oligonucleotides

Abstract

The present invention relates to a splice-switching oligonucleotide (SSO) that binds to a site within a target region present on a pre-mRNA transcript of a Fyn gene, the target region having at least 75% sequence identity to SEQ ID NO: 1, wherein binding of the SSO induces the exclusion of an exon from a mature mRNA transcript of the Fyn gene, and wherein the exon to be excluded is selected from the group consisting of exon 7B and exon 7A. The present invention also relates to a method of exon-skipping comprising providing a splice-switching oligonucleotide (SSO) that binds to a site within a target region present on a pre-mRNA transcript of a Fyn gene, the target region having at least 75% sequence identity to SEQ ID NO: 1, wherein the binding of the SSO induces the exclusion of an exon from a mature mRNA transcript of the Fyn gene, and wherein the exon to be excluded is selected from the group consisting of exon 7B and exon 7A.

Description

DESCRIPTIONTITLE OF THE INVENTION: OLIGONUCLEOTIDESFIELD OF THE INVENTION

[0001] The present invention relates generally to the field of RNA splicing. In particular, the invention relates to splice-switching oligonucleotides (SSOs) configured to alter the splicing of a Fyn pre-mRNA. The invention also relates to the use of SSOs as therapeutic and validation candidates for Alzheimer’s Disease (AD) and tauopathies-related dementias.BACKGROUND OF THE INVENTION

[0002] Alzheimer’s disease (AD) is the most common type of dementia, a progressive neurodegenerative disorder that primarily affects memory, thinking skill, behaviour and eventually interfere with daily functional living activities. AD manifests neuropathological hallmarks of amyloid plaques, neurofibrillary tangles (NFT) and neuroinflammation.

[0003] Unfortunately, there is no cure for AD or tauopathies. Acetylcholinesterase (AChE) inhibitors (e.g. Donepezil, galantamine and rivastigmine) are standard-of-care to temporarily reduce symptoms during early to mid-stage AD. For patients in moderate or severe stage or intolerable to AChE inhibitors, memantine, which blocks the effects of excessive glutamate in the brain, may be prescribed.

[0004] Existing therapeutic options include the first AD disease-modifying drugs namely Lecanemab (Leqembi), which has attained full FDA regulatory approval in July 2023, and Donanemab (Kisunla), which received FDA approval in July 2024. Both are monoclonal antibodies that target the p-amyloid (A|3) plaques that are indicated for patients with mild cognitive impairment and with confirmed elevated A|3 levels. However, given the multifactorial mechanisms of AD pathogenesis, A|3 burden while indicative of the disease does not correlate well with cognitive deficits. As a result, the clinical needs for patients at the moderate and advanced stages of AD remain unmet, and the next class of AD disease-modifying drugs are needed to target other pathways of AD pathogenesis that address the progressive cognitive deficits.

[0005] Neuroinflammation and tau pathology are two important and yet intertwined pathological processes that are closely associated with cognitive deficits. Although beneficial at early AD stage to promote the clearance of tau seeds by activated microglia, a persistent inflammatory brain at the middle and late AD stages is a vicious circle that aggravates thepathological progression. Fyn tyrosine kinase has been proposed to be a therapeutic target based on its suggested role as an essential mediator between Ap- and tau-associated pathologies, two neuropathological hallmarks of AD. The present inventors have shown that it is the FynT isoform that is pathogenic whose overexpression is significantly correlated with tau pathology and neuroinflammation, and exacerbate disease progression in AD and LBD (Lewy body dementia), and in tauopathy mice whose disease progression were consequently attenuated when FynT was knockout.

[0006] To date, no inhibitor for FynT exists whereas inhibitors against total Fyn (e.g. AZD0530) are non-selective towards the Src family kinases. As Fyn is an important tyrosine kinase involved in various cellular processes and is expressed broadly in many tissues, it is therefore not unexpected when a quarter of AD cohort in phase 2A trial dropped out due to adverse side effects from AZD0530.

[0007] There is thus a need for a therapeutic option targeting Fyn that overcomes the drawbacks of the prior art. Furthermore, other desirable features and characteristics will become apparent from the subsequent detailed description and the appended claims, taken in conjunction with the accompanying drawings and this background of the disclosure.SUMMARY

[0008] In one aspect, the present invention provides a splice-switching oligonucleotide (SSO) that binds to a site within a target region present on a pre-mRNA transcript of a Fyn gene, the target region having at least 75% sequence identity to SEQ ID NO: 1, wherein binding of the SSO induces the exclusion of an exon from a mature mRNA transcript of the Fyn gene, and wherein the exon to be excluded is selected from the group consisting of exon 7B and exon 7A.

[0009] In one embodiment, the target region comprises the sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2.

[0010] In one embodiment, the SSO binding site is located within a first portion of the target region, the first portion having the sequence selected from the group consisting of SEQ ID NO: 3 and SEQ ID NO: 4, wherein binding of the SSO within the first portion induces the exclusion of exon 7B from the mature mRNA transcript of the Fyn gene to reduce the expression of a FynT isoform of Fyn and redirect the splicing to exon 7A inclusion, which increases the expression of a FynB isoform of Fyn.

[0011] In one embodiment, the SSO as described herein comprises a sequence selected from the group consisting of SEQ ID NOs 17 to 79.

[0012] In one embodiment, the SSO binding site is located within a second portion of the target region, the second portion having the sequence selected from the group consisting of SEQ ID NO: 5 and SEQ ID NO: 6, wherein binding of the SSO within the second portion induces the exclusion of exon 7A from the mature mRNA transcript of the Fyn gene to reduce the expression of a FynB isoform of Fyn and redirect the splicing to exon 7B inclusion, which increases the expression of a FynT isoform of Fyn.

[0013] In one embodiment, the SSO as described herein comprises a sequence selected from the group consisting of SEQ ID NOs 7 to 11.

[0014] In one embodiment, the SSO as described herein is between 17 and 33 nucleotides in length.

[0015] In another aspect, there is provided an SSO as described herein for use in treating a tauopathy.

[0016] In another aspect, there is provided a use of an SSO as described herein in the manufacture of a medicament for treating a tauopathy.

[0017] In another aspect, there is provided a method of treating a tauopathy comprising administering to a subject a composition comprising an SSO as described herein.

[0018] In one embodiment, the tauopathy is Alzheimer’s disease.

[0019] In one aspect, there is provided a pharmaceutical composition comprising (a) a therapeutically effective amount of an SSO as described herein and (b) one or more pharmaceutically acceptable carriers and / or diluents.

[0020] In one aspect, there is provided a method of exon-skipping comprising providing a splice-switching oligonucleotide (SSO) that binds to a site within a target region present on a pre-mRNA transcript of a Fyn gene, the target region having at least 75% sequence identity to SEQ ID NO: 1, wherein the binding of the SSO induces the exclusion of an exon from a mature mRNA transcript of the Fyn gene, and wherein the exon to be excluded is selected from the group consisting of exon 7B and exon 7A.

[0021] In one embodiment, the target region comprises the sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2.

[0022] In one embodiment, the method as described herein comprises providing an SSO having a binding site located within a first portion of the target region, the first portion having the sequence selected from the group consisting of SEQ ID NO: 3 and SEQ ID NO: 4, wherein binding of the SSO within the first portion induces the exclusion of exon 7B from the mature mRNA transcript of the Fyn gene to reduce the expression of a FynT isoform of Fyn.

[0023] In one embodiment, the method as described herein comprises providing an SSO comprising a sequence selected from the group consisting of SEQ ID NOs 17 to 79.

[0024] In one embodiment, the method as described herein comprises providing an SSO having a binding site located within a second portion of the target region, the second portion having the sequence selected from the group consisting of SEQ ID NO: 5 and SEQ ID NO: 6, wherein binding of the SSO within the second portion induces the exclusion of exon 7A from the mature mRNA transcript of the Fyn gene to reduce the expression of a FynB isoform of Fyn.

[0025] In one embodiment, the method as described herein comprises providing an SSO comprising a sequence selected from the group consisting of SEQ ID NOs 7 to 11.

[0026] In one embodiment, the method as described herein comprises providing an SSO that is between 17 and 33 nucleotides in length.BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the accompanying drawings, in which:

[0028] Fig. 1 shows a screening for effective SSOs specific for modulating Fyn isoform expression in human and mouse cells. A) human HEK293T cells, (B) mouse BV2 cells and mouse NIH3T3 cells were transfected with control (water) or 200nM of SSOs for 48h and analyzed for Fyn isoforms expression using real-time RT-PCR (qPCR) derived from specific primers (top panel, stacked bar charts) and RT-PCR derived from common primers followed by capillary electrophoresis (bottom panel, electropherograms). Percentage stacked bar chart displayed the effectiveness of each SSO in modulating the changes in % distribution of FynT (black), FynB (light grey) and delta Fyn (dark grey) isoform expression. Electropherograms displayed the relative fluorescence units (RFU) of FynT peak (219bp, T) and FynB peak (228bp, B), with T to B ratio calculated based on the corresponding peak heights. The identified effective SSOs were indicated by *B for FynB-SSOs (switching from FynB to FynT) and *T for FynT-SSOs (switching from FynT to FynB). FynT- and FynB-SSOs are indicated respectively by their “T” and “B” suffixes, while human and / or mouse targeting SSOs are named respectively with “h” and / or “m” prefixes.

[0029] Fig. 2 shows a dose-response assessment to confirm the potency of FynB-SSOs (hm#2105B, h#2106B, m#2115B) and FynT-SSOs (hm#2111T, h#2113T, m#2118T). (A) human HEK293T cells, (B) mouse BV2 and NIH3T3 cells and (C) human immortalized astrocytes (iNHA) were transfected with control (water) or different dosage of SSOs (20, 25, 50, 100, 200nM) for 48h and analyzed for Fyn isoforms expression by qPCR. Note that 20nMand 100nM of scramble control (SC) and hm#BSSO3 were transfected in iNHA for comparison. Percentage stacked bar chart displayed the dosage effects of each SSO in modulating the changes in % distribution of FynT (black), FynB (light grey) and delta Fyn (dark grey) isoform expression. Corresponding Fyn isoforms (same colour-coded bars) and total Fyn expression (lined bars) were presented on the bottom panel, with corresponding colour-coded dotted lines indicating the basal expression level.

[0030] Fig. 3 shows FynB-SSOs and FynT-SSOs modulated Fyn kinase activity as determined by Western blot analysis. HEK293T cells were transfected with 200nM SSOs for 48h. Rat primary neurons at DIV1 were transfected with 200nM hm#BSSO3 for 48h. Transfection without SSOs was served as control. Western blot analysis was performed to detect the immunoreactivities of pTyr416 (corresponding to Fyn kinase activity), total Fyn protein and beta-actin (as loading control).

[0031] Fig. 4 shows intracerebroventricular (ICV) injection of FynB-SSO candidate (hm#BSSO3) in mice showed induction of FynB-specific exon skipping and FynT / delta Fyn splicing, which was accompanied by the upregulation of neuroinflammatory markers and enhanced Fyn kinase activity. WT and P301S (PS) mice were ICV injected with 1nmol (n=3 WT) or 10nmol hm#BSSO3 (n=4 WT and 4 PS), or 10nmol scramble control (SC) (n=2 WT and 4 PS) and harvested at day 7 post-injection. Mice without injection were served as control (Ctrl) (n=2 WT). (A) Hippocampus (R_hpc) and cortex (R_cortex) from the right hemisphere were isolated for RNA and determined by real-time RT-PCR for expressions of FynT, FynB, delta Fyn, total Fyn, CD11b and GFAP expression. FynT to FynB ratio was also determined independently using common primer followed by capillary electrophoresis (CE). Data was analyzed independently in R_hpc and R_cortex using Kruskal-Wallis test with post-hoc Dunn’s multiple comparisons test. *p<0.05, **p<0.01, ***p<0.001. Pearson r correlation revealed significant correlation between FynT and CD11b and GFAP. (B) Western blot analysis of soluble protein fraction of left hippocampus in PS mice treated with SC (n=4) or hm#BSSO3 (n=4) was performed to monitor the changes of immunoreactivities of phosphorylated tau (AT8, T231 and pTyr18), Fyn kinase activity (pTyr416), total Fyn protein, GFAP and GAPDH (as loading control).

[0032] Fig. 5 shows the phagocytosis function of HMC3 was significantly attenuated by FynT-SSO candidate. HMC3 cells were transfected with 100nM or 400nM scramble control (SC), FynB-SSO (hm#BSSO3) or FynT-SSO (h#2113T) for one day followed by incubation with various concentration of 2pm red fluorescence latex beads to allow phagocytosis for 20h. Flow cytometry analysis was performed to determine the percentage of positive cells that successfully execute the phagocytosis function. (A) Representative histograms weredisplayed. (B) The percentage of positive cells in SC was set as 100% to allow data consolidation from independent set of experiments. Statistical analysis was determined by repeated measures ANOVA with Bonferroni post-hoc test. * indicate p<0.05.

