brevis DX3004 strain is cultured until a density greater than or equal to the cell density at the completion of the pre-culture step is reached; and

[0025] (c) Includes a fermentation step in which a glutamic acid source is added to a cell suspension obtained by centrifuging the culture from the above main culture step and cultured.

[0026] In one specific embodiment of the method for producing a fermented product of the present invention, the method further includes a step of freeze-drying the product after completing the aforementioned fermentation step.

[0027] In another aspect of the present invention, a pharmaceutical composition for the prevention or treatment of hearing loss is provided, comprising the aforementioned fermented composition containing gamma-aminobutyric acid as an active ingredient. In one embodiment of the pharmaceutical composition for the prevention or treatment of hearing loss according to the present invention, the aforementioned hearing loss is stress-induced sudden hearing loss. In one specific embodiment of the pharmaceutical composition for the prevention or treatment of hearing loss according to the present invention, this pharmaceutical composition has the effect of improving cytomechanical signaling of auditory receptor cells and / or the formation of sensory cilia structures of auditory receptor cells.

[0028] In another aspect of the present invention, a health functional food comprising the aforementioned gamma-aminobutyric acid-containing fermented composition is provided.

[0029] The Reviractobacillus brevis DX3004 strain and its culture of the present invention possess the ability to secrete GABA and promote the growth of human microbiome strains that are highly associated with depression. In addition, the DX3004 strain and its culture have the efficacy to improve physiological and behavioral disorders caused by depression induced by the use of dopamine receptor antagonist drugs or chronic stress, and the improvement efficacy is superior to that of GABA alone. The Reviractobacillus brevis DX3004 strain and its culture of the present invention can be usefully applied in pharmaceutical compositions, quasi-drugs, food compositions, and feed compositions for the prevention and treatment of depression. The method of preparing a gamma-aminobutyric acid-containing fermentation product of the present invention using Reviractobacillus brevis DX3004 can effectively biosynthesize GABA from glutamic acid source. The fermented composition containing gamma-aminobutyric acid of the present invention has efficacy in preventing and treating hearing loss, particularly stress-induced sudden hearing loss, and can be usefully applied to pharmaceutical compositions, quasi-drugs, and health functional foods for the prevention and treatment of stress-induced sudden hearing loss.

[0030] Figure 1 is a photograph showing the results of thin-layer chromatography performed to confirm the gamma-aminobutyric acid (GABA) production capacity of each of the 42 lactic acid bacteria strains isolated and identified from the feces of healthy Korean infants. Lanes 1–3: Lactobacillus jonhsonii culture, Lane 4: Levillactobacillus brevis culture, Lanes 5–10: Lactobcillus gasseri culture, Lanes 11–16: Lacticaseibacillus rhamnosus culture, Lanes 17–20: Limosilactobacillus reuteri culture, Lanes 21–24: Limosilactobcillus fermentum culture, Lanes 25–32: Bifidobacterium longum culture, Lanes 33–38: Bifidobacterium breve culture, Lane 39: Bifidobacterium bifidum culture, Lane 40: Bifidobacterium infantis culture, Lane 41: Bifidobacterium animalis culture, Lane 42: Bifidobacterium pseudocatenulatum culture.

[0031] Figure 2 is a photograph showing the results of thin-layer chromatography performed to compare the GABA production capacity between ATCC 8287, a standard strain of the Levilactobacillus brevis species, and the Levilactobacillus brevis DX3004 strain.

[0032] Figure 3 is a photograph showing the growth of Haemophilus parainfluenzae strains after being inoculated in nutrient-normal medium (A), nutrient-depleted medium (B), nutrient-depleted medium with DX3004 strain culture added (C), and nutrient-depleted medium with GABA added alone (D), while decreasing the amount tenfold from 1,000,000 CFU to 100 CFU.

[0033] Figure 4 is a photograph showing the growth of Clostridium difficile strains after being inoculated in nutrient-normal medium (A), nutrient-depleted medium (B), nutrient-depleted medium with DX3004 strain culture added (C), and nutrient-depleted medium with GABA added alone (D), while decreasing the amount tenfold from 1,000,000 CFU to 100 CFU.

[0034] Figure 5 shows photographs of the negative locomotority of fruit flies in a normal group (A), a group treated with 0.1% chlorpromazine (CPZ) (B), a group with 0.1% CPZ treatment and DX3004 strain culture added (C), and a group with 0.1% CPZ treatment and GABA alone added (D).

[0035] Figure 6 is a graph showing the proportion of fruit flies in vials of each experimental group (A), (B), (C), and (D) described in Figure 5 that crawl up to a point 6 cm from the bottom in 10 seconds, expressed as a percentage. In the graph, * and *** marks indicate the significance of the p-values ​​calculated by performing a one-way ANOVA Tukey test on the corresponding measurements (* is p < 0.05, *** is p < 0.001).

[0036] Figure 7 is a graph showing the dopamine receptor mRNA expression levels measured in the heads of fruit flies of the normal group (A), the 0.1% CPZ treatment group (B), the group with DX3004 strain culture added along with 0.1% CPZ treatment (C), and the group with GABA alone added along with 0.1% CPZ treatment (D). In the graph, * and *** indicate the significance of the p-value calculated by performing a unidirectional ANOVA TUKE test on the corresponding measurements (* indicates p < 0.05, *** indicates p < 0.001), and ns indicates that the difference between the two experimental groups indicated is not statistically significant.

[0037] Figure 8 is a graph showing the serotonin receptor mRNA expression levels measured in the heads of fruit flies of the normal group (A), the 0.1% CPZ treatment group (B), the group with DX3004 strain culture added along with 0.1% CPZ treatment (C), and the group with GABA alone added along with 0.1% CPZ treatment (D). In the graph, * and *** indicate the significance of the p-values ​​calculated by performing a one-way ANOVA TUKE test on the corresponding measurements (* indicates p < 0.05, *** indicates p < 0.001), and ns indicates that the difference between the two experimental groups indicated is not statistically significant.

[0038] Figure 9 is a photograph showing the negative geopathic behavior of fruit flies in a normal group with no treatment (A), a group treated with chronic unpredictable mild stress (CUMS) (B), a group treated with CUMS and GABA with the addition of the DX3004 strain (C), and a group treated with CUMS and only GABA (D).

[0039] Figure 10 is a graph showing the percentage of fruit flies crawling up from the bottom to a point 6 cm above in 10 seconds in each vial of experimental groups (A), (B), (C) and (D) of Figure 9. In the graph, *** indicates the significance of the p-value calculated by performing a unidirectional ANOVA test on the corresponding measurement (*** is p < 0.001), and ns indicates that the difference between the two experimental groups indicated is not statistically significant.

[0040] Figure 11 is a graph showing the dopamine hormone content in the heads of fruit flies measured in a normal group (A), a chronic unpredictable mild stress (CUMS) treatment group (B), a group with DX3004 strain culture added along with CUMS treatment (C), and a group with GABA added along with CUMS treatment (D). In the graph, * indicates the significance of the p-value calculated by performing a unidirectional ANOVA TUKE test on the corresponding measurement (* indicates p < 0.05), and ns indicates that the difference between the two experimental groups indicated is not statistically significant.

[0041] Figure 12 is a graph showing the serotonin hormone content in the heads of fruit flies measured in a group (C) with DX3004 strain culture added and a group (D) with GABA alone added along with CUMS treatment. In the graph, * indicates the significance of the p-value calculated by performing a unidirectional ANOVA test on the corresponding measurement (* indicates p < 0.05), and ns indicates that the difference between the two experimental groups is not statistically significant.

[0042] FIG. 13 is a bar graph showing the gamma-aminobutyric acid content in the fermentation product obtained by high-performance liquid chromatography (HPLC), respectively, according to the conventional GABA fermentation method (DX3004-MF) or the fermentation product preparation method (DX3004-HMF) of the present invention using Reviractobacillus brevis DX3004.

[0043] Figure 14 is a photograph showing the formation of a male-male chain by an artificial courtship song in a normal male fruit fly.

[0044] Figure 15 is a photograph showing the inhibition of male-male chain formation by an artificial courtship song in male fruit flies subjected to cold-shock stress.

[0045] Figure 16 is a photograph showing the formation of a male-male chain by artificial mating song in male fruit flies subjected to cold stress along with the intake of the fermented composition (DX3004-HMF) of the present invention.

[0046] Figure 17 is a bar graph showing the results of analyzing the amount of gene nanchung mRNA expressed in fruit flies of normal group A, group B (cold stress-induced sudden hearing loss group) in which sudden hearing loss was induced by cold stress, and group C (cold stress-induced sudden hearing loss + DX3004-HMF) in which the fermented composition containing gamma-aminobutyric acid of the present invention was consumed while cold stress was applied. In the graph, * and ** indicate the significance of the p-values ​​calculated by performing a one-way ANOVA Tukey test on the corresponding measurements (* is p < 0.05, ** is p < 0.01).

[0047] Figure 18 is a bar graph showing the results of analyzing the mRNA levels of the gene nompB expressed in fruit flies of normal group A, group B (cold stress-induced sudden hearing loss group) in which sudden hearing loss was induced by cold stress, and group C (cold stress-induced sudden hearing loss + DX3004-HMF) in which the fermented composition containing gamma-aminobutyric acid of the present invention was consumed while cold stress was applied. In the graph, * indicates the significance of the p-value calculated by performing a unidirectional ANOVA TUKE test on the corresponding measurement (* indicates p < 0.05).

[0048] Figure 19 is a bar graph showing the results of analyzing the mRNA levels of the gene rempA expressed in fruit flies of normal group A, group B (cold stress-induced sudden hearing loss group) in which sudden hearing loss was induced by cold stress, and group C (cold stress-induced sudden hearing loss + DX3004-HMF) in which the fermented composition containing gamma-aminobutyric acid of the present invention was consumed while cold stress was applied. In the graph, * indicates the significance of the p-value calculated by performing a unidirectional ANOVA TUKE test on the corresponding measurement (* indicates p < 0.05).

[0049] Embodiments of the present invention will be described in detail below. Prior to this, terms and words used in this specification and claims should not be interpreted as being limited to their ordinary or dictionary meanings, but should be interpreted in a meaning and concept consistent with the technical spirit of the present invention, based on the principle that the inventor may appropriately define the concept of the terms to best describe his invention.

