Lipid nanoparticles for enhancing tumor immunity and methods of use thereof

Abstract

Provided are compositions comprising lipid nanoparticle formulations (LNPs) and methods of use thereof for treating cancer or enhancing antitumor immunity. The compositions comprise chemotherapeutic-derived ionizable lipids that induce immunogenic cell death in cancer cells and deliver mRNAs encoding FMS-like tyrosine kinase 3 ligand (Flt3L) and / or CD40 ligand (CD40L) to promote dendritic cell mobilization and activation. Methods of treating cancer using the compositions, optionally in combination with checkpoint inhibitors, are also provided.

Description

[0001] Docket No. 084284.00357

[0002] LIPID NANOPARTICLES FOR ENHANCING TUMOR IMMUNITY AND METHODS OF USE THEREOF

[0003] REFERENCE TO SEQUENCE LISTING

[0004] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled SeqListing_084284.00357.xml, created on March 10, 2026, which is 4,761 bytes in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

[0005] CROSS-REFERENCE TO RELATED APPLICATIONS

[0006] This application claims priority under 35 U.S.C. §119(e) to U.S. Provisional Patent Application No. 63 / 776,378, filed March 24, 2025. The foregoing application is incorporated by reference herein in its entirety.

[0007] FIELD OF THE INVENTION

[0008] This disclosure relates generally to lipid nanoparticle compositions for enhancing tumor immunity and methods of use thereof.

[0009] BACKGROUND OF THE INVENTION

[0010] Immunotherapies that enhance CD8+ T cell responses have shown clinical promise; however, their effectiveness in solid tumors remains limited, emphasizing the need for further improvement. Central to effective T cell-mediated antitumor activity are dendritic cells (DCs), which cross-present tumor-associated antigens (TAAs) and provide critical costimulatoiy signals. However, the immunosuppressive tumor microenvironment (TME) often hampers DC recruitment, infiltration, and maturation, limiting their functional capacity. Overcoming these barriers by boosting DC mobilization, antigen processing, and activation is a key strategy to improve T cell-driven immunity.

[0011] The FMS-like tyrosine kinase 3 ligand (Flt3L) / Flt3 axis plays a pivotal role in the differentiation, survival, and migration of DCs, particularly conventional type 1 DCs (cDCl), which are integral to initiating robust antitumor T cell responses. Recent clinical investigations demonstrated that intratumoral (i.t.) administration of Flt3L protein significantly increased cDCl

[0012] 183149425.1Docket No. 084284.00357

[0013] infiltration, thereby amplifying the efficacy of PD-1 blockade. On the other hand, the CD40 / CD40L signaling pathway is crucial for licensing DCs to mature and activate T cells. CD40 signaling triggers proinflammatory cytokine release and the upregulation of costimulatory molecules on DCs, necessary for CD8+ T cell cytotoxicity and memory formation. CD40 agonist antibodies (CD40 Ab) have shown modest efficacy alongside some high-grade toxicities, prompting evaluation of alternative delivery approaches, including i.t. administration. Immunogenic cell death (ICD), a distinct form of cell death, is characterized by releasing damage-associated molecular patterns (DAMPs) and TAAs, which can stimulate DC activation and antigen presentation. Traditional ICD inducers, such as chemotherapeutic agents and radiotherapy, have shown clinical benefits by synergizing with cancer immunotherapies. However, prior approaches have not effectively combined ICD induction with targeted delivery of DC-activating factors in a single therapeutic modality. Accordingly, there remains a need for improved compositions and methods that effectively enhance dendritic cell function and promote robust antitumor T cell responses.

[0014] SUMMARY OF THE INVENTION

[0015] In one aspect, provided are compositions comprising one or more mRNAs and a chemotherapeutic-derived ionizable lipid. In one aspect, provided is a composition comprising a lipid nanoparticle comprising: a chemotherapeutic-derived ionizable lipid containing a chemotherapeutic agent moiety, and one or more mRNAs comprising an FMS-like tyrosine kinase 3 ligand (Flt3L) mRNA and / or a CD40 ligand (CD40L) mRNA.

[0016] In one embodiment, the lipid nanoparticle comprises any one of the following structures:

[0017] CPT6

[0018]

[0019] Docket No. 084284.00357

[0020] PTXS

[0021] GEM6

[0022]

[0023] DOX6

[0024] In some embodiments, the lipid nanoparticle comprises DMG-PEG2000 or C16-pSar (polysarcosine).

[0025] In some embodiments, the lipid nanoparticle further comprises a phospholipid. In one embodiment, the phospholipid is l,2-dioleoyl-sn-glycero-3 -phosphoethanolamine (DOPE). In some embodiments, the lipid nanoparticle further comprises cholesterol. In some embodiments, the lipid nanoparticle comprises the chemotherapeutic-derived ionizable lipid, the phospholipid, the cholesterol, and a PEG- or pSar-lipid at a molar ratio of 20-80:20-50:30-60:0.75-1.5. In someDocket No. 084284.00357

[0026] embodiments, the lipid nanoparticle has a nitrogen-to-phosphate (N / P) ratio ranging from 5.4 to 9.3. In one embodiment, the lipid nanoparticle has a nitrogen-to-phosphate (N / P) ratio of about 9.3. In some embodiments, the chemotherapeutic agent moiety is derived from camptothecin (CPT), paclitaxel (PTX), gemcitabine (GEM), or doxorubicin (DOX). In some embodiments, the poly dispersity index (PDI) ranges from 0 to 0.3. In some embodiments, the lipid nanoparticle has a particle size ranging from about 100 nm to about 400 nm. In one embodiment, the lipid nanoparticle has a particle size of about 120 nm.

[0027] In some embodiments, the composition comprises GEM-derived ionizable lipid, DOPE, cholesterol, and C16-pSar at a molar ratio of 20:50:30:0.75.

[0028] In some embodiments, the composition comprises a Flt3L mRNA and a CD40L mRNA. In some embodiments, the Flt3L mRNA comprises the sequence of SEQ ID NO: 1 or comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 1. In some embodiments, the CD40L mRNA comprises the sequence of SEQ ID NO: 2 or comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 2.

[0029] In some embodiments, provided is a method of treating cancer or inducing an anti-tumor T-cell response in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the composition described herein. In one embodiment, the subject is a human. In some embodiments, the method further comprises administering a checkpoint inhibitor. In some embodiments, the checkpoint inhibitor comprises an inhibitor of PD-1, LAG3, VISTA, BTLA, TIM3, HVEM, CD27, CD28, CD137, 0X40, PDL2, GITR, SIRPa, ILT2, ILT3, ILT4, or 4-IBB. In some embodiments, the cancer is melanoma, breast cancer, lung cancer, or prostate cancer. In some embodiments, the cancer is a solid tumor or lymphoma. In one embodiment, the composition is administered via intratumoral injection or intravenous injection.

[0030] BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 shows the structures of chemotherapeutic-derived ionizable lipids.

[0031] FIGS. 2A, 2B, 2C, 2D, 2E, 2F, 2G, and 2H depict screening and optimization of chemotherapeutic-derived LNP-mRNA formulations. FIG. 2A is a graph of mRNA delivery efficacy of CPT, PTX, CEM, and DOXLNPs in B16 cells. FIG.2B is a table that depicts the first-round of optimization: LNPs formulated with four different levels of each lipid component. FIG.Docket No. 084284.00357

[0032] 2C is a graph of luminescence intensity of GEM5 LNPs’ orthogonal formulations. FIG.2D shows graphs of the impact of varying molar ratios of each lipid component in GEM5 LNPs on mRNA delivery. FIG. 2E is a table of the second-round of optimization: LNPs formulated with four different N / P ratios, along with varying PEG- and pSar-lipids. FIG. 2F is a graph of the relative luminescence intensity of predicted formulations of GEM5 LNPs. FIG. 2G is a graph of the relative luminescence intensity of LNPs in the second-round optimization. FIG. 2H is a graph of the relative luminescence intensity of LNPs to ALC-0315. Data in FIGS.2A, 2C-2D, and 2F-2H are from n = 3 biologically independent samples and are presented as mean ± s.d. Statistical significance was analyzed by two-tailed Student’ s t-test. *P < 0.05, **P < 0.01, ****p < 0.0001.

[0033] FIGS. 3A, 3B, and 3C show optimization of chemotherapeutic-derived LNP-mRNA formulations. FIG. 3A is a L16 (4)4orthogonal table. FIG. 3B is a table of the predicted formulations of GEM5 LNPs. FIG. 3C shows graphs that characterize GEM5Q7 LNP, including size, PDI, encapsulation efficiency, and zeta potential.

[0034] FIGS. 4A, 4B, 4C, 4D, 4E, 4F, 4G, and 4H illustrate chemotherapeutic-derived LNP-induced immunogenic cell death (ICD) and therapeutic effects on B16 tumor. FIG. 4A is a graph of the cytotoxicity of the FDA-approved LNPs and GEM5Q7 in B16F10 melanoma cells. FIG.

[0035] 4B is a graph of CD40L expression in B16F10 melanoma cells treated with PBS control or GEM5Q7. FIG. 4C is a graph of apoptosis induced by CD40L-GEM5Q7 in Bl 6F 10 melanoma cells. FIG. 4D is a graph of Flt3L expression induced by Flt3L-GEM5Q7 in B16F10 melanoma cells. FIG.4E is a graph of GEM5Q7-induced ICD markers in Bl 6F 10 melanoma cells, including extracellular HMGB1, extracellular ATP, and cellular surface calreticulin. FIG. 4F is a schematic illustration of the treatment regimen in a B16F10 tumor model. FIG. 4G is a graph of tumor volumes in mice inoculated with B16F10 melanoma cells. FIG. 4H is a graph of mouse survival over time following tumor inoculation; n = 5 for each group. Data in FIGS. 4A-4E are presented as mean ± s.d. Data in FIG. 4G are presented as mean ± s.e.m. Statistical significance in FIGS.

[0036] 4A-4E and 4G was analyzed by two-tailed Student’ s t-test. Statistical significance in FIG.4H was analyzed by log-rank (Mantel-Cox) test. *P < 0.05, **P < 0.01, ****p < 0.0001.

[0037] FIGS. 5A, 5B, 5C, 5D, 5E, 5F, and 5G illustrate immune cell infiltration and activation in tumor, tumor-draining lymph nodes (TDLNs), and spleen. FIG. 5A is a graph of immune cell populations in the tumor. FIG. 5B is a graph of immune cell populations in TDLNs. FIG. 5CDocket No. 084284.00357

[0038] shows graphs of immune cell populations in the spleen; n = 5 biologically independent mice. FIG.