[0033] Fig. 6 shows an assessment of FynT-to-FynB splice-switching efficiency of three optimized FynT-SSOs (hm#2233T, hm#2234T, hm#2235T), each synthesized with 20 different chemical modifications, in iNHA and HMC3 cells under calcium-enriched medium (CEM)-mediated free uptake conditions. (A) iNHA were treated with 50nM of FynT-SSOs for 24h in CEM, and (B) HMC3 cells were treated with 200nM FynT-SSOs for 48h in CEM. Note that HMC3 cells were less responsive to SSO uptake under CEM when compared to iNHA. Thus, SSO concentration and incubation time were both increased in HMC3 to overcome the limitation. FynT-SSOs in used were optimized SSOs, hm#2233T, hm#2234T and hm#2235T, each with 20 different chemical modifications (1 x 2’-MOE (2MOE), 1 x 2’-OMe (2OM), 9 x 2MOL-mixers and 9 x 2OML-mixers), and their parent SSOs, hm#2111T and h#2113T (1 x 2MOE, 1 x 2OM). Negative SSO control (NC) was served as baseline expression control, presented as dotted lines, and also for monitoring the changes of each Fyn isoform expression. FynT to FynB ratio were determined by the peak height of the corresponding PCR products after amplification using common primers followed by capillary electrophoresis (CE) (the top row). Real-time RT-PCR with specific primers were further confirmed the expression of FynT (2nd row), FynB (3rd row), delta Fyn (4th row) and total Fyn (5th row). Percentage stacked bar chart displayed the changes in % distribution of FynT (black), FynB (light grey) and delta Fyn (dark grey) (the last row). Asterisk highlighted 7 FynT-SSOs in iNHA and 8 FynT-SSOs in HMC3 to be conducted by dose-response assessment.

[0034] Fig.7 shows the identification of lead FynT-SSOs with high potency to induce FynT-to-FynB splice-switching. (A) iNHA cells were treated with 5, 10, 20 or 50nM of FynT-SSOs (7 selected 2OML-mixer of hm#2233T and hm#2234T) for 24h in CEM and (B) HMC3 cells were treated with 25, 50, 100 or 200nM of FynT-SSOs (8 selected 2OML-mixer of hm#2233T and hm#2234T) for 48h in CEM. Real-time RT- PCR were determined for each Fyn isoforms. Percentage stacked bar chart displayed the dosage effects of each SSO in modulating the changes in % distribution of FynT (black), FynB (light grey) and delta Fyn (dark grey) isoform expression. Corresponding Fyn isoforms (same colour-coded bars) and total Fyn expression (lined bars) were presented on the right panel, with corresponding colour-coded dotted lines indicating the basal expression level.

[0035] Fig. 8 shows the location of the binding sites (i.e. target motifs) of the SSOs in relation to the target region. (A) SEQ ID NO: 1 for human species, where the binding sites of SSOs are indicated by either shading or underlining. (B) SEQ ID NO: 3 for human species,covering from the start to end of the region in exon 7B within which the SSO binding sites lie. Note that the hm#2111T motif is applied for FynT-SSO sequence and chemistry optimization in human and mouse species, generating three SSOs: hm#2233T, hm#2234T and hm#2235T, with target motifs indicated by italics, shading and underlining, respectively. (C) SEQ ID NO:5 for human species (covering from start to end of the region in exon 7A within which the SSO binding sites lie). (D) SEQ ID NO: 2 for mouse species, with indication of binding sites of SSOs by either shading or underlining. (E) SEQ ID NO: 4 for mouse species (covering from start to end the region in exon 7B within which the SSO binding sites lie). (F) SEQ ID NO: 6 for mouse species (covering from start to end of the region in exon 7A within which the SSO binding sites lie).

[0036] Fig. 9 shows that the splice-switching modulation of the Fyn gene is sustained for 4 months following a single ICV injection of FynB-SSO and FynT-SSO in WT mice. WT mice aged 2-3 months received a single ICV injection of 15 nmol SSO: hm#BSSO3 (denoted as B), hm#2233T.401(2MOL) (denoted as T) or sham control (denoted as C). Mice were sacrificed 4 months post-injection. The cortex and hippocampus (Hpc) were dissected, with the left hemisphere used for RNA isolation and the right hemisphere for protein extraction. (A) The FynT to FynB ratio was determined by PCR using a common primer set followed by capillary electrophoresis (CE), demonstrating that each SSO induced its corresponding, desired spliceswitching profile of the Fyn gene. For PCR, n=3 for each group. (B) Western blot analysis demonstrated that FynB-SSO treatment was associated with increased expression of GFAP (astrocytic markers), CD68 (microglial marker) and inflammasome-related proteins, including ASC and caspase-1. For Western blot, n=2 for each group.DETAILED DESCRIPTION OF THE PRESENT INVENTION

[0037] The present disclosure provides the full composition of two groups of spliceswitching oligonucleotides (SSOs). They were each validated to be highly efficacious in modulating the splicing of two mutually exclusive exons (referred to as FynT and FynB exons) in Fyn nascent transcripts. The first group (named as FynT-SSOs) each induces the skipping of FynT exon resulting in the expression of FynB-containing mature transcripts, referred to as FynB isoform that is dominantly expressed in healthy brain tissues. Conversely, the second group (named as FynB-SSOs) each skips FynB exon leading to the expression of FynT-containing mature transcripts or the FynT isoform, which is expressed in immune cells. The present inventors have observed that FynT isoform is significantly upregulated and correlatedwith tau pathology and neuroinflammation in postmortem brain of AD and Lewy body dementias (LBD), and also in P301S tauopathy mice.

[0038] The AD therapeutic strategy of the present disclosure not only inhibits FynT expression but also restores the expression of FynB isoform in brain tissues, accomplished through FynT-SSOs that reverse the expression from FynT to FynB isoforms. The present inventors hypothesized that, given FynB isoform is endogenously present in normal brain tissues, rescuing FynB isoform expression is potentially a more effective therapy and with less side-effects than reducing FynT abundance.

[0039] SSOs may be single-stranded oligonucleotides, whose sugar moieties and backbone linkages are fully chemically modified, that bind sequences in nascent transcripts to effect steric blockage to specific RNA-BPs (RNA binding proteins) or components of the spliceosome. For this therapeutic application, they were designed to induce the skipping of either FynT or FynB exon, that increases the abundance of FynB- or FynT-containing mature transcripts respectively. As used herein, the term “FynB exon” may refer to “exon 7 A” and the term “FynT exon” may refer to “exon 7B”.

[0040] Selective targeting of Fyn isoforms via SSO-mediated exon skipping presents a new avenue for therapeutic intervention that aims to disrupt isoform-specific roles of Fyn in diseases. In the present disclosure, FynT-SSOs were designed to induce FynT exon skipping, leading to selective FynT isoform reduction and the corresponding FynB isoform restoration, which decreases the proportional abundance of FynT to FynB, whereas FynB-SSOs were designed to induce FynB exon skipping, leading to an increase in the FynT to FynB abundance ratio.

[0041] In various embodiments, (1) FynB-SSOs induce skipping of exon 7A, leading to reduced FynB expression; (2) FynT-SSOs induce skipping of exon 7B, leading to reduced FynT expression; and (3) Delta Fyn, an isoform that excludes both exon 7A and exon 7B, is generally upregulated to varying degrees in cells treated with either FynB-SSOs and FynT-SSOs. In other words, exon 7A is targeted by FynB-SSOs so that exon 7A is skipped, and the resulting mature mRNA transcript may encode FynT (when exon 7B is retained) or delta Fyn (when both exon 7A and exon 7B are skipped). Exon 7B is targeted by FynT SSOs so that exon 7B is skipped, and the resulting mature mRNA transcript may encode FynB (when exon 7A is retained) or delta Fyn (when both exon 7A and 7B are skipped). Due to the complexity of the alternative splicing machinery, certain SSOs may induce delta Fyn transcript more than others. As delta Fyn lacks kinase activity, it is not expected to impact the therapeutic use of FynT SSOs even if it is transcribed.

[0042] FynT-SSOs may be used as primary therapeutic candidates for AD. On the other hand, FynB-SSOs can serve as an experimental tool to mimic the splice-switching from FynB to FynT during the progression of AD. Indeed, the present inventors have successfully induced splice-switching from FynB to FynT in mouse brains following intracerebroventricular (ICV) injection of FynB-SSOs, which was accompanied by an increase in neuroinflammatory marker expression (see Figure 4). Additionally, FynB-SSOs could serve as therapeutic candidates for hematological malignancies such as acute lymphoblastic leukemia (ALL) and chronic lymphocytic leukemia (CLL) where abnormal splicing leads to increased FynB expression despite FynT typically being the predominant isoform in lymphoid cells.

[0043] FynT-SSOs cause the reduction of FynT expression, and increase expression of either FynB or delta Fyn or both. For example, FynT-SSOs consistently reduce FynT expression, but may increase FynB and delta Fyn expression to different extents. Similarly, FynB-SSOs cause the reduction of FynB expression, and increase expression of either FynT or delta Fyn expression or both.

[0044] The target region (i.e. SEQ ID NO: 1 in human Fyn pre-mRNA and SEQ ID NO: 2 in mouse Fyn pre-mRNA) includes Exon 7A (targeted by FynB-SSOs), followed by an intron (targeted by FynB-SSOs and / or FynT-SSOs) and Exon 7B (targeted by FynT-SSOs) in both human and mouse species. The first portion of the target region (i.e. SEQ ID NO: 3 in human Fyn pre-mRNA and SEQ ID NO: 4 in mouse Fyn pre-mRNA), where only the FynT-SSOs bind, is a region in Exon 7B, plus a few bases extended to the connected intron. The second portion of the target region (i.e. SEQ ID NO: 5 in human Fyn pre-mRNA and SEQ ID NO: 6 in mouse Fyn pre-mRNA), where only the FynB-SSOs bind, is a region in Exon 7A. There is no overlap between the first portion and the second portion of the target region.

[0045] Location of binding sites of SSOs:• SEQ ID NOs 17-79 (SSOs with “T” postfix) bind to the first portion of the target region (i.e. SEQ ID NO: 3 in human Fyn pre-mRNA and SEQ ID NO: 4 in mouse Fyn pre- mRNA). In particular, SEQ ID NOs 17-20 (SSOs with “h” prefix) bind to SEQ ID NO: 3, SEQ ID NOs 21 and 22 (SSOs with “m” prefix) bind to SEQ ID NO: 4, and SEQ ID NOs 18 and 23-79 (SSOs with “hm” prefix) bind to both SEQ ID NOs 3 and 4.• SEQ ID NOs 12-16 (SSOs with “TB” postfix) bind to SEQ ID NOs 1 or 2 at the intron region between Exons 7A and 7B. In particular, SEQ ID NOs 12-14 (SSOs with “h” prefix) bind to SEQ ID NO: 1 in human Fyn pre-mRNA and SEQ ID NOs 15-16 (SSOs with “m” prefix) bind to SEQ ID NO: 2 in mouse Fyn pre-mRNA.• SEQ ID NOs 7-11 (generally SSOs with “B” postfix) bind to the second portion of the target region (i.e. SEQ ID NO: 5 in human Fyn pre-mRNA and SEQ ID NO: 6 in mouseFyn pre-mRNA). In particular, SEQ ID NOs 7 and 9 bind to SEQ ID NO: 5, SEQ ID NO: 10 binds to SEQ ID NO: 6, and SEQ ID NOs 8 and 11 bind to both SEQ ID NOs 5 and 6.

[0046] Existing Fyn kinase inhibitors such as AZD0530 are not specific to FynT. In addition to inhibiting FynT, they may inadvertently target FynB, other Src family members and other tyrosine kinases, leading to off-target effects that could cause adverse side effects. Achieving specific targeting FynT without affecting FynB and other kinases is challenging due to the high similarity in their kinase domains. Given the altered splicing of Fyn observed in AD, which led to FynT induction and were strongly associated with tau pathology and neuroinflammation, the present inventors propose a novel approach. By employing a steric-blocking antisense oligonucleotides strategy to induce Exon 7B skipping, the present approach can selectively reduce FynT expression, thereby addressing the pathological effects without disrupting FynB or other kinases.

[0047] In one aspect, the present disclosure provides a splice-switching oligonucleotide (SSO) that binds to a site within a target region present on a pre-mRNA transcript of a Fyn gene, the target region having at least 75% sequence identity to SEQ ID NO: 1, wherein binding of the SSO induces the exclusion of an exon from a mature mRNA transcript of the Fyn gene, and wherein the exon to be excluded is selected from the group consisting of exon 7B and exon 7A.