[0050] Therefore, the embodiments described in this specification are merely examples presented for the purpose of helping to understand the invention and do not represent all technical ideas of the invention; thus, it should be understood that various equivalents and modifications that can replace them may exist at the time of filing this application.

[0051] Unless otherwise defined, all technical terms used in this invention are used in the sense generally understood by a person skilled in the art related to this invention. While preferred methods or samples are described herein, similar or equivalents are also included within the scope of this invention. Numerical values ​​described herein are deemed to include the meaning of "approximately" unless explicitly stated otherwise. Numerical ranges indicated by the term "to" in this specification include ranges that include the values ​​described before and after the term "to" as lower and upper limits, respectively.

[0052] In this specification, "culture" means growing microorganisms under artificially and appropriately controlled environmental conditions.

[0053] In this specification, "culture medium" means a solid or liquid containing nutrients necessary for the growth of animal cells, plant cells, bacteria, etc.

[0054] In this specification, the term "medium" refers to a substance containing nutrients required by the microorganism to be cultured—that is, the microorganism serving as the culture medium—for the purpose of culturing a specific microorganism; it may also contain substances added for special purposes. A medium in a liquid state is also referred to as a culture solution. The concept of a medium encompasses natural media, synthetic media, and selective media. The medium used for cultivation must satisfy the requirements of the target strain in an appropriate manner by controlling temperature, pH, etc., within a conventional medium containing suitable carbon sources, nitrogen sources, amino acids, vitamins, etc.

[0055] In this specification, the term "culture" refers to a product obtained by culturing lactic acid bacteria in a known medium. The culture may include the lactic acid bacteria strains as the result of the culture, or it may include only the culture excluding such strains. The culture may be in a liquid or solid form, but is not limited thereto. The medium for culturing lactic acid bacteria may be selected from known liquid or solid media, and may be, for example, MRS liquid medium, GAM liquid medium, MRS agar medium, GAM agar medium, or BL agar medium, but is not limited thereto. In the present invention, "cell-free culture supernatant" refers to a liquid mixture obtained by removing bacterial cells from a culture obtained by culturing lactic acid bacteria strains for a certain period, and refers to a liquid mixture containing metabolic products, excess nutrients, etc., produced during the culture process of the strains. Furthermore, in the present invention, "cell-free culture supernatant" encompasses the concentrate of the cell-free culture supernatant obtained immediately after culturing the lactic acid bacteria strains, as well as its extracts or fractions. As the supernatant of a cell-free culture, the following may be used: a culture medium left undisturbed for a certain period of time to obtain only the liquid from the upper layer excluding the portion settled at the bottom; a culture medium from which bacterial cells have been removed through filtration; or a culture medium obtained by centrifuging the culture medium to remove the lower sediment and obtaining only the upper liquid. In the present invention, the term "crushed material" refers to lactic acid bacteria that have been destroyed by enzymatic treatment, homogenization, or ultrasonic treatment. Additionally, in the present invention, the term "extract" refers to a product obtained by extracting lactic acid bacteria with a known extraction solvent. Furthermore, in the present invention, the term "live cell" refers to the novel lactic acid bacteria of the present invention itself, and the term "dead cell" refers to lactic acid bacteria that have been sterilized by heating, pressurization, or drug treatment.

[0056] As used herein, the term "extract of a culture" refers to a fraction obtained by treating a culture with an organic solvent or a mixed solvent containing an organic solvent, or a preparation obtained by concentrating said fraction. Although not limited thereto, the extract of a culture may be an extract obtained by extraction, a diluted or concentrated extract, a dried product obtained by drying the extract, a crude or purified product thereof, or furthermore, a chromatographic fraction thereof. As the organic solvent or mixed solvent containing an organic solvent for extraction, lower alcohols having 1 to 4 carbon atoms, polar solvents such as ethyl acetate, acetone, and chloroform, non-polar solvents such as hexane and dichloromethane, or a mixture thereof may be used. Additionally, water, lower alcohols, or a mixture thereof may be used. The extraction method for obtaining the extract is not particularly limited and may be carried out according to methods commonly used in the relevant technical field. For example, after suspending the culture in distilled water, a non-polar solvent such as hexane, chloroform, ethyl acetate, or dichloromethane can be added in an amount of about 1 to 100 times, preferably about 1 to 5 times, of the volume of the suspension, and a non-polar solvent-soluble layer can be obtained by extracting and separating it 1 to 10 times, preferably 2 to 5 times. Additionally, a conventional fractionation process may be performed. Specifically, after suspending the culture of the strain in water, each solvent-soluble extract can be obtained by continuous extraction using equal amounts of n-hexane, chloroform, and ethyl acetate solvents.

[0057] As used in this specification, the term "dried product of culture" refers to a substance obtained by simply drying, drying under reduced pressure, or freeze-drying the culture of the lactic acid bacteria strain.

[0058] In the present invention, the term "starter culture" refers to a strain of microorganism used for fermentation (e.g., a stock of the strain) that is in a preserved state, such as a frozen state.

[0059] The term "starter culture" is well known in the art. In this specification, "starter culture" refers to a procedure of culturing the aforementioned starter culture in a suitable culture medium (starter culture medium) to a desired cell density in order to obtain living microorganisms capable of initiating or completing the fermentation of organic matter. If a main culture is separately provided as a subsequent step to the starter culture, the main culture uses a larger scale of culture medium and has a higher cell density than the starter culture.

[0060] The term "depression" as used in this invention refers to a state of physiological homeostasis disturbance and loss of behavioral motivation caused by continuous exposure to external stimuli that exceed the human body's permissible range. Since chlorpromazine, a drug used to treat mania in patients with bipolar disorder, inhibits dopamine and serotonin receptor activity, long-term use of chlorpromazine disrupts the dopamine and serotonin signaling pathways, thereby causing severe depression instead of satisfaction and happiness. In addition to drugs, sleep deprivation and nutritional imbalances resulting from excessive physical and mental labor also cause "depression" accompanied by a decrease in satisfaction and happiness, and in severe cases, lead to loss of motivation and suicidal impulses.

[0061] The term "human microbiome strain highly associated with depression" used in this invention refers to a strain that inhabits the oral cavity and intestines with a significant quantitative difference in patients with stress-induced depression compared to normal individuals. According to the research results of the aforementioned papers by Wingfield et al. and Zhang et al. published in 2021, the distribution of Haemophilus parainfluenzae strains in the oral cavity and intestines of patients with depression was found to be significantly lower compared to normal individuals. Therefore, Haemophilus parainfluenzae can represent the "human microbiome strain highly associated with depression" used in this invention.

[0062] The term "prevention" as used in this invention refers to any act of suppressing symptoms of depression-related diseases or delaying their progression through the administration of the pharmaceutical composition of this invention.

[0063] The term "treatment" as used in this invention refers to any act of improving or beneficially altering the symptoms of depression-related diseases through the administration of the pharmaceutical composition of this invention.

[0064] The term "included as an active ingredient" as used in the present invention refers to an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level may be determined based on factors including the type and severity of the patient's disease, drug activity, sensitivity to the drug, time of administration, route of administration and elimination rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field.

[0065] In the present invention, when relating to Reviractobacillus brevis, the term "secretion" refers to the phenomenon in which a Reviractobacillus brevis strain releases substances, such as metabolic products or signaling substances, out of the cell, for example, into a culture medium or the host body.

[0066] In the present invention, "host" refers to a person who has been administered a pharmaceutically effective amount of the DX3004 strain disclosed in the present invention (deposit number: KCTC 16236BP), the lysate of the strain, the dead cells of the strain, the culture of the strain, the concentrate of the culture of the strain, the extract of the culture of the strain, the dried culture of the strain, and the supernatant of the cell-free culture of the strain.

[0067] In the present invention, "gamma-aminobutyric acid" or "GABA" in the context of the secretion of substances outside the cell by Reviractobacillus brevis is a term that encompasses all forms, including the undissociated neutral molecular form (i.e., the neutral molecule of 4-aminobutanoic acid by IUPAC name) as well as the dissociated anion or salt form (i.e., the 4-aminobutanoic acid anion or the salt of that anion), unless specifically indicated otherwise.

[0068] Throughout this specification, "%" used to indicate the concentration of a particular substance is (weight / weight) % for solid / solid, (weight / volume) % for solid / liquid, and (volume / volume) % for liquid / liquid, unless otherwise noted.

[0069] In one aspect of the present invention, the strain of Levilactobacillus brevis DX3004 (deposit number: KCTC 16236BP) is provided. Levilactobacillus brevis is a Gram-positive bacillus distributed in various environments, including fermented foods and the gut microbiota, and is a type of lactic acid bacterium that performs heterolactic fermentation and can survive under oxygen and both anaerobic and anaerobic conditions. Levilactobacillus brevis is a lactic acid fermenting bacterium normally found in the intestines, which was previously classified in the genus Lactobacillus and known by the scientific name Lactobacillus brevis. The inventors selected a novel strain of Levilactobacillus brevis with excellent gamma-aminobutyric acid secretion efficacy and named it DX3004. The above strain was deposited at the National Center for Biological Resources of the Korea Research Institute of Biotechnology and Bioengineering on February 42, 2025, under deposit number KCTC 16236BP. In addition, the above strain is a probiotic strain, is harmless to the human body, and can be used without side effects. In this specification and the accompanying drawings, this Reviractobacillus brevis DX3004 strain may be abbreviated simply as DX3004 without the name of the bacterial species.

[0070] The culture medium used for culturing the strain of *Reviractobacillus brevis* of the present invention may be any medium used for culturing microorganisms in the field, but is not limited thereto. To cultivate a specific microorganism, the medium may contain nutrients required by the microorganism to be cultured, i.e., the microorganism serving as the culture medium, and may be a medium in which substances for a special purpose are additionally added and mixed. The culture medium used for cultivation must satisfy the requirements of the specific strain while controlling the temperature, pH, etc., within a conventional medium containing a suitable carbon source, nitrogen source, amino acids, vitamins, etc. As for carbon sources that can be used, a mixed sugar of glucose and xylose is used as the main carbon source, and in addition, sugars and carbohydrates such as sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid are included. These substances may be used individually or as a mixture. Nitrogen sources that may be used include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate; amino acids such as glutamic acid, methionine, and glutamine, and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquid, casein hydrolysate, fish or its decomposition products, defatted soybean cake or its decomposition products. These nitrogen sources may be used alone or in combination. The medium may contain potassium monophosphate, potassium diphosphate, and corresponding sodium-containing salts as phosphorus. Potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium-containing salts may be used as phosphorus. Additionally, inorganic compounds such as sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, and calcium carbonate may be used. Finally, in addition to the above substances, essential growth substances such as amino acids and vitamins may be used.