[0039] 5D shows graphs of immune cell activation in TDLNs. FIG. 5E shows graphs of immune cell activation in the spleen. FIG. 5F shows graphs of immune cell activation in the tumor; n = 5 biologically independent mice. FIG. 5G shows graphs of liver transaminase levels in the blood after the first dose of treatment in a B16F10 tumor model; n = 5 biologically independent mice. Data are presented as mean ± s.d. and statistical significance was analyzed by two-tailed Student’s / -test. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

[0040] FIG. 6 shows the structures of chemotherapeutic-derived ionizable lipids with R6 tail and their mRNA delivery efficacy in B16 cells.

[0041] DETAILED DESCRIPTION OF THE INVENTION

[0042] This disclosure relates to compositions comprising lipid nanoparticles (LNPs) and methods of use thereof for enhancing antitumor immunity. In some embodiments, the compositions described herein are used to treat cancer (including, but not limited to melanoma, breast cancer, lung cancer, prostate cancer, solid tumors, lymphoma, etc.). Advantages of the compositions described herein include the ability to enhance dendritic cell (DC) mobilization and activation, overcome the immunosuppressive tumor microenvironment (TME), and ultimately promote robust antitumor T cell responses. In one aspect, the compositions described herein comprise LNPs that comprise a chemotherapeutic-derived ionizable lipid containing a chemotherapeutic agent moiety, and one or more mRNAs comprising an FMS-like tyrosine kinase 3 ligand (Flt3L) mRNA and / or a CD40 ligand (CD40L) mRNA.

[0043] Flt3L is broadly expressed with levels highest in stromal bone marrow (BM) cells and T lymphocytes. Flt3L is a transmembrane molecule that functions as a soluble cytokine after proteolytic release of its extracellular domain (EC). Soluble FLT3L binds FLT3 (CD135 / Flk2) to form signal-transducing homodimers. Flt3L can expand the number of type 1 conventional DCs and thereby improve cross-presentation.

[0044] CD40L (also known as TNFSF5 or CD 154) is expressed by various cell types including endothelial cells, macrophages, monocytes, DCs, and B cells. CD40L is a member of the TNF family and signals to CD40, which is a costimulatory molecule expressed on B cells, DCs, monocytes and macrophages. CD40 signaling causes proinflammatory cytokine release and upregulates costimulatory molecules on DCs.Docket No. 084284.00357

[0045] In some embodiments, the Flt3L mRNA encodes an amino acid sequence comprising residues corresponding to the extracellular domain of human Flt3L (approximately amino acids 1-181 of the mature protein). In some embodiments, the CD40L mRNA encodes an amino acid sequence comprising residues corresponding to the extracellular domain of human CD40L (approximately amino acids 47-261 of the mature protein) or full-length CD40L including the transmembrane domain.

[0046] In some embodiments, the mRNA encodes a full-length protein. In some embodiments, the mRNA encodes a functional fragment or domain of the protein. In some embodiments, the Flt3L mRNA encodes a soluble form of Flt3L comprising the extracellular domain. In some embodiments, the CD40L mRNA encodes a membrane-bound form or a soluble form of CD40L.

[0047] Without being bound by theory, the combination of Flt3L and CD40L mRNAs in the compositions described herein is believed to provide synergistic effects on antitumor immunity. Flt3L promotes the differentiation and expansion of conventional type 1 dendritic cells (cDCls), which are critical for cross-presenting tumor-associated antigens to CD8+ T cells. CD40L subsequently licenses these DCs to provide the costimulatory signals necessary for robust CD8+ T cell activation, proliferation, and cytotoxic function. This combination addresses multiple barriers in the tumor microenvironment, including deficient DC recruitment, impaired DC maturation, and insufficient T cell priming.

[0048] In one embodiment, the lipid nanoparticle comprises any one of the following structures:

[0049]

[0050] Docket No. 084284.00357

[0051] PTXS

[0052] GEM6

[0053]

[0054] DOX6

[0055] In some embodiments, the lipid nanoparticle comprises DMG-PEG2000 or C16-pSar (polysarcosine):

[0056]

[0057] Docket No. 084284.00357

[0058]

[0059] In some embodiments, the LNP further comprises a phospholipid. In some embodiments, the phospholipid is selected from a glycerophospholipid, a phosphosphingolipid, 1,2-distearoyl-sn-glycero-3 -phosphocholine (DSPC), l,2-dilinoleoyl-sn-glycero-3 -phosphocholine (DLPC), 1,2-dimyristoyl-sn-gly cero-phosphocholine (DMPC), l,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), l,2-dipalmitoyl-sn-glycero-3 -phosphocholine (DPPC), 1,2-diundecanoyl-sn-gly cero-phosphocholine (DUPC), l-palmitoyl-2-oleoyl-sn-glycero-3 -phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3 -phosphocholine (18:0 Diether PC), l-oleoyl-2 cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), l-hexadecyl-sn-glycero-3-phosphocholine (Cl 6 Lyso PC), 1, 2-dilinolenoyl-sn-glycero-3 -phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, l,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, l,2-diphytanoyl-sn-glycero-3 -phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, l,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, l,2-dilinolenoyl-sn-glycero-3 -phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3 -phosphoethanolamine, 1 ,2-didocosahexaenoyl-sn-gly cero-3 -phosphoethanolamine, l,2-dioleoyl-sn-glycero-3-phospho-rac-(l -glycerol) sodium salt (DOPG), or sphingomyelin. In some embodiments, phospholipid is l,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE). In some embodiments, the lipid nanoparticle comprises the chemotherapeutic-derived ionizable lipid, the phospholipid, the cholesterol, and a PEG- or pSar-lipid at a molar ratio of 20-80: 20-50: 30-60: 0.75-3.

[0060] In some embodiments, the LNP has a nitrogen-to-phosphate (N / P) ratio ranging from 5.4 to 9.3, such as 5.4, 6.7, 8.0, 9.3, or any value therebetween or in a range of any high value and low value selected from these values. In a preferred embodiment, the lipid nanoparticle has a N / P ratio of9.3.

[0061] In some embodiments, the LNP has a particle size ranging from about 100 nm to about 400 nm, such as about 100 nm, about 200 nm, about 300 nm, about 400 nm, or any value therebetweenDocket No. 084284.00357

[0062] or in a range of any high value and low value selected from these values. In some embodiments, the lipid nanoparticle has a particle size ranging from about 100 to about 200 nm, such as about 100 nm, about 125 nm, about 150 nm, about 200 nm, or any value therebetween or in a range of any high value and low value selected from these values. In one embodiment, the LNP has a particle size of about 120 nm.

[0063] In some embodiments, the LNP has a PDI that ranges from 0 to 0.3, such as 0, 0.05, 0.1, 0.15, 0.2, 0.25, or 0.3, or any value therebetween or in a range of any high value and low value selected from these values. In a preferred embodiment, the LNP has a PDI below 0.1. PDI (poly dispersity index) is a dimensionless measure of the broadness of the particle size distribution, where a value of 0 indicates a perfectly monodisperse sample and values approaching 1 indicate increasing polydispersity.

[0064] In some embodiments, the LNP has a zeta potential ranging from about -10 mV to about +10 mV, from about -5 mV to about +5 mV, or is approximately neutral. In some embodiments, the LNP has an mRNA encapsulation efficiency of at least 70%, at least 80%, at least 85%, at least 90%, or at least 95%.

[0065] In some embodiments, the LNP exhibits pH-responsive behavior, wherein the ionizable lipid component is substantially uncharged at physiological pH (approximately pH 7.4) and becomes protonated at endosomal pH (approximately pH 5-6), thereby facilitating endosomal escape and cytoplasmic delivery of the mRNA cargo.

[0066] In some embodiments, the chemotherapeutic agent includes, but is not limited to, camptothecin, paclitaxel, gemcitabine, or doxorubicin.

[0067] In some embodiments, the chemotherapeutic agent moiety retains pharmacological activity when released from the LNP, thereby contributing to the induction of immunogenic cell death (1CD) in cancer cells. In some embodiments, the chemotherapeutic agent moiety is released from the ionizable lipid backbone through hydrolysis or enzymatic cleavage within the intracellular environment.

[0068] In some embodiments, the chemotherapeutic agent moiety is covalently attached to an ionizable lipid backbone. In some embodiments, the ionizable lipid backbone comprises one or more tertiary amine groups that are protonatable at endosomal pH (approximately pH 5-6) butDocket No. 084284.00357

[0069] remain substantially uncharged at physiological pH (approximately pH 7.4). This pH-responsive behavior facilitates endosomal escape and mRNA delivery to the cytoplasm. In preferred embodiments, the chemotherapeutic agent moiety is derived from gemcitabine (GEM), which has demonstrated superior mRNA delivery efficiency compared to camptothecin, paclitaxel, and doxorubicin-derived lipids.

[0070] In some embodiments, the composition comprises GEM-derived ionizable lipid, DOPE, cholesterol, and C16-pSar at a molar ratio of 20:50:30:0.75.

[0071] In some embodiments, the composition comprises a GEM5-derived ionizable lipid. In one embodiment, the GEM5-derived ionizable lipid has the structure shown in Scheme SI and is synthesized by condensation of a carboxylated ionizable lipid (R5) with gemcitabine. In some embodiments, the GEM5-derived ionizable lipid has a molecular weight of approximately 1238.9 Da as determined by MALDI-MS.

[0072] In one embodiment, the lipid nanoparticle is formulated using a GEM5Q7 formulation, which comprises a GEM5-derived ionizable lipid, DOPE, cholesterol, and C16-pSar at a molar ratio of 20:50:30:0.75 and an N / P ratio of 9.3. In some embodiments, the GEM5Q7 formulation exhibits a spherical morphology with a particle size of approximately 120 nm and a PDI below 0.1. In some embodiments, the GEM5Q7 formulation has an mRNA encapsulation efficiency of approximately 90% and a nearly neutral zeta potential. The structure of the GEM5-derived ionizable lipid in the GEM5Q7 formulation is:

[0073] In some embodiments, the GEM5Q7 formulation is prepared by microfluidic mixing of an aqueous phase comprising the mRNA cargo with an organic phase comprising the lipid components dissolved in ethanol. In some embodiments, the microfluidic mixing is performed at a flow rate ratio of aqueous to organic phase of approximately 3:1. In some embodiments, the resulting LNPs are dialyzed or buffer-exchanged to remove residual ethanol prior to administration.Docket No. 084284.00357

[0074]

[0075] GEM5

[0076] In some embodiments, the composition comprises a Flt3L mRNA and a CD40L mRNA. In some embodiments, the mRNA polynucleotides are modified. As used herein, the term “nucleotide” refers to a nucleoside including a phosphate group. As used herein, the term “nucleoside” refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”).

[0077] In some embodiments, the mRNA comprises one or more modified nucleosides selected from pseudouridine, N1 -methylpseudouridine, 5-methylcytidine, 5-methoxyuridine, and 2-thiouridine. In preferred embodiments, the mRNA comprises N1 -methylpseudouridine in place of uridine, which reduces innate immune recognition and enhances translation efficiency.