[0048] By “oligonucleotide”, it is meant to refer to any polynucleotide. A "polynucleotide" is an oligomer comprised of nucleotides. A polynucleotide may be comprised of DNA, RNA modified forms thereof, or a combination thereof. The term "nucleotide" or its plural as used herein is interchangeable with modified forms as discussed herein and otherwise known in the art. In certain instances, the art uses the term "nucleobase" which embraces naturally occurring nucleotides as well as modifications of nucleotides that can be polymerized. Thus, nucleotide or nucleobase means the naturally occurring nucleobases adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U) as well as non-naturally occurring nucleobases such as xanthine, diaminopurine, 8-oxo-N6- methyladenine, 7-deazaxanthine, 7-deazaguanine, N4, N4-ethanocytosin, N', N'-ethano-2,6- diaminopurine, 5-methylcytosine (mC), 5-(C[3]- C6)-alkynyl-cytosine, 5-fluorouracil, 5- bromouracil, pseudoisocytosine, 2-hydroxy-5-methyl-4-tr- iazolopyridin, isocytosine, isoguanine, inosine and the "non-naturally occurring" nucleobases described in Benner et al, U. S. Pat. No. 5,432,272. The term "nucleobase" also includes not only the known purine and pyrimidine heterocycles, but also heterocyclic analogues and tautomers thereof. Further naturally and non-naturally occurring nucleobases include those disclosed in U. S. Pat. No. 3,687,808, which is hereby incorporatedby reference in its entirety. In various embodiments, polynucleotides also include one or more "nucleosidic bases" or "base units" which include compounds such as heterocyclic compounds that can serve like nucleobases, including certain "universal bases" that are not nucleosidic bases in the most classical sense but serve as nucleosidic bases. Universal bases include 3-nitropyrrole, optionally substituted indoles {e.g., 5-nitroindole), and optionally substituted hypoxanthine. Other desirable universal bases include pyrrole, and diazole or triazole derivatives, including those universal bases known in the art.

[0049] Polynucleotides may also include modified nucleobases. A "modified base" is understood in the art to be one that can pair with a natural base (e.g., adenine, guanine, cytosine, uracil, and / or thymine) and / or can pair with a non-naturally occurring base. Exemplary modified bases are described in EP 1 072679 and WO 97 / 12896, the disclosures of which are incorporated herein by reference. Modified nucleobases include, without limitation, 5- methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5- bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7- methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Further modified bases include tricyclic pyrimidines such as phenoxazine cytidine(IH-pyrimido[5,4-b] [l,4]benzoxazin-2(3H)- one), phenothiazine cytidine (IH-pyrimido[5,4-b] [l,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido[5,4-b] [l,4]benzox- azin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H- pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified bases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Additional nucleobases include those disclosed in U. S. Pat. No. 3,687,808. Certain of these bases are useful for increasing the binding affinity of the polynucleotide and include 5-substituted pyrimidines, 6- azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5- propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2. deg. C and are, in certain embodiments, combined with 2'- O-methoxyethyl sugar modifications. See, U. S. Pat. Nos. 3,687,808, U. S. Pat. Nos. 4,845,205;5,130,302; 5, 134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502, 177; 5,525,711; 5,552,540; 5,587,469; 5,594, 121, 5,596,091; 5,614,617; 5,645,985; 5,830,653; 5,763,588; 6,005,096; 5,750,692 and 5,681,941, the disclosures of which are incorporated herein by reference.

[0050] As used herein, the term “splice switching oligonucleotides” (SSOs) or “splice switching oligomers” is meant to include synthetic antisense nucleic acids that base-pair with a pre-mRNA and disrupt the splicing process by sterically blocking the RNA-RNA base-pairing or protein-RNA binding interactions that occur between components of the splicing machinery and the pre-mRNA. The SSOs may also be known as “antisense nucleotides”, “steric blockers” or “steric hindrance antisense nucleotides" which can modulate splicing. SSOs may modulate splicing via steric blocking. In some embodiments, SSOs may be mixmers. The term “mixmer” includes an oligomer on which different types of chemical modifications are applied on its sugar moieties, or on its backbone linkages, or both. Examples of chemical modifications include phosphorothioate linkages, 2’-O-methyl RNA modifications, 2’-O-methoxyethyl RNA modifications and locked nucleic acid substitutions. The terms “phosphorothioate bond” and “phosphorothioate linkage” are used interchangeably. The chemical modifications may increase the efficacy, selectivity and stability while manifesting superior toxicity profile of SSOs.

[0051] The term “splicing” refers to an RNA processing mechanism in which a pre-mRNA is made into a mature mRNA. During splicing, introns are removed and exons are connected. Splicing is catalysed by the spliceosome complex. As used herein, the term “alternative splicing” is meant to include a process by which a gene can encode for multiple mRNA and protein products by differentially selecting which exons are to be included in a mature mRNA transcript. For example, alternative splicing can take the form of one or more skipped exons, variable position of intron splicing, or intron retention.

[0052] As used herein, the term “intron” refers to a segment of non-coding nucleic acid sequence that is transcribed and is present in the pre-mRNA but is excised by the splicing machinery and therefore not present in the mature mRNA transcript.

[0053] As used herein, the term “exon” refers to a segment of a nucleic acid sequence that is transcribed into mRNA and that is present in mature mRNA after splicing. The term “exon skipping” is meant to include the process by which an entire exon, or a portion thereof, is removed from a given pre-mRNA and is thereby excluded from being present in the mature mRNA. For example, the portion of the protein that is otherwise encoded by the skipped exon is not present in the expressed form of the protein.

[0054] As used herein, the term “splice site” is meant to include specific nucleic acid sequences that can be recognized by the splicing machinery as being suitable for excision and / or ligation with the corresponding splice site. The splice site defines the precise exonintron boundary that allows the excision of introns present in pre-mRNA transcripts. As used herein, the term “5’ splice site” (also known as donor splice site) refers to a nucleic acid sequence surrounding the exon-intron boundary at the 5’ end of an intron that marks the start of the intron and its boundary with the preceding exon sequence. The term “3’ splice site” (also known as acceptor splice site) as used herein refers to a nucleic acid sequence surrounding the intron-exon boundary at the 3’ end of an intron that marks the end of the intron and its boundary with the following exon sequence.

[0055] As used herein, the term “pre-mRNA” or “precursor mRNA” refers to a strand of messenger ribonucleic acid (mRNA), synthesized from a DNA template by transcription. Pre-mRNA is composed of exons, introns and untranslated sequences (before the first and after the last exons respectively). Generally, eukaryotic pre-mRNA exists only briefly before it is fully processed into mature mRNA.

[0056] The term “binding” as used in the context of an SSO is meant to include the hybridization of the SSO to a site within a target region on a pre-mRNA transcript. The term “hybridize” or “hybridization” may include the binding of a single-stranded nucleic acid or a locally single-stranded region of a double-stranded nucleic acid to another single-stranded nucleic acid or a locally single-stranded region of a double-stranded nucleic acid having a complementary sequence through the pairing of complementary nucleic acids. It is generally known to a person skilled in the art that binding or hybridization of one sequence to another does not require total complementarity of the sequences. For example, the sequence of the SSO may be completely complementary or partially complementary to the target region to which it binds.

[0057] Advantageously, the SSOs of the present embodiments are able to bind to the respective binding sites on the target region competitively due to favourable binding thermodynamics and extent of co-transcriptional locally single-stranded binding site on the target region identified. Selection of the target region involves considering the presence of RNA-binding protein motifs on the target region. The SSOs of the present embodiments are able to induce the desired splicing modulation by competitive binding to target sites that encompass or overlap sequence motifs used by the appropriate RNA-binding protein(s), snRNPs (small nuclear ribonucleoproteins), or both.

[0058] In one embodiment, the target region comprises the sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2. In one example, SEQ ID NO: 1 is thesequence of the target region in the human Fyn pre-mRNA and SEQ ID NO: 2 is the sequence of the target region in the mouse Fyn pre-mRNA.

[0059] In one embodiment, the SSO binding site is located within a first portion of the target region, the first portion having the sequence selected from the group consisting of SEQ ID NO: 3 and SEQ ID NO: 4, wherein binding of the SSO within the first portion induces the exclusion of exon 7B from the mature mRNA transcript of the Fyn gene to reduce the expression of a FynT isoform of Fyn. In one example, SEQ ID NO: 3 is the sequence of the first portion of the target region in the human Fyn pre-mRNA and SEQ ID NO: 4 is the sequence of the first portion of the target region in the mouse Fyn pre-mRNA.

[0060] In one embodiment, the SSO as described herein comprises a sequence selected from the group consisting of SEQ ID NOs 17 to 79.

[0061] In one embodiment, the SSO binding site is located within a second portion of the target region, the second portion having the sequence selected from the group consisting of SEQ ID NO: 5 and SEQ ID NO: 6, wherein binding of the SSO within the second portion induces the exclusion of exon 7A from the mature mRNA transcript of the Fyn gene to reduce the expression of a FynB isoform of Fyn. In one example, SEQ ID NO: 5 is the sequence of the second portion of the target region in the human Fyn pre-mRNA and SEQ ID NO: 6 is the sequence of the second portion of the target region in the mouse Fyn pre-mRNA.

[0062] In one embodiment, the SSO as described herein comprises a sequence selected from the group consisting of SEQ ID NOs 7 to 11.

[0063] In one embodiment, the SSO as described herein is between 17 and 33 nucleotides in length.

[0064] In various embodiments, at least one of the nucleotides of the SSO is chemically modified and wherein the chemical modification is selected from the group consisting of 2’-O-methyl RNA modification, 2’-O-methoxyethyl RNA modification, locked nucleic acid substitution and phosphorothioate linkage. The term “locked nucleic acid” (LNA) generally refers to a modified RNA nucleotide where the ribose ring is “locked” with a methylene bridge connecting the 2'-0 atom with the 4'-C atom. The SSO may comprise phosphorothioate linkages between all nucleotides of the SSO. In various embodiments, each nucleotide of the SSO comprises either a 2’-O-methyl RNA modification, a 2’O-methoxyethylRNA modification or a locked nucleic acid substitution.

[0065] In another aspect of the invention, there is provided the SSOs of this invention for use in treating a tauopathy. In another aspect, there is provided a use of an SSO as described herein in the manufacture of a medicament for treating a tauopathy. In yet another aspect,there is provided a method of treating a tauopathy comprising administering to a subject a composition comprising an SSO as described herein.

[0066] In one embodiment, the tauopathy is Alzheimer’s disease.

[0067] As used herein, the term “treat” or “treating” in the context of treating a disease such as a tauopathy is meant to include improving clinical condition of patients having the disease. This includes reducing the severity and preventing or slowing the progression of the disease.

[0068] These SSOs may be used in compositions that can be used for treatment, e.g. as a pharmaceutical composition comprising the SSO of the invention and a pharmaceutically acceptable carrier. The composition is suitable for parenteral administration either naked or complexed with a delivery agent to a patient. The carrier is selected from the group consisting of a nanoparticle, such as a polymeric nanoparticle; a liposome, such as pH-sensitive liposome, an antibody conjugated liposome; a viral vector, a cationic lipid, a polymer, a UsnRNA, such as U7 snRNA and a cell penetrating peptide. The SSO is administered topically, or orally, or rectal, ortransmucosal, or intestinal, or intramuscular, or subcutaneous, or intramedullary, or intrathecal, or direct intraventricular, or intravenous, or intravitreal, or intraperitoneal, or intranasal, or intraocular.

[0069] In another aspect of the present invention, there is provided a pharmaceutical composition comprising (a) a therapeutically effective amount of an SSO as described herein and (b) one or more pharmaceutically acceptable carriers and / or diluents.

[0070] The term “therapeutically effective amount” refers to the amount of the SSO as described herein that is required to confer the intended therapeutic effect in the subject, which amount will vary depending on the route of administration, status of disease, body weight and possible inclusion of other therapeutics or excipients. A “therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve a desired therapeutic result. A therapeutically effective amount may vary according to factors such as the disease state, width of the organ, e.g. affected skin area, affected, age, sex, and weight of the individual, and the ability of the therapeutic agent to elicit a desired response in the individual. A therapeutically effective amount is also one in which any toxic or detrimental effects of the protein or protein portion are outweighed by the therapeutically beneficial effects.

[0071] A “therapeutically effective amount” for therapy may also be measured by its ability to stabilize the progression of disease. A therapeutically effective amount of a therapeutic agent may reduce or ameliorate symptoms in a subject. One of ordinary skill in the art would be able to determine such amounts based on such factors as the subject’s size, the severity of the subject’s symptoms, and the particular composition or route of administration selected.