[0071] In addition, suitable precursors may be used in the culture medium. The aforementioned raw materials may be added to the culture in a batch, fed-batch, or continuous manner in a manner suitable for the culture process, but are not particularly limited thereto. The pH of the culture may be adjusted by using basic compounds such as sodium hydroxide, potassium hydroxide, and ammonia, or acid compounds such as phosphoric acid or sulfuric acid in a suitable manner.

[0072] The Reviractobacillus brevis DX3004 strain of the present invention has the advantageous effect of secreting gamma-aminobutyric acid (GABA).

[0073] The DX3004 strain (deposit number: KCTC 16236BP), the lysate of the strain, the dead cells of the strain, the culture of the strain, the concentrate of the culture of the strain, the extract of the culture of the strain, the dried culture of the strain, and the supernatant of the cell-free culture of the strain contain GABA and have an effect of preventing or treating depression in the host.

[0074] In one embodiment, the DX3004 strain of the present invention is a strain of Reviractobacillus brevis containing a naturally occurring mutation of Reviractobacillus brevis.

[0075] In another aspect of the present invention, a pharmaceutical composition for the prevention or treatment of depression is provided, comprising as active ingredients one or more selected from the Reviractobacillus brevis DX3004 strain (deposit number: KCTC 16236BP), lysate of said strain, dead cell body of said strain, culture of said strain, concentrate of said strain culture, extract of said strain culture, dried culture of said strain, and supernatant of said strain cell-free culture.

[0076] In one embodiment of a pharmaceutical composition for the prevention or treatment of depression, the depression may be induced by a psychotropic drug. More specifically, the depression is induced by a drug that acts as an antagonist to dopamine receptors. In the most specific embodiment, the depression is depression induced by chlorpromazine.

[0077] In another embodiment of a pharmaceutical composition for the prevention or treatment of depression, the depression may be caused by chronic stress.

[0078] In the pharmaceutical composition for the prevention or treatment of depression according to the present invention, the active ingredient, namely the Reviractobacillus brevis DX3004 strain, the lysate of the strain, the dead cell of the strain, the culture of the strain, the concentrate of the culture of the strain, the extract of the culture of the strain, the dried product of the culture of the strain, or the supernatant of the cell-free culture of the strain, has the effect of regulating the growth of human microbiome strains highly associated with depression. Specifically, among the effects of regulating the growth of such human microbiome strains highly associated with depression, there is an effect of promoting the growth of Haemophilus parainfluenzae strains. Among the effects of regulating the growth of such human microbiome strains highly associated with depression, there is an effect of not promoting the growth of harmful bacteria in the body, such as Clostridium difficile.

[0079] The Reviractobacillus brevis DX3004 strain of the present invention, the lysate of the strain, the dead cell of the strain, the culture of the strain, the concentrate of the culture of the strain, the extract of the culture of the strain, the dried culture of the strain, or the supernatant of a cell-free culture of the strain have the effect of promoting the expression of serotonin receptor and / or dopamine receptor genes that are highly related to the symptoms and onset of depression in a host. More specifically, the effect of promoting the expression of serotonin receptor and dopamine receptor genes is the effect of increasing the mRNA amount of serotonin receptor genes and / or dopamine receptor genes in the host body.

[0080] The administration of the Reviractobacillus brevis DX3004 strain of the present invention, the lysate of the strain, the dead cell of the strain, the culture of the strain, the concentrate of the culture of the strain, the extract of the culture of the strain, the dried culture of the strain, or the supernatant of the cell-free culture of the strain is superior to the administration of GABA alone in terms of the effect of improving host depression, the effect of promoting the expression of genes for serotonin receptors and / or dopamine receptors, and the effect of promoting the growth of Haemophilus parainfluenzae strains.

[0081] The pharmaceutical composition for the prevention or treatment of depression according to the present invention may further include one or more additives selected from the group consisting of preservatives, dyes, emulsifiers, sweeteners, stabilizers, flavor enhancers, flavoring agents, and acidity agents, in addition to the aforementioned active ingredients.

[0082] In one aspect of the present invention, a method for producing a fermented product containing gamma-aminobutyric acid is provided, comprising the step of culturing the Reviractobacillus brevis DX3004 strain deposited under accession number KCTC 16236BP and contacting it with a liquid glutamic acid source.

[0083] In one embodiment of the method for producing a fermentation product of the present invention, the step of culturing the aforementioned DX3004 strain and contacting it with a liquid glutamic acid source

[0084] (a) A pre-culture step of culturing the Reviractobacillus brevis DX3004 strain in a medium containing a carbon source and a nitrogen source,

[0085] (b) a main culture step in which the entire culture of the pre-culture step or the Reviractobacillus brevis DX3004 strain that has completed the pre-culture step is inoculated into a medium containing a carbon source and a nitrogen source, which is larger in scale than the medium of the pre-culture step, and the Reviractobacillus brevis DX3004 strain is cultured until a density greater than or equal to the cell density at the completion of the pre-culture step is reached; and

[0086] (c) Includes a fermentation step in which a glutamic acid source is added to a cell suspension obtained by centrifuging the culture from the above main culture step and cultured.

[0087] The culture medium used for culturing the strain of Reviractobacillus brevis of the present invention may be any medium used for culturing microorganisms in the field, but is not limited thereto. To cultivate a specific microorganism, the medium may contain nutrients required by the microorganism to be cultured, i.e., the culture medium, and may be a medium in which substances for a special purpose are additionally added and mixed. The culture medium used must satisfy the requirements of the specific strain while controlling the temperature, pH, etc., within a conventional medium containing suitable carbon sources, nitrogen sources, amino acids, vitamins, etc.

[0088] Carbon sources that can be used for culture include sugars and carbohydrates such as glucose, xylose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These substances may be used individually or as a mixture. Nitrogen sources that can be used include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate; amino acids such as glutamic acid, methionine, and glutamine; and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquid, casein hydrolysate, fish or its decomposition products, defatted soybean cake or its decomposition products. These nitrogen sources may be used alone or in combination. The medium may contain potassium monophosphate, potassium diphosphate, and corresponding sodium-containing salts as phosphorus. Potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium-containing salts may be used as phosphorus. Additionally, inorganic compounds such as sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, and calcium carbonate may be used. Finally, essential growth substances such as amino acids and vitamins may be used in addition to the above materials.

[0089] In the method for producing a fermentation product containing gamma-aminobutyric acid according to the present invention, the carbon source content is suitable to be 0.1 to 10% (w / v), the nitrogen source content is suitable to be 0.5 to 10% (w / v), and the mineral content is 0.05 to 1.0% (w / v). More specifically, the carbon source content can be 0.5 to 3% (w / v), the nitrogen source content can be 0.5 to 4% (w / v), and the mineral content can be 0.05 to 0.4% (w / v).

[0090] As a medium that meets these conditions, the manufacturing method of the present invention may use a medium that is conventionally used for culturing Lactobacillus strains classified by the old classification. For example, MRS (deMan Rogosa Sharpe) broth medium, APT (All Purpose with Tween) medium, or BHI (Brain Heart Infusion) medium may be used.

[0091] In the method of the present invention, the temperature of the culture can be in the temperature range of a typical lactic acid bacteria culture, for example, 20 to 35°C, more preferably 23 to 30°C, and most preferably about 30°C.

[0092] In addition, suitable precursors may be used in the culture medium. The aforementioned raw materials may be added to the culture in a batch, fed-batch, or continuous manner in a manner suitable for the culture process, but are not particularly limited thereto. The pH of the culture may be adjusted by using basic compounds such as sodium hydroxide, potassium hydroxide, and ammonia, or acid compounds such as phosphoric acid or sulfuric acid in a suitable manner.

[0093] In one embodiment of the method for producing a fermentation product according to the present invention, the inoculum culture step of step (a) described above may use a different culture medium than the main culture step of (b), or it may be performed using the same culture medium. When the same culture medium is used, the main culture is performed in a culture medium larger in scale than the inoculum culture until a cell density greater than that of the pre-culture is reached.

[0094] In the present invention, glutamic acid source refers to various forms of the amino acid glutamic acid that can be fermented by Levilactobacillus brevis into gamma-aminobutyric acid. That is, glutamic acid source includes both the neutral molecular form and the salt form of glutamic acid. The salt form of glutamic acid source includes monobasic salts and dibasic salts of glutamic acid. To give just a few examples of the constituent cations of the monobasic and dibasic salts of glutamic acid, alkali metals, ammonium, and tetraquaternary ammonium can be cited. For instance, sodium monoglutamate is an example of a glutamic acid source that is a monobasic salt, and the amino acid glutamic acid is an example of a neutral molecular form.

[0095] In the most specific embodiment of the manufacturing method of the present invention, the glutamic acid source is sodium monoglutamate.

[0096] In one embodiment of the method for preparing a fermentation product of the present invention, the fermentation step of adding a glutamic acid source to the cell suspension of step (c) and culturing can be performed under methods and conditions known in the art. In one specific embodiment, DX3004 strain 10 in the cell pellet after the main culture 11 Step (c) is carried out under conditions of fermentation by supplying glutamic acid source at a ratio of 0.5 to 2.0 g per piece.

[0097] The method for preparing a fermentation product according to the present invention may further include a step of powder drying the product after completing the aforementioned fermentation step. Methods well known in the art may be used for powder drying, such as spray drying and freeze drying.

[0098] In one specific embodiment of the method for producing a fermented product of the present invention, the method further includes a step of freeze-drying the product after completing the aforementioned fermentation step.

[0099] In another aspect of the present invention, a fermented composition containing gamma-aminobutyric acid is provided. The fermented composition containing gamma-aminobutyric acid of the present invention is a product obtained by drying and pulverizing a product obtained by fermenting a culture of the strain Reviractobacillus brevis DX3004, deposited under accession number KCTC 16236BP, by contacting it with a liquid glutamic acid source.

[0100] The gamma-aminobutyric acid-containing fermentation composition of the present invention can be obtained by the method for preparing the gamma-aminobutyric acid-containing fermentation product described above.