[0078] In some embodiments, the LNP induces immunogenic cell death (ICD) in cancer cells. As used herein, “immunogenic cell death” refers to a form of cell death characterized by the release of damage-associated molecular patterns (DAMPs), including but not limited to high mobility group box 1 (HMGB1) and adenosine triphosphate (ATP), and the translocation of calreticulin to the cell surface. In some embodiments, treatment of cancer cells with the LNP results in at least a 2-fold, at least a 3-fold, at least a 4-fold, or at least a 5-fold increase in extracellular HMGB1, extracellular ATP, or surface calreticulin expression compared to untreated cancer cells. In some embodiments, the ICD is induced by the chemotherapeutic-derived ionizable lipid component of the LNP independently of the mRNA cargo.

[0079] Modified nucleotides can be synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides. Polynucleotides can comprise a region or regions of linked nucleosides. Such regions can have variable backbone linkages. The linkages can be standard phosphodiester linkages, inDocket No. 084284.00357

[0080] which case the polynucleotides would comprise regions of nucleotides. In some embodiments, the modified polynucleotides comprise various modifications. In some embodiments, the modified polynucleotides contain one, two, or more (optionally different) nucleoside or nucleotide modifications. In some embodiments, a naturally-occurring modified nucleotide or nucleoside is one that is generally known or recognized in the art. Non-limiting examples of such non-naturally occurring modified nucleotides and nucleosides can be found, inter alia, in published International Patent Application Nos. PCT / US2012 / 058519; PCT / US2013 / 075177; PCT / US2014 / 058897; PCI7US2014 / 058891; PCT / US2014 / 070413; PCT / US2015 / 36773; PCT / US2015 / 36759; PCT / US2015 / 36771; or PCT / IB2017 / 051367, each of which is incorporated by reference herein in its entirety.

[0081] In some embodiments, the mRNA comprises a 5' cap structure, such as CapO, Capl, or Cap2. In some embodiments, the mRNA comprises a 5' untranslated region (5' UTR) and a 3' untranslated region (31UTR). In some embodiments, the mRNA comprises a poly(A) tail of at least 50, at least 100, at least 120, or at least 150 adenosine residues.

[0082] In some embodiments, the composition comprises a human Flt3L mRNA and a human CD40L mRNA. In one embodiment, the Flt3L mRNA comprises the sequence of SEQ ID NO: 1. In some embodiments, the Flt3L mRNA comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 1 such as at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or any value therebetween.

[0083] SEQ ID NO: 1 (Flt3L mRNA):

[0084] AUGACCGUACUUGCACCAGCAUGGUCCCCUACUACUUACCUUUUGUUGUUGCUCC UCCUGUCCUCUGGCCUCUCUGGCACCCAGGACUGCAGCUUCCAGCAUAGUCCGAU AUCGUCGGACUUUGCUGUGAAGAUCCGCGAGUUGUCGGACUACCUGUUACAGGA CUAUCCUGUGACGGUAGCCAGCAACUUGCAGGACGAGGAGUUGUGCGGGGGGCU UUGGCGCCUCGUGCUGGCUCAGAGGUGGAUGGAGCGGCUGAAGACUGUGGCUGG AUCGAAGAUGCAGGGGCUGCUGGAGAGGGUGAACACGGAGAUACACUUCGUGAC GAAGUGUGCUUUCCAGCCACCCCCCAGCUGCCUGCGCUUCGUCCAGACCAACAUC UCUCGGCUGCUCCAGGAGACCUCUGAGCAGCUCGUGGCGCUAAAGCCCUGGAUCA CCCGCCAGAACUUCUCGCGGUGUUUGGAGCUCCAGUGUCAACCCGAUUCGAGCAC ACUUCCGCCUGAUAAGACACACACAUGUCCACCAUGUCCAGCUCCGCCGGUGGCU GGUCCGAGCGUGUUCUUGUUUCCCCCGAAGCCCAAGGACACGCUCAUGAUCAGCC GCACGCCGGAGGUGACAUGCGUGGUCGUGGAUGUGUCUCAUGAGGACCCGGAAG UGAAGUUCAAUUGGUACGUUGACGGCGUGGAGGUCCACAACGCCAAGACGAAGC CCCGUGAGGAGCAGUACGGCUCGACCUAUCGAGUCGUAUCGGUCCUCACGGUGCU UCAUCAGGACUGGCUGAACGGCAAGGAGUACAAAUGCAAGGUCUCGAACAAGGCDocket No. 084284.00357

[0085] UCUCCCUGCGCCUAUCGAGAAGACCAUCUCGAAGGCGAAGGGACAGCCUCGAGAG CCGCAGGUGUACACCUUGCCGCCCAGCCGGGAAGAGAUGACCAAGAACCAGGUCU CUCUCACCUGCCUUGUCAAGGGCUUCUACCCCAGCGACAUCGCUGUGGAGUGGGA GUCCAACGGUCAGCCGGAGAACAAUUAUAAGACGACCCCUCCGGUCCUCGACUCG GACGGGUCGUUUUUUUUGUACUCCAAGCUGACCGUUGACAAGAGCAGGUGGCAG CAGGGGAAUGUUUUCUCCUGCUCGGUUAUGCACGAGGCGUUGCAUAACCACUACA CUCAGAAGUCCCUGAGUCUGAGUCCUGGGAAGUAG

[0086] In one embodiment, the CD40L mRNA comprises the sequence of SEQ ID NO: 2. In some embodiments, the CD40L mRNA comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 2 such as at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or any value therebetween.

[0087] SEQ ID NO: 2 (CD40L mRNA):

[0088] AUGAUAGAAACAUACAGCCAACCUUCCCCCAGAUCCGUGGCAACUGGACUUCCAG CGAGCAUGAAGAUUUUUAUGUAUUUACUUACUGUUUUCCUUAUCACCCAAAUGA UUGGAUCUGUGCUUUUUGCUGUGUAUCUUCAUAGAAGAUUGGAUAAGGUCGAAG AGGAAGUAAACCUUCAUGAAGAUUUUGUAUUCAUAAAAAAGCUAAAGAGAUGCA ACAAAGGAGAAGGAUCUUUAUCCUUGCUGAACUGUGAGGAGAUGAGAAGGCAAU UUGAAGACCUUGUCAAGGAUAUAACGUUAAACAAAGAAGAGAAAAAAGAAAACA GCUUUGAAAUGCAAAGAGGUGAUGAGGAUCCUCAAAUUGCAGCACACGUUGUAA GCGAAGCCAACAGUAAUGCAGCAUCCGUUCUACAGUGGGCCAAGAAAGGAUAUU AUACCAUGAAAAGCAACUUGGUAAUGCUUGAAAAUGGGAAACAGCUGACGGUUA AAAGAGAAGGACUCUAUUAUGUCUACACUCAAGUCACCUUCUGCUCUAAUCGGG AGCCUUCGAGUCAACGCCCAUUCAUCGUCGGCCUCUGGCUGAAGCCCAGCAGUGG AUCUGAGAGAAUCUUACUCAAGGCGGCAAAUACCCACAGUUCCUCCCAGCUUUGC GAGCAGCAGUCUGUUCACUUGGGCGGAGUGUUUGAAUUACAAGCUGGUGCUUCU GUGUUUGUCAACGUGACUGAAGCAAGCCAAGUGAUCCACAGAGUUGGCUUCUCA UCUUUUGGCUUACUCAAACUCUGA

[0089] In some embodiments, the compositions described herein are administered to the subject at least once every day. In some embodiments, the composition is administered to the subject at least once every week for one month, two months, three months, four months, five months, six months, seven months, eight months, nine months, ten months, eleven months, one year, or longer. In some embodiments, the compositions described herein are administered to the subject at least once a month for one month, two months, three months, four months, five months, six months, seven months, eight months, nine months, ten months, eleven months, one year, or longer. A medical professional determines the duration of time for which the composition is needed.

[0090] In some embodiments, the composition is administered at a dose of about 0.01 mg / kg to about 10 mg / kg, about 0.05 mg / kg to about 5 mg / kg, or about 0.1 mg / kg to about 1 mg / kg ofDocket No. 084284.00357

[0091] mRNA based on body weight of the subject. Tn some embodiments, for intratumoral administration, the composition is administered at a dose of about 1 pg to about TOO pg, about 1 pg to about 50 pg, or about 3 pg to about 10 pg of mRNA per injection.

[0092] In some embodiments, the compositions described herein are administered via intratumoral injection or intravenous injection. In some embodiments, the compositions described herein are administered via image-guided delivery systems.

[0093] In some embodiments, the composition is administered in combination with an imaging agent for image-guided delivery. In some embodiments, the composition is administered to a tumor that is accessible for direct injection, including but not limited to cutaneous tumors, subcutaneous tumors, tumors accessible by endoscopy, or tumors accessible by interventional radiology techniques.

[0094] In some embodiments, the compositions described herein are further administered with a checkpoint inhibitor. Checkpoint inhibitors include, but are not limited to, inhibitors of PD-1, LAG3, VISTA, BTLA, TIM3, HVEM, CD27, CD28, CD 137, 0X40, PDL2, GITR, SIRPa, ILT2, ILT3, ILT4, and 4-IBB. In some embodiments, the checkpoint inhibitors comprise an anti-PD-1 antibody or an antigen binding fragment thereof, an anti-LAG3 antibody or an antigen biding portion thereof, an anti-VISTA antibody or an antigen binding fragment thereof, an anti-BTLA antibody or an antigen binding fragment thereof, an anti-TIM3 antibody or an antigen binding fragment thereof, an anti-CTLA4 antibody or an antigen binding fragment thereof, an anti-HVEM antibody or an antigen binding fragment thereof, an anti-CD27 antibody or an antigen binding fragment thereof, an anti-CD137 antibody or an antigen binding fragment thereof, an anti-OX40 antibody or an antigen binding fragment thereof, an anti-CD28 antibody or an antigen binding fragment thereof, an anti-PDLl antibody or an antigen binding fragment thereof, an anti-PDL2 antibody or an antigen binding fragment thereof, an anti-GITR antibody or an antigen binding fragment thereof, an anti-ICOS antibody or an antigen binding fragment thereof, an anti-SIRPa antibody or an antigen binding fragment thereof, an anti-ILT2 antibody or an antigen binding fragment thereof, an anti-ILT3 antibody or an antigen binding fragment thereof, an anti-ILT4 antibody or an antigen binding fragment thereof, an anti-ILT5 antibody or an antigen binding fragment thereof, and an anti -4-IBB antibody or an antigen binding fragment thereof.Docket No. 084284.00357

[0095] In some embodiments, the compositions described herein, when administered to a subject having cancer, result in increased infiltration of immune cells into the tumor microenvironment. In some embodiments, the immune cells comprise macrophages, conventional type 1 dendritic cells (cDCls), conventional type 2 dendritic cells (cDC2s), CD8+ T cells, and / or CD4+ T cells. In some embodiments, administration of the composition results in increased expression of activation markers on immune cells, including but not limited to CD80 and / or CD86 on dendritic cells; CD69, IFN-y, TNF-a, granzyme B, and / or Ki-67 on CD8+ T cells; and CD69, CD134, and / or 0X40 on CD4+ T cells. In some embodiments, administration of the composition results in increased levels of cytokines and chemokines in the tumor and / or blood, including but not limited to IL-1, TNF-a, IFN-y, and / or CXCL10.