[0072] In the methods of the invention, therapy is used to provide a positive therapeutic response with respect to a disease or condition. The term “positive therapeutic response” is intended to include an improvement in the disease or condition, and / or an improvement in the symptoms associated with the disease or condition, and / or prevent the worsening of symptoms associated with the disease or condition. Positive therapeutic responses in any given disease or condition can be determined by standardized response criteria specific to that disease or condition. In addition to these positive therapeutic responses, the subject undergoing therapy may experience the beneficial effect of an improvement in the symptoms associated with the disease.

[0073] A pharmaceutically acceptable carrier refers, generally, to materials that are suitable for administration to a subject wherein the carrier is not biologically harmful, or otherwise, causes undesirable effects. Such carriers are typically inert ingredients of a medicament. Typically a carrier is administered to a subject along with an active ingredient without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of a pharmaceutical composition in which it is contained.

[0074] In a more specific form of the disclosure there are provided pharmaceutical compositions comprising therapeutically effective amounts of an SSO together with pharmaceutically acceptable diluents, preservatives, solubilizers, emulsifiers, adjuvants and / or carriers. Such compositions include diluents of various buffer content (e.g., phosphate, Tris-HCI, acetate), pH and ionic strength and additives such as detergents and solubilizing agents (e.g., Tween 80, Polysorbate 80), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimersol, benzyl alcohol) and bulking substances (e.g., lactose, mannitol). The material may be incorporated into particulate preparations of polymeric compounds such as, for example and without limitation, polylactic acid or polyglycolic acid, or into liposomes. Hyaluronic acid (HA) may also be used. Such compositions may influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of the disclosed compositions. The compositions may be prepared in liquid form, or may be in dried powder, such as lyophilized form.

[0075] It will be appreciated that pharmaceutical compositions provided according to the disclosure may be administered by any means known in the art. Preferably, the pharmaceutical compositions for administration are administered by injection, topically, or orally, or by the pulmonary, or nasal route. The antisense polynucleotides are, in various embodiments, delivered by intravenous, intra-arterial, intraperitoneal, intramuscular, transdermal, or subcutaneous routes of administration.

[0076] In one embodiment, the pharmaceutical compositions comprising an SSO as described herein may be delivered via microneedle that include self-dissolving microneedle patch and microneedle device, such as a microneedle patch. Self-dissolving microneedle patch is made of HA that is casted into crystal in the form of microneedle. SSO can be embedded by mixing it with HA solution before to be casted into microneedle patch. Once the microneedles puncture through the skin barrier, they will naturally melt releasing the SSO for maximum uptake by the cells in the epidermis and dermis while the HA is being absorbed by the skin tissue. Microneedle devices which are made of plastics or metal or other polymers can also be used to deliver substances through the skin to the body. A microneedle device may be used to deliver a drug directly to the epidermis and dermis, the second layer of skin. The microneedles puncture the epidermal barrier and deliver the drug directly to the epidermis, dermis to maximise diffusion and even further diffuse to the bloodstream and absorption by the body’s active tissues. This delivery method has an advantage over oral delivery because it allows the composition to be absorbed into the body without coming into contact with powerful digestive enzymes of the stomach, over injectable delivery because it is comparatively painless, and over topical delivery because it allows for much greater absorption of the delivered composition. The microneedle patch will be attached to a reservoir that will contain the composition to be delivered, and this reservoir will itself be attached to contain an apparatus to encourage flow of the composition contained in the reservoir through the microneedles and into the skin.

[0077] The pharmaceutical compositions comprising an SSO as described herein may also be delivered via lipid nanoparticles. Lipid nanoparticles as used herein may refer to carrier systems in the nanometer size comprising a continuous aqueous phase and at least one dispersed oily phase, in which the oily phase comprises at least one amphiphilic lipid such as phospholipids and at least one solubilizing lipid with a monolayer around an amorphous core. Lipid nanoparticles are known for their high degree of biocompatibility, controlled release, efficient targeting, stability, natural biodegradability and high therapeutic index to their payload. Lipid nanoparticles may be assembled as solid lipid nanoparticles (SLN), nanostructured lipid carriers (NLC), and NanoSpheres (NS). The lipids used in the process of synthesizing the lipid nanoparticle compositions may include fatty acids, triglycerides, triacylglycerols, acylglycerols, fats, waxes, cholesterol, sphingolipids, glycerides, sterides, cerides, glycolipids, sulfolipids, lipoproteins, chylomicrons and the derivatives of these lipids. Surfactants used in the assembly of lipid nanoparticles may include biocompatible and biodegradable surfactants such as lecithins, polysorbates, monoglycerides, diglycerides,triglycerides, glyceryl oleate, polaxamers and other non-toxic, non-ionic surfactants that are known in the art.

[0078] The oligonucleotides of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such pro-drugs, and other bioequivalents.

[0079] The term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

[0080] For polynucleotides, preferred examples of pharmaceutically acceptable salts include, but are not limited to, (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine; (b) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine. The pharmaceutical compositions of the disclosure may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (e.g. lotion / cream / microneedle based, ophthalmic or to mucous membranes including rectal delivery), pulmonary, e.g., by inhalation of powders or aerosols (including by nebulizer, intratracheal, intranasal), oral or parenteral. Parenteral administration includes intravenous, intra-arterial, subcutaneous, transdermal, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration.

[0081] The pharmaceutical formulations of the disclosure, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general the formulations are prepared by uniformly bringing into association the active ingredients withliquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

[0082] Combination therapy with an additional therapeutic agent may also be contemplated by the disclosure. The term “combination” or “combination therapy” as used throughout the specification, is meant to encompass the administration of the referred therapeutic agents to a subject suffering from a disease, disorder or pathological condition, in the same or separate pharmaceutical formulations, and at the same time or at different times. If the therapeutic agents are administered at different times they should be administered sufficiently close in time to provide for the potentiating or synergistic response to occur. In such instances, it is contemplated that one would typically administer both therapeutic agents within about 12-24 hours of each other and, more preferably, within about 6-12 hours of each other. In some situations, it may be desirable to extend the time period for treatment significantly, however, where several days (2, 3, 4, 5, 6 or 7) to several weeks (1, 2, 3, 4, 5, 6, 7 or 8) lapse between the respective administrations. In other situations, it might be desirable to reduce the time between administration, administering both therapeutic agents within seconds or minutes to hours, preferably within about 6 hours from each other, more preferably within about 1 or 3 hours.

[0083] The term "therapeutically effective amount" refers to the amount of the SSO that is required to confer the intended therapeutic effect in the subject, which amount will vary depending on the route of administration, status of disease, age, gender, body weight, and possible inclusion of other therapeutics or excipients. The method and uses of the invention are for a patient in need thereof. The compositions and methods of this invention are for a subject or patient in need thereof. The term “patient in need thereof” refers to a person who has or is suspected of having or developing a tauopathy, as well as a person who is predisposed to but yet to develop a tauopathy.

[0084] In some embodiments, the present invention may be used in gene therapy such as, e.g. using a vector (e.g., an expression vector) comprising a polynucleotide of the invention to direct expression of the polynucleotide in a suitable host cell. Such vectors are useful, e.g., for amplifying the polynucleotides in host cells to create useful quantities thereof. In some embodiments, the vector is an expression vector wherein a polynucleotide of the invention is operatively linked to a polynucleotide comprising an expression control sequence.

[0085] In one aspect, the present disclosure provides a method of exon-skipping comprising providing a splice-switching oligonucleotide (SSO) that binds to a site within a target region present on a pre-mRNA transcript of a Fyn gene, the target region having at least 75% sequence identity to SEQ ID NO: 1, wherein the binding of the SSO induces the exclusionof an exon from a mature mRNA transcript of the Fyn gene, and wherein the exon to be excluded is selected from the group consisting of exon 7B and exon 7A.

[0086] In one embodiment, the target region comprises the sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2. In one example, SEQ ID NO: 1 is the sequence of the target region in the human Fyn pre-mRNA and SEQ ID NO: 2 is the sequence of the target region in the mouse Fyn pre-mRNA.

[0087] In one embodiment, the method as described herein comprises providing an SSO having a binding site located within a first portion of the target region, the first portion having the sequence selected from the group consisting of SEQ ID NO: 3 and SEQ ID NO: 4, wherein binding of the SSO within the first portion induces the exclusion of exon 7B from the mature mRNA transcript of the Fyn gene to reduce the expression of a FynT isoform of Fyn. In one example, SEQ ID NO: 3 is the sequence of the first portion of the target region in the human Fyn pre-mRNA and SEQ ID NO: 4 is the sequence of the first portion of the target region in the mouse Fyn pre-mRNA.

[0088] In one embodiment, the method as described herein comprises providing an SSO comprising a sequence selected from the group consisting of SEQ ID NOs 17 to 79.

[0089] In one embodiment, the method as described herein comprises providing an SSO having a binding site located within a second portion of the target region, the second portion having the sequence selected from the group consisting of SEQ ID NO: 5 and SEQ ID NO: 6, wherein binding of the SSO within the second portion induces the exclusion of exon 7A from the mature mRNA transcript of the Fyn gene to reduce the expression of a FynB isoform of Fyn. In one example, SEQ ID NO: 5 is the sequence of the second portion of the target region in the human Fyn pre-mRNA and SEQ ID NO: 6 is the sequence of the second portion of the target region in the mouse Fyn pre-mRNA.

[0090] In one embodiment, the method as described herein comprises providing an SSO comprising a sequence selected from the group consisting of SEQ ID NOs 7 to 11.

[0091] In one embodiment, the method as described herein comprises providing an SSO that is between 17 and 33 nucleotides in length.

[0092] The invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms "comprising", "including", "containing", etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible withinthe scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the inventions embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.

[0093] The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.

[0094] Other embodiments are within the following claims and non- limiting examples. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.

[0095] MATERIAL AND METHODS

[0096] Cell culture

[0097] Human embryonic kidney cells (HEK293T), immortalized normal human astrocytes (iNHA, provided by Dr. Russell O. Pieper from UCSF), immortalized human embryonic microglial cells (HMC3, obtained from ATCC (CRL3304)), mouse embryonic fibroblasts cells (NIH3T3) and immortalized murine microglial cells (BV2) were maintained in DMEM high glucose (Gibco) supplemented with 4mM L-glutamine, 1mM sodium pyruvate and 10% heat-inactivated fetal bovine serum (FBS) (Hyclone). Additionally, 1x MEM non-essential amino acids were added to the growth media for human cells. Cells were cultured in a 37°C humidified incubator with 5% CO2 and passaged at 80-90% confluence using Trypsin-EDTA solution.

[0098] Transfection of SSOs

[0099] SSOs were reconstituted in sterile distilled water to prepare a 100μM stock solution and store at -20°C. HEK293T, iNHA, NIH3T3 and BV2 cells were seeded at densities of 1-4 x 105cells per well in 6-well plates. Transfection was performed the following day using either 9μl of HilyMax transfection reagent (Dojindo Laboratories, Japan) or 7.5μl of Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific) following the manufacturer’s protocols, with varying final concentrations of SSOs (0, 20, 25, 50, 100, 200 and 400nM). Cells were harvested for analysis 48 hours post-transfection.

[0100] CEM-mediated uptake of SSOs

[0101] Calcium-enriched medium (CEM)-mediated free uptake of oligonucleotides has been reported in various cell types. In this study, iNHA cells were treated with SSOs at final concentrations of 5, 10, 20 and 50nM for 24 hours in media containing 9mM CaCl₂ (CEM). HMC3 cells were less responsive to SSO uptake under CEM conditions; therefore, they were treated with SSOs at higher concentration of 25, 50, 100 and 200nM for 48 hours in CEM.

[0102] RNA isolation and reverse transcription

[0103] Upon cell harvesting, HEK293T, iNHA, HMC3, NIH3T3 and BV2 cells cultured in 6-well plates was rinsed once with PBS. After removing PBS, 1ml of NucleoZOL reagent (Macherey Nagel) was added directly to lyse the cells, and the lysate was transferred to a new tube for total RNA isolation according to the manufacturer's instructions. RNA was quantified using NanoDrop™ One (ThermoFisher Scientific). 1μg of total RNA was reverse-transcribed using High-Capacity cDNA RT kit (Applied Biosystems) following the manufacturer's protocols to yield a final reaction volume of 20μl. The thermal cycler conditions were as follows: 25°C for 10 min, 37°C for 120 min and 85°C for 5 sec. cDNA products were diluted with 20μl of nuclease-free water for subsequent real-time PCR analysis.