[0101] The gamma-aminobutyric acid-containing fermentation composition of the present invention is a product obtained by fermenting a culture of the Reviractobacillus brevis DX3004 strain in contact with the product and then drying the product into a powder. The method used for powder drying can be a method well known in the art and is not particularly limited. For example, it may be a spray-dried powder or freeze-dried powder of the fermentation product.

[0102] In one embodiment of the fermentation composition containing gamma-aminobutyric acid according to the present invention, the gamma-aminobutyric acid content is 30% to 70% by weight based on the total weight of the fermentation composition.

[0103] In one specific embodiment of the fermented composition containing gamma-aminobutyric acid of the present invention, the glutamic acid source is sodium monoglutamate.

[0104] In another aspect of the present invention, a pharmaceutical composition for the prevention or treatment of hearing loss is provided, comprising the aforementioned gamma-aminobutyric acid-containing fermented composition as an active ingredient.

[0105] The aforementioned hearing loss may be sudden hearing loss. More specifically, the sudden hearing loss is caused by physical or mental stress.

[0106] In one embodiment of the pharmaceutical composition for the prevention or treatment of hearing loss of the present invention, the hearing loss is stress-induced sudden hearing loss.

[0107] In one specific embodiment of the pharmaceutical composition for the prevention or treatment of hearing loss of the present invention, the pharmaceutical composition improves the cytomechanical signal transmission of auditory receptor cells.

[0108] In another specific embodiment of the pharmaceutical composition for the prevention or treatment of hearing loss of the present invention, the pharmaceutical composition improves the formation of sensory cilia structures of auditory receptor cells.

[0109] In the most specific embodiment of the pharmaceutical composition for the prevention or treatment of hearing loss of the present invention, the cell mechanical signaling of auditory receptor cells and / or the formation of sensory cilia structures of auditory receptor cells is improved.

[0110] The pharmaceutical composition for the prevention or treatment of hearing loss according to the present invention has the effect of promoting the expression of one or more of the genes nanchung, nompB, and rempA, which play a role in the auditory function of an individual.

[0111] The pharmaceutical composition for preventing or treating hearing loss according to the present invention may further include one or more additives selected from the group consisting of preservatives, dyes, emulsifiers, sweeteners, stabilizers, flavor enhancers, flavoring agents, and acidity agents, in addition to the aforementioned active ingredients.

[0112] The pharmaceutical composition of the present invention may further comprise at least one pharmaceutically acceptable excipient and / or lyophilizing agent.

[0113] "Pharmacologically acceptable" means physiologically acceptable and, when administered to humans, does not typically cause severe gastrointestinal disturbances, dizziness, allergic reactions, or similar reactions.

[0114] The pharmaceutical composition for preventing or treating depression according to the present invention and the pharmaceutical composition for preventing or treating hearing loss according to the present invention may further include at least one pharmaceutically acceptable excipient in addition to the aforementioned lactic acid bacteria or fermentation composition. Excipients that may be included in the composition of the present invention include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. The composition of the present invention can be formulated into a formulation for oral administration or a formulation for parenteral administration by conventional methods, and when formulated, it can be prepared using commonly used fillers, extenders, binders, wetting agents, disintegrants, surfactants, cryoprotectants, etc.

[0115] For example, a cryoprotectant selected from the group consisting of sucrose, maltose, maltodextrin, trehalose, mannitol, sorbitol, inulin, glycerol, DMSO, ethylene glycol, propylene glycol, 2-methyl-2,4-pentanediol, polyethylene glycol, polyvinylpyrrolidone, polyvinyl alcohol, polyglycerol, skim milk, milk protein, whey protein, betaine, adonitol, lactose, or any combination thereof may be used. Preferably, the cryoprotectant may include one or more selected from the group consisting of sucrose, skim milk, and sorbitol. More preferably, it may include sucrose, skim milk, and sorbitol, and specifically, may include 2 to 20 weight % of sucrose, 2 to 20 weight % of sorbitol, and 5 to 30 weight % of skim milk based on the total weight of the composition. Lactic acid bacteria freeze-dried by the addition of a cryoprotectant can exhibit significantly increased viability, storage stability, acid resistance, and bile resistance. In addition, the addition of antioxidants such as riboflavin, riboflavin phosphate or a physiologically acceptable salt thereof, glutathione, ascorbate, and cysteine ​​to the freeze-dried composition according to the present invention can further increase the viability of the strain during storage.

[0116] When the pharmaceutical composition for preventing or treating depression and the pharmaceutical composition for preventing or treating hearing loss according to the present invention are formulated into solid dosage forms for oral administration, they include tablets, pills, powders, granules, capsules, etc., and such solid dosage forms may include at least one excipient in addition to the active ingredient, such as starch, calcium carbonate, sucrose, lactose, or gelatin. In addition, they may include, but are not limited to, lubricants such as magnesium stearate and talc, in addition to simple excipients.

[0117] The content of additives and excipients included in the pharmaceutical composition for the prevention or treatment of depression according to the present invention and the pharmaceutical composition for the prevention or treatment of hearing loss according to the present invention is not particularly limited and can be appropriately adjusted within the content range used in conventional formulations.

[0118] The pharmaceutical composition for the prevention or treatment of depression according to the present invention and the pharmaceutical composition for the prevention or treatment of hearing loss according to the present invention may be provided, in particular, as an enteric-coated formulation as an oral unit formulation. The term "enteric coating" in this specification includes any known type of pharmaceutically acceptable coating that is not degraded by gastric acid and thus maintains the coating, but is sufficiently degraded in the small intestine to allow the active ingredient to be released into the small intestine. The "enteric coating" of the present invention refers to a coating that remains intact for at least 2 hours when contacted with an artificial gastric fluid, such as an HCl solution with a pH of 1, at 36°C to 38°C, and preferably degrades within 30 minutes in an artificial intestinal fluid, such as a KH2PO₄ buffer solution with a pH of 6.8.

[0119] When the pharmaceutical composition for the prevention or treatment of depression and the pharmaceutical composition for the prevention or treatment of hearing loss of the present invention are formulated as liquid preparations for oral administration, they include suspensions, liquid preparations, emulsions, and syrups, and may include various excipients, such as humectants, sweeteners, flavorings, preservatives, etc., in addition to commonly used simple diluents such as water and liquid paraffin, but are not limited thereto. When the composition of the present invention is formulated as a preparation for parenteral administration, it may include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, and suppositories. Non-aqueous solvents and suspension solvents may include, but are not limited to, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Witepsol, macrogol, Tween 61, cacao dough, laurin dough, glycerogelatin, etc. may be used as the base material for suppositories. The content of the active ingredient, such as the novel lactic acid bacterium DX3004 strain, of the pharmaceutical composition of the present invention can be adjusted within various ranges depending on the specific form, purpose of use, or aspect of the composition. The content of the active ingredient in the pharmaceutical composition according to the present invention is not significantly limited and, for example, may be 0.01 to 99 weight%, specifically 0.1 to 75 weight%, more specifically 0.5 to 50 weight% based on the total weight of the composition. The cryoprotectant used in the present invention is used to preserve the probiotic formulation during freeze-drying and to improve shelf-life. The cryoprotectant used in the present invention may include common sugars. The sugars may be monosaccharides, disaccharides, oligosaccharides, polysaccharides, or a mixture of at least two sugars.

[0120] The pharmaceutical composition for preventing or treating depression according to the present invention and the pharmaceutical composition for preventing or treating hearing loss according to the present invention may be administered to humans, mammals, and livestock, specifically monkeys, mice, rats, rabbits, sheep, cattle, dogs, horses, pigs, etc., through various routes. Specifically, the pharmaceutical composition of the present invention may be administered orally or parenterally (e.g., topically or intravenously, subcutaneously, or intraperitoneally), but oral administration is preferred. Solid dosage forms for oral administration may include powders, granules, tablets, capsules, soft capsules, pills, etc.

[0121] The dosage of the pharmaceutical composition for the prevention or treatment of depression according to the present invention and the pharmaceutical composition for the prevention or treatment of hearing loss according to the present invention must be a pharmaceutically effective amount. A "pharmaceutically effective amount" means an amount sufficient to prevent or treat neurological diseases with a reasonable benefit / risk ratio applicable to medical treatment. The effective dose level may be selected by those skilled in the art according to various factors such as the method of formulation, the patient's condition and body weight, the patient's gender, age, severity of the disease, drug form, route and duration of administration, excretion rate, response responsiveness, etc. As is recognized by those skilled in the art, the effective amount may vary depending on the route of treatment, the use of excipients, and the possibility of co-administration with other agents. However, for a desirable effect, in the case of oral formulations, the composition of the present invention may generally be administered to adults at a dose of 0.001 to 1000 mg / kg per day, preferably 0.01 to 100 mg / kg per day of body weight.

[0122] When the formulation is administered as described above, the Reviractobacillus brevis DX3004 strain of the present invention is 1 × 10 per day. 3 Colony-forming units (CFU) / g to 1×10⁻⁶ 16 It can be administered at CFU / g. For example, 10 strains of the present invention 3 to 1016 CFU / g, 10 3 to 10 15 CFU / g, 10 3 to 10 14 CFU / g, 10 3 to 10 13 CFU / g, 10 3 to 10 12 CFU / g, 10 4 to 10 16 CFU / g, 10 4 to 10 15 CFU / g, 10 4 to 10 14 CFU / g, 10 4 to 10 13 CFU / g, 10 4 to 10 12 CFU / g, 10 5 to 10 16 CFU / g, 10 5 to 10 15 CFU / g, 10 5 to 10 14 CFU / g, 10 5 to 10 13 CFU / g, 10 5 to 10 12 CFU / g, 10 6 to 10 13 CFU / g, 10 6 to 10 12 CFU / g, 10 7 to 10 13 CFU / g, 10 7 to 10 12 CFU / g, 10 8 to 10 13 CFU / g or 10 8 to 10 12 It may be administered at a dosage of CFU / g. The daily dosage may be administered at once or divided into several doses. The above dosage does not limit the scope of the present invention in any way.

[0123] In another aspect of the present invention, a food composition is provided comprising the Reviractobacillus brevis DX3004 strain (deposit number: KCTC 16236BP), a lysate of the strain, a dead cell of the strain, a culture of the strain, a concentrate of the culture of the strain, an extract of the culture of the strain, a dried culture of the strain, or a supernatant of a cell-free culture of the strain.

[0124] In another aspect of the present invention, a food composition comprising a fermented composition containing the aforementioned gamma-aminobutyric acid is provided.