[0096] In some embodiments, provided is a method of treating cancer or inducing an anti-tumor T-cell response in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the composition described herein. In some embodiments, the method results in tumor regression, tumor growth inhibition, or complete tumor response. In some embodiments, the method results in a complete response rate of at least 20%, at least 30%, at least 40%, or greater than 40%. In some embodiments, the method extends survival time in the subject compared to an untreated subject or a subject treated with a conventional chemotherapeutic agent alone.

[0097] In some embodiments, the composition is administered intratumorally. Without being bound by theory, intratumoral administration is believed to provide localized delivery of the composition directly to the tumor microenvironment, maximizing ICD induction and DC activation at the tumor site while minimizing systemic exposure. In some embodiments, the composition is administered every other day for a treatment course comprising 2, 3, 4, 5, or more doses. In some embodiments, a single intratumoral injection comprises about 1 pg to about 20 pg, about 3 pg to about 10 pg, or about 6 pg of mRNA encapsulated in the LNP.

[0098] As used herein, the term “enhanced” or “enhances” refers to an increase in antitumor immunity such as an increase in the immune system’s ability to eliminate cancer cells.

[0099] As used herein, the term “cancer” shall be given its ordinary meaning, as a general term for diseases in which abnormal cells divide without control.Docket No. 084284.00357

[0100] As used herein, the term “treating” or “treatment” of any disease or disorder refers, in one embodiment, to ameliorating cancer (i.e., arresting or reducing the development of cancer or at least one of the clinical symptoms thereof). In another embodiment, “treating” or “treatment” refers to ameliorating at least one physical parameter, which may not be discernible by the subject. In yet another embodiment, “treating” or “treatment” refers to modulating the cancer, either physically, (e.g., stabilization of a discernible symptom), physiologically, (e.g., stabilization of a physical parameter), or both. In yet another embodiment, “treating” or “treatment” refers to preventing or delaying the onset or development or progression of cancer.

[0101] As used herein, the term “tumor regression” refers to a decrease in tumor size, volume, or mass following treatment as compared to before treatment or as compared to an untreated control. Tumor regression may be partial (a reduction but not elimination of detectable tumor) or complete (no detectable tumor remaining).

[0102] As used herein, the term “complete response” or “complete tumor response” refers to the disappearance of all detectable tumor in a subject following treatment. As used herein, the term “tumor regression” refers to a reduction in tumor volume or size following treatment compared to tumor volume or size prior to treatment or compared to an untreated control.

[0103] As used herein, the term “antitumor immunity” refers to innate and adaptive immune responses, which lead to tumor control.

[0104] As used herein, the term “immunogenic cell death” or “ICD” refers to a form of cell death that stimulates an immune response against dead-cell antigens. ICD is characterized by the release or exposure of damage-associated molecular patterns (DAMPs), including but not limited to high mobility group box 1 (HMGB1), adenosine triphosphate (ATP), and cell surface calreticulin, which promote dendritic cell activation and antigen presentation.

[0105] As used herein, the term “therapeutically effective amount” refers to an amount of the composition that is sufficient to achieve a desired therapeutic effect in a subject, such as tumor regression, tumor growth inhibition, increased survival time, or induction of an anti-tumor T-cell response. A therapeutically effective amount may vary depending on factors including the type and stage of cancer, the route of administration, the subject’s age and weight, and the subject's overall health status. In some embodiments, a therapeutically effective amount comprises about 1 pg to about 50 pg, about 1 pg to about 20 pg, or about 3 pg to about 10 pg of mRNA per dose.Docket No. 084284.00357

[0106] As used herein, the term “conventional type 1 dendritic cell” or“cDCl” refers to a dendritic cell subset characterized by expression of CD103 (in mice) or CD141 / BDCA-3 (in humans) and specialized for cross-presentation of antigens to CD8+ T cells. As used herein, the term “conventional type 2 dendritic cell” or “cDC2” refers to a dendritic cell subset characterized by expression of CD1 lb and specialized for presentation of antigens to CD4+ T cells. As used herein, the term “cross-presentation” refers to the presentation of exogenous antigens on MHC class I molecules to CD8+ T cells.

[0107] As used herein, the term “subject” refers to a mammal. The term “mammal” as used herein is intended to include, but is not limited to, humans, laboratory animals, domestic pets, and farm animals. Mammals, include, but are not limited to, a human or non-human mammal, such as a canine, bovine, equine, ovine, orfeline, etc. Individuals and patients are also subjects herein.

[0108] As used herein, the term “ionizable lipid” refers to a lipid that has a pKa such that it is substantially uncharged at physiological pH (approximately pH 7.4) but becomes protonated and positively charged at acidic pH (such as endosomal pH of approximately pH 5-6). The pH-responsive behavior of ionizable lipids facilitates endosomal escape of the LNP cargo following cellular uptake.

[0109] As used herein, the term “molar ratio” when describing lipid components refers to the relative number of moles of each lipid component in the lipid nanoparticle formulation. For example, a molar ratio of 20:50:30:0.75 for ionizable lipid:phospholipid:cholesterol:PEG-lipid indicates that for every 20 moles of ionizable lipid, there are 50 moles of phospholipid, 30 moles of cholesterol, and 0.75 moles of PEG-lipid.

[0110] As used herein, the term “lipid nanoparticle” or “LNP” refers to a particle having at least one dimension on the order of nanometers (e.g., 1-1000 nm) that comprises one or more lipids. In some embodiments, the LNP is included in a formulation that includes one or more lipids selected from cationic or ionizable lipids, anionic lipids, neutral lipids, amphipathic lipids, PEG-modified lipids, pSar-modified lipids, and sterols.

[0111] As used herein and in the appended claims, the singular forms “a,” “and” and “the” include plural references unless the context clearly dictates otherwise.Docket No. 084284.00357

[0112] As used herein, the terms “including,” “comprising,” “containing,” or “having” and variations thereof are meant to encompass the items listed thereafter and equivalents thereof as well as additional subject matter unless otherwise noted.

[0113] As used herein, the phrases “in one embodiment,” “in various embodiments,” “in some embodiments,” and the like are used repeatedly. Such phrases do not necessarily refer to the same embodiment, but they may unless the context dictates otherwise.

[0114] As used herein, the terms “and / or”

[0115]

[0116] or means any one of the items, any combination of the items, or all of the items with which this term is associated.

[0117] As used herein, the term “each,” when used in reference to a collection of items, is intended to identify an individual item in the collection but does not necessarily refer to every item in the collection. Exceptions can occur if explicit disclosure or context clearly dictates otherwise. All publications mentioned herein are incorporated herein by reference in their entireties.

[0118] As used herein, the term “about” when used in connection with a numerical value means within 10% of the stated value, unless otherwise indicated or apparent from the context.

[0119] As used herein, the term “checkpoint inhibitor” refers to a molecule that inhibits an immune checkpoint protein or pathway. Immune checkpoint proteins include, but are not limited to, PD-1, PD-L1, PD-L2, CTLA-4, LAG3, TIM3, VISTA, BTLA, TIGIT, and B7-H3. Checkpoint inhibitors include antibodies, small molecules, peptides, and nucleic acids that block the interaction between checkpoint proteins and their ligands or that otherwise inhibit checkpoint signaling.

[0120] The following examples serve to further illustrate the methods of the present disclosure. It will be understood by those skilled in the art that the specific embodiments described in the Examples below are provided to enable practice of the claimed invention and are not intended to limit the scope of the claims. Variations on the specific protocols, cell lines, animal models, dosages, and other parameters described herein are within the skill of the ordinary artisan and are encompassed by the claims.

[0121] EXAMPLES

[0122] Example 1. Materials and Methods.

[0123] This Example describes the materials and methods used in Examples 2 and 3.Docket No. 084284.00357

[0124] Cell culture and antibodies

[0125] The Bl 6F 10 cell line was purchased from the American Type Culture Collection (ATCC) and cultured in DMEM supplemented with 10% FBS. Antibodies for CD40L, CD80, CD86, MHC II, calreticulin, Ki-67, Granzyme B, IFN-y, TNF-a, CD11c, CD45, F4 / 80, Ly-6C, CD103, CD1 lb, CD3e, CD69, CD134, CD4, and CD8a were obtained from Invitrogen, Proteintech, BD Biosciences, and BioLegend.

[0126] mRNA synthesis

[0127] Double-stranded DNA (dsDNA) encoding firefly luciferase (FLuc), mouse CD40L, and human Flt3L was obtained from Integrated DNA Technologies. Corresponding mRNAs were synthesized via in vitro transcription as previously described (Zeng C et al. Adv Mater.

[0128] 2020;32(40):e2004452; Zhao W etal. Adv Mater. 2021;33(45):e2103131).

[0129] Lipid nanoparticle (LNP) preparation and characterization

[0130] The lipid components in LNPs included chemotherapeutic-derived ionizable lipids, cholesterol, DOPE, and either DMG-PEG2000 or polysarcosine lipids. The LNP -mRNA formulations were assembled using a microfluidic mixing system (Micro&Nano) (Xu S et al. Adv Mater. 2024:e2400307; Zhu Y et al. Nat Biomed Eng. 2024;8(5):544-60; Hou X et al. Nat Nanotechnol. 2020;15(l):41-6). Particle size, poly dispersity index (PDI), and zeta potential were measured using a NanoZS Zetasizer (Malvern). Encapsulation efficiency was determined via the Ribogreen assay, and morphology was visualized using a Glacios Cryo-TEM (Thermo Scientific). Lipofectamine 3000 / mRNA complexes were prepared following the manufacturer's protocol (Thermo Fisher, L3000015). mRNA delivery efficiency was assessed by luciferase assay, using a BioTek Cytation 5 plate reader.

[0131] Synthesis of chemotherapeutic-derived ionizable lipids

[0132] All chemicals and solvents were purchased from Fisher Scientific unless otherwise listed. All chemotherapeutic-derived lipids were purified by column chromatography using a CombiFlash® Rf system with a RediSep Gold® Resolution silica column (Teledyne Isco) with gradient elution. All 'H NMR spectra were run on Bruker Avance 400 MHz instrument. Mass spectrometric measurements were performed by microFlex™ LRF MALDI-TOF mass spectrometer (Bruker).Docket No. 084284.00357

[0133] The chemotherapeutic-derived ionizable lipids were characterized by 1H NMR spectroscopy and MALDLTOF mass spectrometry to confirm structure and purity. The following data demonstrate that the claimed compounds can be synthesized and characterized by one of ordinary skill in the art.