[0104] PCR and capillary electrophoresis (CE)

[0105] To determine FynT to FynB ratios, a pair of common primers spanning the alternatively spliced exon of Fyn (forward: 5’-GGCCCAGTTTGAAACACTTC-3’; reverse: 5’-GTGTTTCCATTCCAGGTACC-3’ with 5’ labelled 6-FAM) were used. Both FynB and FynT isoforms were simultaneously amplified under 26 to 28 cycles of PCR with 1μl of cDNA using Promega GoTaq Hot Start Polymerase. For CE, 1μl of PCR product and 0.5μl of ABI Genescan 500 Rox size standard (Applied Biosystems) were added to 12μl of Hi-Di™ formamide (Applied Biosystems). After denaturing at 95°C for 4 min and snap cooling on ice, samples were assayed by CE using the 3500 series Genetic Analyzer (ThermoFisher Scientific). The product size and quantity of each DNA amplicon in the capillary electropherograms were analysed using GeneScan analysis software (ThermoFisher Scientific). Peak heights of FynT (219 bp DNA amplicon) and FynB (228 bp DNA amplicon) in each electropherogram were translated into expression levels and used to determine ratios of FynT to FynB expression.

[0106] Real-time RT-PCR

[0107] Semiquantitative measurements of gene expression were performed on the CFX96™ Real-time PCR system (BioRad) using GoTaq® qPCR Master Mix (Promega) following the manufacturer's protocols. The thermal cycling conditions were as follows: 2 min at 95°C, followed by 40 cycles at 95°C for 15 sec and 60°C for 1 min, then 95°C for 10 sec,followed by a melt curve with 0.5°C increments from 65°C to 95°C. The primer sequences used in this study are listed in Table 1. All real-time RT-PCR assays were performed in duplicate. Standard curves of each gene were generated independently by 10x serial dilution of template DNA. The relative signal intensity of each sample was calculated according to the corresponding standard curve. Normalization was performed for each sample by dividing the relative signal intensity of the gene of interest by the geometric mean of p-actin, GAPDH, and 18S rRNA. The relative expression levels of each isoform, used for graph plotting, were adjusted by a scaling factor derived from the mean of the ratio of the peak heights of each isoform in the capillary electropherograms.

[0108] Table 1: Primers used in real-time RT-PCR _Product Forward Primer (5’ -3’) Reverse Primer (5’ -3’) Product Size (bp) HumanFynB CTGCTGCCGCCTAGTAGTTC GTGTTTCCATTCCAGGTACC 168 (SEQ ID NO: 80) (SEQ ID NO: 81)FynT CATCGAGTTGTACCCCACAA GTGTTTCCATTCCAGGTACC 136 (SEQ ID NO: 82) (SEQ ID NO: 81)Delta Fyn CARCATTACTCAGGTACCTGGAA GACGATGTARATGGGCTCCT 174 (SEQ ID NO: 83) (SEQ ID NO: 84)Total Fyn GGCCCGATTGATAGAAGACA TTGGTGACCAGCTCTGTGAG 153 (SEQ ID NO: 85) (SEQ ID NO: 86)P-actin ACTGGAACGGTGAAGGTGAC AGAGAAGTGGGGTGGCTTTT 169 (SEQ ID NO: 87) (SEQ ID NO: 88)GAPDH TGACATCAAGAAGGTGGTGAAG TTACTCCTTGGAGGCCATGTG 241 (SEQ ID NO: 89) (SEQ ID NO: 90)18s rRNA CCTGCGGCTTAATTTGACTC CGCTGAGCCAGTCAGTGTAG 310 (SEQ ID NO: 91) (SEQ ID NO: 92)MouseFynB CTGCTGCCGCCTAGTAGTTC GTATTTCCATTCCAGGTACC 168 (SEQ ID NO: 80) (SEQ ID NO: 93)FynT CATCAAGTTGTACCCCACAA GTATTTCCATTCCAGGTACC 136 (SEQ ID NO: 94) (SEQ ID NO: 93)Delta Fyn CARCATTACTCAGGTACCTGGAA GACGATGTARATGGGCTCCT 174 (SEQ ID NO: 83) (SEQ ID NO: 84)Total Fyn GCATGACGTCCTCTCCATTT TAGAACTGGCTGGCTGCTTT 191 (SEQ ID NO: 95) (SEQ ID NO: 96)P-actin ACTGGAACGGTGAAGGCGAC GAGGGTGAGGGACTTCCTGT 175 (SEQ ID NO: 97) (SEQ ID NO: 98)GAPDH GGCATTGCTCTCAATGACAA TGTGAGGGAGATGCTCAGTG 200 (SEQ ID NO: 99) (SEQ ID NO: 100)18s rRNA CCTGCGGCTTAATTTGACTC CGCTGAGCCAGTCAGTGTAG 319(SEQ ID NO: 91) (SEQ ID NO: 92)(R=either A or G)

[0109] Western Blot analysis

[0110] Upon harvesting, cells cultured in 6-well plates were rinsed once with PBS. After removing PBS, 120 to 200μl of 2x Laemmli Sample Buffer (Biorad) was added per well to lyse the cells. Cell lysates were then transferred to tubes and boiled at 100°C for 5 minutes todenature proteins. Protein concentration was determined using the 2-D Quant Kit (GE Healthcare) according to the manufacturer’s instructions. 5pg of protein lysate were loaded per well and separated according to their molecular weight on a 12% SDS-PAGE gel in Tri / glycine SDS running buffer. Proteins were then transferred onto a nitrocellulose membrane using the Trans-Blot® Turbo Transfer System (Biorad) following the manufacturer’s instructions. The membrane was blocked with 5% BSA in TBST for 1 hour at room temperature before incubation with primary antibodies diluted in 5% BSA on a roller overnight at 4°C. The membrane was washed 3 times with TBST and incubated with anti-rabbit or anti-mouse HRP conjugated secondary antibodies for 1 hour at room temperature on an orbital shaker. After 3 washes with TBST, Immobilon Western Chemiluminescent HRP substrate (Millipore) was added for visualization using UV Luminescence Alliance Mini HD4 chemiluminescence imaging system (UVITEC, Cambridge). The antibodies and dilution factors used are listed in Table 2.

[0111] Table 2. List of primary antibodies for Western blot analysis.Label in HostWB Name of antibody species MW Company (cat#) pTyr416 Phospho-Src family Rb mAb 60kD Cell Signaling (#6943)(Tyr416) (D49G4)Total Fyn Fyn antibody Rb pAb 59kD Cell Signaling (#4023) AT8 Tau (human PHF-Tau, Ms mAb 65kD Thermo Scientific (MN 1020) clone AT8)T231 Tau-phospho threonine 231 Rb pAb 65kD Millipore (AB9668SP) pTyr18 phospho-tau-Tyr18 Ms mAb 65kD MEDIMABS (MM-0194-P) GFAP GFAP (GA5) Ms mAb 50kD Cell Signaling (#3670) Beta-actin p-Actin (13E5), HRP Rb mAb 45kD Cell Signaling (#5125)conjugateGAPDH GAPDH (1E6D9) Ms mAb 36kDProteintech (HRP60004) ASC ASC / TMS1 (D2W8U) Rb mAb 22kD Cell Signaling (#67824) mouse specificCD68 CD68 (E307V) Rb mAb 80kD Cell Signaling (#97778) PSD95 PSD95 (D27E11) Rb mAb 95kD Cell Signaling (#3450) Caspase- Caspase-1 (E2Z1C) Rb mAb 48kD Cell Signaling (#24232)1

[0112] Intracerebroventricular (ICV) injection of SSO

[0113] Wild type and P301S transgenic mice, aged 2 to 3 months, were deeply anesthetized with i.p. injection of a ketamine (65mg / kg BW) and xylazine (13mg / kg BW) mixture. Prior to the start of the procedure, a brief foot pinch was used to confirm the reflex inhibition. The mice were then secured in a stereotaxic frame throughout the surgery. The cranium was stabilized using a stereotaxic apparatus (RWD) with 18-degree ear bars inserted into the ear canals and the incisors positioned in the tooth bar, ensuring the bregma and lambda sutures were aligned on the same z-plane. A midline scalp incision approximately 1 cm long was made under aseptic conditions to expose the bregma. Stereotaxic coordinates for ICV injection were set at 1.7mm posterior and 0.8mm right of bregma, with a depth of 1.8 mm from the dura surface. A small hole was drilled into the skull using a 0.6mm round-tip drill bit fixed to a motorized microdrill before inserting the delivery syringe. A total of 5pl of SSO (either 1nmol or 10nmol) was administered at a rate of 0.5pl per minute using a 33-gauge blunt-point needle affixed to a 10pl glass Hamilton syringe, driven by a Pump 11 Elite programmable syringe pumps (Harvard Apparatus). Following injection, the needle was slowly withdrawn after 2-3 minutes’ wait to minimize reflux. The scalp incision was then closed with sutures. Post-surgery, mice were i.p injected with atipamezole (1mg / kg BW) for the reversal of sedative effect and placed in heated recovery cages. One week after the ICV injection, mouse brain tissues were harvested following CO2 euthanasia. The cerebellum, olfactory bulb and meninges were removed, and the left and right hemispheres were further dissected to isolate the hippocampus and the remaining hemisphere tissue. Left and right portions of the brain tissues were processed separately for protein extraction and RNA isolation.

[0114] Assessment of phagocytosis function using flow cytometry

[0115] HMC3 cells were seeded at a density of 2x105cells per well in a 6-well plate. The following day, cells were treated with either 100 or 400nM SSO in 9mM CaCl₂ containing media (also known as CEM) for 24 hours. Phagocytosis function was then assessed by adding 10pl of 2pm red fluorescence latex beads (Sigma) to each well. After a 20-hour incubation period, the media was discarded, and the cells were washed 3 times with PBS. Cells were trypsinized into a single-cell suspension and resuspended in 1ml of culture media. A 200pl aliquot of the cell suspension was fixed by adding it to a tube containing 100μl of 37% formaldehyde and 700pl PBS, resulting in a final concentration of 3.7% formaldehyde. Flow cytometry was performed using the CytoFLEX LX system to detect the red fluorescent bead-positive cells via the PE channel (Y585 / 42 filter).

[0116] EXAMPLES

[0117] Non-limiting examples of the invention and comparative examples will be further described in greater detail by reference to specific Examples, which should not be construed as in any way limiting the scope of the invention.

[0118] Example 1: Screening of FynT and FynB SSOs in human and mouse cells

[0119] SSOs were rationally designed by the present inventors’ platform technologies to either induce the skipping of FynT (FynT-SSOs) or FynB (FynB-SSOs) exon. While FynT-SSOs are used as therapeutics, FynB-SSOs serve as target validation tools by inducing or accelerating AD pathology in mice. To facilitate validation on AD mouse models, SSOs targeting both human and mouse Fyn sequences with perfect complementarity were designed wherever possible. In addition to SSOs that were designed to target species-specific Fyn sequences, they were screened for their efficacy and efficiency in inducing specific target exon skipping in HEK293T (human), and NIH3T3 and BV2 mouse cell lines. FynT- and FynB-SSOs are generally indicated respectively by their “T” and “B” suffixes, while human and / or mouse targeting SSOs are named respectively with “h” and / or “m” prefixes.

[0120] After screening 10 human-specific splice-switching oligonucleotides (SSOs) in HEK293T cells, the present inventors identified hm#2105B, #h2106B, hm#2111T and h#2113T as the effective SSOs (Figure 1A). On the other hand, 6 mouse-specific SSOs were tested on two mouse cell lines BV2 and NIH3T3 upon which hm#2105B, m#2115B and m#2118T were identified to be effective (Figure 1B). Subsequently, the dose-response for each potential SSO candidate was determined in these cells (Figure 2A to 2B) and in immortalized normal human astrocytes (iNHA) (Figure 2C). Real-time RT-PCR was used to quantitate the expression levels of FynB, FynT, delta Fyn (transcripts without both FynB and FynT exons) and total Fyn. The results confirmed that all FynB-SSOs, including hm#BSSO3 (a FynB-SSO candidate designed by one of the present inventors) were able to induce skipping of FynB-specific exon in a dose-dependent manner, resulting in significant reduction in FynB expression that is in tandem with increment of FynT and delta Fyn expressions. Apparently, induction of splice-switching to delta Fyn isoform were more prominent in h#2106B and m#2115B and less in hm#2105B and hm#BSSO3 (Figure 2A to 2C). Among the FynT-SSOs, both hm#2111T and h#2113T showed high potency in reducing FynT expression, whereas m#2118T was not as effective (Figure 2A to 2C).