[0125] The above-mentioned Reviractobacillus brevis DX3004 strain is the same as described above. The above-mentioned food composition includes all forms such as functional food, nutritional supplement, health food, and food additives, and such food compositions can be prepared in various forms according to conventional methods known in the art. Furthermore, in the present invention, the term "food composition" is used to encompass not only the food itself, which is cited as an example of the above-mentioned food composition, but also "food additives" or "food additive compositions" added to such food. When the above-mentioned strain is used as a food additive, the strain may be added as is or used together with other food or food ingredients, and may be used appropriately according to conventional methods. The amount of the active ingredient can be appropriately determined according to the purpose of use (prevention, health, or therapeutic treatment). Generally, when manufacturing food or beverages, it may be added in an amount of 0.0001% to 1% by weight, specifically 0.001% to 0.1% by weight, to the raw material composition containing the above-mentioned strain. However, in the case of long-term consumption for the purpose of health and hygiene or health control, the above amount may be used in an amount less than the above range. The food composition of the present invention may be used for the prevention or inhibition of metabolic diseases.

[0126] In yet another aspect of the present invention, a health functional food is provided comprising, as an active ingredient, one or more selected from the Reviractobacillus brevis DX3004 strain (deposit number: KCTC 16236BP), a lysate of said strain, an extract of said strain, a dead cell of said strain, a culture of said strain, an extract of said culture, and a supernatant of said culture of said strain. The health functional food may be a health functional food for the prevention or improvement of obesity.

[0127] In another aspect of the present invention, a health functional food is provided that comprises a fermented composition containing the aforementioned gamma-aminobutyric acid as an active ingredient.

[0128] In this specification, "health functional food" refers to a food manufactured or processed by methods such as extraction, concentration, purification, or mixing, using a specific ingredient as a raw material or a specific ingredient contained in a food raw material for the purpose of health supplementation, and is a food designed and processed to fully exert biological regulatory functions on the body, such as biological defense, regulation of biological rhythms, prevention and recovery of disease, through said ingredient, and is capable of performing functions related to the prevention of disease or recovery of health.

[0129] When the Reviractobacillus brevis DX3004 strain according to the present invention is used as a health functional food, or when the fermented composition containing gamma-aminobutyric acid according to the present invention is used as a health functional food, DX3004 may be used as is, or the fermented composition may be added as is, or used together with other foods or food ingredients, and these may be selected and used appropriately as needed. In addition, the amount of the added DX3004 strain or the mixed amount of the fermented composition containing gamma-aminobutyric acid may be appropriately determined according to the purpose of use. The formulation of a health functional food containing the Reviractobacillus brevis DX3004 strain according to the present invention or a health functional food containing the fermented composition containing gamma-aminobutyric acid according to the present invention is not particularly limited, and any form such as powder, granule, pill, tablet, or capsule, as well as general food or beverage, is possible. There are no specific restrictions on the types of such foods, and examples of foods to which the above substance may be added include meat, sausage, bread, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and encompass foods in the conventional sense.

[0130] Another aspect of the present invention provides a feed composition comprising the Reviractobacillus brevis DX3004 strain (Deposit No.: KCTC 16236BP), a lysate of the strain, a dead cell of the strain, a culture of the strain, a concentrate of the culture of the strain, an extract of the culture of the strain, a dried culture of the strain, or a supernatant of a cell-free culture of the strain. The Reviractobacillus brevis DX3004 strain (Deposit No.: KCTC 16236BP) is the same as described above.

[0131] Another aspect of the present invention provides a feed composition comprising a fermented composition containing the aforementioned gamma-aminobutyric acid.

[0132] In the present invention, the term "feed composition" encompasses not only the feed itself but also feed additives (feed additive compositions). Such a feed composition can be prepared by adding the DX3004 strain or a fermented composition containing the aforementioned gamma-aminobutyric acid within an appropriate effective concentration range according to various feed manufacturing methods known in the art. The feed composition of the present invention may be used to reduce stress in livestock or to prevent or suppress depression.

[0133] In another aspect of the present invention, a method for preventing and treating depression is provided, comprising the step of administering to an individual one or more selected from the Reviractobacillus brevis DX3004 strain (Deposit No.: KCTC 16236BP), a lysate of said strain, a dead cell of said strain, a culture of said strain, a concentrate of said culture, an extract of said culture, a dried culture of said strain, and a cell-free culture supernatant of said strain. The individual may be an individual having depression. In addition, said individual may be a mammal, and preferably a human. In this case, the Reviractobacillus brevis DX3004 strain (Deposit No.: KCTC 16236BP) is the same as described above. Furthermore, the administration route, dosage, and frequency of administration of said strain or its culture may be administered to the subject in various ways and amounts depending on the patient's condition and the presence or absence of side effects, and the optimal administration method, dosage, and frequency of administration may be selected within an appropriate range by a person skilled in the art. In addition, the types of depressive disorders are as described above.

[0134] In another aspect of the present invention, a method for preventing and treating hearing loss is provided, comprising the step of administering the aforementioned pharmaceutical composition for preventing or treating hearing loss to an individual requiring treatment or prevention. The individual may be an individual having hearing loss. Additionally, the individual may be a mammal, and preferably a human. In this case, the strain Reviractobacillus brevis DX3004 (Deposit No.: KCTC 16236BP) is the same as described above. Furthermore, the administration route, dosage, and frequency of administration of the strain or its culture may be administered to the subject in various ways and amounts depending on the patient's condition and the presence or absence of side effects, and the optimal administration method, dosage, and frequency may be selected within an appropriate range by a person skilled in the art. Additionally, the types of hearing loss diseases are as described above.

[0135] In another aspect of the present invention, one or more components selected from the Reviractobacillus brevis DX3004 strain (deposit number: KCTC 16236BP), the lysate of the strain, the dead cells of the strain, the culture of the strain, the concentrate of the culture of the strain, the extract of the culture of the strain, the dried culture of the strain, and the supernatant of a cell-free culture of the strain are provided for the treatment of depression. In this case, the Reviractobacillus brevis DX3004 strain is the same as described above. Furthermore, the type of depression is as described above.

[0136] In one specific embodiment of the method for preventing or treating hearing loss according to the present invention, the cellular mechanical signal transmission of auditory receptor cells is improved.

[0137] In another specific embodiment of the method for preventing or treating hearing loss according to the present invention, the formation of sensory cilia structures of auditory receptor cells is improved.

[0138] In the most specific embodiment of the method for preventing or treating hearing loss of the present invention, the cell mechanical signal transmission of auditory receptor cells and / or the formation of sensory cilia structures of auditory receptor cells are improved.

[0139] In another aspect of the present invention, the use of the aforementioned pharmaceutical composition for the prevention or treatment of hearing loss is provided for the treatment of hearing loss. In this case, the Reviractobacillus brevis DX3004 strain is the same as described above. In addition, the type of hearing loss is as described above.

[0140] [Example]

[0141] The present invention will be explained in more detail below through the following examples and experimental examples. However, these examples and experimental examples are intended only to aid in understanding the present invention and do not limit the scope of the present invention in any way. Various changes and modifications may be made to these examples, and such changes and modifications are also included within the scope of the appended claims.

[0142] [Example 1]

[0143] Preparation Example: Isolation of lactic acid bacteria strains from a bacterial source

[0144] Candidate lactic acid bacteria strains were selected from human fecal samples and fermented foods. Lactic acid bacteria strains were isolated from the feces of healthy Korean infants under 3 months of age obtained from Soonchunhyang University Bucheon Hospital.

[0145] Specifically, 0.1 g of a fecal sample was diluted in sterile saline, and 0.1 mL of the diluted solution was plated onto MRS (deMan, Rogosa, Sharpe) agar medium and incubated at 37°C for 48 hours. Once colonies formed on the medium, single colonies were subcultured at least twice on MRS agar medium, and mycological staining and morphological observations were performed. As a result, a total of 42 lactic acid bacteria strains were isolated as pure strains, suspended in MRS liquid medium containing 20% ​​(v / v) glycerol, and stored at -70°C for use in the following experiments.

[0146] [Example 2]

[0147] Identification of lactic acid bacteria strains

[0148] The identification of the strains was performed based on 16S rRNA gene sequence similarity. To identify the 42 lactic acid bacteria strains of Example 2 described above, whole genomic DNA was extracted for each of the 42 strains, and PCR equipment using 785F (GGATTAGATACCCTGGTA) and 907R (CCGTCAATTCMTTTRAGTTT) primers was used to sequence variant nucleotides on the 16S ribosomal RNA gene. The results were entered into BLAST (Basic Local Alignment Search Tool, https: / blast.ncbi.nlm.nih.gov) software to identify the species names of all 42 strains.

[0149] As a result of analyzing the species of the bacterial strains using the bacterial genetic information obtained in this way, the aforementioned 42 types of lactic acid bacteria were identified as belonging to the genera Reviractobacillus, Lactobacillus, Limosilactobacillus, and Bifidobacterium. The results are summarized in Table 1 below.

[0150] Species Name of Lactobacillus Strain Number of Isolated Lactobacillus Strains Lactobacillus gasseri 6 Lacticase Lactobacillus rhamnosus 6 Limosilactobacillus reuteri 4 Limosilactobacillus fermentum 4 Lactobacillus jonhsonii 3 Levilactobacillus brevis 1 Bifidobacterium longum 8 Bifidobacterium breve 6 Bifidobacterium bifidum 1 Bifidobacterium infantis 1 Bifidobacterium animalis 1 Bifidobacterium pseudocatenulatum 1 Total 42

[0151] [Example 3]

[0152] Gamma-aminobutyric acid (GABA) production ability of Rihan lactic acid bacteria strain

[0153] Among 42 lactic acid bacteria strains, those with high GABA production efficacy were screened. Each of the 42 strains was inoculated at 1% into MRS liquid medium containing 2% monosodium glutamate (MSG) and incubated at 37°C for 24 hours until the absorbance (600 nm) reached 1.0. Upon completion of incubation, the supernatant obtained by centrifuging the culture medium was analyzed for GABA production using thin-layer chromatography. For the qualitative analysis of GABA, silica gel-coated TLC plates (Merck, Germany) were used, and TLC development was performed in a square development vessel (12 cm × 5.5 cm × 12 cm). The developing solvent was a mixture of normal butanol, acetic acid, and water in a ratio of 3:1:1 (v / v / v), added to the vessel, and saturated at room temperature for at least one day. A GABA standard sample was prepared by dissolving it in water at a concentration of 0.5% (w / v) and 2 μL was spotted onto a TLC plate. Additionally, 2 μL of the supernatant from the culture of 42 types of lactic acid bacteria was spotted after centrifugation. The sample was applied at a position 1 cm from the bottom of the plate and in the form of a spot. After spotting, the TLC plate was dried and then developed, and the developed TLC plate was hot-air dried. The dried TLC plate was treated with a 0.1% (w / v) ninhydrin solution, a colorimetric reagent, and after hot-air drying for 5–10 minutes, the color was developed in a 120°C oven, after which the GABA spots in the culture supernatant were observed. The results are shown in Figure 1.