[0134] R5 was synthesized according to previously reported procedures (Yan J et al. Adv Mater.

[0135] 2022;34(47):e2207486; Zhang Y et al. Nano Lett. 2023;23(7):2593-600). To a solution of R5 (38 mg, 38 pmol) in THF (5 mL), A'A"-Dicyclohexylcarbodiimide (9.5 mg, 46 pmol), and N,N-Di isopropyl ethyl amine (19 pl, 110 pmol) was added. The resulting mixture was kept stirring for 30 minutes at room temperature. Then GEM (10 mg, 38 pmol) and Hydroxybenzotriazole (6.7 mg, 49 pmol) were added, and the solution was stirred at room temperature overnight. The resultant mixture was added to a solution of NaHCOa (50 mL), followed by extraction using ethyl acetate. The extracted solution was concentrated and subjected to purification by Combiflash® column chromatography, utilizing a RediSep Gold Resolution silica column with a gradient elution starting from 100% CH2CI2 to CIhC MeOII / NlLOII (80 / 20 / 0.6, v / v / v) to obtain product GEM5 (8 mg, 17% yield). 'H NMR (400 MHz, MeOD) 88.38 (d, J= 7.6 Hz, 1H), 7.50 (d, J= 7.6 Hz, 1H), 6.28 (m, 1H), 4.88 -4.73 (m, 3H), 4.39 - 4.22 (m, 1H), 4.08 - 3.90 (m, 2H), 3.84 (m, 1H), 3.37 (s, 1H), 2.68 (m, 10H), 2.51 (t, J= 7.1 Hz, 2H), 2.33 (t,J= 7.2 Hz, 6H), 1.92 - 1.11 (m, 75H), 0.99 - 0.83 (m, 18H). MALDLMS for C69H125F2N5O11 ([M+H]+) calculated: 1238.9, found: 1239.0.

[0136]

[0137] Scheme SI Synthesis of GEM5

[0138] CPT lipids and PTX lipids were synthesized according to previously reported procedures (Zhang C et al. Chemotherapy drugs derived nanoparticles encapsulating mRNA encoding tumor suppressor proteins to treat triple-negative breast cancer. Nano research. 2019;12:855-61).

[0139] CPT1 (20mg, 18%): *HNMR (400 MHz, CDCh) 88.42 (s, 1H), 8.35 - 8.21 (m, 1H), 8.04 - 7.90 (m, 1H), 7.90 - 7.79 (m, 1H), 7.79 - 7.57 (m, 1H), 7.24 (s, 1H), 7.21 - 7.15 (m, 1H), 5.68 - 5.46 (d, 2H), 4.01 (s, 2H), 2.33 (d, J= 7.0 Hz, 12H), 1.94 - 1.07 (m, 59H), 1.00 (t, J= 7.5 Hz,Docket No. 084284.00357

[0140] 3H), 0.90 (t, J = 6.7 Hz, 6H). MALDI-MS for C50H75N3O5 ([M+H]+) calculated: 798.6, found: 798.6.

[0141] CPT2 (16mg, 14%); 'HNMR (400 MHz, CDCh) 88.42 (s, 1H), 8.35 - 8.21 (m, 1H), 8.04 - 7.90 (m, 1H), 7.90 - 7.79 (m, 1H), 7.79 - 7.57 (m, 1H), 7.24 (s, 1H), 7.21 - 7.15 (m, 1H), 5.68 (m, 2H), 5.46 (m, 2H), 4.63 (q, 2H), 4.01 (s, 2H), 3.55 (m 4H), 3.35 (m, 4H), 2.35 (m, 12H), 1.94 - 1.07 (m, 50H), 0.98 (t, J = 7.5 Hz, 3H), 0.88 (t, J = 6.7 Hz, 6H). MALDI-MS for C54H83N3O9 ([M+Na]+) calculated: 940.6, found: 940.5.

[0142] CPT3 (17mg, 11%): lHNMR(400MHz, CDC13) 88.44 (s, 1H), 8.41 - 8.24 (m, 1H), 8.02 - 7.94 (m, 1H), 7.94 - 7.82 (m, 1H), 7.76 (m, 2H), 7.38 (m, 1H), 5.76 (m, 2H), 4.69 (s, 6H), 4.20 - 3.91 (m, 2H), 3.69 (m, 6H), 3.63 - 3.42 (m, 12H), 1.64 (m, 60H), 1.07 (t, J = 7.5 Hz, 3H), 0.91 (t, J = 6.7 Hz, 6H). MALDI-MS for C68H112N4O11 ([M+Na]+) calculated: 1183.8, found: 1184.0.

[0143] CPT4 (15mg, 10%): 1H NMR (400 MHz, CDC13) 8 8.47 - 8.30 (s, 1H), 8.30 - 8.21 (m, 1H), 8.03 - 7.92 (m, 1H), 7.92 - 7.83 (m, 1H), 7.71 (s, 1H), 7.44 - 7.34 (m, 1H), 5.88 - 5.70 (d, 1H), 4.69 (q, 3H), 4.14 (m, 4H), 3.63 (m, 12H), 3.43 (m, 6H), 2.19 - 1.15 (m, 67H), 1.07 (t, J = 7.5 Hz, 3H), 0.90 (t, I = 6.7 Hz, 6H). MALDI-MS for C71H118N4O11 ([M+H]+) calculated: 1203.9, found: 1203.6.

[0144] CPT5 (20mg, 24%) 1H NMR (400 MHz, CDC13) 8 8.43 (s, 1H), 8.24 (d, I = 8.4 Hz, 1H), 7.97 (d, J = 8.1 Hz, 1H), 7.86 (s, 1H), 7.70 (d, J = 6.6 Hz, 1H), 7.23 (s, 1H), 5.70 (d, J = 17.3 Hz, 2H), 5.43 (d, J = 17.2 Hz, 1H), 4.81 (m, 3H), 2.98 - 2.23 (m, 24H), 2.21 - 2.07 (m, 2H), 1.84 -1.11 (m, 99H), 0.99 (t, J = 7.4 Hz, 3H), 0.89 (t, J = 6.8 Hz, 18H). MALDI-MS for C80H130N4011 ([M+H]+) calculated: 1324.0, found: 1324.0.

[0145] PTX1 (21mg, 31%) 1HNMR (400 MHz, CDC13) 8 8.14 (d, J = 7.7 Hz, 2H), 7.76 (d, J = 6.4 Hz, 2H), 7.62 (t, J = 6.8 Hz, 1H), 7.51 (m, 3H), 7.27 (t, J = 21.9 Hz, 2H), 6.27 (d, J = 12.7 Hz, 1H), 6.23 (s, 1H), 6.02 - 5.85 (m, 1H), 5.67 (d, J = 6.6 Hz, 1H), 5.51 (d, J = 3.0 Hz, 1H), 5.12 -4.88 (m, 1H), 4.43 (d, J = 6.9 Hz, 1H), 4.31 (d, 1 = 8.3 Hz, 1H), 4.19 (d, J = 8.2 Hz, 1H), 3.81 (d, J = 6.5 Hz, 1H), 3.44 (s, 1H), 2.65 - 2.28 (m, 12H), 2.28 - 2.16 (m, 2H), 2.04 - 1.74 (m, 6H), 1.74 - 1.54 (m, 4H), 1.52 - 1.18 (m, 47H), 1.13 (t, J = 7.5 Hz, 3H), 0.87 (d, J = 6.9 Hz, 6H). MALDI-MS for C77H110N2015 ([M+H]+) calculated: 1303.8, found: 1303.8.Docket No. 084284.00357

[0146] PTX2 (25mg, 35%): 1HNMR (400 MHz, CDC13) 88.13 (d, J = 7.2 Hz, 1H), 7.84 (d, J = 6.0 Hz, 1H), 7.62 (d, J = 6.8 Hz, 1H), 7.48 (m, 3H), 6.29 (s, 1H), 6.15 (s, 1H), 6.05 - 5.85 (m, 1H), 5.67 (d, J = 6.2 Hz, 1H), 5.54 (s, 1H), 4.97 (d, J = 9.2 Hz, 1H), 4.68 (q, 2H), 4.43 (s, 1H), 4.30 (d, J = 8.1 Hz, 1H), 4.20 (d, J = 8.0 Hz, 1H), 3.78 (d, J = 5.8 Hz, 1H), 3.67 (s, 2H), 3.56 (m, 4H), 3.40 (m, 4H), 2.76 - 2.50 (m, 8H), 2.42 (m, 4H), 2.36 - 2.26 (m, 2H), 2.22 (s, 3H), 1.98 - 1.06 (m, 57H), 0.89 (t, J = 6.9 Hz, 6H). MALDI-MS for C81H118N2O19 ([M+H]+) calculated: 1423.8, found: 1423.9.

[0147] PTX3 (28 mg, 37%): 1HNMR (400 MHz, CDC13) 88.14 (d, J = 6.4 Hz, 1H), 8.06 - 7.87 (m, 1H), 7.76 - 7.64 (m, 1H), 7.55 (m, 3H), 7.42 (d, J = 6.8 Hz, 2H), 6.38 - 6.21 (m, 1H), 6.21 -6.00 (tn, 1H), 6.00 - 5.77 (m, 1H), 5.65 (s, 1H), 5.04 - 4.90 (m, 1H), 4.77 (m, 2H), 4.67 (s, 6H), 4.46 - 4.35 (m, 1H), 4.35 - 4.27 (m, 1H), 4.27 - 4.12 (m, 1H), 4.07 - 3.94 (m, 1H), 3.80 - 3.62 (m, 1H), 3.53 (m, 12H), 3.00 (m, 6H), 2.48 (m, 6H), 2.24 (m, 4H), 2.02 - 1.03 (m, 68H), 0.91 (t, J = 6.9 Hz, 9H). MALDI-MS for C95H147N3O21 ([M+H]+) calculated: 1667.1, found: 1666.9.

[0148] PTX4 (32mg, 41%): 1HNMR (400 MHz, CDC13) 88.15 (d, J = 7.1 Hz, 1H), 8.04 - 7.83 (m, 1H), 7.66 (s, 1H), 7.54 (m, 2H), 7.42 (m, 3H), 6.30 (s, 1H), 6.19 - 6.04 (m, 1H), 6.04 - 5.85 (m, 1H), 5.66 (s, 1H), 4.98 (d, J = 9.0 Hz, 1H), 4.68 (q, 3H), 4.53 - 4.39 (m, 1H), 4.31 (s, 1H), 4.21 (s, 1H), 3.77 (s, 1H), 3.57 (m, 6H), 3.41 (m, 6H), 2.64 (m, 8H), 2.46 (d, J = 14.2 Hz, 4H), 2.24 (m, 4H), 2.02 - 1.06 (m, 72H), 0.90 (t, J = 6.7 Hz, 9H). MALDI-MS for C98H153N3O21 ([M+H]+) calculated: 1709.1, found: 1709.3.