[0121] It has been reported that FynT exhibits stronger kinase activity compared to FynB. To investigate whether FynB-SSOs and FynT-SSOs may modulate Fyn kinase activity after splice-switching, Western blot analysis was performed. The pTyr416 immunoreactivities, representing Fyn kinase activity, was found to increase in HEK-293T cells transfected withFynB-SSOs and decreased in those transfected with FynT-SSOs when compared to control (Figure 3). It was also observed that rat primary neurons transfected with hm#BSSO3 showed increased pTyr416 immunoreactivities compared to control. The results aligned well with reported stronger kinase activity of FynT relative to FynB.

[0122] Example 2: Functional studies of FynB-SSO

[0123] In view of increased FynT that correlated well with tau pathology and neuroinflammation in postmortem brain of AD patients and tauopathy mice, mice were treated with one of the present FynB-SSO candidates (hm#BSSO3) via ICV injection to validate its potency in FynB-to-FynT splice-switching in vivo and monitored the corresponding changes of tau phosphorylation and neuroinflammation one-week post-injection. WT and P301S (PS) tauopathy mice at the age of 2.5 to 3.5 months were administered via ICV with either 1nmol or 10nmol of hm#BSSO3, or 10nmol of scramble controls (SC) or without treatment as controls. At 1-week ICV post-injection, mice were sacrificed, hippocampus and cortex were resected from the right hemisphere for RNA isolation and from the right hemisphere for protein extraction. Real-time RT-PCR were performed to determine the expression changes of Fyn isoforms, as well as two crucial neuroinflammatory biomarkers, GFAP and CD11b. Western blot analysis was performed to monitor the changes of tau phosphorylation and Fyn kinase activity in hippocampus of PS mice.

[0124] A dose-dependent FynB-to-FynT splice-switching was observed in mice injected with 1nmol to 10nmol of hm#BSSO3, with a significant reduction in FynB expression that is in tandem with increment of FynT and delta Fyn expressions in both hippocampus and cortex in the 10nmol group (Figure 4A). Of note is that no major change in total Fyn expression was detected. Correspondingly, CD11b expression was also significantly induced in the 10nmol hm#BSSO3 group, as compared to the 10nmol SC group. In addition, an increasing trend of GFAP expression was detected in hippocampus upon hm#BSSO3 treatment (Figure 4A). It was observed that pTyr416 immunoreactivities were increased in hm#BSSO3-treated mice (Figure 4B). A trend of increment of GFAP and tau phosphorylation as determined by pTyr18 and T231 were also observed (Figure 4B). In conclusion, the present inventors have demonstrated the in vivo activity of hm#BSSO3 and the consequential induction of the two crucial neuroinflammatory biomarkers in association with AD.

[0125] Example 3: Functional studies of FynT-SSO

[0126] Using human microglial clone 3 cell line (HMC3), it was assessed if SSOs may modulate its phagocytic functions. Interestingly, it was observed that FynT-SSO candidate (h#2113T) significantly attenuates the phagocytosis function of HMC3 cells (Figure 5).

[0127] Example 4: Sequence and chemistry optimisations of FynT-SSO

[0128] The goal of the present inventors was to identify lead FynT-SSOs that not only inhibit FynT but also restore FynB expression as a therapeutic strategy for AD. The top two candidates, hm#2111T and h#2113T were selected for sequence and chemistry optimizations. Through the present inventors’ platform technologies, three sequence-optimized FynT-SSOs were identified, namely hm#2233T, hm#2234T and hm#2235T. Each has a significantly reduced molecular size as compared to the two parent SSOs with its target sequence overlapping with hm#2111T and / or h#2113T, and are fully complementary to both human and mouse sequences. “Lateral” chemical modification rules, which were shown to increase SSO potency and are agnostic to nucleobase sequences, were subsequently applied to each SSO. Specifically, every ribose was chemically modified with either LNA and 2’-MOE (2MOL for short) or with LNA and 2’-OMe (2OML for short) at specific positions according to the “lateral rules”. 20 different chemically modified versions per SSO (1 x 2’-MOE, 1 x 2’-OMe, 9 x 2MOL-mixers and 9 x 2OML-mixers) were considered. The FynT-to-FynB splice-switching efficiencies of these newly optimized FynT-SSOs were validated and benchmarked against hm#2111T and h#2113T (fully modified with 2’-OMe or 2’-MOE) in INHA and HMC3 cells under calcium enriched medium (CEM) mediated free uptake of SSOs without a transfection reagent (Figure 6).

[0129] The 2OML-mixers in hm#2233T and hm#2234T outperformed the 2MOL-mixers, 2’-MOE (2MOE) and 2’-OMe (2MO), as evidenced by a dramatic reduction in the FynT to FynB ratio, lower FynT expression and a relatively lower proportion of FynT expression in the treated iNHA cells (Figure 6A). Similar results were observed in HMC3 cells, where the 2OML-mixers in hm#2233T and hm#2234T consistently outperformed other chemical modifications, despite varying effectiveness in FynT-to-FynB splice-switching (Figure 6B).

[0130] The dose-response of 7 to 8 selected 2OML-mixers in hm#2233T and hm#2234T was further determined in iNHA and HMC3. Results showed that 2OML-mixers in hm#2233T consistently have better effectiveness in inducing FynT-to-FynB splice-switching when compared to 2OML-mixers in hm#2234T in both cell models (Figure 7A and 7B). In summary, hm#2233T_401_2OML and hm#2233T_402_2OML are the potential lead FynT-SSOs.

[0131] Example 5: Long-term effects of single SSO injection on Fyn splice-switching and neuroinflammatory responses in wild-type mice

[0132] Figure 9 shows the results of a single ICV injection of SSO in WT mice, with assessment conducted at 4 months post-injection to monitor splice-switching modulation and its downstream effects by Western blot analysis. It was confirmed that a single injection of 15nmol SSO sustained the desired splice-switching of the Fyn gene for 4 months, with hm#BSSO3 increasing the FynT to FynB ratio and hm#2233T.401(2MOL) decreasing theFynT to FynB ratio in both cortex and hippocampus (Figure 9A). Western blot analysis demonstrated that hm#BSSO3 treatment was specifically associated with increased expression of GFAP (an astrocytic marker), CD68 (a microglial marker) and inflammasome-related proteins including ASC and caspase 1 in both hippocampus and cortex (Figure 9B). These findings suggest that an increased FynT to FynB ratio may promote chronic neuroinflammation, indicating a potential mechanistic link between Fyn isoform balance and glial activation.

[0133] Example 6: SSO names and compositions

[0134] SEQ ID NOs 1 to 6 are shown below. In SEQ ID NOs 1 and 2, Exon 7A is shown in uppercase, followed by an intron in lowercase and Exon 7B in uppercase.

[0135] SEQ ID NO: 1, i.e. target region for human species (Exon 7A appears as the uppercase sequence at the beginning, followed by the intron in lowercase and Exon 7B as the uppercase sequence at the end): AGA GAGCUGCAGGUCUCUGCUGCCGCCUA GUA GUUCCCUGUCA CAAA GGGA UGCCA AGGCUUACCGAUCUGUCUGUCAAAACCAAAGAUGUCUGGGAAAUCCCUCGAGAAUCC CUGCAGUUGAUCAAGAGACUGGGAAAUGGGCAGUUUGGGGAAGUAUGGAUGGguaug cugagacucaauuacucucuuauuagcuuccccguuuggaagaucccaaacaccaaagauggaaggugaaaauaa agacugcgugaccgggaagaaaguuugaauuacuaauaguggggaauaauaauuucaguuuugguuuuaacauu cuggaauuccuaaaaaaaaaaaaaaaaaaaaaaaagauaguaagugggcaaaauuggcaaauggcucaaguugu acuauuacaugacucucaauucauaaaccagcaaaugguccaaggaauguuccagcugccauaaaauaucuugcu cuucauuuccaaaagcaaauauuuguugagugucauccuaacgggcaagucaccuuccaucuuuccuagugcaug cauaauuauggauuauaaggacuguguuuucuuuauuaauucccuuuccuguagAGAAAGCUGAUGGUU UGUGUUUUAACUUAACUGUGAUUGCA CGAG G ACCCCACAAAC C GGA G GCUAAAGAUGCUUGGGAAGUUGCACGUCGUUCGUUGUGUCUGGAGAAGAAGCUGGG UCAGGGGUGUUUCGCUGAAGUGUGGCUUGgu. The DNA sequence that encodes for SEQ ID NO: 1 is AGAGAGCTGCAGGTCTCTGCTGCCGCCTAGTAGTTCCCTGTCACAAAGGGATGCCAAG GCTTACCGA TCTGTCTGTCAAAACCAAAGA TGTCTGGGAAATCCCTCGAGAA TCCCTGC AGTTGATCAAGAGACTGGGAAATGGGCAGTTTGGGGAAGTATGGATGGgtatgctgagactca attactctcttattagcttccccgtttggaagatcccaaacaccaaagatggaaggtgaaaataaagactgcgtgaccgggaaga aagtttgaattactaatagtggggaataataatttcagttttggttttaacattctggaattcctaaaaaaaaaaaaaaaaaaaaaa aagatagtaagtgggcaaaattggcaaatggctcaagttgtactattacatgactctcaattcataaaccagcaaatggtccaag gaatgttccagctgccataaaatatcttgctcttcatttccaaaagcaaatatttgttgagtgtcatcctaacgggcaagtcaccttcca tctttcctagtgcatgcataattatggattataaggactgtgttttctttattaattccctttcctgtagAGAAAGCTGATGGTTT GTGTTTTAACTTAACTGTGATTGCA TCGA G TTG TACCCCA CAAA C TTC TGGA TTGGCTAAAGATGCTTGGGAAGTTGCACGTCGTTCGTTGTGTCTGGAGAAGAAGCTGGGTCAGGGG TGTTTCGCTGAAGTGTGGCTTGgt (SEQ ID NO: 101). It would be generally understood that the skilled person given SEQ ID NO: 101 would know how to derive the RNA sequence of the target region (i.e. SEQ ID NO: 1).

[0136] SEQ ID NO:3, i.e. first portion of target region for human species (covering from start to end of in the region in exon 7B within which the SSO binding sites lie): GCAUCGAGUUGUACCCCACAAACUUCUGGAUUGGCUAAAGAUGCUUGGGAAGUUGC ACGUCGUUCGUUGUGUCUGGAGAAGAAGCUGGGUCAGGGGUGUUUCGCUGAAGUG UGGCUUGgu. The DNA sequence that encodes for SEQ ID NO: 3 is GCATCGAGTTGTACCCCACAAACTTCTGGATTGGCTAAAGATGCTTGGGAAGTTGCACG TCGTTCGTTGTGTCTGGAGAAGAAGCTGGGTCAGGGGTGTTTCGCTGAAGTGTGGCTTGgt (SEQ ID NO: 103). It would be generally understood that the skilled person given SEQ ID NO: 103 would know how to derive the RNA sequence of the target region (i.e. SEQ ID NO: 3).

[0137] SEQ ID NO:5, i.e. second portion of target region for human species (covering from start to end of the region in exon 7A within which the SSO binding sites lie): GAGAGCUGCAGGUCUCUGCUGCCGCCUAGUAGUUCCCUGUCACAAAGGGAUGCCAA GGCUUACCGAUCUGUCUGUCAAAACCAAAGAUGUCUGGGAAAUCCCUCGAGAAUCCC UGCAGUUGAUC. The DNA sequence that encodes for SEQ ID NO: 5 is GAGAGCTGCAGGTCTCTGCTGCCGCCTAGTAGTTCCCTGTCACAAAGGGATGCCAAGG CTTACCGATCTGTCTGTCAAAACCAAAGATGTCTGGGAAATCCCTCGAGAATCCCTGCA GTTGATC (SEQ ID NO: 105). It would be generally understood that the skilled person given SEQ ID NO: 105 would know how to derive the RNA sequence of the target region (i.e. SEQ ID NO: 5).