[0154] Figure 1 is a photograph showing that GABA was produced in the MSG-MRS culture (lane 4) containing the Levilactobacillus brevis DX3004 strain. On the other hand, the remaining 41 lactic acid bacteria strains, excluding line 4, did not produce GABA.

[0155] [Example 4]

[0156] Excellent GABA production ability of the DX3004 strain

[0157] Experiments were conducted to determine that the GABA production ability of the Reviractobacillus brevis DX3004 strain is significantly superior to that of the Reviractobacillus brevis ATCC 8287 strain, which is already known to produce GABA. After incubating each of the ATCC 8287 and DX3004 strains in MRS liquid medium containing 2% monosodium glutamate (MSG) at 37°C for 24 hours, the production of GABA in each culture was confirmed using thin-layer chromatography. The results are shown in Figure 2.

[0158] Figure 2 is a photograph of the thin-layer chromatography results showing that the strain has superior GABA production ability compared to the standard strain ATCC 8287. As shown in Figure 2, a larger amount of GABA can be observed in the DX3004 culture supernatant in line 2 than in the ATCC 8287 culture supernatant in line 1. At this time, the GABA concentrations of the ATCC 8287 culture supernatant and the DX3004 culture supernatant were measured to be 14.33 mg / mL and 20.17 mg / mL, respectively. From the following examples, a DX3004 strain culture containing both the DX3004 strain and GABA derived from the DX3004 strain was used in the experiment.

[0159] [Example 5]

[0160] Growth efficacy of DX3004 strain culture on Haemophilus parainfluenzae strains

[0161] An experiment was conducted to investigate the effects of the DX3004 strain culture on the growth of Haemophilus parainfluenzae and Clostridium difficile strains. The DX3004 strain culture was obtained by incubating Reviractobacillus brevis DX3004 in 1 L of MRS medium supplemented with 2% (w / v) MSG at 37°C for 24 hours, followed by freeze-drying the entire culture to obtain 60 g of the final DX3004 strain culture, of which GABA alone accounted for approximately 20 g. Haemophilus parainfluenzae is a commensal bacterium that inhabits the oral cavity and intestines of patients with depression in smaller quantities compared to healthy individuals, and Clostridium difficile is a pathogenic bacterium well known for its resistance. A nutrient-normal medium mixed with 10% sugar and 1% yeast extract, a nutrient-depleting medium mixed with 10% sugar and 0.1% yeast extract, and an experimental medium prepared by adding DX3004 strain culture (treated at 100°C for 30 minutes) and GABA alone to the nutrient-depleting medium were prepared. At this time, DX3004 strain culture (treated at 100°C for 30 minutes) was added at a ratio of 0.3%, and GABA alone was added at a ratio of 0.1%. After inoculating the four different experimental media with varying numbers of Haemophilus parainfluenzae strains and Clostridium difficile strains, the results of incubation at 37°C for 48 hours are shown in Figures 3 and 4, respectively.

[0162] Figure 3 is a photograph showing that the DX3004 strain culture has the efficacy of promoting the growth of Haemophilus parainfluenzae strains. As shown in Figure 3, compared to a nutrient-normal medium (A), Haemophilus parainfluenzae strains of 10,000 CFU or less were not cultured at all in a nutrient-depleted medium (B), but in a medium (C) to which the DX3004 strain culture was added to the nutrient-depleted medium, it was confirmed that Haemophilus parainfluenzae strains of 10,000 CFU or less grew well again. On the other hand, in the case of a medium (D) to which GABA alone was added to the nutrient-depleted medium, it was confirmed that Haemophilus parainfluenzae strains of 10,000 CFU or less were still not cultured properly. These results suggest that the DX3004 strain culture can contribute to the improvement of depression by restoring the oral and gut microbiome environments of patients with depression to a level close to that of normal individuals.

[0163] Figure 4 is a photograph showing that the DX3004 strain culture does not promote the growth of the harmful bacterium Clostridium difficile. As shown in Figure 4, compared to the nutrient-normal medium (A), no Clostridium difficile strains of less than 10,000 CFU were cultured in the nutrient-depleted medium (B), and it was confirmed that Clostridium difficile strains of less than 10,000 CFU did not grow again in the nutrient-depleted medium with the addition of the DX3004 strain culture (C) and the medium with the addition of GABA alone (D). These results demonstrate that the microbiome growth regulating ability of the DX3004 strain culture is highly selective.

[0164] [Example 6]

[0165] Efficacy of DX3004 strain culture in improving drug (Chlorpromazine)-induced depression

[0166] An experiment was conducted to investigate the efficacy of the DX3004 strain culture in improving drug-induced depression. Chlorpromazine (CPZ) is a drug prescribed to calm hyper-excitability by inhibiting dopamine receptors; however, excessive inhibition of dopamine receptors can actually induce depression. It is known that treating fruit fly models with CPZ at a concentration of 0.1% (w / v) induces depression, and the induction of depression can be confirmed by monitoring the degree of the fruit flies' negative locomotion (tendency to move away from the ground). Fifteen male fruit flies were placed in each vial, and when the vial was gently tapped twice on a table, the fruit flies gathered at the bottom and then crawled upwards. During this process, the number of fruit flies that crawled up to a point 6 cm from the bottom over a period of 10 seconds was measured. Two to three vials, or 30 to 45 fruit flies, were used for each group, and the experiment was repeated three times. We checked whether the negative locomotority of fruit flies reduced by CPZ treatment increased again by the addition of DX3004 strain culture, and the results are shown in Figures 5 and 6.

[0167] Figure 5 shows photographs of the negative locomotority of normal fruit flies (A), fruit flies treated with 0.1% CPZ (B), fruit flies treated with 0.1% CPZ and DX3004 strain culture (C), and fruit flies treated with 0.1% CPZ and GABA alone (D). As shown in Figure 5, it was confirmed that the negative locomotority, which was reduced in fruit flies treated with 0.1% CPZ (B) compared to normal fruit flies (A), was restored by the addition of DX3004 strain culture (C). On the other hand, negative locomotority was not restored by the addition of GABA alone (D).

[0168] Figure 6 is a graph quantifying Figure 5. It quantifies the rate at which fruit flies crawl from the bottom to a point 6 cm above in 10 seconds. As shown in Figure 6, it was confirmed that fruit flies crawled from the bottom to a point 6 cm above in 10 seconds at rates of 74.4%, 0%, 66.7%, and 23.7% for the normal group (A), the 0.1% CPZ treatment group (B), the group supplemented with DX3004 strain culture along with 0.1% CPZ treatment (C), and the group supplemented with GABA alone along with 0.1% CPZ treatment (D), respectively. These results suggest that the DX3004 strain culture is more effective than GABA alone in improving depression caused by CPZ treatment.

[0169] Next, experiments were conducted to determine the dopamine receptor mRNA expression levels in the normal group, the 0.1% CPZ-treated group, and the groups supplemented with 0.1% CPZ along with DX3004 strain culture or GABA alone. Drosophila heads were harvested to extract mRNA, and complementary DNA (cDNA) was synthesized via reverse transcription polymerase chain reaction (RT-PCR). Real-time PCR was performed on the cDNA using primers [Table 2] that bind complementarily to the dopamine receptor and serotonin receptor cDNA, as well as the SYBR Green Universal Master Mix reagent. mRNA expression levels for the 5S ribosomal RNA gene were used as an internal standard. The results are shown in Figures 7 and 8, respectively.

[0170] Forward Reverse Dopamine Receptor TCGTCTCCTTTGTGCCCATCGATGCCAATCATGACCACGC Serotonin Receptor CACAACCGCAACATCAGCAATCGACGTAATTGTGGTGGCA5S Ribosomal RNA ACGACCATACCACGCTGAATAGCGGTCCCCCATCTAAGTA

[0171] Figure 7 shows the dopamine receptor mRNA expression levels of normal fruit flies (A), fruit flies treated with 0.1% CPZ (B), fruit flies treated with 0.1% CPZ and DX3004 strain culture (C), and fruit flies treated with 0.1% CPZ and GABA alone (D). As shown in Figure 7, it was confirmed that the dopamine receptor mRNA expression level, which was reduced by 36% in fruit flies treated with 0.1% CPZ (B) compared to normal fruit flies (A), increased again by 32% upon the addition of DX3004 strain culture (C). On the other hand, it increased by 9% with the addition of GABA alone (D), and these results suggest that the DX3004 strain culture is superior to GABA alone in terms of the efficacy of restoring dopamine receptor mRNA expression. Figure 8 is a photograph showing the serotonin receptor mRNA expression levels of normal fruit flies (A), fruit flies treated with 0.1% CPZ (B), fruit flies treated with 0.1% CPZ and DX3004 strain culture (C), and fruit flies treated with 0.1% CPZ and GABA alone (D). As shown in Figure 8, it was confirmed that the serotonin receptor mRNA expression level, which was reduced by 27% in fruit flies treated with 0.1% CPZ (B) compared to normal fruit flies (A), increased again by 19% with the addition of the DX3004 strain culture (C). On the other hand, the addition of GABA alone (D) increased it by 4%, and these results suggest that the DX3004 strain culture is superior to GABA alone in terms of the efficacy of restoring serotonin receptor mRNA expression.

[0172] [Example 7]

[0173] Efficacy of DX3004 strain culture in improving chronic stress-induced depression

[0174] An experiment was conducted to investigate whether the DX3004 strain culture has the efficacy to improve depression induced by chronic stress. As a method to apply chronic stress to fruit fly animal models, cold (4°C, 30 minutes), fasting (24h), and nighttime lighting (12 hours) were repeated for two weeks, and whether depression was induced was confirmed by monitoring the degree of negative grounding (tendency to move away from the ground) of the fruit flies. It was determined whether the negative grounding of fruit flies, which had decreased due to this chronic unpredictable mild stress (CUMS), increased again upon the addition of the DX3004 strain culture, and the results are shown in Figures 9 and 10.