[0149] PTX5 (38 mg, 55%): 1HNMR (400 MHz, CDC13) 88.06 (d, J = 7.4 Hz, 2H), 7.78 - 7.63 (m, 2H), 7.55 (t, J = 7.3 Hz, 1H), 7.50 - 7.40 (m, 3H), 7.33 (t, J = 6.7 Hz, 6H), 6.20 (d, J = 12.5 Hz, 1H), 6.14 (s, 1H), 5.86 (d, J = 5.4 Hz, 1H), 5.60 (d, J = 6.7 Hz, 1H), 5.46 (s, 1H), 4.90 (d, J = 9.3 Hz, 1H), 4.84 - 4.65 (m, 3H), 4.37 (s, 1H), 4.24 (d, J = 8.4 Hz, 1H), 4.12 (d, J = 8.4 Hz, 1H), 3.72 (d, J = 6.6 Hz, 1H), 3.56 (m, 1H), 3.35 (s, 1H), 2.90 (d, J= 19.1 Hz, 2H), 2.80 (s, 2H), 2.58 -2.27 (m, 16H), 2.27 -2.05 (m, 12H), 1.82 (m, 6H), 1.64 - 1.11 (m, 78H), 1.05 (t, J = 7.5 Hz, 3H), 0.89 (t, J = 6.9 Hz, 18H). MALDLMS for C107H165N3O21 ([M+H]+) calculated: 1829.2, found: 1829.1.

[0150] DOX lipids and GEM lipids were synthesized using similar synthetic routes with those of GEM5.Docket No. 084284.00357

[0151] D0X1 (lOmg, 15%): 1HNMR (400 MHz, CDC13) 88.05 (d, J = 7.6 Hz, 1H), 7.80 (t, J = 7.8 Hz, 1H), 7.41 (d, J = 8.5 Hz, 1H), 6.67 - 6.38 (m, 1H), 5.53 (s, 1H), 4.78 (d, J = 9.5 Hz, 2H), 4.28 - 4.12 (m, 1H), 4.10 (m, 2H), 3.66 (s, 1H), 3.50 (s, 4H), 3.30 (d, J = 19.0 Hz, 1H), 3.05 (d, J = 18.8 Hz, 1H), 2.68 (m, 6H), 2.50 - 1.14 (m, 63H), 0.89 (t, J = 6.0 Hz, 6H). MALDI-MS for C57H88N2O12 ([M+H]+) calculated: 993.6, found: 993.7.

[0152] DOX2 (12mg, 17%): 1HNMR (400 MHz, CDC13) 88.19 - 7.98 (m, 1H), 7.93 - 7.63 (m, 1H), 7.51 - 7.32 (m, 1H), 5.70 - 5.43 (m, 2H), 4.77 (q, 2H), 4.71 - 4.54 (m, 4H), 4.09 (m, 4H), 3.64 - 3.46 (m, 4H), 3.40 (m, 8H), 3.37 - 2.93 (m, 2H), 2.36 (m, 6H), 2.26 - 2.03 (m, 4H), 1.88 -1.01 (m, 67H), 0.88 (t, J = 6.9 Hz, 6H). MALDI-MS for C61H96N2O16 ([M+H]+) calculated: 1113.7, found: 1113.8.

[0153] DOX3 (8mg, 10%): 1H NMR (400 MHz, CDC13) 88.15 - 8.00 (d, J = 7.6 Hz, 1H), 7.80 (t, J = 7.8 Hz, 1H), 7.50 - 7.30 (m, 1H), 6.67 - 6.38 (m, 1H), 5.53 (s, 1H), 4.78 (s, 6H), 4.28 - 4.12 (m, 1H), 4.10 (m, 2H), 3.66 (s, 1H), 3.64 - 3.46 (m, 6H), 3.40 (m, 12H), 3.50 (m, 4H), 3.30 (m, 1H), 3.05 (d, J = 18.8 Hz, 1H), 2.68 (m, 6H), 2.45 - 1.14 (m, 92H), 0.89 (t, J = 6.0 Hz, 9H).

[0154] DOX4 (10 mg, 14%): 1H NMR (400 MHz, CDC13) 88.05 (d, J = 7.6 Hz, 1H), 7.80 (t, J = 7.8 Hz, 1H), 7.41 (m, 1H), 6.67-6.38 (m, 1H), 5.53 (s, 1H), 4.67 (q, 3H), 4.10 (s, 1H), 3.57 (m, 6H), 3.41 (m, 6H), 3.15 - 2.89 (m, 6H), 2.69 (m, 12H), 2.34 (m, 6H), 1.98 - 1.00 (m, 84H), 0.90 (t, J = 6.8 Hz, 9H). MALDI-MS for C78H131N3O18 ([M+H]+) calculated: 1398.9, found: 1398.7.

[0155] DOX5 (6 mg, 11%): 1H NMR (400 MHz, MeOD) 88.38 (d, J = 7.6 Hz, 1H), 7.50 (d, J = 7.6 Hz, 1H), 6.28 (s, 1H), 4.88 - 4.73 (m, 3H), 4.39 - 4.22 (m, 1H), 4.08 - 3.90 (m, 2H), 3.84 (s, 1H), 3.37 (s, 1H), 2.68 (m, 12H), 2.51 (t, J = 7.1 Hz, 2H), 2.33 (t, J = 7.2 Hz, 6H), 1.92 - 1.11 (m, 77H), 0.99 - 0.83 (t, 18H). MALDI-MS for C87H143N3O18 ([M+H]+) calculated: 1519.0, found: 1519.1.

[0156] GEM1 (lOmg, 18%): 1H NMR (400 MHz, CDC13) 88.38 (d, J = 7.6 Hz, 1H), 7.50 (d, J = 7.6 Hz, 1H), 6.28 (m, 1H), 4.62 - 4.41 (m, 1H), 4.14 - 3.91 (m, 2H), 3.75 - 3.58 (m, 1H), 3.23 -2.82 (m, 4H), 2.73 - 2.47 (m, 2H), 2.05 - 1.14 (m, 51H), 0.90 (t, J = 6.7 Hz, 6H). MALDI-MS for C39H70F2N4O5 ([M+H]+) calculated: 713.54, found: 713.55.

[0157] GEM2 (12mg, 17%): 1HNMR (400 MHz, CDC13) 88.38 (d, J = 7.6 Hz, 1H), 7.50 (d, J = 7.6 Hz, 1H), 6.28 (m, 1H), 4.72 (m, 1H), 4.63 (q, 2H), 4.14 - 3.91 (m, 2H), 3.75 - 3.58 (m, 1H),Docket No. 084284.00357

[0158] 3.56 (tn 4H), 3.39 (m, 4H), 3.23 - 2.82 (m, 4H), 2.73 - 2.47 (tn, 2H), 1.95 - 1.04 (m, 57H), 0.88 (t, J = 6.7 Hz, 6H). MALDI-MS for C42H78F2N4O9 ([M+H]+) calculated: 833.6, found: 833.8.

[0159] GEM3 (1 Img, 20%): 1H NMR (400 MHz, CDC13) 88.38 (d, J = 7.6 Hz, 1H), 7.50 (d, J = 7.6 Hz, 1H), 6.28 (m, 1H), 4.68 (s, 6H), 4.19 - 4.01 (m, 3H), 4.01 - 3.85 (m, 2H), 3.63 - 3.38 (m, 10H), 2.97 (m, 12H), 2.67 - 2.42 (m, 6H), 2.42 - 2.28 (m, 2H), 2.10 - 1.86 (m, 4H), 1.80 - 1.13 (m, 65H), 0.88 (t, J = 6.7 Hz, 12H). MALDI-MS for C57H107F2N5O11 ([M+H]+) calculated: 1076.8, found: 1076.9.

[0160] GEM4 (9mg, 15%): 1H NMR (400 MHz, CDC13) 8 8.51 - 8.12 (d, J = 7.6 Hz, 1H), 7.58 - 7.37 (m, 1H), 6.33 - 6.09 (m, 1H), 4.74 - 4.53 (q, 3H), 4.58 - 4.38 (m, 1H), 4.16 - 3.79 (m, 6H), 3.71 - 3.51 (m, 6H), 3.50 - 3.17 (m, 6H), 2.98 (m, 6H), 2.61 -2.32 (m, 3H), 2.32 - 1.94 (m, 2H), 1.43 (m, 61H), 0.88 (t, J = 7.1 Hz, 9H). MALDI-MS for C60H113F2N5O11 ([M+H]+) calculated: 1118.8, found: 1118.7.

[0161] GEM5 (8 mg, 17%). 1H NMR (400 MHz, MeOD) 88.38 (d, J = 7.6 Hz, 1H), 7.50 (d, J = 7.6 Hz, 1H), 6.28 (m, 1H), 4.88 - 4.73 (m, 3H), 4.39 - 4.22 (m, 1H), 4.08 - 3.90 (m, 2H), 3.84 (m, 1H), 3.37 (s, 1H), 2.68 (m, 10H), 2.51 (t, J = 7.1 Hz, 2H), 2.33 (t, J = 7.2 Hz, 6H), 1.92 - 1.11 (m, 75H), 0.99 - 0.83 (m, 18H). MALDI-MS for C69H125F2N5O11 ([M+H]+) calculated: 1238.9, found: 1239.0.

[0162] CD40L and Flt3L expression, and immunogenic cell death (ICD) assay

[0163] B16 cells (1 x 105) were seeded in 500 pL of medium in 24-well plates. After overnight incubation, cells were treated with 7.5 pg of LNP-mRNA formulations for 18 hours. Following treatment, calreticulin and CD40L expression were quantified via flow cytometry using the LSRFortessa™ system (Becton Dickinson). ATP, Flt3L, and HMGB1 levels in the supernatant were measured using the ATP assay system (Promega, FF2000), Flt3L ELISA kit (RayBio, P49771), and HMGB-1 ELISA kit (Novus Biologicals, NBP2-62767), respectively. Cell apoptosis was analyzed using the Dead Cell Apoptosis kit (Invitrogen, V35113).

[0164] Tumor models and treatment regimens

[0165] C57BL / 6 mice (male and female, 6-8 weeks) were purchased from the Jackson Laboratory or Charles River. All mice were housed in The Icahn School of Medicine at Mount Sinai. In this study, up to 5 mice were housed in each cage under a barrier environment under the condition of:Docket No. 084284.00357

[0166] ~20°C, -45% humidity, and 12 light / 12 dark cycle. Mouse experiments were carried out based on previously established methods. For subcutaneous (s.c.) tumor model, about 1 x 105B16F10 cells were s.c. inoculated on the right flank. On day 7 post tumor inoculation, mice with tumor size of about or over 0.5 cm of the largest diameter were randomly separated into different groups. In a single i.t. injection, the dose of free mRNA or LNP-mRNA formulations was about 6 pg.