[0138] SEQ ID NO:2, i.e. target region for mouse species (Exon 7A appears as the uppercase sequence at the beginning, followed by the intron in lowercase and Exon 7B as the uppercase sequence at the end): AGAGAGCCGCAGGUCUCUGCUGCCGCCUAGUAGUUCCCUGUCACAAAGGGAUGCCA AGGCUUACCGAUCUGUCUGUCAAAACCAAAGAUGUCUGGGAAAUCCCUCGAGAAUCC CUGCAGUUGAUCAAGAGACUGGGAAAUGGGCAGUUUGGGGAAGUAUGGAUGGguaug cugagauucaauuacucucuuauuagcuuccucguuuggaaaaucccaaacaucaagauggaagguggaaauaaa gauauuuuaugaucaggacaaacagacaguuugaauuauucaacuuuuauuuggaaaaauuuggaaucucucaa agagagcuagaaacaggcaagaacuacagcugucuccaguugugcuacaguguuccaaccuggcucaauguugcc gucagggaagucaccuuccaucuuuccuagugcaugcaugauuauggauuauaaggacuguuuucuuuauuaauu cccuuuccuguagAGAAAGCUGAUGGUUUGUGUUUUAACUUAACUGUGG CA CAAGUGUACCCCACAAACUUCUGGAUUGGCUAAAGAUGCUUGGGAAGUUGCACGUGACUC GUUGUUUCUGGAGAAGAAGCUGGGGCAGGGGUGUUUCGCUGAAGUGUGGCUUGgua ag. The DNA sequence that encodes for SEQ ID NO: 2 is AGAGAGCCGCAGGTCTCTGCTGCCGCCTAGTAGTTCCCTGTCACAAAGGGATGCCAAG GCTTACCGA TCTGTCTGTCAAAACCAAAGA TGTCTGGGAAATCCCTCGAGAA TCCCTGC AGTTGATCAAGAGACTGGGAAATGGGCAGTTTGGGGAAGTATGGATGGgtatgctgagattca attactctcttattagcttcctcgtttggaaaatcccaaacatcaagatggaaggtggaaataaagatattttatgatcaggacaaac agacagtttgaattattcaacttttatttggaaaaatttggaatctctcaaagagagctagaaacaggcaagaactacagctgtctc cagttgtgctacagtgttccaacctggctcaatgttgccgtcagggaagtcaccttccatctttcctagtgcatgcatgattatggattat aaggactgttttctttattaattccctttcctgtagAGAAAGCTGATGGTTTGTGTTTTAACTTAACTGTGGTT TCATCAAGTTGTACCCCACAAACTTCTGGATTGGCTAAAGATGCTTGGGAAGTTGCACG TGACTCGTTGTTTCTGGAGAAGAAGCTGGGGCAGGGGTGTTTCGCTGAAGTGTGGCTTGgtaag (SEQ ID NO: 102). It would be generally understood that the skilled person given SEQ ID NO: 102 would know how to derive the RNA sequence of the target region (i.e. SEQ ID NO: 2).

[0139] SEQ ID NO:4, i.e. first portion of target region for mouse species (covering from start to end of the region in exon 7B within which the SSO binding sites lie): UUUCAUCAAGUUGUACCCCACAAACUUCUGGAUUGGCUAAAGAUGCUUGGGAAGUU GCACGUGACUCGUUGUUUCUGGAGAAGAAGCUGGGGCAGGGGUGUUUCGCUGAAG UGUGGCUUGguaag. The DNA sequence that encodes for SEQ ID NO: 4 is TTTCATCAAGTTGTACCCCACAAACTTCTGGATTGGCTAAAGATGCTTGGGAAGTTGCA CGTGACTCGTTGTTTCTGGAGAAGAAGCTGGGGCAGGGGTGTTTCGCTGAAGTGTGGC TTGgtaag (SEQ ID NO: 104). It would be generally understood that the skilled person given SEQ ID NO: 104 would know how to derive the RNA sequence of the target region (i.e. SEQ ID NO: 4).

[0140] SEQ ID NO:6, i.e. second portion of target region for mouse species (covering from start to end of the region in exon 7A within which the SSO binding sites lie): UCACAAAGGGAUGCCAAGGCUUACCGAUCUGUCUGUCAAAACCAAAGAUGUCUGGGA AAUCCCUCGAGAAUCCCUGCAGUUGAUC. The DNA sequence that encodes for SEQ ID NO: 6 is TCACAAAGGGATGCCAAGGCTTACCGATCTGTCTGTCAAAACCAAAGATGTCTGGGAAA TCCCTCGAGAATCCCTGCAGTTGATC (SEQ ID NO: 106). It would be generally understood that the skilled person given SEQ ID NO: 106 would know how to derive the RNA sequence of the target region (i.e. SEQ ID NO: 6).

[0141] Exemplary SSOs and their sequences are shown in Table 3.SEQ Name of FynB-SSO Sequence from 5’ to 3’ID SSO (i.e. skipsNO exon 7A) orFynT-SSO(i.e. skipsexon 7B)7 h#2104B FynB-SSO CAGCAGAGACCUGCAGCUCUC8 hm#2105B FynB-SSO GUAAGCCUUGGCAUCCCUUUGUGA9 h#2106B FynB-SSO UCGAGGGAUUUCCCAGACAUCUUUGG10 m#2115B FynB-SSO GAGGGAUUUCCCAGACAUCUUUGGUUU11 hm#BSSO3 FynB-SSO GAUCAACUGCAGGGAUUCUC12 h#2107TB FynB-SSO AAACUUUCUUCCCGGUCACGCAGUCor FynT- SSO13 h#2108TB FynB-SSO GAGUCAUGUAAUAGUACAACUUGAGCCAUUUGC or FynT- SSO14 h#2109TB FynB-SSO UGCCCGUUAGGAUGACACUCAACAAAUA or FynT- SSO15 m#2116TB FynB-SSO GUUCUUGCCUGUUUCUAGCUCUCUUUGAG or FynT- SSO16 m#2117TB FynB-SSO AGACAGCUGUAGUUCUUGCCUGUUUCUor FynT- SSO17 h#2110T FynT-SSO CCAGCUUCUUCUCCAGACACAACG18 hm#2111T FynT-SSO CUUUAGCCAAUCCAGAAGUUUGUGGGGU 19 h#2112T FynT-SSO ACCAAGCCACACUUCAGCGAAACA20 h#2113T FynT-SSO AGAAGUUUGUGGGGUACAACUCGAUGC21 m#2118T FynT-SSO UCCAGAAGUUUGUGGGGUACAACUUGAUGAAA 22 m#2119T FynT-SSO CUUACCAAGCCACACUUCAGCGAA23 hm#2233T FynT-SSO AAUCCAGAAGUUUGUGGG24 hm#2234T FynT-SSO CUUUAGCCAAUCCAGAAGUUUhm#2235T FynT-SSO CAAGCAUCUUUAGCCAAhm#2233T. FynT-SSO +A*mA*mU*mC*mC*mA*mG*mA*mA*mG*mU*mU*mU*mG* 101 (2OML) mU*mG*mG*mGhm#2233T. FynT-SSO +A*mA*mU*mC*mC*mA*mG*mA*mA*mG*mU*mU*mU*mG* 201 (2OML) mU*mG*mG*+Ghm#2233T. FynT-SSO +A*+A*mU*mC*mC*mA*mG*mA*mA*mG*mU*mU*mU*mG* 202 (2OML) mU*mG*mG*mGhm#2233T. FynT-SSO +A*+A*mU*mC*mC*mA*mG*mA*mA*mG*mU*mU*mU*mG* 301 (2OML) mU*mG*mG*+Ghm#2233T. FynT-SSO +A*+A*+T*mC*mC*mA*mG*mA*mA*mG*mU*mU*mU*mG* 302 (2OML) mU*mG*mG*mGhm#2233T. FynT-SSO +A*+A*mU*mC*mC*mA*mG*mA*mA*mG*mU*mU*mU*mG* 401 (2OML) mU*mG*+G*+Ghm#2233T. FynT-SSO +A*+A*+T*mC*mC*mA*mG*mA*mA*mG*mU*mU*mU*mG* 402 (2OML) mU*mG*mG*+Ghm#2233T. FynT-SSO +A*+A*+T*mC*mC*mA*mG*mA*mA*mG*mU*mU*mU*mG* 501 (2OML) mU*mG*+G*+Ghm#2233T. FynT-SSO +A*+A*+T*mC*mC*mA*mG*mA*mA*mG*mU*mU*mU*mG* 601 (2OML) mU*+G*+G*+Ghm#2233T. FynT-SSO +A7MOErA / 7MOErT / 7MOErC / 7MOErC / 7MOErA / 7MOErG / 101 (2MOL) 7MOErA / 7MOErA / 7MOErG / 7MOErT / 7MOErT / 7MOErT / 7M OErG / 7MOErT / 7MOErG / 7MOErG / 7MOErG / hm#2233T. FynT-SSO +A7MOErA / 7MOErT / 7MOErC / 7MOErC / 7MOErA / 7MOErG / 201 (2MOL) 7MOErA / 7MOErA / 7MOErG / 7MOErT / 7MOErT / 7MOErT / 7M OErG / 7MOErT / 7MOErG / 7MOErG / *+Ghm#2233T. FynT-SSO +A*+A7MOErT / 7MOErC / 7MOErC / 7MOErA / 7MOErG / 7MO 202 (2MOL) ErA / 7MOErA / 7MOErG / 7MOErT / 7MOErT / 7MOErT / 7MOEr G / 7MOErT / 7MOErG / 7MOErG / 7MOErG / hm#2233T. FynT-SSO +A*+A7MOErT / 7MOErC / 7MOErC / 7MOErA / 7MOErG / 7MO 301 (2MOL) ErA / 7MOErA / 7MOErG / 7MOErT / 7MOErT / 7MOErT / 7MOEr G / 7MOErT / 7MOErG / 7MOErG / *+Ghm#2233T. FynT-SSO +A*+A*+T7MOErC / 7MOErC / 7MOErA / 7MOErG / 7MOErA / 7 302 (2MOL) MOErA / 7MOErG / 7MOErT / 7MOErT / 7MOErT / 7MOErG / 7MOErT / 7MOErG / 7MOErG / 7MOErG / hm#2233T. FynT-SSO +A*+A7MOErT / 7MOErC / 7MOErC / 7MOErA / 7MOErG / 7MO 401 (2MOL) ErA / 7MOErA / 7MOErG / 7MOErT / 7MOErT / 7MOErT / 7MOEr G / 7MOErT / 7MOErG / *+G*+Ghm#2233T. FynT-SSO +A*+A*+T7MOErC / 7MOErC / 7MOErA / 7MOErG / 7MOErA / 7 402 (2MOL) MOErA / 7MOErG / 7MOErT / 7MOErT / 7MOErT / 7MOErG / 7M OErT / 7MOErG / 7MOErG / *+Ghm#2233T. FynT-SSO +A*+A*+T7MOErC / 7MOErC / 7MOErA / 7MOErG / 7MOErA / 7 501 (2MOL) MOErA / 7MOErG / 7MOErT / 7MOErT / 7MOErT / 7MOErG / 7M OErT / 7MOErG / *+G*+Ghm#2233T. FynT-SSO +A*+A*+T7MOErC / 7MOErC / 7MOErA / 7MOErG / 7MOErA / 7 601 (2MOL) MOErA / 7MOErG / 7MOErT / 7MOErT / 7MOErT / 7MOErG / 7M OErT / *+G*+G*+Ghm#2234T. FynT-SSO +C*mU*mU*mU*mA*mG*mC*mC*mA*mA*mU*mC*mC*mA* 101 (2OML) mG*mA*mA*mG*mU*mU*mUhm#2234T. FynT-SSO +C*mU*mU*mU*mA*mG*mC*mC*mA*mA*mU*mC*mC*mA* 201 (2OML) mG*mA*mA*mG*mU*mU*+Thm#2234T. FynT-SSO +C*+T*mU*mU*mA*mG*mC*mC*mA*mA*mU*mC*mC*mA* 202 (2OML) mG*mA*mA*mG*mU*mU*mUhm#2234T. FynT-SSO +C*+T*mU*mU*mA*mG*mC*mC*mA*mA*mU*mC*mC*mA* 301 (2OML) mG*mA*mA*mG*mU*mU*+Thm#2234T. FynT-SSO +C*+T*+T*mU*mA*mG*mC*mC*mA*mA*mU*mC*mC*mA*m 302 (2OML) G*mA*mA*mG*mU*mU*mUhm#2234T. FynT-SSO +C*+T*mU*mU*mA*mG*mC*mC*mA*mA*mU*mC*mC*mA* 401 (2OML) mG*mA*mA*mG*mU*+T*+Thm#2234T. FynT-SSO +C*+T*+T*mU*mA*mG*mC*mC*mA*mA*mU*mC*mC*mA*m 402 (2OML) G*mA*mA*mG*mU*mU*+Thm#2234T. FynT-SSO +C*+T*+T*mU*mA*mG*mC*mC*mA*mA*mU*mC*mC*mA*m 501 (2OML) G*mA*mA*mG*mU*+T*+Thm#2234T. FynT-SSO +C*+T*+T*mU*mA*mG*mC*mC*mA*mA*mU*mC*mC*mA*m 601 (2OML) G*mA*mA*mG*+T*+T*+Thm#2234T. FynT-SSO +C7MOErT / 7MOErT / 7MOErT / 7MOErA / 7MOErG / 7MOErC / 101 (2MOL) 7MOErC / 7MOErA / 7MOErA / 7MOErT / 7MOErC / 7MOErC / 7M OErA / 7MOErG / 7MOErA / 7MOErA / 7MOErG / 7MOErT / 7MOE rT / 7MOErT / hm#2234T. FynT-SSO +C7MOErT / 7MOErT / 7MOErT / 7MOErA / 7MOErG / 7MOErC / 201 (2MOL) 7MOErC / 7MOErA / 7MOErA / 7MOErT / 7MOErC / 7MOErC / 7M OErA / 7MOErG / 7MOErA / 7MOErA / 7MOErG / 7MOErT / 7MOE rT / *+Thm#2234T. FynT-SSO +C*+T7MOErT / 7MOErT / 7MOErA / 7MOErG / 7MOErC / 7MO 202 (2MOL) ErC / 7MOErA / 7MOErA / 7MOErT / 7MOErC / 7MOErC / 7MOEr A / 7MOErG / 7MOErA / 7MOErA / 7MOErG / 7MOErT / 7MOErT / * / MOErT / hm#2234T. FynT-SSO +C*+T7MOErT / 7MOErT / 7MOErA / 7MOErG / 7MOErC / 7MO 301 (2MOL) ErC / 7MOErA / 7MOErA / 7MOErT / 7MOErC / 7MOErC / 7MOEr A / 7MOErG / 7MOErA / 7MOErA / 7MOErG / 7MOErT / 7MOErT / * +Thm#2234T. FynT-SSO +C*+T*+T7MOErT / 7MOErA / 7MOErG / 7MOErC / 7MOErC / 7 302 (2MOL) MOErA / 7MOErA / 7MOErT / 7MOErC / 7MOErC / 7MOErA / 7M OErG / 7MOErA / 7MOErA / 7MOErG / 7MOErT / 7MOErT / 7MOE rT / hm#2234T. FynT-SSO +C*+T7MOErT / 7MOErT / 7MOErA / 7MOErG / 7MOErC / 7MO 401 (2MOL) ErC / 7MOErA / 7MOErA / 7MOErT / 7MOErC / 7MOErC / 7MOEr A / 7MOErG / 7MOErA / 7MOErA / 7MOErG / 7MOErT / *+T*+T hm#2234T. FynT-SSO +C*+T*+T7MOErT / 7MOErA / 7MOErG / 7MOErC / 7MOErC / 7 402 (2MOL) MOErA / 7MOErA / 7MOErT / 7MOErC / 7MOErC / 7MOErA / 7M OErG / 7MOErA / 7MOErA / 7MOErG / 7MOErT / 7MOErT / *+T hm#2234T. FynT-SSO +C*+T*+T7MOErT / 7MOErA / 7MOErG / 7MOErC / 7MOErC / 7 501 (2MOL) MOErA / 7MOErA / 7MOErT / 7MOErC / 7MOErC / 7MOErA / 7M OErG / 7MOErA / 7MOErA / 7MOErG / 7MOErT / *+T*+T hm#2234T. FynT-SSO +C*+T*+T7MOErT / 7MOErA / 7MOErG / 7MOErC / 7MOErC / 7 601 (2MOL) MOErA / 7MOErA / 7MOErT / 7MOErC / 7MOErC / 7MOErA / 7M OErG / 7MOErA / 7MOErA / 7MOErG / *+T*+T*+T hm#2235T. FynT-SSO +C*mA*mA*mG*mC*mA*mU*mC*mU*mU*mU*mA*mG*mC* 101 (2OML) mC*mA*mAhm#2235T. FynT-SSO +C*mA*mA*mG*mC*mA*mU*mC*mU*mU*mU*mA*mG*mC* 201 (2OML) mC*mA*+Ahm#2235T. FynT-SSO +C*+A*mA*mG*mC*mA*mU*mC*mU*mU*mU*mA*mG*mC* 202 (2OML) mC*mA*mAhm#2235T. FynT-SSO +C*+A*mA*mG*mC*mA*mU*mC*mU*mU*mU*mA*mG*mC* 301 (2OML) mC*mA*+Ahm#2235T. FynT-SSO +C*+A*+A*mG*mC*mA*mU*mC*mU*mU*mU*mA*mG*mC* 302 (2OML) mC*mA*mAhm#2235T. FynT-SSO +C*+A*mA*mG*mC*mA*mU*mC*mU*mU*mU*mA*mG*mC* 401 (2OML) mC*+A*+Ahm#2235T. FynT-SSO +C*+A*+A*mG*mC*mA*mU*mC*mU*mU*mU*mA*mG*mC* 402 (2OML) mC*mA*+Ahm#2235T. FynT-SSO +C*+A*+A*mG*mC*mA*mU*mC*mU*mU*mU*mA*mG*mC* 501 (2OML) mC*+A*+Ahm#2235T. FynT-SSO +C*+A*+A*mG*mC*mA*mU*mC*mU*mU*mU*mA*mG*mC*+ 601 (2OML) C*+A*+Ahm#2235T. FynT-SSO +C7MOErA / 7MOErA / 7MOErG / 7MOErC / 7MOErA / 7MOErT / 101 (2MOL) 7MOErC / 7MOErT / 7MOErT / 7MOErT / 7MOErA / 7MOErG / 7M OErC / 7MOErC / 7MOErA / 7MOErA / hm#2235T. FynT-SSO +C7MOErA / 7MOErA / 7MOErG / 7MOErC / 7MOErA / 7MOErT / 201 (2MOL) 7MOErC / 7MOErT / 7MOErT / 7MOErT / 7MOErA / 7MOErG / 7M OErC / 7MOErC / 7MOErA / *+Ahm#2235T. FynT-SSO +C*+A7MOErA / 7MOErG / 7MOErC / 7MOErA / 7MOErT / 7MO 202 (2MOL) ErC / 7MOErT / 7MOErT / 7MOErT / 7MOErA / 7MOErG / 7MOEr C / 7MOErC / 7MOErA / 7MOErA / hm#2235T. FynT-SSO +C*+A7MOErA / 7MOErG / 7MOErC / 7MOErA / 7MOErT / 7MO 301 (2MOL) ErC / 7MOErT / 7MOErT / 7MOErT / 7MOErA / 7MOErG / 7MOEr C / 7MOErC / 7MOErA / *+Ahm#2235T. FynT-SSO +C*+A*+A7MOErG / 7MOErC / 7MOErA / 7MOErT / 7MOErC / 7 302 (2MOL) MOErT / 7MOErT / 7MOErT / 7MOErA / 7MOErG / 7MOErC / 7MO ErC / 7MOErA / 7MOErA / hm#2235T. FynT-SSO +C*+A7MOErA / 7MOErG / 7MOErC / 7MOErA / 7MOErT / 7MO 401 (2MOL) ErC / 7MOErT / 7MOErT / 7MOErT / 7MOErA / 7MOErG / 7MOEr C / 7MOErC / *+A*+Ahm#2235T. FynT-SSO +C*+A*+A7MOErG / 7MOErC / 7MOErA / 7MOErT / 7MOErC / 7 402 (2MOL) MOErT / 7MOErT / 7MOErT / 7MOErA / 7MOErG / 7MOErC / 7MOErC / 7MOErA / *+A78 hm#2235T. FynT-SSO +C*+A*+A7MOErG / 7MOErC / 7MOErA / 7MOErT / 7MOErC / 7 501 (2MOL) MOErT / 7MOErT / 7MOErT / 7MOErA / 7MOErG / 7MOErC / 7MO ErC / *+A*+A79 hm#2235T. FynT-SSO +C*+A*+A7MOErG / 7MOErC / 7MOErA / 7MOErT / 7MOErC / 7 601 (2MOL) MOErT / 7MOErT / 7MOErT / 7MOErA / 7MOErG / 7MOErC / *+C*+A*+ATable 3. SSOs of the present disclosure