[0175] Figure 9 shows photographs of the negative locomotority of normal fruit flies (A), CUMS-treated fruit flies (B), CUMS-treated fruit flies with added DX3004 strain culture (C), and CUMS-treated fruit flies with added GABA alone (D). As shown in Figure 9, it was confirmed that the negative locomotority, which was reduced in chronically stressed fruit flies (B) compared to normal fruit flies (A), increased again with the addition of the DX3004 strain culture (C). On the other hand, negative locomotority was not restored with the addition of GABA alone (D).

[0176] Figure 10 is a graph quantifying Figure 9. It quantifies the rate at which fruit flies crawl from the bottom to a point 6 cm above in 10 seconds. As shown in Figure 10, it was confirmed that fruit flies crawled from the bottom to a point 6 cm above in 10 seconds at rates of 83%, 20%, 53%, and 21% for normal fruit flies (A), fruit flies treated with chronic unpredictable mild stress (CUMS) (B), fruit flies with DX3004 strain culture added along with chronic unpredictable mild stress (CUMS) (C), and fruit flies with GABA alone added along with chronic unpredictable mild stress (CUMS) (D), respectively. These results suggest that the DX3004 strain culture is more effective than GABA alone in improving depression caused by chronic unpredictable mild stress (CUMS).

[0177] Next, experiments were conducted to determine the levels of dopamine and serotonin hormones present in the heads of Drosophila in the normal group, the chronic unpredictable mild stress (CUMS) treatment group, the group supplemented with DX3004 strain culture along with chronic unpredictable mild stress (CUMS), and the group supplemented with GABA alone along with chronic unpredictable mild stress (CUMS). To obtain analytical samples, head samples isolated from the bodies of Drosophila were homogenized in 200 μL of phosphate-buffered saline (pH 7.4), centrifuged at 12,000 g at 4°C for 10 minutes, and the supernatant was collected. Dopamine and serotonin hormone levels were measured using a Waters Alliance e2695 HPLC instrument equipped with a Waters 2475 multiplex fluorescence detector and a YMC-Pack Pro C18 column (250 x 4.6 mm, 5 μm, YMC). The mobile phase was acetate buffer (pH 4.0, 12 mM acetic acid, 0.26 mM Na2EDTA)-methanol (86:14, v / v), the flow rate was set to 1.0 mL / min, and the analysis was performed at 35°C for 20 minutes. The excitation wavelength of the fluorescence detector was set to 270 nm, and the emission wavelength to 320 nm. Qualitative analysis was performed by comparing the retention times between the standard solution peaks and the sample peaks for dopamine and serotonin. For quantitative analysis, calibration curves were plotted against the concentration-area ratio of the chromatogram at concentrations of 1, 2, 5, 10, 20, 50, 100, 200, 500, and 1000 ng / mL to determine the content of dopamine and serotonin in the samples. The results are shown in Figures 11 and 12, respectively.

[0178] Figure 11 shows the dopamine hormone content measured in the heads of normal fruit flies (A), fruit flies treated with chronic unpredictable mild stress (CUMS) (B), fruit flies with DX3004 strain culture added along with chronic unpredictable mild stress (CUMS) (C), and fruit flies with GABA alone added along with chronic unpredictable mild stress (CUMS) (D). As shown in Figure 11, it was confirmed that the amount of dopamine hormone, which had decreased by 35% in fruit flies treated with chronic unpredictable mild stress (CUMS) (B) compared to normal fruit flies (A), increased again by 41% with the addition of DX3004 strain culture (C). On the other hand, it increased by 9% with the addition of GABA alone (D), and these results suggest that the DX3004 strain culture is more effective in restoring dopamine hormone levels compared to GABA alone.

[0179] Figure 12 shows the serotonin hormone content measured in the heads of normal fruit flies (A), fruit flies treated with chronic unpredictable mild stress (CUMS) (B), fruit flies with DX3004 strain culture added along with chronic unpredictable mild stress (CUMS) (C), and fruit flies with GABA alone added along with chronic unpredictable mild stress (CUMS) (D). As shown in Figure 12, it was confirmed that the amount of serotonin hormone, which had decreased by 38% in fruit flies treated with chronic unpredictable mild stress (CUMS) (B) compared to normal fruit flies (A), increased again by 51% with the addition of DX3004 strain culture (C). On the other hand, it increased by 12% with the addition of GABA alone (D), and these results suggest that the DX3004 strain culture is more effective in restoring serotonin hormone levels compared to GABA alone.

[0180] [Example 8]

[0181] Production of gamma-aminobutyric acid-containing oil-producing products

[0182] A GABA fermentation method according to the prior art and a method for producing a GABA-containing fermented product according to the present invention were each applied to the Reviractobacillus brevis DX3004 strain to produce fermented products, and the products were compared.

[0183] For the main culture and inoculum culture, a liquid medium composed of enzyme extract (4%), sucrose (3.5%), minerals (sulfur, manganese, magnesium) (0.065%), and polysorbate 80 (0.2%) was used. In the method for producing a GABA-containing fermentation product according to the present invention, 10 of the cell pellet after completing the main culture 11Sodium monoglutamate was added at a ratio of 1.0 g per cell. In the case of the GABA fermentation method according to the prior art, the main culture medium prepared by adding 20 g / L of sodium monoglutamate to the aforementioned liquid medium after inoculum culture was used as the main culture medium, and the main culture and fermentation stages were carried out simultaneously. In both cases, freeze-drying was performed after fermentation was completed to obtain a powdered product.

[0184] The content of gamma-aminobutyric acid in the product was quantified using high-performance liquid chromatography (HPLC), and the results are shown in Fig. 13.

[0185] In FIG. 13, DX3004-HMF indicates the method for producing a GABA-containing fermented product according to the present invention, and DX3004-MF indicates the result according to the conventional GABA fermentation method. The GABA content of the fermented product was 596 mg / g as shown in FIG. 13 when produced according to the method for producing a GABA-containing fermented product according to the present invention, and 204 mg / g from the same amount of sodium monoglutamate when produced according to the conventional GABA fermentation method. It was confirmed that the method for producing a GABA-containing fermented product according to the present invention can increase the production efficiency of gamma-aminobutyric acid by about three times compared to the conventional GABA fermentation method.

[0186] [Example 9]

[0187] Efficacy of GABA-containing fermented composition in preventing and improving stress-induced sudden hearing loss

[0188] Because the antennae, the auditory organs of fruit flies, and the ears, the auditory organs of humans, are functionally very similar, fruit flies are utilized as an important model for research on human hearing. In particular, the "artificial courtship song-induced male-male chain formation model" is highly useful to hearing researchers worldwide. When a fruit fly courtship song is artificially played in an environment containing only male flies, the male flies form a chain of tails; this is known as male-male chain formation. Since this chain-forming behavior by male flies can occur relying solely on auditory signals, it can serve as a means to verify the auditory function of fruit flies.

[0189] The inventors used a "courtship song-induced male-male chain formation model" to confirm the anti-sudden hearing loss efficacy of the novel lactic acid bacteria DX3004-HMF fermentation composition. First, artificial courtship songs were produced by collecting sounds generated from the wings of fruit flies. Then, it was confirmed that male-male chain formation by artificial courtship songs was successfully induced in a population of wingless male fruit flies. The results are shown in Figure 2.

[0190] Figure 14 is a photograph showing the behavioral characteristics exhibited by male fruit flies in response to an artificial mating song. As shown in Figure 14, male fruit flies formed a male-male chain in response to the artificial mating song. This suggests that the auditory function of the fruit flies is normal.

[0191] Next, sudden hearing loss was induced in fruit flies by applying repeated cold shock stress. It was confirmed that the induction of artificial mating song-induced male-male chain formation was inhibited by exposing wingless male fruit flies to a 4°C environment for 30 minutes daily for 3 days. The results are shown in Figure 15.

[0192] Figure 15 is a photograph showing male fruit flies subjected to repeated cold stress failing to respond normally to artificial mating songs. As shown in Figure 15, it was confirmed that the formation of male-male chains by artificial mating songs was inhibited by repeated cold stress. This suggests that repeated cold stress induced sudden hearing loss.

[0193] Next, it was confirmed that the novel lactic acid bacteria DX3004-HMF fermented substance has preventive and corrective efficacy against stress-induced sudden hearing loss. Wingless fruit flies were exposed to a 4°C environment for 30 minutes daily for 3 days, during which time they were simultaneously fed a freeze-dried fermented composition of the fermentation product of Example 1 described above. After 3 days, when an artificial mating song was played, it was observed that the male fruit flies were still forming male-male chains. The results are shown in Fig. 16.

[0194] Figure 16 is a photograph showing male fruit flies that consumed the aforementioned fermented composition (indicated as DX3004-HMF in Figure 16) along with repeated cold stress responding normally to an artificial mating song. As shown in Figure 16, it was confirmed that fruit flies that consumed the aforementioned fermented composition still formed a male-male chain through the artificial mating song despite being exposed to repeated cold stress. This suggests that the gamma-aminobutyric acid-containing fermented composition of the present invention has efficacy in preventing and improving stress-induced sudden hearing loss.

[0195] [Example 10]

[0196] Confirmation of the molecular genetic mechanism for the efficacy of GABA-containing fermented compositions in preventing and improving stress-induced sudden hearing loss

[0197] The ability of auditory receptor cells to convert mechanical vibrations caused by external sounds into electrical signals is called mechanotransduction. By stimulating the brain with these converted electrical signals, sound can be perceived. In 2003, a research team led by Dr. Chang-Su Kim in Korea discovered a mechanotransduction gene using a fruit fly model and named the gene "nanchung" (hearing loss). In this embodiment, we confirmed how the fermented composition containing gamma-aminobutyric acid of the present invention affects the expression of the nanchung gene under conditions of cold stress-induced sudden hearing loss.

[0198] To this end, the head containing the fruit fly antennae was isolated, messenger RNA (mRNA) was extracted from the isolated head, and complementary DNA (cDNA) was synthesized based on it. cDNA and a polymerase chain reaction mixture (AccuPower® GreenStar TM After injecting a mixed solution composed of qPCR PreMix and nanchung gene primers (GAGGCCGAGTATATCTCCAATCC, AGCAGGCACAAATGGAGAATAGTT) into a real-time polymerase chain reaction machine (real-time PCR machine ABI7500), the results of the polymerase chain reaction are shown in Fig. 17.