[0167] Luminex analysis of cytokines and chemokines

[0168] Mouse tumor tissues and blood samples were collected at 9 and 18 hours post-injection of the first treatment with 6 pg LNP-mRNA formulations. Tumor tissues were flash-frozen in liquid nitrogen, and subsequently pulverized for extraction using RIPA lysis buffer (Thermo Scientific, 89900) supplemented with protease inhibitors (Thermo Scientific, 87785). Whole blood was collected in sodium citrate-containing tubes, and plasma was isolated by centrifugation. Mouse cytokines and chemokines were measured using the Mouse Cytokine / Chemokine Discovery Assay (Eve Technologies, Canada).

[0169] Immune cell activation in vivo

[0170] Four days following the first treatment, tumors, tumor-draining lymph nodes, and spleens were dissociated, and immune cells were stained for flow cytometry analysis. Gating strategies for flow cytometry were adapted from previously published methods (Zhang Y et al. Close the cancerimmunity cycle by integrating lipid nanoparticle-mRNA formulations and dendritic cell therapy. Nat Nanotechnol. 2023. Epub 2023 / 07 / 28; Hewitt SL et al. Durable anticancer immunity from intratumoral administration of IL-23, IL-36Y, and OX40L mRNAs. Sci Transl Med. 2019; 11(477); Li W et al. Biomimetic nanoparticles deliver mRNAs encoding costimulatory receptors and enhance T cell mediated cancer immunotherapy. Nat Commun. 2021 ; 12(1):7264).

[0171] Macrophages: CD45+, CDllb+, F4 / 80+

[0172] Conventional type 1 dendritic cells (cDCls): CD45+, F4 / 80; Ly6C, MHC II+, CDllc+, CD103+Conventional type 2 dendritic cells (cDC2s): CD45+, F4 / 80’, Ly6C', MHC II+, CDllc+, CDllb+CD4+T cells: CD45+, CD3e+, CD4+, FoxP3‘

[0173] CD8+T cells: CD45+, CD3e+, CD8a+

[0174] Safety evaluation in vivoDocket No. 084284.00357

[0175] Mouse major organs and plasma were collected at 9 and 18 hours post-injection of the firsttreatment with 6 pg LNP -mRNA formulations. The alanine transaminase (ALT) and aspartate aminotransferase (AST) were detected by ELISA kits (abeam, ab263882, ab282882). Tissue sections were stained with hematoxylin and eosin (H&E) and examined under an optical microscope by a professional pathologist at Mount Sinai.

[0176] Example 2. Generation of GEM5Q7 LNP

[0177] As shown in FIG. 1, four representative chemotherapeutic agents, camptothecin (CPT), paclitaxel (PTX), gemcitabine (GEM), and doxorubicin (DOX), were chosen for lipid synthesis due to their proven ability to induce hallmarks of ICD and their use in clinical trials alongside other immunotherapies. To synthesize chemotherapeutic-derived lipids distinct carboxylated ionizable lipids were prepared with various lipid tails, including saturated alkyl chains, ester-based chains, and acetal-containing chains. These carboxylated ionizable lipids were then condensed with CPT, PTX, GEM, and DOX to generate chemotherapeutic-derived lipids confirmed by 1H NMR and mass spectrometry.

[0178] To evaluate mRNA delivery efficacy, chemotherapeutic-derived ionizable lipids were formulated with DOPE, cholesterol, DMG-PEG2000, and firefly luciferase (FLuc) mRNA using microfluidic technology (Xu S et al. Tumor-Tailored Ionizable Lipid Nanoparticles Facilitate IL-12 Circular RNA Delivery for Enhanced Lung Cancer Immunotherapy. Adv Mater.

[0179] 2024:e2400307; Zhu Y et al. Screening for lipid nanoparticles that modulate the immune activity of helper T cells towards enhanced anti-tumor activity. Nat Biomed Eng. 2024;8(5):544-60; Hou X et al. Vitamin lipid nanoparticles enable adoptive macrophage transfer for the treatment of multidrug-resistant bacterial sepsis. NatNanotechnol. 2020; 15(1 ):41-6). The diverse structures in chemotherapeutic-derived lipids greatly affect the formulation of LNPs and their interactions with biological membranes, resulting in different mRNA delivery efficacy. Specifically, these LNPs exhibited sizes ranging from 100 to 400 nm with a narrow poly dispersity index (PDI). Their Zeta potential was neutral or slightly positively charged and most of their encapsulation was over 80%. Based on luminescence intensity measurements in Bl 6F 10 cells (FIG. 2A and FIG. 6), delivery number of these new LNPs showed superior delivery compared to Lipo 3K. Importantly, GEM5 and GEM6 LNPs demonstrated the highest mRNA delivery efficiency (FIG.2A and FIG. 6). To further improve the mRNA delivery efficacy of GEM5 LNP, two rounds of optimization studiesDocket No. 084284.00357

[0180] were performed. In the first round, a Design of Experiments (DOE) approach was applied to optimize the molar ratio of each lipid component (Hou X et al. Vitamin lipid nanoparticles enable adoptive macrophage transfer for the treatment of multidrug-resistant bacterial sepsis. Nat Nanotechnol. 2020;15(l):41-6; Li B et al. An Orthogonal Array Optimization of Lipid-like Nanoparticles for mRNA Delivery in Vivo. Nano Lett. 2015;15(12):8099-107; Cheng Q et al. Dendrimer-Based Lipid Nanoparticles Deliver Therapeutic FAH mRNA to Normalize Liver Function and Extend Survival in a Mouse Model of Hepatorenal Tyrosinemia Type I. Adv Mater.

[0181] 2018;30(52):el805308; Kauffman KJ et al. Optimization of Lipid Nanoparticle Formulations for mRNA Delivery in Vivo with Fractional Factorial and Definitive Screening Designs. Nano Lett.

[0182] 2015; 15(11):7300-6). Sixteen formulations were prepared using an L16 (4)4orthogonal table (FIG. 2B). Luminescence intensity quantification (FIG. 2C) enabled assessment of the impact of each lipid component on mRNA delivery efficiency (FIG. 2D). The optimal molar ratios of the lipid components (FIG.2D) were also predicted and additional LNPs were formulated to validate the predictions. As shown in FIG. 2F, the GEM5Q formulation exhibited approximately 1.7-fold higher mRNA delivery efficiency compared to the original GEM5 formulation, as well as other top-performing formulations (GEM5A, GEM5B, and GEM5M) from the orthogonal assay. In the second optimization round, the N / P ratio was adjusted and DMG-PEG2000 was replaced with alternatives. Polysarcosine (pSar), a PEG alternative composed of the polypeptoid of sarcosine (N-methylated glycine), was selected due to recent studies showing that replacing PEG-lipids with pSar-lipids can enhance mRNA delivery efficacy in FDA-approved LNPs in vivo. DMG-PEG2000 was substituted in GEM5Q with pSar25 of a similar molecular weight, incorporating five different lipid tails (FIG. 2E). Additionally, the N / P ratio was increased from 5.4 to 9.4 in these formulations (FIG. 2E). As illustrated in FIG. 2G, LNPs containing C16-pSar and DMG-pSar demonstrated progressively increased luminescence intensity with rising N / P ratios. Notably, the GEM5Q7 formulation (GEM5Q with C16-pSar and an N / P ratio of 9.3) exhibited a 5-fold increase in mRNA delivery efficacy compared to GEM5Q. GEM5Q7 LNP displayed a spherical morphology with an approximate size of 120 nm and a PDI below 0.1 (FIG. 3C). The encapsulation efficiency of mRNA was around 90%, with a nearly neutral Zeta potential (FIG.

[0183] 3C). Based on these results, GEM5Q7 was selected for subsequent studies.

[0184] Example 3. Characterization of GEM5Q7 LNPDocket No. 084284.00357

[0185] At the same mRNA concentration, GEM5Q7 LNP demonstrated mRNA delivery efficiency in B16F10 cells comparable to SM-102, while exhibiting approximately 2-fold and 3-fold higher efficacy compared to MC3 and ALC-0315, respectively (FIG.2H). Notably, GEM5Q7 LNPs induced about 50% cytotoxicity in Bl 6F 10 cells, whereas SM-102 did not cause significant cytotoxicity (FIG. 4A). To assess the expression of CD40L and Flt3L, B16F10 cells were treated with GEM5Q7 LNP encapsulating CD40L mRNA (CD40L-GEM5Q7) or Flt3L mRNA (Flt3L-GEM5Q7). After 18 hours of treatment, nearly 100% of B16F10 cells expressed CD40L (FIG.

[0186] 4B), and over 60% of these cells also exhibited markers of apoptosis (FIG. 4C). Moreover, more than 30 pg / mL of Flt3L was detected in the supernatant (FIG. 4D). To evaluate the ability of GEM5Q7 LNP to induce ICD in cancer cells, typical ICD markers, including extracellular high mobility group box 1 (HMGB1), extracellular ATP, and cell surface calreticulin, were measured in Bl 6F 10 cells following treatment with PBS, FLuc-GEM5Q7, or GEM5Q7 LNP encapsulating both CD40L and Flt3L mRNAs (CD40L-Flt3L-GEM5Q7). As shown in FIG. 4E, both FLuc-GEM5Q7 and CD40L-Flt3L-GEM5Q7 induced significantly higher levels of extracellular HMGB1, ATP, and surface calreticulin compared to PBS treatment. Moreover, FLuc-GEM5Q7 and CD40L-Flt3L-GEM5Q7 induced comparable levels of these ICD markers, suggesting that the GEM5Q7 LNP itself, rather than the mRNA cargo, was responsible for the ICD effects (FIG. 4E).

[0187] The antitumor effects of various treatments were evaluated in a s.c. melanoma mouse model using i.t. injections administered every other day for four doses (FIG. 4F). Compared to the PBS group, FLuc-GEM5Q7 significantly reduced tumor burden by day 12 (P = 0.002, FIG.

[0188] 4G) and extended overall survival (P = 0.002, FIG. 4H), indicating an effective ICD in tumor tissues. However, CD40L-GEM5Q7, Flt3L-GEM5Q7, and CD40L-Flt3L-GEM5Q7 treatments demonstrated even more pronounced tumor suppression than FLuc-GEM5Q7 by day 14 (P = 0.001, FIG. 4G), leading to extended survival times (P = 0.003, FIG. 4H). These results suggest that while ICD alone contributes to antitumor activity, it is insufficient for full tumor regression, underscoring the critical role of DC infiltration and activation. Notably, CD40L-Flt3L-GEM5Q7 exhibited the strongest antitumor effects compared to CD40L-GEM5Q7 or Flt3L-GEM5Q7 alone. By day 24, CD40L-Flt3L- GEM5Q7 more effectively suppressed tumor growth (P = 0.003, FIG.