[0142] Nucleotides with a 2-O-Methyl RNA (2’OMe) are indicated with,:m”. Nucleotides with a 2-O-methoxyethyl (2’MOE) RNA are indicated with 7MOEr / ”. 2’MOE~modified thymidine is used in place of 2‘MOE-modified uridine. Nucleotides with a locked nucleic acid (LNA) are indicated with “A". LNA-modified thymidine is used in place of LNA-modified uridine. Nucleotides joined by a phosphorothioate (PS) bond to the following nucleotide are indicated with It would be generally known to the person skilled in the art that the number of phosphorothioate bonds is one less than the number of bases.indicates that the SSO is modified with S'-O-methyi RNA. “2MOE” indicates that the SSO is modified with 2‘-O- methoxyethyl RNA. “2OML” indicates that the SSO includes 2-O-methyl RNA and locked nucleic acid modifications. “2MOL" indicates that the SSO includes 2’-O-methoxyethyi RNA and locked nucleic acid modifications.

[0143] While embodiments of the invention have been particularly shown and described with reference to specific embodiments, it should be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the scope of the invention as defined by the appended claims. The scope of the invention is thus indicated by the appended claims and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced.

Claims

CLAIMS1. A splice-switching oligonucleotide (SSO) that binds to a site within a target region present on a pre-m RNA transcript of a Fyn gene, the target region having at least 75% sequence identity to SEQ ID NO: 1, wherein binding of the SSO induces the exclusion of an exon from a mature mRNA transcript of the Fyn gene, and wherein the exon to be excluded is selected from the group consisting of exon 7B and exon 7A.

2. The SSO according to claim 1, wherein the target region comprises the sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2.

3. The SSO according to claim 1 or 2, wherein the SSO binding site is located within a first portion of the target region, the first portion having the sequence selected from the group consisting of SEQ ID NO: 3 and SEQ ID NO: 4, wherein binding of the SSO within the first portion induces the exclusion of exon 7B from the mature mRNA transcript of the Fyn gene to reduce the expression of a FynT isoform of Fyn.

4. The SSO according to any one of claims 1 to 3, wherein the SSO comprises a sequence selected from the group consisting of SEQ ID NOs 17 to 79.

5. The SSO according to claim 1 or 2, wherein the SSO binding site is located within a second portion of the target region, the second portion having the sequence selected from the group consisting of SEQ ID NO: 5 and SEQ ID NO: 6, wherein binding of the SSO within the second portion induces the exclusion of exon 7A from the mature mRNA transcript of the Fyn gene to reduce the expression of a FynB isoform of Fyn.

6. The SSO according to any one of claims 1, 2 or 5, wherein the SSO comprises a sequence selected from the group consisting of SEQ ID NOs 7 to 11.

7. The SSO according to any one of claims 1 to 6, wherein the SSO is between 17 and 33 nucleotides in length.

8. An SSO according to any one of claims 1 to 7 for use in treating a tauopathy.

9. Use of an SSO according to any one of claims 1 to 7 in the manufacture of a medicament for treating a tauopathy.

10. A method of treating a tauopathy comprising administering to a subject a composition comprising an SSO according to any one of claims 1 to 7.

11. The SSO according to claim 8, the use according to claim 9 or the method according to claim 10, wherein the tauopathy is Alzheimer’s disease.

12. A pharmaceutical composition comprising (a) a therapeutically effective amount of an SSO according to any one of claims 1 to 7 and (b) one or more pharmaceutically acceptable carriers and / or diluents.

13. A method of exon-skipping comprising providing a splice-switching oligonucleotide (SSO) that binds to a site within a target region present on a pre-mRNA transcript of a Fyn gene, the target region having at least 75% sequence identity to SEQ ID NO: 1, wherein the binding of the SSO induces the exclusion of an exon from a mature mRNA transcript of the Fyn gene, and wherein the exon to be excluded is selected from the group consisting of exon 7B and exon 7A.

14. The method according to claim 13, wherein the target region comprises the sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2.

15. The method according to claim 13 or 14, comprising providing an SSO having a binding site located within a first portion of the target region, the first portion having the sequence selected from the group consisting of SEQ ID NO: 3 and SEQ ID NO: 4, wherein binding of the SSO within the first portion induces the exclusion of exon 7B from the mature mRNA transcript of the Fyn gene to reduce the expression of a FynT isoform of Fyn.

16. The method according to any one of claims 13 to 15, comprising providing an SSO comprising a sequence selected from the group consisting of SEQ ID NOs 17 to 79.

17. The method according to claim 13 or 14, comprising providing an SSO having a binding site located within a second portion of the target region, the second portion having the sequence selected from the group consisting of SEQ ID NO: 5 and SEQ ID NO: 6, wherein binding of the SSO within the second portion induces the exclusion of exon 7A from the mature mRNA transcript of the Fyn gene to reduce the expression of a FynB isoform of Fyn.

18. The method according to any one of claims 13, 14 or 17, comprising providing an SSO comprising a sequence selected from the group consisting of SEQ ID NOs 7 to 11.

19. The method according to any one of claims 13 to 18, comprising providing an SSO that is between 17 and 33 nucleotides in length.

Images