[0199] Figure 17 is a bar graph showing the results of analyzing the amount of gene nanchung mRNA in fruit flies of normal group A, group B (cold stress-induced sudden hearing loss group in Figure 17) in which sudden hearing loss was induced by cold stress, and group C (cold stress-induced sudden hearing loss + DX3004-HMF in Figure 17) in which cold stress was applied while consuming the fermented composition containing gamma-aminobutyric acid of the present invention. As shown in Figure 17, the expression level of the nanchung gene mRNA decreased by 77% in (B) compared to (A). However, the expression level of the nanchung gene mRNA increased again by 357% in (C) compared to (B). This suggests that the fermented composition containing gamma-aminobutyric acid of the present invention exhibits anti-sudden hearing loss prevention and improvement efficacy by enhancing the mechanotransduction ability of auditory receptor cells.

[0200] Next, the expression of the nompB gene was investigated. In Drosophila, auditory receptor cells are able to perform normal auditory functions by forming bundles of sensory cilia in a regular pattern among themselves. In 2003, a research team led by Dr. Maurice J. Kernan in the United States discovered a gene involved in the formation of sensory cilia bundles in auditory receptor cells using a Drosophila model and named the gene nompB. In this invention, we verified whether the expression level of the nompB gene decreases due to cold shock stress-induced sudden hearing loss, and whether the decreased nompB gene expression level increases again by the fermented composition containing gamma-aminobutyric acid of this invention. To this end, the head where the Drosophila antenna is located was isolated, messenger RNA (mRNA) was extracted from the isolated head, and complementary DNA (cDNA) was synthesized based on this. cDNA and a polymerase chain reaction mixture (AccuPower® GreenStar TMAfter injecting a reaction mixture composed of qPCR PreMix and nompB gene primers (ATGATGGGTATAATTGGTGCATTG, TTTGTCGGAGATATACTAAGGCTT) into a real-time polymerase chain reaction machine (real-time PCR machine ABI7500), the results of the polymerase chain reaction are shown in Fig. 18.

[0201] Figure 18 is a photograph showing the results of analyzing the mRNA levels of the gene nompB in fruit flies of normal group A, group B (cold stress-induced sudden hearing loss group in Figure 18) in which sudden hearing loss was induced by cold stress, and group C (cold stress-induced sudden hearing loss + DX3004-HMF in Figure 18) in which the fermented composition containing gamma-aminobutyric acid of the present invention was consumed while inducing cold stress. As shown in Figure 18, the mRNA expression of the nompB gene decreased by 79% in (B) compared to (A). However, the mRNA expression of the nompB gene increased again by 358% in (C) compared to (B). This suggests that the fermented composition containing gamma-aminobutyric acid of the invention exhibits anti-sudden hearing loss prevention and improvement efficacy by enhancing the bundle formation ability of auditory receptor cells.

[0202] Next, the normal formation of the internal structure of auditory receptor cells is also essential for the performance of normal auditory function. In 2008, a research team led by Dr. Morris J. Kernan in the United States discovered a gene involved in the normal internal structure formation of auditory receptor cells using a fruit fly model and named the gene rempA. In this invention, we verified whether the expression level of the rempA gene decreases due to cold stress-induced sudden hearing loss and whether the decreased rempA gene expression level increases again by the fermented composition containing gamma-aminobutyric acid of this invention. To this end, the head where the fruit fly antennae are located was isolated, mRNA was extracted from the isolated head, and cDNA was synthesized based on it. cDNA and a polymerase chain reaction mixture (AccuPower® GreenStar TM After injecting a reaction mixture composed of qPCR PreMix and rempA gene primers (TGGTTCTCGCAGGTAAAGATACTCT, CGTAATGCCTCGCCAAGTG) into a real-time polymerase chain reaction machine (real-time PCR machine ABI7500), the results of the polymerase chain reaction are shown in Fig. 19.

[0203] Figure 19 is a bar graph showing the results of analyzing the mRNA levels of the gene rempA in fruit flies of normal group A, group B (cold stress-induced sudden hearing loss group in Figure 19) in which sudden hearing loss was induced by cold stress, and group C (cold stress-induced sudden hearing loss + DX3004-HMF in Figure 19) in which the fermented composition containing gamma-aminobutyric acid of the present invention was consumed while inducing cold stress. As shown in Figure 19, the rempA gene mRNA expression level decreased by 81% in (B) compared to (A). However, the rempA gene mRNA expression level increased again by 383% in (C) compared to (B). This suggests that the fermented composition containing gamma-aminobutyric acid of the present invention exhibits anti-sudden hearing loss prevention and improvement efficacy by improving internal structural defects of auditory receptor cells.

[0204] Although the present invention has been described with reference to limited embodiments as above, the technical concept and scope of the present invention are not limited to these aforementioned embodiments. In addition to the invention of the patent claims described below, various modifications or variations of the invention described in the patent claims that are obvious to those skilled in the art to which this invention belongs are also included within the scope of the present invention within the equivalent scope of the invention described in the patent claims.

[0205]

Claims

1. Levilactobacillus brevis DX3004 strain (Deposit No.: KCTC 16236BP).

2. A strain of Reviractobacillus brevis according to claim 1, characterized in that the DX3004 strain comprises a naturally occurring mutation of Reviractobacillus brevis.

3. A pharmaceutical composition for the prevention or treatment of depression comprising, as active ingredients, one or more selected from the Reviractobacillus brevis DX3004 strain (deposit number: KCTC 16236BP), lysate of said strain, dead cell body of said strain, culture of said strain, concentrate of said strain culture, extract of said strain culture, dried culture of said strain, and supernatant of said strain cell-free culture.

4. A pharmaceutical composition for the prevention or treatment of depression according to claim 3, characterized in that the depression is induced by a drug that acts as an antagonist to dopamine receptors.

5. A pharmaceutical composition for the prevention or treatment of depression, characterized in that, in paragraph 4, the antagonist drug for the dopamine receptor is chlorpromazine.

6. A pharmaceutical composition for the prevention or treatment of depression according to claim 3, characterized in that the depression is depression induced by chronic stress.

7. A pharmaceutical composition for the prevention or treatment of depression according to claim 3, characterized in that the DX3004 strain, the lysate of the strain, the dead cell of the strain, the culture of the strain, the concentrate of the culture of the strain, the extract of the culture of the strain, the dried product of the culture of the strain, or the supernatant of a cell-free culture of the strain promotes gene expression of dopamine receptors and / or serotonin receptors in a host.

8. A pharmaceutical composition for the prevention or treatment of depression according to claim 3, characterized in that the DX3004 strain, the lysate of the strain, the dead cell of the strain, the culture of the strain, the concentrate of the culture of the strain, the extract of the culture of the strain, the dried product of the culture of the strain, or the supernatant of a cell-free culture of the strain promotes the growth of Haemophilus parainfluenzae.

9. A food composition comprising the strain Reviractobacillus brevis DX3004 (deposit number: KCTC 16236BP), a lysate of the strain, a dead cell of the strain, a culture of the strain, a concentrate of the culture of the strain, an extract of the culture of the strain, a dried culture of the strain, or a supernatant of a cell-free culture of the strain.

10. A health functional food comprising the strain Reviractobacillus brevis DX3004 (Deposit No.: KCTC 16236BP), a lysate of the strain, a dead cell of the strain, a culture of the strain, a concentrate of the culture of the strain, an extract of the culture of the strain, a dried culture of the strain, or a cell-free culture supernatant of the strain.

11. A feed composition comprising the strain Reviractobacillus brevis DX3004 (deposit number: KCTC 16236BP), a lysate of the strain, a dead cell of the strain, a culture of the strain, a concentrate of the culture of the strain, an extract of the culture of the strain, a dried culture of the strain, or a supernatant of a cell-free culture of the strain.

12. A fermented composition containing gamma-aminobutyric acid, A fermented composition obtained by drying and pulverizing a product obtained by fermenting a culture of the Reviractobacillus brevis DX3004 strain, deposited under accession number KCTC 16236BP, in contact with a liquid glutamic acid source.

13. A fermentation composition according to claim 12, characterized in that the fermentation product has a gamma-aminobutyric acid content of 30% to 70% by weight relative to the total weight of the fermentation composition.

14. A fermentation composition according to claim 12, characterized in that the glutamic acid source is sodium monoglutamate.

15. A method for preparing a fermentation product containing gamma-aminobutyric acid, comprising the step of culturing the Reviractobacillus brevis DX3004 strain deposited under deposit number KCTC 16236BP and contacting it with a liquid glutamic acid source.

16. In paragraph 15, the step of culturing and contacting with a liquid glutamate source (a) A pre-culture step of culturing the Reviractobacillus brevis DX3004 strain in a medium containing a carbon source and a nitrogen source; (b) a main culture step in which the entire culture of the pre-culture step or the Reviractobacillus brevis DX3004 strain that has completed the pre-culture step is inoculated into a medium containing a carbon source and a nitrogen source, which is larger in scale than the medium of the pre-culture step, and the Reviractobacillus brevis DX3004 strain is cultured until a density greater than or equal to the cell density at the completion of the pre-culture step is reached; and (c) a fermentation step in which a glutamic acid source is added to a cell suspension obtained by centrifuging the culture of the above-mentioned main culture step and cultured; characterized by comprising a method for producing a fermented product containing gamma-aminobutyric acid.

17. A method for producing a fermented product containing gamma-aminobutyric acid, characterized in that, in claim 16, the glutamic acid source is sodium monoglutamate.

18. A method for producing a fermented product containing gamma-aminobutyric acid, characterized in that, in claim 17, it further comprises the step of freeze-drying the product after completing the fermentation step.

19. A pharmaceutical composition for the prevention or treatment of hearing loss comprising the fermented composition of claim 12 as an active ingredient.

20. A pharmaceutical composition characterized in that the hearing loss in claim 19 is stress-induced sudden hearing loss.

21. The pharmaceutical composition of claim 19, wherein the pharmaceutical composition is characterized by improving cytomechanical signal transmission of auditory receptor cells and / or the formation of sensory cilia structures of auditory receptor cells.

22. A health functional food comprising the fermented composition of Paragraph 12.

Images