[0189] 4G) and achieved a 40% complete response rate, whereas neither CD40L-GEM5Q7 nor Flt3L-GEM5Q7 treatments resulted in any complete responses (P = 0.04, FIG. 4H).Docket No. 084284.00357

[0190] Cytokine and chemokine levels in both blood and melanoma tissues were analyzed following the first dose of CD40L-Flt3L-GEM5Q7 LNP. Compared to Flue mRNA treatment, Fluc-GEM5Q7 induced the expression of over 20 cytokines and chemokines, including IL-1, TNF-a, and CXCL10, in the blood at 9 and 18 hours. Additionally, elevated levels of multiple cytokines and chemokines, such as TNF-a and IFN-y, were observed in the tumor following Fluc-GEM5Q7 treatment. These results suggest that GEM5Q7-mediated cancer cell ICD not only reprogrammed the tumor microenvironment, but also triggered a systemic immune modulation. Notably, CD40L-Flt3L-GEM5Q7 LNP induced greater levels of cytokines and chemokines in both tumor tissues and blood relative to Fluc-GEM5Q7 treatment. To study the effects of CD40L-Flt3L-GEM5Q7 treatment on immune cells, immune cell populations were profded in the tumor, tumor-draining lymph nodes (TDLNs), and spleen. Four days after a single i t. treatment, immune cells were collected, and their activation status was analyzed via flow cytometry. Compared to Fluc-GEM5Q7, the CD40L-Flt3L-GEM5Q7 treatment resulted in greater recruitment of macrophages, eDC 1 and cDC2 DCs, as well as CD8 and CD4 T cells, within tumor tissues (FIG.5A), indicating that i.t. expression of CD40L and Flt3L enhances the reprograming of the immunosuppressive TME. Similarly, the numbers of macrophages, cDCl, and cDC2 DCs increased in TDLNs (FIG.

[0191] 5B). In the spleen, CD40L-Flt3L-GEM5Q7 treatment markedly elevated the percentage of cDCl DCs, without a significant change in macrophage numbers (FIG. 5C). Notably, CD40L-Flt3L-GEM5Q7 treatment induced stronger immune cell activation compared to Fluc-GEM5Q7. In TDLNs (FIG. 5D), the treatment upregulated the expression of activation markers in DCs (CD80 and CD86), CD8+ T cells (CD69, IFN-y, and Ki67), and CD4+T cells (CD134). Enhanced T cell activation was also observed in the spleen (FIG. 5E), where CD8+T cells exhibited increased levels of IFN-y, TNF-a, granzyme B, and Ki-67, while CD4+T cells showed elevated CD69 and CD 134 expression. The spleen, serving as a critical reservoir and source of circulating and tumorinfiltrating immune cells, contributes to systemic immune mobilization. Consequently, the activation of APCs and T cells within the spleen can potentially support antitumor immunity. In tumor tissues (FIG. 5F), CD40L-Flt3L-GEM5Q7 treatment increased the proportion of activated APCs, including CD80 / 86+macrophages and CD80 / 86+DCs. Additionally, the expression of IFN-y, TNF-a, granzyme B, and Ki-67 in CD8+T cells, along with CD69 and CD134 in CD4+T cells, was upregulated (FIG. 5F), indicating the generation of effector and cytotoxic T cell responses. To assess safety, alanine transaminase (ALT) and aspartate transaminase (AST) levels wereDocket No. 084284.00357

[0192] measured, and histopathological analyses were conducted. A single dose of CD40L-Flt3L-GEM5Q7 treatment did not significantly increase ALT or AST levels (FIG. 5G), and no evident toxicity was observed in major tissues.

[0193] Effective antitumor T cell immunity relies on DCs that cross-present TAAs and provide essential costimulatory signals to T cells. However, the immunosuppressive TME often impairs DC function, resulting in unchecked tumor growth and metastasis. This study demonstrates that combining cancer cell 1CD with DC mobilization and activation, achieved through chemotherapeutic-derived LNPs encapsulating Flt3L and CD40L mRNAs, offers a promising strategy to overcome the immunosuppressive TME and enhance antitumor T cell responses. First, a library of chemotherapeutic-derived ionizable lipids was synthesized, and it was determined that multiple parameters of chemical structures can dramatically influence particle formulations and their mRNA delivery efficiency. After screening and optimization, the GEM5Q7 formulation proved to be highly effective, showing strong mRNA delivery and robust ICD induction, evidenced by the expression of CD40L and Flt3L, as well as the upregulation of key ICD markers in B16F10 melanoma cells. These findings underscore the dual potential of chemotherapeutic-derived LNPs for efficient mRNA delivery and eliciting immune responses via ICD. These results emphasize the importance of ICD in driving antitumor immunity. Incorporating mRNA therapeutics into this strategy provides distinct advantages. This is clearly reflected in the enhanced antitumor effects observed when GEM5Q7 encapsulated both CD40L and Flt3L mRNAs, compared to ICD induction alone, highlighting the synergy between ICD effects and DC activation.

[0194] Without being bound by theory, it is believed that the GEM5Q7 formulation provides superior mRNA delivery compared to FDA-approved LNP formulations (such as MC3 and ALC-0315) due to the unique structural features of the GEM-derived ionizable lipid, which combines efficient endosomal escape properties with the ability to induce immunogenic cell death. The replacement of PEG-lipids with polysarcosine (pSar) lipids is believed to reduce potential immunogenicity associated with PEG while maintaining or improving colloidal stability and circulation time.

[0195] CD40L plays a pivotal role in licensing DCs to present antigens and activate T cells effectively, while Flt3L enhances the differentiation and survival of DCs, particularly cDCl 11-14,Docket No. 084284.00357

[0196] which are crucial for initiating CD8+T cell responses. Compared to FLuc-GEM5Q7, the CD40L-Flt3L-GEM5Q7 formulation significantly increased cytokine and chemokine levels in both the tumor and blood, indicating that this approach not only reprograms the TME, but also offers protection against tumor metastasis. Furthermore, the combination therapy led to a substantial recruitment of macrophages, cDCl, cDC2, CD8+T cells, and CD4+T cells into tumor tissues, as well as a significant influx of immune cells into TDLNs and the spleen. Importantly, the treatment enhanced the phenotypic activation of cDCl and CD8+T cells in the tumor, TDLNs, and spleen. Finally, the CD40L-Flt3L-GEM5Q7 treatment led to marked tumor regression and achieved a complete response rate of approximately 40%.

[0197] The experimental results demonstrate that the compositions and methods described herein can be practiced across the full scope of the claims. The disclosure provides detailed synthesis procedures for multiple chemotherapeutic-derived ionizable lipids (CPT1-5, PTX1-5, DOX1-5, and GEM1-5), demonstrating that one of ordinary skill in the art can prepare the claimed compositions. The optimization studies further demonstrate that variations in lipid composition, N / P ratio, and PEG / pSar selection can be made while maintaining therapeutic efficacy, supporting the claimed ranges.

[0198] The present disclosure is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention, in addition to those described herein, will become apparent to those skilled in the art from the foregoing description and the accompanying figures. Such modifications are intended to fall within the scope of the appended claims.

[0199] All references cited herein are incorporated herein by reference in their entireties.

Claims

Docket No. 084284.00357CLAIMSWhat is claimed is:

1. A composition comprising a lipid nanoparticle comprising: a chemotherapeutic-derived ionizable lipid containing a chemotherapeutic agent moiety, and one or more mRNAs comprising an FMS-like tyrosine kinase 3 ligand (Flt3L) mRNA and / or a CD40 ligand (CD40L) mRNA.

2. The composition of claim 1, wherein the lipid nanoparticle comprises any one of the following structures:

3. The composition of claim 1, wherein the lipid nanoparticle comprises DMG-PEG2000 or C16-pSar (polysarcosine).

4. The composition of any one of claims 1-3, wherein the lipid nanoparticle further comprises a phospholipid.

5. The composition of claim 4, wherein the phospholipid is l,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE).Docket No. 084284.003576. The composition of any one of claims 1-5, wherein the lipid nanoparticle further comprises a cholesterol.

7. The composition of any one of claims 1-6, wherein the lipid nanoparticle comprises the chemotherapeutic-derived ionizable lipid, the phospholipid, the cholesterol, and a PEG- or pSar-lipid at a molar ratio of 20-80: 20-50: 30-60: 0.75-3.

8. The composition of any one of claims 1-7, wherein the lipid nanoparticle has a nitrogen-to-phosphate (N / P) ratio ranging from 5.4 to 9.3.

9. The composition of any one of claims 1-8, wherein the lipid nanoparticle has a nitrogen-to-phosphate (N / P) ratio of about 9.3.

10. The composition of any one of claims 1-9, wherein the lipid nanoparticle has a zeta potential of about -10 mV to about +10 mV.

11. The composition of any one of claims 1-10, wherein the chemotherapeutic agent moiety is derived from camptothecin, paclitaxel, gemcitabine, or doxorubicin.

12. The composition of any one of claims 1-11, wherein the poly dispersity index ranges from 0 to 0.3.

13. The composition of any one of claims 1-11, wherein the lipid nanoparticle has a particle size ranging from about 100 nm to about 400 nm.

14. The composition of claim 12, wherein the lipid nanoparticle has a particle size of about 120 nm.

15. The composition of any one of claims 1-13, wherein the composition comprises GEM-derived ionizable lipid, DOPE, cholesterol, and C16-pSar at a molar ratio of 20:50:30:0.75.Docket No. 084284.0035716. The composition of any one of claims 1-15, wherein the lipid nanoparticle has an mRNA encapsulation efficiency of at least 80%.

17. The composition of any one of claims 1-14, comprising a Flt3L mRNA and a CD40L mRNA.

18. The composition of any one of claims 1-15, wherein the Flt3L mRNA comprises the sequence of SEQ ID NO: 1 or comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 1.

19. The composition of any one of claims 1-15, wherein the CD40L mRNA comprises the sequence of SEQ ID NO: 2 or comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 2.

20. The composition of any one of claims 1-18, wherein the mRNA comprises Nl-methylpseudouridine.

21. A method of treating cancer or inducing an anti -turn or T-cell response in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the composition of any one of the preceding claims.

22. The method of claim 21, wherein the subject is a human.

23. The method of claims 21 or 22, further comprising administering a checkpoint inhibitor.

24. The method of claim 23, wherein the checkpoint inhibitor comprises an inhibitor of PD-1, LAG3, VISTA, BTLA, TIM3, HVEM, CD27, CD28, CD 137, 0X40, PDL2, GITR, SIRPa, ILT2, ILT3, ILT4, or 4-IBB.

25. The method of any one of claims 21-24, wherein the cancer is melanoma, breast cancer, lung cancer, or prostate cancer.Docket No. 084284.0035726. The method of any one of claims 21-24, wherein the cancer is a solid tumor or lymphoma.

27. The method of any one of claims 21-26, wherein the composition is administered via intratumoral injection or intravenous injection.

28. The method of any one of claims 21-27, wherein the lipid nanoparticle induces immunogenic cell death in cancer cells.

Images